A molecular probe technique that utilizes branched DNA (bDNA) as a means to amplify the hybridization signal. One end of the bDNA molecule is designed to bind a specific target, while the other end of the bDNA molecule contains many branches of DNA that are designed to bind a probe used for signal detection.
Laboratory techniques that involve the in-vitro synthesis of many copies of DNA or RNA from one original template.
An isothermal in-vitro nucleotide amplification process. The process involves the concomitant action of a RNA-DIRECTED DNA POLYMERASE, a ribonuclease (RIBONUCLEASES), and DNA-DIRECTED RNA POLYMERASES to synthesize large quantities of sequence-specific RNA and DNA molecules.
Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)
Therapy for the insufficient cleansing of the BLOOD by the kidneys based on dialysis and including hemodialysis, PERITONEAL DIALYSIS, and HEMODIAFILTRATION.
The fundamental dispositions and traits of humans. (Merriam-Webster's Collegiate Dictionary, 10th ed)
The quantity of measurable virus in a body fluid. Change in viral load, measured in plasma, is sometimes used as a SURROGATE MARKER in disease progression.
The end-stage of CHRONIC RENAL INSUFFICIENCY. It is characterized by the severe irreversible kidney damage (as measured by the level of PROTEINURIA) and the reduction in GLOMERULAR FILTRATION RATE to less than 15 ml per min (Kidney Foundation: Kidney Disease Outcome Quality Initiative, 2002). These patients generally require HEMODIALYSIS or KIDNEY TRANSPLANTATION.
INFLAMMATION of the LIVER in humans caused by HEPATITIS C VIRUS, a single-stranded RNA virus. Its incubation period is 30-90 days. Hepatitis C is transmitted primarily by contaminated blood parenterally, and is often associated with transfusion and intravenous drug abuse. However, in a significant number of cases, the source of hepatitis C infection is unknown.
A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.
Recycling through liver by excretion in bile, reabsorption from intestines (INTESTINAL REABSORPTION) into portal circulation, passage back into liver, and re-excretion in bile.
A storage reservoir for BILE secretion. Gallbladder allows the delivery of bile acids at a high concentration and in a controlled manner, via the CYSTIC DUCT to the DUODENUM, for degradation of dietary lipid.
An emulsifying agent produced in the LIVER and secreted into the DUODENUM. Its composition includes BILE ACIDS AND SALTS; CHOLESTEROL; and ELECTROLYTES. It aids DIGESTION of fats in the duodenum.
Steroid acids and salts. The primary bile acids are derived from cholesterol in the liver and usually conjugated with glycine or taurine. The secondary bile acids are further modified by bacteria in the intestine. They play an important role in the digestion and absorption of fat. They have also been used pharmacologically, especially in the treatment of gallstones.
The circulation of the BLOOD through the LUNGS.
The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.
Scientific study of human skeletal remains with the express purpose of identification. This includes establishing individual identity, trauma analysis, facial reconstruction, photographic superimposition, determination of time interval since death, and crime-scene recovery. Forensic anthropologists do not certify cause of death but provide data to assist in determination of probable cause. This is a branch of the field of physical anthropology and qualified individuals are certified by the American Board of Forensic Anthropology. (From Am J Forensic Med Pathol 1992 Jun;13(2):146)
The application of dental knowledge to questions of law.
Exclusive legal rights or privileges applied to inventions, plants, etc.
A method of differentiating individuals based on the analysis of qualitative or quantitative biological traits or patterns. This process which has applications in forensics and identity theft prevention includes DNA profiles or DNA fingerprints, hand fingerprints, automated facial recognition, iris scan, hand geometry, retinal scan, vascular patterns, automated voice pattern recognition, and ultrasound of fingers.
The application of genetic analyses and MOLECULAR DIAGNOSTIC TECHNIQUES to legal matters and crime analysis.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
Specific regions that are mapped within a GENOME. Genetic loci are usually identified with a shorthand notation that indicates the chromosome number and the position of a specific band along the P or Q arm of the chromosome where they are found. For example the locus 6p21 is found within band 21 of the P-arm of CHROMOSOME 6. Many well known genetic loci are also known by common names that are associated with a genetic function or HEREDITARY DISEASE.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Ribonucleic acid that makes up the genetic material of viruses.
The clear portion of BLOOD that is left after BLOOD COAGULATION to remove BLOOD CELLS and clotting proteins.
A novel composition, device, or process, independently conceived de novo or derived from a pre-existing model.
A common, acute infection usually caused by the Epstein-Barr virus (HERPESVIRUS 4, HUMAN). There is an increase in mononuclear white blood cells and other atypical lymphocytes, generalized lymphadenopathy, splenomegaly, and occasionally hepatomegaly with hepatitis.
Infection of the retina by cytomegalovirus characterized by retinal necrosis, hemorrhage, vessel sheathing, and retinal edema. Cytomegalovirus retinitis is a major opportunistic infection in AIDS patients and can cause blindness.
A genus of the family HERPESVIRIDAE, subfamily BETAHERPESVIRINAE, infecting the salivary glands, liver, spleen, lungs, eyes, and other organs, in which they produce characteristically enlarged cells with intranuclear inclusions. Infection with Cytomegalovirus is also seen as an opportunistic infection in AIDS.
The ability of lymphoid cells to mount a humoral or cellular immune response when challenged by antigen.
Hereditary, progressive degeneration of the neuroepithelium of the retina characterized by night blindness and progressive contraction of the visual field.
Infection with CYTOMEGALOVIRUS, characterized by enlarged cells bearing intranuclear inclusions. Infection may be in almost any organ, but the salivary glands are the most common site in children, as are the lungs in adults.
Inflammation of the RETINA. It is rarely limited to the retina, but is commonly associated with diseases of the choroid (CHORIORETINITIS) and of the OPTIC DISK (neuroretinitis).
The geographic designation for states bordering on or located in the Pacific Ocean. The states so designated are Alaska, California, Hawaii, Oregon, and Washington. (U.S. Geologic Survey telephone communication)
The time span between the beginning of physical activity by an individual and the termination because of exhaustion.
A subtype of striated muscle, attached by TENDONS to the SKELETON. Skeletal muscles are innervated and their movement can be consciously controlled. They are also called voluntary muscles.
Diet modification and physical exercise to improve the ability of animals to perform physical activities.
The non-genetic biological changes of an organism in response to challenges in its ENVIRONMENT.
Physical activity which is usually regular and done with the intention of improving or maintaining PHYSICAL FITNESS or HEALTH. Contrast with PHYSICAL EXERTION which is concerned largely with the physiologic and metabolic response to energy expenditure.
An activity in which the body is propelled by moving the legs rapidly. Running is performed at a moderate to rapid pace and should be differentiated from JOGGING, which is performed at a much slower pace.
An oxide of aluminum, occurring in nature as various minerals such as bauxite, corundum, etc. It is used as an adsorbent, desiccating agent, and catalyst, and in the manufacture of dental cements and refractories.
Compounds similar to hydrocarbons in which a tetravalent silicon atom replaces the carbon atom. They are very reactive, ignite in air, and form useful derivatives.
The transference of BONE MARROW from one human or animal to another for a variety of purposes including HEMATOPOIETIC STEM CELL TRANSPLANTATION or MESENCHYMAL STEM CELL TRANSPLANTATION.
An organism that, as a result of transplantation of donor tissue or cells, consists of two or more cell lines descended from at least two zygotes. This state may result in the induction of donor-specific TRANSPLANTATION TOLERANCE.
A chain of islands, cays, and reefs in the West Indies, lying southeast of Florida and north of Cuba. It is an independent state, called also the Commonwealth of the Bahamas or the Bahama Islands. The name likely represents the local name Guanahani, itself of uncertain origin. (From Webster's New Geographical Dictionary, 1988, p106 & Room, Brewer's Dictionary of Names, 1992, p45)
Common name for many members of the FALCONIFORMES order, family Accipitridae, generally smaller than EAGLES, and containing short, rounded wings and a long tail.
INFLAMMATION of the LIVER in humans that is caused by HEPATITIS C VIRUS lasting six months or more. Chronic hepatitis C can lead to LIVER CIRRHOSIS.
Antibodies to the HEPATITIS C ANTIGENS including antibodies to envelope, core, and non-structural proteins.
Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.
INFLAMMATION of the LIVER in humans caused by a member of the ORTHOHEPADNAVIRUS genus, HEPATITIS B VIRUS. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.

Multicenter comparison of Roche COBAS AMPLICOR MONITOR version 1.5, Organon Teknika NucliSens QT with Extractor, and Bayer Quantiplex version 3.0 for quantification of human immunodeficiency virus type 1 RNA in plasma. (1/39)

The performance and characteristics of Roche COBAS AMPLICOR HIV-1 MONITOR version 1.5 (CA MONITOR 1.5) UltraSensitive (usCA MONITOR 1. 5) and Standard (stCA MONITOR 1.5) procedures, Organon Teknika NucliSens HIV-1 RNA QT with Extractor (NucliSens), and Bayer Quantiplex HIV RNA version 3.0 (bDNA 3.0) were compared in a multicenter trial. Samples used in this study included 460 plasma specimens from human immunodeficiency virus (HIV) type 1 (HIV-1)-infected persons, 100 plasma specimens from HIV antibody (anti-HIV)-negative persons, and culture supernatants of HIV-1 subtype A to E isolates diluted in anti-HIV-negative plasma. Overall, bDNA 3.0 showed the least variation in RNA measures upon repeat testing. For the Roche assays, usCA MONITOR 1.5 displayed less variation in RNA measures than stCA MONITOR 1.5. NucliSens, at an input volume of 2 ml, showed the best sensitivity. Deming regression analysis indicated that the results of all three assays were significantly correlated (P < 0.0001). However, the mean difference in values between CA MONITOR 1.5 and bDNA 3.0 (0.274 log(10) RNA copies/ml; 95% confidence interval, 0.192 to 0.356) was significantly different from 0, indicating that CA MONITOR 1.5 values were regularly higher than bDNA 3.0 values. Upon testing of 100 anti-HIV-negative plasma specimens, usCA MONITOR 1.5 and NucliSens displayed 100% specificity, while bDNA 3.0 showed 98% specificity. NucliSens quantified 2 of 10 non-subtype B viral isolates at 1 log(10) lower than both CA MONITOR 1.5 and bDNA 3.0. For NucliSens, testing of specimens with greater than 1,000 RNA copies/ml at input volumes of 0.1, 0.2, and 2.0 ml did not affect the quality of results. Additional factors differing between assays included specimen throughput and volume requirements, limit of detection, ease of execution, instrument work space, and costs of disposal. These characteristics, along with assay performance, should be considered when one is selecting a viral load assay.  (+info)

Comparative performance of three viral load assays on human immunodeficiency virus type 1 (HIV-1) isolates representing group M (subtypes A to G) and group O: LCx HIV RNA quantitative, AMPLICOR HIV-1 MONITOR version 1.5, and Quantiplex HIV-1 RNA version 3.0. (2/39)

The performance of the LCx HIV RNA Quantitative (LCx HIV), AMPLICOR HIV-1 MONITOR version 1.5 (MONITOR v1.5), and Quantiplex HIV-1 RNA version 3.0 (bDNA v3.0) viral load assays was evaluated with 39 viral isolates (3 A, 7 B, 6 C, 4 D, 8 E, 4 F, 1 G, 4 mosaic, and 2 group O). Quantitation across the assay dynamic ranges was assessed using serial fivefold dilutions of the viruses. In addition, sequences of gag-encoded p24 (gag p24), pol-encoded integrase, and env-encoded gp41 were analyzed to assign group and subtype and to assess nucleotide mismatches at primer and probe binding sites. For group M isolates, quantification was highly correlated among all three assays. In contrast, only the LCx HIV assay reliably quantified group O isolates. The bDNA v3.0 assay detected but consistently underquantified group O viruses, whereas the MONITOR v1.5 test failed to detect group O viruses. Analysis of target regions revealed fewer primer or probe mismatches in the LCx HIV assay than in the MONITOR v1.5 test. Consistent with the high level of nucleotide conservation is the ability of the LCx HIV assay to quantify efficiently human immunodeficiency virus type 1 group M and the genetically diverse group O.  (+info)

Intra- and interlaboratory variabilities of results obtained with the Quantiplex human immunodeficiency virus type 1 RNA bDNA assay, version 3.0. (3/39)

Normal assay variation associated with bDNA tests for human immunodeficiency virus type 1 (HIV-1) RNA performed at two laboratories with different levels of test experience was investigated. Two 5-ml aliquots of blood in EDTA tubes were collected from each patient for whom the HIV-1 bDNA test was ordered. Blood was stored for no more than 4 h at room temperature prior to plasma separation. Plasma was stored at -70 degrees C until transported to the Central Pennsylvania Alliance Laboratory (CPAL; York, Pa.) and to the Hershey Medical Center (Hershey, Pa.) on dry ice. Samples were stored at < or =-70 degrees C at both laboratories prior to testing. Pools of negative (donor), low-HIV-1-RNA-positive, and high-HIV-1-RNA-positive plasma samples were also repeatedly tested at CPAL to determine both intra- and interrun variation. From 11 August 1999 until 14 September 2000, 448 patient specimens were analyzed in parallel at CPAL and Hershey. From 206 samples with results of > or =1,000 copies/ml at CPAL, 148 (72%) of the results varied by < or =0.20 log(10) when tested at Hershey and none varied by >0.50 log(10). However, of 242 specimens with results of <1,000 copies/ml at CPAL, 11 (5%) of the results varied by >0.50 log(10) when tested at Hershey. Of 38 aliquots of HIV-1 RNA pool negative samples included in 13 CPAL bDNA runs, 37 (97%) gave results of <50 copies/ml and 1 (3%) gave a result of 114 copies/ml. Low-positive HIV-1 RNA pool intrarun variation ranged from 0.06 to 0.26 log(10) while the maximum interrun variation was 0.52 log(10). High-positive HIV-1 RNA pool intrarun variation ranged from 0.04 to 0.32 log(10), while the maximum interrun variation was 0.55 log(10). In our patient population, a change in bDNA HIV-1 RNA results of < or =0.50 log(10) over time most likely represents normal laboratory test variation. However, a change of >0.50 log(10), especially if the results are >1,000 copies/ml, is likely to be significant.  (+info)

Quantitation of human immunodeficiency virus type 1 (HIV-1) RNA in cell-free cervicovaginal secretions: comparison of reverse transcription-PCR amplification (AMPLICOR HIV-A MONITOR 1.5) with enhanced-sensitivity branched-DNA assay (Quantiplex 3.0). (4/39)

Two commercially available hypersensitive assays for human immunodeficiency virus type 1 (HIV-1) RNA quantitation, AMPLICOR HIV-1 Monitor Test 1.5 and Quantiplex HIV RNA 3.0, were compared to detect and quantify HIV-1 RNA in the cell-free fraction of cervicovaginal secretions collected by vaginal washing. Three panel specimens were used: pooled cervicovaginal secretions spiked with HIV-1 subtype A or HIV-1 subtype B and cervicovaginal lavages from HIV-positive and HIV-negative women. Compared to the AMPLICOR HIV-1 Monitor Test 1.5 assay, the Quantiplex HIV-1 3.0 assay yielded higher estimates of HIV-1 RNA concentrations in several tested samples spiked with HIV-1 RNA subtype A, as well as subtype B, particularly samples containing low amounts of HIV-1 RNA. The sensitivity and specificity of the AMPLICOR HIV-1 Monitor Test 1.5 assay were 93 and 100%, respectively; the sensitivity and specificity of the Quantiplex HIV RNA 3.0 assay were 97 and 50%, respectively. In conclusion, in quantifying HIV-1 RNA in cervicovaginal secretions, the Quantiplex HIV RNA 3.0 may lack specificity, and the AMPLICOR HIV-1 Monitor Test 1.5 assay, although highly specific, may lack sensitivity.  (+info)

Comparative evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR version 2.0 Assays for quantification of hepatitis C virus RNA in serum. (5/39)

A comparison of quantitative results expressed in hepatitis C virus (HCV) international units per milliliter, obtained from the VERSANT HCV RNA 3.0 (bDNA-3.0) assay, the QUANTIPLEX HCV RNA 2.0 (bDNA-2.0) assay, and the COBAS AMPLICOR HCV MONITOR version 2.0 (HCM-2.0) test was performed. A total of 168 patient specimens submitted to the Mayo Clinic Molecular Microbiology Laboratory for HCV quantification or HCV genotyping were studied. Of the specimens tested, 97, 88, and 79% yielded quantitative results within the dynamic range of the bDNA-3.0, bDNA-2.0, and HCM-2.0 assays, respectively. Overall, there was substantial agreement between the results generated by all three assays. A total of 15 out of 29 (52%) of the specimens determined to contain viral loads of <31,746 IU/ml by the bDNA-3.0 assay were categorized as containing viral loads within the range of 31,746 to 500,000 IU/ml by the bDNA-2.0 assay. Although substantial agreement was noted between the results generated by the bDNA-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-2.0 assay was noted (P = 0.001). Likewise, although substantial agreement was noted between the results generated by the HCM-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-3.0 assay was noted (P < or = 0.001). The discrepancy between the HCM-2.0 and bDNA-3.0 results was more pronounced when viral loads were >500,000 IU/ml and resulted in statistically significant differences (P < or = 0.001) in determining whether viral loads were above or below 800,000 IU/ml of HCV RNA, the proposed threshold value for tailoring the duration of combination therapy. The expression of quantitative values in HCV international units per milliliter was a strength of both the bDNA-3.0 and HCM-2.0 assays.  (+info)

Postnatal expression and induction by pregnenolone-16alpha-carbonitrile of the organic anion-transporting polypeptide 2 in rat liver. (6/39)

Newborn rats are more sensitive to the toxic effects of cardiac glycosides than are adult rats. This is associated with a decreased ability to remove cardiac glycosides from blood into the liver. Pregnenolone-16alpha-carbonitrile (PCN), a prototypical rodent CYP3A inducer and pregnane-X-receptor (PXR) ligand, stimulates the hepatic clearance of cardiac glycosides in newborn rats, which results in decreased toxicity of the cardiac glycosides. The mechanism responsible for this phenomenon is not clear; however, if elucidated, it would help in understanding and preventing potential drug-drug interactions. The recently cloned rat organic anion-transporting polypeptide 2 (oatp2) (Slc21a5) is a sinusoidal hepatic uptake transporter, with very high affinities for cardiac glycosides, and thus it was hypothesized that rat oatp2 increases during postnatal development and is inducible by PCN. In the present study, livers were removed from Sprague-Dawley rats from postnatal days (pnd) 0 to 45, in 5-day increments; as well as from pnd 10 to 90, in 10-day increments, after PCN (75 mg/kg i.p., for 4 days) or corn oil (vehicle for PCN) treatment. The protein and mRNA levels of rat oatp2 were determined by Western blot analysis and branched DNA signal amplification technique, respectively. Expression of rat oatp2 protein and mRNA increased gradually during postnatal development. PCN treatment increased liver to body weight ratio in both genders, and dramatically accelerated the maturation of hepatic oatp2 protein and mRNA levels. In summary, rat oatp2 undergoes age-dependent and chemical regulation during postnatal development, and is a potential target for drug-drug and age-drug interactions.  (+info)

Evaluation of the VERSANT HCV RNA 3.0 assay for quantification of hepatitis C virus RNA in serum. (7/39)

We assessed the performance of a new assay (VERSANT HCV RNA 3.0 [bDNA 3.0] assay [Bayer Diagnostics]) to quantitate HCV RNA levels and compared the results of the bDNA 3.0 assay to results of the Quantiplex HCV RNA 2.0 (bDNA 2.0) assay. Samples used in this study included 211 serum specimens from hepatitis C virus (HCV)-infected persons from two sites (Bordeaux and Marseille, France) with different genotypes; 383 serum specimens from HCV antibody-negative, HCV RNA-negative persons; and serial dilutions of World Health Organization (WHO) HCV RNA standard at a titer of 100,000 IU/ml. The specificity of the bDNA 3.0 assay was 98.2%. A high correlation was observed between expected and observed values in all dilutions of WHO standard (r = 0.9982), in serial dilutions of pooled samples (r = 0.9996), and in diluted sera from different HCV genotypes (r = 0.9930 to 0.9995). The standard deviations (SD) for the within-run and between-run reproducibility of the bDNA 3.0 assay were +info)

External quality assessment program for qualitative and quantitative detection of hepatitis C virus RNA in diagnostic virology. (8/39)

To assess the performance of laboratories in detecting and quantifying hepatitis C virus (HCV) RNA levels in HCV-infected patients, we distributed two proficiency panels for qualitative and quantitative HCV RNA testing. The panels were designed by the European Union Quality Control Concerted Action, prepared by Boston Biomedica Inc., and distributed in May 1999 (panel 1) and February 2000 (panel 2). Each panel consisted of two negative samples and six positive samples, with HCV RNA target levels from 200 to 500,000 copies/ml. Panel 1 had four samples with at least 50,000 copies/ml, and panel 2 had two samples with at least 50,000 copies/ml. Fifty-seven laboratories submitted 45 qualitative and 35 quantitative data sets on panel 1, and 81 laboratories submitted 75 qualitative and 48 quantitative data sets on panel 2. In both panels, about two-thirds of the qualitative data sets and >90% of the quantitative data sets were obtained with commercial assays. With each panel, two data sets gave one false-positive result, corresponding to false-positivity rates of 1.3% and 0.8% for panel 1 and panel 2, respectively. Samples containing at least 50,000 copies/ml were found positive in 97% and 99% of the cases with panel 1 and panel 2, respectively. In contrast, the positive samples containing < or =5,000 copies/ml were reported positive in only 71% and 77% of the cases with panel 1 and panel 2, respectively. Adequate or better scores on qualitative results (all results correct or only the low-positive samples missed) were obtained in 84% (panel 1) and 80% (panel 2) of the data sets. In the analysis of quantitative results, 60% (panel 1) and 73% (panel 2) of the data sets obtained an adequate or better score (> or =80% of the positive results within the range of the geometric mean +/- 0.5 log(10)). Our results indicate that considerable improvements in molecular detection and quantitation of HCV have been achieved, particularly through the use of commercial assays. However, the lowest detection levels of many assays are still too high, and further standardization is still needed. Finally, this study underlines the importance of proficiency panels for monitoring the quality of diagnostic laboratories.  (+info)

The VERSANT HCV RNA 1.0 Assay is a real-time kPCR assay for quantitative detection of human HCV RNA in plasma or serum of HCV-infected individuals.
The VERSANT® HCV RNA 1.0 Assay (kPCR)* is a real-time kinetic polymerase chain reaction (kPCR) assay for quantitative detection of human hepatitis C virus (HCV) RNA in plasma or serum of HCV-infected individuals. The assay is intended to be used in conjunction with clinical presentation and other laboratory markers of disease status to aid in the management of HCV-infected individuals undergoing antiviral therapy.. ...
HCV infection is one of the main causes of chronic liver disease worldwide.1 Fortunately, with detection and appropriate therapy, the majority of HCV-infected individuals can be cured. The European Association for the Study of the Liver (EASL) recommends response-guided therapy for HCV, which includes the monitoring of treatment efficacy using a real-time PCR-based assay, with a lower limit of detection of 10-20 IU/mL.2 The VERSANT® HCV RNA 1.0 Assay (kPCR)*, which has a limit of detection of 15 IU/mL, provides excellent precision across the dynamic range and 100 percent specificity. Additionally, the assay features technology that is compatible with all HCV genotypes, providing clinicians the information that they need to manage patient therapy.. 1. Lavanchy D. The global burden of hepatitis C. Liver Int 2009; 29:74-81 ...
The performance of the point-of-care Xpert HIV-1 viral load assay was evaluated against the Abbott RealTime PCR m2000rt system. A total of 96 plasma specimens ranging from 2.5 log10 copies ml-1 to 4.99 log10 copies ml-1 and proficiency testing panel specimens were used. Precision and accuracy were checked using the Pearson correlation co-efficient test and Bland-Altman analysis.. RESULTS ...
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence ACT. If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.,br ...
Investigator Quantiplex Pro Kit, For quantification of human and male DNA with high sensitivity and a straightforward quality assessment
IVDD, CE marked. Product availability varies from country to country and is subject to local regulatory requirements.. VERSANT is a registered trademark of Siemens. All other marks are the property of their respective owners.. The products/features (mentioned herein) are not commercially available in all countries. Due to regulatory reasons their future availability cannot be guaranteed. Please contact your local Siemens organization for further details. ...
The products/features (mentioned herein) are not commercially available in all countries. Due to regulatory reasons their future availability cannot be guaranteed. Please contact your local Siemens organization for further details. ...
Likely a new method, although hard to be certain. This definitely happens when labs go to a new viral load assay. Depending on the technology used, some recalibration will be required, either up or...
Buy The Review E-newsletter design by super_things on ThemeForest. About The Review An elegant and clean layout, ideal for business and commercial use. Special Campaign Monitor version...
Product Description Convenient real-time RNA quantification in one EASY step. Biocredes One-Step TaqTicProbe qRT-PCR iCycler Kit uses a combination of high-qua
In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification assay) that is used to detect nucleic acid molecules. A branched DNA assay begins with a dish or some other solid support (e.g., a plastic dipstick). The dish is peppered with small, single stranded DNA molecules (or chains) that stick up into the air. These are known as capture probe DNA molecules. Next, an extender DNA molecule is added. Each extender has two domains; one that hybridizes to the capture DNA molecule and one that hangs out in the air. The purpose of the extender is two-fold. First, it creates more available surface area for target DNA molecules to bind, and second, it allows the assay to be easily adapted to detect a variety of target DNA molecules. Once the capture and extender molecules are in place and they have hybridized, the sample can be added. Target molecules in the sample will bind to the extender molecule. This results in a base peppered with capture probes, ...
Five methods for the assessment of plasma viral load (VL) were evaluated in 103 seropositive patients infected with various subtypes of HIV-1. The methods included three RNA-based assays (Amplicor Monitor 1.5, Quantiplex version 2.0, NucliSens), one ultrasensitive reverse transcriptase (PERT) assay and one boosted p24 antigen (Ag) enzyme immunoassay (EIA). Subtyping was based on sequencing in env. The sensitivities were, in decreasing order, Amplicor | PERT | p24 Ag | NucliSens | Quantiplex. The low sensitivity of NucliSens was related to the missing of several non-B (A, E, F, G) or recombinant strains, whereas that of Quantiplex did not depend on subtype. In the 1 group O sample and 4 group M samples, only PERT assay or p24Ag EIA produced a positive result. In the quantitative range, correlation was best between Amplicor and Quantiplex (r = 0.8848), fair between Amplicor and NucliSens (r = 0.7064) or PERT assay (r = 0.7266), lowest between Amplicor and p24Ag EIA (r = 0.3989). Amplic
In a previous study, we evaluated a mecA-specific assay that used a paramagnetic particle-labeled probe to separate the target-probe duplexes from solution and an acridinium ester-labeled probe to detect the hybridized mecA gene (11). However, the assay was limited by low sensitivity and high concentrations of organism were needed to obtain a valid result. The MecA bDNA assay affords a significant increase in sensitivity that is probably due to the inherent signal amplification properties of the assay. When the PCR was used as the gold standard, the bDNA assay was 100% sensitive and specific for both S. aureus and CNS.. Among 416 isolates, only 11 gave discrepant results between genotypic and phenotypic assays. Of these discrepant isolates, 10 contained themecA gene yet were phenotypically sensitive to oxacillin and 1 did not contain the mecA gene but was oxacillin resistant. Eight of these MecA+ isolates were later identified asS. epidermidis, and two were identified as S. hominis. The MecA− ...
The VERSANT HIV-1 RNA 1.0 Assay (kPCR) provides efficient and reproducible extraction, amplification, and detection of HIV-1 RNA.
This white paper can help you determine if the Versant 3100 Press can meet the printing needs of your business with its very advanced automation
A method for determining a molecule A comprising a sample of molecules capable of participating in formation of triplex structures is useful for sensitive determination. The principle can be used to determine any kind of analytes.
article{BUT115093, author=Karel {Sedlář} and Helena {Škutková} and Martin {Vítek} and Ivo {Provazník}, title=Set of rules for genomic signal downsampling, annote=Comparison and classification of organisms based on molecular data is an important task of computational biology, since at least parts of DNA sequences for many organisms are available. Unfortunately, methods for comparison are computationally very demanding, suitable only for short sequences. In this paper, we focus on the redundancy of genetic information stored in DNA sequences. We proposed rules for downsampling of DNA signals of cumulated phase. According to the length of an original sequence, we are able to significantly reduce the amount of data with only slight loss of original information. Dyadic wavelet transform was chosen for fast downsampling with minimum influence on signal shape carrying the biological information. We proved the usability of such new short signals by measuring percentage deviation of pairs of ...
Results bDNA was quantified in 714 whole blood samples. There was no correlation between bDNA levels and baseline characteristics such as age and gender, nor with static markers of liver function such as MELD. Elevated bDNA levels were associated with development of infection within the first 7 days in patients treated with prednisolone (p = 0.001), and remained independently associated with the subsequent development of infection after multivariate analysis (p = 0.02). Importantly, bDNA levels were not associated with the development of infection in patients treated without prednisolone (p = 0.43).. Elevated bDNA levels were associated with death at 90 days (p = 0.05). Mortality in prednisolone treated patients was increased for patients with high bDNA compared to patients with low bDNA (hazard ratio 2; p = 0.02). Accordingly, patients with elevated bDNA were more likely to die if they were randomly allocated prednisolone therapy (OR 2.9, 95% CI 1.2-6.9, p = 0.02). We estimate that if patients ...
These findings suggest that the recently developed cross-linking assay is more sensitive than the bDNA assay for the quantitative determination of HBV-DNA.
You have made the correct diagnosis. Blipping is usually caused by issues associated with the viral load assay or more specifically with the blood collection tube that the sample is collected in. In...
Title: Alabel-free and enzyme-free signal amplification strategy for a sensitive RNase Hactivity assay Author: Chang Yeol Lee,‡Hyowon Jang,‡ Ki Soo Park* and Hyun Gyu Park* (‡: equal contribution) Journal: Nanoscale 2017, 9, 16149-16153 Abstra
Title: Alabel-free and enzyme-free signal amplification strategy for a sensitive RNase Hactivity assay Author: Chang Yeol Lee,‡Hyowon Jang,‡ Ki Soo Park* and Hyun Gyu Park* (‡: equal contribution) Journal: Nanoscale 2017, 9, 16149-16153 Abstra
Ready and easy-to-use VERSANT Urine Transport Kit (UTK) requires no manual pipetting, centrifugation, or off-line processing steps ...
To proactively address cybersecurity risk, federal agencies need comprehensive visibility into their IT environments and actionable data to prioritize risk-mitigation activities. These six capabilities will help do that.
Cell Biology Lecture on types of receptors and signaling, GPCR, Ach, signal amplification and transduction along with the cell surface receptors and their functions.
Hepatitis C virus (HCV) genotyping is a tool used to optimize antiviral treatment regimens. The newly developed Versant HCV genotype assay (LiPA) 2.0 uses sequence information from both the 5 untranslated region and the core region, allowing distinction between HCV genotype 1 and subtypes c to l of genotype 6 and between subtypes a and b of genotype 1. HCV-positive samples were genotyped manually using the Versant HCV genotype assay (LiPA) 2.0 system according to the manufacturers instructions. For the comparison study, Versant HCV genotype assay (LiPA) 1.0 was used. In this study, 99.7% of the samples could be amplified, the genotype of 96.0% of samples could be determined, and the agreement with the reference method was 99.4% when a genotype was determined. The reproducibility study showed no significant differences in performance across sites (P = 0.43) or across lots (P = 0.88). In the comparison study, 13 samples that were uninterpretable or incorrectly genotyped with Versant HCV genotype ...
Background: Routine monitoring of HIV-1 Viral Load (VL) is important in patients on Antiretroviral Therapy (ART) management. Access to HIV VL remains ..
Tumor-derived exosomes (TEXs) are extracellular vesicles that are continuously released into the blood by tumor cells and carry specific surface markers of the original tumor cells. Substantial evidence has implicated TEXs as attractive diagnostic markers for cancer. However, the detection of TEXs in blood at an early tumor stage is challenging due to their very low concentration. Here, we established a method called PLA-RPA-TMA assay that allows TEXs to be detected with high sensitivity and specificity. Based on two proximity ligation assay (PLA) probes that recognize a biomarker on a TEX, we generated a unique surrogate DNA signal for the specific biomarker, which was synchronously amplified twice by recombinase polymerase amplification (RPA) coupled with transcription-mediated amplification (TMA), and then the products of the RPA-TMA reaction were quantitatively detected using a gold nanoparticle-based colorimetric assay ...
Fingerprint Dive into the research topics of Biological dynamics of viral load in hemodialysis patients with HCV infection: Analysis by branched -chain DNA (bDNA) signal amplification assay. Together they form a unique fingerprint. ...
TY - JOUR. T1 - Hepatitis C virus RNA quantification in right and left lobes of the liver in patients with chronic hepatitis C. AU - Idrovo, V.. AU - Dailey, P. J.. AU - Jeffers, Lennox J. AU - Coelho-Little, E.. AU - Bernstein, D.. AU - Bartholomew, M.. AU - Alvarez, L.. AU - Urdea, M. S.. AU - Collins, M. L.. AU - Schiff, Eugene R. PY - 1996/9/1. Y1 - 1996/9/1. N2 - Quantification of hepatitis C virus RNA in liver tissue is likely to be useful in the study of the natural history, pathogenesis, progression and treatment of hepatitis C virus-associated liver disease. Quantitative measurements of hepatitis C virus RNA in liver biopsy samples using the branched DNA (bDNA) signal amplification assay were carried out. The aims of this study were threefold: first, to assess the level of hepatitis C virus RNA in biopsy samples from the right and left lobes of the liver; second, to evaluate the correlation between hepatitis C virus RNA levels in serum and liver; and third, to investigate the ...
Utility of random amplification of polymorphic DNA assay and BOX-A PCR in molecular characterization of Streptococcus pneumoniae isolates recovered from various
16 x PERSONA MONITOR TEST STICKS for the NEW and OLD Persona Monitor These Persona monitor sticks are for use with the NEW and the OLD Persona ovulation
Javais prévu daller vers la Croix de Belledonne, mais lenneigemment est encore énorme en cette fin mai. Et donc pour éviter une longue galère dans de la neige molle je me tourne vers le Grand Colon, plus proche et plus facile daccès ...
Leader LV5700A The LV 5700A is a Multi SDI Monitor for HD/SD-SDI signals with an XGA TFT color LCD in an adjustable tilt front panel. The monitor tests 14 HD-SDI and SD-SDI formats with total digital processing c
San Diego, CA. FDA-cleared TMA tests are available for the detection of Chlamydia trachomatis, Neisseria gonorrhoeae, and Mycobacterium tuberculosis (APTIMA CT, APTIMA GC, and, AMPLIFIED Mycobacterium tuberculosis Direct Test [MTD] assays, respectively) An FDA-approved TMA qualitative assay for hepatitis C virus (HCV) is also available (VERSANT HCV RNA [distributed by Siemens Healthcare Diagnostics, Deerfield, IL]) - Nucleic acid sequence-based amplification (NASBA) ◆ NASBA is an isothermal amplification technique and can be used for the amplification of a DNA or RNA target. Following the first PCR cycle, there is (theoretically) a per-cycle doubling in the number of copies of the PCR product. (Modified from Leonard DGB [ed]: Diagnostic Molecular Pathology. ) - Basic PCR method ◆ During the denaturation stage, sample specimen DNA is rendered single-stranded by heating to 94° to 98°C ◆ In the annealing step, oligonucleotide primers hybridize with the target sequences they have been ...
When a test has more than two possible outcomes, its accuracy can be reported as pairs of sensitivity and specificity corresponding to each degree of abnormality. This approach, the basis for receiver-operating characteristic analysis, maximizes the use of diagnostic information (2). When the diagnostic threshold is set at a lower degree of abnormality, the sensitivity of the test tends to increase but its specificity tends to decrease. The opposite occurs when a higher diagnostic threshold is selected. In the case of HIV viral load assays, if more viral units must be detected to report the test result as abnormal, the specificity will increase. As noted by Rich and colleagues, the lowest reported plasma viral load during seroconversion is more than 17 times higher than the highest viral load detected in our three patients. Thus, for the diagnosis of acute infection, the threshold should probably be set much higher ...
Dr Ellen Jo Baron, Emeritus Professor of Pathology at the Stanford University Medical Center and associated with Cepheid, gave the example of Cepheids Xpert HIV1 Viral Load assay which is strictly not a point-of-care test. But it can be done in a small laboratory that has necessary resources. It is fully automated, can identify all the sub-types and gives results in 90 minutes. Dr Baron shared that Cepheid has got a grant to create a finger-stick test for viral load testing, which is battery operated, portable, rugged, relatively affordable, can be run on omni instrument at remote sites. It is hoped to give results in less than 60 minutes, with an accuracy of 500 copies/ml ...
The present invention relates to a power detection circuit and an RF signal amplification circuit including the same. According to one embodiment of the present invention, there is provided a RF matching amplifier comprising: a coupling portion adjacent to an RF matching inductor and extracting induced power; A rectifying unit for rectifying and outputting a signal output from the coupling unit; A slope adjusting unit connected between an output terminal of the rectifying unit and the ground and changing an output signal of the output terminal of the rectifying unit according to a change in internal impedance to adjust a voltage slope for power detection; And a smoothing unit for smoothing the output signal of the output terminal of the rectifying unit into a DC voltage for power detection using a voltage slope. Further, an RF signal amplifying circuit having the RF signal amplifying circuit is proposed.
Our Bilirubin verifier contains both Direct Bilirubin and Total Bilirubin so testing is fully covered. Dedicated for use on Roche Cobas systems, this verifier coming in a lyophilised format and spans five levels ensuring the instruments entire reportable range is measured. ...
Make an appointment for the Holter Monitor Test with Dr. Roya Golshani if you have symptoms, such as irregular palpitations/ heartbeats, chest pain, and shortness of breath.
Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. These tests may have been performed at any time in the past, but the results must be available for review by Serono prior to entry into the study ...
Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. These tests may have been performed at any time in the past, but the results must be available for review by Serono prior to entry into the study ...
MicroStrains cost-effective wireless sensing solutions enable a broad suite of monitoring, testing, and measurement applications. Our expertise in long-range wireless sensor communication, progressive power management, and cloud-based sensor data management enable accessible, long-term monitoring of machines, buildings, vehicles, bridges, wind turbines, conveyor belts and other high value assets.. With MicroStrains wireless sensor networks, structural health monitoring, condition based maintenance, and predictive maintenance can help ensure integrity, safety, and reliability of machines, buildings and structures and more while efficiently and cost-effectively assessing the long-term performance of structure and machine components and preventing costly repairs and downtime.. ...
The farnesoid X receptor (FXR) controls the synthesis and transport of bile acids (BAs). Mice lacking expression of FXR, designated Fxr-null, have elevated levels of serum and hepatic BAs and an increase in BA pool size. Surprisingly, at 12 months of age, male and female Fxr-null mice had a high incidence of degenerative hepatic lesions, altered cell foci and liver tumors including hepatocellular adenoma, carcinoma and hepatocholangiocellular carcinoma, the latter of which is rarely observed in mice. At 3 months, Fxr-null mice had increased expression of the proinflammatory cytokine IL-1beta mRNA and elevated beta-catenin and its target gene c-myc. They also had increased cell proliferation as revealed by increased PCNA mRNA and BrdU incorporation. These studies reveal a potential role for FXR and BAs in hepatocarcinogenesis.
Generally, an immunoaffinity SPR biosensor detects a target analyte in a sample through highly selective adsorption by using the antigen–antibody interaction. For improving the sensitivity, various kinds of particles have been added to the already bound analytes on the SPR biosensor (sandwich assay). In this work, signal amplification was demonstrated by the expression of the IgG-binding Z-domain of protein A on the outer membrane of Escherichia coli via Autodisplay. The amount of Z-domain of protein A expressed on the outer membrane was calculated to be 280,000 molecules per cell. In addition, the IgGbinding ability of the expressed proteinwas characterized using FACS analysis. The signal amplification of the SPR biosensor was performed in the sandwich assay format using a model of horseradish peroxidase (HRP); the limit of detectionwas determined to be significantly improved from1 g/ml to 1 ng/ml. Finally, myoglobin analysis was demonstrated for the medical diagnosis of cardiac ...
Dr Ellen Jo Baron, Emeritus Professor of Pathology at the Stanford University Medical Center and associated with Cepheid, gave the example of Cepheids Xpert HIV1 Viral Load assay which is strictly not a point-of-care test. But it can be done in a small laboratory that has necessary resources. It is fully automated, can identify all the sub-types and gives results in 90 minutes. Dr Baron shared that Cepheid has got a grant to create a finger-stick test for viral load testing, which is battery operated, portable, rugged, relatively affordable, can be run on omni instrument at remote sites. It is hoped to give results in less than 60 minutes, with an accuracy of 500 copies/ml ...
TestLine Clinical Diagnostics s.r.o. - Development, production and distribution of laboratory diagnostics for human and veterinary use
TY - JOUR. T1 - Evaluation of the COBAS AMPLICOR CMV MONITOR test for detection of viral DNA in specimens taken from patients after liver transplantation. AU - Sia, Irene G.. AU - Wilson, Jennie A.. AU - Espy, Mark J.. AU - Paya, Carlos V.. AU - Smith, Thomas F.. PY - 2000/2/16. Y1 - 2000/2/16. N2 - Detection of cytomegalovirus (CMV) DNA in blood by PCR is a sensitive method for the detection of infection in patients posttransplantation. The test, however, has low specificity for the identification of overt CMV disease. Quantitative CMV PCR has been shown to overcome this shortcoming. The COBAS AMPLICOR CMV MONITOR test was evaluated by using consecutive serum and peripheral blood mononuclear cell (PBMN) samples from liver transplant patients. Twenty-five patients had CMV viremia (by shell vial cell culture assay) and/or tissue-invasive disease (by biopsy); 20 had no active infection. A total of 262 serum and 62 PBMN specimens were tested. Of 159 serum specimens from patients with overt CMV ...
Brambilla, D., Granger, S., Jennings, C., & Bremer, J. (2001). Effect of errors in the sequence of optical densities from the Roche Amplicor HIV-1 Monitor assay on the validity of assay results. Journal of Clinical Microbiology, 39, 1118 - 1120. ...
Disease marker detection plays an important role in clinical practice; however, rapid, low-cost and simultaneous detection of multiple trace disease markers remain a challenge because of low abundance of related strategies. Herein, we report a G-quadruplex DNAzyme and nicking enzyme-assisted multiplex chemil
GelRed, GelGreen, EvaGreen - Fluorescence dyes, EtBr substitute Apoptosis and necrosis assay kitsCell biology accessory products Nucleic acid stains for microbiology Enzyme substrates Membrane and organelle stains Qubit® kits - DNA, RNA quantification Spectrophotometers a fluorometers Consumables GelRed Nucleic Acid Gel Stain, 10.000 x in water Biot41003 119 €144,30 € incl. Btw […]. ...
... branched dna signal amplification assay MeSH E05.393.525.640 - oligonucleotide array sequence analysis MeSH E05.393.525.680 - ... branched dna signal amplification assay MeSH E05.393.661.250 - heteroduplex analysis MeSH E05.393.661.475 - in situ ... comet assay MeSH E05.393.560.598 - micronucleus tests MeSH E05.393.600.300 - dna footprinting MeSH E05.393.620.311 - ligase ... colony-forming units assay MeSH E05.200.500.383.910 - tumor stem cell assay MeSH E05.200.500.385 - cytogenetic analysis MeSH ...
... simultaneous branched DNA (bDNA) signal amplification and background suppression. ... DNA and RNA assays, and all other relevant molecular techniques using DNA and RNA. When circulating tumor cells are captured ... Each fully assembled amplification structure is contained within 40−50 bp of target RNA with the capacity for 400-fold signal ... An oligo pair hybridization event is essential for support of the signal amplification structure, which is assembled by a ...
It has also been used as an on-chip signal amplification method for nucleic acid (for both DNA and RNA) microarray assay. In ... Bacteriophage T4 DNA replication intermediates include circular and branched circular concatemeric structures. These structures ... and Vent exo-DNA polymerase for DNA amplification, and T7 RNA polymerase for RNA amplification. Since Phi29 DNA polymerase has ... This amplification technique is named as Rolling circle amplification (RCA). Different from conventional DNA amplification ...
Once converted, there is not enough cDNA to be sequenced so the same DNA amplification techniques discussed in single cell ... Single-cell transcriptomic assays have allowed reconstruction development trajectories. Branching of these trajectories ... and to measure changes in protein expression and cell signaling in response to cancer treatment. Mass Cytometry: rare metal ... Antibody-DNA quantification: another antibody-based method converts protein levels to DNA levels. The conversion to DNA makes ...
... to prevent further amplification. In contrast with MDA, the highly branched DNA network is not formed. Instead, in another ... "A comparison of existing global DNA methylation assays to low-coverage whole-genome bisulfite sequencing for epidemiological ... Using machine learning methods, data from bulk RNA-Seq has been used to increase the signal/noise ratio in scRNA-Seq. ... Due to scant amounts of DNA, accurate analysis of DNA poses problems even after amplification since coverage is low and is ...
Cook's role in providing him one of the first SAM I DNA synthesizers which was used in support of Kary Mullis' PCR research. ... The series of Black Hole Quencher dyes have no native fluorescence, high signal-to-noise ratios providing greater sensitivity, ... RealTimeDesign is meant to help scientists craft custom oligonucleotides, averaging 99% in amplification efficiency through a ... Continually expanding their genomics portfolio offerings, ranging from high quality PCR reagents, custom genotyping assays, ...
Ataxin 1 is involved in a number of signaling pathways and its expression is controlled by signaling pathways. The MAPK/ERK ... The process that turns coded information in DNA into proteins requires two steps: transcription, in which DNA is used to ... Amplification is done using polymerase chain reactions or PCR. The choice of primers can allow either for a single gene to be ... For repeat lengths within the range where interruptions are relevant, assays like CE and PAGE will not determine if the strain ...
DNA virus. HBV (B). RNA virus. CBV. HAV (A). HCV (C). HDV (D). HEV (E). HGV (G). ... In October 2011 the US Food and Drug Administration approved the Aptima HPV Assay test for RNA created when and if any HPV ... Studies suggest that HPV evolved along five major branches that reflect the ethnicity of human hosts, and diversified along ... Rampias T, Boutati E, Pectasides E, Sasaki C, Kountourakis P, Weinberger P, Psyrri A (2010). "Activation of Wnt signaling ...
Chain-termination methods require a single-stranded DNA template, a DNA primer, a DNA polymerase, normal ... A major branch of genomics is still concerned with sequencing the genomes of various organisms, but the knowledge of full ... In turn, proteins make up body structures such as organs and tissues as well as control chemical reactions and carry signals ... Kawashima EH, Farinelli L, Mayer P (12 May 2005). "Method of nucleic acid amplification". Retrieved 2012-12-22. Mardis ER (2008 ...
Although much less commonly available, nucleic acid testing (e.g., viral RNA or proviral DNA amplification method) can also ... Nef's function in non-pathogenic forms of SIV is to downregulate expression of inflammatory cytokines, MHC-1, and signals that ... Although IFA can be used to confirm infection in these ambiguous cases, this assay is not widely used. In general, a second ... these subtypes form branches in the phylogenetic tree representing the lineage of the M group of HIV-1. Co-infection with ...
The forming ribosomal RNA strands are visible as branches from the main DNA strand.[citation needed] ... Run-off transcription assay: identifies transcription start sites (TSS). *Nuclear run-on assay: measures the relative abundance ... amplification of particular mRNA), so many mRNA molecules can be rapidly produced from a single copy of a gene.[citation needed ... "TNFα signals through specialized factories where responsive coding and miRNA genes are transcribed". The EMBO Journal. 31 (23 ...
Moreover, bulk assays fail to identify if a change in the expression profile is due to a change in regulation or composition, ... Wildsmith, S. E.; Archer, G. E.; Winkley, A. J.; Lane, P. W.; Bugelski, P. J. (1 January 2001). "Maximization of signal derived ... Fluorescent dyes are used as reporter molecules to detect the PCR product and monitor the progress of the amplification - the ... Another control uses unique molecular identifiers (UMIs)-short DNA sequences (6-10nt) that are added to each cDNA before ...
positive regulation of DNA biosynthetic process. • regulation of gene expression. • canonical Wnt signaling pathway. • negative ... Myc overexpression stimulates gene amplification,[12] presumably through DNA over-replication.. There have been several studies ... branching involved in ureteric bud morphogenesis. • cellular response to drug. • negative regulation of cell division. • ... "Comprehensive genomic profiling of epithelial ovarian cancer by next generation sequencing-based diagnostic assay reveals new ...
"Method of nucleic acid amplification". Retrieved 2012-12-22.. *^ Mardis ER (2008). "Next-generation DNA sequencing methods" ... A major branch of genomics is still concerned with sequencing the genomes of various organisms, but the knowledge of full ... and the detected electrical signal will be proportionally higher.[59] ... of epigenetics on a global level has been made possible only recently through the adaptation of genomic high-throughput assays. ...
Many diagnostic tests have been developed, including glasshouse pot assays, petri dish assays and chlorophyll fluorescence. A ... Target-site resistance may also be caused by an overexpression of the target enzyme (via gene amplification or changes in a ... Alberto D, Serra AA, Sulmon C, Gouesbet G, Couée I (2016) «Herbicide-related signaling in plants reveals novel insights for ... is the first step in the synthesis of the branched-chain amino acids (valine, leucine, and isoleucine). These herbicides slowly ...
mTOR signaling pathway[edit]. It appears that growth factors, amino acids, ATP, and oxygen levels regulate mTOR signaling. ... "DNA Repair. 8 (9): 1004-8. doi:10.1016/j.dnarep.2009.04.006. PMC 2725225. PMID 19464237.. ... In the 1980s rapamycin was evaluated by the Developmental Therapeutic Branch of the National Cancer Institute (NCI). It was ... like PI3K amplification/mutation, PTEN loss of function, AKT overexpression, and S6K1, 4EBP1, and eIF4E overexpression have ...
Selective DNA isolationEdit. PCR allows isolation of DNA fragments from genomic DNA by selective amplification of a specific ... PCR assays can be performed directly on genomic DNA samples to detect translocation-specific malignant cells at a sensitivity ... so successful amplification with an SNP-specific primer signals presence of the specific SNP in a sequence.[40] See SNP ... University of Texas Medical Branch at Galveston. ISBN 978-0963117212. . PMID 21413270.. ...
... directly binds to DNA, with higher affinity for branched DNA structures. This ability to bind to DNA contributes to its ... signal transduction involved in G2 DNA damage checkpoint. • regulation of signal transduction by p53 class mediator. ... "Real-time PCR-based gene dosage assay for detecting BRCA1 rearrangements in breast-ovarian cancer families". Clin. Genet. 65 (2 ... Multiplex Ligation-dependent Probe Amplification (MLPA),[55] and Quantitative Multiplex PCR of Short Fluorescent Fragments ( ...
Many diagnostic tests have been developed, including glasshouse pot assays, petri dish assays and chlorophyll fluorescence. A ... Target-site resistance may also be caused by an over-expression of the target enzyme (via gene amplification or changes in a ... Alberto, Diana; Serra, Anne-Antonella; Sulmon, Cécile; Gouesbet, Gwenola; Couée, Ivan (2016). "Herbicide-related signaling in ... is part of the first step in the synthesis of the branched-chain amino acids (valine, leucine, and isoleucine). These ...
Rhee, S. G. (2006). «CELL SIGNALING: H2O2, a Necessary Evil for Cell Signaling». Science. 312 (5782): 1882-3. PMID 16809515. ... Cao G, Alessio H, Cutler R (1993). «Oxygen-radical absorbance capacity assay for antioxidants». Free Radic Biol Med. 14 (3): ... Iverson F (1995). «Phenolic antioxidants: Health Protection Branch studies on butylated hydroxyanisole». Cancer Lett. 93 (1): ... Valko, Marian; Izakovic, Mario; Mazur, Milan; Rhodes, Christopher J.; Telser, Joshua (2004). «Role of oxygen radicals in DNA ...
Koger CH, Shaner DL, Henry WB, Nadler-Hassar T, Thomas WE, Wilcut JW (2005). "Assessment of two nondestructive assays for ... The IARC monograph noted that glyphosate-based formulations can cause DNA strand breaks in various taxa of animals in vitro.[ ... "The shikimate pathway and its branches in apicomplexan parasites". The Journal of Infectious Diseases. 185 (Suppl 1): S25-36. ... "Gene amplification delivers glyphosate-resistant weed evolution". Proceedings of the National Academy of Sciences of the ...
The forming ribosomal RNA strands are visible as branches from the main DNA strand.[citation needed] ... Run-off transcription assay: identifies transcription start sites (TSS). *Nuclear run-on assay: measures the relative abundance ... amplification of particular mRNA), so many mRNA molecules can be rapidly produced from a single copy of a gene.[citation needed ... "TNFα signals through specialized factories where responsive coding and miRNA genes are transcribed". EMBO J. CiteSeerX 10.1. ...
Analysis by branched -chain DNA (bDNA) signal amplification assay. Together they form a unique fingerprint. * Sort by ... Biological dynamics of viral load in hemodialysis patients with HCV infection: Analysis by branched -chain DNA (bDNA) signal ... Dinamica biologica dellinfezione da virus dellepatite C (HCV) nei pazienti emodializzati cronici: Studio con bDNA assay. ...
Mesh term Branched DNA Signal Amplification Assay. Browse to parent terms:. Molecular Probe Techniques. Nucleic Acid ... A molecular probe technique that utilizes branched DNA (bDNA) as a means to amplify the hybridization signal. One end of the ... while the other end of the bDNA molecule contains many branches of DNA that are designed to bind a probe used for signal ...
Branched DNA Signal Amplification Assay.. The mRNA expression of mouse Kim-1 (kidney injury molecule-1), PCNA (proliferating ... were quantified using the branched DNA 1.0 signal amplification assay (Affymetrix, Inc.) (Hartley and Klaassen, 2000). Novel ... differential expression of rat hepatic cytochrome P450 mRNA transcripts using branched DNA signal amplification technology. ... Transcription Factor Binding Assays.. Nuclear extracts were used to quantify DNA binding of Nrf2 and the p65 subunit of nuclear ...
Branched DNA Signal Amplification Assay.. Reagents required for RNA analysis (i.e., lysis buffer, amplifier/label probe buffer ... were analyzed for mRNA expression of each gene by branched DNA signal amplification assay. The data are represented as the ... were analyzed for mRNA expression of each gene by branched DNA signal amplification assay. Because Asbt, IBABP, and Fgf15 are ... were analyzed for mRNA expression of each transporter by branched DNA signal amplification assay. The data are represented as ...
Branched DNA Assay. In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification ... The assay can be used to detect and quantify many types of RNA or DNA target. In the assay, branched DNA is mixed with a sample ... Famous quotes containing the words assay, branched and/or dna:. "The lyf so short, the craft so longe to lerne,. Th assay so ... Several different short single-stranded DNA molecules (oligonucleotides) are used in a branched DNA-assay. The capture and ...
... branched dna signal amplification assay MeSH E05.393.525.640 - oligonucleotide array sequence analysis MeSH E05.393.525.680 - ... branched dna signal amplification assay MeSH E05.393.661.250 - heteroduplex analysis MeSH E05.393.661.475 - in situ ... comet assay MeSH E05.393.560.598 - micronucleus tests MeSH E05.393.600.300 - dna footprinting MeSH E05.393.620.311 - ligase ... colony-forming units assay MeSH E05.200.500.383.910 - tumor stem cell assay MeSH E05.200.500.385 - cytogenetic analysis MeSH ...
Signal-based amplification such as oligonucleotide ligation assay (OLA), Q.β. RNA replicase (Lizardi and Kramer. 1991. TIB 9: ... Biotechniques 9: 142-147) and branched DNA (bDNA) (Urdea. 1993. Clin. Chem. 39: 725-726), amplify or alter a signal from a ... Direct linear amplification thermal cycle sequencing34,35 of double stranded PCR products was accomplished using exo− Pfu DNA ... DNA Amplification. Total cellular DNAs were on hand in our laboratory stocks. These had been purified by conventional methods ...
... this invention enables the extraction of circulating RNA from plasma or serum and utilizes nucleic acid amplification assays ... using nucleic acid amplification assays, such as, but not limited to, polymerase chain reaction (RT-PCR), branched DNA signal ... branched DNA signal amplification, transciption-based amplification, amplifiable RNA reporters, boomerang DNA amplification, ... branched DNA signal amplification, and self-sustained sequence replication assays, such as isothermal nucleic acid sequence ...
Rapid and precise quantification of HIV-1 RNA in plasma using a branched DNA signal amplification assay. J Acquir Immune Defic ...
... is a ubiquitous DNA virus that infects the majority of the adult population. In the immunocompetent host, infection is ... Quantification of cytomegalovirus DNA in peripheral blood leukocytes by a branched-DNA signal amplification assay. J Clin ... Comparison of three assays for cytomegalovirus detection in AIDS patients at risk for retinitis. J Clin Microbiol. 2000 Feb. 38 ... Quantitative cytomegalovirus DNA level in the blood and its relationship to cytomegalovirus retinitis in patients with acquired ...
... is a ubiquitous DNA virus that infects the majority of the adult population. In the immunocompetent host, infection is ... Quantification of cytomegalovirus DNA in peripheral blood leukocytes by a branched-DNA signal amplification assay. J Clin ... Comparison of three assays for cytomegalovirus detection in AIDS patients at risk for retinitis. J Clin Microbiol. 2000 Feb. 38 ... Cytomegalovirus (CMV) blood DNA load, CMV retinitis progression, and occurrence of resistant CMV in patients with CMV retinitis ...
Quantitation of HBV DNA in human serum using branched DNA signal amplification assay.Am. J. Clin. Pathol.1041995537546. ... bDNA hybridization assay and serology.HBV DNA in serum was quantitated by the signal amplification method with enzymatically ... The presence of HBV DNA in these samples was then assessed by RTD-PCR and bDNA signal amplification assays. ... the assay has been replaced by a simpler and more accurate HBV DNA quantification system that uses a branched-DNA (bDNA) probe ...
Urdea, M. S. Branched DNA signal amplification. Does bDNA represent post-PCR amplification technology? Biotechnology 12:926-927 ... Carlowicz, M. Rapid tuberculosis assay under expedited FDA review. Clin. Lab. News July 1-4, 1995.Google Scholar ... Wilber, J. C. Direct quantification of viral nucleic acids using branched DNA (bDNA) signal amplification: methodology and ... Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase Science 239:487-491, 1988.PubMedCrossRef ...
... simultaneous branched DNA (bDNA) signal amplification and background suppression. ... DNA and RNA assays, and all other relevant molecular techniques using DNA and RNA. When circulating tumor cells are captured ... Each fully assembled amplification structure is contained within 40−50 bp of target RNA with the capacity for 400-fold signal ... An oligo pair hybridization event is essential for support of the signal amplification structure, which is assembled by a ...
Quantification of hepatitis C virus RNA in serum by branched DNA-based signal amplification assays.J. Virol. Methods791999227 ... Branched DNA signal amplification for direct quantitation of nucleic acid sequences in clinical specimens.Adv. Clin. Chem.33 ... the direct quantitative analysis of nucleic acids based on signal amplification after hybridization is designated branched DNA ... Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase.Science2391988487491. ...
1997) A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic ... 2006) A multiplex branched DNA assay for parallel quantitative gene expression profiling. Anal. Biochem. 352, 50-60. ... This method is hybridization-based and incorporates branched DNA (bDNA) technology (44, 45). Because it relies on signal ... Multiplex Assays for Measuring Cytokine Protein Level. Multiplex assays for 66 mouse cytokines (covering most of the well- ...
... probe amplification using ligase chain reaction or Q-beta replicase; and (3) signal amplification, as in branched DNA assay.1 ... Conventional PCR is designed to result in the amplification of a specific DNA fragment and subsequent analysis is required to ... transcription mediated amplification, nucleic acid sequence based amplification (NASBA), and so on; (2) ... Mutations in DNA sequences can also be detected by real time PCR, as the stability of the probe-target duplex can be measured. ...
DNA polymerases have evolved for billions of years to accept natural nucleoside triphosphate substrates with high fidelity and ... DNA polymerases have evolved for billions of years to accept natural nucleoside triphosphate substrates with high fidelity and ... 1997). A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic ... coli and Bacillus DNA polymerase I, Thermus aquaticus DNA polymerase and the T7 RNA and DNA polymerases. It also includes the ...
These characterized transcripts were then quantified using the bDNA assay. Comparisons were made using a ratio of signal per ... signal amplification technology. For example, HIV RNA is detected in a plasma sample by hybridization of multiple specific ... Branched DNA for quantification of viral load.. Wilber JC1.. Author information. 1. Chiron Corporation, Emeryville, California ... acids in patient samples can be quantified directly using a solid phase nucleic acid hybridization assay based on branched DNA ...
Pachl et al., 1995, "Rapid and Precise Quantification of HIV-1 RNA in Plasma Using a Branched DNA Signal Amplification Assay", ... Pachl et al., 1995, Rapid and Precise Quantification of HIV 1 RNA in Plasma Using a Branched DNA Signal Amplification Assay , J ... 5.1.12 QUALITATIVE DNA PCR. Qualitative DNA PCR was performed on lyzed cells without purification of DNA. Amplification was ... viral DNA synthesis was measured by qualitative DNA PCR following infection. No significant HIV-1 DNA PCR signal was observed ...
Quantitative assays for the measurement of SIV RNA were performed by using a branched chain DNA signal amplification assay ... Because the incorporation of BrdUrd into cellular DNA occurs via the nucleotide salvage pathway, which is preferentially used ... BrdUrd is incorporated into the DNA of dividing cells, is not reused after incorporation, and can be detected by flow ... specific for SIV (18). The lower quantitation limit of this assay is 10,000 copies of SIV RNA per milliliter of plasma. ...
... which was measured as the concentration of HIV-1 RNA found using a sensitive branched-DNA signal-amplification assay. ...
... and a branched DNA (deoxyribonucleic acid) signal amplification assay (Quantiplex™ HCV RNA Assay (bDNA), Chiron Corp., ... and a branched DNA (bDNA) test. Quantitative assays for measuring the viral load (titer), of HCV RNA have been developed. Many ... DNA sequences encoding IFN-con can be synthesized as described in the aforementioned patents or other standard methods. ... Such individuals include anti-HCV ELISA-positive individuals, and individuals with a positive recombinant immunoblot assay ( ...
... nucleic acid amplification with or without enrichment for mutant DNA. In particular, the invention relates to the detection, ... extracellular mutant oncogenes or tumor-associated DNA found in the plasma or serum fraction of blood by using rapid DNA ... Specifically, the invention relates to detection of nucleic acid derived from mutant oncogenes or other tumor-associated DNA, ... malignancies carrying tumor-related mutations of DNA and methods for monitoring cancer and other neoplastic disorders in humans ...
HIV-1 QT assay, Organon Teknika) or signal amplification methods (e.g., branched DNA {bDNA}, Quantiplex (TM) HIV RNA bDNA assay ... Rapid and precise quantification of HIV-1 RNA in plasma using a branched DNA signal amplification assay. J Acquir Immune Defic ... Clinical evaluation of branched DNA signal amplification for quantifying HIV type 1 in human plasma. AIDS Res Hum Retroviruses ... Target amplification assays are more sensitive (400 copies HIV RNA/mL plasma) than the first generation bDNA assay (10,000 ...
Detectable viral load measured by polymerase chain reaction (PCR) amplification, branched chain DNA (bDNA) signal amplification ... In the absence of documented historical confirmation, an assay of HIV antibodies will be included in the Screening Laboratory ... Presence of HIV antibodies confirmed by either Western blot or immunofluorescence assay. ...
Branched DNA (bDNA) Assays. Oatp4 mRNA levels in liver were determined by the quantitative branched DNA signal amplification ... differential expression of rat hepatic cytochrome P450 mRNA transcripts using branched DNA signal amplification technology. ... Electrophoretic Mobility Shift Assays. The DNA sequence of the sense strand of each oligonucleotide is listed in Table 1. ... assay (QuantiGene bDNA Signal Amplification Kit; Bayer Corp.-Diagnostics Div., Tarrytown, NY) (Hartley and Klaassen, 2000). ...
Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay. AIDS 1994; 7 ( ... Mulder J, McKinney N, Christopherson C, Sninsky J, Greenfield L, Kwok S. Rapid and simple PCR assay for quantitation of human ... Discordance of RT sequences conferring ZDV resistance in proviral DNA from brain and spleen. HIV Drug Resistance Third ... resistant human immunodeficiency virus isolates to antiviral agents determined by using a quantitative plaque reduction assay. ...
The QuantiGene assay uses branched DNA (bDNA) technology, relying on signal amplification instead of target amplification for ... Plus: 6 tips for QuantiGene assays When you want an assay that can detect nucleic acids, youll likely choose the high-quality ... xMAP®-powered Assay Provides Critical Clues from Liquid Biopsy Samples. Posted on March 5, 2019. (February 14, 2019) by Hilary ... 5 Tips for Multiplex Kit Users and Assay Developers. Posted on November 21, 2017. (February 12, 2019) by Hilary Graham ...
  • Polymerase chain reaction-based assays of vitreous samples for the diagnosis of viral retinitis. (medscape.com)
  • The DNA polymerase assay has been widely used for monitoring antiviral treatments. (asm.org)
  • In this assay, levels of DNA polymerase are quantified in vitro by the incorporation of radio-labeled deoxynucleoside monophosphates ( 8 ), which is difficult to standardize among laboratories ( 3 ). (asm.org)
  • This chapter will review the original discovery of the PCR in which the synthetic cycles were driven by the Klenow firagment of DNA polymerase I, and the rapid development of this exciting technology after the introduction of the heat-resistant Thermus aquaticus (Taq) polymerase. (springer.com)
  • Kawasaki, E., Saiki, R., and Erlich, H. Genetic analysis using polymerase chain reactionamplified DNA and immobilized oligonucleotide probes: reverse dot-blot typing. (springer.com)
  • Eckert, K. A. and Kunkel, T. A. DNA polymerase fidelity and the polymerase chain reaction. (springer.com)
  • Currently, many DNA polymerases are used in polymerase chain reaction (PCR) and other procedures that involve the copying of nucleic acids. (frontiersin.org)
  • 1992) "Nested polymerase chain reaction of cellular DNA in plasma: a rapid method to investigate th collagen type I A2 MspI polymorphic restriction site in alcoholic patients. (patentgenius.com)
  • HCV molecular assays, such as detection of HCV -RNA by reverse transcription and polymerase chain reaction, were developed to detect live virus particles and for use in following therapeutic efficacy. (indmedica.com)
  • Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. (clinicaltrials.gov)
  • RNA oligonucleotides are synthesized using a small, circular DNA template which lacks an RNA polymerase promoter sequence. (google.com)
  • The signal was markedly attenuated in cell lines and in prostate tissue slices after pharmacologic inhibition of RNA polymerase I (Pol I) using BMH-21 or actinomycin D, and by RNAi depletion of Pol I, demonstrating validity as a measure of Pol I activity. (aacrjournals.org)
  • The GR transcript profiles of various lymphoid cell lines and 4 bone marrow samples from patients with T-cell ALL were analyzed using both an optimized branched DNA (bDNA) assay and a real-time quantitative reverse transcription-polymerase chain reaction assay. (bvsalud.org)
  • Technique that utilizes low-stringency polymerase chain reaction (PCR) amplification with single primers of arbitrary sequence to generate strain-specific arrays of anonymous DNA fragments. (harvard.edu)
  • a) Detection methods evidence nucleic acids in fluid or tissue samples, mainly using the polymerase chain reaction (PCR), but also newly developed techniques, such as the NASBA (nucleic-acid-sequence-based amplification), the Q-beta reaction, and the LCR (ligase chain reaction), and techniques that localize viral RNAs in tissue (in situ hybridization, in situ PCR). (semanticscholar.org)
  • Its cost has been estimated to be around 4-10 times lesser than the in-house reverse transcription-polymerase (RT-PCR) assays. (oncquest.net)
  • The initiator protein remains bound to the 5' phosphate end of the nicked strand, and the free 3' hydroxyl end is released to serve as a primer for DNA synthesis by DNA polymerase III. (wikipedia.org)
  • RNA polymerase and DNA polymerase III then replicate the single-stranded origin (SSO) DNA to make another double-stranded circle. (wikipedia.org)
  • DNA polymerase I removes the primer, replacing it with DNA, and DNA ligase joins the ends to make another molecule of double-stranded circular DNA. (wikipedia.org)
  • Quantitation of hepatitis B virus (HBV) DNA in serum is a useful method for the monitoring of HBV replication. (asm.org)
  • The efficacy of this assay was evaluated by quantitatively measuring sequential levels of synthetic DNA and DNA in clinical serum samples. (asm.org)
  • 1991) " Rapid Purification of Hepatitis B Virus DNA from Serum. (patentgenius.com)
  • Detecting Tumor-related Alteractions in Plasma or Serum DNA of patients Diagnosed with Breast Cancer," Clinical Cancer Research, Sep. (patentgenius.com)
  • 1993) "Amplification of Specific Gene Products from Human Serum. (patentgenius.com)
  • Both types of assays detected anti-HCV antibodies in serum. (indmedica.com)
  • After the virus was characterized, an enzyme-linked immunosorbent assay (ELISA) was developed for detecting anti- HCV antibodies in serum. (indmedica.com)
  • Quantitation of serum hepatitis B virus (HBV) DNA has proven useful in assisting with patient management and treatment and several commercially available assays have been developed to quantify serum HBV-DNA levels. (nih.gov)
  • Branched DNA (bDNA) is a signal amplification nucleic acid probe assay for the direct quantitation of viral RNA in serum or plasma. (cell-penetrating-peptides.com)
  • One end of the bDNA molecule is designed to bind a specific target, while the other end of the bDNA molecule contains many branches of DNA that are designed to bind a probe used for signal detection. (mcw.edu)
  • We detected HBV DNA by real-time detection PCR (RTD-PCR) based on Taq Man chemistry. (asm.org)
  • The detection limit of this system was as few as 10 DNA copies/reaction. (asm.org)
  • In this report, we show our results of a highly sensitive assay for HBV DNA by real-time detection PCR (RTD-PCR) based on Taq Man chemistry ( 5 ). (asm.org)
  • 1991) "Electrochemiluminescence Detection of Immunoassays and DNA Probe Assays for Clinical Diagnostics. (patentgenius.com)
  • 1990) "Diagnosis of Chylamydia trachomatis Cervical Infection by Detection of Amplified DNA with and Enzyme Immunoassay. (patentgenius.com)
  • In fact, the problem of false positivity as well as detection of lately produced or pre-existing antibodies with first and second generation ELISA , prompted the researchers to further improve the assay system. (indmedica.com)
  • Sales and support for MAGPIX, 100/200, and FLEXMAP 3D Luminex instrument systems involving detection by Luminex xMAP (multianalyte profiling) technology with Invitrogen ProcartaPlex assays. (thermofisher.com)
  • The system delivers fast and cost-effective immunoassay profiling and gene expression analysis through the multiplex quantitative measurement and detection of protein, RNA, and DNA. (thermofisher.com)
  • The specific amplification and detection of an oligonucleotide sequence went from the fictional to the mundane in the span of two decades. (asmscience.org)
  • Misincorporation can produce amplicon mismatched to detection probes and can also result in inefficient amplification (especially when longer genetic stretches are targeted), due to primer mismatch in subsequent amplification rounds. (asmscience.org)
  • The protocols take advantage of optimized tyramide signal amplification (TSA) conditions of the PO assay and long-lasting high signal-to-noise ratio of the AP reaction, thereby enabling detection of less abundant transcripts. (su.se)
  • This precursor rRNA assay has potential utility for detection of increased rRNA production in various tumor types and as a novel companion diagnostic for clinical trials involving Pol I inhibition. (aacrjournals.org)
  • the other end has multiple branches of DNA that bind to a probe for signal detection. (thefreedictionary.com)
  • This paper reports on the development and validation of a loop-mediated isothermal amplification assay (LAMP) for the rapid and specific detection of Actinobacillus pleuropneumoniae (A. pleuropneumoniae). (bvsalud.org)
  • Moreover, the LAMP assay provided a rapid yet simple test of A. pleuropneumoniae suitable for laboratory diagnosis and pen-side detection due to ease of operation and the requirement of only a regular water bath or heat block for the reaction. (bvsalud.org)
  • Fundamentally different from target amplification methods such as PCR, the bDNA assay directly measures nucleic acid molecules at physiological levels by boosting the reporter signal, rather than replicating target sequences as the means of detection, and hence avoids the errors inherent in the extraction and amplification of target sequences. (mybiosource.com)
  • These improvements have extended the quantitative detection limit of the bDNA assay to as low as 50 molecules. (mybiosource.com)
  • The bDNA assay uses a 96-well microplate format, and is based on a series of specific hybridization reactions and chemiluminescent detection of hybridized probes. (mybiosource.com)
  • Detection of the target nucleic acid and amplification of the signal is accomplished through another series of hybridizations. (mybiosource.com)
  • Detection occurs after binding of marked DNA fragments. (hivbook.com)
  • The aptasensor makes it possible to detect from 0.1 to 100 nM of OTA (limit of detection: 0.02 nM) in the presence of at least 50 fold excess of ochratoxin B. The applicability of the aptasensor for real sample assay was confirmed by testing spiked beer samples. (mdpi.com)
  • Two or more amplification oligomers can be used to allow multiplexed amplifications of two or more nucleic acids of interest with deconvolution based on unique detection signals or unique signal locations. (patentsencyclopedia.com)
  • The branches amplify detection signals. (cell-penetrating-peptides.com)
  • Investigations for diagnosis of HCV infection include serological assays for antibodies to hepatitis C (anti- HCV) and molecular assays for detection of viral RNA. (oncquest.net)
  • HCV nucleic acid detection relies on either amplification of the detection signal or amplification of the nucleic acid target. (oncquest.net)
  • Quantitative assays using RT-PCR methods have a lower limit of detection of 50 IU/mL (Amplicor v2.0® and Cobas v2.0®, Roche). (oncquest.net)
  • Also, by gradually increasing the SAW generation voltage, a SAW actuation-based DNA melting method could be used for multiplex detection. (gla.ac.uk)
  • The analytical sensitivity of colorimetric LAMP assays was tested by WHO International Standard DNA, with the limit of detection down to 105 IU/ml. (gla.ac.uk)
  • Detection of junctional diversity is based upon electrophoretic separation of single stranded (ss) and double stranded (ds) DNA molecules via mobility shifts due to nucleotide sequence polymorphism. (tudelft.nl)
  • The presence of CMV in blood (as measured by culture, CMV DNA amplification, or antigen detection) is a risk factor for the development of CMV disease in patients with AIDS [ 4 ]. (uptodate.com)
  • Quantitative methods that rely on target amplification include transcription-mediated amplification (TMA) and nucleic acid sequenced-based amplification (NASBA). (asmscience.org)
  • and, occasionally, Nucleic Acid Sequence-Based Amplification (NASBA). (hivbook.com)
  • 3). A produção de antígenos e peptídeos sintéticos possibilitou o desenvolvimento de testes que permitem a detecção de anticorpos contra o VHC (anti-VHC), como os testes ELISA ( enzyme-linked immunosorbent assay ) e RIBA ( recombinant immunoblot assay ). (scielosp.org)
  • Plus: 6 tips for QuantiGene assays When you want an assay that can detect nucleic acids, you'll likely choose the high-quality Invitrogen™ ProcartaPlex™ and QuantiGene™ Plex assays from Thermo Fisher Scientific, a Luminex partner. (luminexcorp.com)
  • The QuantiGene assay uses branched DNA (bDNA) technology, relying on signal amplification instead of target amplification for optimal quantitation of transcripts. (luminexcorp.com)
  • The Invitrogen QuantiGene Plex Assay utilizes xMAP Luminex beads for multiplexing of 3 to 80 RNA targets followed by branched DNA-based signal amplification. (thermofisher.com)
  • The Invitrogen QuantiGene Plex DNA CNV Assay is a 96-well, hybridization-based assay that utilizes xMAP Luminex magnetic beads for multiplexing of 3 to 33 DNA targets and branched-DNA signal amplification technology to quantify DNA targets. (thermofisher.com)
  • QuantiGene™ RNA assays are 96- and 384- well, hybridization-based assays that utilize a branched DNA technology for signal amplification for the direct quantitation of gene expression. (thermofisher.com)
  • Welcome to the new era of quantitative targeted gene and microRNA expression profiling using eBiosciences' QuantiGene Plex assays . (oceanridgebio.com)
  • The QuantiGene workflow has also removed the reverse transcription and PCR amplification steps which eliminates any associated artifacts and enables reduced sample consumption. (oceanridgebio.com)
  • ORB provides cost-effective customizable QuantiGene assays to rapidly characterize mRNA and microRNA targets as standalone projects or confirmation studies following broader interrogation strategies such as RNA sequencing and gene expression and microRNA microarray . (oceanridgebio.com)
  • To support biomarker discovery projects, ORB's predictive modeling analyses can be used to select the best performing targets for validation using QuantiGene assays. (oceanridgebio.com)
  • Contact us for sample-specific starting input requirements for the QuantiGene assays and the appropriate sample submission checklist for your study. (oceanridgebio.com)
  • Contact Us to learn how QuantiGene assays can advance your targeted nucleic acid research! (oceanridgebio.com)
  • We have evaluated the efficacy of this system using synthetic standard HBV DNA and several clinical samples and have assessed the correlation between the results obtained by this assay and those obtained using the bDNA assay. (asm.org)
  • Mullis, K. B. and Faloona, F. A. Specific synthesis of DNA in vitro via a polymerasecatalyzed chain reaction. (springer.com)
  • These amplification strategies include branched DNA-based RNAscope and in situ hybridization chain reaction (HCR) techniques, as well as alkaline phosphatase (AP)- and horseradish peroxidase (PO)-based immunoassays. (su.se)
  • 3). The development of a novel branched Hybridization Chain Reaction (HCR) assay. (gla.ac.uk)
  • and (ii) signal amplification systems (including probe amplification methods), such as branched-DNA technologies (bDNA) and cleavage-based signal amplification (cycling probe technologies [CPT] and Invader assays). (asmscience.org)
  • Commercially available quantitative signal and probe amplification methods include the branched DNA (bDNA) method and the Invader assay, respectively. (asmscience.org)
  • Secondly, although a preliminary diagnosis in clinical virology does not require quantitation, it should be clarified whether direct quantitative molecular methods are likely to provide, in the near future, a real alternative to classic culture techniques or immunological assays in the laboratory evaluation of most (all) viral infections. (asm.org)
  • The multiplex quantitation capability of an assay is dependent upon instrument model, and ranges from 50 analytes with use of the MAGPIX, to 500 analytes with the FLEXMAP 3D. (thermofisher.com)
  • Recombinant immunoblot assay. (cdc.gov)
  • In this project, surface acoustic wave (SAW) signals are generated by interdigitated transducer (IDT) on LiNbO3 and propagated into disposable silicon superstrates on which a droplet of Loop-mediated isothermal amplification (LAMP) reaction mixture has been placed. (gla.ac.uk)
  • We attempted to develop a quantitative assay system for HBV DNA that is more sensitive, accurate, and reproducible than existing systems. (asm.org)
  • Enhanced chemiluminescence immunoassay (ECi) a quantitative assay based on chemiluminescent reaction, which is as good as ELISA. (oncquest.net)
  • Test to detect HCV RNA by amplification of viral genetic sequences. (cdc.gov)
  • Tests to detect HCV RNA concentration (viral load) by amplification of viral genetic sequences or by signal amplification. (cdc.gov)
  • DNA polymerases have been classified into evolutionary families based on an analysis of their amino acid sequences. (frontiersin.org)
  • In molecular biology, a hybridization probe is a fragment of DNA or RNA of variable length (usually 100-1000 bases long) which is used in DNA or RNA samples to detect the presence of nucleotide sequences (the DNA target ) that are complementary to the sequence in the probe . (primidi.com)
  • DNA sequences or RNA transcripts that have moderate to high sequence similarity to the probe are then detected by visualizing the hybridized probe via autoradiography or other imaging techniques. (primidi.com)
  • Molecular DNA- or RNA-based probes are now routinely used in screening gene libraries, detecting nucleotide sequences with blotting methods, and in other gene technologies, such as nucleic acid and tissue microarrays. (primidi.com)
  • Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity. (termsreign.ga)
  • 43. The amplification oligomer of claim 33, further comprising two or more sequences complimentary to a capture extender C-3 sequence or to a capture probe C-2 sequence, thereby providing for cooperative hybridization. (patentsencyclopedia.com)
  • 44. The amplification oligomer of claim 32, further comprising two or more sequences complimentary to the label extender L-1 sequence or to the amplification multimer M-1 sequence of the second amplification multimer. (patentsencyclopedia.com)
  • In order to define the extent of T cell heterogeneity and clonality, unique DNA sequences in the junctional region in rearranged T cell receptor (TcR) genes can be studied. (tudelft.nl)
  • With Affymetrix' ViewRNA ISH portfolio for tissue samples, researchers can rapidly design assays for virtually any mRNA transcript or long noncoding RNA in any tissue type. (technologynetworks.com)
  • For example, researchers have designed probes for the bDNA assay to measure cellular mRNA levels. (mybiosource.com)
  • and (iii) in what are often referred to as ''gene expression'' assays, QRT-PCR can be used to determine relative mRNA expression levels for different disease states. (asmscience.org)
  • This brief report describes the sequential modifications and improvements made in the development of various assays for laboratory diagnosis of hepatitis C virus (HCV) infection after its characterization in 1989. (indmedica.com)
  • Important factors that must be considered when selecting HIV-1 diagnostic assays for pediatric patients and when choosing the timing of such assays include the age of the child, potential timing of infection of the child, whether the infection status of the child's mother is known or unknown, the antiretroviral exposure history of the mother and of the child, and characteristics of the virus. (aappublications.org)
  • A diagnosis of HIV-1 infection can be made on the basis of 2 positive HIV-1 DNA or RNA assay results. (aappublications.org)
  • Many clinicians confirm the absence of HIV-1 infection with a negative HIV-1 antibody assay result at 12 to 18 months of age. (aappublications.org)
  • The indomitable aspect of HIV-1 infection is not that HIV-1 proviral DNA is integrated into host DNA but that it can also turn itself off, remaining invisible to drug or immune surveillance. (asm.org)
  • However, the assay may be negative early in acute HCV infection, in immunosuppressed individuals. (oncquest.net)
  • As a simplified version of natural rolling circle replication, an isothermal DNA amplification technique, rolling circle amplification was developed. (wikipedia.org)
  • This system detected HBV DNA in 100% of chronic hepatitis B patients tested and never detected HBV DNA in healthy volunteers who were negative for HBV markers. (asm.org)
  • The performance of the cross-linking assay and the branched-DNA signal amplification (bDNA) assay for the quantitative measurement of HBV-DNA was studied in 99 hepatitis B surface antigen-positive and viraemic patients. (nih.gov)
  • Quantitative measurements of hepatitis C virus RNA in liver biopsy samples using the branched DNA (bDNA) signal amplification assay were carried out. (elsevier.com)
  • Data gathered from medical record review included weight, height, signs and symptoms of hepatitis, alanine aminotransferase (ALT) levels, serologic markers, hepatitis B virus (HBV) DNA levels and serious adverse events (SAEs). (elsevier.com)
  • Failure of Serologic Assays for Diagnosis of Hepatitis and C Virus Infections in Patients with Advanced HIV. (od.ua)
  • A molecular probe technique that utilizes branched DNA (bDNA) as a means to amplify the hybridization signal. (mcw.edu)
  • All these assays have been described in a sequence of their need and place in diagnosis. (indmedica.com)
  • The probe thereby hybridizes to single-stranded nucleic acid (DNA or RNA ) whose base sequence allows probe-target base pairing due to complementarity between the probe and target. (primidi.com)
  • The DNA sequence derived revealed an operon-like gene structure with two open reading frames encoding an 11,122- and a 57,956-Da protein. (faintpower.ml)
  • and, a nucleotide sequence complimentary to a label extender L-2 sequence or to an M-1 sequence of a second amplification multimer. (patentsencyclopedia.com)
  • 33. The amplification oligomer of claim 32, further comprising a nucleotide sequence complimentary to a capture extender C-3 sequence or to a capture probe C-2 sequence. (patentsencyclopedia.com)
  • 34. The amplification oligomer of claim 33, wherein the nucleotide sequence complimentary to the capture extender C-3 sequence or to the capture probe C-2 sequence comprises from 20 to 60 nucleotides. (patentsencyclopedia.com)
  • 35. The amplification oligomer of claim 32, wherein the first amplification multimer is a component of a first bDNA assay, and the label extender L-2 sequence or the M-1 sequence of a second amplification multimer are components of a second bDNA assay. (patentsencyclopedia.com)
  • 36. The amplification oligomer of claim 32, wherein the nucleotide sequence complimentary to an amplification multimer M-2 comprises from 30 to 60 nucleotides. (patentsencyclopedia.com)
  • 37. The amplification oligomer of claim 32, wherein the nucleotide sequence complimentary to the label extender L-2 sequence or to the amplification multimer M-1 sequence of the second amplification multimer comprises from 20 to 40 nucleotides. (patentsencyclopedia.com)
  • 41. Two or more of the amplification oligomers of claim 33, wherein a first amplification oligomer comprises a nucleotide sequence complimentary to a C-3 or C-2 sequence different from a C-3 or C-2 complimentary sequence of a second amplification oligomer. (patentsencyclopedia.com)
  • After Rep, along with other replication proteins, binds to the dsDNA it forms a stem loop where the DNA is then cleaved at the nanomer sequence causing a displacement of the strand. (wikipedia.org)
  • By utilizing branched DNA (bDNA) signal amplification technology on Luminex xMAP beads, these assays can distinguish percentage differences in RNA copy number with a low coefficient of variation, less than 15% for the entire process. (oceanridgebio.com)
  • There are currently more than 60 Luminex Licensed Technologies Partners worldwide that provide kits, assay development, and testing services for the research and diagnostic markets. (luminexcorp.com)
  • We continue to support customers of our pre-existing (non-ProcartaPlex) portfolio of Invitrogen assays for the Luminex platform. (thermofisher.com)
  • The assay is performed in a 96-well plate and signal is detected using a Luminex instrument. (thermofisher.com)
  • Signal is detected using a Luminex instrument. (thermofisher.com)
  • Branched DNA signal amplification on Luminex beads. (oceanridgebio.com)
  • Despite the fact that the starting material is not preamplified, bDNA assays can detect less than 100 copies of HIV-RNA per mL of blood. (primidi.com)
  • Discriminating 93 serotypes takes a lot of beads Ger Rijkers and the Pneumococcal Consortium are working to develop standardized multiplex assays for S. pneumoniae antibodies. (luminexcorp.com)
  • The assay can be used to detect and quantify many types of RNA or DNA target. (primidi.com)
  • A signal amplification (vs target amplification) assay used to detect and quantify nucleic acids (DNA and RNA), based on their hybridisation with long-branched side chains of synthetic DNA containing thousands of chemiluminescent tags. (thefreedictionary.com)
  • These assays can also directly quantify ncRNA, fusion transcripts, and DNA copy number variations. (oceanridgebio.com)
  • Ten-fold serially diluted targets from 105 copies/reaction to 10 copies/reaction were used to quantify the analytical sensitivity of the SAW-LAMP system and measurable signals were found down to 10 copies/reaction. (gla.ac.uk)
  • Anti-HCV antibodies can be detected by rapid immunoassays, enzyme-linked immunosorbent assays (ELISA), or chemiluminescent immunoassays. (oncquest.net)
  • All samples were also tested with commercially available LAMP kit and benchmark real-time PCR assay. (gla.ac.uk)
  • Rolling circle DNA replication is initiated by an initiator protein encoded by the plasmid or bacteriophage DNA, which nicks one strand of the double-stranded, circular DNA molecule at a site called the double-strand origin, or DSO. (wikipedia.org)
  • Using the unnicked strand as a template, replication proceeds around the circular DNA molecule, displacing the nicked strand as single-stranded DNA. (wikipedia.org)
  • Some DNA viruses replicate their genomic information in host cells via rolling circle replication. (wikipedia.org)
  • During replication, at the origin, the E1 hexamer wraps around the single strand DNA and moves in the 3' to 5' direction. (wikipedia.org)
  • This displacement allows the replication fork to progress in the 3' to 5' direction which ultimately yields a new ssDNA strand and a concatameric DNA strand. (wikipedia.org)
  • Bacteriophage T4 DNA replication intermediates include circular and branched circular concatemeric structures. (wikipedia.org)
  • This report develops an analytically validated chromogenic in situ hybridization (CISH) assay using branched DNA signal amplification (RNAscope) for detecting the expression of the 5′ external transcribed spacer (ETS) of the 45S ribosomal (r) RNA precursor in formalin-fixed and paraffin-embedded (FFPE) human tissues. (aacrjournals.org)
  • The labeled probe is first denatured (by heating or under alkaline conditions such as exposure to sodium hydroxide) into single stranded DNA (ssDNA) and then hybridized to the target ssDNA (Southern blotting) or RNA (Northern blotting) immobilized on a membrane or in situ. (primidi.com)
  • Advanced DNA and RNA sequencing technology has created large pools of data that are being studied to better understand the meaning and consequences of variation in genomic DNA and its transcription products. (thermofisher.com)
  • In zebrafish (F)ISH non-enzymatic and enzymatic amplification systems have been employed to obtain enhanced signal intensities and signal-to-noise ratios. (su.se)
  • The label oligonucleotide and the branched DNA then detects the immobilized target nucleic acid . (primidi.com)
  • ends of oligonucleotide probes on a target DNA molecule. (asmscience.org)
  • With the custom design of oligonucleotide probes, the potential applications of the bDNA assay reach far beyond viral nucleic acid quantification. (mybiosource.com)
  • ViewRNA assays utilize branched DNA signal amplification technology to achieve unparalleled sensitivity and specificity, enabling the visualization of targets at the single-molecule level within the context of the tissue morphology. (technologynetworks.com)
  • However, patients with viremia (eg, those with a positive blood CMV DNA test result) do not necessarily have invasive disease. (uptodate.com)
  • DNA polymerases are enzymes that catalyze the template-directed synthesis of DNA. (frontiersin.org)
  • The present invention provides methods for synthesis and therapeutic use of DNA and RNA oligonucleotides and analogs. (google.com)
  • Continued DNA synthesis can produce multiple single-stranded linear copies of the original DNA in a continuous head-to-tail series called a concatemer. (wikipedia.org)
  • The signal is directly proportional to the level of target nucleic acid, and the quantity of HIV RNA in a sample is determined by comparison with a 4-point standard curve. (nih.gov)
  • The bDNA assay is inherently quantitative since the number of photons emitted is directly related to the amount of target nucleic acid in the specimen. (mybiosource.com)
  • Next, an " extender " DNA molecule is added. (primidi.com)
  • Each "extender" has two domains, one that hybridizes to the capture DNA molecule and one that "hangs out" in the air. (primidi.com)
  • A " label extender " DNA molecule is added that has two domains (similar to the first extender). (primidi.com)
  • 14-gene assay interrogates circulating tumor cells Liquid biopsies are opening new avenues for cancer research and diagnosis, but even experts in the field continue to nail down the best protocols for analyzing the cell-free DNA and circulating tumor cells (CTCs) contained in these peripheral blood samples. (luminexcorp.com)
  • Hybridization probes used in DNA microarrays refer to DNA covalently attached to an inert surface, such as coated glass slides or gene chips, to which a mobile cDNA target is hybridized. (primidi.com)
  • A set of six primers were designed derived from the dsbE-like gene of A.pleuropneumoniae and validate the assay using 9 A. pleuropneumoniae reference/field strains, 132 clinical isolates and 9 other pathogens. (bvsalud.org)
  • Following two months of treatment, the rats were euthanized and the gene expressions of BMP-2, OPG, RANKL and MCSF in the femoral bones were measured using a branch - DNA technique. (biomedcentral.com)
  • The present study aimed to investigate the antiproliferative and anti-invasive effects of urolithin A in a stable full-length HBV gene integrated cell line HepG2.2.15 using CCK-8 and transwell assays. (bvsalud.org)
  • After binding of the target to the solid support it can be detected by branched DNA which is coupled to an enzyme (e.g. alkaline phosphatase). (primidi.com)
  • A chemiluminescent signal is generated upon introduction of a dioxetane substrate which is activated by the alkaline phosphatase. (mybiosource.com)
  • c) detecting in a quantitative or qualitative fashion one or more amplified RNA or cDNA products or signals associated with a disease with or without comparison to RNA not associated with a disease, whereby a disease in a human is characterized or evaluated without performance of a biopsy or surgery. (google.com.au)
  • l) a combination or variation thereof that amplifies or signal amplifies the RNA or cDNA. (google.com.au)
  • Data obtained by gel analysis were very similar to those obtained by conventional bacterial cloning and DNA sequencing procedures on the corresponding cDNA clones. (tudelft.nl)
  • A molecular probe technique based on branched DNA (bDNA) for hybridisation signal amplification. (thefreedictionary.com)
  • The first assay developed was the 'first generation ELISA ', followed by assays with further improvement in the sensitivity and specificity, labeled subsequently as ELISA -2 and ELISA -3. (indmedica.com)
  • Genetic subtypes A-F quantified within a factor of 1.5, indicating that the bDNA assay can be used to measure viral load in clinical samples regardless of genotype. (nih.gov)
  • There were significant correlations between both assay platforms when measuring total GR (exon 5/6) transcripts in various cell lines and patient samples, but not for a probe set that detects a specific, low abundance GR transcript (exon 1A3). (bvsalud.org)
  • The branched DNA method (bDNA assay) for signal amplification detects HCV RNA and has a lower limit of quantification of 615 IU/mL. (oncquest.net)
  • C. in each of the samples, separating by size the DNA fragments generated in step (B). (google.com.au)
  • signal amplification occurs via binding of branched DNA fragments to viral RNA. (hivbook.com)
  • Displaced DNA is a lagging strand and is made double stranded via a series of Okazaki fragments. (wikipedia.org)