A species of gram-negative, aerobic bacteria that causes MELIOIDOSIS. It has been isolated from soil and water in tropical regions, particularly Southeast Asia.
A disease of humans and animals that resembles GLANDERS. It is caused by BURKHOLDERIA PSEUDOMALLEI and may range from a dormant infection to a condition that causes multiple abscesses, pneumonia, and bacteremia.
A genus of gram-negative, aerobic, rod-shaped bacteria. Organisms in this genus had originally been classified as members of the PSEUDOMONAS genus but overwhelming biochemical and chemical findings indicated the need to separate them from other Pseudomonas species, and hence, this new genus was created.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
A species of gram-negative bacteria parasitic on HORSES and DONKEYS causing GLANDERS, which can be transmitted to humans.
Infections with bacteria of the genus BURKHOLDERIA.
An essential amino acid that is physiologically active in the L-form.
A species of BURKHOLDERIA considered to be an opportunistic human pathogen. It has been associated with various types of infections of nosocomial origin.
A contagious disease of horses that can be transmitted to humans. It is caused by BURKHOLDERIA MALLEI and characterized by ulceration of the respiratory mucosa and an eruption of nodules on the skin.
Cell-surface components or appendages of bacteria that facilitate adhesion (BACTERIAL ADHESION) to other cells or to inanimate surfaces. Most fimbriae (FIMBRIAE, BACTERIAL) of gram-negative bacteria function as adhesins, but in many cases it is a minor subunit protein at the tip of the fimbriae that is the actual adhesin. In gram-positive bacteria, a protein or polysaccharide surface layer serves as the specific adhesin. What is sometimes called polymeric adhesin (BIOFILMS) is distinct from protein adhesin.
Physicochemical property of fimbriated (FIMBRIAE, BACTERIAL) and non-fimbriated bacteria of attaching to cells, tissue, and nonbiological surfaces. It is a factor in bacterial colonization and pathogenicity.
Thin, filamentous protein structures, including proteinaceous capsular antigens (fimbrial antigens), that mediate adhesion of E. coli to surfaces and play a role in pathogenesis. They have a high affinity for various epithelial cells.
A species of gram-negative bacteria, primarily infecting SWINE, but it can also infect humans, DOGS, and HARES.
Distinct units in some bacterial, bacteriophage or plasmid GENOMES that are types of MOBILE GENETIC ELEMENTS. Encoded in them are a variety of fitness conferring genes, such as VIRULENCE FACTORS (in "pathogenicity islands or islets"), ANTIBIOTIC RESISTANCE genes, or genes required for SYMBIOSIS (in "symbiosis islands or islets"). They range in size from 10 - 500 kilobases, and their GC CONTENT and CODON usage differ from the rest of the genome. They typically contain an INTEGRASE gene, although in some cases this gene has been deleted resulting in "anchored genomic islands".
The genetic complement of a BACTERIA as represented in its DNA.
An enzyme which catalyzes the catabolism of S-ADENOSYLHOMOCYSTEINE to ADENOSINE and HOMOCYSTEINE. It may play a role in regulating the concentration of intracellular adenosylhomocysteine.
Any member of the class of enzymes that catalyze the cleavage of the substrate and the addition of water to the resulting molecules, e.g., ESTERASES, glycosidases (GLYCOSIDE HYDROLASES), lipases, NUCLEOTIDASES, peptidases (PEPTIDE HYDROLASES), and phosphatases (PHOSPHORIC MONOESTER HYDROLASES). EC 3.
5'-S-(3-Amino-3-carboxypropyl)-5'-thioadenosine. Formed from S-adenosylmethionine after transmethylation reactions.
A nucleoside that is composed of ADENINE and D-RIBOSE. Adenosine or adenosine derivatives play many important biological roles in addition to being components of DNA and RNA. Adenosine itself is a neurotransmitter.

Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. (1/670)

Burkholderia pseudomallei, the causative agent of melioidosis, is intrinsically resistant to a wide range of antimicrobial agents including beta-lactams, aminoglycosides, macrolides, and polymyxins. We used Tn5-OT182 to mutagenize B. pseudomallei to identify the genes involved in aminoglycoside resistance. We report here on the identification of AmrAB-OprA, a multidrug efflux system in B. pseudomallei which is specific for both aminoglycoside and macrolide antibiotics. We isolated two transposon mutants, RM101 and RM102, which had 8- to 128-fold increases in their susceptibilities to the aminoglycosides streptomycin, gentamicin, neomycin, tobramycin, kanamycin, and spectinomycin. In addition, both mutants, in contrast to the parent, were susceptible to the macrolides erythromycin and clarithromycin but not to the lincosamide clindamycin. Sequencing of the DNA flanking the transposon insertions revealed a putative operon consisting of a resistance, nodulation, division-type transporter, a membrane fusion protein, an outer membrane protein, and a divergently transcribed regulatorprotein. Consistent with the presence of an efflux system, both mutants accumulated [3H] dihydro streptomycin, whereas the parent strain did not. We constructed an amr deletion strain, B. pseudomallei DD503, which was hypersusceptible to aminoglycosides and macrolides and which was used successfully in allelic exchange experiments. These results suggest that an efflux system is a major contributor to the inherent high-level aminoglycoside and macrolide resistance found in B. pseudomallei.  (+info)

Phylogenetic analysis of Ara+ and Ara- Burkholderia pseudomallei isolates and development of a multiplex PCR procedure for rapid discrimination between the two biotypes. (2/670)

A Burkholderia pseudomallei-like organism has recently been identified among some soil isolates of B. pseudomallei in an area with endemic melioidosis. This organism is almost identical to B. pseudomallei in terms of morphological and biochemical profiles, except that it differs in ability to assimilate L-arabinose. These Ara+ isolates are also less virulent than the Ara- isolates in animal models. In addition, clinical isolates of B. pseudomallei available to date are almost exclusively Ara-. These features suggested that these two organisms may belong to distinctive species. In this study, the 16S rRNA-encoding genes from five clinical (four Ara- and one Ara+) and nine soil isolates (five Ara- and four Ara+) of B. pseudomallei were sequenced. The nucleotide sequences and phylogenetic analysis indicated that the 16S rRNA-encoding gene of the Ara+ biotype was similar to but distinctively different from that of the Ara- soil isolates, which were identical to the classical clinical isolates of B. pseudomallei. The nucleotide sequence differences in the 16S rRNA-encoding gene appeared to be specific for the Ara+ or Ara- biotypes. The differences were, however, not sufficient for classification into a new species within the genus Burkholderia. A simple and rapid multiplex PCR procedure was developed to discriminate between Ara- and Ara+ B. pseudomallei isolates. This new method could also be incorporated into our previously reported nested PCR system for detecting B. pseudomallei in clinical specimens.  (+info)

Characterization of a murine model of melioidosis: comparison of different strains of mice. (3/670)

Melioidosis is an infectious disease caused by the saprophytic gram-negative rod Burkholderia pseudomallei. The aim of this study was to establish and characterize a murine model of melioidosis to provide a basis for further investigations on the pathogenesis of the disease. After intravenous infection with B. pseudomallei, C57BL/6 mice were found to be significantly more resistant than BALB/c mice. There was a marked organotropism of B. pseudomallei for the spleen and liver in both strains of mice, with the highest bacterial load in the spleen. Electron microscopic investigations of the spleen clearly demonstrated intracellular replication within membrane-bound phagosomes. Electron micrographs of the liver provided evidence that B. pseudomallei-containing phagosomes in hepatocytes fuse with lysosomes, leading to degradation of bacteria. In both strains of mice, the course of infection was highly dependent on the infective dose and the bacterial strain used, ranging from death within a few days to death after several weeks. In comparison with BALB/c mice, the bacterial counts in C57BL/6 mice were decreased 12 h after infection, which is suggestive of an innate immune mechanism against B. pseudomallei in this early phase of infection contributing to the lower susceptibility of C57BL/6 mice. BALB/c mice developed a more pronounced lymphopenia, granulocytosis, and splenomegaly at a lower infective dose compared to C57BL/6 mice. Analysis of the antibody response against B. pseudomallei 11 days after infection revealed a significantly higher immunoglobulin G2A (IgG2a)/IgG1 ratio in C57BL/6 mice than in BALB/c mice, indicating that a T helper type 1 immune response is associated with resistance to infection with B. pseudomallei.  (+info)

Obligatory role of gamma interferon for host survival in a murine model of infection with Burkholderia pseudomallei. (4/670)

Burkholderia pseudomallei, the causative agent of melioidosis, is a gram-negative bacterium capable of causing either acute lethal sepsis or chronic but eventually fatal disease in infected individuals. However, despite the clinical importance of this infection in areas where it is endemic, there is essentially no information on the mechanisms of protective immunity to the bacterium. We describe here a murine model of either acute or chronic infection with B. pseudomallei in Taylor Outbred (TO) mice which mimics many features of the human pathology. Intraperitoneal infection of TO mice at doses of >10(6) CFU resulted in acute septic shock and death within 2 days. In contrast, at lower doses mice were able to clear the inoculum from the liver and spleen over a 3- to 4-week period, but persistence of the organism at other sites resulted in a chronic infection of between 2 and 16 months duration which was eventually lethal in all of the animals tested. Resistance to acute infection with B. pseudomallei was absolutely dependent upon the production of gamma interferon (IFN-gamma) in vivo. Administration of neutralizing monoclonal antibody against IFN-gamma lowered the 50% lethal dose from >5 x 10(5) to ca. 2 CFU and was associated with 8,500- and 4,400-fold increases in the bacterial burdens in the liver and spleen, respectively, together with extensive destruction of lymphoid architecture in the latter organ within 48 h. Neutralization of either tumor necrosis factor alpha or interleukin-12 but not granulocyte-macrophage colony-stimulating factor, also increased susceptibility to infection in vivo. Together, these results provide the first evidence of a host protective mechanism against B. pseudomallei. The rapid production of IFN-gamma within the first day of infection determines whether the infection proceeds to an acute lethal outcome or becomes chronic.  (+info)

Evidence for the presence in Burkholderia pseudomallei of a type III secretion system-associated gene cluster. (5/670)

Burkholderia pseudomallei, the causative agent of melioidosis, contains a cluster of putative genes homologous to those encoding HpaP, HrcQ, HrcR, HrcS and HrpV in the plant pathogen Ralstonia solanacearum. In R. solanacearum, these genes form part of a type III secretion-associated pathogenicity island. The order of the genes in B. pseudomallei is directly equivalent to that found in R. solanacearum. The B. pseudomallei proteins share 49.5% (HpaP), 52.6% (HrcQ), 80.0% (HrcR), 72.1% (HrcS) and 46.7% (HrpV) similarity, respectively, with their equivalent R. solanacearum proteins. The presence of type III secretion-associated genes in B. pseudomallei pathogens suggests a possible role for type III secretion systems in the pathogenicity of this organism.  (+info)

Molecular characterization of genetic loci required for secretion of exoproducts in Burkholderia pseudomallei. (6/670)

Previous studies have demonstrated that Burkholderia pseudomallei secretes protease, lipase, and phospholipase C (PLC) into the extracellular milieu, but their mechanisms of secretion and roles in pathogenesis have not been elucidated. In this study, we isolated and characterized 29 transposon mutants unable to secrete protease, lipase, and PLC.  (+info)

Melioidosis with adrenal gland abscess. (7/670)

We report a case of melioidosis with left adrenal gland abscess in a 51-year-old man from Taiwan who traveled to Rangoon, Burma for a four-day tour on July 15, 1997. The patient developed fever and left upper abdominal pain upon returning to Taiwan on July 19, 1997. Ten days after returning to Taiwan, he was admitted to Chang Gung Memorial Hospital in Keelung, Taiwan and blood culture on admission was positive for Burkholderia pseudomallei. Computerized tomography of the abdomen revealed left adrenal gland swelling and suppuration. Treatment with parenteral ceftazidime and cotrimoxazole for three weeks followed by two months of oral cotrimoxazole cured the infection. The patient remained asymptomatic at 12 months follow-up.  (+info)

Epidemiology of Burkholderia pseudomallei in Thailand. (8/670)

The distribution of Burkholderia pseudomallei in soil collected from four regions of Thailand and the frequency of B. pseudomallei infections in patients attending government hospitals throughout Thailand in 1997 were surveyed. A total of 3,585 soil samples collected from 896 sites in four regions of Thailand were cultured for B. pseudomallei using selective enrichment broth and modified Ashdown's agar. The organism was recovered in 4.4%, 6.1%, 20.4%, and 5.9% of the soil samples collected from the northern, central, northeastern, and southern regions, respectively, of Thailand (P < 0.0001). Burkholderia pseudomallei was cultured from 50.1% of the sites in the northeastern region compared with 13.8%, 24.5%, and 18.4% in the northern, central, and southern regions, respectively (P < 0.0001). The infection rate in patients attending government hospitals in the northeastern region (137.9 per 100,000 inpatients) was significantly higher than those in the northern (18 per 100,000 inpatients), central (13.4 per 100,000 inpatients), and southern (14.4 per 100,000 inpatients) regions, respectively (P < 0.0001). It is suggested that melioidosis, which is endemic in Thailand, is associated with the presence of B. pseudomallei in soil.  (+info)

The avidin-biotin technology has many applications, including molecular detection; immobilization; protein purification; construction of supramolecular assemblies and artificial metalloenzymes. Here we present the recombinant expression of novel biotin-binding proteins from bacteria and the purification and characterization of a secreted burkavidin from the human pathogen Burkholderia pseudomallei. Expression of the native burkavidin in Escherichia coli led to periplasmic secretion and formation of a biotin-binding, thermostable, tetrameric protein containing an intra-monomeric disulphide bond. Burkavidin showed one main species as measured by isoelectric focusing, with lower isoelectric point (pI) than streptavidin. To exemplify the potential use of burkavidin in biotechnology, an artificial metalloenzyme was generated using this novel protein-scaffold and shown to exhibit enantioselectivity in a rhodium-catalysed hydrogenation reaction ...
Infections with the Gram-negative bacterium Burkholderia pseudomallei (meliodosis) are associated with high mortality and there is currently no approved vaccine to prevent the development of meliodosis in humans. Infected patients also do not develop protective immunity to re-infection and some individuals will develop chronic, subclinical infections with B. pseudomallei. At present our understanding of what constitutes effective protective immunity against B. pseudomallei infection remains incomplete. Therefore, we conducted a study to elucidate immune correlates of vaccine-induced protective immunity against acute B. pseudomallei infection. BALB/c and C57BL/6 mice were immunized subcutaneously with a highly attenuated, Select Agent excluded purM deletion mutant of B. pseudomallei (strain Bp82), and then subjected to intranasal challenge with virulent B. pseudomallei strain 1026b. Immunization with Bp82 generated significant protection from challenge with B. pseudomallei, and protection was ...
Neurologic melioidosis is a serious, potentially fatal form of Burkholderia pseudomallei infection. Recently, we reported that a subset of clinical isolates of B. pseudomallei from Australia have heightened virulence and potential for dissemination to the central nervous system. In this study, we demonstrate that this subset has a B. mallei-like sequence variation of the actin-based motility gene, bimA. Compared with B. pseudomallei isolates having typical bimA alleles, isolates that contain the B. mallei-like variation demonstrate increased persistence in phagocytic cells and increased virulence with rapid systemic dissemination and replication within multiple tissues, including the brain and spinal cord, in an experimental model. These findings highlight the implications of bimA variation on disease progression of B. pseudomallei infection and have considerable clinical and public health implications with respect to the degree of neurotropic threat posed to human health.
Neurologic melioidosis is a serious, potentially fatal form of Burkholderia pseudomallei infection. Recently, we reported that a subset of clinical isolates of B. pseudomallei from Australia have heightened virulence and potential for dissemination to the central nervous system. In this study, we demonstrate that this subset has a B. mallei-like sequence variation of the actin-based motility gene, bimA. Compared with B. pseudomallei isolates having typical bimA alleles, isolates that contain the B. mallei-like variation demonstrate increased persistence in phagocytic cells and increased virulence with rapid systemic dissemination and replication within multiple tissues, including the brain and spinal cord, in an experimental model. These findings highlight the implications of bimA variation on disease progression of B. pseudomallei infection and have considerable clinical and public health implications with respect to the degree of neurotropic threat posed to human health.
Citation. Tumapa, S., Holden, M. T., Vesaratchavest, M., Wuthiekanun, V., Limmathurotsakul, D., Chierakul, W., Feil, E. J., Currie, B. J., Day, N. P., Nierman, W. C., Peacock, S. J.. Burkholderia pseudomallei Genome Plasticity Associated With Genomic Island Variation. BMC Genomics. 2008 Apr 25; 9(1): 190.. PubMed Citation. Abstract. ABSTRACT: BACKGROUND: Burkholderia pseudomallei is a soil-dwelling saprophyte and the cause of melioidosis. Horizontal gene transfer contributes to the genetic diversity of this pathogen and may be an important determinant of virulence potential. The genome contains genomic island (GI) regions that encode a broad array of functions. Although there is some evidence for the variable distribution of genomic islands in B. pseudomallei isolates, little is known about the extent of variation between related strains or their association with disease or environmental survival. RESULTS: Five islands from B. pseudomallei strain K96243 were chosen as representatives of ...
Cystic fibrosis (CF) is a genetic disorder characterized by progressive lung function decline. CF patients are at an increased risk of respiratory infections, including those by the environmental bacterium Burkholderia pseudomallei, the causative agent of melioidosis. Here, we compared the genomes of B. pseudomallei isolates collected between similar to 4 and 55 months apart from seven chronically infected CF patients. Overall, the B. pseudomallei strains showed evolutionary patterns similar to those of other chronic infections, including emergence of antibiotic resistance, genome reduction, and deleterious mutations in genes involved in virulence, metabolism, environmental survival, and cell wall components. We documented the first reported B. pseudomallei hypermutators, which were likely caused by defective MutS. Further, our study identified both known and novel molecular mechanisms conferring resistance to three of the five clinically important antibiotics for melioidosis treatment. Our ...
TY - JOUR. T1 - Malleilactone is a Burkholderia pseudomallei virulence factor regulated by antibiotics and quorum sensing. AU - Klaus, Jennifer R.. AU - Deay, Jacqueline. AU - Neuenswander, Benjamin. AU - Hursh, Wyatt. AU - Gao, Zhe. AU - Bouddhara, Tiffany. AU - Williams, Todd D.. AU - Douglas, Justin. AU - Monize, Kyle. AU - Martins, Patricia. AU - Majerczyk, Charlotte. AU - Seyedsayamdost, Mohammad R.. AU - Peterson, Blake R.. AU - Rivera, Mario. AU - Chandler, Josephine R.. PY - 2018/7/1. Y1 - 2018/7/1. N2 - Burkholderia pseudomallei, the causative agent of melioidosis, encodes almost a dozen predicted polyketide (PK) biosynthetic gene clusters. Many of these are regulated by LuxR-I-type acyl-homoserine (AHL) quorum-sensing systems. One of the PK gene clusters, the mal gene cluster, is conserved in the close relative Burkholderia thailandensis. The B. thailandensis mal genes code for the cytotoxin malleilactone and are regulated by a genetically linked LuxR-type transcription factor, MalR. ...
Melioidosis caused by the environmental gram-negative bacillus Burkholderia pseudomallei, is classically characterized by pneumonia and multiple abscesses, wit...
Melioidosis is a neglected tropical disease with high mortality rate. It is caused by the Gram-negative, CDC category B select agent Burkholderia pseudomallei (B. ps) that is intrinsically resistant to first-line antibiotics. An antibody-based vaccine is likely to be the most effective control measure. Previous studies have demonstrated significant mechanistic roles of antibodies in protection against death in animal models, but data from human melioidosis is scarce. Herein, we used in-vitro antibody-dependent cellular phagocytosis and growth inhibition assays to assess the mechanism of protective antibodies in patients with acute melioidosis. We found that serum from patients who survived the disease enable more live B. ps to be engulfed by THP-1 derived macrophages (median 1.7 × 103 CFU/ml, IQR 1.1 × 103-2.5 × 103 CFU/ml) than serum from patients who did not survive (median 1.2 × 103 CFU/ml, IQR 0.7 × 103-1.8 × 103, p = 0.02). In addition, the intracellular growth rate of B. ps pre-opsonized
TY - JOUR. T1 - The genetic and molecular basis of O-antigenic diversity in Burkholderia pseudomallei lipopolysaccharide. AU - Tuanyok, Apichai. AU - Stone, Joshua K.. AU - Mayo, Mark. AU - Kaestli, Mirjam. AU - Gruendike, Jeffrey. AU - Georgia, Shalamar. AU - Warrington, Stephanie. AU - Mullins, Travis. AU - Allender, Christopher J.. AU - Wagner, David M.. AU - Chantratita, Narisara. AU - Peacock, Sharon J.. AU - Currie, Bart J.. AU - Keim, Paul. N1 - Copyright: Copyright 2012 Elsevier B.V., All rights reserved.. PY - 2012/1. Y1 - 2012/1. N2 - Lipopolysaccharide (LPS) is one of the most important virulence and antigenic components of Burkholderia pseudomallei, the causative agent of melioidosis. LPS diversity in B. pseudomallei has been described as typical, atypical or rough, based upon banding patterns on SDS-PAGE. Here, we studied the genetic and molecular basis of these phenotypic differences. Bioinformatics was used to determine the diversity of genes known or predicted to be involved in ...
TY - JOUR. T1 - Epidemiological tracking and population assignment of the non-clonal bacterium, burkholderia pseudomallei. AU - Dale, Julia. AU - Price, Erin P.. AU - Hornstra, Heidie. AU - Busch, Joseph D.. AU - Mayo, Mark. AU - Godoy, Daniel. AU - Wuthiekanun, Vanaporn. AU - Baker, Anthony. AU - Foster, Jeffrey T. AU - Wagner, David M. AU - Tuanyok, Apichai. AU - Warner, Jeffrey. AU - Spratt, Brian G.. AU - Peacock, Sharon J.. AU - Currie, Bart J.. AU - Keim, Paul S. AU - Pearson, Talima R. PY - 2011/12. Y1 - 2011/12. N2 - Rapid assignment of bacterial pathogens into predefined populations is an important first step for epidemiological tracking. For clonal species, a single allele can theoretically define a population. For non-clonal species such as Burkholderia pseudomallei, however, shared allelic states between distantly related isolates make it more difficult to identify population defining characteristics. Two distinct B. pseudomallei populations have been previously identified using ...
Ceftazidime is the antibiotic of choice for treatment of Burkholderia pseudomallei infections (melioidosis). The chromosomally encoded PenA β-lactamase possesses weak cephalosporinase activity. The wild-type penA gene confers clinically significant ceftazidime resistance only when overexpressed due to a promoter mutation, transcriptional anti-termination or by gene duplication and amplification (GDA). Here we characterize a reversible 33-kb GDA event involving wild-type penA in a ceftazidime resistant clinical isolate from Thailand. We show that duplication arises from exchanges between short (|10 base pairs, bp) chromosomal sequences, which in this example consist of 4 bp repeats flanked by 3 bp inverted repeats. GDA involving β-lactamase may be a common ceftazidime resistance mechanism in B. pseudomallei.
Burkholderia pseudomallei, the etiological agent of melioidosis, is a saprophytic bacterium existing endemically in the water and soil of SE Asia and Northern Australia. This organism has shown the ability to remain dormant in its host for decades. B. thailandensis is a closely related non-pathogenic near neighbor that is also found in these soils. It has been suggested that free-living amoeba could be natural reservoirs for these organisms. The interactions of Burkholderia species and Acanthamoeba castellanii, a species of free-living amoeba, were studied to better understand the natural ecology of these organisms and to determine the effects amoeba interactions might have on pathogenesis. In this study, the adherence and persistence of several B. pseudomallei clinical isolates were compared to that of B. thailandensis within both amoeba and a human monocyte cell line. Results showed that B. pseudomallei isolates can enter amoeba and survive therein at varying levels of efficiency. Some isolates were
Our proteomic analysis of the B. pseudomallei MSHR668 T2SS secretome revealed the presence of ∼50 proteins dependent on the T2SS for export. Numerous hydrolytic enzymes, including 12 putative peptidases, were members of the T2SS secretome. Previous studies suggest that MprA, a serine metalloprotease, is responsible for the majority of protease activity in B. pseudomallei supernatants (39, 55, 56). However, the results presented here indicate that MprA is not the only protease exported by the B. pseudomallei T2SS (Table 2). Valade et al. constructed a mprA mutant and showed that a small amount of protease activity was still present in the supernatant when it was grown in rich medium, which is consistent with our results (56). Although MprA is likely responsible for most of the protease activity present in B. pseudomallei supernatants, we speculate that one or more of the T2SS-dependent peptidases shown in Table 2 also play a minor role in the hydrolysis of protein substrates. It is also worth ...
TY - JOUR. T1 - Burkholderia pseudomallei Antibodies in Individuals Living in Endemic Regions in Northeastern Brazil. AU - Rolim, D.B.. AU - Vilar, D.C.F.L.. AU - De Goes Cavalcanti, L.P.. AU - Freitas, C.L.B.N.. AU - Inglis, Tim. AU - Nobre Rodrigues, J.L.N.. AU - Nagao-Dias, A.T.. PY - 2011. Y1 - 2011. N2 - A seroepidemiological investigation was conducted among the population of two municipalities in Northeastern Brazil. Immunoglobulin M (IgM) and IgG antibodies to Burkholderia pseudomallei were positive in 51.27% (161 in 317 samples) and 58.49% (186), respectively. IgM titers were higher in children than in adults. On the contrary, IgG increased progressively with age. We observed a significant association between agricultural occupation and raised IgM titers (P ,0.005) and IgG titers (P ,0.001), and between construction workers and raised IgG titers (P = 0.005). Antibody IgG avidities did not correlate with age. The highest titers of antibodies (1/800) showed the highest antibody avidity ...
Easton A, Haque https://www.ncbi.nlm.nih.gov/pubmed/?term=19829050%5Bpmid%5DA, Chu K, Lukaszewski R, Bancroft GJ. 2007. A critical role for neutrophils in resistance to experimental infection with Burkholderia pseudomallei. J Infect Dis 195: 99-107. A Critical Role for Neutrophils in Resistance to Experimental Infection with Burkholderia pseudomallei. ...
Background Burkholderia pseudomallei is the causative agent of melioidosis, a disease of significant morbidity and mortality in both human and animals in endemic areas. There is no vaccine towards the bacterium available in the market, and the efficacy of many of the bacteriums surface and secreted proteins are currently being evaluated as vaccine candidates. Methodology/Principal Findings With the availability of the B. pseudomallei whole genome sequence, we undertook to identify genes encoding the known immunogenic outer membrane protein A (OmpA). Twelve OmpA domains were identified and ORFs containing these domains were fully annotated. Of the 12 ORFs, two of these OmpAs, Omp3 and Omp7, were successfully cloned, expressed as soluble protein and purified. Both proteins were recognised by antibodies in melioidosis patients sera by Western blot analysis. Purified soluble fractions of Omp3 and Omp7 were assessed for their ability to protect BALB/c mice against B. pseudomallei infection. Mice were
Burkholderia pseudomallei (also known as Pseudomonas pseudomallei) is a Gram-negative, bipolar, aerobic, motile rod-shaped bacterium. It is a soil-dwelling bacterium endemic in tropical and subtropical regions worldwide, particularly in Thailand and northern Australia. It infects humans and animals and causes the disease melioidosis. It is also capable of infecting plants. B. pseudomallei measures 2-5 μm in length and 0.4-0.8 μm in diameter and is capable of self-propulsion using flagella. The bacteria can grow in a number of artificial nutrient environments, especially betaine- and arginine-containing ones. In vitro, optimal proliferation temperature is reported around 40 °C in neutral or slightly acidic environments (pH 6.8-7.0). The majority of strains are capable of fermentation of sugars without gas formation (most importantly, glucose and galactose; older cultures are reported to also metabolize maltose and starch). Bacteria produce both exo- and endotoxins. The role of the toxins ...
Kynurenine formamidase (KynB) forms part of the kynurenine pathway which metabolises tryptophan to anthranilate. This metabolite can be used for downstream production of 2-alkyl-4-quinolone (AQ) signalling molecules that control virulence in Pseudomonas aeruginosa. Here we investigate the role of kynB in the production of AQs and virulence-associated phenotypes of Burkholderia pseudomallei K96243, the causative agent of melioidosis. Deletion of kynB resulted in reduced AQ production, increased biofilm formation, decreased swarming and increased tolerance to ciprofloxacin. Addition of exogenous anthranilic acid restored the biofilm phenotype, but not the persister phenotype. This study suggests the kynurenine pathway is a critical source of anthranilate and signalling molecules that may regulate B. pseudomallei virulence ...
Burkholderia pseudomallei is the causative agent of melioidosis, a fatal human tropical disease. The non-specific DNA-binding protein DpsA plays a key role in protecting B. pseudomallei from oxidative stress mediated, for example, by organic hydroperoxides. The regulation of dpsA expression is poorly understood but one possibility is that it is regulated in a cell population density-dependent manner via N-acylhomoserine lactone (AHL)-dependent quorum sensing (QS) since a lux-box motif has been located within the dpsA promoter region. Using liquid chromatography and tandem mass spectrometry, it was first established that B. pseudomallei strain PP844 synthesizes AHLs. These were identified as N-octanoylhomoserine lactone (C8-HSL), N-(3-oxooctanoyl)homoserine lactone (3-oxo-C8-HSL), N-(3-hydroxyoctanoyl)-homoserine lactone (3-hydroxy-C8-HSL), N-decanoylhomoserine lactone (C10-HSL), N-(3-hydroxydecanoyl) homoserine lactone (3-hydroxy-C10-HSL) and N-(3-hydroxydodecanoyl)homoserine lactone (3-hydroxy-C12-HSL)
The effect of the two antibiotics ceftazidime and meropenem on a collection of 46 Burkholderia pseudomallei isolates representing clinical and environmental sources across northern Australia was investigated by using a series of in vitro test methods. The susceptibility testing methods used included Kirby-Bauer disk diffusion, Etest MIC, broth microdilution MIC, and a modification of the microdilution method in which Acanthamoeba cells were added to simulate the effect of a professional phagocytic cell on test outcome. In a semiquantitative validation coculture series, the majority of bacteria were intracellular up to a multiplicity of infection of 10 bacteria to one ameba. The optical density and bacterial count (log10 CFU/ml) correlated across the range tested (r2 = 0.77; P , 0.0001). Susceptibility test results were compared against clinical outcomes. The MICs of ceftazidime were consistently higher than those of meropenem by all three methods. The MICs of both agents were significantly ...
Sorry, but the advert you were looking for has expired. To see more employment opportunities with University of East Anglia, please click here. Perhaps you were looking for something totally different? In that case, it might be best start a new job search from our Home Page. You might also find our Site Map useful too. ...
Burkholderia pseudomallei is a Gram-negative bacterium that causes the serious human disease, melioidosis. There is no vaccine against melioidosis and it can be fatal if not treated with a specific antibiotic regimen, which typically includes the third-generation cephalosporin, ceftazidime (CAZ). There have been several resistance mechanisms described for B. pseudomallei, of which the best described are amino acid changes that alter substrate specificity in the highly conserved class A β-lactamase, PenA. In the current study, we sequenced penA from isolates sequentially derived from two melioidosis patients with wild-type (1.5 µg/mL) and, subsequently, resistant (16 or ≥256 µg/mL) CAZ phenotypes. We identified two single-nucleotide polymorphisms (SNPs) that directly increased CAZ hydrolysis. One SNP caused an amino acid substitution (C69Y) near the active site of PenA, whereas a second novel SNP was found within the penA promoter region. In both instances, the CAZ resistance phenotype ...
Burkholderia pseudomallei is the causative agent of the disease melioidosis, which is endemic in the tropics and a concern elsewhere as a biological warfare agent. Currently no human vaccine exists either in clinical trials or in a licensed form. Recently passively transferred monoclonal antibodies directed toward the expolysaccharide of B. pseudomallei have been shown to impart survival when administered prior to lethal challenge and active immunization using purified exopolysaccharide extends the mean time to death. Short peptides, termed mimotopes, mimicking native carbohydrate have been developed and used to induce protective responses against extracellular bacteria. Here the ability of mimotopes to generate a protective response against a pathogen that can invade host cells was investigated. Mimotopes immunoreactive to the passive protective monoclonals were developed and used to generate an antibody response against B. pseudomallei. Preliminary evaluation of the mimotopes in a murine ...
Burkholderia pseudomallei is a human and animal pathogen in tropical regions, especially Southeast Asia and northern Australia. Currently little is known about the genetics and molecular biology of this organism. In this report, we describe the mutagenesis of B. pseudomallei with the transposon Tn5-OT182. B. pseudomallei 1026b transposon mutants were obtained at a frequency of 4.6 x 10(-4) per initial donor cell, and the transposon inserted randomly into the chromosome. We used Tn5-OT182 to identify the flagellin structural gene, fliC. We screened 3,500 transposon mutants and identified 28 motility mutants. Tn5-OT182 integrated into 19 unique genetic loci encoding proteins with homology to Escherichia coli and Salmonella typhimurium flagellar and chemotaxis proteins. Two mutants, MM35 and MM36, contained Tn5-OT182 integrations in fliC. We cloned and sequenced fliC and used it to complement MM35 and MM36 in trans. The fliC transcriptional start site and a sigmaF-like promoter were identified by ...
Abstract Burkholderia pseudomallei is the causative agent of melioidosis, a severe infection endemic to many tropical regions. Lipopolysaccharide (LPS) is recognized as an important virulence factor used by B. pseudomallei. Isolates of B. pseudomallei have been shown to express one of four different types of LPS (typical LPS, atypical LPS types B and B2, and rough LPS) and in vitro studies have demonstrated that LPS types may impact disease severity. The association between LPS types and clinical manifestations, however, is still unknown, in part because an effective method for LPS type identification is not available. Thus, we developed antigen capture immunoassays capable of distinguishing between the LPS types. Mice were injected with B or B2 LPS for atypical LPS-specific monoclonal antibody (mAb) isolation; only two mAbs (3A2 and 5B4) were isolated from mice immunized with B2 LPS. Immunoblot analysis and surface plasmon resonance demonstrated that 3A2 and 5B4 are reactive with both B2 and B LPS
Burkholderia pseudomallei is resistant to a diverse group of antimicrobials including third generation cephalosporins whilst quinolones and aminoglycosides have no reliable effect. As therapeutic options are limited, development of more effective forms of immunotherapy is vital to avoid a fatal outcome. In an earlier study, we reported on the B. pseudomallei serine MprA protease which is relatively stable over a wide pH and temperature range and digests physiological proteins. The present study was carried out to evaluate the immunogenicity and protective efficacy of the MprA as a potential vaccine candidate. In BALB/c mice immunized with recombinant MprA protease (smBpF4), a significantly high IgG titer was detectable. Isotyping studies revealed that the smBpF4-specific antibodies produced were predominantly IgG1, proposing that immunization with smBpF4 triggered a Th2 immune response. Mice were immunized with smBpF4 and subsequently challenged with B. pseudomallei via the intraperitoneal route. Whilst
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Fingerprint Dive into the research topics of Genomic patterns of pathogen evolution revealed by comparison of Burkholderia pseudomallei, the causative agent of melioidosis, to avirulent Burkholderia thailandensis. Together they form a unique fingerprint. ...
Background Pathogenic bacteria adhere to the host cell surface using a family of outer membrane proteins called Trimeric Autotransporter Adhesins (TAAs). Although TAAs are highly divergent in sequence and domain structure, they are all conceptually comprised of a C-terminal membrane anchoring domain and an N-terminal passenger domain. Passenger domains consist of a secretion sequence, a head region that facilitates binding to the host cell surface, and a stalk region. Methodology/Principal Findings Pathogenic species of Burkholderia contain an overabundance of TAAs, some of which have been shown to elicit an immune response in the host. To understand the structural basis for host cell adhesion, we solved a 1.35 Å resolution crystal structure of a BpaA TAA head domain from Burkholderia pseudomallei, the pathogen that causes melioidosis. The structure reveals a novel fold of an intricately intertwined trimer. The BpaA head is composed of structural elements that have been observed in other TAA head
The work was undertaken to expand the tools available for researching Burkholderia pseudomallei (Bp), the etiological agent of the tropical disease melioidosis. Melioidosis has the potential to pose a severe threat to public health and safety. In the United States, Bp is listed as a Tier-1 select agent by the Centers for Disease Control and Prevention (CDC), thus requiring high levels of regulation and biosafety level 3 (BSL3) facilities for experimental manipulation of live organisms. An avirulent ∆purM derivative of strain 1026b (Bp82) has proven to be a valuable tool for biosafe research as a select-agent excluded strain, but the high level of genetic diversity between Bp strains necessitates an expansion of the biosafe toolset. The ∆purM mutation was recapitulated in the Bp 576a strain, a serotype B background. An important difference between strains 1026b and 576a is the lipopolysaccharide (LPS), a major virulence factor and protective antigen. Polyclonal sera from 1026b-challenged non-human
We evaluated the correlation of Burkholderia pseudomallei quantities in blood versus urine, sputum or pus. Correlations between bacterial counts in blood and other samples were not found. It is likely that an initial seeding event to extracellular organs is followed by independent growth of B. pseudomallei, and that bacteria in the urine were not passively filtered from the bloodstream.
If you have used this database, please ensure that you acknowledge the Burkholderia Genome Database publication rather than just the website URL. Thank you!. Winsor GL, Khaira B, Van Rossum T, Lo R, Whiteside MD, Brinkman FS. (2008 ...
PubMed journal article: Use of 16S rRNA gene sequencing for rapid identification and differentiation of Burkholderia pseudomallei and B. mallei. Download Prime PubMed App to iPhone, iPad, or Android
Burkholderia pseudomallei is a gram-negative soil bacterium that is able to infect both humans and animals. Although cellculture based studies have revealed si...
The reaction of the catalase-peroxidase of Burkholderia pseudomallei with peroxyacetic acid has been analyzed using stopped-flow spectrophotometry. Two well-defined species were observed, the first de
If you have used this database, please ensure that you acknowledge the Burkholderia Genome Database publication rather than just the website URL. Thank you!. Winsor GL, Khaira B, Van Rossum T, Lo R, Whiteside MD, Brinkman FS. (2008 ...
Recently MALDI-TOF mass spectrum analysis has been considered an easy and discriminatory tool for identification of bacterial species (Lista et al., 2011). The results of MALDI-TOF mass spectrum analysis of the eight suspected isolates matched with that of the 16S rDNA sequence analysis. The four isolates DRDEBPS1001, DRDEBPS1002, DRDEBPS1003 and DRDEBPS1004 were confirmed as B. pseudomallei on the basis of score values 2.601, 2.099, 2.362 and 2.047. The other four isolates had been biochemically suspected but not supported by both the PCRs were also identified by MALDI-TOF spectrum analysis as Cupriavidus necator and Enterobacter cloacae with score value of 2.112, 2.122 and 2.341, 2.241 respectively, confirming the results of the 16S analysis.. The isolation of B. pseudomallei from soil is very complex as the presence of large numbers of closely related soil microflora interferes with its recovery although use of Ashdown broth and agar for the isolation of B. pseudomallei from soil samples ...
The overall goal of this project is to forensically characterize 100 unknown Burkholderia isolates in the US-Australia collaboration. We will identify genome-wide single nucleotide polymorphisms (SNPs) from B. pseudomallei and near neighbor species including B. mallei, B. thailandensis and B. oklahomensis. We will design microarray probes to detect these SNP markers and analyze 100 Burkholderia genomic DNAs extracted from environmental, clinical and near neighbor isolates from Australian collaborators on the Burkholderia SNP microarray. We will analyze the microarray genotyping results to characterize the genetic diversity of these new isolates and triage the samples for whole genome sequencing. In this interim report, we described the SNP analysis and the microarray probe design for the Burkholderia SNP microarray. ...
General Information: This organism was originally isolated from a rice field sample in Thailand. Burkholderia thailandensis is a common soil saprophyte (lives on decaying organic matter in the soil). This bacterium is very similar to the human and animal pathogen Burkholderia pseudomallei but appears to be avirulent. Distinguishing the two organisms is very difficult and may depend on using monoclonal antibodies to detect differences in exopolysaccharide production. ...
General Information: This organism was originally isolated from a rice field sample in Thailand. Burkholderia thailandensis is a common soil saprophyte (lives on decaying organic matter in the soil). This bacterium is very similar to the human and animal pathogen Burkholderia pseudomallei but appears to be avirulent. Distinguishing the two organisms is very difficult and may depend on using monoclonal antibodies to detect differences in exopolysaccharide production. ...
CUBRC, Inc. two weeks ago announced that CUBRCs Biological and Medical Sciences team, in collaboration with EpiVax, Inc., has received a four-year grant worth $1.87 million from the Defense Threat Reduction Agency (DTRA) within the Department of Defense (DoD). CUBRC, EpiVax, and scientists at the University of Florida will be investigating immune cells from patients that were previously infected with Burkholderiapseudomallei to understand how this bacterium evades the human immune system and use that information to engineer an effective vaccine. CUBRCs president and CEO, Tom McMahon, stated, We are truly thankful for DTRAs confidence in our proposal to research vaccine antigens for prevention of Burkholderia pseudomallei infections, an important pathogen of biothreat potential.. CUBRC says it will leverage its technical expertise in biomedical R&D and its experience leading large federal government grants and contracts in collaboration with EpiVax and the University of Florida to execute ...
Burkholderia pseudomallei is an intracellular pathogen and the causative agent of melioidosis, a life-threatening disease of humans. Within host cells, superoxide is an important mediator of pathogen killing. In this study, we have identified the B. pseudomallei K96243 sodC gene, shown that it has superoxide dismutase activity, and constructed an allelic deletion mutant of this gene. Compared with the wild-type, the mutant was more sensitive to killing by extracellular superoxide, but not to superoxide generated intracellularly. The sodC mutant showed a markedly decreased survival in J774A.1 mouse macrophages, and reduced numbers of bacteria were recovered from human polymorphonuclear neutrophils (PMNs) when compared with the wild-type. The numbers of wild-type or mutant bacteria recovered from human diabetic neutrophils were significantly lower than from normal human neutrophils. The sodC mutant was attenuated in BALB/c mice. Our results indicate that SodC plays a key role in the virulence of B.
Looking for Pseudomonas pseudomallei? Find out information about Pseudomonas pseudomallei. A bacteria that is the causative agent of melioidosis, an endemic glanders-like disease of humans and animals that occurs most frequently in southeastern... Explanation of Pseudomonas pseudomallei
Abstract Melioidosis is a tropical disease of high mortality caused by the environmental bacterium, Burkholderia pseudomallei. We have collected clinical isolates from the highly endemic Northern Territory of Australia routinely since 1989, and animal and environmental B. pseudomallei isolates since 1991. Here we provide a complete record of all B. pseudomallei multilocus sequence types (STs) found in the Northern Territory to date, and distribution maps of the eight most common environmental STs. We observed surprisingly restricted geographic distributions of STs, which is contrary to previous reports suggesting widespread environmental dissemination of this bacterium. Our data suggest that B. pseudomallei from soil and water does not frequently disperse long distances following severe weather events or by migration of infected animals.
Endemic melioidosis is caused by genetically diverse Burkholderia pseudomallei strains. However, clonal outbreaks (multiple cases caused by 1 strain) have occurred, such as from contaminated potable water. B. pseudomallei is designated a group B bioterrorism agent, which necessitates rapidly recognizing point-source outbreaks. Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) can identify genetically related isolates, but results take several days to obtain. We developed a simplified 4-locus multilocus variable number tandem repeat analysis (MLVA-4) for rapid typing and compared results with PFGE and MLST for a large number of well-characterized B. pseudomallei isolates. MLVA-4 compared favorably with MLST and PFGE for the same isolates; it discriminated between 65 multilocus sequence types and showed relatedness between epidemiologically linked isolates from outbreak clusters and between isolates from individual patients. MLVA-4 can establish or refute that a clonal ...
Melioidosis, caused by the highly recombinogenic bacterium Burkholderia pseudomallei, is a disease with high mortality. Tracing the origin of melioidosis outbreaks and understanding how the bacterium spreads and persists in the environment are essential to protecting public and veterinary health and reducing mortality associated with outbreaks. We used whole-genome sequencing to compare isolates from a historical quarter-century outbreak that occurred between 1966 and 1991 in the Avon Valley, Western Australia, a region far outside the known range of B. pseudomallei endemicity. All Avon Valley outbreak isolates shared the same multilocus sequence type (ST-284), which has not been identified outside this region. We found substantial genetic diversity among isolates based on a comparison of genome-wide variants, with no clear correlation between genotypes and temporal, geographical or source data. We observed little evidence of recombination in the outbreak strains, indicating that genetic ...
Melioidosis, caused by the highly recombinogenic bacterium Burkholderia pseudomallei, is a disease with high mortality. Tracing the origin of melioidosis outbreaks and understanding how the bacterium spreads and persists in the environment are essential to protecting public and veterinary health and reducing mortality associated with outbreaks. We used whole-genome sequencing to compare isolates from a historical quarter-century outbreak that occurred between 1966 and 1991 in the Avon Valley, Western Australia, a region far outside the known range of B. pseudomallei endemicity. All Avon Valley outbreak isolates shared the same multilocus sequence type (ST-284), which has not been identified outside this region. We found substantial genetic diversity among isolates based on a comparison of genome-wide variants, with no clear correlation between genotypes and temporal, geographical or source data. We observed little evidence of recombination in the outbreak strains, indicating that genetic ...
Burkholderia pseudomallei, the causative agent of melioidosis, is endemic to Southeast Asia and northern Australia. Clinical manifestations of disease are diverse, ranging from chronic infection to acute septicaemia. The current gold standard of diagnosis involves bacterial culture and identification which is time consuming and often too late for early medical intervention. Hence, rapid diagnosis of melioidosis is crucial for the successful management of melioidosis. The study evaluated 4 purified B. pseudomallei recombinant proteins (TssD-5, Omp3, smBpF4 and Omp85) as potential diagnostic agents for melioidosis. A total of 68 sera samples from Malaysian melioidosis patients were screened for the presence of specific antibodies towards these proteins using enzyme-linked immunosorbent assay (ELISA). Sera from patients with various bacterial and viral infections but negative for B. pseudomallei, as well as sera from healthy individuals, were also included as non-melioidosis controls. The Mann Whitney
Melioidosis is a neglected tropical disease with an estimated annual mortality rate of 89,000 in 45 countries across tropical regions. The causative agent is Burkholderia pseudomallei, a gram-negative soil-dwelling bacterium. In Thailand, B. pseudomallei can be found across multiple regions, along with the low-virulence B. thailandensis and the recently discovered B. thailandensis variant (BTCV), which expresses B. pseudomallei-like capsular polysaccharide. Comprehensive studies of human immune responses to B. thailandensis variants and cross-reactivity to B. pseudomallei are not complete. We evaluated human immune responses to B. pseudomallei, B. thailandensis, and BTCV in melioidosis patients and healthy persons in B. pseudomallei-endemic areas using a range of humoral and cellular immune assays. We found immune cross-reactivity to be strong for both humoral and cellular immunity among B. pseudomallei, B. thailandensis, and BTCV. Our findings suggest that environmental exposure to low-virulence
Melioidosis is a tropical disease caused by the bacterium Burkholderia pseudomallei. Outbreaks are uncommon and can generally be attributed to a single point source and strain. We used whole-genome sequencing to analyse B. pseudomallei isolates collected from an historical 2-year long case cluster that occurred in a remote northern Australian indigenous island community, where infections were previously linked to a contaminated communal water supply. We analysed the genome-wide relatedness of the two most common multilocus sequence types (STs) involved in the outbreak, STs 125 and 126. This analysis showed that although these STs were closely related on a whole-genome level, they demonstrated evidence of multiple recombination events that were unlikely to have occurred over the timeframe of the outbreak. Based on epidemiological and genetic data, we also identified two additional patients not previously associated with this outbreak. Our results confirm the previous hypothesis that a single ...
This report published in Communicable Diseases Intelligence Volume 27, No 2, June 2003 describes the epidemiology of melioidosis, which is caused by the Gram negative bacterium Burkholderia pseudomallei and is endemic in northern Australia.
The bacterium Burkholderia ubonensis is commonly co-isolated from environmental specimens harbouring the melioidosis pathogen, Burkholderia pseudomallei. B. ubonensis has been reported in northern Australia and Thailand but not North America, suggesting similar geographic distribution to B. pseudomallei. Unlike most other Burkholderia cepacia complex (Bcc) species, B. ubonensis is considered non-pathogenic, although its virulence potential has not been tested. Antibiotic resistance in B. ubonensis, particularly towards drugs used to treat the most severe B. pseudomallei infections, has also been poorly characterised. This study examined the population biology of B. ubonensis, and includes the first reported isolates from the Caribbean. Phylogenomic analysis of 264 B. ubonensis genomes identified distinct clades that corresponded with geographic origin, similar to B. pseudomallei. A small proportion (4%) of strains lacked the 920kb chromosome III replicon, with discordance of presence/absence amongst
TY - JOUR. T1 - Prophylactic application of CpG oligonucleotides augments the early host response and confers protection in acute melioidosis. AU - Judy, Barbara M.. AU - Taylor, Katherine. AU - Deeraksa, Arpaporn. AU - Johnston, R. Katie. AU - Endsley, Janice J.. AU - Vijayakumar, Sudhamathi. AU - Aronson, Judith F.. AU - Estes, D. Mark. AU - Torres, Alfredo G.. PY - 2012/3/20. Y1 - 2012/3/20. N2 - Prophylactic administration of CpG oligodeoxynucleotides (CpG ODNs) is known to confer protection against lethal sepsis caused by Burkholderia pseudomallei in the mouse model. The mechanisms whereby CpG regulates the innate immune response to provide protection against B. pseudomallei, however, are poorly characterized. In the present study, we demonstrate that intranasal treatment of mice with Class C CpG, results in recruitment of inflammatory monocytes and neutrophils to the lung at 48 h post-treatment. Mice infected with B. pseudomallei 48 h post-CpG treatment had reduced organ bacterial load and ...
Evidence is well documented that Pseudomonas pseudomallei, the cause of melioidosis in animals and man, is a soil organism that occurs mainly in tropical and sub-tropical climates (Cambon 1955: Forunier 1965; Jananetra et al 1974). This letter is to report the idolation of 9 strains of Ps. pseudomallei from the soil and 3 strains from muddy water that drained into artifically-made holes in a 5 ha sheep paddock at the Animal Health Station, Oonoonba, where natural infections occur yearly during the wet season. The morphological, cultural and biochemical characteristics of the isolates agreed with those set down by Cottew (1950) and Laws (1964).. ...
BACKGROUND: Melioidosis is a severe disease caused by Burkholderia pseudomallei. Clinical manifestations are diverse and acute infections require immediate treatment with effective antibiotics. While culture is the current diagnostic standard, it is time-consuming and has low sensitivity. In endemic areas, inaccessibility to biosafety level 3 facilities and a lack of good serodiagnostic tools can impede diagnosis and disease surveillance. Recent studies have suggested that O-polysaccharide (OPS) and hemolysin co-regulated protein 1 (Hcp1) are promising target antigens for serodiagnosis of melioidosis. METHODOLOGY/PRINCIPLE FINDINGS: We evaluated rapid ELISAs using crude antigens, purified OPS and Hcp1 to measure antibody levels in three sets of sera: (i) 419 serum samples from melioidosis patients, Thai and U.S. healthy donors, (ii) 120 serum samples from patients with other bacterial infections, and (iii) 423 serum samples from 200 melioidosis patients obtained upon admission and at 12 and 52 weeks
Melioidosis is caused by the Gram-negative bacillus Burkholderia pseudomallei. Most clinical reports of disease are from south-east Asia and northern Australia. The organism is intrinsically resistant to most commonly available antibiotics. Standard therapy includes ceftazidime either alone or in combination with co-trimoxazole. The clinical advantage in adding cotrimoxazole has never been determined; nor has the activity of newer, fourth-generation cephalosporins, such as cefepime, been studied in the treatment of this condition. BALB/c mice have been shown to represent an animal model of melioidosis. This animal model was used in this study to compare the efficacy of ceftazidime and cefepime alone or with co-trimoxazole, in the therapy of melioidosis. Antibiotic levels in the mice were determined by HPLC, and dosing was modified to keep plasma antibiotic levels at or above the MIC for the organism-antibiotic combination for a significant part of a 12 h period. Bacterial load, as determined by ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
We have measured the in-vitro activity of 27 antimicrobials against 211 clinical and ten reference strains of Pseudomonas pseudomallei. Imipenem was the most active antibiotic tested, followed by piperacillin, doxycycline, amoxycillin/clavulanic acid, cefixime, cefetamet, azlocillin and ceftazidime, all of which had MICs of less than or equal to 2 mg/l for the majority of strains. The measured MICs were dependent on the media and inocula used, to an extent which varied with the antibiotic class under test; MICs of ureidopenicillins were particularly inoculum-dependent. The beta-lactams and ciprofloxacin were bactericidal, whereas the agents conventionally used to treat melioidosis (doxycycline, chloramphenicol, sulphamethoxazole and trimethoprim) had bacteriostatic activity only. Strains highly resistant to chloramphenicol (MIC greater than or equal to 256 mg/l) emerged during treatment in 7.1% of patients. These strains were fully virulent, and frequently showed cross-resistance to tetracyclines,
Burkholderia thailandensis is a non-pathogenic environmental saprophyte closely related to Burkholderia pseudomallei, the causative agent of the often fatal animal and human disease melioidosis. To study B. thailandensis genomic variation, we profiled 50 isolates using a pan-genome microarray comprising genomic elements from 28 Burkholderia strains and species. Of 39 genomic regions variably present across the B. thailandensis strains, 13 regions corresponded to known genomic islands, while 26 regions were novel. Variant B. thailandensis isolates exhibited isolated acquisition of a capsular polysaccharide biosynthesis gene cluster (B. pseudomallei-like capsular polysaccharide) closely resembling a similar cluster in B. pseudomallei that is essential for virulence in mammals; presence of this cluster was confirmed by whole genome sequencing of a representative variant strain (B. thailandensis E555). Both whole-genome microarray and multi-locus sequence typing analysis revealed that the variant strains
A virulent strain of Pseudomonas pseudomallei was subjected to ultraviolet irradiation and a mutant clone requiring preformed adenine or hypoxanthine for growth was isolated. The imposition of auxotrophism was associated with a striking decline in virulence for mice which could be restored by permitting the strain to revert to purine independence in vitro. The mutant persisted in mice without detected reversions or or untoward effects for approximately 20 days following inoculation of 107 cells. After repeated inoculations, a significant immune response was demonstrated by parenteral challenge with diverse strains of this species. However, animals so immunized remained susceptible to lethal respiratory infection.. ...
Yap, E.H.,Thong, T.W.,Tan, A.L.,Yeo, M.,Tan, H.C.,Loh, H.,Teo, T.P.,Thong, K.T.,Singh, M.,Chan, Y.C. (1995). Comparison of Pseudomonas pseudomallei from humans, animals, soil and water by restriction endonuclease analysis.. Singapore Medical Journal 36 (1) : 60-62. [email protected] Repository ...
TY - CHAP. T1 - Management of patients with severe melioidosis in intensive care. AU - West, T Eoin. AU - Cheng, Allen. PY - 2012. Y1 - 2012. N2 - Melioidosis frequently presents as severe sepsis or septic shock. Appropriate managementtherefore dictates familiarity with standard sepsis therapies and approaches to intensive care. These treatments include early and aggressive haemodynamic management using intravenous fluids, vasopressors, and inotropes in a goal-directed fashion to maximise oxygen delivery to peripheral tissues. In the critically ill patient, oxygen consumption can be reduced with antipyretics, sedation, and mechanical ventilation. The role of glycaemic control and adjunctive treatments such as corticosteroids, activated protein C and granulocyte colony stimulating factor (G-CSF) are controversial. G-CSF has been formally studied in melioidosis patients, but the level of evidence for adjunctive treatments is insufficient. Mechanical ventilation for respiratory failure or acute ...
Health officials are stepping up public education and public hygiene campaigns advising people about boiling water, wearing boots in flood waters, etc.. For your information: Massey University researchers produce Leptospirosis video series. Melioidosis (also known as Whitmore disease and Nightcliff gardeners disease) is caused by the bacterium, Burkholderia pseudomallei. The disease though somewhat rare has been seen in areas of Southeast Asia and Northern Australia, particularly after heavy rains. In Thailand it is considered a disease of rice farmers.. The organism is saprophytically found in soil and water. People usually get infected by contact with contaminated soil or water through skin wounds, inhalation or rarely through ingestion of contaminated water.. Person to person transmission can occur through contact with blood and body fluids of an infected person.. Depending on how heavy the infection incubation can range from hours to weeks. Infection may show no symptoms but it can quickly ...
2,3-bisphosphoglycerate-dependent phosphoglycerate mutase from Burkholderia pseudomallei: We present here an ensemble of structures solved by the Seattle Structural Genomics Center for Infectious Disease (SSGCID) of 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase, or PGAM, from Burkholderia pseudomallei, a pathogen which causes the serious skin infection melioidosis.
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
The worldwide epidemiology of melioidosis is changing. We describe a case of acute melioidosis in Spain in a patient who had traveled to Africa. A novel sequence type of Burkholderia pseudomallei was identified in this patient. Clinicians should be a ...
Melioidosis is diagnosed by isolating Burkholderia pseudomallei from blood, urine, sputum, skin lesions, or abscesses; or by detecting an antibody response to the bacteria.
Free Public Domain Picture: This photograph depicts the colonial morphology displayed by Gram-negative Burkholderia thailandensis bacteria, which was grown on a medium | ID: 13545336611235
may be the etiological agent of human melioidosis, a disease with a broad spectrum of clinical manifestations ranging from fatal septicemia to chronic localized infection or asymptomatic latent infection. interferon (IFN-), interleukin-6 (IL-6), monocyte JIB-04 chemotactic protein-1 (MCP-1), and tumor necrosis factor- (TNF-) were induced during chronic infection, and histopathological analysis showed features in common with human melioidosis. Interestingly, many of these features were similar to those induced by in humans, such as development of a collagen cord that encapsulates the lesions, the presence of multinucleated giant cells, and granulomas with a caseous necrotic center, which may explain why chronic melioidosis is often misdiagnosed as tuberculosis. Our model now provides a relevant and practical tool to define the immunological features of chronic melioidosis and aid in the development of more effective treatment of this disease in humans. is a Gram-negative soil bacterium that is ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
A simple method was developed for detection and differentiation of five Tier 1 bacterial agents, including Bacillus anthracis, Francisella tularensis, Yersinia pestis, Burkholderia pseudomallei and Burkholderia mallei as well as their closely related near neighbors by gas chromatography-mass spectrometry (GC-MS). Generally, different classes of compounds can be used as biomarkers for biowarfare agent detection, including nucleic acids (i.e., DNA or RNA), proteins (i.e., antibodies), carbohydrates (i.e., sugars), lipopolysaccharides, lipids (i.e., fatty acids) and small molecules. One-step thermochemolysis (TCM) was developed to provide GC-MS detectable biomarker signatures, including sugars, fatty acids and small molecules. Solid phase micro-extraction (SPME) was used for biomarker extraction, concentration and introduction into the GC-MS. Statistical algorithms were constructed using a combination of biomarkers for the five agents, which were robust against different growth conditions (medium and
A polyphasic taxonomic study including DNA-DNA reassociation experiments and an extensive biochemical characterization was performed on 14 Burkholderia isolates from moss gametophytes of nutrient-poor plant communities on the southern Baltic Sea coast in northern Germany. The strains were classified within two novel species, for which the names Burkholderia bryophila sp. nov. and Burkholderia megapolitana sp. nov. are proposed. The former species also includes isolates from grassland and agricultural soil collected in previous studies. Strains Burkholderia bryophila 1S18T (=LMG 23644T =CCUG 52993T) and Burkholderia megapolitana A3T (=LMG 23650T =CCUG 53006T) are the proposed type strains. They were isolated from Sphagnum rubellum and Aulacomnium palustre, respectively, growing in the Ribnitzer Großes Moor nature reserve (Mecklenburg-Pommern, Germany). All moss isolates of both novel species showed antifungal activity against phytopathogens as well as plant-growth-promoting properties.
A definitive diagnosis is made by culturing the organism from any clinical sample, because the organism is never part of the normal human flora.. A definite history of contact with soil may not be elicited, as melioidosis can be dormant for many years before manifesting. Attention should be paid to a history of travel to endemic areas in returned travellers. Some authors recommend considering possibility of melioidosis in every febrile patient with a history of traveling to and/or staying at endemic areas.. A complete screen (blood culture, sputum culture, urine culture, throat swab, and culture of any aspirated pus) should be performed on all patients with suspected melioidosis (culture on blood agar as well as Ashdowns medium). A definitive diagnosis is made by growing B. pseudomallei from any site. A throat swab is not sensitive, but is 100% specific if positive, and compares favourably with sputum culture. The sensitivity of urine culture is increased if a centrifuged specimen is cultured, ...
Khor, W.C. and Puah, S.M. and Tan, J.A.M.A and Puthucheary, S.D. and Chua, K.H. (2015) Phenotypic and genetic diversity of Aeromonas Species isolated from fresh water lakes in Malaysia. PLoS ONE, 10 (12). ISSN 1932-6203 Karunakaran, R. and Sun, T.T. and Rahim, F.F. and Bee, B.L. and Sam, I.C. and Kahar-Bador, M. and Hassan, H. and Puthucheary, S.D. (2012) Ceftriaxone resistance and genes encoding extended-spectrum ß-lactamase among non-typhoidal salmonella species from a tertiary care hospital in Kuala Lumpur, Malaysia. Japanese Journal of Infectious Diseases, 65. ISSN 1344-6304 Liew, S.M. and Tay, S.T. and Wongratanacheewin, S. and Puthucheary, S.D. (2012) Enzymatic profiling of clinical and environmental isolates of Burkholderia pseudomallei. Tropical Biomedicine, 29 (1). pp. 160-168. ISSN 0127-5720 Puthucheary, S.D. and Puah, S.M. and Chua, K.H. (2012) Molecular characterization of clinical isolates of Aeromonas species from Malaysia. PLoS ONE, 7 (2). ISSN 1932-6203 Puthucheary, S.D. and ...
The imprint of demographic and selective processes on bacterial population structure needs to be evaluated as deviation from the expectations of an appropriate null neutral model. We explore the impact of varying the population mutation and recombination rates theta and rho on ideal populations, using a recently developed model of neutral drift at multiple loci. This model may be fitted to experimental data to provide estimates of these parameters, and we do so for seven bacterial species (Neisseria meningitidis, Streptococcus pneumoniae, Streptococcus pyogenes, Staphylococcus aureus, Helicobacter pylori, Burkholderia pseudomallei and Bacillus cereus), illustrating that bacterial species vary extensively in these fundamental parameters. Historically, the influence of recombination has often been estimated through its influence on the Index of Association I(A). We show that this may be relatively insensitive to changes in either mutation or recombination rates. It is known that biased sampling can lead
Atkins, T; Prior, R; Mack, K; Russell, P; Nelson, M; Prior, J; Ellis, J; Oyston, PCF; Dougan, G; Titball, RW; (2002) Characterisation of an acapsular mutant of Burkholderia pseudomallei identified by signature tagged mutagenesis. Journal of medical microbiology, 51 (7). pp. 539-47. ISSN 0022-2615 https://researchonline.lshtm.ac.uk/id/eprint/17731 Full text not available from this repository ...
Looking for Whitmore's disease? Find out information about Whitmore's disease. An endemic bacterial disease, primarily of rodents but occasionally communicable to humans, caused by Pseudomonas pseudomallei and characterized by... Explanation of Whitmore's disease
TUESDAY, July 7, 2020 (HealthDay News) -- A potentially deadly antibiotic-resistant bacteria could be hiding in the dirt and water of the southernmost U.S. states, warns a new report from the U.S. Centers for Disease Control and Prevention.. The bacterial infection, called melioidosis, caused the lungs of a 63-year-old Texan to shut down in late 2018, forcing doctors to put him on a ventilator to save his life, the researchers said.. U.S. citizens whove caught melioidosis in the past typically picked it up in a foreign country, but this man had not recently traveled abroad, said Johanna Salzer, a veterinary medical officer with the CDCs Bacterial Special Pathogens Branch.. Whats more, the bacteria that caused the mans melioidosis was genetically similar to two prior U.S. cases, one in Texas in 2004 and one in Arizona in 1999.. We feel like this is evidence that it could be in the environment in the United States, Salzer said. We just need to find it.. Melioidosis is caused by the ...
Burkholderia pseudomallei Meningitis multiple Meningococcal disease Neisseria meningitidis Metagonimiasis usually Metagonimus ...
For Burkholderia pseudomallei, some clinical antibiotic agents that are used to treat its infection, mellioidosis, can induce ... "Modified Virulence of Antibiotic-Induced Burkholderia pseudomallei Filaments". Antimicrobial Agents and Chemotherapy. 49 (3): ... However, the B.pseudomallei filaments revert to normal forms when the antibiotics are removed. Moreover, bacillary daughter ...
Brett PJ, DeShazer D, Woods DE (January 1998). "Burkholderia thailandensis sp. nov., a Burkholderia pseudomallei-like species ...
Colonies of Burkholderia pseudomallei, one of many pathogenic Betaproteobacteria. Scientific classification Domain: Bacteria ... Other members of the class can infect plants, such as Burkholderia cepacia which causes bulb rot in onions as well as ...
Chua KL, Chan YY, Gan YH (April 2003). "Flagella are virulence determinants of Burkholderia pseudomallei". Infection and ...
Inglis, TJ; Chiang, D; Lee, GS; Chor-Kiang, L (1998). "Potential misidentification of Burkholderia pseudomallei by API 20NE". ... Care must be taken because Burkholderia pseudomallei is commonly misidentified as C. violaceum by many common identification ... "Comparison of Automated and Nonautomated Systems for Identification of Burkholderia pseudomallei". J Clin Microbiol. 40 (12): ... The two are readily distinguished because B. pseudomallei produces large wrinkled colonies, whereas C. violaceum produces a ...
2010). Kursula P (ed.). "Structure of a Burkholderia pseudomallei trimeric autotransporter adhesin head". PLOS ONE. 5 (9): ...
In Burkholderia pseudomallei BimA initiates actin polymerization in vitro. It is assumed that intracellular migration of this ...
During infection, some bacteria (e.g., Burkholderia pseudomallei) therefore produce superoxide dismutase to protect themselves ... "Superoxide dismutase C is required for intracellular survival and virulence of Burkholderia pseudomallei". Microbiology. 157 ( ...
Colonies of Burkholderia pseudomallei on Müller-Hinton agar after 72 hours incubation. ...
There are pathogens, such as Burkholderia mallei, and Burkholderia pseudomallei which have been shown to exhibit genome-wide ... September 2004). "Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei". Proceedings of the ... September 2004). "Structural flexibility in the Burkholderia mallei genome". Proceedings of the National Academy of Sciences of ...
Brett PJ, DeShazer D, Woods DE (January 1998). "Burkholderia thailandensis sp. nov., a Burkholderia pseudomallei-like species ...
... and Burkholderia pseudomallei selective agar for clinical isolation of Burkholderia pseudomallei" (PDF). J Clin Microbiol. 43 ( ... Ashdown's medium is a selective culture medium for the isolation and characterisation of Burkholderia pseudomallei (the ... 2007). "Biological relevance of colony morphology and phenotypic switching by Burkholderia pseudomallei". J Bacteriol. 189 (3 ... The medium is also enriched with 4% glycerol, which is required by some strains of B. pseudomallei to grow. B. pseudomallei ...
"A preliminary X-ray study of sedoheptulose-7-phosphate isomerase from Burkholderia pseudomallei". Acta Crystallographica ...
Exposure to Burkholderia pseudomallei may commonly cause antibodies to be produced against it without any symptoms. Of the ... Gee JE, Gulvik CA, Elrod MG, Batra D, Rowe LA, Sheth M, Hoffmaster AR (July 2017). "Phylogeography of Burkholderia pseudomallei ... January 2016). "Burkholderia pseudomallei and burden of melioidosis". Nature Microbiology. 1 (1): 15008. doi:10.1038/nmicrobiol ... In animals, another similar organism named Burkholderia mallei is the causative agent of the disease glanders. B. pseudomallei ...
... between Etest and reference broth microdilution for antimicrobial susceptibility testing of Burkholderia pseudomallei". ...
The first structure of a needle-complex monomer was NMR structure of BsaL from "Burkholderia pseudomallei" and later the ... the type III secretion needle protein of Burkholderia pseudomallei". Journal of Molecular Biology. 359 (2): 322-30. doi:10.1016 ... Burkholderia (glanders), Yersinia (plague), Chlamydia (sexually transmitted disease), Pseudomonas (infects humans, animals and ...
It includes some pathogenic species, such as Burkholderia mallei (glanders) and Burkholderia pseudomallei (melioidosis). ... nov., isolated from forest soil and reclassification of Burkholderia alpina as Pararobbsia alpina comb. nov". Int J Syst Evol ... 2014). "Molecular signatures and phylogenomic analysis of the genus Burkholderia: Proposal for division of this genus into the ... 2017). "Reassessment of the taxonomic position of Burkholderia andropogonis and description of Robbsia andropogonis gen. nov., ...
"Caspase-6 mediates resistance against Burkholderia pseudomallei infection and influences the expression of detrimental ...
Bond TE, Sorenson AE, Schaeffer PM (June 2017). "Functional characterisation of Burkholderia pseudomallei biotin protein ligase ...
Fresh-water bacterial infections include Aeromonas hydrophila, Burkholderia pseudomallei causing melioidosis, leptospira ...
Burkholderia pseudomallei and Edwardsiella tarda are two other organisms which possess a T6SS that appears dedicated for ...
A recent Australian study has shown that the bacterium causing the tropical disease melioidosis, Burkholderia pseudomallei, can ... "Burkholderia pseudomallei penetrates the brain via destruction of the olfactory and trigeminal nerves: implications for the ...
... infection mechanisms of Burkholderia pseudomallei and melioidosis. Peacock has published around 150 papers on these topics. ... particularly on the bacterium Burkholderia pseudomallei and on methicillin-resistant Staphylococcus aureus (MRSA). She has held ...
Burkholderia mallei, Burkholderia pseudomallei, Chlamydophila psittaci, Coxiella burnetii, Francisella tularensis, some of the ... Also, Germany itself became a victim of similar attacks - horses bound for Germany were infected with Burkholderia by French ...
Burkholderia pseudomallei. Meningitis. multiple. Meningococcal disease. Neisseria meningitidis. Metagonimiasis. usually ...
Re-infection is a recurrence of symptoms due to an infection with a new strain of Burkholderia pseudomallei following the ... pseudomallei strain. ... Patients re-presenting during this period of therapy are considered to have recrudescent rather than ...
Some can be bacterial from the sporulating clostridium and bacillus to Rhodococcus equi, Burkholderia pseudomallei, Listeria, ... However, cases of zoo-sapronoses involving Listeria, Erysipelothrix, Yersinia pseudotuberculosis, Burkholderia pseudomallei, ...
Caspase-11 has been shown to be activated by Burkholderia pseudomallei, Gram-negative bacteria found in the soil of southeast ...
Burkholderia pseudomallei various animals direct contact with contaminated soil and surface water ... Burkholderia mallei. horses, donkeys direct contact Gnathostomiasis Gnathostoma spp. dogs, minks, opossums, cats, lions, tigers ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei (Melioidosis) · Burkholderia mallei (Glanders) · Burkholderia cepacia complex · Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
... pseudomallei, P. pyrrocinia, P. rubrilineans, P. rubrisubalbicans, P. saccharophila, P. solanacearum, P. spinosa, P. syzygii, P ... And transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia ... Yabuuchi, E.; Kosako, Y.; Yano, I.; Hotta, H.; Nishiuchi, Y. (1995). "Transfer of two Burkholderia and an Alcaligenes species ... Other strains previously classified in the genus Pseudomonas are now classified in the genera Burkholderia and Ralstonia.[9][10 ...
... and Burkholderia pseudomallei selective agar for clinical isolation of Burkholderia pseudomallei". Journal of Clinical ... Burkholderia pseudomallei (also known as Pseudomonas pseudomallei) is a Gram-negative, bipolar, aerobic, motile rod-shaped ... 2011). "Rapid identification of Burkholderia pseudomallei and Burkholderia mallei by fluorescence in situ hybridization (FISH) ... Pathema Burkholderia resource "Burkholderia pseudomallei". NCBI Taxonomy Browser. 28450. ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
KirBac1.1, from Burkholderia pseudomallei, is 333 amino acyl residues (aas) long with two N-terminal TMSs flanking a P-loop ( ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Sicer izraža določeno učinkovitost proti Burkholderia pseudomallei, vendar se pri okužbah s to bakterijo kloramfenikol rutinsko ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
... pseudomallei, P. pyrrocinia, P. rubrilineans, P. rubrisubalbicans, P. saccharophila, P. solanacearum, P. spinosa, P. syzygii, P ... And transfer of seven species of the genus Pseudomonas homology group II to the new genus, with the type species Burkholderia ... Yabuuchi, E.; Kosako, Y.; Yano, I.; Hotta, H.; Nishiuchi, Y. (1995). "Transfer of two Burkholderia and an Alcaligenes species ... outras cepas antes clasificadas no xénero Pseudomonas están agora clasificadas no xénero Burkholderia e Ralstonia.[12][13] ...
Fresh-water bacterial infections include Aeromonas hydrophila, Burkholderia pseudomallei causing melioidosis, leptospira ...
Burkholderia pseudomallei (Melioidosis) · Burkholderia mallei (Glanders) · Burkholderia cepacia complex · Bordetella pertussis/ ...
Burkholderia pseudomallei. *Cryptosporidium parvum. *Giardia lamblia. *Salmonella. *Norovirus and other viruses. *Parasitic ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei *Melioidosis. *Burkholderia mallei *Glanders. *Burkholderia cepacia complex. *Bordetella pertussis/ ...
Burkholderia pseudomallei. *Chlamydophila psittaci. *Coxiella burnetii. *Ebola. *Equine encephalitis (Eastern. *Western. * ...
... and Burkholderia pseudomallei selective agar for clinical isolation of Burkholderia pseudomallei". Journal of Clinical ... Burkholderia pseudomallei (also known as Pseudomonas pseudomallei) is a Gram-negative, bipolar, aerobic, motile rod-shaped ... 2011). "Rapid identification of Burkholderia pseudomallei and Burkholderia mallei by fluorescence in situ hybridization (FISH) ... Pathema Burkholderia resource "Burkholderia pseudomallei". NCBI Taxonomy Browser. 28450. ...
Specimens suspected of containing Burkholderia pseudomallei should be clearly labeled as "suspected Burkholderia pseudomallei" ... This information is being provided at the request of the CDC subject-matter experts for Burkholderia pseudomallei. ... For additional information on Burkholderia pseudomallei refer to the ASM Sentinel Level Clinical Laboratory Guidelines. ... Notes Regarding Identification of B. pseudomallei: *Culture of B. pseudomallei from any clinical specimen is considered ...
Burkholderia pseudomallei in Southwestern United States A recently published case of melioidosis in a Texas resident has ... Contact your state LRN for assistance with rule-out of pseudomallei.. For more information, visit CDCs melioidosis website or ... Laboratory staff who may have been exposed to B. pseudomallei should refer to existing CDC guidance. For information about ... increased concerns that Burkholderia pseudomallei, the bacteria that causes this rare disease, may be present in soil and water ...
Burkholderia pseudomallei str. MSHR346. › Burkholderia pseudomallei strain MSHR346. Rank i. -. Lineage i. › cellular organisms ...
Burkholderia pseudomallei: Brief Summary provided by wikipedia EN Burkholderia pseudomallei (also known as Pseudomonas ... and Burkholderia pseudomallei selective agar for clinical isolation of Burkholderia pseudomallei. Journal of Clinical ... Burkholderia pseudomallei (also known as Pseudomonas pseudomallei) is a Gram-negative, bipolar, aerobic, motile rod-shaped ... 2011). Rapid identification of Burkholderia pseudomallei and Burkholderia mallei by fluorescence in situ hybridization (FISH) ...
DUF1929 domain-containing protein [Burkholderia pseudomallei] DUF1929 domain-containing protein [Burkholderia pseudomallei]. gi ... DUF1929 domain-containing protein [Burkholderia pseudomallei]. NCBI Reference Sequence: WP_004549088.1. Identical Proteins ...
... Taksaon Duangurai,1,2 Nitaya Indrawattana,1 and ... Burkholderia pseudomallei is a Gram-negative bacterium that causes melioidosis, which can be fatal in humans. Melioidosis is ... This review provides an overview of the survival and adaptation of B. pseudomallei to stressful conditions induced by hostile ... The adaptation of B. pseudomallei in host cells is also reviewed. The adaptive survival mechanisms of this pathogen mainly ...
... pseudomallei strain 08 and Burkholderia thailandensis, a non-pathogenic relative of B. pseudomallei, indicates that GIs are key ... Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Matthew T. G. Holden, Richard W. Titball, ... Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Matthew T. G. Holden, Richard W. Titball, ... Burkholderia pseudomallei is a recognized biothreat agent and the causative agent of melioidosis. This Gram-negative bacterium ...
Cross-Species Comparison of the Burkholderia pseudomallei, Burkholderia thailandensis, and Burkholderia mallei Quorum-Sensing ... Targeted Mutagenesis of Burkholderia thailandensis and Burkholderia pseudomallei through Natural Transformation of PCR ... pseudomallei strain 08 and Burkholderia thailandensis, a non-pathogenic relative of B. pseudomallei, indicates that GIs are key ... Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Matthew T. G. Holden, Richard W. Titball, ...
R. Balder, S. Lipski, J. J. Lazarus et al., "Identification of Burkholderia mallei and Burkholderia pseudomallei adhesins for ... Y. Song, C. Xie, Y. M. Ong, Y. H. Gan, and K. L. Chua, "The BpsIR quorum-sensing system of Burkholderia pseudomallei," Journal ... D. A. Rholl, L. A. Trunck, and H. P. Schweizer, "In vivo Himar1 transposon mutagenesis of Burkholderia pseudomallei," Applied ... A. Tuanyok, B. R. Leadem, R. K. Auerbach et al., "Genomic islands from five strains of Burkholderia pseudomallei," BMC Genomics ...
Burkholderia pseudomallei Description and significance. Burkholderia pseudomallei is a gram-negative bacterium with dimensions ... Burkholderia pseudomallei is a human and animal pathogen and is the cause of melioidosis, which is a disease native to ... Burkholderia pseudomallei is significant in its role of causing a disease known as melioidosis, which currently doesnt have a ... Burkholderia pseudomallei is thought to have biological warfare potential and its virulence is made evident by being listed as ...
Burkholderia Pseudomallei Genome Project. Burkholderia pseudomallei, the causative agent of the infectious disease melioidosis ... pseudomallei strains as well as between various bacteriophages harbored within B. pseudomallei. All data will be released ... pseudomallei strains from various geographic and clinical sources. Variable horizontal gene acquisition by B. pseudomallei is ... NIH-NIAID has funded this genome project to sequence nine phenotypically characterized strains of B. pseudomallei, as well as ...
Detection of Burkholderia pseudomallei in blood samples using polymerase chain reaction.. Rattanathongkom A1, Sermswan RW, ... A highly sensitive, specific, rapid and simple method to detect Burkholderia pseudomallei in blood samples was developed. Two ... pseudomallei. As little as 0.5 fg of B. pseudomallei DNA was detectable by this method. Experiments involving inoculation of ...
Burkholderia pseudomallei (Pseudomonas pseudomallei)Imported. Automatic assertion inferred from database entriesi ... tr,A0A069AXT4,A0A069AXT4_BURPE Formamidopyrimidine-DNA glycosylase OS=Burkholderia pseudomallei OX=28450 GN=mutM PE=3 SV=1 ... cellular organisms › Bacteria › Proteobacteria › Betaproteobacteria › Burkholderiales › Burkholderiaceae › Burkholderia › ...
Å resolution crystal structure of a BpaA TAA head domain from Burkholderia pseudomallei, the pathogen that causes melioidosis. ... Methodology/Principal Findings Pathogenic species of Burkholderia contain an overabundance of TAAs, some of which have been ...
... pseudomallei strains has been reported previously. In this study, a comprehensive 16S rDNA-based phylogenetic analysis further ... The presence of a Burkholderia pseudomallei-like species based upon the significant genotypic and phenotypic dissimilarities ... Burkholderia thailandensis sp. nov., a Burkholderia pseudomallei-like species Int J Syst Bacteriol. 1998 Jan;48 Pt 1:317-20. ... The presence of a Burkholderia pseudomallei-like species based upon the significant genotypic and phenotypic dissimilarities ...
Methane metabolism - Burkholderia pseudomallei 1710b [ Pathway menu , Organism menu , Pathway entry , Download KGML , Show ...
Secretion System - Burkholderia pseudomallei 1710b. [ Brite menu , Organism menu , Download htext , Download json ] ...
... and Burkholderia mallei (Bm), the etiologic agents of melioidosis and glanders, respectively, cause severe disease in both ... Burkholderia pseudomallei (Bp) and Burkholderia mallei (Bm), the etiologic agents of melioidosis and glanders, respectively, ... Bondi, S. & Goldberg, J. Strategies toward vaccines against Burkholderia mallei and Burkholderia pseudomallei. Expert Rev. ... Revised structures for the predominant O-polysaccharides expressed by Burkholderia pseudomallei and Burkholderia mallei. ...
ABSTRACT: BACKGROUND: Burkholderia pseudomallei is a soil-dwelling saprophyte and the cause of melioidosis. Horizontal gene ... pseudomallei. In silico analysis of 10 B. pseudomallei genome sequences provided evidence for the variable presence of these ... Although there is some evidence for the variable distribution of genomic islands in B. pseudomallei isolates, little is known ... RESULTS: Five islands from B. pseudomallei strain K96243 were chosen as representatives of different types of genomic islands ...
Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is ... Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei Nat Rev Microbiol. 2006 Apr;4(4):272-82. doi: 10.1038 ... Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is ...
The BpsIR Quorum-Sensing System of Burkholderia pseudomallei. Yan Song, Chao Xie, Yong-Mei Ong, Yunn-Hwen Gan, Kim-Lee Chua ... The BpsIR Quorum-Sensing System of Burkholderia pseudomallei Message Subject (Your Name) has forwarded a page to you from ... The PmlI-PmlR quorum-sensing system in Burkholderia pseudomallei plays a key role in virulence and modulates production of the ... Characterization of Burkholderia pseudomallei infection and identification of novel virulence factors using a Caenorhabditis ...
Burkholderia vietnamiensis, Burkholderia multivorans, Burkholderia stabilis, and Burkholderia cepacia genomovars I and III. J ... Burkholderia pseudomallei is an important pathogen in people living in endemic areas of northern Australia and south east Asia ... Background:Burkholderia pseudomallei is an important cause of acute fulminant pneumonia and septicaemia in tropical regions of ... Dharakul T, Tassaneetrithep B, Trakulsomboon S, et al. Phylogenetic analysis of Ara+ and Ara− Burkholderia pseudomallei ...
Burkholderia pseudomallei 1710b. Mutation(s): 0 Gene Names: ahcY, BURPS1710b_0057. EC: 3.3.1.1. ... Crystal structure of S-adenosyl-L-homocysteine hydrolase from Burkholderia pseudomallei. *DOI: 10.2210/pdb3D64/pdb ... Crystal structure of S-adenosyl-L-homocysteine hydrolase from Burkholderia pseudomallei.. Seattle Structural Genomics Center ...
... pseudomallei infection would be helpful to improve treatment of this severe illness. Osteopontin (OPN) is a cytokine that is ... pseudomallei. In northeast Thailand infection with this bacterium is the major cause of community-acquired septicemia with a ... Author Summary Melioidosis is a severe tropical disease caused by infection with the bacterium Burkholderia (B.) ...
Melioidosis caused by the environmental gram-negative bacillus Burkholderia pseudomallei, is classically characterized by ... New insights into Burkholderia pseudomallei infection (melioidosis). International Congress on Bacteriology & Infectious ... Melioidosis caused by the environmental gram-negative bacillus Burkholderia pseudomallei, is classically characterized by ... with a special interest Burkholderia pseudomallei and Salmonella typhi infection and the role of diabetes as well as the gut ...
Cutaneous melioidosis and necrotizing fasciitis caused by Burkholderia pseudomallei.(Dispatches) by Emerging Infectious ... APA style: Cutaneous melioidosis and necrotizing fasciitis caused by Burkholderia pseudomallei.. (n.d.) >The Free Library. ( ... MLA style: "Cutaneous melioidosis and necrotizing fasciitis caused by Burkholderia pseudomallei.." The Free Library. 2003 U.S. ... Melioidosis is a disease caused by a gram-negative bacterium, Burkholderia pseudomallei. Endemic to Southeast Asia, Taiwan, ...
Cellular fatty acid profile distinguishes Burkholderia pseudomallei from avirulent Burkholderia thailandensis. J. Clin. ... The B. pseudomallei-specific PCR status of all isolates was confirmed prior to their entry in the Burkholderia Culture ... Comparison of Diagnostic Laboratory Methods for Identification of Burkholderia pseudomallei. Timothy J. J. Inglis, Adam Merritt ... Comparison of Diagnostic Laboratory Methods for Identification of Burkholderia pseudomallei. Timothy J. J. Inglis, Adam Merritt ...
  • Routine biochemical methods for identification of bacteria vary widely in their identification of this organism: the API 20NE system accurately identifies B. pseudomallei in 99% of cases, as does the automated Vitek 1 system, but the automated Vitek 2 system only identifies 19% of isolates. (wikipedia.org)
  • The majority of B. pseudomallei isolates are intrinsically resistant to all aminoglycosides (via an efflux pump mechanism), but sensitive to co-amoxiclav: this pattern of resistance almost never occurs in P. aeruginosa and is helpful in identification. (wikipedia.org)
  • Amplification with these primers yielded a 178-base pair product in 100 clinical isolates of B. pseudomallei. (nih.gov)
  • Although there is some evidence for the variable distribution of genomic islands in B. pseudomallei isolates, little is known about the extent of variation between related strains or their association with disease or environmental survival. (jcvi.org)
  • The 95 isolates studied included 71 B. pseudomallei and 3 B. thailandensis isolates. (asm.org)
  • The API 20NE method identified only 37% of the B. pseudomallei isolates. (asm.org)
  • Gas-liquid chromatography analysis of bacterial fatty acid methyl esters (GLC-FAME) identified 98% of the B. pseudomallei isolates. (asm.org)
  • On the basis of these results, the most robust B. pseudomallei discovery pathway combines the previously recommended isolate screening tests (Gram stain, oxidase test, gentamicin and polymyxin susceptibility) with monoclonal antibody agglutination on primary culture, followed by a repeat after 24 h incubation on agglutination-negative isolates and GLC-FAME analysis. (asm.org)
  • The overall goal of this project is to forensically characterize 100 unknown Burkholderia isolates in the US-Australia collaboration. (osti.gov)
  • We will design microarray probes to detect these SNP markers and analyze 100 Burkholderia genomic DNAs extracted from environmental, clinical and near neighbor isolates from Australian collaborators on the Burkholderia SNP microarray. (osti.gov)
  • Multilocus sequence typing of seven isolates of Burkholderia pseudomallei from India showed considerable diversity, with six different sequence types. (ajtmh.org)
  • We sequenced the 1.5-kb 16S rRNA gene of 56 B. pseudomallei and 23 B. mallei isolates selected to represent a wide range of temporal, geographic, and origin diversity. (unboundmedicine.com)
  • Nine 16S types were identified in B. pseudomallei isolates based on six positions of difference, with differences ranging from 0.5 to 1.5 bp. (unboundmedicine.com)
  • Here we report on the development of a discriminatory real-time assay for the rapid identification of Burkholderia pseudomallei isolates and the evaluation of this assay for sensitivity against related species and detection in spiked human blood samples. (asm.org)
  • Assay performance was evaluated with 224 geographically, temporally, and clinically diverse B. pseudomallei isolates from the Centers for Disease Control and Prevention strain collection. (asm.org)
  • Furthermore, some biochemical identification methods for culture isolates are problematic, especially rapid biochemical assays which have been shown to misidentify B. pseudomallei as other bacteria such as Pseudomonas spp. (asm.org)
  • Genomic diversity of Burkholderia pseudomallei clinical isolates: subtractive hybridization reveals a Burkholderia mallei-specific prophage in B. pseudomallei 1026b. (semanticscholar.org)
  • To determine whether strain populations of B. pseudomallei prevalent in soil are gentypically related to strains causing clinical disease, rRNA Bam HI restriction fragment length polymorphisms (RFLP) of 139 soil environmental isolates and 228 human isolates were compared. (microbiologyresearch.org)
  • The biochemical characteristics of 213 isolates of Burkholderia pseudomallei from patients with melioidosis and 140 isolates from the soil in central and northeastern Thailand were compared. (microbiologyresearch.org)
  • In order to exclude the possibility of a single source, including the possibility of intentional release of Burkholderia pseudomallei, we applied a multiplex PCR-based multilocus variable-number tandem repeat (VNTR) assay to determine the clonality of the clinical isolates. (semanticscholar.org)
  • 2013 ). The present study was undertaken to attempt the isolation of B. pseudomallei from the coastal rice cultivating areas of Tamil Nadu, India to confirm the identity of isolates by conventional and molecular methods. (springeropen.com)
  • In this study, the adherence and persistence of several B. pseudomallei clinical isolates were compared to that of B. thailandensis within both amoeba and a human monocyte cell line. (byu.edu)
  • Results showed that B. pseudomallei isolates can enter amoeba and survive therein at varying levels of efficiency. (byu.edu)
  • Optimal entry time into an amoeba trophozoite was found to be about three hours for all ten B. pseudomallei isolates. (byu.edu)
  • Interestingly, it was found that after internalization by amoeba, B. pseudomallei have a significantly increased ability to both attach to, and grow within human monocytes, suggesting that such interactions increase the virulence capabilities of soil isolates. (byu.edu)
  • Moreover, the metabolites were able to kill drug resistant isolates of B. pseudomallei and also inhibit other pathogenic bacteria such as Staphylococcus aureus , Escherichia coli and Acinetobacter baumannii but not the non-pathogenic Burkholderia thailandensis , which is closely related to B. pseudomallei . (springeropen.com)
  • When either N2-4 or N3-8 isolates was co-cultured with B. pseudomallei the numbers of the bacteria decreased by 5 log 10 within 72 h. (springeropen.com)
  • Although the sequence of AhpC is virtually invariant among global B. pseudomallei clinical isolates, a Cambodian isolate varies only in C-terminal truncation of the p6 T cell epitope, raising the possibility of selection by host immunity. (st-andrews.ac.uk)
  • B. pseudomallei identification requires a great deal of clinical suspicion as well as alertness on the part of the medical microbiologist as these isolates are often reported as Pseudomonas spp. (biomedcentral.com)
  • Recently, we reported that a subset of clinical isolates of B. pseudomallei from Australia have heightened virulence and potential for dissemination to the central nervous system. (edu.au)
  • Compared with B. pseudomallei isolates having typical bimA alleles, isolates that contain the B. mallei-like variation demonstrate increased persistence in phagocytic cells and increased virulence with rapid systemic dissemination and replication within multiple tissues, including the brain and spinal cord, in an experimental model. (edu.au)
  • NIH-NIAID has funded this genome project to sequence nine phenotypically characterized strains of B. pseudomallei , as well as 25 B. pseudomallei bacteriophage genomes isolated from 48 different B. pseudomallei strains from various geographic and clinical sources. (jcvi.org)
  • The goal of this project is to identify the specific nucleotide sequences and/or single nucleotide polymorphisms that are correlated with expression of virulence and disease via comparative genomic analysis between B. pseudomallei strains as well as between various bacteriophages harbored within B. pseudomallei . (jcvi.org)
  • The presence of a Burkholderia pseudomallei-like species based upon the significant genotypic and phenotypic dissimilarities exhibited between these organisms and true B. pseudomallei strains has been reported previously. (nih.gov)
  • We compared three methods of confirming the identity of presumptive B. pseudomallei strains using a collection of Burkholderia species drawn from diverse geographic, clinical, and environmental sources. (asm.org)
  • Practical difficulties for the diagnostic laboratory include the presence of closely related Burkholderia species in specimens from nonsterile sites and atypical colony morphology of some B. pseudomallei strains ( 4 ). (asm.org)
  • Possible dissemination of melioidosis by historical trading routes is supported by links to strains from Southeast Asia, China, and Africa and the presence of the Burkholderia mallei allele of the bimA gene. (ajtmh.org)
  • In the present study, type A O-polysaccharide (OPS) and manno -heptose capsular polysaccharide (CPS) antigens were isolated from nonpathogenic, select-agent-excluded strains of B. pseudomallei and covalently linked to carrier proteins. (asm.org)
  • Antibiotic-resistant B. pseudomallei strains are known to emerge during the treatment of melioidosis. (asm.org)
  • Such chloramphenicol- and ceftazidime-resistant B. pseudomallei strains were found to be fully virulent and frequently showed cross-resistance to other antimicrobials such as tetracyclines, sulfamethoxazole, trimethoprim, and ciprofloxacin ( 7 ). (asm.org)
  • All of the mucoid and nonmucoid B. pseudomallei strains tested from geographically different tropical regions were recognized by MAb 3015 in an enzyme-linked immunosorbent assay or immunoblot, indicating that the exopolysaccharide is constitutively expressed among this species. (asm.org)
  • In this work, we evaluated the protective efficacy of OMV immunization against intraperitoneal challenge with a heterologous strain because systemic infection with phenotypically diverse environmental B. pseudomallei strains poses another hazard and a challenge to vaccine development. (asm.org)
  • During routine screening for Burkholderia pseudomallei from water wells in northern Australia in areas where it is endemic, Gram-negative bacteria (strains MSMB43 T , MSMB121, and MSMB122) with a similar morphology and biochemical pattern to B. pseudomallei and B. thailandensis were coisolated with B. pseudomallei on Ashdown's selective agar. (asm.org)
  • To determine the exact taxonomic position of these strains and to distinguish them from B. pseudomallei and B. thailandensis , they were subjected to a series of phenotypic and molecular analyses. (asm.org)
  • B. pseudomallei strains are intrinsically resistant to a broad spectrum of antibiotics, a feature that can often complicate the treatment of melioidosis ( 14 ). (pubmedcentralcanada.ca)
  • The assay permits differentiation of B. mallei and B. pseudomallei strains, and probit analysis showed a very low detection limit. (biomedcentral.com)
  • Although the phenotypic characteristics suggested that the bacterium could be Burkholderia pseudomallei, the Vitek 1 system (GNI+), which can successfully identify 99% of B. pseudomallei strains, showed that the bacterium was "unidentified. (hku.hk)
  • These findings suggest that B. pseudomallei strains that utilise arabinose constitute a population that is genetically distinct from other environmental and clinical strains. (microbiologyresearch.org)
  • Burkholderia thailandensis ( Bt ) is an attenuated bacterium that is closely related to Bp but most strains lack a capsular polysaccharide, among other genomic and virulence factor differences, that do not make it an ideal biosafe surrogate [ 6 ]. (biomedcentral.com)
  • The most dramatic consequence was seen at Sappasitprasong Hospital in Ubon Ratchathani where over 100 strains of B. pseudomallei are isolated each year. (bvsalud.org)
  • In this study, the anti-B. pseudomallei efficacy of a new monosulfactam, BAL30072, was tested against laboratory strains 1026b and 1710b and several isogenic mutant derivatives as well as a collection of clinical and environmental B. pseudomallei strains from Thailand. (elsevier.com)
  • It has been shown that closely related cystic fibrosis-associated Burkholderia species respond to trimethoprim with differing levels of expression of various secondary metabolites, highlighting the personalized nature of metabolomics in related bacterial strains. (wikipedia.org)
  • MALDI-TOF, 16s, VITEK-2) may misidentify B. pseudomallei as another bacterium, such as occurred with the case in TX, where the isolate was initially misidentified as Burkholderia thailandensis by MALDI-TOF. (cdc.gov)
  • Genomic patterns of pathogen evolution revealed by comparison of Burkholderia pseudomallei , the causative agent of melioidosis, to avirulent Burkholderia thailandensis ," BMC Microbiology , vol. 6, article 46, 2006. (hindawi.com)
  • Burkholderia thailandensis sp. (nih.gov)
  • In this study, a comprehensive 16S rDNA-based phylogenetic analysis further supports the existence of this newly described Burkholderia species for which the name Burkholderia thailandensis sp. (nih.gov)
  • Mice immunized with LPS from Bp , and from the non-pathogenic Burkholderia thailandensis ( Bt ), developed high-titer immunoglobulin G (IgG) responses and were partially protected against lethal challenges of Bp 29 , 30 . (nature.com)
  • An alternative approach uses bacterial fatty acid methyl ester (FAME) profile analysis by gas-liquid chromatography (GLC) to detect a cellular fatty acid profile that distinguished B. pseudomallei from B. thailandensis ( 5 ). (asm.org)
  • We will identify genome-wide single nucleotide polymorphisms (SNPs) from B. pseudomallei and near neighbor species including B. mallei, B. thailandensis and B. oklahomensis. (osti.gov)
  • This represents the first real-time PCR for rapid and sensitive identification of B. pseudomallei that has been tested for cross-reactivity with 23 Burkholderia mallei , 5 Burkholderia thailandensis , and 35 Burkholderia and 76 non -Burkholderia organisms which have historically presented diagnostic challenges. (asm.org)
  • We developed a high-throughput cell-based phenotypic assay and screened ∼220,000 small molecules for their ability to disrupt intercellular spread by Burkholderia thailandensis, a closely related BSL-2 surrogate. (caltech.edu)
  • Lane 1 - B. pseudomallei K96243, 2 - B. thailandensis E264, 3 - B. oklahomensis E0147, 4 - B. pseudomallei 576, 5 - B. ubonensis MSMB57, 6 - B. pseudomallei MSHR840, 7 - B. thailandensis 82172, 8 - B. thailandensis -like MSMB122, 9 - B. ubonensis MSMB108, 10 - Burkholderia sp. (biomedcentral.com)
  • 1969 ). The description of B. thailandensis, a non-virulent but closely related species present in the soil, has made the isolation and characterization of B. pseudomallei from soil very challenging (Brett et al. (springeropen.com)
  • In Burkholderia species, certain antibiotics such as trimethoprim has been shown to induce and upregulate a large amount of the metabolome, inducing over 100 silent secondary metabolite gene clusters in Burkholderia thailandensis. (wikipedia.org)
  • Research focused on interbacterial signaling using Burkholderia has shown that contact-dependent growth inhibition plays a significant role in mediating cell to cell communication specifically in B. thailandensis. (wikipedia.org)
  • ABSTRACT: BACKGROUND: Burkholderia pseudomallei is a soil-dwelling saprophyte and the cause of melioidosis. (jcvi.org)
  • Burkholderia pseudomallei is a recognized biothreat agent and the causative agent of melioidosis. (pnas.org)
  • Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei ," Proceedings of the National Academy of Sciences of the United States of America , vol. 101, pp. 14240-14245, 2004. (hindawi.com)
  • Burkholderia pseudomallei is a potential bioterror agent and the causative agent of melioidosis, a severe disease that is endemic in areas of Southeast Asia and Northern Australia. (nih.gov)
  • Burkholderia pseudomallei , a gram-negative soil bacillus, is the causative agent of melioidosis, a severe and potentially fatal emerging tropical infectious disease. (asm.org)
  • Burkholderia pseudomallei , the etiologic agent of melioidosis, is a CDC tier 1 select agent that causes severe disease in both humans and animals. (asm.org)
  • Of note, the B. mallei cannot persist in the environment outside its host (unlike B. pseudomallei -the agent of melioidosis). (centerforhealthsecurity.org)
  • The environmental Gram-negative encapsulated bacillus Burkholderia pseudomallei is the causative agent of melioidosis, a disease associated with high morbidity and mortality rates in areas of Southeast Asia and northern Australia in which the disease is endemic. (asm.org)
  • Burkholderia pseudomallei is a Gram-negative, encapsulated, facultative, intracellular bacillus and the causative agent of melioidosis, a major public health concern in the regions of Southeast Asia and northern Australia in which the disease is endemic ( 1 ). (asm.org)
  • Burkholderia pseudomallei is a Gram-negative facultative intracellular bacterium and the causative agent of melioidosis, a severe infectious disease found throughout the tropics. (asm.org)
  • Burkholderia pseudomallei , the etiological agent of melioidosis, is a saprophytic bacterium existing endemically in the water and soil of SE Asia and Northern Australia. (byu.edu)
  • Burkholderia pseudomallei is the causative agent of melioidosis, which is considered a potential deliberate release agent. (ox.ac.uk)
  • Burkholderia pseudomallei is an intrinsically antibiotic-resistant Category B priority pathogen and the aetiological agent of melioidosis. (elsevier.com)
  • There is an urgent need for a better understanding of adaptive immunity to Burkholderia pseudomallei, the causative agent of melioidosis that is frequently associated with sepsis or death in patients in Southeast Asia and Northern Australia. (st-andrews.ac.uk)
  • Here we describe the 7.25-megabase pair (Mb) genome of B. pseudomallei strain K96243, isolated from a case of human melioidosis. (pnas.org)
  • B. pseudomallei strain K96243 was isolated in 1996 from a 34-year-old female diabetic patient in Khon Kaen hospital in Thailand. (pnas.org)
  • RESULTS: Five islands from B. pseudomallei strain K96243 were chosen as representatives of different types of genomic islands present in this strain, and their presence investigated in other B. pseudomallei. (jcvi.org)
  • The B. pseudomallei K96243 genome contains 11 predicted ATs, eight of which share homologs in the B. mallei ATCC 23344 genome. (frontiersin.org)
  • We demonstrated that B. pseudomallei OMVs derived from strain 1026b afforded significant protection against septicemic infection with B. pseudomallei strain K96243. (asm.org)
  • C57BL/6 mice were vaccinated intranasally with the live attenuated PBK001 strain and then challenged with wild-type B. pseudomallei K96243 by the aerosol route. (asm.org)
  • Burkholderia pseudomallei is a Gram-negative bacterium that causes melioidosis, which can be fatal in humans. (hindawi.com)
  • Burkholderia pseudomallei is a gram-negative bacterium with dimensions 2-5μm in length and .4-.8μm in diameter in the shape of a rod. (kenyon.edu)
  • B urkholderia pseudomallei , the causative organism of melioidosis, is an endemic Gram negative bacterium found in soil and water in northern Australia and south east Asia. (bmj.com)
  • Melioidosis is a disease caused by a gram-negative bacterium, Burkholderia pseudomallei. (thefreelibrary.com)
  • Infection with the gram-negative bacterium Burkholderia pseudomallei can result in a life-threatening disease known as melioidosis. (health.mil)
  • Melioidosis is a potentially lifethreatening disease caused by the gram-negative bacterium Burkholderia pseudomallei . (health.mil)
  • Burkholderia pseudomallei is a gram-negative bacterium that causes the disease known as melioidosis. (pubmedcentralcanada.ca)
  • Melioidosis is an emerging infectious disease caused by a free living soil dwelling Gram-negative bacterium Burkholderia pseudomallei . (springeropen.com)
  • Melioidosis is a bacterial infection caused by Burkholderia pseudomallei , an environmental Gram-negative saprophyte present in wet soil and rice paddies in endemic areas ( 1 - 3 ). (pnas.org)
  • S. L. Reckseidler, D. DeShazer, P. A. Sokol, and D. E. Woods, "Detection of bacterial virulence genes by subtractive hybridization: Identification of capsular polysaccharide of Burkholderia pseudomallei as a major virulence determinant," Infection and Immunity , vol. 69, no. 1, pp. 34-44, 2001. (hindawi.com)
  • In order to ascertain whether a blockage in the efflux mechanism, an inhibition of acyl-HSL synthesis, or both had contributed to the absence of extracellular acyl-HSLs in the bpeAB mutant, we compared the acyl-HSLs produced in cell supernatants of B. pseudomallei before and after the bacterial cells were permeabilized by a freeze-thaw procedure. (asm.org)
  • Of the remaining eight predicted B. pseudomallei trimeric autotransporters, five of which are also present in B. mallei , two (BoaA and BoaB), have been implicated in bacterial adhesion to epithelial cells. (frontiersin.org)
  • 3 The true global distribution of B. pseudomallei and the incidence of melioidosis remain poorly understood, and it is not yet known if the growing number of melioidosis cases reported worldwide reflects an unmasking of long-standing bacterial presence or the spread of B. pseudomallei to previously unaffected areas. (health.mil)
  • Glanders and melioidosis are infectious diseases caused by species of the bacterial genus Burkholderia . (centerforhealthsecurity.org)
  • Bacterial conversion of 5-FC to 5-fluorouracil and subsequently to fluorouridine monophosphate is required for potent and selective activity against intracellular Burkholderia. (caltech.edu)
  • OMV-immune serum promoted bacterial killing in vitro , and passive transfer of B. pseudomallei OMV immune sera protected naive mice against a subsequent challenge. (asm.org)
  • Burkholderia pseudomallei Capsule Exacerbates Respiratory Melioidosis but Does Not Afford Protection against Antimicrobial Signaling or Bacterial Killing in Human Olfactory Ensheathing Cells. (semanticscholar.org)
  • Thus, the T cell response to primary B. pseudomallei infection is biphasic, an early cytokine-induced phase in which T cells appear to be functionally redundant for initial bacterial clearance, followed by a later antigen-induced phase in which B. pseudomallei -specific T cells, in particular CD4 + T cells, are important for host resistance. (edu.au)
  • 16S rDNA sequencing, B. pseudomallei specific PCR, fli C gene RFLP and MALDI-TOF mass spectrometry based bacterial identification. (springeropen.com)
  • and non -Burkholderia bacterial and fungal species of clinical and environmental relevance. (edu.au)
  • Burkholderia pseudomallei is a serious bacterial pathogen that can cause a lethal infection in humans known as melioidosis. (microbiologyresearch.org)
  • Acai PS dramatically reduced the replication of B. pseudomallei in the lung and blocked bacterial dissemination to the spleen and liver. (openaire.eu)
  • Recently, research in Burkholderia species has investigated a range of topics and characteristics including metabolomic response to antibiotics, contact-dependent interactions between bacterial communities, and genomic potential to yield beneficial products. (wikipedia.org)
  • international travel, the disease is now occurring in https://doi.org/10.1016/j.jiac.2019.06.013 areas to which B . pseudomallei is not endemic. (cdc.gov)
  • Subacute and chronic forms of the disease also occur, albeit more commonly in non-endemic regions, and B pseudomallei is capable of causing pyogenic or granulomatous infection in virtually any tissue. (bmj.com)
  • Even in locations such as Southeast Asia and northern Australia where melioidosis is endemic, a preponderance of septicemic cases during the wet season results in a low expectation of B. pseudomallei in clinical specimens at other times of year ( 1 ). (asm.org)
  • This rapid assay is a valuable tool for identification of B. pseudomallei and may improve diagnosis in regions endemic for melioidosis. (asm.org)
  • Due to the potential malicious use of B. pseudomallei as well as its impact on public health in regions where the disease is endemic, there is significant interest in developing vaccines for immunization against this disease. (asm.org)
  • Burkholderia pseudomallei is the causative agent of the disease melioidosis, which is endemic in the tropics and a concern elsewhere as a biological warfare agent. (openthesis.org)
  • Pathogenic Burkholderia are endemic in many regions worldwide and cases of infection, sometimes brought by travelers from unsuspected regions, also occur elsewhere. (biomedcentral.com)
  • In this study, Bacillus amyloliquefaciens N2-4 and N3-8 were isolated from soil and their metabolites could kill Burkholderia pseudomallei, a Gram-negative pathogenic bacterium also found in soil in its endemic areas. (springeropen.com)
  • The causative agent is B. pseudomallei, a Gram-negative bacteria which can be found in soil and water in endemic areas (Cheng and Currie 2005 ). (springeropen.com)
  • An outbreak in 2003 in the state of Ceara, Brazil, resulted in subsequent surveillance and environmental sampling which led to the recognition of B. pseudomallei as an endemic pathogen in that area. (cdc.gov)
  • The gram-negative bacteria that causes melioidosis, B. pseudomallei, is classified as a Tier 1 Select Agent. (cdc.gov)
  • Burkholderia pseudomallei is a Gram-negative, facultative, intracellular pathogen that causes melioidosis, a serious and often fatal disease in humans and animals ( 1 ). (asm.org)
  • Infection with Burkholderia pseudomallei causes melioidosis, a disease with a high mortality rate (20% in Australia and 40% in Southeast Asia). (edu.au)
  • Burkholderia pseudomallei is present in the environment and is a facultative pathogen that causes melioidosis, a glanders-like disease. (biomedcentral.com)
  • The bacterium Burkholderia pseudomallei causes melioidosis, a rare but serious illness that can be fatal if untreated or misdiagnosed. (edu.au)
  • Burkholderia pseudomallei (also known as Pseudomonas pseudomallei) is a Gram-negative, bipolar, aerobic, motile rod-shaped bacterium. (wikipedia.org)
  • Even when the isolate is recognised to be significant, commonly used identification systems may misidentify the organism as Chromobacterium violaceum or other nonfermenting, Gram-negative bacilli such as Burkholderia cepacia or Pseudomonas aeruginosa. (wikipedia.org)
  • It is unclear how acyl-HSLs move across the B. pseudomallei cell membranes and into the extracellular compartment, although in Pseudomonas aeruginosa , the shorter-chain acyl-HSLs appear to do so by diffusion while the longer-chain acyl-HSLs are secreted by multidrug efflux pumps ( 1 , 15 ). (asm.org)
  • Purification and characterization of an exopolysaccharide of Burkholderia (Pseudomonas) pseudomallei. (asm.org)
  • Burkholderia pseudomallei (basonym Pseudomonas pseudomallei) is the causative organism of melioidosis, a disease which is recognized as a major public health problem primarily in Southeast Asia and Northern Australia. (asm.org)
  • Intensive testing for cross-reactivity including members of all the Pseudomonas rRNA groups showed no cross-reactivity except in the case of the closely related species Burkholderia mallei. (asm.org)
  • and Burkholderia cepacia, an important pathogen of pulmonary infections in people with cystic fibrosis (CF). The Burkholderia (previously part of Pseudomonas) genus name refers to a group of virtually ubiquitous Gram-negative, obligately aerobic, rod-shaped bacteria that are motile by means of single or multiple polar flagella, with the exception of Burkholderia mallei, which is nonmotile. (wikipedia.org)
  • Structural analysis of capsular polysaccharides expressed by Burkholderia mallei and Burkholderia pseudomallei. (semanticscholar.org)
  • Burkholderia pseudomallei is thought to have biological warfare potential and its virulence is made evident by being listed as a "Category B agent" by the US centers for Disease Control. (kenyon.edu)
  • BpsIR, a LuxIR quorum-sensing homolog, is required for optimal expression of virulence and secretion of exoproducts in Burkholderia pseudomallei . (asm.org)
  • Intercellular spread is a hallmark of Burkholderia pathogenesis, and its prominent ties to virulence make it an attractive therapeutic target. (caltech.edu)
  • These data suggested that PLCs contribute, at least in part, to B. pseudomallei virulence and support the view that Plc-1 and Plc-2 are not redundant virulence factors. (microbiologyresearch.org)
  • Moore, Emily Ann, "Interactions of Burkholderia pseudomallei and Acanthamoeba castellanii and Their Effects on Virulence in Human Monocytes" (2010). (byu.edu)
  • Type VI secretion is a major virulence determinant in Burkholderia mallei. (burkholderia.com)
  • This study confirms the utility of a range of approaches in defining the presence and significance of genomic variation in natural populations of B. pseudomallei. (jcvi.org)
  • The bpsI and bpsR fragments were amplified from B. pseudomallei KHW genomic DNA using the primer pairs BpsIF (5′AT CTGCAG ATGCGAACTTTCGTTCATGGC) and BpsIR (5′AT CTGCAG GAAATACCGTTGAATGGTCCA) and BpsRF (5′AT CTGCAG ATGGAACTGCGCTGGCAAGA) and BpsRR (5′AT CTGCAG TTACGGCGCGTCGATGAGCC), respectively(Fig. 1 ). (asm.org)
  • Using next-generation sequencing, multilocus sequence typing, and single nucleotide polymorphism analysis, we characterized the genomic diversity of this collection to better understand the population structure of B. pseudomallei associated with Ceara. (cdc.gov)
  • The classic textbook description of B. pseudomallei in clinical samples is of an intracellular, bipolar-staining, Gram-negative rod, but this is of little value in identifying the organism from clinical samples. (wikipedia.org)
  • Understanding the adaptations of this organism to environmental factors provides important insights into the survival and pathogenesis of B. pseudomallei , which may lead to the development of novel strategies for the control, prevention, and treatment of melioidosis in the future. (hindawi.com)
  • Burkholderia pseudomallei , the causative agent of the infectious disease melioidosis, is a CDC Category B biological threat agent, and occurs as a soil organism in Southeast Asia and Northern Australia. (jcvi.org)
  • Recent surveys, however, show that the organism is much more prevalent worldwide than previously believed, and isolation of B. pseudomallei from the environment and in clinical situations in parts of Africa, the Middle East, Europe and in Central and South America has been documented. (jcvi.org)
  • To gain insights into the host defense responses to B. pseudomallei infection within the context of a whole organism, we performed a genome-wide transcriptome analysis on infected Caenorhabditis elegans. (omicsonline.org)
  • This organism is closely related to Burkholderia mallei , the etiological agent of glanders disease which primarily affects equines. (asm.org)
  • Isolation of B. pseudomallei from a clinical specimen of a case of severe febrile illness: Culture of the organism may be done by blood, sputum, urine, pus, throat swab, or swabs from organ abscesses or wounds. (cdc.gov)
  • The genetically related Burkholderia mallei ( Bm ), the causative agent of glanders, primarily infects solipeds but can also lead to fatal infections in humans if left untreated 4 . (nature.com)
  • Because clinical manifestations are protean, the illness is difficult to diagnose, and cutaneous Burkholderia pseudomallei infections can progress to necrotizing fasciitis. (thefreelibrary.com)
  • This latest Pharmaceutical and Healthcare disease pipeline guide Burkholderia pseudomallei Infections - Pipeline Review, H1 2020, provides an overview of the Burkholderia pseudomallei Infections (Infectious Disease) pipeline landscape. (reportbuyer.com)
  • This Pharmaceutical and Healthcare latest pipeline guide Burkholderia pseudomallei Infections - Pipeline Review, H1 2020, provides comprehensive information on the therapeutics under development for Burkholderia pseudomallei Infections (Infectious Disease), complete with analysis by stage of development, drug target, mechanism of action (MoA), route of administration (RoA) and molecule type. (reportbuyer.com)
  • The Burkholderia pseudomallei Infections (Infectious Disease) pipeline guide also reviews of key players involved in therapeutic development for Burkholderia pseudomallei Infections (Melioidosis) and features dormant and discontinued projects. (reportbuyer.com)
  • Burkholderia pseudomallei Infections (Infectious Disease) pipeline guide helps in identifying and tracking emerging players in the market and their portfolios, enhances decision making capabilities and helps to create effective counter strategies to gain competitive advantage. (reportbuyer.com)
  • The pipeline guide provides a snapshot of the global therapeutic landscape of Burkholderia pseudomallei Infections (Infectious Disease). (reportbuyer.com)
  • The pipeline guide reviews pipeline therapeutics for Burkholderia pseudomallei Infections (Infectious Disease) by companies and universities/research institutes based on information derived from company and industry-specific sources. (reportbuyer.com)
  • The pipeline guide reviews key companies involved in Burkholderia pseudomallei Infections (Infectious Disease) therapeutics and enlists all their major and minor projects. (reportbuyer.com)
  • The pipeline guide evaluates Burkholderia pseudomallei Infections (Infectious Disease) therapeutics based on mechanism of action (MoA), drug target, route of administration (RoA) and molecule type. (reportbuyer.com)
  • Find and recognize significant and varied types of therapeutics under development for Burkholderia pseudomallei Infections (Infectious Disease). (reportbuyer.com)
  • Formulate corrective measures for pipeline projects by understanding Burkholderia pseudomallei Infections (Infectious Disease) pipeline depth and focus of Indication therapeutics. (reportbuyer.com)
  • The genus Burkholderia includes pathogenic gram-negative bacteria that cause melioidosis, glanders, and pulmonary infections of patients with cancer and cystic fibrosis. (rcsb.org)
  • B. pseudomallei infection can resemble a number of other infections including typhoid, tuberculosis, and malaria ( 45 ). (asm.org)
  • B. pseudomallei can be isolated from environmental niches such as rice paddies, still or stagnant waters, and moist soils, which predominate in the tropics ( 4 ), and it is believed that these habitats are the primary reservoirs from which susceptible hosts acquire infections. (asm.org)
  • Remarkably, 20% of all community-acquired septicemias in northeast Thailand and 32% of community-acquired bacteremic pneumonias in northern Australia are due to B. pseudomallei infections ( 8 , 9 ). (asm.org)
  • B. pseudomallei is a common cause of opportunistic infections in areas of endemicity, and individuals particularly susceptible include diabetics and those with renal disease ( 8 ). (pubmedcentralcanada.ca)
  • Distributed via the CDC Health Alert Network June 30, 2021, 2:30 PM ET CDCHAN-00444 The Kansas Department of Health and Environment, the Texas Department of State Health Services, and the Minnesota Department of Health, with assistance from the Centers for Disease Control and Prevention (CDC), are investigating three cases of Burkholderia pseudomallei (melioidosis) infections. (cdc.gov)
  • Nasal Acai polysaccharides potentiate innate immunity to protect against pulmonary Francisella tularensis and Burkholderia pseudomallei Infections. (openaire.eu)
  • Pulmonary Francisella tularensis and Burkholderia pseudomallei infections are highly lethal in untreated patients, and current antibiotic regimens are not always effective. (openaire.eu)
  • Several natural agonists were screened for their ability to enhance host resistance to infection, and polysaccharides derived from the Acai berry (Acai PS) were found to have potent abilities as an immunotherapeutic to treat F. tularensis and B. pseudomallei infections. (openaire.eu)
  • Collectively, these results demonstrate Acai PS is a potent innate immune agonist that can resolve F. tularensis and B. pseudomallei infections, suggesting this innate immune agonist has broad-spectrum activity against virulent intracellular pathogens. (openaire.eu)
  • Burkholderia mallei is closely related to B. pseudomallei and is the etiological agent of Glanders, an infectious equine disease that can be transmitted to humans. (frontiersin.org)
  • The work was undertaken to expand the tools available for researching Burkholderia pseudomallei ( Bp ), the etiological agent of the tropical disease melioidosis. (biomedcentral.com)
  • B. pseudomallei ( Bp ), the etiological agent of the disease melioidosis, is a Gram-negative rod typically found in soil and water environments throughout the tropics [ 1 ]. (biomedcentral.com)
  • We propose that variable horizontal gene acquisition by B. pseudomallei is an important feature of recent genetic evolution and that this has resulted in a genetically diverse pathogenic species. (pnas.org)
  • To date, the best characterized of the predicted ATs of B. pseudomallei and B. mallei is BimA, a predicted trimeric AT mediating actin-based motility which varies in sequence and mode of action between Burkholderia species. (frontiersin.org)
  • The assay targets a 115-base-pair region within orf2 of the B. pseudomallei type III secretion system gene cluster and distinguishes B. pseudomallei from other microbial species. (asm.org)
  • In this paper, we report on the identification, purification, and characterization of a species-specific exopolysaccharide of B. pseudomallei. (asm.org)
  • Burkholderia mallei and B. pseudomallei are two closely related species of highly virulent bacteria that can be difficult to detect. (biomedcentral.com)
  • The new assay permits rapid detection of pathogenic Burkholderia and combines enhanced sensitivity, species differentiation, and inclusion of an internal control for both DNA extraction and PCR amplification. (biomedcentral.com)
  • Two closely related Burkholderia species cause severe, potentially fatal disease in humans. (biomedcentral.com)
  • 1998 ). This species has similar colony morphology characteristics to B. pseudomallei on solid media and biochemical and molecular techniques are needed to distinguish between them. (springeropen.com)
  • 1997 ). Recently a review for the global presence and distribution of B. pseudomallei clearly indicates that isolation of this species from soil has not been reported from India, despite its isolation from human cases (Limmathurotsakul et al. (springeropen.com)
  • Species-specific PCR assays provide a technically simple method for differentiating B. pseudomallei from near-neighbor species. (edu.au)
  • However, substantial genetic diversity and high levels of recombination within this species reduce the likelihood that molecular signatures will differentiate all B. pseudomallei from other Burkholderiaceae. (edu.au)
  • Species specificity was validated across a large DNA panel (>2,300 samples) comprising Burkholderia spp. (edu.au)
  • The interactions of Burkholderia species and Acanthamoeba castellanii , a species of free-living amoeba, were studied to better understand the natural ecology of these organisms and to determine the effects amoeba interactions might have on pathogenesis. (byu.edu)
  • Until recently, the genus Burkholderia was inclusive of all Paraburkholderia species. (wikipedia.org)
  • However, the genus Paraburkholderia is phylogenetically distinct, and can be distinguished from all Burkholderia species on the basis of molecular signatures that are uniquely found for each genus. (wikipedia.org)
  • Burkholderia species form a monophyletic group within the Burkholderiales order of the Betaproteobacteria. (wikipedia.org)
  • These indels represent exclusive common ancestry shared among all Burkholderia species. (wikipedia.org)
  • Burkholderia species have been shown to be a potential source of beneficial products such as antimicrobials and biosurfactants. (wikipedia.org)
  • Km insertion mutants were derived from a local virulent isolate, B. pseudomallei KHW, by gene replacement using the suicide vector pJQ200mp18 as described previously ( 2 , 3 ). (asm.org)
  • Sequencing of the groEL gene showed that the isolate was B. pseudomallei. (hku.hk)
  • Currently available molecular assays for B. pseudomallei detection lack rigorous validation across large in silico datasets and isolate collections to test for specificity, and none have been subjected to stringent quality control criteria (accuracy, precision, selectivity, limit of quantitation (LoQ), limit of detection (LoD), linearity, ruggedness and robustness) to determine their suitability for environmental, clinical or forensic investigations. (edu.au)
  • Comparison of assay specificity to two previously published B. pseudomallei -specific assays, BurkDiff and TTS1, demonstrated comparable performance of all assays, providing between 99.7 and 100% specificity against our isolate panel. (edu.au)
  • The isolate was identified as B. pseudomallei by standard biochemical methods [ 3 ] and was found to be sensitive to ciprofloxacin and ceftazidime. (biomedcentral.com)
  • Further purification and characterization of the metabolites is required for future use of the bacteria or their metabolites as biological controls of B. pseudomallei in the environment or for development as new drugs for problematic pathogenic bacteria. (springeropen.com)
  • Burkholderia pseudomallei is a human and animal pathogen and is the cause of melioidosis, which is a disease native to Southeast Asia and northern Australia. (kenyon.edu)
  • B pseudomallei is emerging as a significant pathogen for patients with CF residing and holidaying in the tropics. (bmj.com)
  • He investigates the role and function of pathogen-recognition-receptors and innate immunity in sepsis, with a special interest Burkholderia pseudomallei and Salmonella typhi infection and the role of diabetes as well as the gut microbiota during sepsis. (omicsonline.org)
  • Her research group focuses on understanding the host-pathogen interaction of the tropical bacterium Burkholderia pseudomallei. (omicsonline.org)
  • Production of an effective vaccine against B. pseudomallei is challenging due to the multi-factorial nature of this pathogen. (frontiersin.org)
  • Burkholderia mallei is an obligate mammalian pathogen that causes glanders, a disease that is found in much of the world apart from North America, Europe and Australia. (biomedcentral.com)
  • Comparative analysis highlights the role that horizontal gene acquisition has played in the evolution of the genome and clarifies the genetic relationship of B. pseudomallei with Burkholderia mallei , the genome of which is described in an accompanying manuscript ( 10 ). (pnas.org)
  • CONCLUSIONS: Horizontal gene transfer of mobile genetic elements can rapidly alter the gene repertoire of B. pseudomallei. (jcvi.org)
  • In this study, we describe the identification in B. pseudomallei of the gene operon bpeR-bpeA-bpeB-oprB , which encodes a multidrug efflux system of the RND family. (asm.org)
  • Gene localization, substrate specificities, and proton gradient dependence distinguish the B. pseudomallei BpeAB-OprB efflux system from that of AmrAB-OprA, although both systems efflux aminoglycosides and macrolides. (asm.org)
  • As part of a larger systematic study on the autotransporters of Burkholderia pseudomallei, the causative agent of the severe tropical disease melioidosis, we have constructed an insertion mutant in the bpss1439 gene encoding an unstudied predicted trimeric autotransporter adhesin. (le.ac.uk)
  • Gene is part of a cluster known as the type VI secretion system gene cluster tss-5 used in much of the early P. pseudomallei literature (PMID:17660433) but later referred to as T6SS-1 cluster later (PMID:21670170, PMID:22007185) and by the B. mallei literature (PMID:22892068, PMID:17555434). (burkholderia.com)
  • Burkholderia pseudomallei and Burkholderia mallei are closely related Gram-negative bacteria responsible for the infectious diseases melioidosis and glanders, respectively. (frontiersin.org)
  • Limited experience and a lack of validated diagnostic reagents make Burkholderia pseudomallei , the cause of melioidosis, difficult to recognize in the diagnostic microbiology laboratory. (asm.org)
  • Burkholderia pseudomallei , the cause of melioidosis, can be difficult to reliably identify in the clinical microbiology laboratory. (asm.org)
  • Burkholderia pseudomallei ( Bp ) and Burkholderia mallei ( Bm ), the etiologic agents of melioidosis and glanders, respectively, cause severe disease in both humans and animals. (nature.com)
  • Burkholderia pseudomallei and B. mallei, the causative agents of melioidosis and glanders, respectively, are designated category B biothreat agents. (unboundmedicine.com)
  • Glanders is caused by infection with the bacterium Burkholderia mallei , and melioidosis is caused by Burkholderia pseudomallei . (centerforhealthsecurity.org)
  • Burkholderia pseudomallei (Bp) and Burkholderia mallei (Bm) are Tier-1 Select Agents that cause melioidosis and glanders, respectively. (caltech.edu)
  • Ashdown's medium (or Burkholderia cepacia medium) may be used for selective isolation. (wikipedia.org)
  • Polymerase chain reaction (PCR) based methods were used to confirm B pseudomallei and exclude B cepacia complex. (bmj.com)
  • and CeoAB-OpcM of Burkholderia cepacia ( 22 ). (asm.org)
  • Development of signature-tagged mutagenesis in Burkholderia pseudomallei to identify genes important in survival and pathogenesis," Infection and Immunity , vol. 75, no. 3, pp. 1186-1195, 2007. (hindawi.com)
  • This talk will cover recent developments in pathogenesis, diagnostics, and treatment of B. pseudomallei. (omicsonline.org)
  • This attenuation was abrogated by in trans complementation, suggesting that bpss1439 plays a subtle role in the pathogenesis of B. pseudomallei. (le.ac.uk)
  • The mechanisms involved in the pathogenesis of melioidosis, caused by the intracellular bacterium Burkholderia pseudomallei, are unclear. (edu.au)
  • Quantitative proteomic analysis of Burkholderia pseudomallei Bsa type III secretion system effectors using hypersecreting mutants. (burkholderia.com)
  • Burkholderia pseudomallei is an important cause of acute fulminant pneumonia and septicaemia in tropical regions of northern Australia and south east Asia. (bmj.com)
  • Melioidosis, a disease caused by infection with Burkholderia pseudomallei , is a significant public health burden in Southeast Asia and northern Australia, where in some regions it is the most common cause of fatal community-acquired bacteremic pneumonia ( 6 , 45 ). (asm.org)
  • A recently published case of melioidosis in a Texas resident has increased concerns that Burkholderia pseudomallei , the bacteria that causes this rare disease, may be present in soil and water in some southwestern areas of the United States. (cdc.gov)
  • Laboratorians in these states should be aware of the bacteria and the potential risk for unintentional exposure of laboratory staff if B. pseudomallei is not handled using appropriate biosafety methods in the laboratory. (cdc.gov)
  • Nevertheless, infection is spread through ingestion or contact of bacteria onto open skin wounds or through the inhalation of the aerosolized Burkholderia pseudomallei . (kenyon.edu)
  • Gram-negative bacteria, including B. pseudomallei , secrete outer membrane vesicles (OMVs) which are enriched with multiple protein, lipid, and polysaccharide antigens. (asm.org)
  • To rule out that the bacteria used a hematogenous route, we used a capsule-deficient mutant of B. pseudomallei that does not survive in the blood and found that it also entered the CNS via the trigeminal nerve. (edu.au)
  • Mice were infected with 100 B. pseudomallei strain BRI bacteria by the aerosol route (approximately 20 median lethal doses). (ox.ac.uk)
  • Burkholderia pseudomallei is considered a highly pathogenic bacterium because infection is commonly fatal. (asm.org)
  • An operon, bpeR-bpeA-bpeB-oprB , which encodes a putative repressor, a membrane fusion protein, an inner membrane protein, and an outer membrane protein, respectively, of a multidrug efflux pump of the resistance-nodulation-division family was identified in B. pseudomallei . (asm.org)
  • Detection of Burkholderia pseudomallei in blood samples using polymerase chain reaction. (nih.gov)
  • G. Shalom, J. G. Shaw, and M. S. Thomas, "In vivo expression technology identifies a type VI secretion system locus in Burkholderia pseudomallei that is induced upon invasion of macrophages," Microbiology , vol. 153, no. 8, pp. 2689-2699, 2007. (hindawi.com)
  • Suspected cultures of B. mallei or B. pseudomallei are forwarded to the National Microbiology Laboratory Monday to Thursday. (publichealthontario.ca)
  • Mice were immunized with smBpF4 and subsequently challenged with B. pseudomallei via the intraperitoneal route. (frontiersin.org)
  • After immunization of mice with a B. pseudomallei strain exhibiting mucoid growth characteristics, we isolated an immunoglobulin G1 monoclonal antibody (MAb) (3015) with specificity for a carbohydrate structure as determined by immunoblotting following sodium dodecyl sulfatepolyacrylamide gel electrophoresis. (asm.org)
  • Previously, we demonstrated that immunization with multivalent B. pseudomallei -derived OMVs protects highly susceptible BALB/c mice against an otherwise lethal aerosol challenge. (asm.org)
  • After intranasal inoculation of mice, B. pseudomallei caused low-level localized infection within the nasal cavity epithelium, prior to invasion of the trigeminal nerve in small numbers. (edu.au)
  • Experimental acute respiratory Burkholderia pseudomallei infection in BALB/c mice. (ox.ac.uk)
  • The objective of this study was to establish and characterise a relevant, acute respiratory Burkholderia pseudomallei infection in BALB/c mice. (ox.ac.uk)
  • We show that alkyl hydroperoxidase reductase (AhpC) of B. pseudomallei is strongly immunogenic for T cells of 'humanized' HLA transgenic mice and seropositive human donors. (st-andrews.ac.uk)
  • The isolation of B. pseudomallei from different soil depths and during different seasons of the year has been studied, and quantitative culture of B. pseudomallei from soil samples has also been done in many countries previously (Smith et al. (springeropen.com)
  • But the frequent isolation of B. pseudomallei is surprisingly restricted to some provinces in the northeast, namely Khon Kaen and Ubon Ratchathani provinces and only 1-10 cases or none from adjacent provinces. (bvsalud.org)
  • In an effort to assess the risk of B. pseudomallei infection to service personnel in Australia, 341 paired samples, representing pre- and post-deployment samples of Marines who trained in Australia, were analyzed for antibodies against B. pseudomallei antigens. (health.mil)
  • Unfortunately, treating a B. pseudomallei infection is difficult as the bacterium is intrinsically resistant to many antibiotics and relapse following apparently successful therapy is well recognized ( Cheng and Currie, 2005 ). (frontiersin.org)
  • The low success rate of the treatment of melioidosis is attributed to the fact that B. pseudomallei is intrinsically resistant to a variety of antibiotics, including β-lactams, aminoglycosides, macrolides, and polymyxins ( 10 ). (asm.org)
  • Isogenic mutants were also constructed via allelic exchange and used in complementation analysis studies to further characterize the relative importance of each of the various genetic loci with respect to the polymyxin B resistance phenotype exhibited by B. pseudomallei 1026b. (pubmedcentralcanada.ca)
  • Likewise, nasal Acai PS treatment conferred protection against pulmonary infection with B. pseudomallei strain 1026b. (openaire.eu)
  • In this study, we describe BpsIR, a LuxIR homolog in Burkholderia pseudomallei , a gram-negative soil bacillus and etiologic agent of human and animal melioidosis. (asm.org)
  • The causative agent, Burkholderia pseudomallei , was subsequently identified as a motile, Gram-negative bacillus, which is principally a saprophyte found in soil and water in subtropical areas. (frontiersin.org)
  • infectious disease caused by the en- the water sample: spring (5 [28%] of org/10.1128/AEM.00436-12 vironmental gram-negative bacillus 18 samples), well (17 [13%] of 127), 4. (cdc.gov)
  • BSL-2 practices, containment, and facilities should be used when working with clinical specimens suspected of containing B. pseudomallei. (cdc.gov)
  • Evidence of B. pseudomallei DNA (for example, by LRN-validated polymerase chain reaction) in a clinical specimens collected from a normally sterile site (blood) or lesion of other affected tissue (abscesses, wound). (cdc.gov)
  • Because of the nonspecific presentation, the lack of rapid diagnostic tests, and the intrinsic resistance of B. pseudomallei to commonly used antibiotics, diagnosis and treatment of melioidosis can be challenging. (asm.org)
  • In B. pseudomallei , AmrAB-OprA, an efflux system of the resistance-nodulation-division (RND) family, has been reported to be responsible for the efflux of aminoglycosides and macrolides ( 18 ). (asm.org)
  • B. pseudomallei is also classified as a tier I select agent due to the high level of lethality of the bacterium and its innate resistance to antibiotics, as well as the lack of an effective vaccine. (asm.org)
  • In addition, B. pseudomallei demonstrates high levels of resistance to the action of cationic antimicrobial peptides such as polylysine, protamine sulfate, human neutrophil peptides (HNP-1), and polymyxins ( 14 , 21 ). (pubmedcentralcanada.ca)
  • Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. (semanticscholar.org)
  • Due to their antibiotic resistance and the high mortality rate from their associated diseases, B. mallei and B. pseudomallei are considered to be potential biological warfare agents, targeting livestock and humans. (wikipedia.org)
  • The ubiquitous Proteobacterial genus Burkholderia includes several animal and plant pathogens. (biomedcentral.com)
  • Among these were a fluoroquinolone analog, which we named burkfloxacin (BFX), which potently inhibits growth of intracellular Burkholderia, and flucytosine (5-FC), an FDA-approved antifungal drug. (caltech.edu)
  • Treatment of melioidosis is challenging, as B. pseudomallei is naturally resistant to multiple antibiotics and establishes an intracellular niche within host cells ( 5 ). (asm.org)
  • This message is to inform you of an ongoing public health investigation regarding three cases of melioidosis caused by Burkholderia pseudomallei , which occurred in a Kansas resident in March of 2021, a Texas resident in May of 2021, and a Minnesota resident in May of 2021. (cdc.gov)
  • Tissue (taken during surgery) and blood cultures grew B. pseudomallei susceptible to ceftazidime, amoxicillin/clavulanic acid, imipenem, chlorarnphenicol, and cotrimoxazole but resistant to ampicillin, amikacin, and gentamicin. (thefreelibrary.com)
  • In summary, BAL30072 has superior in vitro activity against B. pseudomallei compared with ceftazidime, meropenem or imipenem and it is rapidly bactericidal. (elsevier.com)
  • Treatment of B. pseudomallei infection is biphasic and lengthy in order to combat the acute and chronic phases of the disease. (elsevier.com)
  • An unexpected feature of the transcriptional response to B. pseudomallei was a progressive increase in the proportion of down-regulated genes, many of which are the transcriptional targets of the intestinal GATA transcription factor ELT-2, which was previously shown to be important for immune response. (omicsonline.org)
  • Correct identification of the etiologic agent is essential as B pseudomallei requires prolonged antimicrobial therapy for a better clinical outcome. (biomedcentral.com)
  • Burkholderia pseudomallei is a gram-negative soil bacterium that is able to infect both humans and animals. (omicsonline.org)
  • The extracellular secretion of these acyl-homoserine lactones is dependent absolutely on the function of the B. pseudomallei BpeAB-OprB efflux pump. (asm.org)
  • Comparison of the MICs and minimal bactericidal concentrations of antimicrobials for bpeAB deletion mutant KHWΔ bpeAB and its isogenic wild-type parent, KHW, showed that the B. pseudomallei BpeAB-OprB pump is responsible for the efflux of the aminoglycosides gentamicin and streptomycin, the macrolide erythromycin, and the dye acriflavine. (asm.org)
  • Burkholderia pseudomallei is resistant to a diverse group of antimicrobials including third generation cephalosporins whilst quinolones and aminoglycosides have no reliable effect. (frontiersin.org)
  • In the current study we compared the performance of a proprietary B. pseudomallei monoclonal antibody agglutination test, FAME profile analysis, and a widely used substrate utilization panel (API 20NE) with the PCR-based identification technique used in this center since 1998 to confirm presumptive B. pseudomallei identification. (asm.org)
  • Mimotopes immunoreactive to the passive protective monoclonals were developed and used to generate an antibody response against B. pseudomallei. (openthesis.org)
  • Antibody titer against B. pseudomallei raised by LFn-mimotope fusions was not increased over peptide conjugates of the mimotope. (openthesis.org)
  • The peripheral blood and pus from the ankle joint was culture positive for Burkholderia pseudomallei with very high antibody titres. (biomedcentral.com)
  • Evidence of a fourfold or greater rise in B. pseudomallei antibody titer by IHA between acute- and convalescent-phase serum specimens obtained greater than or equal to 2 weeks apart. (cdc.gov)
  • Burkholderia pseudomallei and Burkholderia mallei vaccines: Are we close to clinical trials? (semanticscholar.org)
  • Recently passively transferred monoclonal antibodies directed toward the expolysaccharide of B. pseudomallei have been shown to impart survival when administered prior to lethal challenge and active immunization using purified exopolysaccharide extends the mean time to death. (openthesis.org)
  • Melioidosis is a fatal disease, most prevalent in South-East Asia, Northern Australia, and the Indian subcontinent is caused by Gram-negative saprophyte Burkholderia pseudomallei . (innovareacademics.in)
  • Leicester Research Archive: Identification of a predicted trimeric autotransporter adhesin required for biofilm formation of Burkholderia pseudomallei. (le.ac.uk)
  • isolated from soil named KW and SA was reported to contain N-acyl homoserine lactone that significantly decreased biofilm formation of Burkholderia pseudomallei (Ramli et al. (springeropen.com)
  • Further analyses indicate that suppression of ELT-2 is mediated by active degradation of the ELT-2 protein by the host ubiquitin proteasome system and requires the B. pseudomallei type III secretion system. (omicsonline.org)
  • In vivo expression technology identifies a type VI secretion system locus in Burkholderia pseudomallei that is induced upon invasion of macrophages. (burkholderia.com)
  • Another patient suffered two severe episodes of acute bronchopneumonia following acquisition of B pseudomallei . (bmj.com)
  • These findings support a potential pathogenic role for B pseudomallei in CF lung disease, producing both chronic infection and possibly acute bronchopneumonia. (bmj.com)
  • Immunoglobulin G against the lipopolysaccharide (LPS) of B. pseudomallei, as detected by an LPS-based enzyme-linked immunosorbent assay with 95% sensitivity, was negative in both the acute-phase and convalescent-phase sera. (hku.hk)
  • These results suggest that the BALB/c mouse is highly susceptible to B. pseudomallei by the aerosol route and represents a relevant model system of acute human melioidosis. (ox.ac.uk)