Benzeneacetamides: Compounds based on benzeneacetamide, that are similar in structure to ACETANILIDES.Receptors, Opioid, kappa: A class of opioid receptors recognized by its pharmacological profile. Kappa opioid receptors bind dynorphins with a higher affinity than endorphins which are themselves preferred to enkephalins.Receptors, Dopamine D1: A subfamily of G-PROTEIN-COUPLED RECEPTORS that bind the neurotransmitter DOPAMINE and modulate its effects. D1-class receptor genes lack INTRONS, and the receptors stimulate ADENYLYL CYCLASES.Dopamine Agonists: Drugs that bind to and activate dopamine receptors.Receptors, Dopamine D2: A subfamily of G-PROTEIN-COUPLED RECEPTORS that bind the neurotransmitter DOPAMINE and modulate its effects. D2-class receptor genes contain INTRONS, and the receptors inhibit ADENYLYL CYCLASES.Dopamine: One of the catecholamine NEUROTRANSMITTERS in the brain. It is derived from TYROSINE and is the precursor to NOREPINEPHRINE and EPINEPHRINE. Dopamine is a major transmitter in the extrapyramidal system of the brain, and important in regulating movement. A family of receptors (RECEPTORS, DOPAMINE) mediate its action.PyrrolidinesPinealoma: Neoplasms which originate from pineal parenchymal cells that tend to enlarge the gland and be locally invasive. The two major forms are pineocytoma and the more malignant pineoblastoma. Pineocytomas have moderate cellularity and tend to form rosette patterns. Pineoblastomas are highly cellular tumors containing small, poorly differentiated cells. These tumors occasionally seed the neuroaxis or cause obstructive HYDROCEPHALUS or Parinaud's syndrome. GERMINOMA; CARCINOMA, EMBRYONAL; GLIOMA; and other neoplasms may arise in the pineal region with germinoma being the most common pineal region tumor. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, p2064; Adams et al., Principles of Neurology, 6th ed, p670)Thiotepa: A very toxic alkylating antineoplastic agent also used as an insect sterilant. It causes skin, gastrointestinal, CNS, and bone marrow damage. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), thiotepa may reasonably be anticipated to be a carcinogen (Merck Index, 11th ed).Search Engine: Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.Topotecan: An antineoplastic agent used to treat ovarian cancer. It works by inhibiting DNA TOPOISOMERASES, TYPE I.Hematopoietic Stem Cell Transplantation: Transfer of HEMATOPOIETIC STEM CELLS from BONE MARROW or BLOOD between individuals within the same species (TRANSPLANTATION, HOMOLOGOUS) or transfer within the same individual (TRANSPLANTATION, AUTOLOGOUS). Hematopoietic stem cell transplantation has been used as an alternative to BONE MARROW TRANSPLANTATION in the treatment of a variety of neoplasms.Pineal Gland: A light-sensitive neuroendocrine organ attached to the roof of the THIRD VENTRICLE of the brain. The pineal gland secretes MELATONIN, other BIOGENIC AMINES and NEUROPEPTIDES.Carboplatin: An organoplatinum compound that possesses antineoplastic activity.Drug Approval: Process that is gone through in order for a drug to receive approval by a government regulatory agency. This includes any required pre-clinical or clinical testing, review, submission, and evaluation of the applications and test results, and post-marketing surveillance of the drug.Inventors: Persons or entities that introduce a novel composition, device, or process, as well as improvements thereof.Zoology: The study of animals - their morphology, growth, distribution, classification, and behavior.Ketotifen: A cycloheptathiophene blocker of histamine H1 receptors and release of inflammatory mediators. It has been proposed for the treatment of asthma, rhinitis, skin allergies, and anaphylaxis.United States Food and Drug Administration: An agency of the PUBLIC HEALTH SERVICE concerned with the overall planning, promoting, and administering of programs pertaining to maintaining standards of quality of foods, drugs, therapeutic devices, etc.Polygonaceae: The only family of the buckwheat order (Polygonales) of dicotyledonous flowering plants. It has 40 genera of herbs, shrubs, and trees.PyrazinesBenzene DerivativesBenzene: Toxic, volatile, flammable liquid hydrocarbon byproduct of coal distillation. It is used as an industrial solvent in paints, varnishes, lacquer thinners, gasoline, etc. Benzene causes central nervous system damage acutely and bone marrow damage chronically and is carcinogenic. It was formerly used as parasiticide.Peptide Hydrolases: Hydrolases that specifically cleave the peptide bonds found in PROTEINS and PEPTIDES. Examples of sub-subclasses for this group include EXOPEPTIDASES and ENDOPEPTIDASES.Patents as Topic: Exclusive legal rights or privileges applied to inventions, plants, etc.Aldehydes: Organic compounds containing a carbonyl group in the form -CHO.Tylosin: Macrolide antibiotic obtained from cultures of Streptomyces fradiae. The drug is effective against many microorganisms in animals but not in humans.Molecular Structure: The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.Acetamides: Derivatives of acetamide that are used as solvents, as mild irritants, and in organic synthesis.Amides: Organic compounds containing the -CO-NH2 radical. Amides are derived from acids by replacement of -OH by -NH2 or from ammonia by the replacement of H by an acyl group. (From Grant & Hackh's Chemical Dictionary, 5th ed)Propyl Gallate: Antioxidant for foods, fats, oils, ethers, emulsions, waxes, and transformer oils.TRPV Cation Channels: A subgroup of TRP cation channels named after vanilloid receptor. They are very sensitive to TEMPERATURE and hot spicy food and CAPSAICIN. They have the TRP domain and ANKYRIN repeats. Selectivity for CALCIUM over SODIUM ranges from 3 to 100 fold.Floxuridine: An antineoplastic antimetabolite that is metabolized to fluorouracil when administered by rapid injection; when administered by slow, continuous, intra-arterial infusion, it is converted to floxuridine monophosphate. It has been used to treat hepatic metastases of gastrointestinal adenocarcinomas and for palliation in malignant neoplasms of the liver and gastrointestinal tract.Fluorodeoxyglucose F18: The compound is given by intravenous injection to do POSITRON-EMISSION TOMOGRAPHY for the assessment of cerebral and myocardial glucose metabolism in various physiological or pathological states including stroke and myocardial ischemia. It is also employed for the detection of malignant tumors including those of the brain, liver, and thyroid gland. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1162)Fluorodeoxyuridylate: 5-Fluoro-2'-deoxyuridylate. An inhibitor of thymidylate synthetase. Formed from 5-fluorouracil or 5-fluorodeoxyuridine.2,5-Dimethoxy-4-Methylamphetamine: A psychedelic phenyl isopropylamine derivative, commonly called DOM, whose mood-altering effects and mechanism of action may be similar to those of LSD.Pyridines: Compounds with a six membered aromatic ring containing NITROGEN. The saturated version is PIPERIDINES.AmidinesNortropanesOrganosilicon Compounds: Organic compounds that contain silicon as an integral part of the molecule.ThiazolesProtein Kinases: A family of enzymes that catalyze the conversion of ATP and a protein to ADP and a phosphoprotein.Protein Kinase C: An serine-threonine protein kinase that requires the presence of physiological concentrations of CALCIUM and membrane PHOSPHOLIPIDS. The additional presence of DIACYLGLYCEROLS markedly increases its sensitivity to both calcium and phospholipids. The sensitivity of the enzyme can also be increased by PHORBOL ESTERS and it is believed that protein kinase C is the receptor protein of tumor-promoting phorbol esters.Protein Kinase Inhibitors: Agents that inhibit PROTEIN KINASES.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Cytochrome P-450 Enzyme System: A superfamily of hundreds of closely related HEMEPROTEINS found throughout the phylogenetic spectrum, from animals, plants, fungi, to bacteria. They include numerous complex monooxygenases (MIXED FUNCTION OXYGENASES). In animals, these P-450 enzymes serve two major functions: (1) biosynthesis of steroids, fatty acids, and bile acids; (2) metabolism of endogenous and a wide variety of exogenous substrates, such as toxins and drugs (BIOTRANSFORMATION). They are classified, according to their sequence similarities rather than functions, into CYP gene families (>40% homology) and subfamilies (>59% homology). For example, enzymes from the CYP1, CYP2, and CYP3 gene families are responsible for most drug metabolism.Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Nuclear Receptor Subfamily 1, Group F, Member 3: An orphan nuclear receptor found in the THYMUS where it plays a role in regulating the development and maturation of thymocytes. An isoform of this protein, referred to as RORgammaT, is produced by an alternatively transcribed mRNA.Nuclear Receptor Subfamily 1, Group F, Member 1: A DNA-binding orphan nuclear receptor that positively regulates expression of ARNTL TRANSCRIPTION FACTORS and is a regulatory component of the circadian clock system. The protein also has a role in neuron cell survival and differentiation in that loss of function mutations of its gene result in the mouse phenotype referred to as the STAGGERER MOUSE.Nuclear Receptor Subfamily 1, Group F, Member 2: An orphan nuclear receptor that is expressed at high levels in neuronal tissues, the RETINA; EPIDIDYMIS; and VAS DEFERENS. The receptor is believed to play a role in regulating a variety of functions including the processing of sensory information, the differentiation of PHOTORECEPTOR CELLS and the CIRCADIAN RHYTHM.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Receptor Tyrosine Kinase-like Orphan Receptors: A family of cell surface receptors that were originally identified by their structural homology to neurotropic TYROSINE KINASES and referred to as orphan receptors because the associated ligand and signaling pathways were unknown. Evidence for the functionality of these proteins has been established by experiments showing that disruption of the orphan receptor genes results in developmental defects.Gene Regulatory Networks: Interacting DNA-encoded regulatory subsystems in the GENOME that coordinate input from activator and repressor TRANSCRIPTION FACTORS during development, cell differentiation, or in response to environmental cues. The networks function to ultimately specify expression of particular sets of GENES for specific conditions, times, or locations.Receptors, Thyroid Hormone: Specific high affinity binding proteins for THYROID HORMONES in target cells. They are usually found in the nucleus and regulate DNA transcription. These receptors are activated by hormones that leads to transcription, cell differentiation, and growth suppression. Thyroid hormone receptors are encoded by two genes (GENES, ERBA): erbA-alpha and erbA-beta for alpha and beta thyroid hormone receptors, respectively.

Comparison of two aquaretic drugs (niravoline and OPC-31260) in cirrhotic rats with ascites and water retention. (1/208)

kappa-Opioid receptor agonists (niravoline) or nonpeptide antidiuretic hormone (ADH) V2 receptor antagonists (OPC-31260) possess aquaretic activity in cirrhosis; however, there is no information concerning the effects induced by the chronic administration of these drugs under this condition. To compare the renal and hormonal effects induced by the long-term oral administration of niravoline, OPC-31260, or vehicle, urine volume, urinary osmolality, sodium excretion, and urinary excretion of aldosterone (ALD) and ADH were measured in basal conditions and for 10 days after the daily oral administration of niravoline, OPC-31260, or vehicle to cirrhotic rats with ascites and water retention. Creatinine clearance, serum osmolality, ADH mRNA expression, and systemic hemodynamics were also measured at the end of the study. Niravoline increased water excretion, peripheral resistance, serum osmolality, and sodium excretion and reduced creatinine clearance, ALD and ADH excretion, and mRNA expression of ADH. OPC-31260 also increased water metabolism and sodium excretion and reduced urinary ALD, although the aquaretic effect was only evident during the first 2 days, and no effects on serum osmolality, renal filtration, and systemic hemodynamics were observed. Therefore, both agents have aquaretic efficacy, but the beneficial therapeutic effects of the long-term oral administration of niravoline are more consistent than those of OPC-31260 in cirrhotic rats with ascites and water retention.  (+info)

kappa-Opioid receptor effects of butorphanol in rhesus monkeys. (2/208)

Butorphanol and nalbuphine have substantial affinity for mu and kappa-opioid receptor sites, yet their behavioral effects in monkeys are largely consistent with a mu receptor mechanism of action. Using ethylketocyclazocine (EKC) discrimination and diuresis assays in rhesus monkeys (Macaca mulatta), the purpose of the current investigation was to characterize the in vivo kappa-opioid activity of these compounds through the use of an insurmountable mu-opioid receptor antagonist, clocinnamox. Alone, butorphanol (0.001-0.032 mg/kg i.m.) failed to generalize to EKC, and pretreatment with the competitive opioid receptor antagonist quadazocine (0.1 or 0.32 mg/kg i.m.) did not alter this generalization. At 24 h after clocinnamox (0.1 mg/kg i.m.) administration, butorphanol fully generalized to EKC, and this generalization was maintained in two of three monkeys at 72 h. Parallel results were observed in diuresis: butorphanol alone and in the presence of quadazocine (1 mg/kg i.m.) did not alter urine output, and a marked diuretic effect was demonstrated 24 h to 2 weeks after clocinnamox administration. Clocinnamox did not alter the discriminative stimulus or diuretic effects of nalbuphine or of the kappa-opioid receptor agonists EKC or U69593. These results are consistent with an in vivo agonist activity of butorphanol at kappa-opioid receptors that can only be demonstrated when an insurmountable antagonist has substantially eliminated the dominant receptor population through which it exerts its action.  (+info)

kappa-Opioid tolerance and dependence in cultures of dopaminergic midbrain neurons. (3/208)

Repeated cocaine exposure upregulates kappa opioids and their receptors in the mesocorticolimbic system; the ensuing kappa-mediated dysphoria appears to contribute to addiction and withdrawal. As a potential rehabilitation strategy to reverse cocaine-induced kappa sensitization, the present study used tritiated dopamine release assays to examine the induction of kappa-opioid tolerance in cultured mesencephalic neurons. Administration of the kappa agonist U69,593 inhibited tetrodotoxin-sensitive, spontaneous (EC(50) = 1.5 nM), and potassium-stimulated (EC(50) = 10 nM) release. These effects were blocked by pertussis toxin and by the kappa antagonist nor-binaltorphimine. The 2 d agonist exposure (1 microM) caused a shift in the U69,593 dose-response curve that was greater in the potassium-stimulated paradigm (140-fold) than in the spontaneous release assay (sixfold). These results were attributable to the attenuation of kappa-receptor signaling mechanisms and to dependence. In the stimulated release assay, attenuation of kappa signaling caused by 4 hr of U69,593 exposure recovered with a half-life of 1.1 hr, whereas attenuation after 144 hr of exposure recovered slowly (t(1/2) = 20 hr). In the spontaneous release assay, attenuation of kappa-opioid signaling occurred slowly (t(1/2) = 22 hr), and resensitization after a 144 hr exposure was rapid (t(1/2) < 1 hr). kappa-Opioid dependence was observed after 144 hr of U69,593 exposure. Thus multiple mechanisms of adaptation to kappa-opioid exposure occur in mesocorticolimbic neurons. These data support the idea that the administration of kappa opioids might facilitate drug rehabilitation.  (+info)

Actions of opioids on excitatory and inhibitory transmission in substantia gelatinosa of adult rat spinal cord. (4/208)

1. The actions of opioid receptor agonists on synaptic transmission in substantia gelatinosa (SG) neurones in adult (6- to 10-week-old) rat spinal cord slices were examined by use of the blind whole-cell patch-clamp technique. 2. Both the mu-receptor agonist DAMGO (1 microM) and the delta-receptor agonist DPDPE (1 microM) reduced the amplitude of glutamatergic excitatory postsynaptic currents (EPSCs) which were monosynaptically evoked by stimulating Adelta afferent fibres. Both also decreased the frequency of miniature EPSCs without affecting their amplitude. 3. In contrast, the kappa-receptor agonist U-69593 (1 microM) had little effect on the evoked and miniature EPSCs. 4. The effects of DAMGO and DPDPE were not seen in the presence of the mu-receptor antagonist CTAP (1 microM) and the delta-receptor antagonist naltrindole (1 microM), respectively. 5. Neither DAMGO nor DPDPE at 1 microM affected the responses of SG neurones to bath-applied AMPA (10 microM). 6. Evoked and miniature inhibitory postsynaptic currents (IPSCs), mediated by either the GABAA or the glycine receptor, were unaffected by the mu-, delta- and kappa-receptor agonists. Similar results were also obtained in SG neurones in young adult (3- to 4-week-old) rat spinal cord slices. 7. These results indicate that opioids suppress excitatory but not inhibitory synaptic transmission, possibly through the activation of mu- and delta- but not kappa-receptors in adult rat spinal cord SG neurones; these actions are presynaptic in origin. Such an action of opioids may be a possible mechanism for the antinociception produced by their intrathecal administration.  (+info)

Agonist-dependent desensitization of the kappa opioid receptor by G protein receptor kinase and beta-arrestin. (5/208)

We used the Xenopus oocyte expression system to examine the regulation of rat kappa opioid receptor (rKOR) function by G protein receptor kinases (GRKs). kappa agonists increased the conductance of G protein-activated inwardly rectifying potassium channels in oocytes co-expressing KOR with Kir3.1 and Kir3.4. In the absence of added GRK and beta-arrestin 2, desensitization of the kappa agonist-induced potassium current was modest. Co-expression of either GRK3 or GRK5 along with beta-arrestin 2 significantly increased the rate of desensitization, whereas addition of either beta-arrestin 2, GRK3, or GRK5 alone had no effect on the KOR desensitization rate. The desensitization was homologous as co-expressed delta opioid receptor-evoked responses were not affected by KOR desensitization. The rate of GRK3/beta-arrestin 2-dependent desensitization was reduced by truncation of the C-terminal 26 amino acids, KOR(Q355Delta). In contrast, substitution of Ala for Ser within the third intracellular loop [KOR(S255A,S260A, S262A)] did not reduce the desensitization rate. Within the C-terminal region, KOR(S369A) substitution significantly attenuated desensitization, whereas the KOR(T363A) and KOR(S356A,T357A) point mutations did not. These results suggest that co-expression of GRK3 or GRK5 and beta-arrestin 2 produced homologous, agonist-induced desensitization of the kappa opioid receptor by a mechanism requiring the phosphorylation of the serine 369 of rKOR.  (+info)

Dynorphin selectively augments the M-current in hippocampal CA1 neurons by an opiate receptor mechanism. (6/208)

Most electrophysiological studies of opioids on hippocampal principal neurons have found indirect actions, usually through interneurons. However, our laboratory recently found reciprocal alteration of the voltage-dependent K(+) current, known as the M-current (I(M)), by kappa and delta opioid agonists in CA3 pyramidal neurons. Recent ultrastructural studies have revealed postsynaptic delta opiate receptors on dendrites and cell bodies of CA1 and CA3 hippocampal pyramidal neurons (HPNs). Reasoning that previous electrophysiological studies may have overlooked voltage-dependent postsynaptic effects of the opioids in CA1, we reevaluated their role in CA1 HPNs using the rat hippocampal slice preparation for intracellular current- and voltage-clamp recording. None of the delta and mu; receptor-selective opioids tested, including [D-Pen(2,5)]-enkephalin (DPDPE), [D-Ala(2)]-deltorphin II (deltorphin), [D-Ala(2), NMe-Phe(4), Gly-ol]-enkephalin (DAMGO), and [D-Ala(2), D-Leu(5)] enkephalin (DADLE), altered membrane properties such as I(M) or Ca(2+)-dependent spikes in CA1 HPNs. The nonopioid, Des-Tyr-dynorphin (D-T-dyn), also had no effect. By contrast, dynorphin A (1-17) markedly increased I(M) at low concentrations and caused an outward current at depolarized membrane potentials. The opioid antagonist naloxone and the kappa receptor antagonist nor-binaltorphimine (nBNI) blocked the I(M) effect. However, the kappa-selective agonists U69,593 and U50,488h did not significantly alter I(M) amplitudes when averaged over all cells tested, although occasional cells showed an I(M) increase with U50,488h. Our results suggest that dynorphin A postsynaptically modulates the excitability of CA1 HPNs through opiate receptors linked to voltage-dependent K(+) channels. These findings also provide pharmacological evidence for a functional kappa opiate receptor subtype in rat CA1 HPNs but leave unanswered questions on the role of delta receptors in CA1 HPNs.  (+info)

Mitogenic signaling via endogenous kappa-opioid receptors in C6 glioma cells: evidence for the involvement of protein kinase C and the mitogen-activated protein kinase signaling cascade. (7/208)

As reports on G protein-coupled receptor signal transduction mechanisms continue to emphasize potential differences in signaling due to relative receptor levels and cell type specificities, the need to study endogenously expressed receptors in appropriate model systems becomes increasingly important. Here we examine signal transduction mechanisms mediated by endogenous kappa-opioid receptors in C6 glioma cells, an astrocytic model system. We find that the kappa-opioid receptor-selective agonist U69,593 stimulates phospholipase C activity, extracellular signal-regulated kinase 1/2 phosphorylation, PYK2 phosphorylation, and DNA synthesis. U69,593-stimulated extracellular signal-regulated kinase 1/2 phosphorylation is shown to be upstream of DNA synthesis as inhibition of signaling components such as pertussis toxin-sensitive G proteins, L-type Ca2+ channels, phospholipase C, intracellular Ca2+ release, protein kinase C, and mitogen-activated protein or extracellular signal-regulated kinase kinase blocks both of these downstream events. In addition, by overexpressing dominant-negative or sequestering mutants, we provide evidence that extracellular signal-regulated kinase 1/2 phosphorylation is Ras-dependent and transduced by Gbetagamma subunits. In summary, we have delineated major features of the mechanism of the mitogenic action of an agonist of the endogenous kappa-opioid receptor in C6 glioma cells.  (+info)

Mu-opioid agonist inhibition of kappa-opioid receptor-stimulated extracellular signal-regulated kinase phosphorylation is dynamin-dependent in C6 glioma cells. (8/208)

In previous studies we found that mu-opioids, acting via mu-opioid receptors, inhibit endothelin-stimulated C6 glioma cell growth. In the preceding article we show that the kappa-selective opioid agonist U69,593 acts as a mitogen with a potency similar to that of endothelin in the same astrocytic model system. Here we report that C6 cell treatment with mu-opioid agonists for 1 h results in the inhibition of kappa-opioid mitogenic signaling. The mu-selective agonist endomorphin-1 attenuates kappa-opioid-stimulated DNA synthesis, phosphoinositide turnover, and extracellular signal-regulated kinase phosphorylation. To investigate the role of receptor endocytosis in signaling, we have examined the effects of dynamin-1 and its GTPase-defective, dominant suppressor mutant (K44A) on opioid modulation of extracellular signal-regulated kinase phosphorylation in C6 cells. Overexpression of dynamin K44A in C6 cells does not affect kappa-opioid phosphorylation of extracellular signal-regulated kinase. However, it does block the inhibitory action on kappa-opioid signaling mediated by the kappa-opioid receptor. Our results are consistent with a growing body of evidence of the opposing actions of mu- and kappa-opioids and provide new insight into the role of opioid receptor trafficking in signaling.  (+info)

*U-47700

Oxygen substituted amino-cyclohexyl-benzeneacetamides and -benzamides as water diuretic drugs". Casy, Alan F.; Parfitt, Robert ...

*U-77891

... benzeneacetamides and -benzamide analgesics". The Upjohn Company. "Properties Viewer". chemicalize.org. AH-7921 U-47700 U-50488 ...

*List of MeSH codes (D02)

... benzeneacetamides MeSH D02.065.064.294.088 --- bufexamac MeSH D02.065.064.400 --- iodoacetamide MeSH D02.065.064.650 --- ... benzeneacetamides MeSH D02.455.426.559.389.048.088 --- bufexamac MeSH D02.455.426.559.389.097 --- benzenesulfonates MeSH ...
Based on the structural similarity of viral fusion proteins within the family Paramyxoviridae, we tested recently described and newly synthesized acetanilide derivatives for their capacity to inhibit measles virus (MV)-, canine distemper virus (CDV)- and Nipah virus (NiV)-induced membrane fusion. We found that N-(3-cyanophenyl)-2-phenylacetamide (compound 1) has a high capacity to inhibit MV- and CDV-induced (IC50=3 μM), but not NiV-induced, membrane fusion. This compound is of outstanding interest because it can be easily synthesized and its cytotoxicity is low [50 % cytotoxic concentration (CC50)≥300 μM], leading to a CC50/IC50 ratio of approximately 100. In addition, primary human peripheral blood lymphocytes and primary dog brain cell cultures (DBC) also tolerate high concentrations of compound 1. Infection of human PBMC with recombinant wild-type MV is inhibited by an IC50 of approximately 20 μM. The cell-to-cell spread of recombinant wild-type CDV in persistently infected DBC can be nearly
Emergence of disinhibition-induced synchrony in the CA3 region of the guinea pig hippocampus in vitro.: Suppressing inhibition mediated by GABAA receptors induc
Nepafenac - Get up-to-date information on Nepafenac side effects, uses, dosage, overdose, pregnancy, alcohol and more. Learn more about Nepafenac
J Med Chem. 2010 Sep 9;53(17):6386-97.Discovery of N-{1-[3-(3-oxo-2,3-dihydrobenzo[1,4]oxazin-4-yl)propyl]piperidin-4-yl}-2-phenylacetamide (Lu AE51090): an allosteric muscarinic M1 receptor agonist with unprecedented selectivity and procognitive potential. ...
Professional guide for Nepafenac. Includes: pharmacology, pharmacokinetics, contraindications, interactions, adverse reactions and more.
Nepafenac official prescribing information for healthcare professionals. Includes: indications, dosage, adverse reactions, pharmacology and more.
Giá bán lẻ 1 tuýp là 790.000 vnđ, mua 3 bạn sẽ tiết kiệm được ngay: 970.000 vnđ, gọi điện đặt hàng ngay: 093.88.95.700 - 086.8900.269
Giá bán lẻ 1 tuýp là 790.000 vnđ, mua 3 bạn sẽ tiết kiệm được ngay: 970.000 vnđ, gọi điện đặt hàng ngay: 093.88.95.700 - 086.8900.269
... ,,, Kop XANAX natet ,,, http://imagizer.imageshack.us/v2/533x300q90/923/IgToTq.jpg . .
OUTLINE: This is an open label study.. Patients receive gradually escalating doses of antineoplaston A10 and antineoplaston AS2-1 by intravenous injection 6 times daily until the maximum tolerated dose is reached.. Treatment continues for at least 3 months in the absence of toxicity and disease progression. Patients achieving complete response (CR) continue treatment for an additional 8 months after reaching CR.. Tumors are measured every 2 months for the first year and every 3 months for the second year.. PROJECTED ACCRUAL: A total of 20-40 patients will be accrued for this study. ...
Current therapies for metastatic or unresectable Colon Cancer provide very limited benefit to the patient. The anti-cancer properties of Antineoplaston therapy suggest that it may prove beneficial in the treatment of metastatic or unresectable Colon Cancer.. PURPOSE: This study is being performed to determine the effects (good and bad) that Antineoplaston therapy has on patients with metastatic or unresectable Colon Cancer ...
RATIONALE: Antineoplastons are naturally-occurring substances that may also be made in the laboratory. Antineoplastons may inhibit the growth of cancer
Genomic Medicine UK is the home of comprehensive genomic testing in Harley Street in London. Our medical doctors and consultants work tirelessly to provide the best possible standards of testing and screening for genes that may cause cancers or diseases at an affordable cost. We use all available medical, diagnostic, and laboratory technology to provide our patients with a reliable evidence-based and thorough service ...
Rò hậu sĩ chuyên khoa là một bệnh lý nguy hiểm dẫn tới phổ biến hệ lụy tới thể trạng cũng như tinh thần của bệnh nhân. Thế chúng ta đã phát hiện bệnh gì về bệnh? phương pháp trị bệnh lý tận gốc là gì? nếu bạn muốn mua hiểu hay đang mắc phải căn bệnh thì hãy tham khảo các thông tin phong kham da khoa dai dong truyền đạt trong suốt bài viết này để sở hữu thể biết được hơn về bệnh rò hậu sĩ chuyên khoa cũng như kịp thời tậu ra bí quyết trị bệnh lý tận gốc trường hợp ko may mắc bắt buộc nhé. căn
Rò hậu sĩ chuyên khoa là một bệnh lý nguy hiểm dẫn tới phổ biến hệ lụy tới thể trạng cũng như tinh thần của bệnh nhân. Thế chúng ta đã phát hiện bệnh gì về bệnh? phương pháp trị bệnh lý tận gốc là gì? nếu bạn muốn mua hiểu hay đang mắc phải căn bệnh thì hãy tham khảo các thông tin phong kham da khoa dai dong truyền đạt trong suốt bài viết này để sở hữu thể biết được hơn về bệnh rò hậu sĩ chuyên khoa cũng như kịp thời tậu ra bí quyết trị bệnh lý tận gốc trường hợp ko may mắc bắt buộc nhé. căn
N-methyl-N-[2-(1-pyrrolidinylcarbonyl)phenyl]-2-pyridinamine - chemical structural formula, chemical names, chemical properties, synthesis references
Formula: C27H43NO2MW: 413. 64CAS: 126-17-0TNP NUMBER: TNP00027MDL NUMBER: MFCD09787895IUPAC: (1S,2S,4S,7S,9S,12S,16S,8R,13R,26R)-7,9,13,23-tetramethyl-5-oxaspiro[pentacycl o[10....
Ceny za kopírovacie a rozmnožovacie služby zahŕňajú daň z pridanej hodnoty so sadzbou dane platnou v deň vzniku daňovej povinnosti podľa § 27 zákona č. 222/2004 Z. z. o dani z pridanej hodnoty v znení neskorších predpisov ...
pF1KB6168 4922 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGAGTGCTGCA GTGACTGCAGGGAAGCTGGCACGGGCACCGGCCGACCCTGGGAAAGCCGGGGTCCCCGGA GTTGCAGCTCCCGGAGCTCCGGCGGCGGCTCCACCGGCGAAAGAGATCCCGGAGGTCCTA GTGGACCCACGCAGCCGGCGGCGCTATGTGCGGGGCCGCTTTTTGGGCAAGGGCGGCTTT GCCAAGTGCTTCGAGATCTCGGACGCGGACACCAAGGAGGTGTTCGCGGGCAAGATTGTG CCTAAGTCTCTGCTGCTCAAGCCGCACCAGAGGGAGAAGATGTCCATGGAAATATCCATT CACCGCAGCCTCGCCCACCAGCACGTCGTAGGATTCCACGGCTTTTTCGAGGACAACGAC TTCGTGTTCGTGGTGTTGGAGCTCTGCCGCCGGAGGTCTCTCCTGGAGCTGCACAAGAGG AGGAAAGCCCTGACTGAGCCTGAGGCCCGATACTACCTACGGCAAATTGTGCTTGGCTGC CAGTACCTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTG AATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGAC GGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGC AAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTG TTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAG AAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAG ...
pF1KSDB0014 9017 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCTTTCGAAGGAGAT AGAACCATGGCACAGCAAGCTGCCGATAAGTATCTCTATGTGGATAAAAACTTCATCAAC AATCCGCTGGCCCAGGCCGACTGGGCTGCCAAGAAGCTGGTATGGGTGCCTTCCGACAAG AGTGGCTTTGAGCCAGCCAGCCTCAAGGAGGAGGTGGGCGAAGAGGCCATCGTGGAGCTG GTGGAGAATGGGAAGAAGGTGAAGGTGAACAAGGATGACATCCAGAAGATGAACCCGCCC AAGTTCTCCAAGGTGGAGGACATGGCAGAGCTCACGTGCCTCAACGAAGCCTCGGTGCTG CACAACCTCAAGGAGCGTTACTACTCAGGGCTCATCTACACCTATTCAGGCCTGTTCTGT GTGGTCATCAATCCTTACAAGAACCTGCCCATCTACTCTGAAGAGATTGTGGAAATGTAC AAGGGCAAGAAGAGGCACGAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTAC AGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCT GGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCAC AAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTG GAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTC ATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTT TTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTAT ...
Learn about the peripherally acting Kappa Opioid Receptor Agonists that Cara Therapeutics is developing for better pruritus and pain management in patients.
N-Methyl-N-[3-(trifluoromethyl)benzyl]amine, 97+%, Maybridge Amber Glass Bottle; 1g N-Methyl-N-[3-(trifluoromethyl)benzyl]amine, 97+%, Maybridge Methylthios to Mh...
N-Methyl-N-[(1-methylpiperidin-3-yl)methyl]pyridin-2-amine | C13H21N3 | CID 72001564 - structure, chemical names, physical and chemical properties, classification, patents, literature, biological activities, safety/hazards/toxicity information, supplier lists, and more.
91457-53-3 - MTXRYLDKVRPTGG-UHFFFAOYSA-N - Benzeneacetamide, 2,6-dichloro-N-((ethylamino)iminomethyl)- - Similar structures search, synonyms, formulas, resource links, and other chemical information.
Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verifification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice. ...
... ,5-[(3-Amino-2,4,6-triiodophenyl)methylamino]-5-oxopentanoic acid,3-amino-2,4,6-triiodo-N-methylglutaranilic acid,N-methyl-N-(3-amino-2,4,6-triiodophenyl)glutaramic acid,N-methyl-N-(2,4,6-triiodo-3-aminophenyl)glutaramidic acid,RG-270,Falignost
Source: Umuvugizi.com Ubu buhambya bwa Dr Rudasingwa, ikinyamakuru Umuvugizi gifitiye kopi, ni ubuhamya bukomeye ku muntu nka we wari mu basirikari bakuru (major) mu ngabo za FPR-Inkotanyi, akaba yaranagizwe umunyamabanga mukuru wishyaka rya FPR, nyuma gato yuko rifashe ubutegetsi muri nyakanga 1994. Ubu buhamya kandi Dr Rudasingwa yashyize ahagaragara uyu munsi, nta gushidikanya ko bwakoze mu bwonko Perezida Kagame kuko uyu, mu biganiro yakunze kugirana nabanyamakuru mpuzamahanga, yahakanaga yivuye inyuma ko ntaho ahuriye nurupfu rwa Perezida Habyarimana. Mu kiganiro cyitwa «Hard Talk» gihita kuri radiyo BBC mu rurimi rwicyongereza, ubwo umunyamakuru yamubazaga niba ari we koko wahanuye indege ya Perezida Habyarimana, aho kumusubiza ikibazo yari abajijwe, Kagame yahisemo kugikwepa, asubiza ko «Habyarimana yari yaramuhejeje i Shyanga imyaka mirongo itatu». Si Rudasingwa wenyine utanze ubuhamya nkubu, kuko mu mwaka w1998, umunyamakuru witwa Jean-Pierre Mugabe, wayoboraga «Le Tribun du ...
This serie description Aukstums, karstums, lietus, sniegs, stress, netīrumi un citi apkārtējās vides kairinātāji - ar to visu ādai jātiek galā dienas laikā. Tai nepieciešama īpaša aizsardzība, piemērota kopšana pēc ik rīta tīrīšanas un tonizēšanas. Tieši šim nolūkam ir radīti Dr.Hauschka dienas kopšanas līdzekļi. Augstvērtīgie augu ekstrakti aktivizē dabisko mitrināšanu, kamēr izmeklētas eļļas un vērtīgi vaski nodrošina sejas maigu aizsardzību, netraucējot ādai elpot. Turklāt Dr.Hauschka dienas ādas kopšanas produkti ir tikpat daudzveidīgi un dažādi kā ikviens no mums. Vienalga, kāds ir Jūsu ādas stāvoklis attiecīgajā dzīves posmā, augstvērtīgie sastāvi stimulē ādas pašatjaunošanos. Lai āda iegūtu vienmērīgu viegla iedeguma toni, papildus izvēlieties Dr.Hauschka tonējošo dienas krēmu vai Dr.Hauschka tonējošo fluīdu, savukārt nelielus ādas defektus nomaskējiet ar Dr.Hauschka korektoru. Palutiniet savu ādu ar ...
This serie description Aukstums, karstums, lietus, sniegs, stress, netīrumi un citi apkārtējās vides kairinātāji - ar to visu ādai jātiek galā dienas laikā. Tai nepieciešama īpaša aizsardzība, piemērota kopšana pēc ik rīta tīrīšanas un tonizēšanas. Tieši šim nolūkam ir radīti Dr.Hauschka dienas kopšanas līdzekļi. Augstvērtīgie augu ekstrakti aktivizē dabisko mitrināšanu, kamēr izmeklētas eļļas un vērtīgi vaski nodrošina sejas maigu aizsardzību, netraucējot ādai elpot. Turklāt Dr.Hauschka dienas ādas kopšanas produkti ir tikpat daudzveidīgi un dažādi kā ikviens no mums. Vienalga, kāds ir Jūsu ādas stāvoklis attiecīgajā dzīves posmā, augstvērtīgie sastāvi stimulē ādas pašatjaunošanos. Lai āda iegūtu vienmērīgu viegla iedeguma toni, papildus izvēlieties Dr.Hauschka tonējošo dienas krēmu vai Dr.Hauschka tonējošo fluīdu, savukārt nelielus ādas defektus nomaskējiet ar Dr.Hauschka korektoru. Palutiniet savu ādu ar ...
Learn about Lithostat (Acetohydroxamic Acid Tablets) may treat, uses, dosage, side effects, drug interactions, warnings, patient labeling, reviews, and related medications.
Summary: A mutation in a gene designated gmdA has been found to lead to loss of ability of Aspergillus nidulans to use benzamide, phenylacetamide and several other amides as sole nitrogen sources for growth. The gmdAI lesion results in low levels of an enzyme, called the general amidase, which has activity for a wide range of amide substrates. This enzyme is repressed by certain nitrogen-containing metabolites, including ammonium, but is probably not regulated by induction or by carbon catabolite repression. Evidence is presented for the general amidase being distinct from the previously characterized acetamidase and formamidase enzymes. The data also indicate that there is a fourth amidase capable of the hydrolysis of valeramide and hexanamide.
There are a lot of red flags here, of course, the first of which is that the conference is the Asia-Pacific Academy of Anti-Aging Medicine. Anti-aging medicine tends to be, more than anything else, a cesspit of pseudoscience and quackery; so Burzynski fits right in. But what about the report itself. Obviously, its pretty much impossible to tell much from a self-serving press release, but there is one enormous additional red flag. Notice how the press release says that this is a report on a "total of 401 eligible patients (patients who received over 28 days of treatment) with advanced inoperable brain tumors have been treated with antineoplaston A10 and antineoplastons AS2-1 therapy (ANP) in phase II studies." Actually, there are two red flags right in that passage. First, notice how it says only patients who received over 28 days of treatment were counted. This, by its very nature, selects for patients who are in good enough shape to tolerate 28 days of antineoplaston therapy, which, as we have ...
Looking for online definition of H/U or what H/U stands for? H/U is listed in the Worlds largest and most authoritative dictionary database of abbreviations and acronyms
Next is a very familiar story to those of us who have been following Burzynski. Treatment at the Burzynski Clinic easily runs into tens of thousands, if not hundreds of thousands, of dollars. Through a monumental effort, Seáns family managed to raise €120,000 (which at todays exchange rate is approximately $160,000) to go to Houston; so go to Houston they did. We see the video that appears to have been taken with an iPhone camera of the family, including Seán, his mother, his brother Tomás, and his sister Deirdre mugging for the camera in front of the Burzynski Clinic, overjoyed to be there because they think that this is Seáns best hope for survival.. Although it grated me to hear the narrator describe antineoplaston therapy as "controversial" (its not controversial from a scientific standpoint; theres no evidence that it works), I give the producers credit for making it very clear that antineoplastons have never been "granted a general license by the FDA," and calling them in a ...
Generics: Nepafenac, Form: DROPS, Pack Size: 1, Brand name: I NAC EYE 5ML DROPS, Manufacturer: APPASAMY OCULAR DEVICES, Contains: Nepafenac 0.1 %W/V, Drug category: Ophthalmic Decongestants, ...
Ubushakashatsi buheruka gukorwa bugaragaza ko imizabibu isa na mauve igira akamaro mu kurinda kanseri yamabere. Umutobe uva muri iyi mizabibu urwanya ibibyimba biza mu mabere akaba ariyo mvano nyamukuru ya kanseri yibere. Ntabwo nyamara bigarukira kuri kanseri yamabere gusa kuko no ku bundi bwoko bwose bwa kanseri gukoresha iyi mizabibu bifasha mu kuyirwanya. Ibi biterwa nuko mu mizabibu harimo resveratrol ikaba izwiho kubyimbura no kurwanya kanseri. Iyi resveratrol byumwihariko ni ingenzi mu kurinda kanseri yamara niyamabere. Si ukuzirinda gusa ahubwo, kuko inarwanya ko yakomeza gukura no gukwirakwira mu mubiri iyo yamaze kuwugeramo.. ...
(((((((((((( H U G S )))))))))))) You are not alone. Everything you feel, experience, confront, suppress, and express is shared in common with other grieving parents. You belong to an exclusive club, and you paid the highest price to become a member. Nothing in this life prepares you for the loss of your child. And nothing in this life compares to the anguish of your loss. No other death among your loved ones will create the same response as the death of your child. And no one can
Op 6 juni 1964 zetten The Beatles Nederland op zn kop. In het Noord-Hollandse Blokker werd namelijk het enige Beatles-concert in Nederland ooit gegeven. Om die gebeurtenis te eren heeft Vol...
Kappa-opioid receptor agonists may have pharmacotherapeutic potential in the management of psychostimulant abuse, due to their ability to modulate dopamine receptor systems involved in drug reinforcement. kappa-Opioid receptor agonists also modulate dopamine receptor function in the hypothalamic tub …
N-Methyl-N-[(1-methyl-1H-benzimidazol-2-yl)methyl]amine, 97%, Maybridge Amber Glass Bottle; 1g N-Methyl-N-[(1-methyl-1H-benzimidazol-2-yl)methyl]amine, 97%, Maybridge...
Highlights: The opioid system is, thus, a new regulator of vascular development that simultaneously modifies 2 distinct vascular properties, EC differentiation and vascular pathfinding. We confirmed that KOR, but not MOR, was highly expressed in various ECs such as HUVECs (data not shown), suggesting that KOR agonists could directly act on tumor ECs to suppress VEGF receptor expression, similar to the effects observed in embryonic ECs. If so, a combination therapy including an MOR agonist, morphine, and a KOR agonist (such as TRK820, a clinically approved drug in Japan for uremic pruritus) may prove useful for cancer therapy through the suppression of tumor angiogenesis by dual inhibition of VEGF ligands and receptors, extending the therapeutic benefits beyond pain relief ...
A class of opioid peptides including dynorphin A, dynorphin B, and smaller fragments of these peptides. Dynorphins prefer kappa-opioid receptors (RECEPTORS, OPIOID, KAPPA) and have been shown to play a role as central nervous system transmitters ...
PHENYLACETYLGLUTAMINATE (PAG or PG) and PHENYLACETATE (PN) are metabolites of PHENYLBUTYRATE (PB) and are constituents of antineoplaston AS2-1 � � � � � � � � � � � � � � � � Antineoplastons AS2-1 and AS2-5 are DERIVED FROM A10 � � � � � � � � � � � � �…
The present study demonstrates that administration of Nepafenac inhibits functional and morphologic lesions characteristic of the early stages of diabetic retinopathy. The most unique aspect of this study, however, is that local delivery of the drug via eyedrops exerted this beneficial effect. To date, therapies reported to inhibit development of diabetic retinopathy have systemically been given, and several mechanisms postulated for the development of the retinopathy have involved systemic abnormalities (such as excessive occlusion of retinal capillaries or binding of extracellular advanced glycation end products to cell receptors).. Nepafenac, the prodrug of amfenac, has been recognized to inhibit COX-1 and -2 in an approximate 1:2 ratio (19-21). Inhibition of COX activity might be a part of the mechanism by which the drug inhibited the diabetes-induced degeneration of retinal capillaries because COXs and their PG products have long been suspected of contributing to the pathogenesis of ...
Generics: Nepafenac, Form: DROPS, Pack Size: 1, Brand name: I NAC EYE 5ML DROPS, Manufacturer: APPASAMY OCULAR DEVICES, Contains: Nepafenac 0.1 %W/V, Drug category: Ophthalmic Decongestants, ...
With the availability of the cDNA clones of the mu-, delta- and kappa-opioid receptors, and the elucidation of their gene structures, it is now possible to investigate opioid receptor regulation at various levels, and to identify the specific receptors involved in the pharmacological actions of the opioids ...
N-((1-ethyl-5-oxo-2-pyrrolidinyl)methyl)-5-sulfamoyl-2-anisamide: metabolite of sulpiride; structure given in first source; RN given refers to parent cpd without isomeric designation
Ikdienas lietošanai. Viegls skrubja efekts - ar dabīgām abrazīvām daļiņām - sasmalcinātiem jojobas riekstiem. Attīra, uzmundrina ādu...
Fabrikas marka, kura piedāvā līdzekļus, izgatavotus uz olu bāzes. Matu kopšanas līdzekļi satur olas, kas uzlabo pat ļoti bojātu matu veselību, pateicoties to sastāvā esošajām olbaltumvielām un keratīnu.. ...
Salvinorin (Sal) A is a naturally occurring, selective kappa opioid receptor (KOPR) agonist with a short duration of action in vivo. Pharmacological properties of a C(2) derivative, 2-methoxymethyl (MOM)-Sal B, were characterized. MOM-Sal B bound to KOPR with high selectivity and displayed approxima …
Use of nepafenac (Nevanac®) in combination with intravitreal anti-VEGF agents in the treatment of recalcitrant exudative macular degeneration requiring monthly injections Eric Chen, Matthew S Benz, Richard H Fish, David M Brown, Tien P Wong, Rosa Y Kim, James C MajorRetina Consultants of Houston, The Methodist Hospital, Houston, TX, USAPurpose: The purpose of this study is to determine the efficacy of combining topical nepafenac with monthly intravitreal injections of ranibizumab or bevacizumab in the treatment of recalcitrant exudative macular degeneration.Methods: This was a retrospective, consecutive case series of patients with exudative macular degeneration requiring maintenance therapy of antivascular endothelial growth factor (anti-VEGF) injections at least every 6 weeks, who were started on topical nepafenac. Despite frequent anti-VEGF dosing, all patients included in the study had persistence of any combination of the following: intraretinal cysts, subretinal fluid, and/or pigment epithelial
Purpose: : To investigate whether the ocular analgesic effects of nepafemac, a non-steroidal antiinflammatory drug, are mediated by a blockade of sodium currents in corneal peripheral endings of mouse trigeminal ganglion neurons. Methods: : Whole-cell patch-clamp recordings of sodium currents were made from adult mice trigeminal ganglion neurons. Neurons were isolated by a mechano-enzymatic dissociation procedure and kept in culture for 24-48 h. All recordings were performed at room temperature in small to medium size neurons. Drugs were applied by a gravity perfusion system. The effects of nepafenac and its active metabolite amfenac were compared with equivalent doses of diclofenac. Results: : Nepafenac (1-50 µM) had no effect on sodium currents. The active metabolite, amfenac (50 µM), produced a transient enhancement followed by a slow, modest decline, that did not reverse upon wash of the drug. In contrast, diclofenac (50 µM) produced a robust, reversible inhibition of sodium currents. ...
The mechanism by which chiral selectivity takes place is complicated by the surface morphology, the possible involvement of the solvent, and the characteristics of the chiral molecules at the surface. My goal is to model and understand the factors which lead to significant discrimination in the case of three closely related chiral stationary phases: N-(1-phenylethyl)-N-[3-(triethoxysilyl)propyl]-urea (PEPU), [(3,5-dinitrobenzoyl)-amino]-N-[3-(triethoxysilyl)propyl]-2-phenylacetamide (DNB-phenyglycine), and [(3,5-dinitrobenzoyl)amino]-N-[3-(triethoxysilyl)propyl]-4-methylpentanamide (DNB-leucine). Ab initio calculations are used to develop molecular models of these chiral selectors. These models are employed in molecular dynamics (MD) simulations, which provide the theoretical framework for modelling chiral interfaces in different solvent mixtures. The MD simulations of PEPU interfaces show that, in alcohol/water mixtures, the alcohols form domains at the interface with the hydrophobic portions ...
R B REMEDIES PVT. LTD - We are one of the well known manufacturer,supplier and wholesaler of Nepafenac Ophthalmic Suspension Eye Drop. We offer best quality of Nepafenac Ophthalmic Suspension Eye Drop at a best price.
Molecular Biology , The kappa opioid receptor, (also known as OP2, KOP, KOR), is a member of the opioid family ofG-protein-coupled receptors...
chemBlink provides information about CAS # 24622-60-4, 1-(1,3-Benzodioxol-5-yl)-2-(1-pyrrolidinyl)-1-butanone hydrochloride, molecular formula: C15H19NO3.HCl.
Order N-[(1-propyl-2-pyrrolidinyl)methyl]-1-propanamine, CAS 901585-71-5, EC-000.1295, MW C11H24N2 from direct supplier at the best price
methyl (2-oxo-3-phenyl-1-pyrrolidinyl)acetate - chemical structural formula, chemical names, chemical properties, synthesis references
So, when her crying simmered down, I went in to talk to her. I asked what she did. She told me she knock kor kors toys. I asked her if what she did was wrong. She said yes, what she did was wrong. I asked her what she should do if she did something wrong. She said I should say sorry. So I told her to go out and say sorry to both kung kung and kor kor. And she practised saying it in the room with me ...
REBUS SIC STANTIBUS Za těchto okolností / Under the Circumstances Jiří Černický, Zdena Kolečková, Pavel Kopřiva, Antti Laitinen, Renja Leino, Anni Leppälä, Silvie Milková, Harri Pälviranta, Hannele Romppanen,
TY - JOUR. T1 - Binding of norbinaltorphimine (norBNI) congeners to wild-type and mutant mu and kappa opioid receptors. T2 - Molecular recognition loci for the pharmacophore and address components of kappa antagonists. AU - Larson, Dennis L.. AU - Jones, Robert M.. AU - Hjorth, Siv A.. AU - Schwartz, Thue W.. AU - Portoghese, Philip S.. PY - 2000/8/20. Y1 - 2000/8/20. N2 - Molecular modifications of both the kappa opioid antagonist norbinaltorphimine (norBNI, 1) and the kappa receptor have provided evidence that the selectivity of this ligand is conferred through ionic interaction if its N17 protonated amine group (an address) with a nonconserved acidic residue (Glu297) on the kappa receptor. In the present study, we have examined the effect of structural modifications on the affinity of norBNI analogues for wild-type and mutant kappa and mu opioid receptors expressed in COS-7 cells. Compounds 2, 3, and 7, which have an antagonist pharmacophore and basic N17 group in common with norBNI, ...
Efficacy of nepafenac ophthalmic suspension 0.1% in improving clinical outcomes following cataract surgery in patients with diabetes: an analysis of two randomized studies Rishi P Singh,1 Giovanni Staurenghi,2 Ayala Pollack,3 Adeniyi Adewale,4 Thomas M Walker,4 Dana Sager,4 Robert Lehmann5 1Cole Eye Institute, Cleveland Clinic Foundation, Cleveland, OH, USA; 2Department of Biomedical and Clinical Science Luigi Sacco, Luigi Sacco Hospital, University of Milan, Milan, Italy; 3Ophthalmology Department, Kaplan Medical Center, Rehovot, Israel; 4Alcon Research Ltd., Fort Worth, TX, 5Lehmann Eye Center, Nacogdoches, TX, USA Objective: To assess the efficacy of nepafenac 0.1% ophthalmic suspension in improving the clinical outcomes following cataract surgery (CS) in patients with nonproliferative diabetic retinopathy. Methods: In two similar multicenter, randomized studies, patients received either nepafenac 0.1% or vehicle, instilled three times daily starting a day prior to surgery and continuing for 90
1,3-isoquinolinedione / 2,3-dihydroisoquinoline-1,4-dione / Isoquinolone / Benzyloxycarbonyl / Phenylacetamide / Tetrahydroisoquinoline / Aryl ketone / N-arylamide / Chlorobenzene / HalobenzeneAryl chloride / Aryl halide / Monocyclic benzene moiety / Benzenoid / Carboxylic acid imide / Vinylogous amide / Dicarboximide / Carboxylic acid imide, n-unsubstituted / Ketone / Secondary carboxylic acid amide / Carboxamide group / Carboxylic acid ester / Monocarboxylic acid or derivatives / Azacycle / Carboxylic acid derivative / Organonitrogen compound / Organic nitrogen compound / Organic oxygen compound / Carbonyl group / Organooxygen compound / Hydrocarbon derivative / Organic oxide / Organopnictogen compound / Organohalogen compound / Organochloride / Aromatic heteropolycyclic compound ...
TY - JOUR. T1 - Prospects of Using of κ-Opioid Receptor Agonists U-50,488 and ICI 199,441 for Improving Heart Resistance to Ischemia/Reperfusion. AU - Tsibulnikov, S. Yu. AU - Maslov, L. N.. AU - Mukhomedzyanov, A. V.. AU - Krylatov, A. V.. AU - Tsibulnikova, M. R.. AU - Lishmanov, Yu B.. PY - 2015/10/1. Y1 - 2015/10/1. N2 - We studied the ability of the agonist of κ1-opioid receptors U-50,488 in doses of 0.1 and 1 mg/kg to simulate ischemic pre- and postconditioning of the heart and κ-opioid receptors ICI 199,441 in a dose of 0.1 mg/kg to simulate the antiarrhythmic effect of heart preconditioning. The duration of ischemia was 10 or 45 min and the duration of reperfusion was 10 min or 2 h. Administration of 1 mg/kg U-50,488 both before ischemia and 5 min before reperfusion produced a pronounced antiarrhythmic effect. U-50,488 injected 5 min before reperfusion 2-fold reduced the ratio of infarction to risk area. Administration of ICI 199,441 in a dose of 0.1 mg/kg 15 min before ischemia ...
(trans)-Isomer 3,4-Dichloro-N-methyl-N-(2-(1-pyrrolidinyl)-cyclohexyl)-benzeneacetamide: A non-peptide, kappa-opioid receptor agonist which has also been found to stimulate the release of adrenocorticotropin (ADRENOCORTICOTROPIC HORMONE) via the release of hypothalamic arginine vasopressin (ARGININE VASOPRESSIN) and CORTICOTROPIN-RELEASING HORMONE. (From J Pharmacol Exp Ther 1997;280(1):416-21)
The effect of lorcainide on arrhythmias and survival in patients with acute myocardial infarction. International Journal of Cardiology 40:161-166. ...
E x p l o r e t h e f u n c t i o n a l o r g a n i z a t i o n o f h u m a n s Master dInformatique, spécialité Fondements et Ingénierie, Parcours Computational Biology and Biomedicine Our future Computational biology and biomedicine An emerging interdisciplinary field that applies the techniques of computer science, applied mathematics and statistics to address biological problems. -Mathematical modeling -Computational simulation techniques.
2-Amino-5-(1-pyrrolidinyl)benzoic acid/ACM159526213 can be provided in Alfa Chemistry. We are dedicated to provide our customers the best products and services.
The Barbados Water Authority has started another phase of work to try and solve problems with the South Coast sewage system. The strategy, explained t...
The Barbados Water Authority has started another phase of work to try and solve problems with the South Coast sewage system. The strategy, explained t...
Ibbuku lya Talmud lilaazibeela zyobile:(1) Mishna: cibeela citaanzi kulembwa ca zilengwa zyaba Juuda, mumwaka 220 kazyedwe Kristu; (2) Gemara: ibbuku ba Rabbi mobaamba zimwi zijatikizya bbuku lya Mishnah lyaalembwa mumwaka 500 kazyedwe Kristu. Eeli bbuku lijisi milawo amilazyo iijatikizya mbobaali kuvwuntauzya bakamboni kuti bazyibe naa mwezi mupya wabonwa ncobeni. Mukonzyano:. "Aaba batobela tabeelede kuba bakamboni basyomwa: bauma njuka, balungila muulo atalaa zikwelete, bavwubi bankwilimba, balima mumwaka wa Nsabata, a bazike. Ooyu ngomulawo: Bumboni boonse butatambuliki kuzwa kubakaintu mbweenya akuli baaba baambwa kale atala aawa.... Kufumbwa (bakamboni) nobeelede kuba mumusinzo sikati amasiku, cilizumizidwe kutyola mulawo wa Nsabata mukweenda musinzo ooyo, kutegwa bape bumboni kuti naa mwezi walibonya." (Babyloniana Talmud, Section Moed, Rosh Hashana, Chapter I, http://www.jewishvirtuallibrary.org/jsource/Talmud/rh1.html). Amulangisye: Eeci caambwa atalaa aawa tacikwe maanu kutobezya mbuli ...
A combination of drugs including a kappa opioid receptor agonist and a dopamine receptor blocker or dopamine receptor agonist provides a synergistic effect in inducing hypothermia and/or poikilothermia in humans and animals. Hypothermia as much as 10 C. at an ambient temperature of 20 C. is possible, with complete recovery and few, if any, side effects.
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2020 Elsevier B.V. We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. ...
Vīrusveidīgo daļiņu, jeb t.s. VLP (virus-like particles) proteīnu inženierijas idejas pieteikšana un tās pamatu izveidošana (kopā ar E. Grēnu). Vīrusu proteīnu imunoloģisko epitopu kartēšana (kopā ar P. Puško un I. Sominsku). Proteīnu inženierijas VLP vektoru, jeb nesēju, radīšana; himēro VLP konstruēšana uz to pamata. HBcAg izveidošana par universālu VLP nesēju - tradicionālāko himēro VLP struktūru pamatu; svešu epitopu iebūvēšana HBcAg struktūrā - no HIV, HBV, HCV, FMDV un daudziem citiem vīrusu un nevīrusu izcelsmes proteīniem (kopā ar G. Borisovu, I. Sominsku, A. Dišleru, I. Petrovski, A. Kazāku, K. Sasnausku, R. Ulrichu, H. Meiseli u. c.). HBcAg telpiskās struktūras atšifrēšana (kopā ar R. A. Krovčeru (R. A. Crowther), N. Kiseļevu, E. Grēnu u. c.). HBcAg pakojošo īpašību atšifrēšana un izmantošana (kopā ar M. Bahmanu (M. Bachmann) un A.Kazāku). HBcAg imunoloģisko īpašību atšifrēšana (kopā ar R. M. Cinkernāgelu (R. M. ...
Vīrusveidīgo daļiņu, jeb t.s. VLP (virus-like particles) proteīnu inženierijas idejas pieteikšana un tās pamatu izveidošana (kopā ar E. Grēnu). Vīrusu proteīnu imunoloģisko epitopu kartēšana (kopā ar P. Puško un I. Sominsku). Proteīnu inženierijas VLP vektoru, jeb nesēju, radīšana; himēro VLP konstruēšana uz to pamata. HBcAg izveidošana par universālu VLP nesēju - tradicionālāko himēro VLP struktūru pamatu; svešu epitopu iebūvēšana HBcAg struktūrā - no HIV, HBV, HCV, FMDV un daudziem citiem vīrusu un nevīrusu izcelsmes proteīniem (kopā ar G. Borisovu, I. Sominsku, A. Dišleru, I. Petrovski, A. Kazāku, K. Sasnausku, R. Ulrichu, H. Meiseli u. c.). HBcAg telpiskās struktūras atšifrēšana (kopā ar R. A. Krovčeru (R. A. Crowther), N. Kiseļevu, E. Grēnu u. c.). HBcAg pakojošo īpašību atšifrēšana un izmantošana (kopā ar M. Bahmanu (M. Bachmann) un A.Kazāku). HBcAg imunoloģisko īpašību atšifrēšana (kopā ar R. M. Cinkernāgelu (R. M. ...
Gentoo package sci-biology/bwa: Burrows-Wheeler Alignment Tool, a fast short genomic sequence aligner in the Gentoo Packages Database
Collistar ir jauna Itālijas ekskluzīvās kosmētikas sērija, kas, pateicoties tās straujajai attīstībai un izplatībai, ir kļuvusi par vienu no vadošajām kosmētikas sērijām starptautiskajā kosmētikas tirgū. Collistar ir ieņēmusi vadošo pozīciju tirgū, pateicoties tās inovatīvajiem un unikālajiem produktiem, kuru sortimentā ietilpst produkti, kas aizkavē celulīta rašanos un ādas novecošanos; produkti, kas piešķir enerģiju, un aromterapijas produkti; dažādu veidu ādas kopšanas produkti; produkti aizsardzībai pret saules kaitīgo iedarbību; paštonējošie ķermeņa kopšanas un sejas produkti; produkti vīriešiem; matu kopšanas produkti un ikgadējie make-up produkti ar jaunām kolekcijām.. ...
Kirsten P Böhmer, Hubert Kolb, Bernd Kuglin, Jürgen Zielasek, Achim Hübinger, Eberhard F Lampeter, Bruno Weber, Victoria Kolb-Bachofen, H U Jastram, Jörg Bertrams and F Arnold Gries ...
TVNET ir informatīvi izklaidējošs interneta medijs, kas veiksmīgi darbojas jau kopš 2000.gada. Šajos gados TVNET zīmols ir kļuvis par visuzticamāko avotu objektīvu ziņu iegūšanai, vienmēr turot roku uz pulsa visos svarīgākajos pasaules un pašmāju notikumos.
A koleszterincs kkent reformk sz tm nyek rekl mjai elfelejtik tudtunkra adni, hogy az ereinkben kering koleszterin t lnyom r sze saj t produktum, mi "gy rtjuk". Bevitel nek cs kkent s vel kor ntsem biztos, hogy el rj k a c lunk. Mi is az a koleszterin?
U-50,488 (trans-3,4-dichloro-N-methyl-N-[2-(1-pyrrolidinyl)cyclohexyl]-benzeneacetamide) displays analgesic actions in a variety (thermal, pressure and irritant) of assays in mice and rats. Naloxone and MR-2266 block this analgesic effect; thus it is mediated by opioid receptors. However, when compared to morphine analgesia, the naloxone and MR-2266 pA2 values for U-50,488 analgesia were much lower and higher, respectively. Likewise, although tolerance occurs to both morphine and U-50,488 analgesia, there was no cross-tolerance between these drugs, and U-50,488 does not cause morphine-type physical dependence. These observations suggest that different opioid receptors mediate the analgesic effects of morphine and U-50,488. The effects of U-50,488 appear to be mediated by the so-called kappa opioid receptor. In contrast to U-50,488, other reputed kappa opioid agonists displayed varying degrees of mu agonist (ketazocine and ethylketocyclazocine) and narcotic antagonist (bremazocine) activities. ...
RATIONALE. Salvinorin A is the active component of the hallucinogenic plant Salvia divinorum. The potential mode of action of this hallucinogen was unknown until recently. A recent in vitro study detected high affinity and efficacy of salvinorin A at kappa-opioid receptors. It was postulated that salvinorin A would produce discriminative stimulus effects similar to those of a high efficacy kappa-agonist (U69,593) in rhesus monkeys.. METHODS. Monkeys were previously trained to discriminate U69,593 (0.0056 or 0.013 mg/kg; SC) from vehicle in a food-reinforced FR20 (fixed ratio 20) operant conditioning procedure ( n=3). The ability of salvinorin A to cause generalization (>/=90% U69,593-appropriate responding) was examined in time course and cumulative dose-effect curve studies.. RESULTS. All subjects dose-dependently emitted full U69,593-appropriate responding after salvinorin A (0.001-0.032 mg/kg, SC). Salvinorin A-induced generalization started 5-15 min after injection, and dissipated by 120 ...
The Index page for the reference article: Butelman ER, Harris TJ, Kreek MJ The plant-derived hallucinogen, salvinorin A, produces kappa-opioid agonist-like discriminative effects in rhesus monkeys Psychopharmacology (Berl) 2003
You are viewing an interactive 3D depiction of the molecule n,n,n-trimethyl-4-(2-oxo-1-pyrrolidinyl)-2-butyn-1-aminium (C11H20N2O) from the PQR.
Vanaf vandaag is onder het kopje Resources ook een nieuwe kop Mishandeling te vinden.. Hieronder vindt je relevante info over AMK meldingen en Huiselijk geweld meldingen. Ook met de lokale Westfriese organisaties erbij.. Gebruik het menu boven in beeld hiervoor.. ...
The viability of different mechanisms of catalysis and inhibition of the nickel-containing enzyme urease was explored using the available high-resolution structures of the enzyme isolated from Bacillus pasteurii in the native form and inhibited with several substrates. The structures and charge distribution of urea, its catalytic transition state, and three enzyme inhibitors were calculated using ab initio and density functional theory methods. The DOCK program suite was employed to determine families of structures of urease complexes characterized by docking energy scores indicative of their relative stability according to steric and electrostatic criteria. Adjustment of the parameters used by DOCK, in order to account for the presence of the metal ion in the active site, resulted in the calculation of best energy structures for the nickel-bound inhibitors β-mercaptoethanol, acetohydroxamic acid, and diamidophosphoric acid. These calculated structures are in good agreement with the experimentally
Apstrāde - Matu Kopšanas - Inebrya - Produkti matiem - SaldĒjuma Keratin - Putas, Seruma, Naftas Eliksīrs - pārstrukturēšanas līnija: pārstrukturēšanas līniju, kas balstīta uz keratīna matu iztaisnot Kinky un pakļauj ķīmiskiemIce Cream Keratin veic efektīvus pasākumus filmēšana un roņu mednieks apkarošanai un novēršanai sadalīt galiem. Īpašas olbaltumvielas, pamatojoties formulēšanā ir bagātināts ar aminos ...
Quality wall tapestries to add wall decor to any room. These wall hangings are a large fabric with intricate print in any design or color to match your room.

kappa-Opioid Receptor Agonist-Induced Prolactin Release in Primates Is Blocked by Dopamine D(2)-like Receptor Agonists - PubMedkappa-Opioid Receptor Agonist-Induced Prolactin Release in Primates Is Blocked by Dopamine D(2)-like Receptor Agonists - PubMed

Kappa-opioid receptor agonists may have pharmacotherapeutic potential in the management of psychostimulant abuse, due to their ability to modulate dopamine receptor systems involved in drug reinforcement. kappa-Opioid receptor agonists also modulate dopamine receptor function in the hypothalamic tub …
more infohttps://pubmed.ncbi.nlm.nih.gov/11448491/

adult pineoblastoma drug 2000:2010[pubdate] *count=100 - BioMedLib™ search engineadult pineoblastoma drug 2000:2010[pubdate] *count=100 - BioMedLib™ search engine

Benzeneacetamides / administration & dosage. Brain Neoplasms / drug therapy. Glutamine / analogs & derivatives. Neuroectodermal ... Chemical-registry-number] 0 / Antineoplastic Agents; 0 / Benzeneacetamides; 0 / Drug Combinations; 0 / Phenylacetates; 0 / ...
more infohttp://www.bmlsearch.com/?kwr=adult+pineoblastoma+drug+2000:2010%5Bpubdate%5D&cxts=100&stmp=b1

Rojas, C.<...Rojas, C.<...

Nedelcovych, M., Dash, R. P., Tenora, L., Zimmermann, S. C., Gadiano, A. J., Garrett, C., Alt, J., Hollinger, K. R., Pommier, E., Jančařík, A., Rojas, C., Thomas, A. G., Wu, Y., Wozniak, K., Majer, P., Slusher, B. S. & Rais, R. Oct 2 2017 In : Molecular Pharmaceutics. 14, 10, p. 3248-3257 10 p.. Research output: Contribution to journal › Article ...
more infohttps://jhu.pure.elsevier.com/en/persons/camilo-rojas

U-47700 - WikipediaU-47700 - Wikipedia

Oxygen substituted amino-cyclohexyl-benzeneacetamides and -benzamides as water diuretic drugs". Casy, Alan F.; Parfitt, Robert ...
more infohttps://en.wikipedia.org/wiki/U-47700

U-77891 - WikipediaU-77891 - Wikipedia

... benzeneacetamides and -benzamide analgesics". The Upjohn Company. "Properties Viewer". chemicalize.org. AH-7921 U-47700 U-50488 ...
more infohttps://en.wikipedia.org/wiki/U-77891

Drug Approvals International - Page 51 - All about Drugs Live by Dr Anthony Melvin CrastoDrug Approvals International - Page 51 - All about Drugs Live by Dr Anthony Melvin Crasto

Benzeneacetamides; Sulfonamides Mechanism of Action Beta 2 adrenergic receptor agonists Orphan Drug StatusNo On Fast trackNo ...
more infohttp://drugapprovalsint.com/page/51/

Pelvic PainPelvic Pain

Benzeneacetamides. 1. + 297. Receptors, Serotonin. 1. + 298. 2-Aminopurine. 1. + 299. Hydrochloric Acid. 1. + ...
more infohttps://lookfordiagnosis.com/results.php?symptoms=Pelvic+Pain&lang=1&parent=%2F&mode=F&therapy_ap=1

Characterization of Specific Opioid Binding Sites in Neural Membranes from the Myenteric Plexus of Porcine Small Intestine<...Characterization of Specific Opioid Binding Sites in Neural Membranes from the Myenteric Plexus of Porcine Small Intestine<...

TY - JOUR. T1 - Characterization of Specific Opioid Binding Sites in Neural Membranes from the Myenteric Plexus of Porcine Small Intestine. AU - Townsend, DeWayne. AU - Portoghese, Philip S. AU - Brown, David R. PY - 2004/1/1. Y1 - 2004/1/1. N2 - δ- and κ-Opioid receptors (OPRs), but not μ-OPRs, are expressed in the myenteric plexus of the porcine distal small intestine. In a subpopulation of myenteric neurons, δ- and κ-OPRs seem to be colocalized and may functionally interact. In this study, radioligand binding was used to characterize myenteric OPR populations in detail. The nonselective OPR antagonist [3H]diprenorphine bound to a single, high-affinity site in myenteric neural membrane homogenates. Naloxone displaced 65 and 59% of [3H]diprenorphine binding from this site in Na+-free Tris and Krebs-HEPES buffers, respectively. Naltrexone-derived δ- and κ-OPR antagonists, including naltriben, 7-benzylidenenaltrexone, nor-binaltorphimine, and 5′-guanidinonaltrindole, displaced [ ...
more infohttps://experts.umn.edu/en/publications/characterization-of-specific-opioid-binding-sites-in-neural-membr

Drug Approvals International - Page 27 - All about Drugs Live by Dr Anthony Melvin CrastoDrug Approvals International - Page 27 - All about Drugs Live by Dr Anthony Melvin Crasto

Benzeneacetamides; Sulfonamides Mechanism of Action Beta 2 adrenergic receptor agonists Orphan Drug StatusNo On Fast trackNo ...
more infohttp://drugapprovalsint.com/page/27/

US4158063A - Acylamino(alkyl)benzene derivatives and process for preparing them 
        - Google PatentsUS4158063A - Acylamino(alkyl)benzene derivatives and process for preparing them - Google Patents

N-substituted-2-hydroxy-α-oxo-benzeneacetamides and pharmaceutical compositions having activity as modulators of the ... N-substituted-2-hydroxy-α-oxo-benzeneacetamides and pharmaceutical compositions having activity as modulators of the ...
more infohttps://patents.google.com/patent/US4158063A/en

NAVER Academic > Search...NAVER Academic > Search...

Aged, Anti-Inflammatory Agents, adverse effects, Benzeneacetamides, Dermatitis, Photoallergic, etiology, Drug Eruptions, Female ...
more infohttps://academic.naver.com/search.naver?field=3&query=Contact+Dermatitis+27%EA%B6%8C+1%ED%98%B8

Kappa opioid receptor activation decreases inhibitory transmission and antagonizes alcohol effects in rat central amygdala.  -...Kappa opioid receptor activation decreases inhibitory transmission and antagonizes alcohol effects in rat central amygdala. -...

Benzeneacetamides/pharmacology*. *Dynorphins/pharmacology*. *Ethanol/pharmacology*. *Inhibitory Postsynaptic Potentials/drug ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/24157490

Nitrogen attached indirectly to the six-membered hetero ring by nonionic bonding  patent application classNitrogen attached indirectly to the six-membered hetero ring by nonionic bonding patent application class

N-cyclohexyl benzamides and benzeneacetamides as inhibitors of 11-beta-hydroxysteroid dehydrogenases - The present invention ...
more infohttp://www.patentsencyclopedia.com/class/000540045

N-(2-(4-t-butylbenzyl)-3-(pivaloyloxy)propyl)-2-(3-fluoro-4-(methylsulfonylamino)phenyl)propionamide
     Summary Report |...N-(2-(4-t-butylbenzyl)-3-(pivaloyloxy)propyl)-2-(3-fluoro-4-(methylsulfonylamino)phenyl)propionamide Summary Report |...

Benzeneacetamides*N-(2-(4-t-butylbenzyl)-3-(pivaloyloxy)propyl)-2-(3-fluoro-4-(methylsulfonylamino)phenyl)propionamide ... Benzeneacetamides*N-(2-(4-t-butylbenzyl)-3-(pivaloyloxy)propyl)-2-(3-fluoro-4-(methylsulfonylamino)phenyl)propionamide ...
more infohttp://www.curehunter.com/public/keywordSummaryC526801-N--2--4-t-butylbenzyl--3--pivaloyloxy-propyl--2--3-fluoro-4--methylsulfonylamino-phenyl-propionamide.do

2-(3,5-bis-trifluoromethylphenyl)-N-(4-(4-fluoro-2-methylphenyl)-6-(3-hydroxy-2-hydroxymethylpyrrolidin-1-yl)pyridin-3-yl)-N...2-(3,5-bis-trifluoromethylphenyl)-N-(4-(4-fluoro-2-methylphenyl)-6-(3-hydroxy-2-hydroxymethylpyrrolidin-1-yl)pyridin-3-yl)-N...

Benzeneacetamides ← 2-. (3,5-. bis-. trifluoromethylphenyl)-. N-. (4-. (4-. fluoro-. 2-. methylphenyl)-. 6-. (3-. hydroxy-. 2- ... Benzeneacetamides ← 2-. (3,5-. bis-. trifluoromethylphenyl)-. N-. (4-. (4-. fluoro-. 2-. methylphenyl)-. 6-. (3-. hydroxy-. 2- ...
more infohttp://ctdbase.org/detail.go?type=chem&acc=C558113

Search Articles | University of Toronto LibrariesSearch Articles | University of Toronto Libraries

Benzeneacetamides - metabolism , Cell Proliferation - drug effects , Mutation , Glutaminase - genetics , Amino Acid ... Benzeneacetamides - chemistry , Glutamine - chemistry , Sulfides - metabolism , Thiadiazoles - metabolism , Neoplasm Proteins ... genetics , Benzeneacetamides - pharmacology , Sulfides - pharmacology , Thiadiazoles - pharmacology , Binding, Competitive , ...
more infohttps://query.library.utoronto.ca/index.php/search/q?kw=SubjectTerms:Thiadiazoles%20-%20chemistry

Search Articles | University of Toronto LibrariesSearch Articles | University of Toronto Libraries

Benzeneacetamides - pharmacology , Wnt Signaling Pathway , Bile Duct Neoplasms - drug therapy , Cell Survival - drug effects , ...
more infohttps://query.library.utoronto.ca/index.php/search/q?kw=SubjectTerms:Pyrimidinones%20-%20pharmacology

Small-molecule RORγt antagonists inhibit T helper 17 cell transcriptional network by divergent mechanisms. | Broad InstituteSmall-molecule RORγt antagonists inhibit T helper 17 cell transcriptional network by divergent mechanisms. | Broad Institute

Androstenols, Animals, Benzeneacetamides, Benzhydryl Compounds, Cell Differentiation, Cell Line, Tumor, Cell Lineage, Cytokines ...
more infohttps://www.broadinstitute.org/publications/broad5681

US-4943587-A: Hydroxamate derivatives of selected nonsteroidal antiinflammatory acyl residues and their use for cyclooxygenase...US-4943587-A: Hydroxamate derivatives of selected nonsteroidal antiinflammatory acyl residues and their use for cyclooxygenase...

N-substituted-2-hydroxy-α-oxo-benzeneacetamides and pharmaceutical compositions having activity as modulators of the ...
more infohttp://pe.passivity.us/patent/US-4943587-A

Phase II study of antineoplastons A10 and AS2-1 in patients with adenocarcinoma of the stomach - AdisInsightPhase II study of antineoplastons A10 and AS2-1 in patients with adenocarcinoma of the stomach - AdisInsight

Current therapies for Stomach Cancer provide very limited benefit to the patient. The anti-cancer properties of Antineoplaston therapy suggest that it may prove
more infohttps://adisinsight.springer.com/trials/700001784?error=cookies_not_supported&code=ec8942b5-1c05-462e-9d2e-350d49ff5450

No FAQ available that match "benzeneacetamides"