Bcl x protein. Medical search

A member of the Bcl-2 protein family and homologous partner of C-BCL-2 PROTO-ONCOGENE PROTEIN. It regulates the release of CYTOCHROME C and APOPTOSIS INDUCING FACTOR from the MITOCHONDRIA. Several isoforms of BCL2-associated X protein occur due to ALTERNATIVE SPLICING of the mRNA for this protein.

Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.

The type species of the genus ORTHOHEPADNAVIRUS which causes human HEPATITIS B and is also apparently a causal agent in human HEPATOCELLULAR CARCINOMA. The Dane particle is an intact hepatitis virion, named after its discoverer. Non-infectious spherical and tubular particles are also seen in the serum.

Antigens of the virion of the HEPATITIS B VIRUS or the Dane particle, its surface (HEPATITIS B SURFACE ANTIGENS), core (HEPATITIS B CORE ANTIGENS), and other associated antigens, including the HEPATITIS B E ANTIGENS.

A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.

Tumors or cancer of the LIVER.

Membrane proteins encoded by the BCL-2 GENES and serving as potent inhibitors of cell death by APOPTOSIS. The proteins are found on mitochondrial, microsomal, and NUCLEAR MEMBRANE sites within many cell types. Overexpression of bcl-2 proteins, due to a translocation of the gene, is associated with follicular lymphoma.

A family in the order MONONEGAVIRALES comprising one genus Bornavirus. This family has a unique form of mRNA processing: replication and transcription takes place in the nucleus.

The main structural component of the LIVER. They are specialized EPITHELIAL CELLS that are organized into interconnected plates called lobules.

Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.

Established cell cultures that have the potential to propagate indefinitely.

A human liver tumor cell line used to study a variety of liver-specific metabolic functions.

One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.

The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.

A RNA-binding protein that is found predominately in the CYTOPLASM. It helps regulate GENETIC TRANSLATION in NEURONS and is absent or under-expressed in FRAGILE X SYNDROME.

An ORTHOHEPADNAVIRUS causing chronic liver disease and hepatocellular carcinoma in woodchucks. It closely resembles the human hepatitis B virus.

Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.

Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.

INFLAMMATION of the LIVER in humans caused by a member of the ORTHOHEPADNAVIRUS genus, HEPATITIS B VIRUS. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.

A genus of Sciuridae consisting of 14 species. They are shortlegged, burrowing rodents which hibernate in winter.

The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.

The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.

Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.

A species in the genus Bornavirus, family BORNAVIRIDAE, causing a rare and usually fatal encephalitic disease in horses and other domestic animals and possibly deer. Its name derives from the city in Saxony where the condition was first described in 1894, but the disease occurs in Europe, N. Africa, and the Near East.

A cell line derived from cultured tumor cells.

A family of hepatotropic DNA viruses which contains double-stranded DNA genomes and causes hepatitis in humans and animals. There are two genera: AVIHEPADNAVIRUS and ORTHOHEPADNAVIRUS. Hepadnaviruses include HEPATITIS B VIRUS, duck hepatitis B virus (HEPATITIS B VIRUS, DUCK), heron hepatitis B virus, ground squirrel hepatitis virus, and woodchuck hepatitis B virus (HEPATITIS B VIRUS, WOODCHUCK).

DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.

An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.

Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.

The female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in human and other male-heterogametic species.

Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.

Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.

The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.

A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.

A secreted phospholipase A2 subtype that contains a interfacial-binding region with specificity for PHOSPHATIDYLCHOLINE. This enzyme group may play a role in eliciting ARACHIDONIC ACID release from intact cellular membranes and from LOW DENSITY LIPOPROTEINS. Members of this group bind specifically to PHOSPHOLIPASE A2 RECEPTORS.

Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.

Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.

RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.

The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.

A broad category of viral proteins that play indirect roles in the biological processes and activities of viruses. Included here are proteins that either regulate the expression of viral genes or are involved in modifying host cell functions. Many of the proteins in this category serve multiple functions.

Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.

Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.

The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.

Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.

The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.

Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.

Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.

Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)

Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.

The B-cell leukemia/lymphoma-2 genes, responsible for blocking apoptosis in normal cells, and associated with follicular lymphoma when overexpressed. Overexpression results from the t(14;18) translocation. The human c-bcl-2 gene is located at 18q24 on the long arm of chromosome 18.

Proteins found in any species of virus.

Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)

INFLAMMATION of the LIVER in humans caused by HEPATITIS B VIRUS lasting six months or more. It is primarily transmitted by parenteral exposure, such as transfusion of contaminated blood or blood products, but can also be transmitted via sexual or intimate personal contact.

The parts of a macromolecule that directly participate in its specific combination with another molecule.

A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.

The functional hereditary units of VIRUSES.

The hepatitis B antigen within the core of the Dane particle, the infectious hepatitis virion.

A large multisubunit complex that plays an important role in the degradation of most of the cytosolic and nuclear proteins in eukaryotic cells. It contains a 700-kDa catalytic sub-complex and two 700-kDa regulatory sub-complexes. The complex digests ubiquitinated proteins and protein activated via ornithine decarboxylase antizyme.

A member of the bcl-2 protein family that plays a role in the regulation of APOPTOSIS. Two major isoforms of the protein exist due to ALTERNATIVE SPLICING of the BCL2L1 mRNA and are referred to as Bcl-XS and Bcl-XL.

All of the processes involved in increasing CELL NUMBER including CELL DIVISION.

A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.

A transcription factor that regulates the expression of a large set of hepatic proteins including SERUM ALBUMIN; beta-fibrinogen; and ALPHA 1-ANTITRYPSIN. It is composed of hetero- or homo-dimers of HEPATOCYTE NUCLEAR FACTOR 1-ALPHA and HEPATOCYTE NUCLEAR FACTOR 1-BETA.

A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.

Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.

Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.

A family of intracellular signaling adaptor proteins that contain caspase activation and recruitment domains. Proteins that contain this domain play a role in APOPTOSIS-related signal transduction by associating with other CARD domain-containing members and in activating INITIATOR CASPASES that contain CARD domains within their N-terminal pro-domain region.

Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.

Deoxyribonucleic acid that makes up the genetic material of viruses.

A type of chromosome aberration characterized by CHROMOSOME BREAKAGE and transfer of the broken-off portion to another location, often to a different chromosome.

The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.

Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.

A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.

A group of heterogeneous lymphoid tumors generally expressing one or more B-cell antigens or representing malignant transformations of B-lymphocytes.

A short pro-domain caspase that plays an effector role in APOPTOSIS. It is activated by INITIATOR CASPASES such as CASPASE 9. Isoforms of this protein exist due to multiple alternative splicing of its MESSENGER RNA.

A family of intracellular CYSTEINE ENDOPEPTIDASES that play a role in regulating INFLAMMATION and APOPTOSIS. They specifically cleave peptides at a CYSTEINE amino acid that follows an ASPARTIC ACID residue. Caspases are activated by proteolytic cleavage of a precursor form to yield large and small subunits that form the enzyme. Since the cleavage site within precursors matches the specificity of caspases, sequential activation of precursors by activated caspases can occur.

Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.

A condition characterized genotypically by mutation of the distal end of the long arm of the X chromosome (at gene loci FRAXA or FRAXE) and phenotypically by cognitive impairment, hyperactivity, SEIZURES, language delay, and enlargement of the ears, head, and testes. INTELLECTUAL DISABILITY occurs in nearly all males and roughly 50% of females with the full mutation of FRAXA. (From Menkes, Textbook of Child Neurology, 5th ed, p226)

A specific pair of GROUP D CHROMOSOMES of the human chromosome classification.

The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.

The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.

Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.

The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.

Hepatocyte nuclear factor 1-alpha is a transcription factor found in the LIVER; PANCREAS; and KIDNEY that regulates HOMEOSTASIS of GLUCOSE.

Malignant lymphoma composed of large B lymphoid cells whose nuclear size can exceed normal macrophage nuclei, or more than twice the size of a normal lymphocyte. The pattern is predominantly diffuse. Most of these lymphomas represent the malignant counterpart of B-lymphocytes at midstage in the process of differentiation.

Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.

A member of the Bcl-2 protein family that reversibly binds MEMBRANES. It is a pro-apoptotic protein that is activated by caspase cleavage.

The activated center of a lymphoid follicle in secondary lymphoid tissue where B-LYMPHOCYTES are stimulated by antigens and helper T cells (T-LYMPHOCYTES, HELPER-INDUCER) are stimulated to generate memory cells.

Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.

Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.

A protein that has been shown to function as a calcium-regulated transcription factor as well as a substrate for depolarization-activated CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASES. This protein functions to integrate both calcium and cAMP signals.

A specific pair of GROUP E CHROMOSOMES of the human chromosome classification.

Histochemical localization of immunoreactive substances using labeled antibodies as reagents.

Storage-stable glycoprotein blood coagulation factor that can be activated to factor Xa by both the intrinsic and extrinsic pathways. A deficiency of factor X, sometimes called Stuart-Prower factor deficiency, may lead to a systemic coagulation disorder.

In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.

Proteins prepared by recombinant DNA technology.

Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.

The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.

Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.

Transport proteins that carry specific substances in the blood or across cell membranes.

Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill.

Eukaryotic cell line obtained in a quiescent or stationary phase which undergoes conversion to a state of unregulated growth in culture, resembling an in vitro tumor. It occurs spontaneously or through interaction with viruses, oncogenes, radiation, or drugs/chemicals.

ENDOPEPTIDASES which have a cysteine involved in the catalytic process. This group of enzymes is inactivated by CYSTEINE PROTEINASE INHIBITORS such as CYSTATINS and SULFHYDRYL REAGENTS.

Proteins obtained from foods. They are the main source of the ESSENTIAL AMINO ACIDS.

Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.

The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.

Elements of limited time intervals, contributing to particular results or situations.

The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.

Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.

Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.

Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.

The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)

The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.

The complete genetic complement contained in a DNA or RNA molecule in a virus.

The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.

Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.

A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.

A species of POLYOMAVIRUS originally isolated from Rhesus monkey kidney tissue. It produces malignancy in human and newborn hamster kidney cell cultures.

The rate dynamics in chemical or physical systems.

Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.

Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.

Mutant mice homozygous for the recessive gene "nude" which fail to develop a thymus. They are useful in tumor studies and studies on immune responses.

The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.

Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.

Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).

Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.

Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.

The termination of the cell's ability to carry out vital functions such as metabolism, growth, reproduction, responsiveness, and adaptability.

A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes

The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.

Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.

Malignant lymphoma in which the lymphomatous cells are clustered into identifiable nodules within the LYMPH NODES. The nodules resemble to some extent the GERMINAL CENTER of lymph node follicles and most likely represent neoplastic proliferation of lymph node-derived follicular center B-LYMPHOCYTES.

Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.

Ribonucleic acid that makes up the genetic material of viruses.

Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.

The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.

Members of the beta-globin family. In humans, two non-allelic types of gamma-globin - A gamma and G gamma are encoded in the beta-globin gene cluster on CHROMOSOME 11. Two gamma-globin chains combine with two ZETA-GLOBIN chains to form the embryonic hemoglobin Portland. Fetal HEMOGLOBIN F is formed from two gamma-globin chains combined with two ALPHA-GLOBIN chains.

A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.

A subtype of RETINOIC ACID RECEPTORS that are specific for 9-cis-retinoic acid which function as nuclear TRANSCRIPTION FACTORS that regulate multiple signaling pathways.

Extranodal lymphoma of lymphoid tissue associated with mucosa that is in contact with exogenous antigens. Many of the sites of these lymphomas, such as the stomach, salivary gland, and thyroid, are normally devoid of lymphoid tissue. They acquire mucosa-associated lymphoid tissue (MALT) type as a result of an immunologically mediated disorder.

A specific pair of human chromosomes in group A (CHROMOSOMES, HUMAN, 1-3) of the human chromosome classification.

A member of the myeloid leukemia factor (MLF) protein family with multiple alternatively spliced transcript variants encoding different protein isoforms. In hematopoietic cells, it is located mainly in the nucleus, and in non-hematopoietic cells, primarily in the cytoplasm with a punctate nuclear localization. MLF1 plays a role in cell cycle differentiation.

Genes and gene segments encoding the IMMUNOGLOBULIN HEAVY CHAINS. Gene segments of the heavy chain genes are symbolized V (variable), D (diversity), J (joining), and C (constant).

Lymphocyte progenitor cells that are restricted in their differentiation potential to the B lymphocyte lineage. The pro-B cell stage of B lymphocyte development precedes the pre-B cell stage.

A malignant disease of the B-LYMPHOCYTES in the bone marrow and/or blood.

The largest of polypeptide chains comprising immunoglobulins. They contain 450 to 600 amino acid residues per chain, and have molecular weights of 51-72 kDa.

Normal cellular genes homologous to viral oncogenes. The products of proto-oncogenes are important regulators of biological processes and appear to be involved in the events that serve to maintain the ordered procession through the cell cycle. Proto-oncogenes have names of the form c-onc.

The type species of the genus MICROVIRUS. A prototype of the small virulent DNA coliphages, it is composed of a single strand of supercoiled circular DNA, which on infection, is converted to a double-stranded replicative form by a host enzyme.

Family of retrovirus-associated DNA sequences (myc) originally isolated from an avian myelocytomatosis virus. The proto-oncogene myc (c-myc) codes for a nuclear protein which is involved in nucleic acid metabolism and in mediating the cellular response to growth factors. Truncation of the first exon, which appears to regulate c-myc expression, is crucial for tumorigenicity. The human c-myc gene is located at 8q24 on the long arm of chromosome 8.

An increase in circulating RETICULOCYTES, which is among the simplest and most reliable signs of accelerated ERYTHROCYTE production. Reticulocytosis occurs during active BLOOD regeneration (stimulation of red bone marrow) and in certain types of ANEMIA, particularly CONGENITAL HEMOLYTIC ANEMIA.

Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.

Lymphocyte progenitor cells that are restricted in their differentiation potential to the T lymphocyte lineage.

Enzyme that is a major constituent of kidney brush-border membranes and is also present to a lesser degree in the brain and other tissues. It preferentially catalyzes cleavage at the amino group of hydrophobic residues of the B-chain of insulin as well as opioid peptides and other biologically active peptides. The enzyme is inhibited primarily by EDTA, phosphoramidon, and thiorphan and is reactivated by zinc. Neprilysin is identical to common acute lymphoblastic leukemia antigen (CALLA Antigen), an important marker in the diagnosis of human acute lymphocytic leukemia. There is no relationship with CALLA PLANT.

A chronic leukemia characterized by abnormal B-lymphocytes and often generalized lymphadenopathy. In patients presenting predominately with blood and bone marrow involvement it is called chronic lymphocytic leukemia (CLL); in those predominately with enlarged lymph nodes it is called small lymphocytic lymphoma. These terms represent spectrums of the same disease.

A class of cell surface receptors for PURINES that prefer ATP or ADP over ADENOSINE. P2 purinergic receptors are widespread in the periphery and in the central and peripheral nervous system.

The major component of hemoglobin in the fetus. This HEMOGLOBIN has two alpha and two gamma polypeptide subunits in comparison to normal adult hemoglobin, which has two alpha and two beta polypeptide subunits. Fetal hemoglobin concentrations can be elevated (usually above 0.5%) in children and adults affected by LEUKEMIA and several types of ANEMIA.

The middle piece of the spermatozoon is a highly organized segment consisting of MITOCHONDRIA, the outer dense fibers and the core microtubular structure.

Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.

A cyclin D subtype which is regulated by GATA4 TRANSCRIPTION FACTOR. Experiments using KNOCKOUT MICE suggest a role for cyclin D2 in granulosa cell proliferation and gonadal development.

Cellular DNA-binding proteins encoded by the c-myc genes. They are normally involved in nucleic acid metabolism and in mediating the cellular response to growth factors. Elevated and deregulated (constitutive) expression of c-myc proteins can cause tumorigenesis.

A type of chromosomal aberration involving DNA BREAKS. Chromosome breakage can result in CHROMOSOMAL TRANSLOCATION; CHROMOSOME INVERSION; or SEQUENCE DELETION.

Ordered rearrangement of B-lymphocyte variable gene regions coding for the IMMUNOGLOBULIN CHAINS, thereby contributing to antibody diversity. It occurs during the differentiation of the IMMATURE B-LYMPHOCYTES.

A subclass of caspases that contain short pro-domain regions. They are activated by the proteolytic action of INITIATOR CASPASES. Once activated they cleave a variety of substrates that cause APOPTOSIS.

Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.

A family of transcription factors that share an N-terminal HELIX-TURN-HELIX MOTIF and bind INTERFERON-inducible promoters to control GENE expression. IRF proteins bind specific DNA sequences such as interferon-stimulated response elements, interferon regulatory elements, and the interferon consensus sequence.

A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.

A prediction of the probable outcome of a disease based on a individual's condition and the usual course of the disease as seen in similar situations.

Molecular products metabolized and secreted by neoplastic tissue and characterized biochemically in cells or body fluids. They are indicators of tumor stage and grade as well as useful for monitoring responses to treatment and predicting recurrence. Many chemical groups are represented including hormones, antigens, amino and nucleic acids, enzymes, polyamines, and specific cell membrane proteins and lipids.

Regions along polytene chromosomes that are uncondensed and active in DNA REPLICATION or RNA transcription (GENETIC TRANSCRIPTION).

Process of classifying cells of the immune system based on structural and functional differences. The process is commonly used to analyze and sort T-lymphocytes into subsets based on CD antigens by the technique of flow cytometry.

Blood coagulation disorder usually inherited as an autosomal recessive trait, though it can be acquired. It is characterized by defective activity in both the intrinsic and extrinsic pathways, impaired thromboplastin time, and impaired prothrombin consumption.

A nuclear co-repressor protein that shows specificity for RETINOIC ACID RECEPTORS and THYROID HORMONE RECEPTORS. The dissociation of this co-repressor from nuclear receptors is generally ligand-dependent, but can also occur by way of its phosphorylation by members of the MAP KINASE SIGNALING SYSTEM. The protein contains two nuclear receptor interaction domains and four repressor domains and is closely-related in structure to NUCLEAR RECEPTOR CO-REPRESSOR 1.

Antibodies obtained from a single clone of cells grown in mice or rats.

A cell line generated from human embryonic kidney cells that were transformed with human adenovirus type 5.

A CELL LINE derived from human T-CELL LEUKEMIA and used to determine the mechanism of differential susceptibility to anti-cancer drugs and radiation.

Genes encoding the different subunits of the IMMUNOGLOBULINS, for example the IMMUNOGLOBULIN LIGHT CHAIN GENES and the IMMUNOGLOBULIN HEAVY CHAIN GENES. The heavy and light immunoglobulin genes are present as gene segments in the germline cells. The completed genes are created when the segments are shuffled and assembled (B-LYMPHOCYTE GENE REARRANGEMENT) during B-LYMPHOCYTE maturation. The gene segments of the human light and heavy chain germline genes are symbolized V (variable), J (joining) and C (constant). The heavy chain germline genes have an additional segment D (diversity).

Ordered rearrangement of B-lymphocyte variable gene regions of the IMMUNOGLOBULIN HEAVY CHAINS, thereby contributing to antibody diversity. It occurs during the first stage of differentiation of the IMMATURE B-LYMPHOCYTES.

The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.

A member of the beta-globin family. In humans, delta-globin is encoded in the beta-globin gene cluster located on CHROMOSOME 11. Two delta-globin chains along with two alpha-globin chains form HEMOGLOBIN A2 which makes up about 3% of the HEMOGLOBIN in adults.

A protein serine-threonine kinase that catalyzes the PHOSPHORYLATION of I KAPPA B PROTEINS. This enzyme also activates the transcription factor NF-KAPPA B and is composed of alpha and beta catalytic subunits, which are protein kinases and gamma, a regulatory subunit.

The GENETIC TRANSLATION products of the fusion between an ONCOGENE and another gene. The latter may be of viral or cellular origin.

A general term for various neoplastic diseases of the lymphoid tissue.

Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.

Any of a group of malignant tumors of lymphoid tissue that differ from HODGKIN DISEASE, being more heterogeneous with respect to malignant cell lineage, clinical course, prognosis, and therapy. The only common feature among these tumors is the absence of giant REED-STERNBERG CELLS, a characteristic of Hodgkin's disease.

A leukemia/lymphoma found predominately in children and young adults and characterized LYMPHADENOPATHY and THYMUS GLAND involvement. It most frequently presents as a lymphoma, but a leukemic progression in the bone marrow is common.

A multi-domain mitochondrial membrane protein and member of the bcl-2 Protein family. Bak protein interacts with TUMOR SUPPRESSOR PROTEIN P53 and promotes APOPTOSIS.

DNA present in neoplastic tissue.

Members of the beta-globin family. In humans, they are encoded in a gene cluster on CHROMOSOME 11. They include epsilon-globin, gamma-globin, delta-globin and beta-globin. There is also a pseudogene of beta (theta-beta) in the gene cluster. Adult HEMOGLOBIN is comprised of two ALPHA-GLOBIN chains and two beta-globin chains.

A group of compounds that contain the structure SO2NH2.

A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.

Genes whose gain-of-function alterations lead to NEOPLASTIC CELL TRANSFORMATION. They include, for example, genes for activators or stimulators of CELL PROLIFERATION such as growth factors, growth factor receptors, protein kinases, signal transducers, nuclear phosphoproteins, and transcription factors. A prefix of "v-" before oncogene symbols indicates oncogenes captured and transmitted by RETROVIRUSES; the prefix "c-" before the gene symbol of an oncogene indicates it is the cellular homolog (PROTO-ONCOGENES) of a v-oncogene.

A technique for identifying specific DNA sequences that are bound, in vivo, to proteins of interest. It involves formaldehyde fixation of CHROMATIN to crosslink the DNA-BINDING PROTEINS to the DNA. After shearing the DNA into small fragments, specific DNA-protein complexes are isolated by immunoprecipitation with protein-specific ANTIBODIES. Then, the DNA isolated from the complex can be identified by PCR amplification and sequencing.

A short pro-domain caspase that plays an effector role in APOPTOSIS. It is activated by INITIATOR CASPASES such as CASPASE 3 and CASPASE 10. Several isoforms of this protein exist due to multiple alternative splicing of its MESSENGER RNA.

Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.

Motifs in DNA- and RNA-binding proteins whose amino acids are folded into a single structural unit around a zinc atom. In the classic zinc finger, one zinc atom is bound to two cysteines and two histidines. In between the cysteines and histidines are 12 residues which form a DNA binding fingertip. By variations in the composition of the sequences in the fingertip and the number and spacing of tandem repeats of the motif, zinc fingers can form a large number of different sequence specific binding sites.

CXCR receptors isolated initially from BURKITT LYMPHOMA cells. CXCR5 receptors are expressed on mature, recirculating B-LYMPHOCYTES and are specific for CHEMOKINE CXCL13.

Substances that inhibit or prevent the proliferation of NEOPLASMS.

A pro-apoptotic protein and member of the Bcl-2 protein family that is regulated by PHOSPHORYLATION. Unphosphorylated Bad protein inhibits the activity of BCL-XL PROTEIN.

Bcl-2 regulates amplification of caspase activation by cytochrome c. (1/2563)

Caspases, a family of specific proteases, have central roles in apoptosis [1]. Caspase activation in response to diverse apoptotic stimuli involves the relocalisation of cytochrome c from mitochondria to the cytoplasm where it stimulates the proteolytic processing of caspase precursors. Cytochrome c release is controlled by members of the Bcl-2 family of apoptosis regulators [2] [3]. The anti-apoptotic members Bcl-2 and Bcl-xL may also control caspase activation independently of cytochrome c relocalisation or may inhibit a positive feedback mechanism [4] [5] [6] [7]. Here, we investigate the role of Bcl-2 family proteins in the regulation of caspase activation using a model cell-free system. We found that Bcl-2 and Bcl-xL set a threshold in the amount of cytochrome c required to activate caspases, even in soluble extracts lacking mitochondria. Addition of dATP (which stimulates the procaspase-processing factor Apaf-1 [8] [9]) overcame inhibition of caspase activation by Bcl-2, but did not prevent the control of cytochrome c release from mitochondria by Bcl-2. Cytochrome c release was accelerated by active caspase-3 and this positive feedback was negatively regulated by Bcl-2. These results provide evidence for a mechanism to amplify caspase activation that is suppressed at several distinct steps by Bcl-2, even after cytochrome c is released from mitochondria. (+info)

Bcl-2 and Bcl-XL serve an anti-inflammatory function in endothelial cells through inhibition of NF-kappaB. (2/2563)

To maintain the integrity of the vascular barrier, endothelial cells (EC) are resistant to cell death. The molecular basis of this resistance may be explained by the function of antiapoptotic genes such as bcl family members. Overexpression of Bcl-2 or Bcl-XL protects EC from tumor necrosis factor (TNF)-mediated apoptosis. In addition, Bcl-2 or Bcl-XL inhibits activation of NF-kappaB and thus upregulation of proinflammatory genes. Bcl-2-mediated inhibition of NF-kappaB in EC occurs upstream of IkappaBalpha degradation without affecting p65-mediated transactivation. Overexpression of bcl genes in EC does not affect other transcription factors. Using deletion mutants of Bcl-2, the NF-kappaB inhibitory function of Bcl-2 was mapped to bcl homology domains BH2 and BH4, whereas all BH domains were required for the antiapoptotic function. These data suggest that Bcl-2 and Bcl-XL belong to a cytoprotective response that counteracts proapoptotic and proinflammatory insults and restores the physiological anti-inflammatory phenotype to the EC. By inhibiting NF-kappaB without sensitizing the cells (as with IkappaBalpha) to TNF-mediated apoptosis, Bcl-2 and Bcl-XL are prime candidates for genetic engineering of EC in pathological conditions where EC loss and unfettered activation are undesirable. (+info)

Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. (3/2563)

Interleukin 6 (IL-6) is the major survival factor for myeloma tumor cells and induces signaling through the STAT proteins. We report that one STAT family member, Stat3, is constitutively activated in bone marrow mononuclear cells from patients with multiple myeloma and in the IL-6-dependent human myeloma cell line U266. Moreover, U266 cells are inherently resistant to Fas-mediated apoptosis and express high levels of the antiapoptotic protein Bcl-xL. Blocking IL-6 receptor signaling from Janus kinases to the Stat3 protein inhibits Bcl-xL expression and induces apoptosis, demonstrating that Stat3 signaling is essential for the survival of myeloma tumor cells. These findings provide evidence that constitutively activated Stat3 signaling contributes to the pathogenesis of multiple myeloma by preventing apoptosis. (+info)

In vitro induction of activation-induced cell death in lymphocytes from chronic periodontal lesions by exogenous Fas ligand. (4/2563)

Periodontitis is a chronic inflammatory disease which gradually destroys the supporting tissues of the teeth, leading to tooth loss in adults. The lesions are characterized by a persistence of inflammatory cells in gingival and periodontal connective tissues. To understand what mechanisms are involved in the establishment of chronic lesions, we hypothesized that infiltrating lymphocytes might be resistant to apoptosis. However, both Bcl-2 and Bcl-xL were weakly detected in lymphocytes from the lesions, compared with those from peripheral blood, suggesting that these cells are susceptible to apoptosis. Nevertheless, very few apoptotic cells were observed in tissue sections from the lesions. Lymphocytes from the lesions expressed mRNA encoding Fas, whereas Fas-ligand mRNA was very weakly expressed in lymphocytes from the lesions and in periodontal tissues. Since the results indicated that lymphocytes in the lesions might be susceptible to Fas-mediated apoptosis but lack the death signal, we next investigated if these lymphocytes actually undergo apoptosis by the addition of anti-Fas antibodies in vitro. Fas-positive lymphocytes from the lesions underwent apoptosis by these antibodies, but Fas-negative lymphocytes and Fas-positive peripheral lymphocytes did not undergo apoptosis by these antibodies. These results indicate that lymphocytes in the lesions are susceptible to activation-induced cell death and are induced to die by apoptosis after the addition of exogenous Fas ligand. (+info)

Control of apoptosis in Epstein Barr virus-positive nasopharyngeal carcinoma cells: opposite effects of CD95 and CD40 stimulation. (5/2563)

The expression and function of CD95 and CD40 were investigated in malignant cells from EBV-positive undifferentiated nasopharyngeal carcinomas (NPCs). Large amounts of CD95 and CD40 expression were detected in 15 of 16 EBV-positive NPC specimens. In contrast, CD95 was not detected in two biopsies from patients with EBV-negative differentiated NPCs. We tested whether the CD95 apoptotic pathway was functional in NPC cells by treating two EBV-positive NPC tumor lines in vitro with a CD95 agonist. In both cases, NPC cells were extremely susceptible to CD95-mediated apoptosis, despite strong constitutive expression of Bcl-x. Combined CD40 and CD95 stimulation was used to investigate the possible anti-apoptotic activity mediated by CD40. The CD40 receptor was activated by incubating NPC cells with murine L cells producing CD154, the CD40 ligand. This treatment resulted in a strong inhibition of CD95-related cytotoxicity. Such an anti-apoptotic effect of CD40 is well known for B lymphocytes, but has not previously been reported for epithelial cells. These data suggest that NPC tumor-infiltrating lymphocytes, which often produce the CD40 ligand in situ, may increase the survival of malignant cells, thereby enhancing tumor growth in patients. (+info)

Role of cytokine signaling molecules in erythroid differentiation of mouse fetal liver hematopoietic cells: functional analysis of signaling molecules by retrovirus-mediated expression. (6/2563)

Erythropoietin (EPO) and its cell surface receptor (EPOR) play a central role in proliferation, differentiation, and survival of erythroid progenitors. Signals induced by EPO have been studied extensively by using erythroid as well as nonerythroid cell lines, and various controversial results have been reported as to the role of signaling molecules in erythroid differentiation. Here we describe a novel approach to analyze the EPO signaling by using primary mouse fetal liver hematopoietic cells to avoid possible artifacts due to established cell lines. Our strategy is based on high-titer retrovirus vectors with a bicistronic expression system consisting of an internal ribosome entry site (IRES) and green fluorescent protein (GFP). By placing the cDNA for a signaling molecule in front of IRES-GFP, virus-infected cells can be viably sorted by fluorescence-activated cell sorter, and the effect of expression of the signaling molecule can be assessed. By using this system, expression of cell-survival genes such as Bcl-2 and Bcl-XL was found to enhance erythroid colony formation from colony-forming unit-erythroid (CFU-E) in response to EPO. However, their expression was not sufficient for erythroid colony formation from CFU-E alone, indicating that EPO induces signals for erythroid differentiation. To examine the role of EPOR tyrosine residues in erythroid differentiation, we introduced a chimeric EGFR-EPOR receptor, which has the extracellular domain of the EGF receptor and the intracellular domain of the EPOR, as well as a mutant EGFR-EPOR in which all the cytoplasmic tyrosine residues are replaced with phenylalanine, and found that tyrosine residues of EPOR are essential for erythroid colony formation from CFU-E. We further analyzed the function of the downstream signaling molecules by expressing modified signaling molecules and found that both JAK2/STAT5 and Ras, two major signaling pathways activated by EPOR, are involved in full erythroid differentiation. (+info)

Rubella virus-induced apoptosis varies among cell lines and is modulated by Bcl-XL and caspase inhibitors. (7/2563)

Rubella virus (RV) causes multisystem birth defects in the fetuses of infected women. To investigate the cellular basis of this pathology, we examined the cytopathic effect of RV in three permissive cell lines: Vero 76, RK13, and BHK21. Electron microscopy and the TUNEL assay showed that the cytopathic effect resulted from RV-induced programmed cell death (apoptosis) in all three cell lines, but the extent of apoptosis varied among these cells. At 48 h postinfection, the RK13 cell line showed the greatest number of apoptotic cells, the Vero 76 cell line was approximately 3-fold less, and BHK21 had very few. An increased multiplicity of infection and longer time postinfection were required for the BHK21 cell line to reach the level of apoptotic cells in Vero 76 at 48 h. Purified RV induced apoptosis in a dose-dependent fashion, but not UV-inactivated RV or virus-depleted culture supernatant. Specific inhibitors of the apoptosis-specific proteases caspases reduced RV-induced apoptosis and led to higher levels of RV components in infected cells. To address the role of regulatory proteins in RV-induced apoptosis, the antiapoptotic gene Bcl-2 or Bcl-XL was transfected into RK13 cells. Although a high level of Bcl-2 family proteins was expressed, no protection was observed from apoptosis induced by RV, Sindbis virus, or staurosporine in RK13 cells. In BHK21 cells, however, increased expression of Bcl-XL protected cells from apoptosis. The observed variability in apoptotic response to RV of these cell lines demonstrates that programmed cell death is dependent on the unique properties of each cell and may be indicative of how selective organ damage occurs in a congenital rubella syndrome fetus. (+info)

Bcl-2 overexpression results in reciprocal downregulation of Bcl-X(L) and sensitizes human testicular germ cell tumours to chemotherapy-induced apoptosis. (8/2563)

Testicular germ cell tumours are hypersentive to chemotherapy and cell lines derived from these tumours are chemosensitive in vitro. We have previously shown that these cell lines express undetectable levels of the suppressor of apoptosis Bcl-2 and relatively high levels of the apoptosis inducer Bax (Chresta et al., 1996). To determine whether the absence of Bcl-2 in these cell lines makes them highly susceptible to drug-induced apoptosis, Bcl-2 was expressed ectopically in the 833K testicular germ cell tumour cell line. Stable overexpressing clones were isolated and three clones were studied further. Surprisingly, Bcl-2 overexpressing cells were sensitized to chemotherapy-induced apoptosis compared to the parental and vector control cells. Analysis of potential mechanisms of sensitization revealed there was a reciprocal downregulation of the endogenously expressed Bcl-X(L) in the Bcl-2 overexpressing clones. Downregulation of Bcl-X(L) to the same extent using antisense oligonucleotides enhanced etoposide-induced apoptosis by twofold. Our results indicate that Bcl-2 and Bcl-X(L) have different abilities to protect against chemotherapy-induced apoptosis in testicular germ cell tumours. In contrast to findings in some tumour cell types, Bcl-2 did not act as a gatekeeper to prevent entry of p53 to the nucleus. (+info)

There are several risk factors for developing HCC, including:

* Cirrhosis, which can be caused by heavy alcohol consumption, viral hepatitis (such as hepatitis B and C), or fatty liver disease
* Family history of liver disease
* Chronic obstructive pulmonary disease (COPD)
* Diabetes
* Obesity

HCC can be challenging to diagnose, as the symptoms are non-specific and can be similar to those of other conditions. However, some common symptoms of HCC include:

* Yellowing of the skin and eyes (jaundice)
* Fatigue
* Loss of appetite
* Abdominal pain or discomfort
* Weight loss

If HCC is suspected, a doctor may perform several tests to confirm the diagnosis, including:

* Imaging tests, such as ultrasound, CT scan, or MRI, to look for tumors in the liver
* Blood tests to check for liver function and detect certain substances that are produced by the liver
* Biopsy, which involves removing a small sample of tissue from the liver to examine under a microscope

Once HCC is diagnosed, treatment options will depend on several factors, including the stage and location of the cancer, the patient's overall health, and their personal preferences. Treatment options may include:

* Surgery to remove the tumor or parts of the liver
* Ablation, which involves destroying the cancer cells using heat or cold
* Chemoembolization, which involves injecting chemotherapy drugs into the hepatic artery to reach the cancer cells
* Targeted therapy, which uses drugs or other substances to target specific molecules that are involved in the growth and spread of the cancer

Overall, the prognosis for HCC is poor, with a 5-year survival rate of approximately 20%. However, early detection and treatment can improve outcomes. It is important for individuals at high risk for HCC to be monitored regularly by a healthcare provider, and to seek medical attention if they experience any symptoms.

Liver neoplasms, also known as liver tumors or hepatic tumors, are abnormal growths of tissue in the liver. These growths can be benign (non-cancerous) or malignant (cancerous). Malignant liver tumors can be primary, meaning they originate in the liver, or metastatic, meaning they spread to the liver from another part of the body.

There are several types of liver neoplasms, including:

1. Hepatocellular carcinoma (HCC): This is the most common type of primary liver cancer and arises from the main cells of the liver (hepatocytes). HCC is often associated with cirrhosis and can be caused by viral hepatitis or alcohol abuse.
2. Cholangiocarcinoma: This type of cancer arises from the cells lining the bile ducts within the liver (cholangiocytes). Cholangiocarcinoma is rare and often diagnosed at an advanced stage.
3. Hemangiosarcoma: This is a rare type of cancer that originates in the blood vessels of the liver. It is most commonly seen in dogs but can also occur in humans.
4. Fibromas: These are benign tumors that arise from the connective tissue of the liver (fibrocytes). Fibromas are usually small and do not spread to other parts of the body.
5. Adenomas: These are benign tumors that arise from the glandular cells of the liver (hepatocytes). Adenomas are usually small and do not spread to other parts of the body.

The symptoms of liver neoplasms vary depending on their size, location, and whether they are benign or malignant. Common symptoms include abdominal pain, fatigue, weight loss, and jaundice (yellowing of the skin and eyes). Diagnosis is typically made through a combination of imaging tests such as CT scans, MRI scans, and ultrasound, and a biopsy to confirm the presence of cancer cells.

Treatment options for liver neoplasms depend on the type, size, location, and stage of the tumor, as well as the patient's overall health. Surgery may be an option for some patients with small, localized tumors, while others may require chemotherapy or radiation therapy to shrink the tumor before surgery can be performed. In some cases, liver transplantation may be necessary.

Prognosis for liver neoplasms varies depending on the type and stage of the cancer. In general, early detection and treatment improve the prognosis, while advanced-stage disease is associated with a poorer prognosis.

The symptoms of hepatitis B can range from mild to severe and may include fatigue, loss of appetite, nausea, vomiting, abdominal pain, dark urine, pale stools, joint pain, and jaundice (yellowing of the skin and eyes). In some cases, hepatitis B can be asymptomatic, meaning that individuals may not experience any symptoms at all.

Hepatitis B is diagnosed through blood tests that detect the presence of HBV antigens or antibodies in the body. Treatment for acute hepatitis B typically involves rest, hydration, and medication to manage symptoms, while chronic hepatitis B may require ongoing therapy with antiviral drugs to suppress the virus and prevent liver damage.

Preventive measures for hepatitis B include vaccination, which is recommended for individuals at high risk of infection, such as healthcare workers, sexually active individuals, and those traveling to areas where HBV is common. In addition, safe sex practices, avoiding sharing of needles or other bodily fluids, and proper sterilization of medical equipment can help reduce the risk of transmission.

Overall, hepatitis B is a serious infection that can have long-term consequences for liver health, and it is important to take preventive measures and seek medical attention if symptoms persist or worsen over time.

A persistent infection with the hepatitis B virus (HBV) that can lead to liver cirrhosis and hepatocellular carcinoma. HBV is a bloodborne pathogen and can be spread through contact with infected blood, sexual contact, or vertical transmission from mother to child during childbirth.

Chronic hepatitis B is characterized by the presence of HBsAg in the blood for more than 6 months, indicating that the virus is still present in the liver. The disease can be asymptomatic or symptomatic, with symptoms such as fatigue, malaise, loss of appetite, nausea, vomiting, joint pain, and jaundice.

Chronic hepatitis B is diagnosed through serological tests such as HBsAg, anti-HBc, and HBV DNA. Treatment options include interferon alpha and nucleos(t)ide analogues, which can slow the progression of the disease but do not cure it.

Prevention strategies for chronic hepatitis B include vaccination with hepatitis B vaccine, which is effective in preventing acute and chronic HBV infection, as well as avoidance of risky behaviors such as unprotected sex and sharing of needles.

https://www.medicinenet.com › Medical Dictionary › G

A genetic translocation is a change in the number or arrangement of the chromosomes in a cell. It occurs when a portion of one chromosome breaks off and attaches to another chromosome. This can result in a gain or loss of genetic material, which can have significant effects on the individual.

Genetic Translocation | Definition & Facts | Britannica
https://www.britannica.com › science › Genetic-tr...

Genetic translocation, also called chromosomal translocation, a type of chromosomal aberration in which a portion of one chromosome breaks off and attaches to another chromosome. This can result in a gain or loss of genetic material. Genetic translocations are often found in cancer cells and may play a role in the development and progression of cancer.

Translocation, Genetic | health Encyclopedia - UPMC
https://www.upmc.com › health-library › gene...

A genetic translocation is a change in the number or arrangement of the chromosomes in a cell. It occurs when a portion of one chromosome breaks off and attaches to another chromosome. This can result in a gain or loss of genetic material, which can have significant effects on the individual.

Genetic Translocation | Genetics Home Reference - NIH
https://ghr.nlm.nih.gov › condition › ge...

A genetic translocation is a change in the number or arrangement of the chromosomes in a cell. It occurs when a portion of one chromosome breaks off and attaches to another chromosome. This can result in a gain or loss of genetic material, which can have significant effects on the individual.

In conclusion, Genetic Translocation is an abnormality in the number or arrangement of chromosomes in a cell. It occurs when a portion of one chromosome breaks off and attaches to another chromosome, resulting in a gain or loss of genetic material that can have significant effects on the individual.

There are several subtypes of lymphoma, B-cell, including:

1. Diffuse large B-cell lymphoma (DLBCL): This is the most common type of B-cell lymphoma and typically affects older adults.
2. Follicular lymphoma: This type of lymphoma grows slowly and often does not require treatment for several years.
3. Marginal zone lymphoma: This type of lymphoma develops in the marginal zone of the spleen or other lymphoid tissues.
4. Hodgkin lymphoma: This is a type of B-cell lymphoma that is characterized by the presence of Reed-Sternberg cells, which are abnormal cells that can be identified under a microscope.

The symptoms of lymphoma, B-cell can vary depending on the subtype and the location of the tumor. Common symptoms include swollen lymph nodes, fatigue, fever, night sweats, and weight loss.

Treatment for lymphoma, B-cell usually involves chemotherapy, which is a type of cancer treatment that uses drugs to kill cancer cells. Radiation therapy may also be used in some cases. In some cases, bone marrow or stem cell transplantation may be recommended.

Prognosis for lymphoma, B-cell depends on the subtype and the stage of the disease at the time of diagnosis. In general, the prognosis is good for patients with early-stage disease, but the cancer can be more difficult to treat if it has spread to other parts of the body.

Prevention of lymphoma, B-cell is not possible, as the exact cause of the disease is not known. However, avoiding exposure to certain risk factors, such as viral infections and pesticides, may help reduce the risk of developing the disease. Early detection and treatment can also improve outcomes for patients with lymphoma, B-cell.

Lymphoma, B-cell is a type of cancer that affects the immune system and can be treated with chemotherapy and other therapies. The prognosis varies depending on the subtype and stage of the disease at diagnosis. Prevention is not possible, but early detection and treatment can improve outcomes for patients with this condition.

People with Fragile X syndrome may have intellectual disability, developmental delays, and various physical characteristics such as large ears, long face, and joint hypermobility. They may also experience behavioral problems such as anxiety, hyperactivity, and sensory sensitivities. In addition, they are at increased risk for seizures, sleep disturbances, and other health issues.

Fragile X syndrome is usually diagnosed through a combination of clinical evaluation, genetic testing, and molecular analysis. There is no cure for the condition, but various interventions such as behavioral therapy, speech and language therapy, occupational therapy, and medications can help manage its symptoms.

Prevention of Fragile X syndrome is not possible, as it is a genetic disorder caused by an expansion of CGG repeats in the FMR1 gene. However, early identification and intervention can improve outcomes for individuals with the condition.

Overall, Fragile X syndrome is a complex and multifaceted condition that requires comprehensive and individualized care to help individuals with the condition reach their full potential.

DLBCL is characterized by the rapid growth of malignant B cells in the lymph nodes, spleen, bone marrow, and other organs. These cells can also spread to other parts of the body through the bloodstream or lymphatic system. The disease is often aggressive and can progress quickly without treatment.

The symptoms of DLBCL vary depending on the location and extent of the disease, but they may include:

* Swollen lymph nodes in the neck, underarm, or groin
* Fever
* Fatigue
* Night sweats
* Weight loss
* Abdominal pain or discomfort
* Itching

The diagnosis of DLBCL is based on a combination of physical examination findings, imaging studies (such as CT scans or PET scans), and biopsy results. Treatment typically involves a combination of chemotherapy, radiation therapy, and in some cases, immunotherapy or targeted therapy. The prognosis for DLBCL has improved significantly over the past few decades, with overall survival rates ranging from 60% to 80%, depending on the stage and other factors.

Explanation: Neoplastic cell transformation is a complex process that involves multiple steps and can occur as a result of genetic mutations, environmental factors, or a combination of both. The process typically begins with a series of subtle changes in the DNA of individual cells, which can lead to the loss of normal cellular functions and the acquisition of abnormal growth and reproduction patterns.

Over time, these transformed cells can accumulate further mutations that allow them to survive and proliferate despite adverse conditions. As the transformed cells continue to divide and grow, they can eventually form a tumor, which is a mass of abnormal cells that can invade and damage surrounding tissues.

In some cases, cancer cells can also break away from the primary tumor and travel through the bloodstream or lymphatic system to other parts of the body, where they can establish new tumors. This process, known as metastasis, is a major cause of death in many types of cancer.

It's worth noting that not all transformed cells will become cancerous. Some forms of cellular transformation, such as those that occur during embryonic development or tissue regeneration, are normal and necessary for the proper functioning of the body. However, when these transformations occur in adult tissues, they can be a sign of cancer.

See also: Cancer, Tumor

Word count: 190

1) They share similarities with humans: Many animal species share similar biological and physiological characteristics with humans, making them useful for studying human diseases. For example, mice and rats are often used to study diseases such as diabetes, heart disease, and cancer because they have similar metabolic and cardiovascular systems to humans.

2) They can be genetically manipulated: Animal disease models can be genetically engineered to develop specific diseases or to model human genetic disorders. This allows researchers to study the progression of the disease and test potential treatments in a controlled environment.

3) They can be used to test drugs and therapies: Before new drugs or therapies are tested in humans, they are often first tested in animal models of disease. This allows researchers to assess the safety and efficacy of the treatment before moving on to human clinical trials.

4) They can provide insights into disease mechanisms: Studying disease models in animals can provide valuable insights into the underlying mechanisms of a particular disease. This information can then be used to develop new treatments or improve existing ones.

5) Reduces the need for human testing: Using animal disease models reduces the need for human testing, which can be time-consuming, expensive, and ethically challenging. However, it is important to note that animal models are not perfect substitutes for human subjects, and results obtained from animal studies may not always translate to humans.

6) They can be used to study infectious diseases: Animal disease models can be used to study infectious diseases such as HIV, TB, and malaria. These models allow researchers to understand how the disease is transmitted, how it progresses, and how it responds to treatment.

7) They can be used to study complex diseases: Animal disease models can be used to study complex diseases such as cancer, diabetes, and heart disease. These models allow researchers to understand the underlying mechanisms of the disease and test potential treatments.

8) They are cost-effective: Animal disease models are often less expensive than human clinical trials, making them a cost-effective way to conduct research.

9) They can be used to study drug delivery: Animal disease models can be used to study drug delivery and pharmacokinetics, which is important for developing new drugs and drug delivery systems.

10) They can be used to study aging: Animal disease models can be used to study the aging process and age-related diseases such as Alzheimer's and Parkinson's. This allows researchers to understand how aging contributes to disease and develop potential treatments.

Source: National Cancer Institute (www.cancer.gov)

The above definition is given by the National Cancer Institute, which is an authoritative source of information on cancer and lymphoma. It provides a concise overview of follicular lymphoma, including its characteristics, diagnosis, treatment options, and prognosis. The definition includes key terms such as "slow-growing," "B cells," "lymph nodes," and "five-year survival rate," which are important to understand when discussing this type of cancer.

Symptoms of this type of cancer can include swelling of the lymph nodes, fatigue, fever, night sweats, and weight loss. Treatment options for marginal zone B-cell lymphoma depend on the stage and location of the cancer and may involve a combination of chemotherapy, immunotherapy, and/or targeted therapy.

The prognosis for this type of cancer is generally good if it is diagnosed early and treated appropriately. However, in some cases, it can be more aggressive and difficult to treat, and the prognosis may be poorer.

There are several subtypes of B-cell leukemia, including:

1. Chronic lymphocytic leukemia (CLL): This is the most common type of B-cell leukemia, and it typically affects older adults. CLL is a slow-growing cancer that can progress over time.
2. Acute lymphoblastic leukemia (ALL): This is a fast-growing and aggressive form of B-cell leukemia that can affect people of all ages. ALL is often treated with chemotherapy and sometimes with bone marrow transplantation.
3. Burkitt lymphoma: This is an aggressive form of B-cell leukemia that typically affects older adults in Africa and Asia. Burkitt lymphoma can be treated with chemotherapy and sometimes with bone marrow transplantation.
4. Hairy cell leukemia: This is a rare type of B-cell leukemia that is characterized by the presence of hair-like projections on the surface of cancer cells. Hairy cell leukemia can be treated with chemotherapy and sometimes with bone marrow transplantation.

The diagnosis of B-cell leukemia is based on a combination of physical examination, medical history, laboratory tests, and biopsies. Treatment options for B-cell leukemia include chemotherapy, bone marrow transplantation, and in some cases, targeted therapy with drugs that specifically target cancer cells. The prognosis for B-cell leukemia varies depending on the subtype of the disease and the patient's overall health.

The term "reticulocytosis" is derived from the Latin words "reticulum," meaning net-like, and "cytosis," meaning the condition of cells. This refers to the characteristic net-like appearance of reticulocytes under a microscope.

There are several possible causes of reticulocytosis, including:

1. Inherited disorders such as hereditary elliptocytosis, hereditary spherocytosis, and pyruvate kinase (PK) deficiency.
2. Acquired disorders such as hemolytic anemia, thalassemia, and sickle cell disease.
3. Infections such as malaria, dengue fever, and babesiosis.
4. Medications such as antibiotics, chemotherapy drugs, and anti-inflammatory medications.
5. Other conditions such as chronic kidney disease, liver disease, and autoimmune disorders.

Reticulocytosis can be diagnosed through a blood test called a complete blood count (CBC) or a reticulocyte count. Treatment depends on the underlying cause of the condition. In some cases, no treatment may be necessary, while in other cases, medication or blood transfusions may be required.

In LLCB, the B cells undergo a mutation that causes them to become cancerous and multiply rapidly. This can lead to an overproduction of these cells in the bone marrow, causing the bone marrow to become crowded and unable to produce healthy red blood cells, platelets, and white blood cells.

LLCB is typically a slow-growing cancer, and it can take years for symptoms to develop. However, as the cancer progresses, it can lead to a range of symptoms including fatigue, weakness, weight loss, fever, night sweats, and swollen lymph nodes.

LLCB is typically diagnosed through a combination of physical examination, blood tests, bone marrow biopsy, and imaging studies such as X-rays or CT scans. Treatment options for LLCB include chemotherapy, radiation therapy, and in some cases, stem cell transplantation.

Overall, while LLCB is a serious condition, it is typically slow-growing and can be managed with appropriate treatment. With current treatments, many people with LLCB can achieve long-term remission and a good quality of life.

When a chromosome breaks, it can lead to genetic instability and potentially contribute to the development of diseases such as cancer. Chromosome breakage can also result in the loss or gain of genetic material, which can further disrupt normal cellular function and increase the risk of disease.

There are several types of chromosome breakage, including:

1. Chromosomal aberrations: These occur when there is a change in the number or structure of the chromosomes, such as an extra copy of a chromosome (aneuploidy) or a break in a chromosome.
2. Genomic instability: This refers to the presence of errors in the genetic material that can lead to changes in the function of cells and tissues.
3. Chromosomal fragile sites: These are specific regions of the chromosomes that are more prone to breakage than other regions.
4. Telomere shortening: Telomeres are the protective caps at the ends of the chromosomes, and their shortening can lead to chromosome breakage and genetic instability.

Chromosome breakage can be detected through cytogenetic analysis, which involves staining the cells with dyes to visualize the chromosomes and look for any abnormalities. The detection of chromosome breakage can help diagnose certain diseases, such as cancer, and can also provide information about the risk of disease progression.

In summary, chromosome breakage is a type of genetic alteration that can occur as a result of various factors, including exposure to radiation or chemicals, errors during cell division, or aging. It can lead to genetic instability and increase the risk of diseases such as cancer. Detection of chromosome breakage through cytogenetic analysis can help diagnose certain diseases and provide information about the risk of disease progression.

Factor X deficiency can be inherited or acquired, and it can have mild to severe effects on the body. People with factor X deficiency may experience prolonged bleeding after an injury or surgery, easy bruising, and frequent nosebleeds. In severe cases, factor X deficiency can lead to spontaneous bleeding, especially in the joints and internal organs.

There are two types of factor X deficiency:

1. Classic factor X deficiency: This is the most common type of factor X deficiency and is caused by a mutation in the gene that codes for factor X. It is usually inherited in an autosomal recessive pattern, which means that the child must inherit two copies of the mutated gene, one from each parent, to develop the condition.
2. Acquired factor X deficiency: This type of factor X deficiency can occur due to certain medical conditions, such as liver disease, vitamin K deficiency, or exposure to certain medications. It can also occur in people who have a high risk of bleeding, such as those with hemophilia.

Treatment for factor X deficiency typically involves replacing the missing clotting factor through infusions of factor X concentrate. In some cases, medications that help the body produce more factor X may also be used. People with factor X deficiency may need to receive regular infusions to maintain adequate levels of factor X in their blood.

Overall, factor X deficiency is a rare but potentially serious condition that can affect the body's ability to form blood clots and stop bleeding. With proper diagnosis and treatment, however, most people with factor X deficiency can lead normal lives.

There are several types of lymphoma, including:

1. Hodgkin lymphoma: This is a type of lymphoma that originates in the white blood cells called Reed-Sternberg cells. It is characterized by the presence of giant cells with multiple nucleoli.
2. Non-Hodgkin lymphoma (NHL): This is a type of lymphoma that does not meet the criteria for Hodgkin lymphoma. There are many subtypes of NHL, each with its own unique characteristics and behaviors.
3. Cutaneous lymphoma: This type of lymphoma affects the skin and can take several forms, including cutaneous B-cell lymphoma and cutaneous T-cell lymphoma.
4. Primary central nervous system (CNS) lymphoma: This is a rare type of lymphoma that develops in the brain or spinal cord.
5. Post-transplantation lymphoproliferative disorder (PTLD): This is a type of lymphoma that develops in people who have undergone an organ transplant, often as a result of immunosuppressive therapy.

The symptoms of lymphoma can vary depending on the type and location of the cancer. Some common symptoms include:

* Swollen lymph nodes
* Fever
* Fatigue
* Weight loss
* Night sweats
* Itching

Lymphoma is diagnosed through a combination of physical examination, imaging tests (such as CT scans or PET scans), and biopsies. Treatment options for lymphoma depend on the type and stage of the cancer, and may include chemotherapy, radiation therapy, immunotherapy, or stem cell transplantation.

Overall, lymphoma is a complex and diverse group of cancers that can affect people of all ages and backgrounds. While it can be challenging to diagnose and treat, advances in medical technology and research have improved the outlook for many patients with lymphoma.

There are several subtypes of NHL, including:

1. B-cell lymphomas (such as diffuse large B-cell lymphoma and follicular lymphoma)
2. T-cell lymphomas (such as peripheral T-cell lymphoma and mycosis fungoides)
3. Natural killer cell lymphomas (such as nasal NK/T-cell lymphoma)
4. Histiocyte-rich B-cell lymphoma
5. Primary mediastinal B-cell lymphoma
6. Mantle cell lymphoma
7. Waldenström macroglobulinemia
8. Lymphoplasmacytoid lymphoma
9. Myelodysplastic syndrome/myeloproliferative neoplasms (MDS/MPN) related lymphoma

These subtypes can be further divided into other categories based on the specific characteristics of the cancer cells.

Symptoms of NHL can vary depending on the location and size of the tumor, but may include:

* Swollen lymph nodes in the neck, underarm, or groin
* Fever
* Fatigue
* Weight loss
* Night sweats
* Itching
* Abdominal pain
* Swollen spleen

Treatment for NHL typically involves a combination of chemotherapy, radiation therapy, and in some cases, targeted therapy or immunotherapy. The specific treatment plan will depend on the subtype of NHL, the stage of the cancer, and other individual factors.

Overall, NHL is a complex and diverse group of cancers that require specialized care from a team of medical professionals, including hematologists, oncologists, radiation therapists, and other support staff. With advances in technology and treatment options, many people with NHL can achieve long-term remission or a cure.

T-ALL typically occurs in children and young adults, although it can also occur in older adults. The symptoms of T-ALL can include fever, fatigue, loss of appetite, weight loss, swollen lymph nodes, and an enlarged spleen. If left untreated, T-ALL can progress rapidly and lead to life-threatening complications such as infection, bleeding, and organ failure.

The exact cause of T-ALL is not known, but it is believed to be linked to genetic mutations that occur in the T cells. The diagnosis of T-ALL typically involves a combination of physical examination, blood tests, bone marrow biopsy, and imaging studies such as CT scans or PET scans.

Treatment for T-ALL usually involves a combination of chemotherapy and/or radiation therapy to kill the abnormal T cells. In some cases, bone marrow transplantation may also be recommended. The prognosis for T-ALL depends on several factors, including the age of the patient, the severity of the disease, and the response to treatment. Overall, the survival rate for T-ALL is relatively low, but with intensive treatment, many patients can achieve long-term remission.

Some common types of nervous system neoplasms include:

1. Brain tumors: These are abnormal growths that develop in the brain, including gliomas (such as glioblastoma), meningiomas, and acoustic neuromas.
2. Spinal cord tumors: These are abnormal growths that develop in the spinal cord, including astrocytomas, oligodendrogliomas, and metastatic tumors.
3. Nerve sheath tumors: These are abnormal growths that develop in the covering of nerves, such as neurofibromas and schwannomas.
4. Pineal gland tumors: These are abnormal growths that develop in the pineal gland, a small endocrine gland located in the brain.

Symptoms of nervous system neoplasms can vary depending on their location and size, but may include headaches, seizures, weakness or numbness in the arms or legs, and changes in vision, speech, or balance. Diagnosis is typically made through a combination of imaging studies (such as MRI or CT scans) and tissue biopsy. Treatment options vary depending on the type and location of the tumor, but may include surgery, radiation therapy, and chemotherapy.

In summary, nervous system neoplasms are abnormal growths that can develop in the brain, spinal cord, and nerves, and can have a significant impact on the body. Diagnosis and treatment require a comprehensive approach, involving a team of medical professionals with expertise in neurology, neurosurgery, radiation oncology, and other related specialties.

Also known as Burkitt's Lymphoma.

There are several different types of leukemia, including:

1. Acute Lymphoblastic Leukemia (ALL): This is the most common type of leukemia in children, but it can also occur in adults. It is characterized by an overproduction of immature white blood cells called lymphoblasts.
2. Acute Myeloid Leukemia (AML): This type of leukemia affects the bone marrow's ability to produce red blood cells, platelets, and other white blood cells. It can occur at any age but is most common in adults.
3. Chronic Lymphocytic Leukemia (CLL): This type of leukemia affects older adults and is characterized by the slow growth of abnormal white blood cells called lymphocytes.
4. Chronic Myeloid Leukemia (CML): This type of leukemia is caused by a genetic mutation in a gene called BCR-ABL. It can occur at any age but is most common in adults.
5. Hairy Cell Leukemia: This is a rare type of leukemia that affects older adults and is characterized by the presence of abnormal white blood cells called hairy cells.
6. Myelodysplastic Syndrome (MDS): This is a group of disorders that occur when the bone marrow is unable to produce healthy blood cells. It can lead to leukemia if left untreated.

Treatment for leukemia depends on the type and severity of the disease, but may include chemotherapy, radiation therapy, targeted therapy, or stem cell transplantation.

The most common types of hemoglobinopathies include:

1. Sickle cell disease: This is caused by a point mutation in the HBB gene that codes for the beta-globin subunit of hemoglobin. It results in the production of sickle-shaped red blood cells, which can cause anemia, infections, and other complications.
2. Thalassemia: This is a group of genetic disorders that affect the production of hemoglobin and can result in anemia, fatigue, and other complications.
3. Hemophilia A: This is caused by a defect in the F8 gene that codes for coagulation factor VIII, which is essential for blood clotting. It can cause bleeding episodes, especially in males.
4. Glucose-6-phosphate dehydrogenase (G6PD) deficiency: This is caused by a point mutation in the G6PD gene that codes for an enzyme involved in red blood cell production. It can cause hemolytic anemia, especially in individuals who consume certain foods or medications.
5. Hereditary spherocytosis: This is caused by point mutations in the ANK1 or SPTA1 genes that code for proteins involved in red blood cell membrane structure. It can cause hemolytic anemia and other complications.

Hemoglobinopathies can be diagnosed through genetic testing, such as DNA sequencing or molecular genetic analysis. Treatment options vary depending on the specific disorder but may include blood transfusions, medications, and in some cases, bone marrow transplantation.

* Peripheral T-cell lymphoma (PTCL): This is a rare type of T-cell lymphoma that can develop in the skin, lymph nodes, or other organs.
* Cutaneous T-cell lymphoma (CTCL): This is a type of PTCL that affects the skin and can cause lesions, rashes, and other skin changes.
* Anaplastic large cell lymphoma (ALCL): This is a rare subtype of PTCL that can develop in the lymph nodes, spleen, or bone marrow.
* Adult T-cell leukemia/lymphoma (ATLL): This is a rare and aggressive subtype of PTCL that is caused by the human T-lymphotropic virus type 1 (HTLV-1).

Symptoms of T-cell lymphoma can include:

* Swollen lymph nodes
* Fever
* Fatigue
* Weight loss
* Night sweats
* Skin lesions or rashes

Treatment options for T-cell lymphoma depend on the subtype and stage of the cancer, but may include:

* Chemotherapy
* Radiation therapy
* Immunotherapy
* Targeted therapy

Prognosis for T-cell lymphoma varies depending on the subtype and stage of the cancer, but in general, the prognosis for PTCL is poorer than for other types of non-Hodgkin lymphoma. However, with prompt and appropriate treatment, many people with T-cell lymphoma can achieve long-term remission or even be cured.

There are different types of Breast Neoplasms such as:

1. Fibroadenomas: These are benign tumors that are made up of glandular and fibrous tissues. They are usually small and round, with a smooth surface, and can be moved easily under the skin.

2. Cysts: These are fluid-filled sacs that can develop in both breast tissue and milk ducts. They are usually benign and can disappear on their own or be drained surgically.

3. Ductal Carcinoma In Situ (DCIS): This is a precancerous condition where abnormal cells grow inside the milk ducts. If left untreated, it can progress to invasive breast cancer.

4. Invasive Ductal Carcinoma (IDC): This is the most common type of breast cancer and starts in the milk ducts but grows out of them and invades surrounding tissue.

5. Invasive Lobular Carcinoma (ILC): It originates in the milk-producing glands (lobules) and grows out of them, invading nearby tissue.

Breast Neoplasms can cause various symptoms such as a lump or thickening in the breast or underarm area, skin changes like redness or dimpling, change in size or shape of one or both breasts, discharge from the nipple, and changes in the texture or color of the skin.

Treatment options for Breast Neoplasms may include surgery such as lumpectomy, mastectomy, or breast-conserving surgery, radiation therapy which uses high-energy beams to kill cancer cells, chemotherapy using drugs to kill cancer cells, targeted therapy which uses drugs or other substances to identify and attack cancer cells while minimizing harm to normal cells, hormone therapy, immunotherapy, and clinical trials.

It is important to note that not all Breast Neoplasms are cancerous; some are benign (non-cancerous) tumors that do not spread or grow.

... the gene encodes both of the human proteins Bcl-xL and Bcl-xS. The protein encoded by this gene belongs to the Bcl-2 protein ... encodes a protein that activates apoptosis and interacts selectively with survival-promoting proteins Bcl-2 and Bcl-X(L)". The ... "Identification of the protein-protein contact site and interaction mode of human VDAC1 with Bcl-2 family proteins". Biochemical ... Tagami S, Eguchi Y, Kinoshita M, Takeda M, Tsujimoto Y (Nov 2000). "A novel protein, RTN-XS, interacts with both Bcl-XL and Bcl ...

https://en.wikipedia.org/wiki/Bcl-2-like_protein_1

... also known as bcl-2-like protein 4, is a protein that in humans is encoded by the BAX gene. BAX is a member of the Bcl-2 gene ... "Identification of the protein-protein contact site and interaction mode of human VDAC1 with Bcl-2 family proteins". Biochem. ... Bcl-2-associated X protein has been shown to interact with: Bcl-2, BCL2L1, BCL2A1 SH3GLB1, SLC25A4, VDAC1, TCTP, YWHAQ, Bid, ... In addition, it can become activated by binding BCL-2, as well as non-BCL-2 proteins such as p53 and Bif-1. Conversely, BAX can ...

https://en.wikipedia.org/wiki/Bcl-2-associated_X_protein

... encodes a protein that activates apoptosis and interacts selectively with survival-promoting proteins Bcl-2 and Bcl-X(L)". EMBO ... The anti-apoptotic Bcl-2 and Bcl-xL proteins inhibit cytochrome c release through the mitochondrial pore and also inhibit ... Ayllón V, Cayla X, García A, Fleischer A, Rebollo A (July 2002). "The anti-apoptotic molecules Bcl-xL and Bcl-w target protein ... Identification of a BH-3 domain and analysis of its binding to mutant BCL-2 and BCL-XL proteins". J. Biol. Chem. 272 (49): ...

https://en.wikipedia.org/wiki/Bcl-2-associated_death_promoter

... encodes a protein that activates apoptosis and interacts selectively with survival-promoting proteins Bcl-2 and Bcl-X(L)". The ... Bcl-2 (B-cell lymphoma 2), encoded in humans by the BCL2 gene, is the founding member of the Bcl-2 family of regulator proteins ... These pro-apoptotic proteins are in turn activated by BH3-only proteins, and are inhibited by the function of BCL-2 and its ... ABT-737 is superior to previous BCL-2 inhibitors given its higher affinity for Bcl-2, Bcl-xL and Bcl-w. In vitro studies showed ...

https://en.wikipedia.org/wiki/Bcl-2

The lymphocytes have marker protein profiles (e.g. CD20 and Bcl-2 positive; CD5, cyclin D1 and CD10 negative) that are typical ... CD20 and BCL-6 but not CD10 proteins. Patients with primary thyroid EMZL are at an increased risk of developing a more ... marker proteins but do not express the cyclin D1 marker protein., the T-cell marker, CD10, or BCL6. There are various EMZL ... whose protein product indirectly regulates activation of the NF-κB cell signaling pathway; 4) KLF2 whose product protein is a ...

https://en.wikipedia.org/wiki/Marginal_zone_B-cell_lymphoma

Bcl-2, Bcl-x(L) and Bcl-w), which is also seen in some pro-apoptotic proteins like Bcl-x(S), Diva, Bok-L and Bok-S. On the ... Bcl-x(S)) and the β-isoform (Bcl-xβ) promote cell death. Bcl-x(L), Bcl-x(S) and Bcl-xβ are three isoforms derived by ... The anti-apoptotic Bcl-2 proteins, such as Bcl-2 and Bcl-xL, conserve all four BH domains. The BH domains also serve to ... Proteins that are known to contain these domains include vertebrate Bcl-2 (alpha and beta isoforms) and Bcl-x (isoforms Bcl-x(L ...

https://en.wikipedia.org/wiki/Bcl-2_family

Such proteins include Bcl-2 and Bax. Bcl-2 is an antiapoptotic protein. The level of Bcl-2 in PD8 male rats is much higher than ... Tsukahara S, Kakeyama M, Toyofuku Y (2006). "Sex Differences in the level of Bcl-2 Family Proteins and Caspase-3 Activation in ... It is proved that Bcl-2 level in AVPV is higher whereas Bax level is lower in females than in males, just as being opposite of ... On the other hand, Bax, a proapoptotic protein, shows lower level in PD8 males than in PD8 females. Also, the number of active ...

https://en.wikipedia.org/wiki/Sexually_dimorphic_nucleus

Here, BCl-2 inhibits proteins called caspases. Caspases are part of the apoptosis pathway. When BCl-2 decreases, the expression ... Its purified protein is composed of alpha and beta subunits in equal quantities. R-PC II has PCB at beta-84 and the ... Stability of this protein invitro at these temperatures has been shown to be substantially lower. Photo-spectral analysis of ... As of March 7, 2018, there are 44 crystal structures of phycocyanin deposited in the Protein Data Bank. C-phycocyanin has a ...

https://en.wikipedia.org/wiki/Phycocyanin

Other Bcl-2 proteins include Bcl-2, Bcl-w, Bcl-xs, and Mcl-1. Korsmeyer SJ (March 1995). "Regulators of cell death". Trends in ... Small molecule Bcl-xL inhibitor that directly binds to Bcl-xL and releases their partner such as Bax, a proapoptotic protein, ... It is a member of the Bcl-2 family of proteins, and acts as an anti-apoptotic protein by preventing the release of ... While the exact signaling pathway of Bcl-xL is still not known, it is believed that Bcl-xL differs highly from Bcl-2 in their ...

https://en.wikipedia.org/wiki/Bcl-xL

Wang HG, Takayama S, Rapp UR, Reed JC (July 1996). "Bcl-2 interacting protein, BAG-1, binds to and activates the kinase Raf-1 ... Reed JC, Zha H, Aime-Sempe C, Takayama S, Wang HG (1997). "Structure-function analysis of Bcl-2 family proteins. Regulators of ... Wang HG, Rapp UR, Reed JC (November 1996). "Bcl-2 targets the protein kinase Raf-1 to mitochondria". Cell. 87 (4): 629-38. doi: ... 14-3-3 proteins also contribute to the autoinhibition. As 14-3-3 proteins are all known to form constitutive dimers, their ...

https://en.wikipedia.org/wiki/C-Raf

BAD is a pro-apoptotic protein of the Bcl-2 family. Akt1 can phosphorylate BAD on Ser136, which makes BAD dissociate from the ... Protein kinase B (PKB), also known as Akt, is the collective name of a set of three serine/threonine-specific protein kinases ... Akt1 is also able to induce protein synthesis pathways, and is therefore a key signaling protein in the cellular pathways that ... Akt1 is involved in the PI3K/AKT/mTOR pathway and other signaling pathways.[citation needed] The Akt proteins possess a protein ...

https://en.wikipedia.org/wiki/Protein_kinase_B

... attaches to a protein called Bcl-2. This protein is present in high amounts in CLL cancer cells, where it helps the ... Venetoclax blocks the anti-apoptotic B-cell lymphoma-2 (Bcl-2) protein, leading to programmed cell death of CLL cells. ... By attaching to Bcl-2 and blocking its actions, venetoclax causes the death of cancer cells and thereby slows down progression ... Overexpression of Bcl-2 in some lymphoid malignancies has been linked to increased resistance to chemotherapy. The maximum ...

https://en.wikipedia.org/wiki/Venetoclax

"Presenilin 1 protein directly interacts with Bcl-2". J. Biol. Chem. 274 (43): 30764-9. doi:10.1074/jbc.274.43.30764. PMID ... Levesque G (1999). "Presenilins interact with armadillo proteins including neural-specific plakophilin-related protein and beta ... They found that there is higher level expression of both proteins and a multidrug resistance-associated protein 1 (ABCC1) was ... "A new splice variant of glial fibrillary acidic protein, GFAP epsilon, interacts with the presenilin proteins". J. Biol. Chem. ...

https://en.wikipedia.org/wiki/Presenilin-1

... resides on the outer mitochondrial membrane where it co-localizes with the apoptotic Bcl-2 family protein BID. MTCH2 ... Gross A (August 2016). "BCL-2 family proteins as regulators of mitochondria metabolism". Biochimica et Biophysica Acta (BBA) - ... Mitochondrial carrier homolog 2 also known as MTCH2 is a protein which in humans is encoded by the MTCH2 gene. ... Gross A (June 2005). "Mitochondrial carrier homolog 2: a clue to cracking the BCL-2 family riddle?". Journal of Bioenergetics ...

https://en.wikipedia.org/wiki/MTCH2

"The Bcl-2 protein family: arbiters of cell survival". Science. 281 (5381): 1322-6. doi:10.1126/science.281.5381.1322. PMID ... while studying the bcl-2 gene in follicular lymphoma, the most common human lymphoma. He studied for his B.Sc at Emory ...

https://en.wikipedia.org/wiki/Jerry_Adams

In molecular biology, the Bcl-x interacting domain is a protein domain found in BAM, Bim and Bcl2-like protein 11. It is a long ... This article incorporates text from the public domain Pfam and InterPro: IPR015040 (Protein domains). ... "The structure of a Bcl-xL/Bim fragment complex: implications for Bim function". Immunity. 19 (3): 341-52. doi:10.1016/S1074- ... alpha helix, which is required for interaction with Bcl-x. Liu X, Dai S, Zhu Y, Marrack P, Kappler JW (September 2003). " ...

https://en.wikipedia.org/wiki/Bcl-x_interacting_domain

Bcl-2-like protein 12 is a protein that in humans is encoded by the BCL2L12 gene. The protein encoded by this gene belongs to ... This protein contains a Bcl-2 homology domain 2 (BH2). The function of this gene has not yet been determined. Two alternatively ... 2001). "In vitro selection and characterization of Bcl-X(L)-binding proteins from a mix of tissue-specific mRNA display ... the Bcl-2 protein family. Bcl-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are ...

https://en.wikipedia.org/wiki/BCL2L12

2004). "FAST is a BCL-X(L)-associated mitochondrial protein". Biochem. Biophys. Res. Commun. 318 (1): 95-102. doi:10.1016/j. ... The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase was shown to be ... 2005). "Towards a proteome-scale map of the human protein-protein interaction network". Nature. 437 (7062): 1173-8. Bibcode: ... "FAST is a survival protein that senses mitochondrial stress and modulates TIA-1-regulated changes in protein expression". Mol ...

https://en.wikipedia.org/wiki/FASTK

... has been shown to interact with: Bcl-2-associated X protein, and Bcl-2-associated death promoter. ... Bcl-2-related protein A1 is a protein that in humans is encoded by the BCL2A1 gene. This gene encodes a member of the bcl2 ... 1997). "Bok is a pro-apoptotic Bcl-2 protein with restricted expression in reproductive tissues and heterodimerizes with ... 2001). "Underphosphorylated BAD interacts with diverse antiapoptotic Bcl-2 family proteins to regulate apoptosis". Apoptosis. 6 ...

https://en.wikipedia.org/wiki/BCL2-related_protein_A1

... is a protein that in humans is encoded by the BCOR gene. The protein encoded by this gene was identified as ... This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II ... "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration". Cell. 125 (4): ... The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Research. 7 (4): 273-81. ...

https://en.wikipedia.org/wiki/BCL-6_corepressor

... is an inhibitor of the Bcl-2 family of proteins. This inhibition induces apoptosis in cancer cells, preventing tumor ... a Small-Molecule BCL-2 Family Antagonist, for Patients with Myelofibrosis". Clinical Lymphoma, Myeloma & Leukemia. 10 (4): 285- ... a small molecule pan-Bcl-2 family antagonist in patients with relapsed or refractory classical Hodgkin lymphoma". Blood. 119 (9 ... "Mechanisms of Antileukemic Activity of the Novel Bcl-2 Homology Domain-3 Mimetic GX15-070 (Obatoclax)". Cancer Research. 68 (9 ...

https://en.wikipedia.org/wiki/Obatoclax

Examples of viral Bcl-2 proteins include the Epstein-Barr virus BHRF1 protein and the adenovirus E1B 19K protein. Some viruses ... The adenovirus E1B-55K protein and the hepatitis B virus HBx protein are examples of viral proteins that can perform such a ... Bcl-Xl and Bcl-2) members of the Bcl-2 family are established. This balance is the proportion of proapoptotic homodimers that ... these inhibitory proteins target retinoblastoma tumor-suppressing proteins. These tumor-suppressing proteins regulate the cell ...

https://en.wikipedia.org/wiki/Apoptosis

2005). "BMRP is a Bcl-2 binding protein that induces apoptosis". J. Cell. Biochem. 94 (3): 611-26. doi:10.1002/jcb.20292. PMID ... 39S ribosomal protein L41, mitochondrial is a protein that in humans is encoded by the MRPL41 gene. Mammalian mitochondrial ... This gene encodes a 39S subunit protein that belongs to the YmL27 ribosomal protein family. GRCh38: Ensembl release 89: ... 2005). "Mitochondrial ribosomal protein L41 suppresses cell growth in association with p53 and p27Kip1". Mol. Cell. Biol. 25 ( ...

https://en.wikipedia.org/wiki/Mitochondrial_ribosomal_protein_L41

Zhang Z, Sobel RA, Cheng D, Steinberg GK, Yenari MA (November 2001). "Mild hypothermia increases Bcl-2 protein expression ... and there may be an increase in expression of the anti-apoptotic protein BCl-2. Many physicians over the centuries have tried ... April 1992). "Induction of apoptosis in fibroblasts by c-myc protein". Cell. 69 (1): 119-128. doi:10.1016/0092-8674(92)90123-T ...

https://en.wikipedia.org/wiki/Hypothermia_therapy_for_neonatal_encephalopathy

October 1994). "Adenovirus E1B 19 kDa and Bcl-2 proteins interact with a common set of cellular proteins". Cell. 79 (2): 341-51 ... Protein families, Membrane proteins, Transmembrane proteins, Transmembrane transporters, Transport proteins, Integral membrane ... December 1997). "The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric mitochondrial protein that activates apoptosis". The ... December 1997). "The E1B 19K/Bcl-2-binding protein Nip3 is a dimeric mitochondrial protein that activates apoptosis". The ...

https://en.wikipedia.org/wiki/BNIP3

Members of the Bcl-2 family of pro-apoptotic proteins can induce the opening of the VDAC (12). This will cause the same release ... Scientists have found that binding depressors to Bcl-2 anti-apoptotic proteins inhibits them and leaves direct activators free ... The term Apoptosome was first introduced in Yoshihide Tsujimoto's 1998 paper "Role of Bcl-2 family proteins in apoptosis: ... Tsujimoto Y (November 1998). "Role of Bcl-2 family proteins in apoptosis: apoptosomes or mitochondria?". Genes to Cells. 3 (11 ...

https://en.wikipedia.org/wiki/Apoptosome

Fernandez-Sarabia MJ, Bischoff JR (November 1993). "Bcl-2 associates with the ras-related protein R-ras p23". Nature. 366 (6452 ... Ras-related protein R-Ras is a protein that in humans is encoded by the RRAS gene. RRAS has been shown to interact with: ARAF, ... Fernandez-Sarabia MJ, Bischoff JR (1993). "Bcl-2 associates with the ras-related protein R-ras p23". Nature. 366 (6452): 274-5 ... "Novel raf kinase protein-protein interactions found by an exhaustive yeast two-hybrid analysis". Genomics. 81 (2): 112-25. doi: ...

https://en.wikipedia.org/wiki/RRAS

... encodes a protein that activates apoptosis and interacts selectively with survival-promoting proteins Bcl-2 and Bcl-X(L)". EMBO ... Activator of apoptosis Hrk regulates apoptosis through interaction with death-repressor proteins Bcl-2 and Bcl-X(L). The HRK ... Whitfield J, Harada K, Bardelle C, Staddon JM (2004). "High-throughput methods to detect dimerization of Bcl-2 family proteins ... "High-throughput methods to detect dimerization of Bcl-2 family proteins". Anal. Biochem. 322 (2): 170-8. doi:10.1016/j.ab. ...

https://en.wikipedia.org/wiki/HRK_(gene)

... encodes a protein that activates apoptosis and interacts selectively with survival-promoting proteins Bcl-2 and Bcl-X(L)". EMBO ... Bcl-2-interacting killer is a protein that in humans is encoded by the BIK gene. The protein encoded by this gene is known to ... This protein shares a critical BH3 domain with other death-promoting proteins, BAX and BAK. Bcl-2-interacting killer has been ... a BH3-containing mouse protein that interacts with Bcl-2 and Bcl-xL, is a potent death agonist". J. Biol. Chem. 273 (14): 7783- ...

https://en.wikipedia.org/wiki/Bcl-2-interacting_killer

June 2005). "An inhibitor of Bcl-2 family proteins induces regression of solid tumours". Nature. 435 (7042): 677-681. Bibcode: ... There are few protein-protein interaction inhibitors with specific and non-toxic effect in various cancer types. The first and ... Targeting protein-protein interaction with small molecule is known to be extremely difficult due to the fact that binding ... AI-10-49 belongs to a select group of protein-protein interaction inhibitors that has been shown to have specific and potent ...

https://en.wikipedia.org/wiki/AI-10-49

2007). "Large-scale mapping of human protein-protein interactions by mass spectrometry". Molecular Systems Biology. 3 (1): 89. ... "Apoptosis initiated by Bcl-2-regulated caspase activation independently of the cytochrome c/Apaf-1/caspase-9 apoptosome". ... The protein caspase DNase is an endonuclease involved in the cell apoptotic process that facilitates the DNA breakup. Cell ... It also depends on the activity of a protein or a common signal. The factor that seems to induce more cell differentiation is ...

https://en.wikipedia.org/wiki/Caspase-activated_DNase

The encoded protein is an Fe(II)-containing nuclear protein expressed in all tissues of the body and concentrated within dot- ... 1999). "The Bcl-3 oncoprotein acts as a bridging factor between NF-kappaB/Rel and nuclear co-regulators". Oncogene. 18 (22): ... 2005). "Towards a proteome-scale map of the human protein-protein interaction network". Nature. 437 (7062): 1173-8. Bibcode: ... Pirin is a protein that in humans is encoded by the PIR gene. This gene encodes a member of the cupin superfamily. ...

https://en.wikipedia.org/wiki/PIR_(gene)

Bcl-2-modifying factor is a protein that in humans is encoded by the BMF gene. The protein encoded by this gene belongs to the ... This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an ... 2005). "Differential targeting of prosurvival Bcl-2 proteins by their BH3-only ligands allows complementary apoptotic function ... 2007). "Mutational analysis of the BH3 domains of proapoptotic Bcl-2 family genes Bad, Bmf and Bcl-G in laryngeal squamous cell ...

https://en.wikipedia.org/wiki/BMF_(gene)

... factor-related apoptosis-inducing ligand activates a lysosomal pathway of apoptosis that is regulated by Bcl-2 proteins". The ... The protein has N- and C- terminal carbohydrate-binding domains connected by a link peptide. Multiple alternatively spliced ... However, it can also interact with other proteins (CLEC7A, CD137, CD40). For example, an interaction with CD40 on T-cells ... Galectin-9 was first isolated from mouse embryonic kidney in 1997 as a 36 kDa beta-galactoside lectin protein. Human galectin-9 ...

https://en.wikipedia.org/wiki/Galectin-9

The anti-apoptotic protein BCL-2 is up regulated by Gli2 and, to a lesser extent, Gli1 - but not Gli3, which may lead to ... Zinc finger protein GLI2 also known as GLI family zinc finger 2 is a protein that in humans is encoded by the GLI2 gene. The ... Gli2+protein at the US National Library of Medicine Medical Subject Headings (MeSH) GLI2+protein,+human at the US National ... The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It ...

https://en.wikipedia.org/wiki/GLI2

This is typically via characterising protein-protein interactions in the BCL-2 signalling pathway via structural ... Lee's research focuses on cell death and survival, and in particular the role of the BCL-2 protein and its associated homolog ... She then applies this information to animal models to understand the contributions of these proteins to normal physiology and ... characterisation of the constituent proteins (both X-ray and NMR methods) as well as biochemical and biophysical ...

https://en.wikipedia.org/wiki/Erinna_Lee

... cytochrome c release NF-κB WNT/beta-catenin mTOR ERK MAPK Bcl-2 The protein Src tyrosine kinase is overexpressed in Waldenström ... Blood tests show the level of IgM in the blood and the presence of proteins, or tumor markers, that are the key signs of ... Serum protein electrophoresis results indicate evidence of a monoclonal spike but cannot establish the spike as IgM. An M ... This is attributed to the IgM monoclonal protein increasing the viscosity of the blood by forming aggregates to each other, ...

https://en.wikipedia.org/wiki/Waldenström_macroglobulinemia

MicroRNA 195 is a protein that in humans is encoded by the MIR195 gene. microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs ... "miRNA-195 sensitizes human hepatocellular carcinoma cells to 5-FU by targeting BCL-w". Oncol. Rep. 27 (1): 250-7. doi:10.3892/ ... Gonsalves C, Kalra VK (November 2010). "Endothelin-1-induced macrophage inflammatory protein-1beta expression in monocytic ... that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to ...

https://en.wikipedia.org/wiki/MIR195

Bcl-rambo is a member of the Bcl-2 family of proteins that regulate apoptosis. In cells, Bcl-rambo is localized to the ... such as Bcl-rambo beta. As a member of the Bcl-2 protein family, Bcl-rambo comprises four conserved BH domains and a ... This gene encodes a mitochondrially-localized protein which is classified under the Bcl-2 protein family. Overexpression of the ... An alternatively-spliced protein variant, called Bcl-rambo beta, is composed of only the BH4 domain, completely lacking the BH ...

https://en.wikipedia.org/wiki/BCL2L13

Transport protein ZIP1 is responsible for the transport of zinc into prostate cells. One of zinc's important roles is to change ... The upregulation of BCL-2 after androgen ablation in prostate carcinoma cell lines and in a castrated-male rat model further ... The oncoprotein BCL-2 is associated with the development of androgen-independent prostate cancer, due to its high levels of ... Catz SD, Johnson JL (January 2003). "BCL-2 in prostate cancer: a minireview". Apoptosis. 8 (1): 29-37. doi:10.1023/a: ...

https://en.wikipedia.org/wiki/Prostate_cancer

"Protein kinase C-theta-mediated signals enhance CD4+ T cell survival by up-regulating Bcl-xL". Journal of Immunology. 176 (11 ... Masuda A, Yoshikai Y, Kume H, Matsuguchi T (November 2004). "The interaction between GATA proteins and activator protein-1 ... "Human cytomegalovirus IE1 protein activates AP-1 through a cellular protein kinase(s)". The Journal of General Virology. 80 ( ... However, Fos proteins do not dimerize with each other and therefore can only bind to DNA when bound with Jun. The Jun-Fos ...

https://en.wikipedia.org/wiki/AP-1_transcription_factor

... proto-oncogene protein C-kit - proto-oncogene proteins c-abl - proto-oncogene proteins c-bcl-2 - Proto-oncogene proteins c-fos ... protein - protein biosynthesis - Protein Data Bank - protein design - protein expression - protein folding - protein isoform - ... protein P16 - protein P34cdc2 - protein precursor - protein structure prediction - protein subunit - protein synthesis - ... proto-oncogene proteins c-jun - proto-oncogene proteins c-mo - proto-oncogene proteins c-myc - proto-oncogene proteins c-raf - ...

https://en.wikipedia.org/wiki/Index_of_biochemistry_articles

Bcl-2, cytochrome c and PARP proteins". Immunopharmacology and Immunotoxicology. 36 (6): 379-389. doi:10.3109/08923973.2014. ... changes between baseline and 16 weeks on either the placebo or the MSM groups with the exception of C-reactive protein levels, ...

https://en.wikipedia.org/wiki/Methylsulfonylmethane

... who jointly published a paper detailing their findings in May 1999 and named the protein TALL-1. The same protein was named ... levels of Bcl-2, a survival factor, are increased. When all three BAFF receptors are stimulated, levels of NF kappa B, which ... BR3-Fc, a recombinant fusion protein built with the extracellular ligand-binding portion of BAFF-R, blocks activation of this ... Other drugs addressing B lymphocyte hyperactivity include atacicept, a recombinant fusion protein that is built with the ...

https://en.wikipedia.org/wiki/Belimumab

Lee MO, Kang HJ, Cho H, Shin EC, Park JH, Kim SJ (November 2001). "Hepatitis B virus X protein induced expression of the Nur77 ... Nuclear receptor 4A1 has been shown to interact with: AKT1, Bcl-2, HIF1A, Nuclear receptor co-repressor 2, Promyelocytic ... In addition, subcellular localization of the NR4A1 protein appears to play a key role in the survival and death of cells. ... Translocation of the protein from the nucleus to mitochondria induces apoptosis. Multiple alternatively spliced variants, ...

https://en.wikipedia.org/wiki/Nuclear_receptor_4A1

STAT 6 protein is crucial in IL4 mediated biological responses. It was found that STAT6 induce the expression of BCL2L1/BCL-X(L ... family of proteins. The proteins of STAT family transmit signals from a receptor complex to the nucleus and activate gene ... STAT6 protein also regulates other transcription factor as Gata3, which is important regulator of Th2 differentiation. STAT6 is ... In the human genome, STAT6 protein is encoded by the STAT6 gene, located on the chromosome 12q13.3-q14.1. The gene encompasses ...

https://en.wikipedia.org/wiki/STAT6

... protein oxidation and altered protein expression reveal targets of damage, stress response, and antioxidant responsiveness. ... 2004 PMID 15205666 Rapamycin-resistant proliferation of CD8+ T cells correlates with p27kip1 down-regulation and bcl-xL ... Journal of Immunology, 2006 PMID 17056525 HIV Nef-mediated CD4 down-regulation is adaptor protein complex 2 dependent. Jin YJ, ...

https://en.wikipedia.org/wiki/Steven_J._Burakoff

"Association of protein kinase A and protein phosphatase 2B with a common anchoring protein". Science. 267 (5194): 108-11. ... "Suppression of signalling through transcription factor NF-AT by interactions between calcineurin and Bcl-2". Nature. 386 (6626 ... Calcineurin (CaN) is a calcium and calmodulin dependent serine/threonine protein phosphatase (also known as protein phosphatase ... Giri PR, Higuchi S, Kincaid RL (1991). "Chromosomal mapping of the human genes for the calmodulin-dependent protein phosphatase ...

https://en.wikipedia.org/wiki/Calcineurin

... is a protein that in humans is encoded by the H2AZ1 gene. Histones are basic nuclear proteins that are ... 2000). "BCL-6 mutations are associated with immunoglobulin variable heavy chain mutations in B-cell chronic lymphocytic ...

https://en.wikipedia.org/wiki/Histone_H2A.Z

Ayllón V, Cayla X, García A, Fleischer A, Rebollo A (July 2002). "The anti-apoptotic molecules Bcl-xL and Bcl-w target protein ... The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). PP1 is a serine/ ... Hung WJ, Roberson RS, Taft J, Wu DY (May 2003). "Human BAG-1 proteins bind to the cellular stress response protein GADD34 and ... Schillace RV, Scott JD (March 1999). "Association of the type 1 protein phosphatase PP1 with the A-kinase anchoring protein ...

https://en.wikipedia.org/wiki/PPP1CA

Identification of a high-risk subset with coexpression of CD10 and bcl-2". Am. J. Clin. Pathol. 116 (2): 183-90. doi:10.1309/ ... Synthesized as a membrane-bound protein, the neprilysin ectodomain is released into the extracellular domain after it has been ... Córdoba A, Guerrero D, Larrinaga B, Iglesias ME, Arrechea MA, Yanguas JI (2009). "Bcl-2 and CD10 expression in the differential ... This protein is present on leukemic cells of pre-B phenotype, which represent 85% of cases of ALL. Hematopoietic progenitors ...

https://en.wikipedia.org/wiki/Neprilysin

This protein binds to anti-apoptotic proteins resulting in these proteins' inhibition. As a p53 inducible gene, NOXA is ... Noxa, isolated from mice, is a member of the Bcl-2 family and is able to regulate cell death through a variety of intracellular ... NS1 is considered a regulatory protein due to its activity in transcription, translation, and protein-protein interactions, ... This protein, also known as viral protein 3 (VP3) was isolated from chickens, and has been shown to cause PCD in transformed ...

https://en.wikipedia.org/wiki/Anticancer_gene

CHOP causes downregulation of the anti-apoptotic mitochondrial protein Bcl-2, favouring a pro-apoptotic drive at the ... An important example is that the proapoptotic protein CHOP (CCAAT/-enhancer-binding protein homologous protein), is upregulated ... exposed hydrophobic residues of the misfolded protein are bound by the protein glucose regulate protein 78 (Grp78), a heat ... Unsuccessful protein folding can be caused by HLA-B27, disturbing balance of important (IL-10 and TNF) signaling proteins. At ...

https://en.wikipedia.org/wiki/Unfolded_protein_response

Cleft lip and palate transmembrane protein 1-like protein (CLPTM1-like protein), also known as cisplatin resistance-related ... Bcl-xL. Inhibition of CLPTM1L has been shown to inhibit oncogenic transformation and tumorigenesis caused by the KRas oncogene ... protein 9 (CRR9p), is a protein that in humans is encoded by the CLPTM1L gene. CRR9p is associated with cisplatin-induced ... Cleft lip and palate transmembrane protein 1 ENSG00000274811 GRCh38: Ensembl release 89: ENSG00000049656, ENSG00000274811 - ...

https://en.wikipedia.org/wiki/CLPTM1L

... also known as CDK1 or cell division cycle protein 2 homolog is a highly conserved protein that ... Pathan N, Aime-Sempe C, Kitada S, Basu A, Haldar S, Reed JC (2001). "Microtubule-targeting drugs induce bcl-2 phosphorylation ... Cdk1 is comprised mostly by the bare protein kinase motif, which other protein kinases share. Cdk1, like other kinases, ... Cdk1-cyclin complexes are also governed by direct binding of Cdk inhibitor proteins (CKIs). One such protein, already discussed ...

https://en.wikipedia.org/wiki/Cyclin-dependent_kinase_1

Smudge cells are due to cancer cells lacking in vimentin, a type of cytoskeleton proteins which is a structural component in a ... Targeted drugs used in CLL include venetoclax (a Bcl-2 inhibitor), ibrutinib (a Bruton's tyrosine kinase inhibitor), idelalisib ... and only recommended in specific cases where front-line therapies have either failed or there is a lack of response to BCL-2 ... and have some of the same cell marker proteins, chromosome abnormalities, and gene mutations found in CLL. CLL/SLL MBL consist ...

https://en.wikipedia.org/wiki/Chronic_lymphocytic_leukemia

In protein synthesis, DNA is first transcribed into mRNA, and then translated in an amino acid sequence. Gapmers take advantage ... "Lipid Nanoparticles Loaded with an Antisense Oligonucleotide Gapmer Against Bcl-2 for Treatment of Lung Cancer". Pharmaceutical ... Kynamro targets the mRNA product of the APOB gene, which codes for the Apolipoprotein B-100 protein, a component of low-density ... The functional consequences of gapmer off-target effects can vary widely, depending on the proteins affected and the extent of ...

https://en.wikipedia.org/wiki/Gapmer

Coppola D, Fu L, Nicosia SV, Kounelis S, Jones M (1998). "Prognostic significance of p53, bcl-2, vimentin, and S100 protein- ... The S100 proteins are a family of low molecular-weight proteins found in vertebrates characterized by two calcium-binding sites ... S100 proteins have been implicated in a variety of intracellular and extracellular functions, such as regulation of protein ... and knockdown of aryl hydrocarbon receptor downregulates the expression of S100 proteins in THP-1 cells. Most S100 proteins ...

https://en.wikipedia.org/wiki/S100_protein

Targets: M-protein levels in blood, patient-specific assays for immunoglobulin and T cell receptor genes (high levels of ... Jun 2006). "The bcl-2/IgH rearrangement in a population of 204 healthy individuals: occurrence, age and gender distribution, ... These proteins can be stained with fluorescent dye labeled antibodies and detected using flow cytometry. The limit of detection ... White blood cells (WBC) can show a variety of proteins on the surface depending upon the type of WBC. Leukaemic cells often ...

https://en.wikipedia.org/wiki/Minimal_residual_disease

Zhang H, Li Y, Huang Q, Ren X, Hu H, Sheng H, Lai M (2011). "MiR-148a promotes apoptosis by targeting Bcl-2 in colorectal ... that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to ...

https://en.wikipedia.org/wiki/MicroRNA_148a

N1 protein is an intracellular virulence factor that has a Bcl-2-like structure and inhibits both apoptosis and signalling from ... Vaccinia virus lacking the Bcl-2-like protein N1 induces a stronger natural killer cell response to infection J Gen Virol. 2008 ... The vaccinia virus (VACV) N1 protein is an intracellular virulence factor that has a Bcl-2-like structure and inhibits both ... Proto-Oncogene Proteins c-bcl-2 / deficiency* * Proto-Oncogene Proteins c-bcl-2 / immunology ...

https://pubmed.ncbi.nlm.nih.gov/18931086/?dopt=Abstract

Anti-apoptotic pro-apoptotic protein ratios (Bcl-2Bax, p < .001; Bcl-2Bak, p = .01; Bcl-xL Bax, p = .006, Bcl-xLBak, p = .011; ... The tissue levels of Bcl-2 family pro-apoptotic (Bak, Bax, active caspase-3) and anti-apoptotic (Bcl-2, Bcl-xL, Mcl-1) proteins ... The pro-apoptotic proteins; Bak, Bax and anti-apoptotic proteins Bcl-2, Bcl-xL, Mcl-1 were detected significantly higher in ... The aim of the study was to identify the tissue levels and ratios of anti- and pro-apoptotic Bcl-2 family proteins in peri- ...

https://pesquisa.bvsalud.org/odontologia/resource/pt/mdl-37035912

Recently, we have developed the CABS-dock method for flexible protein-peptide docking that enables large-scale rearrangements ... The presented case study demonstrates that CABS-dock methodology opens up new opportunities for protein-peptide docking with ... of the protein chain. In this study, we use CABS-dock to investigate the binding of the p53-MDM2 complex, an element of the ... Protein-peptide interactions are often associated with large-scale conformational changes that are difficult to study either by ...

https://www.nature.com/articles/srep37532?error=cookies_not_supported

The proper assembly of sperm flagellar proteins is fundamental for sperm. The proper assembly of sperm flagellar proteins is ... During the period of FS development newly synthesized proteins are integrated into the developing FS [6]. However the ... of incorporation of GAPDS into FS during flagellar development is a valuable style of the set up of nonstructural protein into ... and assembly of rat FS parts during spermiogenesis have not been precisely examined aside from A-kinase anchoring proteins 4 ( ...

http://www.monossabios.com/2017/05/09/the-proper-assembly-of-sperm-flagellar-proteins-is-fundamental-for-sperm/

Bcl-2 family proteins; and FADD, FLICE, and FLIP proteins in the Fas signaling pathway may be involved in the pathogenesis of ... Marchal J, Kambouchner M, Tazi A, Valeyre D, Soler P. Expression of apoptosis-regulatory proteins in lesions of pulmonary ... Immunohistochemical detection of the apoptosis-related proteins FADD, FLICE, and FLIP in Langerhans cell histiocytosis. J ... Shima H, Takahashi T, Shimada H. Protein-losing enteropathy caused by gastrointestinal tract-involved Langerhans cell ...

https://emedicine.medscape.com/article/1100579-overview

Moreover, in addition, it inhibited the manifestation of anti\apoptotic BCL\2 family members proteins such as for example BCL\2 ... Moreover, in addition, it inhibited the manifestation of anti\apoptotic BCL\2 family members proteins such as for example BCL\2 ... Protein bands were visualized and quantified with an Odyssey system (Pierce, Waltham, MA, USA). The antibodies used were: AKT, ... American blotting Total proteins was extracted from cells lysates using RIPA lysis launching and buffer buffer as prior ...

http://www.neighborhoodhousecharterschool.org/2022/12/06/%EF%BB%BFmoreover-in-addition-it-inhibited-the-manifestation-of-antiapoptotic-bcl2-family-members-proteins-such-as-for-example-bcl2-bclxl-and-mcl1/

As the role of BCL-2 inhibition in various malignancies becomes further elucidated, venetoclax may offer benefit to a myriad ... Attention has been focused on a novel target, the B-cell lymphoma-2 protein (BCL-2), which serves an essential role in ... Venetoclax: A First-in-Class Oral BCL-2 Inhibitor for the Management of Lymphoid Malignancies Amber C King 1 , Tim J Peterson 1 ... Venetoclax: A First-in-Class Oral BCL-2 Inhibitor for the Management of Lymphoid Malignancies Amber C King et al. Ann ...

https://pubmed.ncbi.nlm.nih.gov/28056525

C) The protein levels of Bcl-2 and Bax were measured using western blot analysis. The mRNA levels of (D) Bcl-2 and (E) Bax were ... TNF-α, tumor necrosis factor α; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein; FITC, fluorescein isothiocyanate; PI ... Bcl-2-associated X protein. CGTCCACCAAGAAGCTGAGCG. TGTCCCTACCAACCAGAAGG. GAPDH. CTTTGGTATCGTGGAAGGACTC. GTAGAGGCAGGGATGATGTTCT ... Concomitantly, the expression levels of apoptosis-associated proteins Bcl-2 and Bax were measured. The results suggested that ...

https://www.spandidos-publications.com/10.3892/etm.2018.6872

bcl-X Protein / antagonists & inhibitors Actions. * Search in PubMed * Search in MeSH ... Inhibition of BCL2L1 (BCL-XL) sensitizes breast cancer cells to TRAIL. (A) MB231, MB468, T47D, and SKBR3 cells were incubated ... Inhibition of BCL2L1 (BCL-XL) sensitizes breast cancer cells to TRAIL. (A) MB231, MB468,… ... Bcl-xL inhibition by molecular-targeting drugs sensitizes human pancreatic cancer cells to TRAIL. Hari Y, Harashima N, Tajima Y ...

https://www.ncbi.nlm.nih.gov/pubmed/24745479

Bcl-2 (B-cell leukemia 2) is an apoptotic protein and a member of the Bcl-2 family containing BH1-4 domains. ... The Bcl-2 protein forms homo- or hetero-dimers with other Bcl-2 family members. Bcl-2 is distributed in the outer mitochondrial ... View All Bcl-2 Reagents Request Custom Conjugation Description. Clone. Applications. Purified anti-Bcl-2. BCL/10C4. WB,IP,ICC, ... Bcl-2 (B-cell leukemia 2) is an apoptotic protein and a member of the Bcl-2 family containing BH1-4 domains. Two reported ...

https://www.biolegend.com/fr-fr/products/fitc-anti-bcl-2-antibody-6345?GroupID=BLG2934

Proto-Oncogene Proteins c-bcl-2/genetics; Proto-Oncogene Proteins c-bcl-2/metabolism*; RNA, Messenger/metabolism*; Rats; Rats, ... bcl-2-Associated X Protein; bcl-Associated Death Protein ... and anti-apoptotic Bcl(2) mRNA. Ethanol was administered at ... Carrier Proteins/genetics; Carrier Proteins/metabolism*; Cerebellum/cytology; Cerebellum/drug effects*; Cerebellum/physiology; ... Doses greater than 1.5 g/kg produced significant decreases in Bcl(2) and significant increases in Bad and Bax mRNA during the 8 ...

https://tools.niehs.nih.gov/portfolio/index.cfm?do=portfolio.publicationDetail&id=515871

One is the Bcl-2 protein Bax, which is a critical component in programmed cell death. As cell death is activated under a ... can be modulated by other regulatory proteins. The goal is to understand how protein-protein interactions involving CP can ... The proteins that form viral particles are another area of interest for Dr. Tjandra. During viral replication, these proteins ... Tjandra is studying how Bax transforms from a soluble protein in the cytoplasm to a membrane-associated protein that ...

https://www.nhlbi.nih.gov/science/structural-biophysics/

Trail, tumor necrosis factor-α-related apoptosis-inducing ligand; Bim/Puma, Bcl-2 interacting mediator of cell death/p53- ... Fas-associated death domain-like interleukin-1β converting enzyme-like inhibitory protein. ... Communication between the pathways exists through cleavage of Bcl-2 interacting domain (Bid) by active caspase-8 to form ...

https://wwwnc.cdc.gov/eid/content/13/2/191-f1.htm

Antibodies for proteins involved in regulation of protein localization pathways, according to their Panther/Gene Ontology ...

https://www.thermofisher.com/antibody/primary/panther/regulation%20of%20protein%20localization

Expression of bcl-2, bax and p53 protein in the basal cell carcinoma].. Yan L; Chen M; Yu G. Hunan Yi Ke Da Xue Xue Bao; 1999; ... 1. [Expression of Bcl-2 and Bax protein in endometriosis].. Huang FY; Lin QH; Fang XL. Hunan Yi Ke Da Xue Xue Bao; 2003 Apr; 28 ... 3. [Expression of bcl-2 protein in adenomyosis].. Zhang L; Li J; Li M. Zhonghua Fu Chan Ke Za Zhi; 2000 Sep; 35(9):533-5. ... Potential role of bcl-2 and bax mRNA and protein expression in chronic hepatitis type B and C: a clinicopathologic study. ...

https://pubmedhh.nlm.nih.gov/biomarkers/search.php?id=12934347&mod=related&page=1&outid=&proj=

... persistence of bcl-2 family member expression leads to defective apoptosis; and the bcr-abl chimeric molecule activates several ... alterations in the Rb tumor suppressor protein occurs reciprocally in relation to deletion of certain members of the E2F family ...

https://grants.nih.gov/grants/guide/pa-files/PAR-98-068.html

Among them, Bcl-2 is an anti-apoptotic protein and the others are proapoptotic protein (Ryu et al. 2018 ; Zhu et al. 2017 ). In ... However, the mRNA expression of Bcl-2 was significantly decreased in the NaF treated group. The results of protein levels of ... Moreover, it was observed that fluoride induced an increase in the mRNA and protein expressions of LC3 and Beclin1, while led ... Effects on DNA damage and apoptosis and p53 protein expression induced by fluoride in human embryo hepatocytes.. OBJECTIVE: To ...

https://fluoridealert.org/studytracker/32187/

Bcl-2-family proteins and the role of mitochondria in apoptosis. Curr Opin Cell Biol. 2003;15:691-699. ... Approaches for enhancing oral bioavailability of peptides and proteins. Int J Pharm. 2013;447:75-93. doi:10.1016/j.ijpharm. ... 53 Cancer cells have been suppressing apoptosis as exemplified by a few proteins and between cell death and cell proliferation. ... drug resistance due to suppression of apoptosis and expressive levels of anti-apoptotic proteins has intensified in cancer ...

https://www.dovepress.com/ultrasonic-nanoemulsification-of-cuminum-cyminum-essential-oil-and-its-peer-reviewed-fulltext-article-IJN

It works by blocking the action of a certain protein in the body that helps cancer cells survive. This helps to kill cancer ... Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. ...

https://medlineplus.gov/druginfo/meds/a616028.html

Venetoclax neutralizes the Bcl-2 protein, a culprit that is accountable for existence, maintenance, and survival of CLL ... Through this work, based on molecular changes we observed in the Bcl-2 family of proteins following ibrutinib treatment, we ... we not only see a reduction in phospho-BTK protein, which is expected, but also a decrease in the total BTK protein. Because ... one molecule of ibrutinib is needed to neutralize one molecule of BTK protein, we postulated that ibrutinib doses could be ...

https://www.mdanderson.org/publications/cancer-frontline/chronic-lymphocytic-leukemia-expert-discusses-treatment-advances.h00-159300678.html

Kidney tissues were harvested at 24 h after reperfusion. A. Renal Bcl-2 protein expression. B. Changes of caspase-3 activity. ... Protein concentrations of kidney tissue homogenate were measured using BCA assay (Beyotime, Suzhou, Jiangsu, China) and protein ... the expression of anti-apoptosis protein Bcl-2 and the activity of caspase-3 was also examined. Similarly, it was observed that ... Moreover, we found that the renal mRNA expression levels of tumor necrosis factor α (TNFα), monocyte chemotactic protein 1 (MCP ...

https://www.oncotarget.com/article/14309/text/

B-cell lymphoma 1 protein. *BCL-1. *BCL-1 oncogene. *BCL1. *CCND1 ... members are characterized by a dramatic periodicity in protein ...

https://edrn.nci.nih.gov/data-and-resources/biomarkers/ccnd1/

Bcl-XL antibody for FC, IF, IHC, IP, WB, ELISA and reacts with human, mouse, rat. ... BCL2L1 is a member of the BCL-2 protein family. BCL2L1 is expressed as three isoforms, Bcl-X(L),Bcl-X(s) and Bcl-X(beta) , and ... Bcl-X(beta) is a 227 amino acid protein. This antibody can recognize Bcl-XL, Bcl-X(s) and Bcl-X(Beta). ... The Bcl-X(L) isoform is a 233 amino acid protein, acting as an apoptotic inhibitor. Bcl-XL can forms heterodimers with BAX, BAK ...

https://ptglab.com/products/Bcl-xL-Antibody-10783-1-AP.htm

... alteration in the expression of apoptosis-related proteins (e.g., Bax, Bcl-2) in a manner favoring neuronal survival; (2) up- ...

https://ods.od.nih.gov/Funding/abstract.aspx?g=5R21AA023343-02&print=1

In addition, activation of antiapoptotic factors including phospho-Akt (protein kinase B) and Bcl-2 was detected. Further ... Activation of Akt and Bcl-2 may play an important role in preventing cytochrome c release from mitochondria to the cytoplasm ... Western-blot analysis showed an activation of proapoptotic factors including Fas (CD95), Fas-associated protein with death ...

http://www2a.cdc.gov/nioshtic-2/BuildQyr.asp?s1=+%27ultrafine%2A%27+OR+%28%27nano%2A%27+AND+%27particle%2A%27%29+OR+%27nanotech%2A%27+OR+%27nanomaterial%2A%27+OR+%27nanoparticle%2A%27+OR+%27nanotube%2A%27+&f1=%2A&Startyear=&terms=3&Adv=1&ct=&B1=Search&Limit=25000&Sort=DP+DESC&whichdate=DP&D1=10&EndYear=&PageNo=162&RecNo=1619&View=f&

In vitro, omacetaxine mepesuccinate reduced protein levels of the Bcr-Abl oncoprotein and Mcl-1, an anti-apoptotic Bcl-2 family ... It is a protein synthesis inhibitor. Omacetaxine mepesuccinate is prepared by a semi-synthetic process from cephalotaxine, an ... The mechanism of action of omacetaxine mepesuccinate has not been fully elucidated but includes inhibition of protein synthesis ... The plasma protein binding of omacetaxine mepesuccinate is less than or equal to 50%. ...

https://dailymed.nlm.nih.gov/dailymed/search.cfm?labeltype=all&query=Omacetaxine

The protein p53 is selected because it is an important tumor suppressor antigen. To identify the potential roles of the ... The protein p53 is selected because it is an important tumor suppressor antigen. To identify the potential roles of the ... similar variants of ORF-73 markers involved in the immune response may interact with targeted host proteins as predicted by our ... Methods and results: We searched for homologues of ORF-73 and attempted to predict protein-protein interactions (PPI) based on ...

https://www.frontiersin.org/articles/10.3389/fgene.2019.01376/full

Identification of biphenyl-based hybrid molecules able to decrease the intracellular level of Bcl-2 protein in Bcl-2 ...

https://www.broadinstitute.org/bibcite/keyword/3321

Bcl-xl, an anti-apoptotic protein of this family, is known to form heterodimers with multiple pro-apoptotic proteins, such as Bad, Bim, Bak, and Bid. (omicsdi.org)
A fifth protein-peptide complex composed of another anti-apoptotic protein, Bcl-w, in complex with the peptide from Bim was also studied. (omicsdi.org)
Functional and structural studies of the vaccinia virus virulence factor N1 reveal a Bcl-2-like anti-apoptotic protein. (ox.ac.uk)
This study illustrates the importance of the evolutionary conservation of structure, rather than sequence, in protein function and reveals a novel anti-apoptotic protein from orthopoxviruses. (ox.ac.uk)
A recent study demonstrated the lack of beta-amyloid (Aβ) plaque formation and accumulation of the amyloid precursor protein (APP) in a triple transgenic mouse model of Alzheimer's disease (3xTg-AD) following overexpression of the anti-apoptotic protein, Bcl-2 (Rohn et al. (uthscsa.edu)

Here, we show that the molecular pathway leading to TFEC-mediated cell death is associated with an early cytosolic to mitochondrial translocation of BAX, a pro-apoptotic member of the BCL-2 family. (nih.gov)
Bcl-2 (B-cell leukemia 2) is an apoptotic protein and a member of the Bcl-2 family containing BH1-4 domains. (biolegend.com)

To elucidate the molecular basis of this recognition process, we used molecular dynamics simulations coupled with the Molecular Mechanics/Poisson-Boltzmann Surface Area approach to identify the amino acids that make significant energetic contributions to the binding free energy of four complexes formed between Bcl-xl and pro-apoptotic Bcl-2 homology 3 peptides. (omicsdi.org)

These findings indicate a novel pathway for redox regulation of apoptosis regulatory proteins, which could be important in the understanding of chemotherapy-induced toxicities and development of preventive treatment strategies which are currently lacking. (cdc.gov)

Membrane proteins encoded by the BCL-2 GENES and serving as potent inhibitors of cell death by APOPTOSIS. (nih.gov)
In addition, the expression levels of genes and proteins were determined reverse transcription quantitative polymerase chain reaction and western blot analysis. (spandidos-publications.com)
To screen genes associated with poor prognosis of clear cell renal cell carcinoma (CcRCC) from the public databases HPA (Human Protein Atlas), UALCAN, and GEPIA (Gene Expression Profiling Interactive Analysis) and to investigate the expression of FKBP10 in CcRCC and the effect on prognosis of the patients and the biological behavior of CcRCC cells. (hindawi.com)

Purpose: Bcl-2 is an apoptotic protein that is highly expressed in advanced melanoma. (elsevier.com)
Humanin selectively prevents the activation of pro-apoptotic protein BID by sequestering it into fibers. (nih.gov)

Overexpression of bcl-2 proteins, due to a translocation of the gene, is associated with follicular lymphoma. (nih.gov)
BCL-xL overexpression effectively protects against tetrafluoroethylcysteine-induced intramitochondrial damage and cell death. (nih.gov)

Vaccinia virus (VACV) encodes many immunomodulatory proteins, including inhibitors of apoptosis and modulators of innate immune signalling. (ox.ac.uk)
Presently, inhibitors from the apoptosis protein, mobile FLICE-like R935788 inhibitory proteins (c-FLIP) and inhibitors of apoptosis proteins (IAPs, including XIAP) are believed to lead to cellular Path resistance. (colinsbraincancer.com)

A p53 upregulated modulator of apoptosis that binds Bcl-2. (nih.gov)

The proteins are found on mitochondrial, microsomal, and NUCLEAR MEMBRANE sites within many cell types. (nih.gov)
Taken together, our findings provide a "Membrane-mediated Permissive" model, in which the BH3-only proteins only indirectly activate BAX/BAK by neutralizing the anti-apoptotic BCL-2 proteins, and thus allowing BAX/BAK to undergo unimpeded, spontaneous activation in the mitochondrial outer membrane milieu, leading to apoptosis initiation. (omicsdi.org)
Flow cytometric detection of the mitochondrial BCL-2 protein in normal and neoplastic human lymphoid cells. (ox.ac.uk)
The bcl-2 proto-oncogene, rearranged and deregulated in B-cell lymphomas bearing the t(14;18) translocation, encodes an inner mitochondrial membrane protein that blocks apoptotic cell death. (ox.ac.uk)
Mitochondrial superoxide mediates doxorubicin-induced keratinocyte apoptosis through oxidative modification of ERK and Bcl-2 ubiquitination. (cdc.gov)
The BCL-2 family of proteins is pivotal in regulating cell death through the control of the integrity of the outer mitochondrial membrane. (lifechemicals.com)
Bcl-2 is distributed in the outer mitochondrial membrane, the nuclear envelope, and the endoplasmic reticulum. (biolegend.com)
This protein blocks apoptotic death by controlling mitochondrial membrane permeability. (biolegend.com)

However, unlike the caspase cleavage products of cellular Bcl-2, Bcl-x(L), and Bid, which are potent inducers of apoptosis, the cleavage product of gammaHV68 Bcl-2 lacked proapoptotic activity. (nih.gov)
Communication between the pathways exists through cleavage of Bcl-2 interacting domain (Bid) by active caspase-8 to form truncated Bid (tBid). (cdc.gov)
Cleavage of Bcl-2 can convert to pro-apoptotic (by cleavage of BH4 domain). (biolegend.com)

American blotting Total proteins was extracted from cells lysates using RIPA lysis launching and buffer buffer as prior described.17 Protein were separated with SDS\Web page and incubated with particular antibodies. (neighborhoodhousecharterschool.org)
Of many epithelial, neuronal, and glial markers, we found that calcium-binding protein antibodies recognizing calretinin, calmodulin, or parvalbumin labeled immature hair cells in rat vestibular end organs. (jneurosci.org)

The results identified amino acids of both the anti-apoptotic proteins as well as the Bcl-2 homology 3 (BH3) domains of the pro-apoptotic proteins that make strong, recurrent interactions in the protein complexes. (omicsdi.org)
Quantifying in live cells the contributions of individual amino acids revealed that residue L185 previously thought involved in binding Bim to membranes, instead contributes to binding to anti-apoptotic proteins. (omicsdi.org)

Dr. Tjandra is studying how viral proteins aggregate into specific shapes (e.g. eicosahedral or conical) and how that organization relates to viral function. (nih.gov)

The vaccinia virus (VACV) N1 protein is an intracellular virulence factor that has a Bcl-2-like structure and inhibits both apoptosis and signalling from the interleukin 1 receptor, leading to nuclear factor kappa B activation. (nih.gov)

Protein-peptide interactions are often associated with large-scale conformational changes that are difficult to study either by classical molecular modeling or by experiment. (nature.com)
Molecular basis for Bcl-2 homology 3 domain recognition in the Bcl-2 protein family: identification of conserved hot spot interactions. (omicsdi.org)
Molecular basis for the interplay of apoptosis and proliferation mediated by Bcl-xL:Bim interactions in pancreatic cancer cells. (omicsdi.org)
The importance of the complex network of direct interactions between proteins - known as the interactome - to both biological systems and the development of diseases is widely recognized. (lifechemicals.com)
Life Chemicals has designed PPI Screening Libraries by a receptor-based approach that gathered a number of the most attractive PPI targets for therapeutic intervention via disrupting specific functional interactions between proteins. (lifechemicals.com)
The goal is to understand how protein-protein interactions involving CP can manage a relatively fast actin polymerization response to cellular stimuli. (nih.gov)

Here, through reconstitution of cells lacking all eight pro-apoptotic BH3-only proteins, we demonstrate that all BH3-only proteins primarily target the anti-apoptotic BCL-2 proteins BCL-xL/MCL-1, whose simultaneous suppression enables membrane-mediated spontaneous activation of BAX/BAK. (omicsdi.org)
Dr. Tjandra is studying how Bax transforms from a soluble protein in the cytoplasm to a membrane-associated protein that irreversibly promotes cell death. (nih.gov)
During viral replication, these proteins assemble and interact with the host membrane to bud off forming infectious particles. (nih.gov)

VACV protein N1 is an intracellular homodimer that contributes to virus virulence and was reported to inhibit nuclear factor (NF)-kappaB signalling. (ox.ac.uk)
C57BL/6 splenocytes intracellular stained with BCL/10C4 FITC. (biolegend.com)

Apoptosis regulator proteins, Bcl-2 family, BH1-4 domains. (biolegend.com)

On lymphoblastoid cell lines, the bcl-2 staining intensity was variable and not necessarily correlated to molecular rearrangements of the bcl-2 gene. (ox.ac.uk)
Of four centroblastic-centrocytic cases with rearrangements of the bcl-2 gene, only two presented elevated amounts of bcl-2 protein, indicating that the levels of bcl-2 are not diagnostic of the translocation. (ox.ac.uk)
The gene encoding p53 protein is mutated or deleted in half of the human cancers, which inactivates tumor suppressor activity. (lifechemicals.com)
TP53-induced gene 3 protein. (nih.gov)

Gamma herpesviruses also encode homologs of the Bcl-2 family. (nih.gov)
All tested herpesvirus Bcl-2 homologs possess antiapoptotic activity, including the more distantly related homologs encoded by murine gammaherpesvirus 68 (gammaHV68) and bovine herpesvirus 4 (BHV4), as described here. (nih.gov)
To determine if viral Bcl-2 proteins can be converted into death factors, similar to their cellular counterparts, five herpesvirus Bcl-2 homologs from five different viruses were tested for their susceptibility to caspases. (nih.gov)

The role of apoptosis, proliferation, and the Bcl-2-related proteins in the myelodysplastic syndromes and acute myeloid leukemia secondary to MDS. (bvsalud.org)
Bone marrow CD34(+) cell apoptosis ( annexin V ), proliferation (Ki-67), and Bcl-2-related protein expression was evaluated by flow cytometry in 102 patients with myelodysplastic syndrome (MDS) and acute myeloid leukemia secondary to MDS (MDS-AML) and in 30 normal donors (NBM). (bvsalud.org)
Additionally, apoptotic-enhancing fusion proteins of the current invention could be used to inhibit cell growth, e.g., uncontrolled cellular proliferation. (nih.gov)
Moreover, knockdown of FKBP10 significantly inhibited the proliferation of CcRCC cells, notably declined the protein expression of c-Myc, cyclin D1, and Bcl-2, and promoted cell adhesion. (hindawi.com)

To help resolve this question, we have permanently and stably down-regulated Bcl-2 protein and mRNA expression in 518A2 cells by two different technologies and evaluated the resulting clones both in vitro and in vivo. (elsevier.com)
Experimental Design: 518A2 melanoma cells were transfected with plasmids engineered to produce either a single-stranded antisense oligonucleotide targeted to the initiation codon region of the Bcl-2 mRNA or a short hairpin RNA also targeted to the Bcl-2 mRNA. (elsevier.com)
However, when xenografted into severe combined immunodeficient mice, cells with silenced Bcl-2, using either technology, either failed to grow at all or grew to tumors of low volume and then completely regressed. (elsevier.com)
In contrast, control cells with "normal" levels of Bcl-2 protein expression expanded to be large, necrotic tumors. (elsevier.com)
Conclusions: The presence of Bcl-2 protein profoundly affects the ability of 518A2 melanoma cells to grow as human tumor xenografts in severe combined immunodeficient mice. (elsevier.com)
The in vivo role of Bcl-2 in melanoma cells thus differs significantly from its in vitro role, and these experiments further suggest that Bcl-2 may be an important therapeutic target even in tumors that do not contain the t14:18 translocation. (elsevier.com)
For example, fusing various cell-binding domains to Bcl-X L and Bad allows targeting to specific subsets of cells in vivo, permitting treatment and/or prevention of cell-death related consequences of various diseases and injuries. (nih.gov)
Remarkably, death ligand-induced apoptosis in cells lacking BH3-only proteins and MCL-1 is fully restored by BID mutants capable of neutralizing BCL-xL, but not direct activation of BAX/BAK. (omicsdi.org)
A major mechanism through which cancer cells avoid apoptosis is by promoting the association of anti-apoptotic members of the pro-survival Bcl-2 protein family (like Bcl-2 and Bcl-xL) with BH(3) domain-only proteins (like Bim and Bid). (omicsdi.org)
We have developed a sensitive immunofluorescence assay for the single- and multicolor flow cytometric analysis of bcl-2 protein in relation to other markers and cell cycle, based on a fixation-permeation step of cells with paraformaldehyde and Triton X100 and the use of a bcl-2 specific monoclonal antibody (MoAb). (ox.ac.uk)
As an application of this method, we have examined the expression of bcl-2 in normal and neoplastic lymphoid cells. (ox.ac.uk)
following in vitro mitogen activation, the bcl-2 reactivity decreased slightly in the former but markedly in latter cells. (ox.ac.uk)
The discovery from the TRAIL protein and its own death receptors DR4/5 changed the horizon of cancer research because TRAIL specifically kills cancer cells. (colinsbraincancer.com)
Small molecules that disrupt this interaction by binding to the anti-apoptotic BCL-2 family proteins have been designed to induce apoptosis of cancer cells [2]. (lifechemicals.com)
37. Von Hippel-Lindau tumor suppressor protein transforms human neuroblastoma cells into functional neuron-like cells. (nih.gov)
38. Regulation of Bcl-2 oncoprotein levels with differentiation of human neuroblastoma cells. (nih.gov)
BCL-2 is a protein that promotes cell survival by preventing cells from undergoing a natural self-destruct process called apoptosis. (aacr.org)
Elevated levels of BCL-2 have been seen in several types of leukemia cells, including AML cells and chronic lymphocytic leukemia (CLL) cells. (aacr.org)
By blocking BCL-2, venetoclax triggers the leukemia cells to die by apoptosis. (aacr.org)
In addition, these data suggested that avicularin prevented the activation of the mitogen‑activated protein kinase kinase (MEK)/nuclear factor kappa light‑chain‑enhancer of activated B‑cells (NF‑κB) pathway activated by TNF‑α. (spandidos-publications.com)
Cystinosis is a rare inheritable disorder in which cystine, a small protein, accumulates in all cells throughout the body. (hrb.ie)
It works by blocking the action of a certain protein in the body that helps cancer cells survive. (medlineplus.gov)
Western blot was utilized to examine the protein expression level of c-Myc, cyclin D1, and Bcl-2 in the cells. (hindawi.com)
We further demonstrated that 1g inhibited cell growth, suppressed migration and invasion, and induced apoptosis of CNE-2Z cells by down-regulating HIF-1α, MMP-2, MMP-9, Bcl-2, Akt and up-regulating Bax protein levels. (bvsalud.org)

Superoxide induces dephosphorylation of Bcl-2 through MAP kinase ERK1/2 inactivation, which promotes ubiquitination of Bcl-2. (cdc.gov)

The BCL\2 antibody was bought from Dako (Agilent Technology, Santa Clara, CA, USA). (neighborhoodhousecharterschool.org)

However the manifestation and assembly of rat FS parts during spermiogenesis have not been precisely examined aside from A-kinase anchoring proteins 4 (AKAP4) [15] and tissue-specific testicular thioredoxin-2 (SPTRX-2) [11]. (monossabios.com)
This protein is modified by ASK1/JNK1, PKC, ERKs, and stress-activated kinase phosphorylation and can be ubiquitinated. (biolegend.com)
also called Cdc2) cyclin-dependent protein kinase. (nih.gov)
a protein kinase that inhibits Cdk1. (nih.gov)
ataxia telangiectasia mutated) a protein kinase that signals the presence of certain types of DNA damage. (nih.gov)
Ibrutinib is an inhibitor of Bruton's tyrosine kinase (BTK) in the B-cell receptor signaling cascade, and venetoclax inhibits B-cell lymphoma protein 2 (Bcl-2) interaction with select BH3 domain proteins, thereby promoting apoptosis. (medscape.com)

These include the BH3 sequence shared with other pro-apoptotic proteins and an unexpected sequence located near the Bim carboxyl-terminus (residues 181-192). (omicsdi.org)

Further, BID and BIM do not distinguish BAX from BAK or accelerate BAX/BAK activation following inactivation of BCL-xL/MCL-1. (omicsdi.org)

Glasdegib is a molecularly targeted therapeutic directed against a protein called Smoothened. (aacr.org)
Venetoclax is a molecularly targeted therapeutic directed against the protein BCL-2. (aacr.org)

a tumor suppressor protein often mutated in human cancers. (nih.gov)
retinoblastoma protein, a tumor suppressor that binds to the E2F family of transcription activators. (nih.gov)

Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. (medlineplus.gov)

The present invention relates to the field of apoptosis, in particular, it relates to apoptosis-modifying fusion proteins with at least two domains, one of which targets the fusion proteins to a target cell, and another of which modifies an apoptotic response of the target cell. (nih.gov)
The proteins of the Bcl-2 family are important regulators of apoptosis, or programmed cell death. (omicsdi.org)
In both cases the bcl-2 expression was not restricted to a specific phase of the cell cycle, as evidenced by two-color analysis. (ox.ac.uk)
Among fresh B-cell non-Hodgkin's lymphomas (B-NHL), most sporadic Burkitt's cases were bcl-2 negative. (ox.ac.uk)
One is the Bcl-2 protein Bax, which is a critical component in programmed cell death. (nih.gov)
Bcl-2 has been reported to regulate cell cycle progression via ROS. (biolegend.com)
This work also suggests that calcium-binding proteins are useful markers for studies on inner ear hair cell differentiation and regeneration. (jneurosci.org)
also called CCNB1) cyclin B, a cell cycle inducible protein, prominent in mitosis, which activates cdks. (nih.gov)
a protein that binds to the Cdt1 component of the pre-replication complex and inactivates it, preventing assembly of the pre-replication complex at inappropriate times during the cell cycle. (nih.gov)
also called CCNA1) cyclin A, a cell cycle inducible protein, prominent in S-phase, which activates cdks. (nih.gov)
CCND1 is a member of the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. (nih.gov)

Several strategies have been employed to target the expression of this protein, including G3139, an 18-mer phosphorothioate oligodeoxyribonucleotide targeted to the initiation region of the Bcl-2 mRNA. (elsevier.com)
Concurrently, avicularin inhibited the mRNA and protein expression levels of iNOS and COX‑2 increased by TNF‑α. (spandidos-publications.com)

Although disease progression is accompanied by a fall in pro-apoptotic versus anti-apoptotic Bcl-2-related protein ratios, heterogeneity in patterns of protein expression indicates that factors additional to Bcl-2 family members play a role in the deregulated apoptosis in MDS. (bvsalud.org)
These proteins regulate this fundamental biological process via the formation of heterodimers involving both pro- and anti-apoptotic family members. (omicsdi.org)
The structure also reveals that N1 has a constitutively open surface groove similar to the grooves of other anti-apoptotic Bcl-2 proteins, which bind the BH3 motifs of pro-apoptotic Bcl-2 family members. (ox.ac.uk)
Instead, BH3-only proteins appear to control apoptosis by neutralizing pro-survival Bcl2 family members. (the-scientist.com)
The Bcl-2 protein forms homo- or hetero-dimers with other Bcl-2 family members. (biolegend.com)
BCL2 associated x protein, highly homologous Bcl-2 family members lacking the BH4 domain. (nih.gov)

FLIP, Fas-associated death domain-like interleukin-1β converting enzyme-like inhibitory protein. (cdc.gov)

CDK - a family of cyclin-dependent protein kinases. (nih.gov)

Using automated Fluorescence Lifetime Imaging Microscopy - Fluorescence Resonance Energy Transfer (FLIM-FRET) we show that the two binding interfaces enable Bim to double-bolt lock Bcl-XL and Bcl-2 in complexes resistant to displacement by BH3-mimetic drugs currently in use or being evaluated for cancer therapy. (omicsdi.org)
In particular, he wants to improve the ability of NMR to study protein complexes in their proper context, i.e. as part of multi-component systems in complex lipid environments. (nih.gov)

Only the viral Bcl-2 protein encoded by gammaHV68 was susceptible to caspase digestion. (nih.gov)

Recently, we have developed the CABS-dock method for flexible protein-peptide docking that enables large-scale rearrangements of the protein chain. (nature.com)
The presented case study demonstrates that CABS-dock methodology opens up new opportunities for protein-peptide docking with large-scale changes of the protein receptor structure. (nature.com)
The protein-peptide binding process frequently involves significant conformational rearrangements of protein receptor and peptide chains. (nature.com)
Typically, these PPI inhibitors disrupt the interaction between a globular protein and a single peptide chain on the partner protein by binding into pockets on the surface of the globular protein. (lifechemicals.com)
PPIs can be classified into groups based on common structural elements in both the globular protein and the peptide chain. (lifechemicals.com)

Results: In vitro, down-regulation of Bcl-2 expression by either method produced no change either in the rate of growth or in sensitivity to standard cytotoxic chemotherapeutic agents. (elsevier.com)

Different Roles of Beclin1 in the Interaction Between Glia and Neurons after Exposure to Morphine and the HIV- Trans-Activator of Transcription (Tat) Protein. (nih.gov)
Several docking constraints (positional, H-bond, metal chelation) and amino acid rotatable groups involved in protein-ligand interaction are allowed where reasonable. (lifechemicals.com)

Our results provide insight into the molecular basis for the promiscuous nature of this molecular recognition process by members of the Bcl-2 protein family. (omicsdi.org)
Remarkably, although N1 shows no sequence similarity to cellular proteins, its three-dimensional structure closely resembles Bcl-x(L) and other members of the Bcl-2 protein family. (ox.ac.uk)

24. Transcription factor activating protein 2 beta (TFAP2B) mediates noradrenergic neuronal differentiation in neuroblastoma. (nih.gov)

Examples of virtual hit compounds (binding site: 6GL8) from the BCL-2 compound set. (lifechemicals.com)

It has been widely accepted that mitochondria-dependent apoptosis initiates when select BH3-only proteins (BID, BIM, etc.) directly engage and allosterically activate effector proteins BAX/BAK. (omicsdi.org)

Clone BCL/10C4 has been shown to be useful for Western blotting, immunoprecipitation, and immunofluorescence of the mouse and rat Bcl-2 protein. (biolegend.com)

Anatomy28

Organisms13

Diseases23

Chemicals and Drugs96

Analytical, Diagnostic and Therapeutic Techniques and Equipment27

Phenomena and Processes76

Disciplines and Occupations1

Technology, Industry, Agriculture2

Information Science3

Bcl-2 regulates amplification of caspase activation by cytochrome c. (1/2563)

Bcl-2 and Bcl-XL serve an anti-inflammatory function in endothelial cells through inhibition of NF-kappaB. (2/2563)

Constitutive activation of Stat3 signaling confers resistance to apoptosis in human U266 myeloma cells. (3/2563)

In vitro induction of activation-induced cell death in lymphocytes from chronic periodontal lesions by exogenous Fas ligand. (4/2563)

Control of apoptosis in Epstein Barr virus-positive nasopharyngeal carcinoma cells: opposite effects of CD95 and CD40 stimulation. (5/2563)

Role of cytokine signaling molecules in erythroid differentiation of mouse fetal liver hematopoietic cells: functional analysis of signaling molecules by retrovirus-mediated expression. (6/2563)

Rubella virus-induced apoptosis varies among cell lines and is modulated by Bcl-XL and caspase inhibitors. (7/2563)

Bcl-2 overexpression results in reciprocal downregulation of Bcl-X(L) and sensitizes human testicular germ cell tumours to chemotherapy-induced apoptosis. (8/2563)

bcl-2-Associated X Protein

Trans-Activators

Hepatitis B virus

Hepatitis B Antigens

Carcinoma, Hepatocellular

Liver Neoplasms

Proto-Oncogene Proteins c-bcl-2

Bornaviridae

Hepatocytes

Transcriptional Activation

Cell Line

Hep G2 Cells

Apoptosis

Transfection

Fragile X Mental Retardation Protein

Hepatitis B Virus, Woodchuck

Gene Expression Regulation, Viral

DNA-Binding Proteins

Hepatitis B

Marmota

Base Sequence

Transcription, Genetic

Molecular Sequence Data

Borna disease virus

Cell Line, Tumor

Hepadnaviridae

Promoter Regions, Genetic

Chloramphenicol O-Acetyltransferase

Transcription Factors

X Chromosome

Tumor Suppressor Protein p53

Mutation

Protein Binding

Liver

Group X Phospholipases A2

Blotting, Western

Plasmids

RNA, Messenger

Signal Transduction

Viral Regulatory and Accessory Proteins

Tumor Cells, Cultured

NF-kappa B

Virus Replication

Mice, Transgenic

Amino Acid Sequence

Precipitin Tests

Gene Expression Regulation

Mitochondria

Proto-Oncogene Proteins

Genes, bcl-2

Viral Proteins

Cell Nucleus

Hepatitis B, Chronic

Binding Sites

Reverse Transcriptase Polymerase Chain Reaction

Genes, Viral

Hepatitis B Core Antigens

Proteasome Endopeptidase Complex

bcl-X Protein

Cell Proliferation

Up-Regulation

Hepatocyte Nuclear Factor 1

Down-Regulation

Nuclear Proteins

RNA, Small Interfering

CARD Signaling Adaptor Proteins

Two-Hybrid System Techniques

DNA, Viral

Translocation, Genetic

Cell Survival

Gene Expression Regulation, Neoplastic

RNA Interference

Lymphoma, B-Cell

Caspase 3

Caspases

Enhancer Elements, Genetic

Fragile X Syndrome

Chromosomes, Human, Pair 14

Gene Expression

HeLa Cells