Branched DNA Signal Amplification Assay: A molecular probe technique that utilizes branched DNA (bDNA) as a means to amplify the hybridization signal. One end of the bDNA molecule is designed to bind a specific target, while the other end of the bDNA molecule contains many branches of DNA that are designed to bind a probe used for signal detection.Nucleic Acid Amplification Techniques: Laboratory techniques that involve the in-vitro synthesis of many copies of DNA or RNA from one original template.Self-Sustained Sequence Replication: An isothermal in-vitro nucleotide amplification process. The process involves the concomitant action of a RNA-DIRECTED DNA POLYMERASE, a ribonuclease (RIBONUCLEASES), and DNA-DIRECTED RNA POLYMERASES to synthesize large quantities of sequence-specific RNA and DNA molecules.Sensitivity and Specificity: Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)Enterohepatic Circulation: Recycling through liver by excretion in bile, reabsorption from intestines (INTESTINAL REABSORPTION) into portal circulation, passage back into liver, and re-excretion in bile.Gallbladder: A storage reservoir for BILE secretion. Gallbladder allows the delivery of bile acids at a high concentration and in a controlled manner, via the CYSTIC DUCT to the DUODENUM, for degradation of dietary lipid.Libraries, NursingBile: An emulsifying agent produced in the LIVER and secreted into the DUODENUM. Its composition includes BILE ACIDS AND SALTS; CHOLESTEROL; and ELECTROLYTES. It aids DIGESTION of fats in the duodenum.Bile Acids and Salts: Steroid acids and salts. The primary bile acids are derived from cholesterol in the liver and usually conjugated with glycine or taurine. The secondary bile acids are further modified by bacteria in the intestine. They play an important role in the digestion and absorption of fat. They have also been used pharmacologically, especially in the treatment of gallstones.Infectious Mononucleosis: A common, acute infection usually caused by the Epstein-Barr virus (HERPESVIRUS 4, HUMAN). There is an increase in mononuclear white blood cells and other atypical lymphocytes, generalized lymphadenopathy, splenomegaly, and occasionally hepatomegaly with hepatitis.Cytomegalovirus Retinitis: Infection of the retina by cytomegalovirus characterized by retinal necrosis, hemorrhage, vessel sheathing, and retinal edema. Cytomegalovirus retinitis is a major opportunistic infection in AIDS patients and can cause blindness.Cytomegalovirus: A genus of the family HERPESVIRIDAE, subfamily BETAHERPESVIRINAE, infecting the salivary glands, liver, spleen, lungs, eyes, and other organs, in which they produce characteristically enlarged cells with intranuclear inclusions. Infection with Cytomegalovirus is also seen as an opportunistic infection in AIDS.Immunocompetence: The ability of lymphoid cells to mount a humoral or cellular immune response when challenged by antigen.Retinitis Pigmentosa: Hereditary, progressive degeneration of the neuroepithelium of the retina characterized by night blindness and progressive contraction of the visual field.Bread: Baked food product made of flour or meal that is moistened, kneaded, and sometimes fermented. A major food since prehistoric times, it has been made in various forms using a variety of ingredients and methods.RNA, Long Noncoding: A class of untranslated RNA molecules that are typically greater than 200 nucleotides in length and do not code for proteins. Members of this class have been found to play roles in transcriptional regulation, post-transcriptional processing, CHROMATIN REMODELING, and in the epigenetic control of chromatin.RNA, Untranslated: RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.RNA, Transfer, Ala: A transfer RNA which is specific for carrying alanine to sites on the ribosomes in preparation for protein synthesis.Alanine-tRNA Ligase: An enzyme that activates alanine with its specific transfer RNA. EC 6.1.1.7.Pacific States: The geographic designation for states bordering on or located in the Pacific Ocean. The states so designated are Alaska, California, Hawaii, Oregon, and Washington. (U.S. Geologic Survey telephone communication)Physical Endurance: The time span between the beginning of physical activity by an individual and the termination because of exhaustion.Muscle, Skeletal: A subtype of striated muscle, attached by TENDONS to the SKELETON. Skeletal muscles are innervated and their movement can be consciously controlled. They are also called voluntary muscles.Physical Conditioning, Animal: Diet modification and physical exercise to improve the ability of animals to perform physical activities.Adaptation, Physiological: The non-genetic biological changes of an organism in response to challenges in its ENVIRONMENT.Receptors, Leptin: Cell surface receptors for obesity factor (LEPTIN), a hormone secreted by the WHITE ADIPOCYTES. Upon leptin-receptor interaction, the signal is mediated through the JAK2/STAT3 pathway to regulate food intake, energy balance and fat storage.Drug-Induced Liver Injury: A spectrum of clinical liver diseases ranging from mild biochemical abnormalities to ACUTE LIVER FAILURE, caused by drugs, drug metabolites, and chemicals from the environment.Leptin: A 16-kDa peptide hormone secreted from WHITE ADIPOCYTES. Leptin serves as a feedback signal from fat cells to the CENTRAL NERVOUS SYSTEM in regulation of food intake, energy balance, and fat storage.Multidrug Resistance-Associated Proteins: A sequence-related subfamily of ATP-BINDING CASSETTE TRANSPORTERS that actively transport organic substrates. Although considered organic anion transporters, a subset of proteins in this family have also been shown to convey drug resistance to neutral organic drugs. Their cellular function may have clinical significance for CHEMOTHERAPY in that they transport a variety of ANTINEOPLASTIC AGENTS. Overexpression of proteins in this class by NEOPLASMS is considered a possible mechanism in the development of multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although similar in function to P-GLYCOPROTEINS, the proteins in this class share little sequence homology to the p-glycoprotein family of proteins.Organic Anion Transporters: Proteins involved in the transport of organic anions. They play an important role in the elimination of a variety of endogenous substances, xenobiotics and their metabolites from the body.Hepatitis C: INFLAMMATION of the LIVER in humans caused by HEPATITIS C VIRUS, a single-stranded RNA virus. Its incubation period is 30-90 days. Hepatitis C is transmitted primarily by contaminated blood parenterally, and is often associated with transfusion and intravenous drug abuse. However, in a significant number of cases, the source of hepatitis C infection is unknown.Hepatitis C, Chronic: INFLAMMATION of the LIVER in humans that is caused by HEPATITIS C VIRUS lasting six months or more. Chronic hepatitis C can lead to LIVER CIRRHOSIS.Hepacivirus: A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.Alanine Transaminase: An enzyme that catalyzes the conversion of L-alanine and 2-oxoglutarate to pyruvate and L-glutamate. (From Enzyme Nomenclature, 1992) EC 2.6.1.2.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Organic Anion Transporters, Sodium-Dependent: A subclass of ORGANIC ANION TRANSPORTERS whose transport of organic anions is driven either directly or indirectly by a gradient of sodium ions.Cholestasis: Impairment of bile flow due to obstruction in small bile ducts (INTRAHEPATIC CHOLESTASIS) or obstruction in large bile ducts (EXTRAHEPATIC CHOLESTASIS).Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Bile Canaliculi: Minute intercellular channels that occur between liver cells and carry bile towards interlobar bile ducts. Also called bile capillaries.Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Nucleic Acids: High molecular weight polymers containing a mixture of purine and pyrimidine nucleotides chained together by ribose or deoxyribose linkages.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Aluminum Oxide: An oxide of aluminum, occurring in nature as various minerals such as bauxite, corundum, etc. It is used as an adsorbent, desiccating agent, and catalyst, and in the manufacture of dental cements and refractories.Silanes: Compounds similar to hydrocarbons in which a tetravalent silicon atom replaces the carbon atom. They are very reactive, ignite in air, and form useful derivatives.Patents as Topic: Exclusive legal rights or privileges applied to inventions, plants, etc.Bone Marrow Transplantation: The transference of BONE MARROW from one human or animal to another for a variety of purposes including HEMATOPOIETIC STEM CELL TRANSPLANTATION or MESENCHYMAL STEM CELL TRANSPLANTATION.Transplantation Chimera: An organism that, as a result of transplantation of donor tissue or cells, consists of two or more cell lines descended from at least two zygotes. This state may result in the induction of donor-specific TRANSPLANTATION TOLERANCE.China: A country spanning from central Asia to the Pacific Ocean.Homosexuality, Male: Sexual attraction or relationship between males.Esophageal Neoplasms: Tumors or cancer of the ESOPHAGUS.HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Archives

Multicenter comparison of Roche COBAS AMPLICOR MONITOR version 1.5, Organon Teknika NucliSens QT with Extractor, and Bayer Quantiplex version 3.0 for quantification of human immunodeficiency virus type 1 RNA in plasma. (1/39)

The performance and characteristics of Roche COBAS AMPLICOR HIV-1 MONITOR version 1.5 (CA MONITOR 1.5) UltraSensitive (usCA MONITOR 1. 5) and Standard (stCA MONITOR 1.5) procedures, Organon Teknika NucliSens HIV-1 RNA QT with Extractor (NucliSens), and Bayer Quantiplex HIV RNA version 3.0 (bDNA 3.0) were compared in a multicenter trial. Samples used in this study included 460 plasma specimens from human immunodeficiency virus (HIV) type 1 (HIV-1)-infected persons, 100 plasma specimens from HIV antibody (anti-HIV)-negative persons, and culture supernatants of HIV-1 subtype A to E isolates diluted in anti-HIV-negative plasma. Overall, bDNA 3.0 showed the least variation in RNA measures upon repeat testing. For the Roche assays, usCA MONITOR 1.5 displayed less variation in RNA measures than stCA MONITOR 1.5. NucliSens, at an input volume of 2 ml, showed the best sensitivity. Deming regression analysis indicated that the results of all three assays were significantly correlated (P < 0.0001). However, the mean difference in values between CA MONITOR 1.5 and bDNA 3.0 (0.274 log(10) RNA copies/ml; 95% confidence interval, 0.192 to 0.356) was significantly different from 0, indicating that CA MONITOR 1.5 values were regularly higher than bDNA 3.0 values. Upon testing of 100 anti-HIV-negative plasma specimens, usCA MONITOR 1.5 and NucliSens displayed 100% specificity, while bDNA 3.0 showed 98% specificity. NucliSens quantified 2 of 10 non-subtype B viral isolates at 1 log(10) lower than both CA MONITOR 1.5 and bDNA 3.0. For NucliSens, testing of specimens with greater than 1,000 RNA copies/ml at input volumes of 0.1, 0.2, and 2.0 ml did not affect the quality of results. Additional factors differing between assays included specimen throughput and volume requirements, limit of detection, ease of execution, instrument work space, and costs of disposal. These characteristics, along with assay performance, should be considered when one is selecting a viral load assay.  (+info)

Comparative performance of three viral load assays on human immunodeficiency virus type 1 (HIV-1) isolates representing group M (subtypes A to G) and group O: LCx HIV RNA quantitative, AMPLICOR HIV-1 MONITOR version 1.5, and Quantiplex HIV-1 RNA version 3.0. (2/39)

The performance of the LCx HIV RNA Quantitative (LCx HIV), AMPLICOR HIV-1 MONITOR version 1.5 (MONITOR v1.5), and Quantiplex HIV-1 RNA version 3.0 (bDNA v3.0) viral load assays was evaluated with 39 viral isolates (3 A, 7 B, 6 C, 4 D, 8 E, 4 F, 1 G, 4 mosaic, and 2 group O). Quantitation across the assay dynamic ranges was assessed using serial fivefold dilutions of the viruses. In addition, sequences of gag-encoded p24 (gag p24), pol-encoded integrase, and env-encoded gp41 were analyzed to assign group and subtype and to assess nucleotide mismatches at primer and probe binding sites. For group M isolates, quantification was highly correlated among all three assays. In contrast, only the LCx HIV assay reliably quantified group O isolates. The bDNA v3.0 assay detected but consistently underquantified group O viruses, whereas the MONITOR v1.5 test failed to detect group O viruses. Analysis of target regions revealed fewer primer or probe mismatches in the LCx HIV assay than in the MONITOR v1.5 test. Consistent with the high level of nucleotide conservation is the ability of the LCx HIV assay to quantify efficiently human immunodeficiency virus type 1 group M and the genetically diverse group O.  (+info)

Intra- and interlaboratory variabilities of results obtained with the Quantiplex human immunodeficiency virus type 1 RNA bDNA assay, version 3.0. (3/39)

Normal assay variation associated with bDNA tests for human immunodeficiency virus type 1 (HIV-1) RNA performed at two laboratories with different levels of test experience was investigated. Two 5-ml aliquots of blood in EDTA tubes were collected from each patient for whom the HIV-1 bDNA test was ordered. Blood was stored for no more than 4 h at room temperature prior to plasma separation. Plasma was stored at -70 degrees C until transported to the Central Pennsylvania Alliance Laboratory (CPAL; York, Pa.) and to the Hershey Medical Center (Hershey, Pa.) on dry ice. Samples were stored at < or =-70 degrees C at both laboratories prior to testing. Pools of negative (donor), low-HIV-1-RNA-positive, and high-HIV-1-RNA-positive plasma samples were also repeatedly tested at CPAL to determine both intra- and interrun variation. From 11 August 1999 until 14 September 2000, 448 patient specimens were analyzed in parallel at CPAL and Hershey. From 206 samples with results of > or =1,000 copies/ml at CPAL, 148 (72%) of the results varied by < or =0.20 log(10) when tested at Hershey and none varied by >0.50 log(10). However, of 242 specimens with results of <1,000 copies/ml at CPAL, 11 (5%) of the results varied by >0.50 log(10) when tested at Hershey. Of 38 aliquots of HIV-1 RNA pool negative samples included in 13 CPAL bDNA runs, 37 (97%) gave results of <50 copies/ml and 1 (3%) gave a result of 114 copies/ml. Low-positive HIV-1 RNA pool intrarun variation ranged from 0.06 to 0.26 log(10) while the maximum interrun variation was 0.52 log(10). High-positive HIV-1 RNA pool intrarun variation ranged from 0.04 to 0.32 log(10), while the maximum interrun variation was 0.55 log(10). In our patient population, a change in bDNA HIV-1 RNA results of < or =0.50 log(10) over time most likely represents normal laboratory test variation. However, a change of >0.50 log(10), especially if the results are >1,000 copies/ml, is likely to be significant.  (+info)

Quantitation of human immunodeficiency virus type 1 (HIV-1) RNA in cell-free cervicovaginal secretions: comparison of reverse transcription-PCR amplification (AMPLICOR HIV-A MONITOR 1.5) with enhanced-sensitivity branched-DNA assay (Quantiplex 3.0). (4/39)

Two commercially available hypersensitive assays for human immunodeficiency virus type 1 (HIV-1) RNA quantitation, AMPLICOR HIV-1 Monitor Test 1.5 and Quantiplex HIV RNA 3.0, were compared to detect and quantify HIV-1 RNA in the cell-free fraction of cervicovaginal secretions collected by vaginal washing. Three panel specimens were used: pooled cervicovaginal secretions spiked with HIV-1 subtype A or HIV-1 subtype B and cervicovaginal lavages from HIV-positive and HIV-negative women. Compared to the AMPLICOR HIV-1 Monitor Test 1.5 assay, the Quantiplex HIV-1 3.0 assay yielded higher estimates of HIV-1 RNA concentrations in several tested samples spiked with HIV-1 RNA subtype A, as well as subtype B, particularly samples containing low amounts of HIV-1 RNA. The sensitivity and specificity of the AMPLICOR HIV-1 Monitor Test 1.5 assay were 93 and 100%, respectively; the sensitivity and specificity of the Quantiplex HIV RNA 3.0 assay were 97 and 50%, respectively. In conclusion, in quantifying HIV-1 RNA in cervicovaginal secretions, the Quantiplex HIV RNA 3.0 may lack specificity, and the AMPLICOR HIV-1 Monitor Test 1.5 assay, although highly specific, may lack sensitivity.  (+info)

Comparative evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR version 2.0 Assays for quantification of hepatitis C virus RNA in serum. (5/39)

A comparison of quantitative results expressed in hepatitis C virus (HCV) international units per milliliter, obtained from the VERSANT HCV RNA 3.0 (bDNA-3.0) assay, the QUANTIPLEX HCV RNA 2.0 (bDNA-2.0) assay, and the COBAS AMPLICOR HCV MONITOR version 2.0 (HCM-2.0) test was performed. A total of 168 patient specimens submitted to the Mayo Clinic Molecular Microbiology Laboratory for HCV quantification or HCV genotyping were studied. Of the specimens tested, 97, 88, and 79% yielded quantitative results within the dynamic range of the bDNA-3.0, bDNA-2.0, and HCM-2.0 assays, respectively. Overall, there was substantial agreement between the results generated by all three assays. A total of 15 out of 29 (52%) of the specimens determined to contain viral loads of <31,746 IU/ml by the bDNA-3.0 assay were categorized as containing viral loads within the range of 31,746 to 500,000 IU/ml by the bDNA-2.0 assay. Although substantial agreement was noted between the results generated by the bDNA-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-2.0 assay was noted (P = 0.001). Likewise, although substantial agreement was noted between the results generated by the HCM-2.0 and bDNA-3.0 assays, a bias toward higher viral titer by the bDNA-3.0 assay was noted (P < or = 0.001). The discrepancy between the HCM-2.0 and bDNA-3.0 results was more pronounced when viral loads were >500,000 IU/ml and resulted in statistically significant differences (P < or = 0.001) in determining whether viral loads were above or below 800,000 IU/ml of HCV RNA, the proposed threshold value for tailoring the duration of combination therapy. The expression of quantitative values in HCV international units per milliliter was a strength of both the bDNA-3.0 and HCM-2.0 assays.  (+info)

Postnatal expression and induction by pregnenolone-16alpha-carbonitrile of the organic anion-transporting polypeptide 2 in rat liver. (6/39)

Newborn rats are more sensitive to the toxic effects of cardiac glycosides than are adult rats. This is associated with a decreased ability to remove cardiac glycosides from blood into the liver. Pregnenolone-16alpha-carbonitrile (PCN), a prototypical rodent CYP3A inducer and pregnane-X-receptor (PXR) ligand, stimulates the hepatic clearance of cardiac glycosides in newborn rats, which results in decreased toxicity of the cardiac glycosides. The mechanism responsible for this phenomenon is not clear; however, if elucidated, it would help in understanding and preventing potential drug-drug interactions. The recently cloned rat organic anion-transporting polypeptide 2 (oatp2) (Slc21a5) is a sinusoidal hepatic uptake transporter, with very high affinities for cardiac glycosides, and thus it was hypothesized that rat oatp2 increases during postnatal development and is inducible by PCN. In the present study, livers were removed from Sprague-Dawley rats from postnatal days (pnd) 0 to 45, in 5-day increments; as well as from pnd 10 to 90, in 10-day increments, after PCN (75 mg/kg i.p., for 4 days) or corn oil (vehicle for PCN) treatment. The protein and mRNA levels of rat oatp2 were determined by Western blot analysis and branched DNA signal amplification technique, respectively. Expression of rat oatp2 protein and mRNA increased gradually during postnatal development. PCN treatment increased liver to body weight ratio in both genders, and dramatically accelerated the maturation of hepatic oatp2 protein and mRNA levels. In summary, rat oatp2 undergoes age-dependent and chemical regulation during postnatal development, and is a potential target for drug-drug and age-drug interactions.  (+info)

Evaluation of the VERSANT HCV RNA 3.0 assay for quantification of hepatitis C virus RNA in serum. (7/39)

We assessed the performance of a new assay (VERSANT HCV RNA 3.0 [bDNA 3.0] assay [Bayer Diagnostics]) to quantitate HCV RNA levels and compared the results of the bDNA 3.0 assay to results of the Quantiplex HCV RNA 2.0 (bDNA 2.0) assay. Samples used in this study included 211 serum specimens from hepatitis C virus (HCV)-infected persons from two sites (Bordeaux and Marseille, France) with different genotypes; 383 serum specimens from HCV antibody-negative, HCV RNA-negative persons; and serial dilutions of World Health Organization (WHO) HCV RNA standard at a titer of 100,000 IU/ml. The specificity of the bDNA 3.0 assay was 98.2%. A high correlation was observed between expected and observed values in all dilutions of WHO standard (r = 0.9982), in serial dilutions of pooled samples (r = 0.9996), and in diluted sera from different HCV genotypes (r = 0.9930 to 0.9995). The standard deviations (SD) for the within-run and between-run reproducibility of the bDNA 3.0 assay were +info)

External quality assessment program for qualitative and quantitative detection of hepatitis C virus RNA in diagnostic virology. (8/39)

To assess the performance of laboratories in detecting and quantifying hepatitis C virus (HCV) RNA levels in HCV-infected patients, we distributed two proficiency panels for qualitative and quantitative HCV RNA testing. The panels were designed by the European Union Quality Control Concerted Action, prepared by Boston Biomedica Inc., and distributed in May 1999 (panel 1) and February 2000 (panel 2). Each panel consisted of two negative samples and six positive samples, with HCV RNA target levels from 200 to 500,000 copies/ml. Panel 1 had four samples with at least 50,000 copies/ml, and panel 2 had two samples with at least 50,000 copies/ml. Fifty-seven laboratories submitted 45 qualitative and 35 quantitative data sets on panel 1, and 81 laboratories submitted 75 qualitative and 48 quantitative data sets on panel 2. In both panels, about two-thirds of the qualitative data sets and >90% of the quantitative data sets were obtained with commercial assays. With each panel, two data sets gave one false-positive result, corresponding to false-positivity rates of 1.3% and 0.8% for panel 1 and panel 2, respectively. Samples containing at least 50,000 copies/ml were found positive in 97% and 99% of the cases with panel 1 and panel 2, respectively. In contrast, the positive samples containing < or =5,000 copies/ml were reported positive in only 71% and 77% of the cases with panel 1 and panel 2, respectively. Adequate or better scores on qualitative results (all results correct or only the low-positive samples missed) were obtained in 84% (panel 1) and 80% (panel 2) of the data sets. In the analysis of quantitative results, 60% (panel 1) and 73% (panel 2) of the data sets obtained an adequate or better score (> or =80% of the positive results within the range of the geometric mean +/- 0.5 log(10)). Our results indicate that considerable improvements in molecular detection and quantitation of HCV have been achieved, particularly through the use of commercial assays. However, the lowest detection levels of many assays are still too high, and further standardization is still needed. Finally, this study underlines the importance of proficiency panels for monitoring the quality of diagnostic laboratories.  (+info)

*Branched DNA assay

In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification assay) that is used to ... "A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml". Nucleic Acids ... amplifier The assay can be used to detect and quantify many types of RNA or DNA target. In the assay, branched DNA is mixed ... Several different short single-stranded DNA molecules (oligonucleotides) are used in a branched DNA-assay. The capture and ...

*Circulating tumor cell

... simultaneous branched DNA (bDNA) signal amplification and background suppression. The captured CTCs on the filter membrane of a ... DNA and RNA assays, and all other relevant molecular techniques using DNA and RNA. When circulating tumor cells are captured ... Each fully assembled amplification structure is contained within 40−50 bp of target RNA with the capacity for 400-fold signal ... An oligo pair hybridization event is essential for support of the signal amplification structure, which is assembled by a ...

*In situ hybridization

An alternative technology, branched DNA assay, can be used for RNA (mRNA, lncRNA, and miRNA ) in situ hybridization assays with ... Separate but compatible signal amplification systems enable the multiplex assays. The signal can be visualized using a ... can be used to visualize up to four targets in one assay, and it uses patented probe design and bDNA signal amplification to ... A fully assembled signal amplification structure "Tree" has 400 binding sites for the label probes. When all target-specific ...

*Diagnosis of HIV/AIDS

FDA summary of branched DNA test, accessed 5 October 2006. South Africa teaching unions criticise HIV testing in schools https ... After PCR amplification is complete, the resulting DNA products are hybridized to specific oligonucleotides bound to the vessel ... HIV Antibody Assays - UCSF Medical Center Complete List of Donor Screening Assays for Infectious Agents and HIV Diagnostic ... This is done to amplify the signal. Finally, oligonucleotides that bind to the last set of oligonucleotides and that are bound ...

*Human papillomavirus infection

... type 6 and 16 DNA sequences in bronchial squamous cell carcinomas demonstrated by in situ DNA hybridization". Lung. 167 (1): 33 ... A 2010 study has found that E6 and E7 are involved in beta-catenin nuclear accumulation and activation of Wnt signaling in HPV- ... In October 2011 the US Food and Drug Administration approved the Aptima HPV Assay test for RNA created when and if any HPV ... Studies suggest that HPV evolved along five major branches that reflect the ethnicity of human hosts, and diversified along ...

*Viral load

To be comparable the same test method (Target amplification, probe specific amplification, or signal amplification) should be ... One commonly used method: The branched DNA (bDNA) method can use either DNA or RNA as the target nucleic acid. Short probes ... It is often expressed as viral particles, or infectious particles per mL depending on the type of assay. A higher viral burden ... The probes are then amplified Signal amplification uses large amounts of signal bound to an unamplified target originally ...

*P70-S6 Kinase 1

Amplification of the region of DNA encoding this gene and overexpression of this kinase are seen in some breast cancer cell ... "PLD2 forms a functional complex with mTOR/raptor to transduce mitogenic signals". Cellular Signalling. 18 (12): 2283-91. doi: ... For example, branched chain amino acids such as leucine are sufficient to activate mTOR, resulting in an increase in p70S6K ... and enzyme inhibition as studied by a high capacity assay". Biochemical and Biophysical Research Communications. 332 (1): 304- ...

*Biosearch Technologies

Cook's role in providing him one of the first SAM I DNA synthesizers which was used in support of Kary Mullis' PCR research. " ... The series of Black Hole Quencher dyes have no native fluorescence, high signal-to-noise ratios providing greater sensitivity, ... RealTimeDesign is meant to help scientists craft custom oligonucleotides, averaging 99% in amplification efficiency through a ... Online Design Service for qPCR and SNP Genotyping Assays Patents assigned to Biosearch Technologies by the United States Patent ...

*BRCA1

... directly binds to DNA, with higher affinity for branched DNA structures. This ability to bind to DNA contributes to its ... BRCA1 combines with other tumor suppressors, DNA damage sensors and signal transducers to form a large multi-subunit protein ... Other methods have been proposed: traditional quantitative PCR, Multiplex Ligation-dependent Probe Amplification (MLPA), and ... "Real-time PCR-based gene dosage assay for detecting BRCA1 rearrangements in breast-ovarian cancer families". Clin. Genet. 65 (2 ...

*Spinocerebellar ataxia type 1

Ataxin 1 is involved in a number of signaling pathways and its expression is controlled by signaling pathways. The MAPK/ERK ... The process that turns coded information in DNA into proteins requires two steps: transcription, in which DNA is used to ... Amplification is done using polymerase chain reactions or PCR. The choice of primers can allow either for a single gene to be ... For repeat lengths within the range where interruptions are relevant, assays like CE and PAGE will not determine if the strain ...

*List of RNA-Seq bioinformatics tools

Recent sequencing technologies normally require DNA samples to be amplified via polymerase chain reaction (PCR). Amplification ... generating signal tracks of mapped reads, and segmenting that signal into actively transcribed regions. In addition to the ... DGEclust dgeclust is a Python package for clustering expression data from RNA-seq, CAGE and other NGS assays using a ... Does not use any splice-site-finding heuristics optimized for a single taxonomic branch, but rather finds optimally-scoring ...

*Haplogroup T-M184

Italy DNA Project blog, "What a difference a year makes" (posted Tuesday, September 04, 2007), based on data from the Italy DNA ... The other primary branch of T-M184, haplogroup T-L206 or T1, is far more common than T2 among modern populations in Europe, ... "Neolithic patrilineal signals indicate that the Armenian plateau was repopulated by agriculturalists". European Journal of ... Plus amplification kit validation and calculation of forensic parameters for two Austrian populations". Forensic Science ...

*Genomics

Chain-termination methods require a single-stranded DNA template, a DNA primer, a DNA polymerase, normal ... A major branch of genomics is still concerned with sequencing the genomes of various organisms, but the knowledge of full ... In turn, proteins make up body structures such as organs and tissues as well as control chemical reactions and carry signals ... Kawashima EH, Farinelli L, Mayer P (12 May 2005). "Method of nucleic acid amplification". Retrieved 2012-12-22. Mardis ER (2008 ...

*Phytoplasma

TENGU contains a signal peptide at its N-terminus; after cleavage, the mature protein is only 38 amino acids in length. ... In addition, loop-mediated isothermal amplification (a sensitive, simple, and rapid diagnostic method) is now available as a ... Like other prokaryotes, phytoplasmic DNA is distributed throughout the cytoplasm, instead of being concentrated in a nucleus. ... "Phytoplasma induced free-branching in commercial poinsettia cultivars". Nature Biotechnology. Nature Publishing Group. 15 (2): ...

*Herbicide

Many diagnostic tests have been developed, including glasshouse pot assays, petri dish assays and chlorophyll fluorescence. A ... Target-site resistance may also be caused by an overexpression of the target enzyme (via gene amplification or changes in a ... Alberto D, Serra AA, Sulmon C, Gouesbet G, Couée I (2016) «Herbicide-related signaling in plants reveals novel insights for ... is the first step in the synthesis of the branched-chain amino acids (valine, leucine, and isoleucine). These herbicides slowly ...

*MTOR inhibitors

The mTORC1 signaling cascade is activated by phosphorylated AKT and results in phosphorylation of S6K1, and 4EBP1, which lead ... Thus, this data is based on preclinical assays, based on in vitro cultured tumor cell lines, which suggest that the effects of ... Research on mTOR inhibition has been a growing branch in science and has promising results. In general, protein kinases are ... Lovejoy, Courtney A.; Cortez, David (2009). "Common mechanisms of PIKK regulation". DNA Repair. 8 (9): 1004-8. doi:10.1016/j. ...

*Single-cell transcriptomics

Moreover, bulk assays fail to identify if a change in the expression profile is due to a change in regulation or composition, ... Wildsmith, S. E.; Archer, G. E.; Winkley, A. J.; Lane, P. W.; Bugelski, P. J. (1 January 2001). "Maximization of signal derived ... Fluorescent dyes are used a reporter molecules to detect the PCR product and monitor the progress of the amplification - the ... A more recently developed control uses Unique molecular identifiers (UMIs)-Short DNA sequences (6-10nt)- that are added to each ...
The VERSANT HCV RNA 1.0 Assay is a real-time kPCR assay for quantitative detection of human HCV RNA in plasma or serum of HCV-infected individuals.
The VERSANT® HCV RNA 1.0 Assay (kPCR)* is a real-time kinetic polymerase chain reaction (kPCR) assay for quantitative detection of human hepatitis C virus (HCV) RNA in plasma or serum of HCV-infected individuals. The assay is intended to be used in conjunction with clinical presentation and other laboratory markers of disease status to aid in the management of HCV-infected individuals undergoing antiviral therapy.. ...
HCV infection is one of the main causes of chronic liver disease worldwide.1 Fortunately, with detection and appropriate therapy, the majority of HCV-infected individuals can be cured. The European Association for the Study of the Liver (EASL) recommends response-guided therapy for HCV, which includes the monitoring of treatment efficacy using a real-time PCR-based assay, with a lower limit of detection of 10-20 IU/mL.2 The VERSANT® HCV RNA 1.0 Assay (kPCR)*, which has a limit of detection of 15 IU/mL, provides excellent precision across the dynamic range and 100 percent specificity. Additionally, the assay features technology that is compatible with all HCV genotypes, providing clinicians the information that they need to manage patient therapy.. 1. Lavanchy D. The global burden of hepatitis C. Liver Int 2009; 29:74-81 ...
The performance of the point-of-care Xpert HIV-1 viral load assay was evaluated against the Abbott RealTime PCR m2000rt system. A total of 96 plasma specimens ranging from 2.5 log10 copies ml-1 to 4.99 log10 copies ml-1 and proficiency testing panel specimens were used. Precision and accuracy were checked using the Pearson correlation co-efficient test and Bland-Altman analysis.. RESULTS ...
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence "ACT". If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.,br ...
Investigator Quantiplex Pro Kit, For quantification of human and male DNA with high sensitivity and a straightforward quality assessment
IVDD, CE marked. Product availability varies from country to country and is subject to local regulatory requirements.. VERSANT is a registered trademark of Siemens. All other marks are the property of their respective owners.. The products/features (mentioned herein) are not commercially available in all countries. Due to regulatory reasons their future availability cannot be guaranteed. Please contact your local Siemens organization for further details. ...
The products/features (mentioned herein) are not commercially available in all countries. Due to regulatory reasons their future availability cannot be guaranteed. Please contact your local Siemens organization for further details. ...
Likely a new method, although hard to be certain. This definitely happens when labs go to a new viral load assay. Depending on the technology used, some recalibration will be required, either up or...
Buy The Review E-newsletter design by super_things on ThemeForest. About The Review An elegant and clean layout, ideal for business and commercial use. Special Campaign Monitor version...
Product Description Convenient real-time RNA quantification in one EASY step. Biocredes One-Step TaqTicProbe qRT-PCR iCycler Kit uses a combination of high-qua
In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification assay) that is used to detect nucleic acid molecules. A branched DNA assay begins with a dish or some other solid support (e.g., a plastic dipstick). The dish is peppered with small, single stranded DNA molecules (or chains) that stick up into the air. These are known as capture probe DNA molecules. Next, an extender DNA molecule is added. Each extender has two domains; one that hybridizes to the capture DNA molecule and one that "hangs out" in the air. The purpose of the extender is two-fold. First, it creates more available surface area for target DNA molecules to bind, and second, it allows the assay to be easily adapted to detect a variety of target DNA molecules. Once the capture and extender molecules are in place and they have hybridized, the sample can be added. Target molecules in the sample will bind to the extender molecule. This results in a base peppered with capture probes, ...
A method for determining a molecule A comprising a sample of molecules capable of participating in formation of triplex structures is useful for sensitive determination. The principle can be used to determine any kind of analytes.
article{BUT115093, author="Karel {Sedlář} and Helena {Škutková} and Martin {Vítek} and Ivo {Provazník}", title="Set of rules for genomic signal downsampling", annote="Comparison and classification of organisms based on molecular data is an important task of computational biology, since at least parts of DNA sequences for many organisms are available. Unfortunately, methods for comparison are computationally very demanding, suitable only for short sequences. In this paper, we focus on the redundancy of genetic information stored in DNA sequences. We proposed rules for downsampling of DNA signals of cumulated phase. According to the length of an original sequence, we are able to significantly reduce the amount of data with only slight loss of original information. Dyadic wavelet transform was chosen for fast downsampling with minimum influence on signal shape carrying the biological information. We proved the usability of such new short signals by measuring percentage deviation of pairs of ...
Results bDNA was quantified in 714 whole blood samples. There was no correlation between bDNA levels and baseline characteristics such as age and gender, nor with static markers of liver function such as MELD. Elevated bDNA levels were associated with development of infection within the first 7 days in patients treated with prednisolone (p = 0.001), and remained independently associated with the subsequent development of infection after multivariate analysis (p = 0.02). Importantly, bDNA levels were not associated with the development of infection in patients treated without prednisolone (p = 0.43).. Elevated bDNA levels were associated with death at 90 days (p = 0.05). Mortality in prednisolone treated patients was increased for patients with high bDNA compared to patients with low bDNA (hazard ratio 2; p = 0.02). Accordingly, patients with elevated bDNA were more likely to die if they were randomly allocated prednisolone therapy (OR 2.9, 95% CI 1.2-6.9, p = 0.02). We estimate that if patients ...
You have made the correct diagnosis. Blipping is usually caused by issues associated with the viral load assay or more specifically with the blood collection tube that the sample is collected in. In...
Title: Alabel-free and enzyme-free signal amplification strategy for a sensitive RNase Hactivity assay Author: Chang Yeol Lee,‡Hyowon Jang,‡ Ki Soo Park* and Hyun Gyu Park* (‡: equal contribution) Journal: Nanoscale 2017, 9, 16149-16153 Abstra
Title: Alabel-free and enzyme-free signal amplification strategy for a sensitive RNase Hactivity assay Author: Chang Yeol Lee,‡Hyowon Jang,‡ Ki Soo Park* and Hyun Gyu Park* (‡: equal contribution) Journal: Nanoscale 2017, 9, 16149-16153 Abstra
Ready and easy-to-use VERSANT Urine Transport Kit (UTK) requires no manual pipetting, centrifugation, or off-line processing steps ...
Tumor-derived exosomes (TEXs) are extracellular vesicles that are continuously released into the blood by tumor cells and carry specific surface markers of the original tumor cells. Substantial evidence has implicated TEXs as attractive diagnostic markers for cancer. However, the detection of TEXs in blood at an early tumor stage is challenging due to their very low concentration. Here, we established a method called PLA-RPA-TMA assay that allows TEXs to be detected with high sensitivity and specificity. Based on two proximity ligation assay (PLA) probes that recognize a biomarker on a TEX, we generated a unique surrogate DNA signal for the specific biomarker, which was synchronously amplified twice by recombinase polymerase amplification (RPA) coupled with transcription-mediated amplification (TMA), and then the products of the RPA-TMA reaction were quantitatively detected using a gold nanoparticle-based colorimetric assay ...
TY - JOUR. T1 - Hepatitis C virus RNA quantification in right and left lobes of the liver in patients with chronic hepatitis C. AU - Idrovo, V.. AU - Dailey, P. J.. AU - Jeffers, Lennox J. AU - Coelho-Little, E.. AU - Bernstein, D.. AU - Bartholomew, M.. AU - Alvarez, L.. AU - Urdea, M. S.. AU - Collins, M. L.. AU - Schiff, Eugene R. PY - 1996/9/1. Y1 - 1996/9/1. N2 - Quantification of hepatitis C virus RNA in liver tissue is likely to be useful in the study of the natural history, pathogenesis, progression and treatment of hepatitis C virus-associated liver disease. Quantitative measurements of hepatitis C virus RNA in liver biopsy samples using the branched DNA (bDNA) signal amplification assay were carried out. The aims of this study were threefold: first, to assess the level of hepatitis C virus RNA in biopsy samples from the right and left lobes of the liver; second, to evaluate the correlation between hepatitis C virus RNA levels in serum and liver; and third, to investigate the ...
16 x PERSONA MONITOR TEST STICKS for the NEW and OLD Persona Monitor These Persona monitor sticks are for use with the NEW and the OLD Persona ovulation
Javais prévu daller vers la Croix de Belledonne, mais lenneigemment est encore énorme en cette fin mai. Et donc pour éviter une longue galère dans de la neige molle je me tourne vers le Grand Colon, plus proche et plus facile daccès ...
Leader LV5700A The LV 5700A is a Multi SDI Monitor for HD/SD-SDI signals with an XGA TFT color LCD in an adjustable tilt front panel. The monitor tests 14 HD-SDI and SD-SDI formats with total digital processing c
San Diego, CA. FDA-cleared TMA tests are available for the detection of Chlamydia trachomatis, Neisseria gonorrhoeae, and Mycobacterium tuberculosis (APTIMA CT, APTIMA GC, and, AMPLIFIED Mycobacterium tuberculosis Direct Test [MTD] assays, respectively) An FDA-approved TMA qualitative assay for hepatitis C virus (HCV) is also available (VERSANT HCV RNA [distributed by Siemens Healthcare Diagnostics, Deerfield, IL]) - Nucleic acid sequence-based amplification (NASBA) ◆ NASBA is an isothermal amplification technique and can be used for the amplification of a DNA or RNA target. Following the first PCR cycle, there is (theoretically) a per-cycle doubling in the number of copies of the PCR product. (Modified from Leonard DGB [ed]: Diagnostic Molecular Pathology. ) - Basic PCR method ◆ During the denaturation stage, sample specimen DNA is rendered single-stranded by heating to 94° to 98°C ◆ In the annealing step, oligonucleotide primers hybridize with the target sequences they have been ...
When a test has more than two possible outcomes, its accuracy can be reported as pairs of sensitivity and specificity corresponding to each degree of abnormality. This approach, the basis for receiver-operating characteristic analysis, maximizes the use of diagnostic information (2). When the diagnostic threshold is set at a lower degree of abnormality, the sensitivity of the test tends to increase but its specificity tends to decrease. The opposite occurs when a higher diagnostic threshold is selected. In the case of HIV viral load assays, if more viral units must be detected to report the test result as abnormal, the specificity will increase. As noted by Rich and colleagues, "the lowest reported plasma viral load during seroconversion is more than 17 times higher than the highest viral load detected in our three patients." Thus, for the diagnosis of acute infection, the threshold should probably be set much higher ...
Dr Ellen Jo Baron, Emeritus Professor of Pathology at the Stanford University Medical Center and associated with Cepheid, gave the example of Cepheids Xpert HIV1 Viral Load assay which is strictly not a point-of-care test. But it can be done in a small laboratory that has necessary resources. It is fully automated, can identify all the sub-types and gives results in 90 minutes. Dr Baron shared that Cepheid has got a grant to create a finger-stick test for viral load testing, which is battery operated, portable, rugged, relatively affordable, can be run on omni instrument at remote sites. It is hoped to give results in less than 60 minutes, with an accuracy of 500 copies/ml ...
Make an appointment for the Holter Monitor Test with Dr. Roya Golshani if you have symptoms, such as irregular palpitations/ heartbeats, chest pain, and shortness of breath.
Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. These tests may have been performed at any time in the past, but the results must be available for review by Serono prior to entry into the study ...
Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. These tests may have been performed at any time in the past, but the results must be available for review by Serono prior to entry into the study ...
Maintenance and service is a key contributor to the total cost of train ownership. LORD MicroStrain® wireless sensing systems provide fleet operators with a quick and cost-effective path to embedding health sensing capabilities on both new and existing cr. ...
The farnesoid X receptor (FXR) controls the synthesis and transport of bile acids (BAs). Mice lacking expression of FXR, designated Fxr-null, have elevated levels of serum and hepatic BAs and an increase in BA pool size. Surprisingly, at 12 months of age, male and female Fxr-null mice had a high incidence of degenerative hepatic lesions, altered cell foci and liver tumors including hepatocellular adenoma, carcinoma and hepatocholangiocellular carcinoma, the latter of which is rarely observed in mice. At 3 months, Fxr-null mice had increased expression of the proinflammatory cytokine IL-1beta mRNA and elevated beta-catenin and its target gene c-myc. They also had increased cell proliferation as revealed by increased PCNA mRNA and BrdU incorporation. These studies reveal a potential role for FXR and BAs in hepatocarcinogenesis.
Generally, an immunoaffinity SPR biosensor detects a target analyte in a sample through highly selective adsorption by using the antigen–antibody interaction. For improving the sensitivity, various kinds of particles have been added to the already bound analytes on the SPR biosensor (sandwich assay). In this work, signal amplification was demonstrated by the expression of the IgG-binding Z-domain of protein A on the outer membrane of Escherichia coli via "Autodisplay". The amount of Z-domain of protein A expressed on the outer membrane was calculated to be 280,000 molecules per cell. In addition, the IgGbinding ability of the expressed proteinwas characterized using FACS analysis. The signal amplification of the SPR biosensor was performed in the sandwich assay format using a model of horseradish peroxidase (HRP); the limit of detectionwas determined to be significantly improved from1 g/ml to 1 ng/ml. Finally, myoglobin analysis was demonstrated for the medical diagnosis of cardiac ...
Dr Ellen Jo Baron, Emeritus Professor of Pathology at the Stanford University Medical Center and associated with Cepheid, gave the example of Cepheids Xpert HIV1 Viral Load assay which is strictly not a point-of-care test. But it can be done in a small laboratory that has necessary resources. It is fully automated, can identify all the sub-types and gives results in 90 minutes. Dr Baron shared that Cepheid has got a grant to create a finger-stick test for viral load testing, which is battery operated, portable, rugged, relatively affordable, can be run on omni instrument at remote sites. It is hoped to give results in less than 60 minutes, with an accuracy of 500 copies/ml ...
TestLine Clinical Diagnostics s.r.o. - Development, production and distribution of laboratory diagnostics for human and veterinary use
TY - JOUR. T1 - Evaluation of the COBAS AMPLICOR CMV MONITOR test for detection of viral DNA in specimens taken from patients after liver transplantation. AU - Sia, Irene G.. AU - Wilson, Jennie A.. AU - Espy, Mark J.. AU - Paya, Carlos V.. AU - Smith, Thomas F.. PY - 2000/2/16. Y1 - 2000/2/16. N2 - Detection of cytomegalovirus (CMV) DNA in blood by PCR is a sensitive method for the detection of infection in patients posttransplantation. The test, however, has low specificity for the identification of overt CMV disease. Quantitative CMV PCR has been shown to overcome this shortcoming. The COBAS AMPLICOR CMV MONITOR test was evaluated by using consecutive serum and peripheral blood mononuclear cell (PBMN) samples from liver transplant patients. Twenty-five patients had CMV viremia (by shell vial cell culture assay) and/or tissue-invasive disease (by biopsy); 20 had no active infection. A total of 262 serum and 62 PBMN specimens were tested. Of 159 serum specimens from patients with overt CMV ...
Brambilla, D., Granger, S., Jennings, C., & Bremer, J. (2001). Effect of errors in the sequence of optical densities from the Roche Amplicor HIV-1 Monitor assay on the validity of assay results. Journal of Clinical Microbiology, 39, 1118 - 1120. ...
Disease marker detection plays an important role in clinical practice; however, rapid, low-cost and simultaneous detection of multiple trace disease markers remain a challenge because of low abundance of related strategies. Herein, we report a G-quadruplex DNAzyme and nicking enzyme-assisted multiplex chemil
OBJECTIVES : To use SIVmac-infected Chinese-origin rhesus macaques (Ch Rh) to characterize the immunopathology of the long term non-progressor (LTNP) state. The key questions addressed were whether or not LTNP experience an early and rapid loss of mucosal CD4 T cells during the acute infection and the mechanisms by which they maintain the LTNP state. METHODS : Ch Rh were infected with SIVmac239. Polychromatic flow cytometry was used to analyze T lymphocyte subsets from blood, lymph nodes and gut tissues during SIV infection. Plasma viral loads were monitored by bDNA assay. Two LTNP were treated with anti-CD8 antibody to deplete CD8 cells in vivo. RESULTS : Thirty-one percent (5/16) of SIVmac239-infected ChRh having low viral loads for as long as 6 years were LTNP. Both LTNP and progressors had similar levels of gut memory CD4/CCR5 T cells (target cells) before infection and there was an early and profound depletion of target cells in both groups. LTNP were distinguished by gradual restoration of
African Traditional Medicines (ATMs) serve as a major source of primary healthcare for African people. The reasons for their use range from easy access, affordability, beliefs in traditional systems and long term safety. ATMs have been used to treat individuals infected with HIV and therefore need scientific validation; a view supported by Traditional Health Practitioners (THPs). This study aimed to evaluate the in vitro cytotoxicity, immune modulatory and anti-HIV activities of traditional multiple herbal preparations from local THPs. Ugambu, Ihashi, Product Nene, Product Blue, SPNa and SDKc ATM were supplied by local THPs. Changes in adenosine triphosphate (ATP) & glutathione (GSH) over 24 hours were measured using luminometry. Changes in 12 cytokines were assayed using an ELISA-based absorbance assay. Protective effects against HIV killing of MT-4 cells were tested using the XTT assay and antiviral activity was measured using an HIV-1 viral load assay. Cyclosporine and AZT were used as ...
A viral load test measures how much human immunodeficiency virus (HIV) is in the blood. Viral load is first measured when you are diagnosed with HIV infection.
Siemens proprietary extraction technology uses magnetic particles coated with a nano layer of silica for the efficient isolation of quality nucleic acids. Homogeneous bead size and shape improves reproducibility, recovery, and quality of RNA and DNA extractions to enhance assay performance ...
RNAscope® assay is an innovative and proprietary RNA in situ hybridization (ISH) assay based on ACDs patented technology with signal amplification and simultaneous background noise suppression. RNAscope® assay delivers quantitative, sensitive and specific molecular detection of RNA species on a cell-by-cell basis with morphological context in a single assay. In this webinar, we will focus on how to analyze and review RNAscope® assay data images successfully. We will cover the following topics:. ...
The substantial amount of RNA required for expression analysis is a limiting factor for the cDNA microarray technology in a number of potentially important applications. Two main approaches, signal amplification and global mRNA amplification, have been developed to overcome this obstacle. Signal amplification, such as dendrimer technology [1] and tyramide signal amplification (TSA) [2] aim to increase the fluorescent signal emitted per mRNA molecule. Global mRNA amplification has the purpose of increasing the number of available transcript equivalents for sufficient labeling from a limited starting amount. In current implementations, mRNA amplification techniques require less RNA than those based on signal amplification.. Van Gelder et al. [3] devised a multistep strategy to amplify mRNA from limited quantities of cDNA in studies of gene expression. Their method is commonly referred to in the literature as the Eberwine method. The general steps involve reverse transcription of mRNA with an oligo ...
October 31, 2019 - The new Quantitative Assay Apps from BioTek Instruments, Inc. provide convenience and simplicity for researchers performing four commonly used detection-based applications: absorbance-based BCA, Bradford, Lowry protein assays, and fluorescence-based DNA assays. These easy-to-use Apps are powered through Gen5™ Data Analysis Software and are compatible with BioTek microplate readers equipped with the relevant detection mode, including the popular Cytation™ and Synergy™ multi-mode readers. Weiterlesen ...
RNAscope® assay is an innovative and proprietary RNA in situ hybridization (ISH) assay based on ACDs patented technology with signal amplification and simultaneous background noise suppression.

Faculty Collaboration Database - Mesh term Branched DNA Signal Amplification AssayFaculty Collaboration Database - Mesh term Branched DNA Signal Amplification Assay

Mesh term Branched DNA Signal Amplification Assay. Browse to parent terms:. Molecular Probe Techniques. Nucleic Acid ... A molecular probe technique that utilizes branched DNA (bDNA) as a means to amplify the hybridization signal. One end of the ... while the other end of the bDNA molecule contains many branches of DNA that are designed to bind a probe used for signal ...
more infohttps://fcd.mcw.edu/?module=search&func=showTerm&id=68021121

Plus itPlus it

Branched DNA Signal Amplification Assay.. Reagents required for RNA analysis (i.e., lysis buffer, amplifier/label probe buffer ... were analyzed for mRNA expression of each gene by branched DNA signal amplification assay. The data are represented as the ... were analyzed for mRNA expression of each gene by branched DNA signal amplification assay. Because Asbt, IBABP, and Fgf15 are ... were analyzed for mRNA expression of each transporter by branched DNA signal amplification assay. The data are represented as ...
more infohttp://jpet.aspetjournals.org/content/351/1/105

Transcriptional Regulation of Renal Cytoprotective Genes by Nrf2 and Its Potential Use as a Therapeutic Target to Mitigate...Transcriptional Regulation of Renal Cytoprotective Genes by Nrf2 and Its Potential Use as a Therapeutic Target to Mitigate...

Branched DNA Signal Amplification Assay.. The mRNA expression of mouse Kim-1 (kidney injury molecule-1), PCNA (proliferating ... were quantified using the branched DNA 1.0 signal amplification assay (Affymetrix, Inc.) (Hartley and Klaassen, 2000). Novel ... differential expression of rat hepatic cytochrome P450 mRNA transcripts using branched DNA signal amplification technology. ... Transcription Factor Binding Assays.. Nuclear extracts were used to quantify DNA binding of Nrf2 and the p65 subunit of nuclear ...
more infohttp://jpet.aspetjournals.org/content/335/1/2?ijkey=1df2bf9c8a70abee35ad240fd1cb550d4b9042e5&keytype2=tf_ipsecsha

CMV Retinitis Differential DiagnosesCMV Retinitis Differential Diagnoses

... is a ubiquitous DNA virus that infects the majority of the adult population. In the immunocompetent host, infection is ... Quantification of cytomegalovirus DNA in peripheral blood leukocytes by a branched-DNA signal amplification assay. J Clin ... Comparison of three assays for cytomegalovirus detection in AIDS patients at risk for retinitis. J Clin Microbiol. 2000 Feb. 38 ... Quantitative cytomegalovirus DNA level in the blood and its relationship to cytomegalovirus retinitis in patients with acquired ...
more infohttps://emedicine.medscape.com/article/1227228-differential

Cytomegalovirus (CMV) Retinitis: Practice Essentials, Background, PathophysiologyCytomegalovirus (CMV) Retinitis: Practice Essentials, Background, Pathophysiology

... is a ubiquitous DNA virus that infects the majority of the adult population. In the immunocompetent host, infection is ... Quantification of cytomegalovirus DNA in peripheral blood leukocytes by a branched-DNA signal amplification assay. J Clin ... Comparison of three assays for cytomegalovirus detection in AIDS patients at risk for retinitis. J Clin Microbiol. 2000 Feb. 38 ... Cytomegalovirus (CMV) blood DNA load, CMV retinitis progression, and occurrence of resistant CMV in patients with CMV retinitis ...
more infohttps://emedicine.medscape.com/article/1227228-overview

Molecular bacteriology: a diagnostic tool for the millennium | Journal of Clinical PathologyMolecular bacteriology: a diagnostic tool for the millennium | Journal of Clinical Pathology

... probe amplification using ligase chain reaction or Q-beta replicase; and (3) signal amplification, as in branched DNA assay.1 ... Conventional PCR is designed to result in the amplification of a specific DNA fragment and subsequent analysis is required to ... transcription mediated amplification, nucleic acid sequence based amplification (NASBA), and so on; (2) ... Mutations in DNA sequences can also be detected by real time PCR, as the stability of the probe-target duplex can be measured. ...
more infohttps://jcp.bmj.com/content/53/1/71

AIDS Denialism and Public Health Practice | SpringerLinkAIDS Denialism and Public Health Practice | SpringerLink

Rapid and precise quantification of HIV-1 RNA in plasma using a branched DNA signal amplification assay. J Acquir Immune Defic ...
more infohttps://link.springer.com/article/10.1007%2Fs10461-009-9654-7

Emerging Technologies to Study Long Non-coding RNAs | SpringerLinkEmerging Technologies to Study Long Non-coding RNAs | SpringerLink

1997). A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic ... Scotto-Lavino, E., Du, G., & Frohman, M. A. (2006). Amplification of 5 end cDNA with new RACE. Nature Protocols, 1, 3056. ... 2011). An enzyme-linked assay for the rapid quantification of microRNAs based on the viral suppressor of RNA silencing protein ... Taft, R. J., Pheasant, M., & Mattick, J. S. (2007). The relationship between non-protein-coding DNA and eukaryotic complexity. ...
more infohttps://link.springer.com/chapter/10.1007/978-1-4614-8621-3_7

Plus itPlus it

1997) A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml. Nucleic ... 2006) A multiplex branched DNA assay for parallel quantitative gene expression profiling. Anal. Biochem. 352, 50-60. ... This method is hybridization-based and incorporates branched DNA (bDNA) technology (44, 45). Because it relies on signal ... Multiplex Assays for Measuring Cytokine Protein Level. Multiplex assays for 66 mouse cytokines (covering most of the well- ...
more infohttps://www.mcponline.org/content/17/8/1546

Efficiencies of Four Versions of the AMPLICOR HIV-1 MONITOR Test for Quantification of Different Subtypes of Human...Efficiencies of Four Versions of the AMPLICOR HIV-1 MONITOR Test for Quantification of Different Subtypes of Human...

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay. AIDS 7(Suppl. 2 ... The Quantiplex HIV RNA assay (Chiron)-based on branched DNA (44), the HIV-1 RNA QT (Organon Teknika) NASBA (nucleic acid ... 1993) Genetic relationships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes. Science 262:1257-1261 ... 1996) COBAS AMPLICOR: fully automated RNA and DNA amplification and detection system for routine diagnostic PCR. Clin. Chem. 42 ...
more infohttps://jcm.asm.org/content/37/1/110?ijkey=2aa63ad404729bab3f0c3329809618bb8e695452&keytype2=tf_ipsecsha

Report of the NIH Panel to Define Principles of Therapy of HIV InfectionReport of the NIH Panel to Define Principles of Therapy of HIV Infection

HIV-1 QT assay, Organon Teknika) or signal amplification methods (e.g., branched DNA {bDNA}, Quantiplex (TM) HIV RNA bDNA assay ... Rapid and precise quantification of HIV-1 RNA in plasma using a branched DNA signal amplification assay. J Acquir Immune Defic ... Clinical evaluation of branched DNA signal amplification for quantifying HIV type 1 in human plasma. AIDS Res Hum Retroviruses ... Target amplification assays are more sensitive (400 copies HIV RNA/mL plasma) than the first generation bDNA assay (10,000 ...
more infohttps://wonder.cdc.gov/wonder/prevguid/m0052295/m0052295.asp

Severe diabetes and leptin resistance cause differential hepatic and renal transporter expression in mice | Comparative...Severe diabetes and leptin resistance cause differential hepatic and renal transporter expression in mice | Comparative...

Oligonucleotide probesets for branched DNA signal amplification (bDNA) assay. Probe sets for mouse Abcc1-6, Slc22a6, 7, 8, ... Total RNA was isolated from kidneys of these mice, and mRNA was quantified by the branched DNA signal amplification assay. The ... Total RNA was isolated from liver, and mRNA was quantified using branched DNA signal amplification assay. The data plotted as ... and mRNA was quantified using the Branched DNA signal amplification assay. The data is plotted as average Relative Light Unit ( ...
more infohttps://comparative-hepatology.biomedcentral.com/articles/10.1186/1476-5926-11-1

Antiretroviral Drug Resistance: Mechanisms, Pathogenesis, Clinical Significance | Springer for Research & DevelopmentAntiretroviral Drug Resistance: Mechanisms, Pathogenesis, Clinical Significance | Springer for Research & Development

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay. AIDS 1994; 7 ( ... Mulder J, McKinney N, Christopherson C, Sninsky J, Greenfield L, Kwok S. Rapid and simple PCR assay for quantitation of human ... Discordance of RT sequences conferring ZDV resistance in proviral DNA from brain and spleen. HIV Drug Resistance Third ... resistant human immunodeficiency virus isolates to antiviral agents determined by using a quantitative plaque reduction assay. ...
more infohttps://rd.springer.com/chapter/10.1007/978-1-4757-9209-6_35

Plasma viral load and CD4+ lymphocytes as prognostic markers of HIV-1 infection.  - PubMed - NCBIPlasma viral load and CD4+ lymphocytes as prognostic markers of HIV-1 infection. - PubMed - NCBI

... which was measured as the concentration of HIV-1 RNA found using a sensitive branched-DNA signal-amplification assay. ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/9182471?dopt=Abstract

Detection of extracellular tumor-associated nucleic acid in blood plasma or     serum using nucleic acid amplification assays -...Detection of extracellular tumor-associated nucleic acid in blood plasma or serum using nucleic acid amplification assays -...

... nucleic acid amplification with or without enrichment for mutant DNA. In particular, the invention relates to the detection, ... extracellular mutant oncogenes or tumor-associated DNA found in the plasma or serum fraction of blood by using rapid DNA ... Specifically, the invention relates to detection of nucleic acid derived from mutant oncogenes or other tumor-associated DNA, ... malignancies carrying tumor-related mutations of DNA and methods for monitoring cancer and other neoplastic disorders in humans ...
more infohttp://www.patentgenius.com/patent/6939675.html

Hepatitis C reactivation in patients with chronic infection with genotypes 1b and 2c: a retrospective cohort study of 206...Hepatitis C reactivation in patients with chronic infection with genotypes 1b and 2c: a retrospective cohort study of 206...

Serum HCV-RNA was quantitatively measured by a branched DNA signal amplification assay (Versant HCV-RNA 3.0 Assay bDNA; Bayer, ... The sensitivity of the assay was 50 HCV-RNA copies/ml. HCV was genotyped by a hybridisation assay (Inno-LIPA; Innogenetics, ... Ravaggi A, Zonaro A, Marin MG, et al. Distribution of viral genotypes in Italy determined by hepatitis C virus typing by DNA ... Antibodies to nuclear, smooth muscle, mitochondrial, and liver and kidney microsomal antigens were assayed on rat liver and ...
more infohttp://gut.bmj.com/content/54/3/402

Plus itPlus it

Branched DNA (bDNA) Assays. Oatp4 mRNA levels in liver were determined by the quantitative branched DNA signal amplification ... differential expression of rat hepatic cytochrome P450 mRNA transcripts using branched DNA signal amplification technology. ... Electrophoretic Mobility Shift Assays. The DNA sequence of the sense strand of each oligonucleotide is listed in Table 1. ... assay (QuantiGene bDNA Signal Amplification Kit; Bayer Corp.-Diagnostics Div., Tarrytown, NY) (Hartley and Klaassen, 2000). ...
more infohttp://molpharm.aspetjournals.org/content/66/3/694

ASMscience | In Vitro Nucleic Acid AmASMscience | In Vitro Nucleic Acid Am

... signal amplification systems (including probe amplification methods), such as branched-DNA technologies (bDNA) and cleavage- ... based signal amplification (cycling probe technologies [CPT] and Invader assays). Proofreading may help maintain fidelity of ... transcription-mediated amplification (TMA), strand displacement amplification (SDA), and loop-mediated isothermal amplification ... target amplification systems, including PCR, ligase chain reaction (LCR), self-sustaining sequence amplification (3SR), nucleic ...
more infohttp://www.asmscience.org/content/book/10.1128/9781555816834.ch03

Branched DNA assay - WikipediaBranched DNA assay - Wikipedia

In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification assay) that is used to ... "A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml". Nucleic Acids ... amplifier The assay can be used to detect and quantify many types of RNA or DNA target. In the assay, branched DNA is mixed ... Several different short single-stranded DNA molecules (oligonucleotides) are used in a branched DNA-assay. The capture and ...
more infohttps://en.wikipedia.org/wiki/Branched_DNA_assay

Patent US6039684 - Non-lethal conditioning methods for the treatment of acquired ... - Google PatentsPatent US6039684 - Non-lethal conditioning methods for the treatment of acquired ... - Google Patents

Pachl et al., 1995, "Rapid and Precise Quantification of HIV-1 RNA in Plasma Using a Branched DNA Signal Amplification Assay", ... Pachl et al., 1995, Rapid and Precise Quantification of HIV 1 RNA in Plasma Using a Branched DNA Signal Amplification Assay , J ... 5.1.12 QUALITATIVE DNA PCR. Qualitative DNA PCR was performed on lyzed cells without purification of DNA. Amplification was ... viral DNA synthesis was measured by qualitative DNA PCR following infection. No significant HIV-1 DNA PCR signal was observed ...
more infohttp://www.google.com/patents/US6039684?dq=Donato+M.+Fraioli

Elevated Levels of Innate Immune Modulators in Lymph Nodes and Blood Are Associated with More-Rapid Disease Progression in...Elevated Levels of Innate Immune Modulators in Lymph Nodes and Blood Are Associated with More-Rapid Disease Progression in...

branch DNA signal amplification assay (version 4.0) specific for SIV (37). The viral load in plasma is reported as copies of ...
more infohttp://pubmedcentralcanada.ca/pmcc/articles/PMC2786739/

Hepatitis C virus RNA quantification in right and left lobes of the liver in patients with chronic hepatitis C<...Hepatitis C virus RNA quantification in right and left lobes of the liver in patients with chronic hepatitis C<...

keywords = "Branched DNA (bDNA) signal amplification, Hepatitis C virus RNA quantification, Laparoscopic-guided liver biopsies ... signal amplification assay were carried out. The aims of this study were threefold: first, to assess the level of hepatitis C ... Quantitative measurements of hepatitis C virus RNA in liver biopsy samples using the branched DNA (bDNA) signal amplification ... Quantitative measurements of hepatitis C virus RNA in liver biopsy samples using the branched DNA (bDNA) signal amplification ...
more infohttps://miami.pure.elsevier.com/en/publications/hepatitis-c-virus-rna-quantification-in-right-and-left-lobes-of-t

Long-term lamivudine treatment of children with chronic hepatitis B: Durability of therapeutic responses and safety<...Long-term lamivudine treatment of children with chronic hepatitis B: Durability of therapeutic responses and safety<...

Branched DNA Signal Amplification Assay Placebos Weights and Measures DNA Hepatitis B Surface Antigens ... defined as HBeAg negative and undetectable HBV DNA by the bDNA assay by the end of the extension study at 3 years, and those ... defined as HBeAg negative and undetectable HBV DNA by the bDNA assay by the end of the extension study at 3 years, and those ... defined as HBeAg negative and undetectable HBV DNA by the bDNA assay by the end of the extension study at 3 years, and those ...
more infohttps://indiana.pure.elsevier.com/en/publications/long-term-lamivudine-treatment-of-children-with-chronic-hepatitis
  • The design of the branched DNA and the way it is hybridized to the nucleic acid to be investigated differs between different generations of the bDNA assay. (wikipedia.org)
  • Subjects were divided into two groups for analysis, those who had achieved virological response (VR), defined as HBeAg negative and undetectable HBV DNA by the bDNA assay by the end of the extension study at 3 years, and those who had not. (elsevier.com)
  • These characterized transcripts were then quantified using the bDNA assay. (nih.gov)
  • Genetic subtypes A-F quantified within a factor of 1.5, indicating that the bDNA assay can be used to measure viral load in clinical samples regardless of genotype. (nih.gov)
  • The bDNA assay for HCV RNA can be used to determine level of virus in HCV-infected individuals and assist in establishing prognosis prior to initiation of alpha-interferon therapy. (nih.gov)
  • Data gathered from medical record review included weight, height, signs and symptoms of hepatitis, alanine aminotransferase (ALT) levels, serologic markers, hepatitis B virus (HBV) DNA levels and serious adverse events (SAEs). (elsevier.com)
  • seemed the very fabric of things, as if the city were a single growth of stone and brick, uncounted strata of message and meaning, age upon age, generated over the centuries to the dictates of some now all-but-unreadable DNA of commerce and empire. (primidi.com)
  • A number of signaling pathways, most notably those controlled by the nuclear factor E2-related factor 2 (Nrf2) transcription factor, are activated to counteract accumulating reactive oxygen species and electrophiles ( Aleksunes and Manautou, 2007 ). (aspetjournals.org)