An antioxidant flavonoid, occurring especially in woody plants as both (+)-catechin and (-)-epicatechin (cis) forms.
A condition caused by the neurotoxin MPTP which causes selective destruction of nigrostriatal dopaminergic neurons. Clinical features include irreversible parkinsonian signs including rigidity and bradykinesia (PARKINSON DISEASE, SECONDARY). MPTP toxicity is also used as an animal model for the study of PARKINSON DISEASE. (Adams et al., Principles of Neurology, 6th ed, p1072; Neurology 1986 Feb;36(2):250-8)
A dopaminergic neurotoxic compound which produces irreversible clinical, chemical, and pathological alterations that mimic those found in Parkinson disease.
The infusion of leaves of CAMELLIA SINENSIS (formerly Thea sinensis) as a beverage, the familiar Asian tea, which contains CATECHIN (especially epigallocatechin gallate) and CAFFEINE.
The family of carnivorous or omnivorous bears, having massive bodies, coarse heavy fur, relatively short limbs, and almost rudimentary tails.
A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.
A progressive, degenerative neurologic disease characterized by a TREMOR that is maximal at rest, retropulsion (i.e. a tendency to fall backwards), rigidity, stooped posture, slowness of voluntary movements, and a masklike facial expression. Pathologic features include loss of melanin containing neurons in the substantia nigra and other pigmented nuclei of the brainstem. LEWY BODIES are present in the substantia nigra and locus coeruleus but may also be found in a related condition (LEWY BODY DISEASE, DIFFUSE) characterized by dementia in combination with varying degrees of parkinsonism. (Adams et al., Principles of Neurology, 6th ed, p1059, pp1067-75)
A class of opioid receptors recognized by its pharmacological profile. Kappa opioid receptors bind dynorphins with a higher affinity than endorphins which are themselves preferred to enkephalins.
A subfamily of G-PROTEIN-COUPLED RECEPTORS that bind the neurotransmitter DOPAMINE and modulate its effects. D1-class receptor genes lack INTRONS, and the receptors stimulate ADENYLYL CYCLASES.
Drugs that bind to and activate dopamine receptors.
A subfamily of G-PROTEIN-COUPLED RECEPTORS that bind the neurotransmitter DOPAMINE and modulate its effects. D2-class receptor genes contain INTRONS, and the receptors inhibit ADENYLYL CYCLASES.
Compounds based on benzeneacetamide, that are similar in structure to ACETANILIDES.
One of the catecholamine NEUROTRANSMITTERS in the brain. It is derived from TYROSINE and is the precursor to NOREPINEPHRINE and EPINEPHRINE. Dopamine is a major transmitter in the extrapyramidal system of the brain, and important in regulating movement. A family of receptors (RECEPTORS, DOPAMINE) mediate its action.
Toxic, volatile, flammable liquid hydrocarbon byproduct of coal distillation. It is used as an industrial solvent in paints, varnishes, lacquer thinners, gasoline, etc. Benzene causes central nervous system damage acutely and bone marrow damage chronically and is carcinogenic. It was formerly used as parasiticide.
Hydrolases that specifically cleave the peptide bonds found in PROTEINS and PEPTIDES. Examples of sub-subclasses for this group include EXOPEPTIDASES and ENDOPEPTIDASES.
Exclusive legal rights or privileges applied to inventions, plants, etc.
Organic compounds containing a carbonyl group in the form -CHO.
Macrolide antibiotic obtained from cultures of Streptomyces fradiae. The drug is effective against many microorganisms in animals but not in humans.
The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.
Neoplasms which originate from pineal parenchymal cells that tend to enlarge the gland and be locally invasive. The two major forms are pineocytoma and the more malignant pineoblastoma. Pineocytomas have moderate cellularity and tend to form rosette patterns. Pineoblastomas are highly cellular tumors containing small, poorly differentiated cells. These tumors occasionally seed the neuroaxis or cause obstructive HYDROCEPHALUS or Parinaud's syndrome. GERMINOMA; CARCINOMA, EMBRYONAL; GLIOMA; and other neoplasms may arise in the pineal region with germinoma being the most common pineal region tumor. (From DeVita et al., Cancer: Principles and Practice of Oncology, 5th ed, p2064; Adams et al., Principles of Neurology, 6th ed, p670)
A very toxic alkylating antineoplastic agent also used as an insect sterilant. It causes skin, gastrointestinal, CNS, and bone marrow damage. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), thiotepa may reasonably be anticipated to be a carcinogen (Merck Index, 11th ed).
Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.
An antineoplastic agent used to treat ovarian cancer. It works by inhibiting DNA TOPOISOMERASES, TYPE I.
Transfer of HEMATOPOIETIC STEM CELLS from BONE MARROW or BLOOD between individuals within the same species (TRANSPLANTATION, HOMOLOGOUS) or transfer within the same individual (TRANSPLANTATION, AUTOLOGOUS). Hematopoietic stem cell transplantation has been used as an alternative to BONE MARROW TRANSPLANTATION in the treatment of a variety of neoplasms.
A light-sensitive neuroendocrine organ attached to the roof of the THIRD VENTRICLE of the brain. The pineal gland secretes MELATONIN, other BIOGENIC AMINES and NEUROPEPTIDES.
An organoplatinum compound that possesses antineoplastic activity.
Derivatives of acetamide that are used as solvents, as mild irritants, and in organic synthesis.
Organic compounds containing the -CO-NH2 radical. Amides are derived from acids by replacement of -OH by -NH2 or from ammonia by the replacement of H by an acyl group. (From Grant & Hackh's Chemical Dictionary, 5th ed)
Antioxidant for foods, fats, oils, ethers, emulsions, waxes, and transformer oils.
A subgroup of TRP cation channels named after vanilloid receptor. They are very sensitive to TEMPERATURE and hot spicy food and CAPSAICIN. They have the TRP domain and ANKYRIN repeats. Selectivity for CALCIUM over SODIUM ranges from 3 to 100 fold.
An antineoplastic antimetabolite that is metabolized to fluorouracil when administered by rapid injection; when administered by slow, continuous, intra-arterial infusion, it is converted to floxuridine monophosphate. It has been used to treat hepatic metastases of gastrointestinal adenocarcinomas and for palliation in malignant neoplasms of the liver and gastrointestinal tract.
The compound is given by intravenous injection to do POSITRON-EMISSION TOMOGRAPHY for the assessment of cerebral and myocardial glucose metabolism in various physiological or pathological states including stroke and myocardial ischemia. It is also employed for the detection of malignant tumors including those of the brain, liver, and thyroid gland. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1162)
5-Fluoro-2'-deoxyuridylate. An inhibitor of thymidylate synthetase. Formed from 5-fluorouracil or 5-fluorodeoxyuridine.
An orphan nuclear receptor found in the THYMUS where it plays a role in regulating the development and maturation of thymocytes. An isoform of this protein, referred to as RORgammaT, is produced by an alternatively transcribed mRNA.
A DNA-binding orphan nuclear receptor that positively regulates expression of ARNTL TRANSCRIPTION FACTORS and is a regulatory component of the circadian clock system. The protein also has a role in neuron cell survival and differentiation in that loss of function mutations of its gene result in the mouse phenotype referred to as the STAGGERER MOUSE.
An orphan nuclear receptor that is expressed at high levels in neuronal tissues, the RETINA; EPIDIDYMIS; and VAS DEFERENS. The receptor is believed to play a role in regulating a variety of functions including the processing of sensory information, the differentiation of PHOTORECEPTOR CELLS and the CIRCADIAN RHYTHM.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
A family of cell surface receptors that were originally identified by their structural homology to neurotropic TYROSINE KINASES and referred to as orphan receptors because the associated ligand and signaling pathways were unknown. Evidence for the functionality of these proteins has been established by experiments showing that disruption of the orphan receptor genes results in developmental defects.
Interacting DNA-encoded regulatory subsystems in the GENOME that coordinate input from activator and repressor TRANSCRIPTION FACTORS during development, cell differentiation, or in response to environmental cues. The networks function to ultimately specify expression of particular sets of GENES for specific conditions, times, or locations.
Specific high affinity binding proteins for THYROID HORMONES in target cells. They are usually found in the nucleus and regulate DNA transcription. These receptors are activated by hormones that leads to transcription, cell differentiation, and growth suppression. Thyroid hormone receptors are encoded by two genes (GENES, ERBA): erbA-alpha and erbA-beta for alpha and beta thyroid hormone receptors, respectively.
Mold and yeast inhibitor. Used as a fungistatic agent for foods, especially cheeses.

Comparison of two aquaretic drugs (niravoline and OPC-31260) in cirrhotic rats with ascites and water retention. (1/208)

kappa-Opioid receptor agonists (niravoline) or nonpeptide antidiuretic hormone (ADH) V2 receptor antagonists (OPC-31260) possess aquaretic activity in cirrhosis; however, there is no information concerning the effects induced by the chronic administration of these drugs under this condition. To compare the renal and hormonal effects induced by the long-term oral administration of niravoline, OPC-31260, or vehicle, urine volume, urinary osmolality, sodium excretion, and urinary excretion of aldosterone (ALD) and ADH were measured in basal conditions and for 10 days after the daily oral administration of niravoline, OPC-31260, or vehicle to cirrhotic rats with ascites and water retention. Creatinine clearance, serum osmolality, ADH mRNA expression, and systemic hemodynamics were also measured at the end of the study. Niravoline increased water excretion, peripheral resistance, serum osmolality, and sodium excretion and reduced creatinine clearance, ALD and ADH excretion, and mRNA expression of ADH. OPC-31260 also increased water metabolism and sodium excretion and reduced urinary ALD, although the aquaretic effect was only evident during the first 2 days, and no effects on serum osmolality, renal filtration, and systemic hemodynamics were observed. Therefore, both agents have aquaretic efficacy, but the beneficial therapeutic effects of the long-term oral administration of niravoline are more consistent than those of OPC-31260 in cirrhotic rats with ascites and water retention.  (+info)

kappa-Opioid receptor effects of butorphanol in rhesus monkeys. (2/208)

Butorphanol and nalbuphine have substantial affinity for mu and kappa-opioid receptor sites, yet their behavioral effects in monkeys are largely consistent with a mu receptor mechanism of action. Using ethylketocyclazocine (EKC) discrimination and diuresis assays in rhesus monkeys (Macaca mulatta), the purpose of the current investigation was to characterize the in vivo kappa-opioid activity of these compounds through the use of an insurmountable mu-opioid receptor antagonist, clocinnamox. Alone, butorphanol (0.001-0.032 mg/kg i.m.) failed to generalize to EKC, and pretreatment with the competitive opioid receptor antagonist quadazocine (0.1 or 0.32 mg/kg i.m.) did not alter this generalization. At 24 h after clocinnamox (0.1 mg/kg i.m.) administration, butorphanol fully generalized to EKC, and this generalization was maintained in two of three monkeys at 72 h. Parallel results were observed in diuresis: butorphanol alone and in the presence of quadazocine (1 mg/kg i.m.) did not alter urine output, and a marked diuretic effect was demonstrated 24 h to 2 weeks after clocinnamox administration. Clocinnamox did not alter the discriminative stimulus or diuretic effects of nalbuphine or of the kappa-opioid receptor agonists EKC or U69593. These results are consistent with an in vivo agonist activity of butorphanol at kappa-opioid receptors that can only be demonstrated when an insurmountable antagonist has substantially eliminated the dominant receptor population through which it exerts its action.  (+info)

kappa-Opioid tolerance and dependence in cultures of dopaminergic midbrain neurons. (3/208)

Repeated cocaine exposure upregulates kappa opioids and their receptors in the mesocorticolimbic system; the ensuing kappa-mediated dysphoria appears to contribute to addiction and withdrawal. As a potential rehabilitation strategy to reverse cocaine-induced kappa sensitization, the present study used tritiated dopamine release assays to examine the induction of kappa-opioid tolerance in cultured mesencephalic neurons. Administration of the kappa agonist U69,593 inhibited tetrodotoxin-sensitive, spontaneous (EC(50) = 1.5 nM), and potassium-stimulated (EC(50) = 10 nM) release. These effects were blocked by pertussis toxin and by the kappa antagonist nor-binaltorphimine. The 2 d agonist exposure (1 microM) caused a shift in the U69,593 dose-response curve that was greater in the potassium-stimulated paradigm (140-fold) than in the spontaneous release assay (sixfold). These results were attributable to the attenuation of kappa-receptor signaling mechanisms and to dependence. In the stimulated release assay, attenuation of kappa signaling caused by 4 hr of U69,593 exposure recovered with a half-life of 1.1 hr, whereas attenuation after 144 hr of exposure recovered slowly (t(1/2) = 20 hr). In the spontaneous release assay, attenuation of kappa-opioid signaling occurred slowly (t(1/2) = 22 hr), and resensitization after a 144 hr exposure was rapid (t(1/2) < 1 hr). kappa-Opioid dependence was observed after 144 hr of U69,593 exposure. Thus multiple mechanisms of adaptation to kappa-opioid exposure occur in mesocorticolimbic neurons. These data support the idea that the administration of kappa opioids might facilitate drug rehabilitation.  (+info)

Actions of opioids on excitatory and inhibitory transmission in substantia gelatinosa of adult rat spinal cord. (4/208)

1. The actions of opioid receptor agonists on synaptic transmission in substantia gelatinosa (SG) neurones in adult (6- to 10-week-old) rat spinal cord slices were examined by use of the blind whole-cell patch-clamp technique. 2. Both the mu-receptor agonist DAMGO (1 microM) and the delta-receptor agonist DPDPE (1 microM) reduced the amplitude of glutamatergic excitatory postsynaptic currents (EPSCs) which were monosynaptically evoked by stimulating Adelta afferent fibres. Both also decreased the frequency of miniature EPSCs without affecting their amplitude. 3. In contrast, the kappa-receptor agonist U-69593 (1 microM) had little effect on the evoked and miniature EPSCs. 4. The effects of DAMGO and DPDPE were not seen in the presence of the mu-receptor antagonist CTAP (1 microM) and the delta-receptor antagonist naltrindole (1 microM), respectively. 5. Neither DAMGO nor DPDPE at 1 microM affected the responses of SG neurones to bath-applied AMPA (10 microM). 6. Evoked and miniature inhibitory postsynaptic currents (IPSCs), mediated by either the GABAA or the glycine receptor, were unaffected by the mu-, delta- and kappa-receptor agonists. Similar results were also obtained in SG neurones in young adult (3- to 4-week-old) rat spinal cord slices. 7. These results indicate that opioids suppress excitatory but not inhibitory synaptic transmission, possibly through the activation of mu- and delta- but not kappa-receptors in adult rat spinal cord SG neurones; these actions are presynaptic in origin. Such an action of opioids may be a possible mechanism for the antinociception produced by their intrathecal administration.  (+info)

Agonist-dependent desensitization of the kappa opioid receptor by G protein receptor kinase and beta-arrestin. (5/208)

We used the Xenopus oocyte expression system to examine the regulation of rat kappa opioid receptor (rKOR) function by G protein receptor kinases (GRKs). kappa agonists increased the conductance of G protein-activated inwardly rectifying potassium channels in oocytes co-expressing KOR with Kir3.1 and Kir3.4. In the absence of added GRK and beta-arrestin 2, desensitization of the kappa agonist-induced potassium current was modest. Co-expression of either GRK3 or GRK5 along with beta-arrestin 2 significantly increased the rate of desensitization, whereas addition of either beta-arrestin 2, GRK3, or GRK5 alone had no effect on the KOR desensitization rate. The desensitization was homologous as co-expressed delta opioid receptor-evoked responses were not affected by KOR desensitization. The rate of GRK3/beta-arrestin 2-dependent desensitization was reduced by truncation of the C-terminal 26 amino acids, KOR(Q355Delta). In contrast, substitution of Ala for Ser within the third intracellular loop [KOR(S255A,S260A, S262A)] did not reduce the desensitization rate. Within the C-terminal region, KOR(S369A) substitution significantly attenuated desensitization, whereas the KOR(T363A) and KOR(S356A,T357A) point mutations did not. These results suggest that co-expression of GRK3 or GRK5 and beta-arrestin 2 produced homologous, agonist-induced desensitization of the kappa opioid receptor by a mechanism requiring the phosphorylation of the serine 369 of rKOR.  (+info)

Dynorphin selectively augments the M-current in hippocampal CA1 neurons by an opiate receptor mechanism. (6/208)

Most electrophysiological studies of opioids on hippocampal principal neurons have found indirect actions, usually through interneurons. However, our laboratory recently found reciprocal alteration of the voltage-dependent K(+) current, known as the M-current (I(M)), by kappa and delta opioid agonists in CA3 pyramidal neurons. Recent ultrastructural studies have revealed postsynaptic delta opiate receptors on dendrites and cell bodies of CA1 and CA3 hippocampal pyramidal neurons (HPNs). Reasoning that previous electrophysiological studies may have overlooked voltage-dependent postsynaptic effects of the opioids in CA1, we reevaluated their role in CA1 HPNs using the rat hippocampal slice preparation for intracellular current- and voltage-clamp recording. None of the delta and mu; receptor-selective opioids tested, including [D-Pen(2,5)]-enkephalin (DPDPE), [D-Ala(2)]-deltorphin II (deltorphin), [D-Ala(2), NMe-Phe(4), Gly-ol]-enkephalin (DAMGO), and [D-Ala(2), D-Leu(5)] enkephalin (DADLE), altered membrane properties such as I(M) or Ca(2+)-dependent spikes in CA1 HPNs. The nonopioid, Des-Tyr-dynorphin (D-T-dyn), also had no effect. By contrast, dynorphin A (1-17) markedly increased I(M) at low concentrations and caused an outward current at depolarized membrane potentials. The opioid antagonist naloxone and the kappa receptor antagonist nor-binaltorphimine (nBNI) blocked the I(M) effect. However, the kappa-selective agonists U69,593 and U50,488h did not significantly alter I(M) amplitudes when averaged over all cells tested, although occasional cells showed an I(M) increase with U50,488h. Our results suggest that dynorphin A postsynaptically modulates the excitability of CA1 HPNs through opiate receptors linked to voltage-dependent K(+) channels. These findings also provide pharmacological evidence for a functional kappa opiate receptor subtype in rat CA1 HPNs but leave unanswered questions on the role of delta receptors in CA1 HPNs.  (+info)

Mitogenic signaling via endogenous kappa-opioid receptors in C6 glioma cells: evidence for the involvement of protein kinase C and the mitogen-activated protein kinase signaling cascade. (7/208)

As reports on G protein-coupled receptor signal transduction mechanisms continue to emphasize potential differences in signaling due to relative receptor levels and cell type specificities, the need to study endogenously expressed receptors in appropriate model systems becomes increasingly important. Here we examine signal transduction mechanisms mediated by endogenous kappa-opioid receptors in C6 glioma cells, an astrocytic model system. We find that the kappa-opioid receptor-selective agonist U69,593 stimulates phospholipase C activity, extracellular signal-regulated kinase 1/2 phosphorylation, PYK2 phosphorylation, and DNA synthesis. U69,593-stimulated extracellular signal-regulated kinase 1/2 phosphorylation is shown to be upstream of DNA synthesis as inhibition of signaling components such as pertussis toxin-sensitive G proteins, L-type Ca2+ channels, phospholipase C, intracellular Ca2+ release, protein kinase C, and mitogen-activated protein or extracellular signal-regulated kinase kinase blocks both of these downstream events. In addition, by overexpressing dominant-negative or sequestering mutants, we provide evidence that extracellular signal-regulated kinase 1/2 phosphorylation is Ras-dependent and transduced by Gbetagamma subunits. In summary, we have delineated major features of the mechanism of the mitogenic action of an agonist of the endogenous kappa-opioid receptor in C6 glioma cells.  (+info)

Mu-opioid agonist inhibition of kappa-opioid receptor-stimulated extracellular signal-regulated kinase phosphorylation is dynamin-dependent in C6 glioma cells. (8/208)

In previous studies we found that mu-opioids, acting via mu-opioid receptors, inhibit endothelin-stimulated C6 glioma cell growth. In the preceding article we show that the kappa-selective opioid agonist U69,593 acts as a mitogen with a potency similar to that of endothelin in the same astrocytic model system. Here we report that C6 cell treatment with mu-opioid agonists for 1 h results in the inhibition of kappa-opioid mitogenic signaling. The mu-selective agonist endomorphin-1 attenuates kappa-opioid-stimulated DNA synthesis, phosphoinositide turnover, and extracellular signal-regulated kinase phosphorylation. To investigate the role of receptor endocytosis in signaling, we have examined the effects of dynamin-1 and its GTPase-defective, dominant suppressor mutant (K44A) on opioid modulation of extracellular signal-regulated kinase phosphorylation in C6 cells. Overexpression of dynamin K44A in C6 cells does not affect kappa-opioid phosphorylation of extracellular signal-regulated kinase. However, it does block the inhibitory action on kappa-opioid signaling mediated by the kappa-opioid receptor. Our results are consistent with a growing body of evidence of the opposing actions of mu- and kappa-opioids and provide new insight into the role of opioid receptor trafficking in signaling.  (+info)

Based on the structural similarity of viral fusion proteins within the family Paramyxoviridae, we tested recently described and newly synthesized acetanilide derivatives for their capacity to inhibit measles virus (MV)-, canine distemper virus (CDV)- and Nipah virus (NiV)-induced membrane fusion. We found that N-(3-cyanophenyl)-2-phenylacetamide (compound 1) has a high capacity to inhibit MV- and CDV-induced (IC50=3 μM), but not NiV-induced, membrane fusion. This compound is of outstanding interest because it can be easily synthesized and its cytotoxicity is low [50 % cytotoxic concentration (CC50)≥300 μM], leading to a CC50/IC50 ratio of approximately 100. In addition, primary human peripheral blood lymphocytes and primary dog brain cell cultures (DBC) also tolerate high concentrations of compound 1. Infection of human PBMC with recombinant wild-type MV is inhibited by an IC50 of approximately 20 μM. The cell-to-cell spread of recombinant wild-type CDV in persistently infected DBC can be nearly
Emergence of disinhibition-induced synchrony in the CA3 region of the guinea pig hippocampus in vitro.: Suppressing inhibition mediated by GABAA receptors induc
Nepafenac - Get up-to-date information on Nepafenac side effects, uses, dosage, overdose, pregnancy, alcohol and more. Learn more about Nepafenac
J Med Chem. 2010 Sep 9;53(17):6386-97.Discovery of N-{1-[3-(3-oxo-2,3-dihydrobenzo[1,4]oxazin-4-yl)propyl]piperidin-4-yl}-2-phenylacetamide (Lu AE51090): an allosteric muscarinic M1 receptor agonist with unprecedented selectivity and procognitive potential. ...
Professional guide for Nepafenac. Includes: pharmacology, pharmacokinetics, contraindications, interactions, adverse reactions and more.
Nepafenac official prescribing information for healthcare professionals. Includes: indications, dosage, adverse reactions, pharmacology and more.
The National Institute of Standards and Technology (NIST) uses its best efforts to deliver a high quality copy of the Database and to verify that the data contained therein have been selected on the basis of sound scientific judgment. However, NIST makes no warranties to that effect, and NIST shall not be liable for any damage that may result from errors or omissions in the Database ...
Giá bán lẻ 1 tuýp là 790.000 vnđ, mua 3 bạn sẽ tiết kiệm được ngay: 970.000 vnđ, gọi điện đặt hàng ngay: 093.88.95.700 - 086.8900.269
Giá bán lẻ 1 tuýp là 790.000 vnđ, mua 3 bạn sẽ tiết kiệm được ngay: 970.000 vnđ, gọi điện đặt hàng ngay: 093.88.95.700 - 086.8900.269
Ekipa Federalne televizije krajem februara snimila je reportažu o Kopčićima, boraveći na licu mjesta i razgovarajući sa glavnim imamom, Safet ef. Pozderom.
xanax while pregnant ,,, Kop XANAX natet ,,, http://imagizer.imageshack.us/v2/533x300q90/923/IgToTq.jpg . .
OUTLINE: This is an open label study.. Patients receive gradually escalating doses of antineoplaston A10 and antineoplaston AS2-1 by intravenous injection 6 times daily until the maximum tolerated dose is reached.. Treatment continues for at least 3 months in the absence of toxicity and disease progression. Patients achieving complete response (CR) continue treatment for an additional 8 months after reaching CR.. Tumors are measured every 2 months for the first year and every 3 months for the second year.. PROJECTED ACCRUAL: A total of 20-40 patients will be accrued for this study. ...
Current therapies for metastatic or unresectable Colon Cancer provide very limited benefit to the patient. The anti-cancer properties of Antineoplaston therapy suggest that it may prove beneficial in the treatment of metastatic or unresectable Colon Cancer.. PURPOSE: This study is being performed to determine the effects (good and bad) that Antineoplaston therapy has on patients with metastatic or unresectable Colon Cancer ...
TY - JOUR. T1 - Immunocytochemical localization of glutaminase-like and aspartate aminotransferase-like immunoreactivities in the rat and guinea pig hippocampus. AU - Altschuler, R. A.. AU - Monaghan, D. T.. AU - Haser, W. G.. AU - Wenthold, R. J.. AU - Curthoys, N. P.. AU - Cotman, C. W.. PY - 1985/3/25. Y1 - 1985/3/25. N2 - There is considerable evidence that pathways of the hippocampus use an excitatory amino acids as transmitter. We have attempted to immunocytochemically identify excitatory amino acid neurons in the hippocampus of the rat and guinea pig using antiserum to glutaminase and antiserum to aspartate aminotransferase, which have been proposed as markers for aspartergic/glutamergic neurons. Glutaminase-like immunoreactivity was seen in granule cells in the dentate gyrus and fibers and puncta associated with the mossy fiber pathway in the hilus and stratum lucidum of the hippocampus. At the ultrastructural level, glutaminase-like immunoreactivity was observed in mossy fiber terminals ...
RATIONALE: Antineoplastons are naturally-occurring substances that may also be made in the laboratory. Antineoplastons may inhibit the growth of cancer
RATIONALE: Antineoplastons are naturally-occurring substances that may also be made in the laboratory. Antineoplastons may inhibit the growth of cancer
Nepafenac ophthalmic is used to treat eye pain, redness, and swelling in patients who are recovering from cataract surgery (procedure to treat
Genomic Medicine UK is the home of comprehensive genomic testing in Harley Street in London. Our medical doctors and consultants work tirelessly to provide the best possible standards of testing and screening for genes that may cause cancers or diseases at an affordable cost. We use all available medical, diagnostic, and laboratory technology to provide our patients with a reliable evidence-based and thorough service ...
Rò hậu sĩ chuyên khoa là một bệnh lý nguy hiểm dẫn tới phổ biến hệ lụy tới thể trạng cũng như tinh thần của bệnh nhân. Thế chúng ta đã phát hiện bệnh gì về bệnh? phương pháp trị bệnh lý tận gốc là gì? nếu bạn muốn mua hiểu hay đang mắc phải căn bệnh thì hãy tham khảo các thông tin phong kham da khoa dai dong truyền đạt trong suốt bài viết này để sở hữu thể biết được hơn về bệnh rò hậu sĩ chuyên khoa cũng như kịp thời tậu ra bí quyết trị bệnh lý tận gốc trường hợp ko may mắc bắt buộc nhé. căn
Rò hậu sĩ chuyên khoa là một bệnh lý nguy hiểm dẫn tới phổ biến hệ lụy tới thể trạng cũng như tinh thần của bệnh nhân. Thế chúng ta đã phát hiện bệnh gì về bệnh? phương pháp trị bệnh lý tận gốc là gì? nếu bạn muốn mua hiểu hay đang mắc phải căn bệnh thì hãy tham khảo các thông tin phong kham da khoa dai dong truyền đạt trong suốt bài viết này để sở hữu thể biết được hơn về bệnh rò hậu sĩ chuyên khoa cũng như kịp thời tậu ra bí quyết trị bệnh lý tận gốc trường hợp ko may mắc bắt buộc nhé. căn
N-methyl-N-[2-(1-pyrrolidinylcarbonyl)phenyl]-2-pyridinamine - chemical structural formula, chemical names, chemical properties, synthesis references
The National Institute of Standards and Technology (NIST) uses its best efforts to deliver a high quality copy of the Database and to verify that the data contained therein have been selected on the basis of sound scientific judgment. However, NIST makes no warranties to that effect, and NIST shall not be liable for any damage that may result from errors or omissions in the Database ...
Formula: C27H43NO2MW: 413. 64CAS: 126-17-0TNP NUMBER: TNP00027MDL NUMBER: MFCD09787895IUPAC: (1S,2S,4S,7S,9S,12S,16S,8R,13R,26R)-7,9,13,23-tetramethyl-5-oxaspiro[pentacycl o[10....
Ceny za kopírovacie a rozmnožovacie služby zahŕňajú daň z pridanej hodnoty so sadzbou dane platnou v deň vzniku daňovej povinnosti podľa § 27 zákona č. 222/2004 Z. z. o dani z pridanej hodnoty v znení neskorších predpisov ...
pF1KSDB0014 9017 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCTTTCGAAGGAGAT AGAACCATGGCACAGCAAGCTGCCGATAAGTATCTCTATGTGGATAAAAACTTCATCAAC AATCCGCTGGCCCAGGCCGACTGGGCTGCCAAGAAGCTGGTATGGGTGCCTTCCGACAAG AGTGGCTTTGAGCCAGCCAGCCTCAAGGAGGAGGTGGGCGAAGAGGCCATCGTGGAGCTG GTGGAGAATGGGAAGAAGGTGAAGGTGAACAAGGATGACATCCAGAAGATGAACCCGCCC AAGTTCTCCAAGGTGGAGGACATGGCAGAGCTCACGTGCCTCAACGAAGCCTCGGTGCTG CACAACCTCAAGGAGCGTTACTACTCAGGGCTCATCTACACCTATTCAGGCCTGTTCTGT GTGGTCATCAATCCTTACAAGAACCTGCCCATCTACTCTGAAGAGATTGTGGAAATGTAC AAGGGCAAGAAGAGGCACGAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTAC AGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCT GGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCAC AAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTG GAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTC ATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTT TTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTAT ...
pF1KB7323 8975 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGCGGGGCCCA GTGGGCACCGAGGAGGAGCTGCCGCGGCTGTTCGCCGAGGAGATGGAGAATGAGGACGAG ATGTCAGAAGAAGAAGATGGTGGTCTTGAAGCCTTCGATGACTTTTTCCCTGTGGAGCCC GTGAGCCTTCCTAAGAAGAAGAAACCCAAGAAGCTCAAGGAAAACAAGTGTAAAGGGAAG CGGAAGAAGAAAGAGGGGAGCAATGATGAGCTATCAGAGAATGAAGAGGATCTGGAAGAG AAGTCGGAGAGTGAAGGCAGTGACTACTCCCCGAATAAAAAGAAGAAGAAGAAACTCAAG GACAAGAAGGAGAAAAAAGCCAAGCGAAAAAAGAAGGATGAGGATGAGGATGATAATGAT GATGGATGCTTAAAGGAGCCCAAGTCCTCGGGGCAGCTCATGGCCGAGTGGGGCCTGGAC GACGTGGACTACCTGTTCTCGGAGGAGGATTACCACACGCTGACCAACTACAAGGCCTTC AGCCAGTTCCTCAGGCCACTCATTGCCAAGAAGAACCCGAAGATCCCCATGTCCAAAATG ATGACCGTCCTGGGTGCCAAGTGGCGGGAGTTCAGCGCCAACAACCCCTTCAAGGGCAGC TCCGCGGCAGCAGCGGCGGCGGCGGTGGCTGCGGCTGTAGAGACGGTCACCATCTCCCCT CCGCTAGCCGTCAGCCCCCCGCAGGTGCCCCAGCCTGTGCCTATCCGCAAGGCCAAGACC AAGGAGGGCAAAGGGCCTGGAGTGAGGAAGAAGATCAAAGGCTCCAAAGATGGGAAGAAA AAGGGCAAAGGGAAAAAGACGGCCGGGCTCAAGTTCCGCTTCGGGGGGATCAGCAACAAG ...
Learn about the peripherally acting Kappa Opioid Receptor Agonists that Cara Therapeutics is developing for better pruritus and pain management in patients.
Posts about K. The ingredients of antineoplaston AS2-1 down-regulate glycolysis pathways in glioblastoma cells. Neuro-Oncology 2008; 10:1148″ written by didymusjudasthomas
N-Methyl-N-[3-(trifluoromethyl)benzyl]amine, 97+%, Maybridge Amber Glass Bottle; 1g N-Methyl-N-[3-(trifluoromethyl)benzyl]amine, 97+%, Maybridge Methylthios to Mh...
N-Methyl-N-[(1-methylpiperidin-3-yl)methyl]pyridin-2-amine | C13H21N3 | CID 72001564 - structure, chemical names, physical and chemical properties, classification, patents, literature, biological activities, safety/hazards/toxicity information, supplier lists, and more.
91457-53-3 - MTXRYLDKVRPTGG-UHFFFAOYSA-N - Benzeneacetamide, 2,6-dichloro-N-((ethylamino)iminomethyl)- - Similar structures search, synonyms, formulas, resource links, and other chemical information.
Drugs may be covered by multiple patents or regulatory protections. All trademarks and applicant names are the property of their respective owners or licensors. Although great care is taken in the proper and correct provision of this service, thinkBiotech LLC does not accept any responsibility for possible consequences of errors or omissions in the provided data. The data presented herein is for information purposes only. There is no warranty that the data contained herein is error free. thinkBiotech performs no independent verifification of facts as provided by public sources nor are attempts made to provide legal or investing advice. Any reliance on data provided herein is done solely at the discretion of the user. Users of this service are advised to seek professional advice and independent confirmation before considering acting on any of the provided information. thinkBiotech LLC reserves the right to amend, extend or withdraw any part or all of the offered service without notice. ...
Iomeglamic Acid,5-[(3-Amino-2,4,6-triiodophenyl)methylamino]-5-oxopentanoic acid,3-amino-2,4,6-triiodo-N-methylglutaranilic acid,N-methyl-N-(3-amino-2,4,6-triiodophenyl)glutaramic acid,N-methyl-N-(2,4,6-triiodo-3-aminophenyl)glutaramidic acid,RG-270,Falignost
Customers who buy this item also bought:Udor KAPPA-43/GR Diaphragm Pump 10.5 GPM @ 560 PSI with GearboxView ProductUdor KAPPA-43 Desmopan Diaphragm KitView Product
Source: Umuvugizi.com Ubu buhambya bwa Dr Rudasingwa, ikinyamakuru Umuvugizi gifitiye kopi, ni ubuhamya bukomeye ku muntu nka we wari mu basirikari bakuru (major) mu ngabo za FPR-Inkotanyi, akaba yaranagizwe umunyamabanga mukuru wishyaka rya FPR, nyuma gato yuko rifashe ubutegetsi muri nyakanga 1994. Ubu buhamya kandi Dr Rudasingwa yashyize ahagaragara uyu munsi, nta gushidikanya ko bwakoze mu bwonko Perezida Kagame kuko uyu, mu biganiro yakunze kugirana nabanyamakuru mpuzamahanga, yahakanaga yivuye inyuma ko ntaho ahuriye nurupfu rwa Perezida Habyarimana. Mu kiganiro cyitwa «Hard Talk» gihita kuri radiyo BBC mu rurimi rwicyongereza, ubwo umunyamakuru yamubazaga niba ari we koko wahanuye indege ya Perezida Habyarimana, aho kumusubiza ikibazo yari abajijwe, Kagame yahisemo kugikwepa, asubiza ko «Habyarimana yari yaramuhejeje i Shyanga imyaka mirongo itatu». Si Rudasingwa wenyine utanze ubuhamya nkubu, kuko mu mwaka w1998, umunyamakuru witwa Jean-Pierre Mugabe, wayoboraga «Le Tribun du ...
This serie description Aukstums, karstums, lietus, sniegs, stress, netīrumi un citi apkārtējās vides kairinātāji - ar to visu ādai jātiek galā dienas laikā. Tai nepieciešama īpaša aizsardzība, piemērota kopšana pēc ik rīta tīrīšanas un tonizēšanas. Tieši šim nolūkam ir radīti Dr.Hauschka dienas kopšanas līdzekļi. Augstvērtīgie augu ekstrakti aktivizē dabisko mitrināšanu, kamēr izmeklētas eļļas un vērtīgi vaski nodrošina sejas maigu aizsardzību, netraucējot ādai elpot. Turklāt Dr.Hauschka dienas ādas kopšanas produkti ir tikpat daudzveidīgi un dažādi kā ikviens no mums. Vienalga, kāds ir Jūsu ādas stāvoklis attiecīgajā dzīves posmā, augstvērtīgie sastāvi stimulē ādas pašatjaunošanos. Lai āda iegūtu vienmērīgu viegla iedeguma toni, papildus izvēlieties Dr.Hauschka tonējošo dienas krēmu vai Dr.Hauschka tonējošo fluīdu, savukārt nelielus ādas defektus nomaskējiet ar Dr.Hauschka korektoru. Palutiniet savu ādu ar ...
This serie description Aukstums, karstums, lietus, sniegs, stress, netīrumi un citi apkārtējās vides kairinātāji - ar to visu ādai jātiek galā dienas laikā. Tai nepieciešama īpaša aizsardzība, piemērota kopšana pēc ik rīta tīrīšanas un tonizēšanas. Tieši šim nolūkam ir radīti Dr.Hauschka dienas kopšanas līdzekļi. Augstvērtīgie augu ekstrakti aktivizē dabisko mitrināšanu, kamēr izmeklētas eļļas un vērtīgi vaski nodrošina sejas maigu aizsardzību, netraucējot ādai elpot. Turklāt Dr.Hauschka dienas ādas kopšanas produkti ir tikpat daudzveidīgi un dažādi kā ikviens no mums. Vienalga, kāds ir Jūsu ādas stāvoklis attiecīgajā dzīves posmā, augstvērtīgie sastāvi stimulē ādas pašatjaunošanos. Lai āda iegūtu vienmērīgu viegla iedeguma toni, papildus izvēlieties Dr.Hauschka tonējošo dienas krēmu vai Dr.Hauschka tonējošo fluīdu, savukārt nelielus ādas defektus nomaskējiet ar Dr.Hauschka korektoru. Palutiniet savu ādu ar ...
Learn about Lithostat (Acetohydroxamic Acid Tablets) may treat, uses, dosage, side effects, drug interactions, warnings, patient labeling, reviews, and related medications.
Summary: A mutation in a gene designated gmdA has been found to lead to loss of ability of Aspergillus nidulans to use benzamide, phenylacetamide and several other amides as sole nitrogen sources for growth. The gmdAI lesion results in low levels of an enzyme, called the general amidase, which has activity for a wide range of amide substrates. This enzyme is repressed by certain nitrogen-containing metabolites, including ammonium, but is probably not regulated by induction or by carbon catabolite repression. Evidence is presented for the general amidase being distinct from the previously characterized acetamidase and formamidase enzymes. The data also indicate that there is a fourth amidase capable of the hydrolysis of valeramide and hexanamide.
There are a lot of red flags here, of course, the first of which is that the conference is the Asia-Pacific Academy of Anti-Aging Medicine. Anti-aging medicine tends to be, more than anything else, a cesspit of pseudoscience and quackery; so Burzynski fits right in. But what about the report itself. Obviously, its pretty much impossible to tell much from a self-serving press release, but there is one enormous additional red flag. Notice how the press release says that this is a report on a total of 401 eligible patients (patients who received over 28 days of treatment) with advanced inoperable brain tumors have been treated with antineoplaston A10 and antineoplastons AS2-1 therapy (ANP) in phase II studies. Actually, there are two red flags right in that passage. First, notice how it says only patients who received over 28 days of treatment were counted. This, by its very nature, selects for patients who are in good enough shape to tolerate 28 days of antineoplaston therapy, which, as we have ...
Looking for online definition of H/U or what H/U stands for? H/U is listed in the Worlds largest and most authoritative dictionary database of abbreviations and acronyms
Next is a very familiar story to those of us who have been following Burzynski. Treatment at the Burzynski Clinic easily runs into tens of thousands, if not hundreds of thousands, of dollars. Through a monumental effort, Seáns family managed to raise €120,000 (which at todays exchange rate is approximately $160,000) to go to Houston; so go to Houston they did. We see the video that appears to have been taken with an iPhone camera of the family, including Seán, his mother, his brother Tomás, and his sister Deirdre mugging for the camera in front of the Burzynski Clinic, overjoyed to be there because they think that this is Seáns best hope for survival.. Although it grated me to hear the narrator describe antineoplaston therapy as controversial (its not controversial from a scientific standpoint; theres no evidence that it works), I give the producers credit for making it very clear that antineoplastons have never been granted a general license by the FDA, and calling them in a ...
Big Pharma Plays Hide-the-Ball With Data But if Tamiflu does nothing, and there s even a slight chance of life-threatening side effects, why was it approved? And why continue to prescribe it? That s what the Cochrane Collaboration argued in a report it published in April. http://www.newsweek.com/2014/11/21/medical-science-has-data-problem-284066.html The most infamous case of publication bias is a 1980 study in which heart attack patients were split into two groups: One group received a drug called lorcainide, while the other group received a placebo. Researchers wanted to ...
Generics: Nepafenac, Form: DROPS, Pack Size: 1, Brand name: I NAC EYE 5ML DROPS, Manufacturer: APPASAMY OCULAR DEVICES, Contains: Nepafenac 0.1 %W/V, Drug category: Ophthalmic Decongestants, ...
2-Amino-3-phenyl-1-(1-pyrrolidinyl)-1-propanonehydrochloride Cas No 1236258-19-7 - A wide of 2-Amino-3-phenyl-1-(1-pyrrolidinyl)-1-propanonehydrochloride knowledge covers characteristics, safety, usage, MSDS/SDS & Reach registration data at Echemi.com
This 1200 gallon round tank is 86 in diameter and 56 high. It weighs 200 lbs. and will hold up to a 1.7 specific gravity. It has a .240 nominal wall thickness.
Check out and purchase from our amazing collection of over 3000 strong harmony, lowrider and deep soul vinyl. Descriptions accurate.
Ubushakashatsi buheruka gukorwa bugaragaza ko imizabibu isa na mauve igira akamaro mu kurinda kanseri yamabere. Umutobe uva muri iyi mizabibu urwanya ibibyimba biza mu mabere akaba ariyo mvano nyamukuru ya kanseri yibere. Ntabwo nyamara bigarukira kuri kanseri yamabere gusa kuko no ku bundi bwoko bwose bwa kanseri gukoresha iyi mizabibu bifasha mu kuyirwanya. Ibi biterwa nuko mu mizabibu harimo resveratrol ikaba izwiho kubyimbura no kurwanya kanseri. Iyi resveratrol byumwihariko ni ingenzi mu kurinda kanseri yamara niyamabere. Si ukuzirinda gusa ahubwo, kuko inarwanya ko yakomeza gukura no gukwirakwira mu mubiri iyo yamaze kuwugeramo.. ...
(((((((((((( H U G S )))))))))))) You are not alone. Everything you feel, experience, confront, suppress, and express is shared in common with other grieving parents. You belong to an exclusive club, and you paid the highest price to become a member. Nothing in this life prepares you for the loss of your child. And nothing in this life compares to the anguish of your loss. No other death among your loved ones will create the same response as the death of your child. And no one can
Op 6 juni 1964 zetten The Beatles Nederland op zn kop. In het Noord-Hollandse Blokker werd namelijk het enige Beatles-concert in Nederland ooit gegeven. Om die gebeurtenis te eren heeft Vol...
Oxygen substituted amino-cyclohexyl-benzeneacetamides and -benzamides as water diuretic drugs". Casy AF, Parfitt RT (1986). ...
... benzeneacetamides and -benzamide analgesics". The Upjohn Company. "Properties Viewer". chemicalize.org. AH-7921 U-47700 U-50488 ...
Benzeneacetamides* * Bridged Bicyclo Compounds / pharmacology * Calcimycin / pharmacology * Calcium / metabolism * Dose- ...
Oxygen substituted amino-cyclohexyl-benzeneacetamides and -benzamides as water diuretic drugs". Casy AF, Parfitt RT (1986). ...
0 (Anti-Inflammatory Agents, Non-Steroidal); 0 (Benzeneacetamides); 0 (Ophthalmic Solutions); 0 (Phenylacetates); 0J9L7J6V8C ( ...
Benzeneacetamides / adverse effects * Benzeneacetamides / therapeutic use* * Brain Neoplasms / drug therapy* * Child * Child, ...
... benzeneacetamides and -benzamide analgesics". The Upjohn Company. "Properties Viewer". chemicalize.org. AH-7921 U-47700 U-50488 ...
Nedelcovych, M., Dash, R. P., Tenora, L., Zimmermann, S. C., Gadiano, A. J., Garrett, C., Alt, J., Hollinger, K. R., Pommier, E., Jančařík, A., Rojas, C., Thomas, A. G., Wu, Y., Wozniak, K., Majer, P., Slusher, B. S. & Rais, R. Oct 2 2017 In : Molecular Pharmaceutics. 14, 10, p. 3248-3257 10 p.. Research output: Contribution to journal › Article ...
N-substituted-2-hydroxy-α-oxo-benzeneacetamides and pharmaceutical compositions having activity as modulators of the ... N-substituted-2-hydroxy-α-oxo-benzeneacetamides and pharmaceutical compositions having activity as modulators of the ...
Benzeneacetamides / administration & dosage. Brain Neoplasms / drug therapy. Glutamine / analogs & derivatives. Neuroectodermal ... Chemical-registry-number] 0 / Antineoplastic Agents; 0 / Benzeneacetamides; 0 / Drug Combinations; 0 / Phenylacetates; 0 / ...
TY - JOUR. T1 - Presynaptic modulation of synaptic transmission by opioid receptor in rat subthalamic nucleus in vitro. AU - Shen, Ke Zhong. AU - Johnson, Steven W.. PY - 2002/5/15. Y1 - 2002/5/15. N2 - Presynaptic modulation of synaptic transmission in rat subthalamic nucleus (STN) neurons was investigated using whole-cell patch-clamp recordings in brain slices. Evoked GABAergic inhibitory postsynaptic currents (IPSCs) were reversibly reduced by methionine enkephalin (ME) with an IC50 value of 1.1 ± 0.3 μM. The action of ME was mimicked by the μ-selective agonist [D-Ala2, N-Me-Phe4, Gly5-ol]-enkephalin (DAMGO), and was partially blocked by the μ-selective antagonists naloxonazine and D-Phe-Cys-Tyr-D-Trp-Arg-Thr-Pen-Thr-NH2 (CTAP). Evoked GABAA IPSCs were also inhibited by the δ-selective agonist [D-Pen2,5] -enkephalin (DPDPE), but not by the κ-selective agonist (+)-(5α,7α,8β)-N-methyl-N-[7-(1-pyrrolidinyl) -1-oxaspiro[4.5]dec-8-yl]-benzeneacetamide (U-69593) and the orphan receptor ...
Benzeneacetamides; Sulfonamides Mechanism of Action Beta 2 adrenergic receptor agonists Orphan Drug StatusNo On Fast trackNo ...
Benzeneacetamides. 1. + 297. Receptors, Serotonin. 1. + 298. 2-Aminopurine. 1. + 299. Hydrochloric Acid. 1. + ...
TY - JOUR. T1 - Characterization of Specific Opioid Binding Sites in Neural Membranes from the Myenteric Plexus of Porcine Small Intestine. AU - Townsend, DeWayne. AU - Portoghese, Philip S. AU - Brown, David R. PY - 2004/1/1. Y1 - 2004/1/1. N2 - δ- and κ-Opioid receptors (OPRs), but not μ-OPRs, are expressed in the myenteric plexus of the porcine distal small intestine. In a subpopulation of myenteric neurons, δ- and κ-OPRs seem to be colocalized and may functionally interact. In this study, radioligand binding was used to characterize myenteric OPR populations in detail. The nonselective OPR antagonist [3H]diprenorphine bound to a single, high-affinity site in myenteric neural membrane homogenates. Naloxone displaced 65 and 59% of [3H]diprenorphine binding from this site in Na+-free Tris and Krebs-HEPES buffers, respectively. Naltrexone-derived δ- and κ-OPR antagonists, including naltriben, 7-benzylidenenaltrexone, nor-binaltorphimine, and 5′-guanidinonaltrindole, displaced [ ...
TY - JOUR. T1 - κ-Opioid receptor agonist protects against ischemic reduction of 2-deoxyglucose uptake in morphine-tolerant rats. AU - Shibata, Shigenobu. AU - Tominaga, Keiko. AU - Watanabe, Shigenori. PY - 1995/6/12. Y1 - 1995/6/12. N2 - We examined the effects of μ-opioid receptor agonist and antagonists, and κ-opioid receptor agonist on the hypoxia/hypoglycemia-induced reduction in 2-deoxyglucose uptake of rat hippocampal slices. Naloxone, a μ-opioid receptor antagonist and (5,7,8)-(+)-3,4-dichloro-N-methyl-N-(7,8,1-pyrrolidinyl)-1-oxaspirol 4,5 dec-8-yl)-benzeneacetamide methanesulfonate, U-62,066E, a κ-opioid receptor agonist, showed neuroprotective actions against the hypoxia/hypoglycemia-induced deficit in glucose uptake. In contrast, morphine exhibited an exacerbating action. These results suggest that blockade of μ-opioid receptor-and stimulation of κ-opioid receptor-mediated functions has a protective role against the hypoxia/hypoglycemia-induced decreases in glucose metabolism ...
Benzeneacetamides - Preferred Concept UI. M0445221. Scope note. Compounds based on benzeneacetamide, that are similar in ...
Benzeneacetamides/pharmacology*. *Dynorphins/pharmacology*. *Ethanol/pharmacology*. *Inhibitory Postsynaptic Potentials/drug ...
Benzeneacetamides. Clone Cells. Cytokines -- analysis. Drug Hypersensitivity -- etiology. Drug Hypersensitivity -- immunology. ...
Benzeneacetamides MeSH DeCS ID:. 87 Unique ID:. D000083 Documents indexed in the Virtual Health Library (VHL):. Click here to ...
Benzeneacetamides , Tachycardia - physiopathology , Piperidines - blood , Anti-Arrhythmia Agents - adverse effects , ...
... /administration & dosage , Benzeneacetamides/therapeutic use , Cataract Extraction/complications , Humans , ... Benzeneacetamides , Birth Weight , Body Weight , Cesarean Section , Child , Ductus Arteriosus, Patent , Female , Follow-Up ... Benzeneacetamides , Carbon , Carbon Dioxide , Humans , Lung , Perfusion , Piperidones , Posture , Prone Position , Pulmonary ... Benzeneacetamides , Child , Child, Preschool , China , Epidemiology , Enterovirus A, Human , Classification , Genetics , ...
D02.065.064.294 Benzeneacetamides .. D02.065.064.294.088 Bufexamac .. D02.065.199 Anilides .. D02.065.199.092 Acetanilides .. ... D02.455.426.559.389.048 Benzeneacetamides .. D02.455.426.559.389.048.088 Bufexamac .. D02.455.426.559.389.127 Benzoates .. ...
Benzeneacetamides/administration & dosage , Benzeneacetamides/therapeutic use , Cataract Extraction/complications , Humans , ...
In this concept cloud, the sizes of the concepts are based not only on the number of corresponding publications, but also how relevant the concepts are to the overall topics of the publications, how long ago the publications were written, whether the person was the first or senior author, and how many other people have written about the same topic. The largest concepts are those that are most unique to this person ...
Martinez FJ, Vestbo J, Anderson JA, Brook RD, Celli BR, Cowans NJ, Crim C, Dransfield M, Kilbride S, Yates J, Newby DE, Niewoehner D, Calverley PM. Effect of Fluticasone Furoate and Vilanterol on Exacerbations of Chronic Obstructive Pulmonary Disease in Patients with Moderate Airflow Obstruction. Am J Respir Crit Care Med. 2017 04 01; 195(7):881-888 ...
Benzeneacetamides*N-(2-(4-t-butylbenzyl)-3-(pivaloyloxy)propyl)-2-(3-fluoro-4-(methylsulfonylamino)phenyl)propionamide ... Benzeneacetamides*N-(2-(4-t-butylbenzyl)-3-(pivaloyloxy)propyl)-2-(3-fluoro-4-(methylsulfonylamino)phenyl)propionamide ...
Aged, Anti-Inflammatory Agents, adverse effects, Benzeneacetamides, Dermatitis, Photoallergic, etiology, Drug Eruptions, Female ...
N-cyclohexyl benzamides and benzeneacetamides as inhibitors of 11-beta-hydroxysteroid dehydrogenases - The present invention ...
Alanine, Animals, Benzamides, Benzeneacetamides, Binding Sites, DNA, Complementary, Drug Design, Humans, Inhibitory ...
Androstenols, Animals, Benzeneacetamides, Benzhydryl Compounds, Cell Differentiation, Cell Line, Tumor, Cell Lineage, Cytokines ...
Benzeneacetamides. Benzenoacetamidas. Bencenoacetamidas. Catenanes. Catenanos. Catenanos. Crown Ethers. Éteres de Coroa. Éteres ...
This graph shows the total number of publications written about "Benzene Derivatives" by people in this website by year, and whether "Benzene Derivatives" was a major or minor topic of these publications ...

No FAQ available that match "benzeneacetamides"