AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation ScienceHealth Care
Base SequenceBase PairingNucleic Acid ConformationDNABase CompositionNucleic Acid DenaturationMolecular Sequence DataNucleic Acid RenaturationOligonucleotidesNucleic Acid HybridizationOligodeoxyribonucleotidesPolydeoxyribonucleotidesAminacrineDNA, ViralDNA, BacterialRNA, Ribosomal, 18SEscherichia coliPoly dA-dTCloning, MolecularRNA, RibosomalSkull BaseGuanineSequence Homology, Nucleic AcidDNA, CircularAmino Acid SequenceGenesSaccharomycesSchiff BasesIntercalating AgentsPlasmidsModels, MolecularRNAAdenineSaccharomycetalesDNA Restriction EnzymesMutationRepetitive Sequences, Nucleic AcidRNA, ViralTranscription, GeneticDNA, Single-StrandedDeoxyribonucleotidesSpecies SpecificityThermodynamicsPoly ATritiumColiphagesRNA, MessengerKineticsOligoribonucleotidesHybridization, GeneticTemperatureChemistryGenes, BacterialRNA, BacterialChemical PhenomenaNucleotidesRNA, FungalBinding SitesGenes, ViralRestriction MappingHot TemperatureTransformation, GeneticMagnetic Resonance SpectroscopyTemplates, GeneticMolecular WeightCentrifugation, Density GradientDNA, RecombinantRibonucleasesEndonucleasesPhylogenySubstrate SpecificityDNA ProbesCell LineStructure-Activity RelationshipDNA ReplicationPolymerase Chain ReactionSkull Base NeoplasmsPromoter Regions, GeneticDNA PrimersModels, ChemicalBiological EvolutionBase Pair MismatchCircular DichroismSequence Analysis, DNADNA-Directed RNA PolymerasesSequence AlignmentMicroscopy, ElectronProtein BiosynthesisElectrophoresis, Polyacrylamide GelDenture BasesBacterial ProteinsComputer SimulationViral ProteinsDNA, RibosomalDNA-Binding ProteinsProtein BindingDNA DamageKnowledge BasesMannich BasesDNA GlycosylasesDNA RepairThymineHydrogen BondingUracil
Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Base Pairing: Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Base Composition: The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.Nucleic Acid Denaturation: Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Nucleic Acid Renaturation: The reformation of all, or part of, the native conformation of a nucleic acid molecule after the molecule has undergone denaturation.Oligonucleotides: Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Polydeoxyribonucleotides: A group of 13 or more deoxyribonucleotides in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Aminacrine: A highly fluorescent anti-infective dye used clinically as a topical antiseptic and experimentally as a mutagen, due to its interaction with DNA. It is also used as an intracellular pH indicator.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.RNA, Ribosomal, 18S: Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Poly dA-dT: Polydeoxyribonucleotides made up of deoxyadenine nucleotides and thymine nucleotides. Present in DNA preparations isolated from crab species. Synthetic preparations have been used extensively in the study of DNA.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.RNA, Ribosomal: The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)Skull Base: The inferior region of the skull consisting of an internal (cerebral), and an external (basilar) surface.GuanineSequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.DNA, Circular: Any of the covalently closed DNA molecules found in bacteria, many viruses, mitochondria, plastids, and plasmids. Small, polydisperse circular DNA's have also been observed in a number of eukaryotic organisms and are suggested to have homology with chromosomal DNA and the capacity to be inserted into, and excised from, chromosomal DNA. It is a fragment of DNA formed by a process of looping out and deletion, containing a constant region of the mu heavy chain and the 3'-part of the mu switch region. Circular DNA is a normal product of rearrangement among gene segments encoding the variable regions of immunoglobulin light and heavy chains, as well as the T-cell receptor. (Riger et al., Glossary of Genetics, 5th ed & Segen, Dictionary of Modern Medicine, 1992)Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Saccharomyces: A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.Schiff Bases: Condensation products of aromatic amines and aldehydes forming azomethines substituted on the N atom, containing the general formula R-N:CHR. (From Grant & Hackh's Chemical Dictionary, 5th ed)Intercalating Agents: Agents that are capable of inserting themselves between the successive bases in DNA, thus kinking, uncoiling or otherwise deforming it and therefore preventing its proper functioning. They are used in the study of DNA.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Adenine: A purine base and a fundamental unit of ADENINE NUCLEOTIDES.Saccharomycetales: An order of fungi in the phylum Ascomycota that multiply by budding. They include the telomorphic ascomycetous yeasts which are found in a very wide range of habitats.DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.DNA, Single-Stranded: A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.Deoxyribonucleotides: A purine or pyrimidine base bonded to a DEOXYRIBOSE containing a bond to a phosphate group.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Thermodynamics: A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)Poly A: A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.TritiumColiphages: Viruses whose host is Escherichia coli.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Kinetics: The rate dynamics in chemical or physical systems.Oligoribonucleotides: A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.Hybridization, Genetic: The genetic process of crossbreeding between genetically dissimilar parents to produce a hybrid.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Chemistry: A basic science concerned with the composition, structure, and properties of matter; and the reactions that occur between substances and the associated energy exchange.Genes, Bacterial: The functional hereditary units of BACTERIA.RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.Chemical Phenomena: The composition, conformation, and properties of atoms and molecules, and their reaction and interaction processes.Nucleotides: The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)RNA, Fungal: Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Genes, Viral: The functional hereditary units of VIRUSES.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Hot Temperature: Presence of warmth or heat or a temperature notably higher than an accustomed norm.Transformation, Genetic: Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.Magnetic Resonance Spectroscopy: Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).Templates, Genetic: Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.Molecular Weight: The sum of the weight of all the atoms in a molecule.Centrifugation, Density Gradient: Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.Ribonucleases: Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.Endonucleases: Enzymes that catalyze the hydrolysis of the internal bonds and thereby the formation of polynucleotides or oligonucleotides from ribo- or deoxyribonucleotide chains. EC 3.1.-.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.DNA Replication: The process by which a DNA molecule is duplicated.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Skull Base Neoplasms: Neoplasms of the base of the skull specifically, differentiated from neoplasms of unspecified sites or bones of the skull (SKULL NEOPLASMS).Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Models, Chemical: Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.Biological Evolution: The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.Base Pair Mismatch: The presence of an uncomplimentary base in double-stranded DNA caused by spontaneous deamination of cytosine or adenine, mismatching during homologous recombination, or errors in DNA replication. Multiple, sequential base pair mismatches lead to formation of heteroduplex DNA; (NUCLEIC ACID HETERODUPLEXES).Circular Dichroism: A change from planar to elliptic polarization when an initially plane-polarized light wave traverses an optically active medium. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Microscopy, Electron: Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Denture Bases: The part of a denture that overlies the soft tissue and supports the supplied teeth and is supported in turn by abutment teeth or the residual alveolar ridge. It is usually made of resins or metal or their combination.Bacterial Proteins: Proteins found in any species of bacterium.Computer Simulation: Computer-based representation of physical systems and phenomena such as chemical processes.Viral Proteins: Proteins found in any species of virus.DNA, Ribosomal: DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.DNA Damage: Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.Knowledge Bases: Collections of facts, assumptions, beliefs, and heuristics that are used in combination with databases to achieve desired results, such as a diagnosis, an interpretation, or a solution to a problem (From McGraw Hill Dictionary of Scientific and Technical Terms, 6th ed).Mannich Bases: Ketonic amines prepared from the condensation of a ketone with formaldehyde and ammonia or a primary or secondary amine. A Mannich base can act as the equivalent of an alpha,beta unsaturated ketone in synthesis or can be reduced to form physiologically active amino alcohols.DNA Glycosylases: A family of DNA repair enzymes that recognize damaged nucleotide bases and remove them by hydrolyzing the N-glycosidic bond that attaches them to the sugar backbone of the DNA molecule. The process called BASE EXCISION REPAIR can be completed by a DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE which excises the remaining RIBOSE sugar from the DNA.DNA Repair: The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.ThymineHydrogen Bonding: A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.Uracil

Evidence on the conformation of HeLa-cell 5.8S ribosomal ribonucleic acid from the reaction of specific cytidine residues with sodium bisulphite. (1/178859)

The reaction of HeLa-cell 5.8S rRNA with NaHSO3 under conditions in which exposed cytidine residues are deaminated to uridine was studied. It was possible to estimate the reactivities of most of the 46 cytidine residues in the nucleotide sequence by comparing 'fingerprints' of the bisulphite-treated RNA with those of untreated RNA. The findings were consistent with the main features of the secondary-structure model for mammalian 5.85S rRNA proposed by Nazar, Sitz, & Busch [J. Biol. Chem (1975) 250, 8591--8597]. Five out of six regions that are depicted in the model as single-stranded loops contain cytidine residues that are reactive towards bisulphite at 25 degrees C (the other loop contains no cytidine). The cytidine residue nearest to the 3'-terminus is also reactive. Several cytidines residues that are internally located within proposed double-helical regions show little or no reactivity towards bisulphite, but the cytidine residues of several C.G pairs at the ends of helical regions show some reactivity, and one of the proposed loops appears to contain six nucleotides, rather than the minimum of four suggested by the primary structure. Two cytidine residues that are thought to be 'looped out' by small helix imperfections also show some reactivity.  (+info)

Marker effects on reversion of T4rII mutants. (2/178859)

The frequencies of 2-aminopurine- and 5-bromouracil-induced A:T leads to G:C transitions were compared at nonsense sites throughout the rII region of bacteriophage T4. These frequencies are influenced both by adjacent base pairs within the nonsense codons and by extracodonic factors. Following 2AP treatment, they are high in amber (UAG) and lower in opal (UGA) codons than in allelic ochre (UAA) codons. In general, 5BU-induced transitions are more frequent in both amber and opal codons than in the allelic ochre codons. 2AP- and 5BU-induced transition frequencies in the first and third positions of opal codons are correlated with those in the corresponding positions of the allelic ochre codons. Similarly, the frequencies of 2AP-induced transition in the first and second positions of amber codons and their ochre alleles are correlated. However, there is little correlation between the frequencies of 5BU-induced transitions in the first and second positions of allelic amber and ochre codons.  (+info)

Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region. (3/178859)

On the basis of developmental gene expression, the vertebrate central nervous system comprises: a forebrain plus anterior midbrain, a midbrain-hindbrain boundary region (MHB) having organizer properties, and a rhombospinal domain. The vertebrate MHB is characterized by position, by organizer properties and by being the early site of action of Wnt1 and engrailed genes, and of genes of the Pax2/5/8 subfamily. Wada and others (Wada, H., Saiga, H., Satoh, N. and Holland, P. W. H. (1998) Development 125, 1113-1122) suggested that ascidian tunicates have a vertebrate-like MHB on the basis of ascidian Pax258 expression there. In another invertebrate chordate, amphioxus, comparable gene expression evidence for a vertebrate-like MHB is lacking. We, therefore, isolated and characterized AmphiPax2/5/8, the sole member of this subfamily in amphioxus. AmphiPax2/5/8 is initially expressed well back in the rhombospinal domain and not where a MHB would be expected. In contrast, most of the other expression domains of AmphiPax2/5/8 correspond to expression domains of vertebrate Pax2, Pax5 and Pax8 in structures that are probably homologous - support cells of the eye, nephridium, thyroid-like structures and pharyngeal gill slits; although AmphiPax2/5/8 is not transcribed in any structures that could be interpreted as homologues of vertebrate otic placodes or otic vesicles. In sum, the developmental expression of AmphiPax2/5/8 indicates that the amphioxus central nervous system lacks a MHB resembling the vertebrate isthmic region. Additional gene expression data for the developing ascidian and amphioxus nervous systems would help determine whether a MHB is a basal chordate character secondarily lost in amphioxus. The alternative is that the MHB is a vertebrate innovation.  (+info)

Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. (4/178859)

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

Activation of systemic acquired silencing by localised introduction of DNA. (5/178859)

BACKGROUND: In plants, post-transcriptional gene silencing results in RNA degradation after transcription. Among tobacco transformants carrying a nitrate reductase (Nia) construct under the control of the cauliflower mosaic virus 35S promoter (35S-Nia2), one class of transformants spontaneously triggers Nia post-transcriptional gene silencing (class II) whereas another class does not (class I). Non-silenced plants of both classes become silenced when grafted onto silenced stocks, indicating the existence of a systemic silencing signal. Graft-transmitted silencing is maintained in class II but not in class I plants when removed from silenced stocks, indicating similar requirements for spontaneous triggering and maintenance. RESULTS: Introduction of 35S-Nia2 DNA by the gene transfer method called biolistics led to localised acquired silencing (LAS) in bombarded leaves of wild-type, class I and class II plants, and to systemic acquired silencing (SAS) in class II plants. SAS occurred even if the targeted leaf was removed 2 days after bombardment, indicating that the systemic signal is produced, transmitted and amplified rapidly. SAS was activated by sense, antisense and promoterless Nia2 DNA constructs, indicating that transcription is not required although it does stimulate SAS. CONCLUSIONS: SAS was activated by biolistic introduction of promoterless constructs, indicating that the DNA itself is a potent activator of post-transcriptional gene silencing. The systemic silencing signal invaded the whole plant by cell-to-cell and long-distance propagation, and reamplification of the signal.  (+info)

Molecular cloning and epitope analysis of the peanut allergen Ara h 3. (6/178859)

Peanut allergy is a significant IgE-mediated health problem because of the increased prevalence, potential severity, and chronicity of the reaction. Following our characterization of the two peanut allergens Ara h 1 and Ara h 2, we have isolated a cDNA clone encoding a third peanut allergen, Ara h 3. The deduced amino acid sequence of Ara h 3 shows homology to 11S seed-storage proteins. The recombinant form of this protein was expressed in a bacterial system and was recognized by serum IgE from approximately 45% of our peanut-allergic patient population. Serum IgE from these patients and overlapping, synthetic peptides were used to map the linear, IgE-binding epitopes of Ara h 3. Four epitopes, between 10 and 15 amino acids in length, were found within the primary sequence, with no obvious sequence motif shared by the peptides. One epitope is recognized by all Ara h 3-allergic patients. Mutational analysis of the epitopes revealed that single amino acid changes within these peptides could lead to a reduction or loss of IgE binding. By determining which amino acids are critical for IgE binding, it might be possible to alter the Ara h 3 cDNA to encode a protein with a reduced IgE-binding capacity. These results will enable the design of improved diagnostic and therapeutic approaches for food-hypersensitivity reactions.  (+info)

TIF1gamma, a novel member of the transcriptional intermediary factor 1 family. (7/178859)

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. (8/178859)

The telomerase reverse transcriptase component (TERT) is not expressed in most primary somatic human cells and tissues, but is upregulated in the majority of immortalized cell lines and tumors. Here, we identify the c-Myc transcription factor as a direct mediator of telomerase activation in primary human fibroblasts through its ability to specifically induce TERT gene expression. Through the use of a hormone inducible form of c-Myc (c-Myc-ER), we demonstrate that Myc-induced activation of the hTERT promoter requires an evolutionarily conserved E-box and that c-Myc-ER-induced accumulation of hTERT mRNA takes place in the absence of de novo protein synthesis. These findings demonstrate that the TERT gene is a direct transcriptional target of c-Myc. Since telomerase activation frequently correlates with immortalization and telomerase functions to stabilize telomers in cycling cells, we tested whether Myc-induced activation of TERT gene expression represents an important mechanism through which c-Myc acts to immortalize cells. Employing the rat embryo fibroblast cooperation assay, we show that TERT is unable to substitute for c-Myc in the transformation of primary rodent fibroblasts, suggesting that the transforming activities of Myc extend beyond its ability to activate TERT gene expression and hence telomerase activity.  (+info)

Sequence context effect for hMSH2-hMSH6 mismatch-dependent activation | PNAS  Sequence context effect for hMSH2-hMSH6 mismatch-dependent activation | PNAS
We describe the effect of nearest-neighbor sequence context on mismatch-dependent activation of hMSH2-hMSH6. Examination of the intrinsic sequences that occur around symmetric mismatched nucleotides suggests little if any effect of non-nearest-neighbor base pairs on hMSH2-hMSH6 mismatch recognition and ATPase activation (20), although longer-range effects have been reported (22). Although a sequence context effect is not novel in MMR (21), the underlying mechanism is unknown. Our studies have suggested that when a significant nearest-neighbor sequence context effect is manifest, 2 × 3′-purines enhanced, and 2 × 3′-pyrimidines reduced hMSH2-hMSH6 ATPase activation (kcat). A similar trend is observed for mismatch binding (KD), whereas an inverse effect was observed for the Tm of unbound mismatched oligonucleotides. Importantly, the KD and Tm do not accurately account for hMSH2-hMSH6 ATPase activation. Interestingly, the effect of sequence context on KD appears associated with alteration of ...
https://www.pnas.org/content/106/11/4177
Leicester Research Archive: Sequences involved in the control of translation in potato virus S.  Leicester Research Archive: Sequences involved in the control of translation in potato virus S.
Specific cis-acting sequences within the carlavirus potato virus S (PVS) genomic RNA molecule appear to control gene expression at the translational level. Two sequences have been investigated, the untranslated sequence upstream from the initiation codon of the viral coat protein gene, designated VTE and the 5 untranslated leader sequence from the genomic RNA molecule (PVS 5). In vitro and in vivo, either of these sequences enhance the translation of a downstream open reading frame when provided as the untranslated leader in a transcript molecule. Translational enhancement was also detected at the transgenic plant level. Both PVS sequences were deleted in an attempt to identify the core regulatory element responsible for this translational enhancement phenomenon. Results indicate that in vitro and in vivo, the functional motif is contained within the 5 promixal portion of both sequences. When the sequences of these important regions were compared, a homologous block of nucleotides was ...
https://lra.le.ac.uk/handle/2381/35361
Determination of binding constants for cooperative site-specific protein-DNA interactions using the gel mobility-shift assay<...  Determination of binding constants for cooperative site-specific protein-DNA interactions using the gel mobility-shift assay<...
TY - JOUR. T1 - Determination of binding constants for cooperative site-specific protein-DNA interactions using the gel mobility-shift assay. AU - Senear, D. F.. AU - Brenowitz, M.. PY - 1991/9/9. Y1 - 1991/9/9. N2 - We have investigated the question of whether the gel mobility-shift assay can provide data that are useful to the demonstration of cooperativity in the site-specific binding of proteins to DNA. Three common patterns of protein-DNA interaction were considered: (i) the cooperative binding of a protein to two sites (illustrated by the Escherichia coli Gal repressor); (ii) the cooperative binding of a bidentate protein to two sites (illustrated by the E. coli Lac repressor); and (iii) the cooperative binding of a protein to three sites (illustrated by the λcI repressor). A simple, rigorous, and easily extendable statistical mechanical approach to the derivation of the binding equations for the different patterns is presented. Both stimulated and experimental data for each case are ...
https://einstein.pure.elsevier.com/en/publications/determination-of-binding-constants-for-cooperative-site-specific--2
Cbf1p is required for chromatin remodeling at promoter-proximal CACGTG motifs in yeast. - Oxford Neuroscience  Cbf1p is required for chromatin remodeling at promoter-proximal CACGTG motifs in yeast. - Oxford Neuroscience
Cbf1p is a basic-helix-loop-helix-zipper protein of Saccharomyces cerevisiae required for the function of centromeres and MET gene promoters, where it binds DNA via the consensus core motif CACRTG (R = A or G). At MET genes Cbf1p appears to function in both activator recruitment and chromatin-remodeling. Cbf1p has been implicated in the regulation of other genes, and CACRTG motifs are common in potential gene regulatory DNA. A recent genome-wide location analysis showed that the majority of intergenic CACGTG palindromes are bound by Cbf1p. Here we tested whether all potential Cbf1p binding motifs in the yeast genome are likely to be bound by Cbf1p using chromatin immunoprecipitation. We also tested which of the motifs are actually functional by assaying for Cbf1p-dependent chromatin remodeling. We show that Cbf1p binding and activity is restricted to palindromic CACGTG motifs in promoter-proximal regions. Cbf1p does not function through CACGTG motifs that occur in promoter-distal locations within coding
https://www.neuroscience.ox.ac.uk/publications/101189
Transcriptome Profiling Using Single-Molecule Direct RNA Sequencing | SpringerLink  Transcriptome Profiling Using Single-Molecule Direct RNA Sequencing | SpringerLink
Methods for in-depth characterization of transcriptomes and quantification of transcript levels have emerged as valuable tools for understanding cellular physiology and human disease biology, and have begun to be utilized in various clinical diagnostic applications. Today, current methods utilized by the scientific community typically require RNA to be converted to cDNA prior to comprehensive measurements. However, this cDNA conversion process has been shown to introduce many biases and artifacts that interfere with the proper characterization and quantitation of transcripts. We have developed a direct RNA sequencing (DRS) approach, in which, unlike other technologies, RNA is sequenced directly without prior conversion to cDNA. The benefits of DRS include the ability to use minute quantities (e.g. on the order of several femtomoles) of RNA with minimal sample preparation, the ability to analyze short RNAs which pose unique challenges for analysis using cDNA-based approaches, and the ability to ...
https://link.springer.com/protocol/10.1007%2F978-1-61779-089-8_4
Full Length cDNA Clones Lauched by Creative Biogene | Raleigh News Now  Full Length cDNA Clones Lauched by Creative Biogene | Raleigh News Now
The full-length ORF clone contains only the coding sequence of the full-length protein, while the other full-length cDNA clones contain some untranslated sequences, such as the 5side or 3′ side non translation. It is well known that these untranslated sequences may have a negative effect on the transcription and translation processes of the encoded proteins in the host.. If it is the ORF expressed clone, it can be transfected into cells and expressed in cells.. In the general situation, the carrier of cDNA clone is not the expression vector, so it can not be directly used for transfection of cells.. The difference between ORF, cDNA and CDS:. 1.what is a full-length ORF clone?. A full-length ORF clone is a plasmid inserted into a DNA fragment encoding a full-length protein. The inserted DNA fragment only contains sequence incoding a full-length protein, and does not contain the untranslated region of 5 or 3 end (UTRs) or intron.. 2.why should the full length ORF cDNA clones are used instead ...
http://www.raleighnewsnow.com/story/124162/full-length-cdna-clones-lauched-by-creative-biogene.html
Detection of 28S RNA with the FGF-2 cDNA at high stringency through related G/C-rich sequences - Semantic Scholar  Detection of 28S RNA with the FGF-2 cDNA at high stringency through related G/C-rich sequences - Semantic Scholar
Fibroblast growth factor-2 (FGF-2) or basic FGF is a multifunctional protein that, through interaction with specific cell surface receptors, plays important roles in the growth and development of tissues and organs. Thus, considerable attention has focused on the control of FGF-2 gene expression, including assessments of RNA levels through blotting and the use of radiolabeled FGF-2 cDNA probes. Multiple transcripts of different sizes have been reported for FGF-2 by this approach, however, more recent evidence indicates that at least one of these RNAs of about 1.5 kb, is not an authentic FGF-2 transcript. A major band of 4.7 kb and a minor band of 6.1 kb were detected in total rat glial tumor cell RNA, using the intact rat ovarian FGF-2 cDNA as a probe at high stringency. This cDNA contains both coding and 5′-untranslated sequences. Although the 6.1 kb transcript levels were increased in RNA enriched for polyadenylated species, the levels of the 4.7 kb band were decreased and also shared a mobility
https://www.semanticscholar.org/paper/Detection-of-28S-RNA-with-the-FGF-2-cDNA-at-high-s-Cattini-Jin/7bea7cb11901677f36262e8954e8a6b6b7692d9a
Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a...  Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a...
In the preceding paper we described an experiment that determined the in vivo forward mutation rate in a single replication cycle for spleen necrosis virus. In addition to substitutions, frameshifts, and hypermutations, the mutated proviruses contained two classes of deletions. One class of deletions contained short direct repeats at the deletion junctions. Another class of deletions had short stretches of sequences inserted at the deletion junctions. In this report, we describe the deletion mutations, and we present models for their generation. Detailed analysis of two deletions with insertions indicates that these mutations occurred as a result of template switching during plus-strand DNA synthesis. The analysis also indicates that fragments of viral RNA generated by the viral RNase H endonuclease are used as templates and contribute to the sequences inserted at the deletion junctions.. ...
https://www.pnas.org/content/87/16/6024?ijkey=3e7ca06947248df2b66ff34ad71abf91f34d5f5f&keytype2=tf_ipsecsha
The Pem homeobox gene. Androgen-dependent and -independent promoters and tissue-specific alternative RNA splicing. - Semantic...  The Pem homeobox gene. Androgen-dependent and -independent promoters and tissue-specific alternative RNA splicing. - Semantic...
The Pem gene encodes an atypical homeodomain protein, distantly related to Prd/Pax family members, that we demonstrate is regulated in a complex transcriptional and post-transcriptional manner. We show that the rat Pem genomic structure includes three 5-untranslated (5-UT) exons and four coding exons, three of which encode the homeodomain. Several alternatively spliced transcripts were identified, including one that skips an internal coding exon, enabling this mRNA to express a novel form of the Pem protein. Other alternatively spliced mRNAs were characterized that possess different 5-UT regions, including a muscle-specific transcript. The different 5-UT termini present in Pem transcripts conferred different levels of translatability in vitro. Two promoters containing multiple transcription initiation sites were identified: a distal promoter (Pd) in the first 5-UT exon and a proximal promoter (Pp) located in the intron upstream of the first coding exon. The Pd was active in placenta, ovary, tumor
https://www.semanticscholar.org/paper/The-Pem-homeobox-gene-Androgen-dependent-and-indep-Maiti-Doskow/58cfa967743a4c25ba014374475e349af433a296
ProtoScript® II First Strand cDNA Synthesis Kit | NEB  ProtoScript® II First Strand cDNA Synthesis Kit | NEB
ProtoScript II First Strand cDNA Synthesis Kit features two optimized mixes, ProtoScript II Enzyme Mix and ProtoScript II Reaction Mix. The enzyme mix combines ProtoScript II Reverse Transcriptase and Murine RNase Inhibitor, while the reaction mix contains dNTPs and an optimized buffer. ProtoScript II Reverse Transcriptase is a recombinant M-MuLV reverse transcriptase with reduced RNase H activity and increased thermostability. It can be used to synthesize first strand cDNA at higher temperatures than the wild type M-MuLV. The enzyme is active up to 48°C, providing higher specificity and higher yield of cDNA. The kit also provides two optimized primers for reverse transcription and nuclease-free water. An anchored Oligo-dT primer [d(T)23VN] forces the primer to anneal to the beginning of the polyA tail. The optimized Random Primer Mix provides random and consistent priming sites covering the entire RNA templates including both mRNAs and non-polyadenylated RNAs. The first strand cDNA product generated
https://www.neb.com/products/e6560-protoscript-ii-first-strand-cdna-synthesis-kit
US20160304952A1 - In situ nucleic acid sequencing of expanded biological samples - Google Patents  US20160304952A1 - In situ nucleic acid sequencing of expanded biological samples - Google Patents
The invention provides in situ nucleic acid sequencing to be conducted in biological specimens that have been physically expanded. The invention leverages the techniques for expansion microscopy (ExM) to provide new methods for in situ sequencing of nucleic acids as well as new methods for fluorescent in situ sequencing (FISSEQ) in a new process referred to herein as
https://patents.google.com/patent/US20160304952A1
Mouse TCR Profiling  Mouse TCR Profiling
Figure 1. Library preparation workflow and PCR strategy for TCR profiling using the SMARTer approach. Panel A. Reverse transcription and PCR amplification of TCR subunit mRNA sequences. First-strand cDNA synthesis is primed by the TCR dT Primer and performed by an MMLV-derived reverse transcriptase (RT). Upon reaching the 5′ end of each mRNA molecule, the RT adds non-templated nucleotides to the first-strand cDNA. The SMART-Seq v4 Oligonucleotide contains a sequence that is complementary to the non-templated nucleotides added by the RT, and the oligo hybridizes to the first-strand cDNA. In the template-switching step, the RT uses the remainder of the SMART-Seq v4 Oligonucleotide as a template for the incorporation of an additional sequence on the end of the first-strand cDNA. Full-length variable regions of TCR cDNA are selectively amplified by PCR using primers that are complementary to the oligonucleotide-templated sequence (SMART Primer 1) and the constant region(s) of TCR-α and/or TCR-β ...
http://www.clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/NGS_Learning_Resources/Technical_Notes/Mouse_TCR_Profiling?sitex=10020:22372:US&PEBCL1=8YMtyTMirwI3ubwu3SR3ygo7EC&PEBCL1_pses=ZGE81BB9AD9B711DEEEF71A4A84BC7988DBB572E793CBC6155A9C62D1C92FD6838647251BC98433D2FD7E7091BAEEE79845D7B323303A2C72F
Mouse TCR Profiling  Mouse TCR Profiling
Figure 1. Library preparation workflow and PCR strategy for TCR profiling using the SMARTer approach. Panel A. Reverse transcription and PCR amplification of TCR subunit mRNA sequences. First-strand cDNA synthesis is primed by the TCR dT Primer and performed by an MMLV-derived reverse transcriptase (RT). Upon reaching the 5′ end of each mRNA molecule, the RT adds non-templated nucleotides to the first-strand cDNA. The SMART-Seq v4 Oligonucleotide contains a sequence that is complementary to the non-templated nucleotides added by the RT, and the oligo hybridizes to the first-strand cDNA. In the template-switching step, the RT uses the remainder of the SMART-Seq v4 Oligonucleotide as a template for the incorporation of an additional sequence on the end of the first-strand cDNA. Full-length variable regions of TCR cDNA are selectively amplified by PCR using primers that are complementary to the oligonucleotide-templated sequence (SMART Primer 1) and the constant region(s) of TCR-α and/or TCR-β ...
http://www.clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/NGS_Learning_Resources/Technical_Notes/Mouse_TCR_Profiling?sitex=10020:22372:US&PEBCL1=ByZ6S0OoRSh3F0j3gA3UzGqqTj&PEBCL1_pses=ZGF83DC17DD251EE0613D0BFC00D50AE392409EC89F20AF191A9E80799CB1D1CA726FC3E0C28454EF2912BE2297939006B2F0DE8DE6B2A3A24
The Role of CYP3A4 mRNA Transcript with Shortened 3′-Untranslated Region in Hepatocyte Differentiation, Liver Development, and...  The Role of CYP3A4 mRNA Transcript with Shortened 3′-Untranslated Region in Hepatocyte Differentiation, Liver Development, and...
In the current study, we applied cDNA cloning and RNA-Seq methods to identify two alternative CYP3A4 mRNA transcripts, one of which contained partial intron-6 retention and the other with a shorter 3′-UTR.. The CYP3A4 mRNA transcript with partial intron-6 retention can potentially be translated into a novel protein with a shortened amino acid sequence as a result of a translational stop codon in intron 6. However, the absence of a heme-binding signature in the encoded polypeptide precludes a catalytically active protein. Proportion of this transcript in all examined samples is less than 2% of total CYP3A4 mRNA. Therefore, its influence on CYP3A4 function is considered to be limited; as a result, we did not investigate function of this transcript in the current study. Although RNA-Seq also showed faint peaks in intron 11, Cufflinks did not assemble a transcript with intron-11 retention. Thus, the possible existence of intron-11 retention cannot be excluded based on the current evidence, and ...
http://molpharm.aspetjournals.org/content/81/1/86.long
Study About DNA: Base pairing  Study About DNA: Base pairing
king interactions (hydrogen bonding merely provides specificity of the pairing, not stability). As a result, it is both the percentage of GC base pairs and the overall length of a DNA double helix that determine the strength of the association between the two strands of DNA. Long DNA helices with a high GC content have stronger-interacting strands, while short helices with high AT content have weaker-interacting strands. In biology, parts of the DNA double helix that need to separate easily, such as the TATAAT Pribnow box in some promoters, tend to have a high AT content, making the strands easier to pull apart. In the laboratory, the strength of this interaction can be measured by finding the temperature required to break the hydrogen bonds, their melting temperature (also called Tm value). When all the base pairs in a DNA double helix melt, the strands separate and exist in solution as two entirely independent molecules. These single-stranded DNA molecules have no single common shape, but some ...
http://studyaboutdna.blogspot.com/2010/05/base-pairing.html
C# extensions method by JavaScript | Gorgo.Live.ToString()  C# extensions method by JavaScript | Gorgo.Live.ToString()
Not so many people are aware that extensions method are possible to implemented also on JavaScript code. Here you have quick example how to achieve that:1. Lets create class definition function MyClass(imput){ this.myProperty = input; } 2. Lets create object of our class var myObject = new MyClass(test); 3. Now, we are ready to add…
https://mariuszgorzoch.wordpress.com/2014/08/23/c-extensions-method-by-javascript/
Studying Gene Regulation with the LightSwitch System | Active Motif LightSwitch Store  Studying Gene Regulation with the LightSwitch System | Active Motif LightSwitch Store
Luciferase Assay Reagents. OVERVIEW Control of gene expression in eukaryotic cells is regulated on transcriptional and post-transcriptional levels. Transcription factors are important regulators of transcription rates, and microRNAs are key mediators of mRNA stability and translation efficiency.. Regulation of transcription. DNA-encoded elements like promoters interact with transcription factors and other regulatory proteins to determine when, where, and how much of a genes mRNA product gets made. Reporter assays are a powerful technique for measuring the activity of promoters in living cells. Promoter GoClone Reporter Constructs are created by isolating a promoter from the human genome and cloning it upstream of the RenSP luciferase reporter gene on a plasmid. Once this plasmid is transfected into a living cell, a change in promoter activity causes a change in reporter signal (light output).. SwitchGear Promoter GoClone Reporter Assays can be used to monitor the activity of any promoter in a ...
http://switchgeargenomics.com/switchgear-3%E2%80%99utr-goclone-reporter-assays
cloning of non-coding region for protein expression - Protein Expression and Purification - BioForum  cloning of non-coding region for protein expression - Protein Expression and Purification - BioForum
cloning of non-coding region for protein expression - posted in Protein Expression and Purification: Hi! I am trying to see the function of my non-coding region in protein expression. I have clone my gene and its non-coding region upstream of 5UTR to find if non-coding region plays any role in expression of cloned protein. I have other clones with no non-coding region just 5UTR and coding region. Has anybody cloned these type construct in mammalian expression vector and does...
http://www.protocol-online.org/forums/topic/12486-cloning-of-non-coding-region-for-protein-expression/
US5484701A - Method for sequencing DNA using biotin-strepavidin conjugates to facilitate the purification of primer extension...  US5484701A - Method for sequencing DNA using biotin-strepavidin conjugates to facilitate the purification of primer extension...
A simplified method for isolating primer extension products and generating them in a form appropriate for electrophoresis is disclosed. The method is compatible with automated DNA sequencing procedures.
https://patents.google.com/patent/US5484701
A Molecular Biology Glossary  A Molecular Biology Glossary
Gel shift assay: (aka gel mobility shift assay (GMSA), band shift assay (BSA), electrophoretic mobility shift assay (EMSA)) A method by which one can determine whether a particular protein preparation contains factors which bind to a particular DNA fragment. When a radiolabeled DNA fragment is run on a gel, it shows a characteristic mobility. If it is first incubated with a cellular extract of proteins (or with purified protein), any protein-DNA complexes will migrate slower than the naked DNA - a shifted band.. Gene: A unit of DNA which performs one function. Usually, this is equated with the production of one RNA or one protein. A gene contains coding regions, introns, untranslated regions and control regions.. Genome: The total DNA contained in each cell of an organism. Mammalian genomic DNA (including that of humans) contains 6x109 base pairs of DNA per diploid cell. There are somewhere in the order of a hundred thousand genes, including coding regions, 5 and 3 untranslated regions, ...
http://seqcore.brcf.med.umich.edu/sites/default/files/html/educ/dnapr/mbglossary/mbgloss.html
FinchTalk: 2008  FinchTalk: 2008
ChiP (Chromosome Immunoprecipitation) is a technique where DNA binding proteins, like transcription factors, can be localized to regions of a DNA molecule. We can use this method to identify which DNA sequences control expression and regulation for diverse genes. In the ChIP procedure, cells are treated with a reversible cross-linking agent to "fix" proteins to other proteins that are nearby, as well as the chromosomal DNA where theyre bound. The DNA is then purified and broken into smaller chunks by digestion or shearing and antibodies are used to precipitate any protein-DNA complexes that contain their target antigen. After the immunoprecipitation step, unbound DNA fragments are washed away, the bound DNA fragments are released, and their sequences are analyzed to determine the DNA sequences that the proteins were bound to. Only few years ago, this procedure was much more complicated than it is today, for example, the fragments had to be cloned before they could be sequenced. When microarrays ...
http://finchtalk.blogspot.com/2008/
BIOL 112 - Practice Qs from 2008 - 71 The initiator sequence and promoter sequences must  BIOL 112 - Practice Qs from 2008 - 71 The initiator sequence and promoter sequences must
View Notes - BIOL 112 - Practice Qs from 2008 from BIOL 112 at UBC. sheet. 71. The initiator sequence and promoter sequences must exhibit a large degree of overlap. 72. If the lac operon was designed
https://www.coursehero.com/file/8680739/71-The-initiator-sequence-and-promoter-sequences-must-exhibit/
Patent US4675283 - Detection and isolation of homologous, repeated and amplified nucleic acid ... - Google Patents  Patent US4675283 - Detection and isolation of homologous, repeated and amplified nucleic acid ... - Google Patents
A novel method for detecting and isolating DNA sequences commonly held by different DNA preparations or repeated or amplified within a complex genome has been provided. The DNA preparations of interest are digested with the same restriction enzyme and a portion of at least one preparation is labeled with 32 P. The labeled and unlabeled DNA preparations are combined and electrophoresed in an agarose gel. Following electrophoresis, the DNA is denatured in situ and allowed to reanneal within the gel so that homologous DNA sequences present within restriction fragments of the same size can reanneal. After reannealing, unhybridized single-stranded DNA is digested in situ followed by detection of the reannealed DNA by autoradiography. When labeled and unlabeled DNAs are derived from different DNA preparations, only the restriction fragments commonly held by these two preparations are detected. When a restriction digest of total eukaryotic DNA is reassociated in the gel by this procedure, repeated restriction
http://www.google.com/patents/US4675283?dq=5754119
T7 RNA polymerase termination signals?  T7 RNA polymerase termination signals?
Bottom line: What are the sequences of phage polymerase termination signals? Yes, I am still trying to get good in vitro transcription of a particular sequence for use in RNase protection analysis. Basically I can only really use one region and this is next to a T7 promoter so I am fiddling with the conditions. The transcript I get is mainly full length but the yield is awful. I tried 15degC for 3 h. It was worse then 37degC for 1 h. I tried the Maslak & Martin buffer and this may have improved things but the salt/detergent in the buffer screw up the gel purification of the probe (I am working on this). I tried beefing up the amount of enzyme or the amount of limiting nucleotide (32P-CTP) but this didnt really help. I have yet to try T4g32 protein or its equivalent. In the back of the Ambion MAXIscript guide their is a vague reference to accidental incorporation of phage RNA polymerase termination signals in a template being a reason for poor yield. No information is given as to what these ...
http://www.bio.net/bionet/mm/methods/1996-June/045220.html
CA/TG sequence at the 5 end of oligo(A)-tracts strongly modulates DNA curvature - ePrints@IISc  CA/TG sequence at the 5' end of oligo(A)-tracts strongly modulates DNA curvature - [email protected]
An analysis of the base pair doublet geometries in available crystal structures indicates that the often reported intrinsic curvature of DNA containing oligo-(d(A).d(T)) tracts may also depend on the nature of the flanking sequences. The presence of CA/TG doublet in particular at the 5 end of these tracts is expected to enhance their intrinsic bending property. To test this proposition, three oligonucleotides, d(GAAAAACCCCCC), d(CCCCCCAAAAAG), d(GAAAAATTTTTC), and their complementary sequences were synthesized to study the effect of various flanking sequences, at the 5 and 3 ends of the A-tracts, on the curvature of DNA in solution. An analysis of the polyacrylamide gel electrophoretic mobilities of these sequences under different conditions of salts and temperatures (below their melting points) clearly showed that the oligomer with CA/TG sequence in the center was always more retarded than the oligomer with AC/GT sequence, as well as the oligomer with AT/AT sequence. Hydroxyl radical probing ...
http://eprints.iisc.ernet.in/35233/
DNA - Stock Image G110/0642 - Science Photo Library  DNA - Stock Image G110/0642 - Science Photo Library
DNA. Computer artwork of a DNA (deoxyribonucleic acid) double helix seen against autoradiograms of genetic sequences (upper right). The spiralling strands of the DNA helix (blue) are composed of complex chemical groups called nucleotides, which consist of a sugar phosphate and a base group. Complementary pairing between the base groups of nucleotides on opposite strands holds the helix together. The sequence of the 4 base groups (adenine, cytosine, guanine and thymine; coloured rods) along the DNA helix is unique for every individual and is known as the genetic code. The autoradiograms depict DNA base sequences, each band (dark blue) representing an individual base. - Stock Image G110/0642
http://www.sciencephoto.com/media/210102/view
FPGEETutor.com : FPGEE Exams, Practice Tests, Flashcards, Study Material: 2015  FPGEETutor.com : FPGEE Exams, Practice Tests, Flashcards, Study Material: 2015
Knowledge of the sequence of a DNA segment has many uses, and some examples follow. First, it can be used to find genes, segments of DNA that code for a specific protein or phenotype. If a region of DNA has been sequenced, it can be screened for characteristic features of genes. For example, open reading frames (ORFs)-long sequences that begin with a start codon (three adjacent nucleotides; the sequence of a codon dictates amino acid production) and are uninterrupted by stop codons (except for one at their termination)-suggest a protein-coding region. Also, human genes are generally adjacent to so-called CpG islands-clusters of cytosine and guanine, two of the nucleotides that make up DNA. If a gene with a known phenotype (such as a disease gene in humans) is known to be in the chromosomal region sequenced, then unassigned genes in the region will become candidates for that function. Second, homologous DNA sequences of different organisms can be compared in order to plot evolutionary ...
http://fpgeetutor.blogspot.com/2015/
Significance of strand configuration in self-replicating RNA molecules | Philosophical Transactions of the Royal Society B:...  Significance of strand configuration in self-replicating RNA molecules | Philosophical Transactions of the Royal Society B:...
The kinetic theory of replication has been extended to include dual mechanisms for conversion of self-annealed single-strand RNA to double-strand molecules, which do not replicate. An analysis of experimental results established that the replicate-template annealing reaction during transcription significantly retarded replication in vitro among three RNA variants copied by Qβ replicase. Annealing between complementary RNA strands free in solution had far less significance. The finding that an RNA variant can be replicated in a multiple hairpin configuration, but not as its single, long hairpin conformer, the correlation between stability of strand secondary structure and replicative fitness, and a lack of homology in the internal sequence of RNA variants copied by Qβ replicase support the conclusion that template competence depends on strand configuration, independent of most of the underlying base sequence. Occurrence of self-annealed strands in the Qβ replicase system was attributed to its ...
http://rstb.royalsocietypublishing.org/content/350/1334/345
MinION™ Applications: Microbial genomics and direct RNA sequencing  MinION™ Applications: Microbial genomics and direct RNA sequencing
Oxford Nanopore’s MinION is a small sensing device which can sequence DNA and RNA directly, without the need to perform an enzymatic synthesis reaction. The device is portable and is po
https://www.labroots.com/ms/webinar/tbd-7
THE EVOLUTION LIST: March 2010  THE EVOLUTION LIST: March 2010
However, in cases 5 and 6 we seem to come to a radical discontinuity. In both of these cases, there can be an analogical (and therefore "meaningful") relationship between the nucleotide sequence ACA in DNA and the corresponding amino acid sequence in a translated polypeptide, either in vitro or in a cell. What makes this difference possible (and what may make it necessary) is the analogical relationship between the nucleotide sequence and the corresponding amino acid sequence (if one exists). If the DNA sequence ACA is located in the template strand of an actively transcribed DNA sequence (i.e. a DNA sequence beginning with a promoter to which RNA polymerase can bind) and furthermore its complementary RNA analog is located in an mRNA molecule following the "start" codon AUG but not following a "stop" codon (either UAA, UAG, or UGA, assuming a three-base reading frame), then that the DNA sequence does indeed contain "meaningful" information: it is encoded in one medium, is translated into another ...
http://evolutionlist.blogspot.co.nz/2010/03/
THE EVOLUTION LIST: March 2010  THE EVOLUTION LIST: March 2010
However, in cases 5 and 6 we seem to come to a radical discontinuity. In both of these cases, there can be an analogical (and therefore "meaningful") relationship between the nucleotide sequence ACA in DNA and the corresponding amino acid sequence in a translated polypeptide, either in vitro or in a cell. What makes this difference possible (and what may make it necessary) is the analogical relationship between the nucleotide sequence and the corresponding amino acid sequence (if one exists). If the DNA sequence ACA is located in the template strand of an actively transcribed DNA sequence (i.e. a DNA sequence beginning with a promoter to which RNA polymerase can bind) and furthermore its complementary RNA analog is located in an mRNA molecule following the "start" codon AUG but not following a "stop" codon (either UAA, UAG, or UGA, assuming a three-base reading frame), then that the DNA sequence does indeed contain "meaningful" information: it is encoded in one medium, is translated into another ...
http://evolutionlist.blogspot.ca/2010/03/
Microbes & Human Health: Mutation in a primate-conserved retrotransposon reveals a noncoding RNAs a mediator of infantile...  Microbes & Human Health: Mutation in a primate-conserved retrotransposon reveals a noncoding RNAs a mediator of infantile...
The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. This study reports homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. This study show here that a mutation in a unique transposable element-containing RNA is associated with lethal ...
http://microbes-human-health.blogspot.com/2012/03/mutation-in-primate-conserved.html
Patente US5279952 - PCR-based strategy of constructing chimeric DNA molecules - Google Patentes  Patente US5279952 - PCR-based strategy of constructing chimeric DNA molecules - Google Patentes
The invention relates to methods for the use of the polymerase chain reaction to amplify a segment of a cloned gene of interest in such a way as to allow a simplified introduction of alterations such as deletions, insertions, repetitions (both direct and inverted) and substitutions into the cloned gene in a specific and precise manner. The unique, amplified segment of the cloned gene so amplified is a common substrate for each of the different approaches to introducing the various alterations into the gene. Choice of the primer sites within the amplified segment coupled with choice of the orientation of the molecule once ligated to itself results in the various resulting embodiments of the invention.
http://www.google.es/patents/US5279952?dq=flatulence
LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PRIMER-LINKED STEM-AND-LOOP PROBES - diagram, schematic,...  LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PRIMER-LINKED STEM-AND-LOOP PROBES - diagram, schematic,...
LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PRIMER-LINKED STEM-AND-LOOP PROBES - diagram, schematic, and image 20 ...
http://www.patentsencyclopedia.com/imgfull/20110312587_20
Genes, Transcription & Translation - Revision Notes in A Level and IB Biology  Genes, Transcription & Translation - Revision Notes in A Level and IB Biology
Gene - A length of DNA that codes for one (or more) polypeptides.. Polypeptide - A polymer consisting of a chain of amino acids, joined together by peptide bonds.. Genome - The entire DNA sequence (nucleotide base pairs) of an organism.. Protein - A large polypeptide (usually 100 or more amino acids). Some consist of more than one polypeptide chain e.g. Haemoglobin.. Locus - A specific position on a chromosome, occupied by a specific gene.. In the human genome, there are about 25,000 genes. A few are in the mitochondria, but most genes are found on the chromosomes within the nucleus. Each gene occupies a specific locus on the chromosome. The DNA in the chromosomes is associated with histone proteins.. Remember each chromosome consists of one molecule of DNA, and each gene is just a part of a DNA molecule.. Genes code for polypeptides such as:. ...
https://getrevising.co.uk/revision-notes/cellular_control_1_1
brock-2017--knu-383 - MICROPUBLICATION:BIOLOGY  brock-2017--knu-383 - MICROPUBLICATION:BIOLOGY
The mod-5(knu383) allele repair oligonucleotide contained a 3-frame stop of TAAATAAATAAA surrounded by filler sequence of CCTCCCGTTCGCCTGGGACATC and GATGTCCCAGGCGAACGGGAGG. The homology arms were designed to give perfect homology for each of the sgRNA cut sites with 35 nucleotides of perfect homology on the 5 side and 34 nucleotides on the 3 side. These homology arms are 12,775bp apart from each other in the genomic sequence. The deletion was created using the CRISPR/Cas9 technology (Paix 2014, Kim 2014). The guide sequences were caaaagaaaagagcagccga and caaaagaaaagagcagccga provided in the injection mix as synthetic RNA. The deletion was detected by a three-primer PCR approach where an 813bp band would amplify in the deletion and a 614bp band would amplify in N2 wild-type, Figure 1A ...
https://www.micropublication.org/brock-2017--knu-383.html
Plus it  Plus it
Construction of p53RE database and comparative analysis of p53 target genes. p53REs typically consist of two copies of a 10-bp motif (RRRCWWGYYY) separated by 0 to 12 bp. We first extracted all putative p53 binding sites in the entire human and mouse genomes. The sequence data were downloaded from the National Center for Biotechnology Information (NCBI) Human Assembly 33 (April 10, 2003) and the MGSC Mouse Assembly 3 (February 2003) and then input to the p53RE prediction system. We set the parameter conditions to include the following restrictions: (i) fewer than four mismatches in the 20-nucleotide consensus binding sequence, and (ii) the spacer between the 10-bp motifs has fewer than 12 bp. The output data, which consisted of p53 binding site IDs, chromosomal positions, nucleotide sequences, the number of mismatches, spacer length, and the 200-bp sequences surrounding the binding sites, were stored in the p53RE database.. We next added the gene annotation information into each of the binding ...
http://cancerres.aacrjournals.org/content/66/9/4574
Genetics of cosQ, the DNA-Packaging Termination Site of Phage λ: Local Suppressors and Methylation Effects | Genetics  Genetics of cosQ, the DNA-Packaging Termination Site of Phage λ: Local Suppressors and Methylation Effects | Genetics
A local suppressor of the G48,475C mutation was T48,479C (found in Rev8), which by itself has no phenotype (Wieczorek and Feiss 2001). To ask whether other pairs of cosQ mutations affecting base pairs 48,475 and 48,479 were mutually suppressing, we constructed the eight other possible double-mutant combinations of base pair changes. None of the double mutants formed plaques, indicating that the changes in Rev8 were the only ones showing suppression at these positions (S. Gaeth, D. Wieczorek and M. Feiss, unpublished observations). Curiously, all of the mutually suppressing pairs of mutations we have found are 4 bp apart. Furthermore, the pairs of mutually suppressing cosQ mutations in the first and fifth cosQ base pairs occupy positions that are rotationally symmetric with the third and seventh base pairs that also exhibit mutual suppression (Figure 3).. A second observation suggests that cosQ may be a rotationally symmetric element: the 7-bp cosQ segment is coincident with an EcoO109I ...
http://www.genetics.org/content/165/1/11
Patent US5667972 - Method of sequencing of genoms by hybridization of oligonucleotide probes - Google Patents  Patent US5667972 - Method of sequencing of genoms by hybridization of oligonucleotide probes - Google Patents
The conditions under which oligonucleotides hybridize only with entirely homologous sequences are recognized. The sequence of a given DNA fragment is read by the hybridization and assembly of positively hybridizing probes through overlapping portions. By simultaneous hybridization of DNA molecules applied as dots and bound onto a filter, representing single-stranded phage vector with the cloned insert, with about 50,000 to 100,000 groups of probes, the main type of which is (A,T,C,G)(A,T,C,G)N8(A,T,C,G), information for computer determination of a sequence of DNA having the complexity of a mammalian genome are obtained in one step. To obtain a maximally completed sequence, three libraries are cloned into the phage vector, M13, bacteriophage are used: with the 0.5 kb and 7 kbp insert consisting of two sequences, with the average distance in genomic DNA of 100 kbp. For a million bp of genomic DNA, 25,000 subclones of the 0.5 kbp are required as well as 700 subclones 7 kb long and 170 jumping subclones.
http://www.google.com/patents/US5667972?dq=patent:6144888
sequence searcher  sequence searcher
For DNA, the searches are conducted by finding the motif within a sequence from the 5 to 3 end on the top strand. The searches are also processed from the 5 to 3 end of the bottom strand. As a result, bases are numbered from 1 starting at the 5 at either the top or bottom strand.. Regular expression and fuzzy pattern searches are available:. Fuzzy searches provide the option for the program to allow a certain number of mismatches from a sequence input at any position. Note that the maximum number of mismatches that the program allows is 40% of the length of the sequence motif.. Regular expression allows for inputs of precise motifs along with considerable user-specified flexibility at specific positions.. ...
http://www.virology.ws/tag/sequence-searcher/
1. Evolution or Design? Duons | The Skeptical Zone  1. Evolution or Design? Duons | The Skeptical Zone
Well, in this case "sheer dumb luck" seems to be smarter than you in a very obvious way.. In most cases, palindromes with functions in DNA sequences dont have to be perfect. They often have variation and are still functional. Whats often palindromic is not each instance of, say, a transcription factor binding site, but the consensus obtained from aligning several of those sequences and looking at the most frequent "letter" at each position.. Theres also the tiny little detail that actual "palindromes" are pretty short. Its not impossible to write several palindromes with DNA, say, six letters long. Its not impossible for those to occur, just by chance, in quite large numbers in a genome.. Check this out. Suppose that every base has equal probability in the human genome. The probability of any sequence six bases long, including any of the potential palindromes, would be:. p = (1/4)**6 = 0.000244140625. Now, that means that the sequence can be present in a six billion bases long genome (like ...
http://theskepticalzone.com/wp/1-evolution-or-design-duons/comment-page-8/
Viral DNA sequence a possible trigger for bre...( A small sequence of DNA in the envelope...)  Viral DNA sequence a possible trigger for bre...( A small sequence of DNA in the envelope...)
Health,A small sequence of DNA in the envelope (Env) protein of a mouse breas...The DNA sequence in question is usually found in immune cells and h...Katz and colleagues now show that this sequence is contained in the......,Viral,DNA,sequence,a,possible,trigger,for,breast,cancer,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
http://news.bio-medicine.org/medicine-news-2/Viral-DNA-sequence-a-possible-trigger-for-breast-cancer-858-1/
Activation of Latent Transgenes in Arabidopsis Using a Hybrid Transcription Factor | Genetics  Activation of Latent Transgenes in Arabidopsis Using a Hybrid Transcription Factor | Genetics
Recombinant plasmids: pSGZL1 was constructed by ligating the GAL4-C1 EcoRI fragment from pGALC1 (Goffet al. 1991) into the EcoRI site of pIC20H (Marshet al. 1984). The GAL4-C1 fragment of pSGZL1 was excised with BamHI-Bgl II and inserted into the BamHI site of pCIB770 (Rothsteinet al. 1987) yielding pAT53.. The 10 UASG sites and the minimal CaMV 35S promoter (−59 to +1) were excised from pGALLuc2 (Goffet al. 1991) as an EcoRI-PstI fragment and inserted into the respective sites of pBluescript, yielding pAT52. pAT66 was constructed with a three-way ligation between the HindIII-PstI fragment of pAT52, a PstI-EcoRI fragment of pCIB1716 (containing a CaMV 35S untranslated leader, GUS gene, CaMV 35S terminator) and HindIII-EcoRI cut pUC18. The CaMV 35S leader of pAT66 was excised with PstI-NcoI and replaced with a PCR-generated 35S leader extending from +1 to +48 to yield pAT71.. pCIB921 contains a dihydrofolate reductase (dhfr) plant selectable marker gene inserted in the BamHI site of pCIB710 ...
http://www.genetics.org/content/149/2/633
Epigenetic Regulation  Epigenetic Regulation
In principle, any mechanism that provides regulatory information to a genome without altering its primary nucleotide sequence could be considered epi- (on top of) genetic. We begin by providing a general overview of the modifications and responsible enzymes, followed by a more detailed discussion of various epigenetic mechanisms that exist in complex genomes and some concluding remarks about the future of the human epigenome project.
https://epigenie.com/epigenie-learning-center/epigenetics/epigenetic-regulation/
Multi-scale modeling of DNA | Institute for Mathematics and its Applications  Multi-scale modeling of DNA | Institute for Mathematics and its Applications
Encoded in the strings of DNA bases that make up the genomes of living species are codes that regulate, control, and describe all sorts of biological processes. The underpinnings of these codes lie in the base sequence-dependent micromechanical properties of DNA, which determine the degree to which the long, threadlike molecule fluctuates and how it responds to the proteins that control its processing and govern its packaging. In order to understand the mechanisms by which DNA base sequence and tightly bound proteins control the biophysical properties of the long, threadlike molecule, we have developed a coarse-grained model, in which the DNA base pairs are treated as rigid bodies subject to realistic, knowledge-based energy constraints, and computational techniques to determine the minimum-energy configurations, intrinsic dynamics, and looping/cyclization propensities of these molecules. The presentation will highlight some of the unique, sequence-dependent spatial information that has been ...
https://ima.umn.edu/2008-2009/W11.3-7.08/6541
IUCr) Symbols for symmetry elements  IUCr) Symbols for symmetry elements
The scope of this symbol should then be extended to glide planes in a diagonal orientation, that is, parallel to just one crystal axis, provided that the glide plane has a glide vector along that axis and that the net N is orthogonal centred. For such planes there is not the ambiguity of the above a-b random choice, but the extended scope of the new symbol is in line with that of all existing symbols (namely a, b, c, n and d). Each of these is used for a glide plane with both one and two crystal axes in the net N, cf. Fig. 3.. The letter e is proposed for the new symbol. Thus, Ee will apply to glide planes with orthogonal centred nets N and at least one glide vector along a crystal axis. A new criterion is hence necessary: namely the orientation of glide vectors with respect to the conventional axes of the crystal. Since the latter are along symmetry directions, whereas every glide plane is parallel to a mirror plane of the lattice, it is not surprising that there is always at least one ...
https://www.iucr.org/resources/commissions/crystallographic-nomenclature/symsym
Joint action of two RNA degradation pathways controls the timing of maternal transcript elimination at the midblastula...  Joint action of two RNA degradation pathways controls the timing of maternal transcript elimination at the midblastula...
Standard protocols were used (Sambrook et al., 1989).. Hsp83-lacZ transgenes. The following approach was taken to generate the series of lacZ-Hsp83 3′‐UTR constructs that include the 5′‐Hsp83 enhancer sequences and promoter (Figure 3B). Previous reports (Kim‐Ha et al., 1993) suggested that a full‐length lacZ ORF might not be completely transcribed in vivo. Therefore, we inserted the Hsp83 3′‐UTR fragments downstream of a truncated lacZ tag. We accomplished this by constructing pB83Z, a Bluescript subclone that contains all of the Hsp83 5′ upstream region, the first exon, the intron and the first 111 codons of the ORF fused to 603 bp of lacZ sequence (Halsell, 1995). At the 3′ end of the lacZ sequence are AatII, HindIII and KpnI cloning sites for inserting the Hsp83 3′‐UTR fragments. The template for the PCR was Eco9, an 8 kb EcoRI fragment subcloned in Bluescript that contains the full‐length Hsp83 transcription unit. 5′ Fragments of the 3′‐UTR were PCR amplified ...
http://emboj.embopress.org/content/18/9/2610
E. coli plasmid pXC33 - incomplete.  E. coli plasmid pXC33 - incomplete.
Misc.Comments : Restriction digests of the clone give the following sizes (kb): BamHI--5.8; EcoRI--5.8; HindIII--5.8. (ATCC staff) One of 12 expression vectors (ATCC 86990-87001) designed to maximize expression from the lambda PL promoter and support cloning of PCR products. The vectors differ in cloning sites and in translational enhancer and initiation sequences. The vector contains a 0.7 kb bovine cDNA that can be excised using the 5 and 3 cloning sites and be replaced by a gene of interest. The bovine insert may be used as a positive control for expression. The lambda R1 terminator is partially deleted. [1] Growth: LB plus ampicillin (ATCC medium number 1227) 37C Deposited by: Patterson T.A ...
http://genome-www.stanford.edu/vectordb/vector_descrip/PXC33.html
EGL Genetics | About EGL Genetics  EGL Genetics | About EGL Genetics
PCR amplification of 13 exons contained in the ALG8 gene is performed on the patients genomic DNA. Direct sequencing of amplification products is performed in both forward and reverse directions, using automated fluorescence dideoxy sequencing methods. The patients gene sequences are then compared to a normal reference sequence. Sequence variations are classified as mutations, benign variants unrelated to disease, or variations of unknown clinical significance. Variants of unknown clinical significance may require further studies of the patient and/or family members. This assay does not interrogate the promoter region, deep intronic regions, or other regulatory elements, and does not detect large deletions ...
https://egl-eurofins.com/tests/?testid=SALG8
Patent US5187263 - Expression of biologically active PDGE analogs in eucaryotic cells - Google Patents  Patent US5187263 - Expression of biologically active PDGE analogs in eucaryotic cells - Google Patents
Methods for expressing a variety of biologically active PDGF analogs in eucaryotic cells are disclosed. The methods generally comprise introducing into a eucaryotic host cell a DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells. The DNA construct contains a transcriptional promoter followed downstream by a suitable DNA sequence. The DNA sequence may encode a protein substantially homologous to the A-chain or the B-chain of PDGF, or a portion thereof, or an A-B heterodimer. In addition, a portion of the DNA sequence may encode at least a portion of the A-chain, while another portion encodes at least a portion of the B-chain of PDGF. Eucaryotic cells transformed with these DNA constructs are also disclosed. Methods of promoting the growth of mammalian cells, comprising incubating the cells with a biologically active PDGF analog expressed by a eucaryotic host cell transformed with such a DNA construct, are also disclosed.
http://www.google.com.au/patents/US5187263
Fasta Alignment Format - Sequences Must Be Same Length?  Fasta Alignment Format - Sequences Must Be Same Length?
No matter what the length of A and B are, A and B (the aligned sequences) will be of the same length. This simply comes from the definition of an alignment. The characters (representing base pairs) from the two sequences are arranged as to minimize the differences between them, and then the empty spaces (if any) are filled in with gaps (dash characters). These gaps are typically interpreted as evolutionary events between two homologous sequences, i.e. an insertion of nucleotides to one sequence or a deletion of nucleotides from the other (indels).. ...
https://www.biostars.org/p/5322/
LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PCR AMPLIFICATION USING PRIMERS COVALENTLY ATTACHED TO...  LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PCR AMPLIFICATION USING PRIMERS COVALENTLY ATTACHED TO...
LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PCR AMPLIFICATION USING PRIMERS COVALENTLY ATTACHED TO STEM-AND-LOOP PROBES - diagram, schematic, and image 22 ...
http://www.patentsencyclopedia.com/imgfull/20110312768_22
Difference between revisions of BME103:T930 Group 11 - OpenWetWare  Difference between revisions of "BME103:T930 Group 11" - OpenWetWare
PCR can be used for a variety of purposes, in this case however, PCR was used in order to determine whether or not a specific gene codes for cancer or not. If a cancer gene is located, then it will yield a positive result because the primers only bind to a certain sequence in the DNA and if that certain sequence codes for cancer, then it will produce a positive result indicating that it was located in that sequence. The specific sequence that was focused on was r17879961 with the sequence AACTCTTACA[C]TGCATACAT instead of being AACTCTTACA[T]TGCATACAT. The change is from ACT to ATT. The change from the C base into the C base is a missense where the normal T mutates into the cancer C. To identify whether such mutation occurred in the sequence using PCR, primers should first be designed to bind into the specific sequence. The primer needed for the sequence. The forward primer needed for the sequence is TGGTATAAGACATTCCTGT while the reverse primer should be AACTCTTACACTGCATACAT. Using PCR, the ...
https://openwetware.org/wiki/?title=BME103:T930_Group_11&diff=655758&oldid=655754
5race pcr  5'race pcr
St Georges Hosp Medical School (fenechc at sghms.ac.uk) wrote: : Hello, : i am trying to to find the 5 end of a gene, using Clontechs 5 RACE kit. I perform reverse transcription : on mRNA using AMV at 52 degrees for 30 min. This is performed using either a gene-specific reverse : primer, or random hexamers at a lower incubation temperature. An anchor sequence is then ligated to the : 5 end of the first strand and heminested PCR is performed using nested gene-specific reverse primers : and an anchor primer. The predicted size of my PCR product should be about 400bp, but my products are : smaller (350bp approx). After cloning and sequencing, i find the extreme 5 end of my gene is missing : including the first 10-15 codons and the start codon. It is as if the reverse transcriptase has terminated : first strand synthesis prematurely (even though the template is short) and the anchor has ligated to the : truncated 5end resulting in smaller than expected PCR products. Has anyone encountered ...
http://www.bio.net/bionet/mm/methods/1995-January/023311.html
Index of /oca-simple/odoo10-addon-base-partner-sequence/  Index of /oca-simple/odoo10-addon-base-partner-sequence/
odoo10-addon-base_partner_sequence-10.0.1.0.0.9.., 23-Apr-2018 11:43 21538 odoo10-addon-base_partner_sequence-10.0.1.0.0.9.., 19-Jun-2018 03:17 21570 odoo10-addon-base_partner_sequence-10.0.1.0.0.9.., 13-Nov-2018 04:13 21579 odoo10_addon_base_partner_sequence-10.0.1.0.0-p.., 21-Dec-2016 03:34 27239 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 24-Dec-2016 03:34 29533 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 11-Jun-2017 02:37 59742 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 26-Nov-2017 03:41 59786 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 04-Mar-2018 03:44 60637 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 19-Jun-2018 03:17 61218 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 13-Nov-2018 04:13 58983 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 01-Jan-2017 03:34 31016 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 08-Jan-2017 03:34 31074 odoo10_addon_base_partner_sequence-10.0.1.0.0.9.., 15-Jan-2017 03:34 31109 ...
https://wheelhouse.odoo-community.org/oca-simple/odoo10-addon-base-partner-sequence/
Repeats  Repeats
The presence of certain types of repetitive elements in a sequence may sometimes distort the results of GENSCAN. In particular, L1 elements are often predicted as genes. To avoid this potential problem, you may wish to pre-screen for repetitive elements with a program like RepeatMasker or censor which replace sequence segments matching any of a set of elements common to your organism (e.g., Alu, L1, etc.) by the same number of asterisks or `Ns. (To get instructions for the censor email server, send mail to [email protected] with the word "help" in the body of the message.) Note that GENSCAN does accept sequences containing Ns or asterisks and that long stretches of such symbols are interpreted as probable repetitive elements (i.e. non-coding DNA). For large-scale sequencing efforts, other repeat-screening methods are also available, e.g., masking repeats detected by BLASTN or TBLASTN using the XBLAST procedure (Claverie, J.-M. (1994) In Automated DNA Sequencing and Analysis Techniques, M. ...
http://genes.mit.edu/Repeats.html
Novel Method Developed to Further the Understanding of DNA Palindromes  Novel Method Developed to Further the Understanding of DNA Palindromes
The researchers developed technology that will enable them to examine tumors, with the goal of understanding the likelihood of palindrome formation in these tumors, Rattray said. They hope to learn what events initiate such unstable formations, and this new understanding could lead to novel treatments. For example, she said, the group has already determined that certain yeast cells that are susceptible to palindrome formation are far more sensitive than normal cells to radiation as well as to compounds often used in the treatment of cancer, such as cisplatin.. "Currently, I am trying to establish methods to selectively enrich palindromes from the rest of the cellular DNA, which will allow greater sensitivity in the analysis of the palindrome content of cancer cells," she said. In the previous method, the researchers lost the junction sequences that might provide clues to the origin of the palindromes, and had to analyze them one by one, she explained. "We have now shown that the PacBio platform ...
https://ncifrederick.cancer.gov/about/theposter/print/content/novel-method-developed-further-understanding-dna-palindromes
Plus it  Plus it
Transgene vector and generation of transgenic mice.We obtained the Crx genomic clone from a 129SVJ mouse library (Stratagene, La Jolla, CA) by using a mouse Crx cDNA probe. We ligated and subcloned a 10 kb XhoI (partial digestion)-EcoRI fragment and a PCR-amplified 2 kbEcoRI-SmaI fragment containing exon 1 into a pβ-gal-Basic vector (Clontech, Palo Alto, CA) to make the Pcrx12k-lacZ construct (see Fig. 1A). Sequencing verified the 2 kb EcoRI-SmaI fragment. The Pcrx2k-lacZ vector contains the 2 kbEcoRI-exon 1 fragment and a 10 kbSmaI-EcoRI fragment that contains the first intron.. We extracted the Pcrx2k-lacZ and the Pcrx12k-lacZ from the recombinant plasmids by aNotI and SalI digestion. We fractionated theNotI-SalI fragments by electrophoresis on a 0.8% agarose gel and purified them by electroelution in dialysis tubes. We microinjected the DNA fragment into pronuclei of B6SJL/F2 C57BL/6 × SJL F2 hybrids. Then Southern blot hybridization of a HindIII-ClaI 954 bp fragment of the β-galactosidase ...
http://www.jneurosci.org/content/22/5/1640
Global Description of Amino Acid & Nucleotide Sequences: Application to Predicting Protein Folds, Intron-Exon Discrimination, &...  Global Description of Amino Acid & Nucleotide Sequences: Application to Predicting Protein Folds, Intron-Exon Discrimination, &...
General global sequence descriptors have been developed which proved to be widely applicable to the prediction of properties of biological genes and gene products. These descriptors include composition, transition, and distribution of defined attributes in the amino acid or nucleotide sequence. We have tested this approach on three completely distinct biological problems: 1) prediction of protein three-dimensional folds, 2) discrimination between sequences of gene introns and exons, and 3) identification of putative RNA genes in genomic sequences.
http://www.nsti.org/procs/MSM99/2/T23.04
RNA Sequence Analysis of Single Cells by NGS - QIAGEN  RNA Sequence Analysis of Single Cells by NGS - QIAGEN
The transcriptome of a cell is not fixed, but is dynamic, and reflects the function or type of the cell, the cell stage or the cells response to intrinsic and extrinsic influences, such as signaling or stress factors. Only on a single-cell level, can you eliminate the biological noise that is inherent to standard gene expression analysis - providing you the insights needed for a deeper understanding of transcription dynamics ...
https://www.qiagen.com/no/resources/knowledge-area/single-cell-resource/repli-g-rna-sequencing/
Synthesis of cDNA Probes from mRNA Using Random Oligonucleotide Primers  Synthesis of cDNA Probes from mRNA Using Random Oligonucleotide Primers
Molecular Cloning, also known as Maniatis, has served as the foundation of technical expertise in labs worldwide for 30 years. No other manual has been so popular, or so influential.
http://molecularcloning.com/index.php?prt=148
Addgene lenti MS2-P65-HSF1 Hygro Sequencing Result - Sequence Analyzer  Addgene lenti MS2-P65-HSF1 Hygro Sequencing Result - Sequence Analyzer
Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site). To select a portion of sequence, click one location on the plasmid and then a second location to display the sequence between the two locations.. ...
http://www.addgene.org/browse/sequence/140565/
Addgene TAL2079 Sequencing Result - Sequence Analyzer  Addgene TAL2079 Sequencing Result - Sequence Analyzer
Displays a graphical map based on nucleotide sequence data labeled with restriction enzymes, plasmid features, ORFs (theoretical open reading frames) and primers. Hovering over data labels will display additional information (e.g. cut site). To select a portion of sequence, click one location on the plasmid and then a second location to display the sequence between the two locations.. ...
https://www.addgene.org/browse/sequence/52646/
Programming Assignment 6  Programming Assignment 6
Each strand of DNA is built out of four nucleotides (or bases) called adenine (A), thymine (T), cytosine (C), and guanine (G). Genetic information is determined by the sequence of bases along the strand. This program will find the longest common base sequence in two strands of DNA. Each strand is represented by the sequence of letters A, T, C, and G. For example, in the two strands ATGC and TGAC the longest common sequence is TG. The two strands need not have the same length. It is quite possible for the two strands not to have any common sequence (a sequence of 1 base does not count). Input: Prompt the user to enter two strands of DNA one strand at a time. Output: You will write out all the common longest subsequences, one line at a time. If you do not find any common sequence write No Common Sequence Found. Here is what a typical session would look like ...
http://www.cs.utexas.edu/~mitra/csSummer2013/cs303/assgn/assgn6.html
Heavy-Duty IV Stand, 16 Base Epoxy-Coated, 4 Hooks, 5 Legs, 24 lbs., Surgical Supplies - Allegro Medical Supplies  Heavy-Duty IV Stand, 16' Base Epoxy-Coated, 4 Hooks, 5 Legs, 24 lbs., Surgical Supplies - Allegro Medical Supplies
Heavy-Duty IV Stand, 16 Base Epoxy-Coated, 4 Hooks, 5 Legs, 24 lbs. - Get the lowest price on Heavy-Duty IV Stand, 16 Base Epoxy-Coated, 4 Hooks, 5 Legs, 24 lbs., online at AllegroMedical.com.
https://www.allegromedical.com/surgical-supplies-c537/heavy-duty-iv-stand-16-base-epoxy-coated-4-hooks-5-legs-24-lbs-p209845.html
Physical Biology Boot Camp - MurrayWiki  Physical Biology Boot Camp - MurrayWiki
So pZS25 uses an SC101 origin of replication (low copy number; about 10 copies), has kanemycin antibiotic resistance, and uses P_lacUV5-1 as its regulatory unit (repressed by LacI and induced by IPTG). The actual plasmid that we used was a version that had been modified by Hernan Garcia so that the promotor region had modifications that could be used to study the structural properties of DNA. Hernan created plasmids of the form pZS25.TA-94-YFP, which is a plasmid with a promotor region of length 94 (default), using a certain combination of sequences between the operator regions for lacI. The cloning that we want to do is to replace YFP with lacZ (which we extracted from a pZE21 plasmid). Step 1: create pZS25 vector (Sun afternoon) - the first thing that we did was to use restriction enzymes to create our "vector", where we would eventually insert the lacZ gene. We did this but cutting the pZS25 plasmid using HindIII and KpmI in a "double digest". To get some sense of how the restriction enzymes ...
http://www.cds.caltech.edu/~murray/wiki/index.php?title=Physical_Biology_Boot_Camp&direction=next&oldid=4922
Plantae | Intron DNA sequences can be more important than the proximal promoter in determining the site of transcript...  Plantae | Intron DNA sequences can be more important than the proximal promoter in determining the site of transcript...
The site at which transcription begins is traditionally thought to be determined in the proximal promoter by assembly of the pre-initiation complex just…
https://plantae.org/intron-dna-sequences-can-be-more-important-than-the-proximal-promoter-in-determining-the-site-of-transcript-initiation/
Plus it  Plus it
Targeted Disruption of theMrp3Gene and Generation ofMrp3-/-Mice. A 1-kb fragment containing the 5′ end of the Mrp3 coding sequence was used to screen a mouse strain 129-derived λ phage genomic library, and a ∼9-kb Mrp3 clone was isolated. The Mrp3 genomic clone was sequenced using an ABI 377 DNA sequencer (Applied Biosystems, Foster City, CA) and encompassed exons 2 to 11 of the Mrp3 gene, corresponding to nucleotides 100 to 1482 of the coding sequence. The left and right arms of a targeting vector were generated by polymerase chain reaction and were inserted, respectively, to the 5′ and 3′ of the pgk-neo cassette in the PNT plasmid. The vector was designed to delete exons 6 to 8, encoding nucleotides 613 to 996 of the coding sequence, and to introduce a frame-shift into the transcribed RNA sequence. The nucleotide sequence of the cloned arms was confirmed, and the resulting ∼12-kb vector was digested with NotI. The linearized DNA was electroporated into strain 129-derived R1 ...
http://molpharm.aspetjournals.org/content/68/1/160
Formating - Extension Method  Formating - Extension Method
summary, /// formating the string with a custom user-defined format. /// # sign is input characters. /// ,/summary, /// ,param name=format,the format string,/param, /// ,returns,formated string,/returns, public static string Formating(this string input, string format) { if(string.IsNullOrEmpty(input)) return string.Empty; StringBuilder output = new StringBuilder(); int j = 0; for(int i = 0; i , format.Length; i++) { switch(format[i]) { case #: output.Append(input[i - j]); break; default: output.Append(format[i]); j++; break; } } return output.ToString ...
http://extensionmethod.net/1888/csharp/string/formating
IG1 05 Fig18  IG1 05 Fig18
The 5 and 3 ends of each intron are marked with GU and AG dinucleotide sequences; a short tract of poly-pyrimidines (C or T) also occurs near the 3 end ahead of the AG singal. ...
http://www.mun.ca/biology/scarr/IG1_05_Fig18.html
BioInformatics - polyA tail search  BioInformatics - polyA tail search
usr/bin/perl -w use strict; ## set minimum length for polytail to search for my $polytail_min_len = 10; my $polytail_curr_len = $polytail_min_len; my $workline; my $polya_str_base; ## read data record for (,DATA,) { ## remove exteranious characters s/[\r\n]//g; # add new data to end of working data string $workline = $workline . $_; while (length($workline) , $polytail_curr_len) { $polya_str_base = substr($workline,0,$polytail_curr_len); ## remove desired characters from string $polya_str_base =~ s/[AN]//g; ## no characters left = all characters were in desired character set if (length($polya_str_base) == 0) { ## add a character from data set to string to test (ok - bump subscrip +t) $polytail_curr_len++; } else { ## a polytail of at least minimum length was found if ($polytail_curr_len , $polytail_min_len) { print substr($workline,0,$polytail_curr_len-1) . \n; ## trim characters of found polytail from working string $workline = substr($workline,$polytail_curr_len); ## reset length of string ...
http://www.perlmonks.org/index.pl?node_id=288362
Using Biology = Workbench to determine the effects of DNA mutations on the target = protein  Using Biology = Workbench to determine the effects of DNA mutations on the target = protein
Now answer question 1a. What will be = the=20 outcome of an adenine to guanine base substitution at base pair = 829? To=20 help you answer you write a good answer, check this page out....How=20 to answer questions in this lab.. 1b. What will be the outcome if = cytosine 1837=20 is switched to a guanine?. =B7 =20 Repeat the process above but the original ALD sequence = will not=20 need to be saved since it already exits on your workbench.. =B7 =20 Return to the nucleic acids by clicking on the NUCLEIC TOOLS button at=20 the top of the page. This time only ADD the change described above and call = it=20 "ALD1837". Be sure to hit the SAVE=20 button. =B7 =20 To determine the amino acid sequence, check the box next = to this=20 sequence. Now click on the SIXFRAME=20 button. Scroll down to the Frame with the longest ORF and the = fewest stop=20 codons. Put a check next to it and IMPORT the = sequence. =B7 =20 The screen now showing is PROTEIN=20 TOOLS. Scroll to the = bottom of the=20 page and put a ...
http://lazarebiology.weebly.com/uploads/8/3/1/6/8316143/part_i.mht
RepeatMasker Viz. Track Settings  RepeatMasker Viz. Track Settings
In dense display mode, a single line is displayed denoting the coverage of repeats using a series of black boxes. In full display mode, the track view is controlled by the scale of the view. At scales between 10 Mb and 30 kb, this track displays up to ten different classes of repeats (see below) one class per line. The repeat ranges are denoted as grayscale boxes, reflecting both the size of the repeat and the amount of base mismatch, base deletion, and base insertion associated with a repeat element. The higher the combined number of these, the lighter the shading. In full display mode and at scales less than 30 kb, a new detailed display mode is used. Repeats are displayed as arrow boxes, indicating the size and orientation of the repeat. The interior grayscale shading represents the divergence of the repeat (see above) while the outline color represents the class of the repeat. Dotted lines above the repeat and extending left or right indicate the length of unaligned repeat consensus ...
http://genome.ucsc.edu/cgi-bin/hgTrackUi?hgsid=792335733_1owraQe6v5aB8IGUdEDfJpB61Xe9&c=chr17&g=joinedRmsk
RepeatMasker Viz. Track Settings  RepeatMasker Viz. Track Settings
In dense display mode, a single line is displayed denoting the coverage of repeats using a series of black boxes. In full display mode, the track view is controlled by the scale of the view. At scales between 10 Mb and 30 kb, this track displays up to ten different classes of repeats (see below) one class per line. The repeat ranges are denoted as grayscale boxes, reflecting both the size of the repeat and the amount of base mismatch, base deletion, and base insertion associated with a repeat element. The higher the combined number of these, the lighter the shading. In full display mode and at scales less than 30 kb, a new detailed display mode is used. Repeats are displayed as arrow boxes, indicating the size and orientation of the repeat. The interior grayscale shading represents the divergence of the repeat (see above) while the outline color represents the class of the repeat. Dotted lines above the repeat and extending left or right indicate the length of unaligned repeat consensus ...
http://genome.ucsc.edu/cgi-bin/hgTrackUi?hgsid=802725241_2GqyAXJ76fEwSjZtEcFT8KUPGbgA&c=chr12&g=joinedRmsk
The Same DNA (deoxyribonucleic acid) | Foundation for Global Collaboration and Peace  The Same DNA (deoxyribonucleic acid) | Foundation for Global Collaboration and Peace
DNA from all organisms is made up of the same chemical and physical components. DNA molecules are shaped like a twisted ladder ("double helix"). Each rung/step is made up of a Base pair of nucleotide (molecules) bases, either A (Adenine) and T (Thymine) or C (Cytosine) and G (Guanine)). These Base pairs are held together by a band of Sugar phosphate on either end. The DNA sequence is a particular side-by-side arrangement of bases (half of the ladder) along the DNA strand (e.g., ATTCCGGA). The genome is an organisms complete set of DNA. DNA in the human genome is arranged into 24 distinct chromosomes. Genes comprise only about 2% of the human genome.. ...
http://fgcnp.org/uhc/biochemistry/same-dna
Cross-correlations of base-pair and dimer step parameters of DNA  Cross-correlations of base-pair and dimer step parameters of DNA
Deformability of both individual base pairs and dimer steps is important for DNA sequence recognition. Parameters describing base-pair and dimer step geometry may be correlated with each other due to stereochemical interactions of adjacent bases in dimer
http://www.jbsdonline.com/cross-correlations-base-pair-and-dimer-step-parameters-of-dna-p15784.html
DNA/RNA Synthesis  DNA/RNA Synthesis
Mixed bases are used in primers to bind to templates that contain variability or a mixture of sequences at the primer binding sites. Mixed bases can also be used to create diversity in clone libraries and in site directed mutagenesis.. IDT offers random base oligos. Order them by using an upper case letter N or other IUPAC-IUB symbol (see table below). IDT offers two types of randomization, machine mix and hand mix. Machine mix bases are charged at the standard base price for the scale ordered. Hand mixing is done to provide custom ratios of the bases, and incurs an additional charge. When entering your sequence, the "Mixed Base" tab at the bottom of the page lists the IUB symbols and is where custom mix ratios need to be entered ...
https://www.idtdna.com/pages/support/technical-vault/faq/product/dna-rna-synthesis/when-do-researchers-use-random-
Improved qPCR Analysis Following Storage in RNAstable™ | Sigma-Aldrich  Improved qPCR Analysis Following Storage in RNAstable™ | Sigma-Aldrich
RNAstable is a novel RNA preservation product designed to protect RNA samples from degradation during storage or shipment at ambient temperatures.
https://www.sigmaaldrich.com/technical-documents/articles/biology/improved-qpcr-analysis-following-storage-in-rnastable.html
Difference between revisions of BE.109:DNA engineering/DNA engineering by PCR - OpenWetWare  Difference between revisions of "BE.109:DNA engineering/DNA engineering by PCR" - OpenWetWare
There are three important considerations for the landing sequence. First, the sequence must be unique. Clearly a very short landing sequence (like TTT) would anneal to too many places during the PCR. You are assuring specificity by starting with a sequence that is 20 bases long. The second consideration is the temperature required for this sequence to base pair. The melting temperature depends on both the length of the landing sequence and the GC content. Finally there are secondary structures that the primer can adopt. A well-designed primer will have short hairpins (if any), its melting temperature will be around 60°C, and if possible its GC content will be about 50%. There are several websites to help you evaluate these aspects of your primer. Try to copy the 20 bases of landing sequence into the Cybergene website (http://www.cybergene.se/primer.html), another link that can be found on the BE.109 DNA engineering wiki page. Leave the defaults for stems and loops as they are and then analyze ...
https://openwetware.org/wiki/?title=BE.109:DNA_engineering/DNA_engineering_by_PCR&diff=20363&oldid=20265
Which DNA is good for PCR for amplify a certain sequence? cDNA or genomic DNA ? - Real-Time PCR  Which DNA is good for PCR for amplify a certain sequence? cDNA or genomic DNA ? - Real-Time PCR
genomic DNA - fewer steps (DNA purification, then PCR), but probably will be more difficult to perform the PCR because there will be fewer copies of your target sequence. However, if you have introns in your gene they will be included ...
http://www.protocol-online.org/biology-forums/posts/42224.html
a) Several methods to detect specific nucleotide chang | Open-i  a) Several methods to detect specific nucleotide chang | Open-i
(a) Several methods to detect specific nucleotide changes (polymorphisms) exist. One method relies on hybridization of oligonucleotides of known sequences to ta
https://openi.nlm.nih.gov/detailedresult.php?img=PMC107844_rr164-1&req=4
2% agarose gel showing 323 bp DNA fragment amplified | Open-i  2% agarose gel showing 323 bp DNA fragment amplified | Open-i
2% agarose gel showing 323 bp DNA fragment amplified using plasmids from fecal samples (a) M: marker pUC 19/Msp Digest, C(+): positive control, Lane 1-10: 5
https://openi.nlm.nih.gov/detailedresult.php?img=PMC3794518_BMRI2013-583850.002&req=4
Autoradiogram for DNA sequencing - Stock Image G210/0558 - Science Photo Library  Autoradiogram for DNA sequencing - Stock Image G210/0558 - Science Photo Library
DNA sequencing. A scientist marks reference points on an autoradiogram. The dark bands correspond to the base-pair (nucleotide) sequence of a section of DNA following its separation into fragments by the process of gel electrophoresis. Each group of four banded lines represents the nucleotide sequence of A-G-C-T (Adenine-Guanine-Cytosine- Thymine). Nucleotides are the structural and functional units of DNA. From this map the sequence of nucleotides can be determined in a strand of DNA, in order to find the structure of genes. - Stock Image G210/0558
http://www.sciencephoto.com/media/211072/view
Sandwalk: False history and the number of genes: 2016  Sandwalk: False history and the number of genes: 2016
The DNA sequence has a simple numerical expression: it is composed of three billion base pairs. That is enough information to code for about 100,000 to 300,000 genes, each gene being a region of DNA that can specify a protein or some other structure that carries out a function in the organism. Nobody knows how many genes are really involved, because we do not know the average size of a gene in the human body. Our estimate of 100,000 assumes that there are about 30,000 base pairs per gene, which is a reasonably good guess. But many genes are only 10,000 base pairs long, so perhaps there are as many as 300,000. Many of the most interesting of those genes have multiple RNA splicing patterns, that is, the messenger RNA transcribed from a single gene may splice together different parts of the DNA sequence of the gene. The function of these patterns must be understood in order to study an individual human gene. So saying that a human is made up of 1,000 genes underestimates the complexity of the human ...
http://sandwalk.blogspot.com/2016/07/false-history-and-number-of-genes-2016.html
thinkhand4a  thinkhand4a
Cut out the DNA base sequence strips along the dotted lines, and tape them, end to end, together to form one long strip. The pieces must be taped together so the numbers on the left and right sides of the strips match. Cut out the enzyme cards.. ...
http://www.accessexcellence.org/RC/AB/WYW/wkbooks/OBAS/thinkhand4a.html
Aleph Instants (AI)  Aleph Instants (AI)
This lecture and the first part have some interesting discussion of biology. They are from a couple years ago and are somewhat dated, but provide a very good overview of some of the interesting aspects of genes. The thing that I found to be really interesting was the fact that in any progeny there is a small set of SNPs which are carried along to all progeny and since we are talking about the product of 20 random numbers in the range between 1 and about 24 billion ( 3 billion base pairs x two duplicate sets ( in 26 chromosomes ) x 4 possible bases ), the likelihood of that specific product is unique in small populations like the humans. [ When rereading this I wondered about the possibility that every cell in my body could have an identifiable parentage due to the same transcription variations, kind of spooky and possibly a useful observation ...
http://infinitefuture.blogspot.com/2013/01/the-mother-and-father-of-all-snps.html
3849번: Palindromic DNA  3849번: Palindromic DNA
A DNA sequence is composed of a series of four possible nucleobases, namely Adenine, Guanine, Thymine and Cytosine; we will refer to each of these bases by their initial. For our purposes, nucleobases have an associated cyclic "order": A is followed by G, which in turn is followed by T, which is followed by C, which is followed by A again. State-of-the-art research in genomics has revealed the startling fact that many diseases are caused by certain subsequences of bases not forming a palindromic sequence! Your mission as a leading researcher at ICPC laboratories is to take a DNA string S and a series of subsets P1, ... , Pt of indices to characters (nucleobases) in S, and transform S so that each of the restrictions of the resulting string to P1, ... , Pt are palindromic. (The restriction of S to a subset P = {i1, i2, ... , ik} of indices, where 0 ≤ i1 , i2 , . . . , ik , ,S,, is the string Si1 Si2 ... Sik). It is possible to inspect any base of S at will, but only three transformations can be ...
https://www.acmicpc.net/problem/3849
State of the Phillies: Center field  State of the Phillies: Center field
Yesterday, we kicked off our week-long State of the Phillies series by breaking down the past, present and future of the first base and second base positions. Our mission over these next few days is to identify where, exactly, the Phillies can improve this roster. The outfield is one such area, although the free agent market isnt exactly bursting with talent there either. In todays story in the Daily News, Ruben Amaro Jr. tells Ryan Lawrence that the trade market could offer some possibilities. Here, we break it down. - David Murphy, Philadelphia Daily News
http://www.philly.com/philly/blogs/phillies/State-of-the-Phillies-Center-field.html?i=2&i=4&jCount=2
X-ChIP with various cell lines exhibiting amplification of exact same fragments in selected primer pairs | MEK Inhibitor...  X-ChIP with various cell lines exhibiting amplification of exact same fragments in selected primer pairs | MEK Inhibitor...
Figure S16 Comparison of distinct histones in between A2B1 and A2C12 (A). Examples of ChIP experiments carried out on the same working day in A2B1 and A2C12 in
http://www.sgkinhibitor.com/2016/12/06/x-chip-with-various-cell-lines-exhibiting-amplification-of-exact-same-fragments-in-selected-primer-pairs/
Integrated DNA Technologies  Integrated DNA Technologies
Return to Fluorophores Modifications The internal and 3 version of this modification are attached to the oligonucleotide through a dT base; therefore, a dT nucleotide will be added at the position of these modifications. To avoid adding an extra nucleotide, replace an existing T nucleotide in your sequence with the required modification.. ...
https://www.idtdna.com/site/Catalog/Modifications/Product/2463
Release 5.6/6.1 sp1 - changes from 5.6/6.1  Release 5.6/6.1 sp1 - changes from 5.6/6.1
Base: rocks yum repository is clean from errors (automatic dependecies/provides detection has been disable on several packages, in particular: all the opt-perl-* rpms, foudation-git, etc.) Base: /opt/rocks/lib/mysql is not included in the loader path so system mysql uses system libmysqlclient.so and not rocks mysql libs (several other useless entries were removed from the ld.so.conf). Base: JDK updated Base: grub boot timeout is now 10 seconds Base: improved script to fetch 441 private key after re-installation of a node Base: it is now possible to use a /etc/ssh/ssh_known_hosts.local to insert static entries Base: rocks set host interface ip does not allow anymore invalid IP number Base, Ganglia, KVM: several fixes and improvement to the documentations Base: Bugfix. record in rocks data base partitioning information Base: rocks report host interface was failing with bonded interface Ganglia: rrd uses previous data retention policy (as in ganglia 3.2) to reduce disk usage (ganglia 3.3 policy was ...
http://central-7-0-x86-64.rocksclusters.org/roll-documentation/base/7.0/x2944.html
HRES1 Gene - GeneCards | HRES1 Protein | HRES1 Antibody  HRES1 Gene - GeneCards | HRES1 Protein | HRES1 Antibody
Complete information for HRES1 gene (Protein Coding), HTLV-1 Related Endogenous Sequence, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
http://www.genecards.org/cgi-bin/carddisp.pl?gene=HRES1
cis-acting locus - oi  cis-acting locus - oi
A genetic region affecting the activity of genes on that same DNA molecule. Cis-acting loci generally do not encode proteins, but rather serve as attachment sites for DNA-binding proteins. Enhancers, operators, and promoters are examples of cis-acting loci. Contrast with trans-acting locus. ...
http://oxfordindex.oup.com/view/10.1093/oi/authority.20110803095613471
Mortensen RD et al. (2011), Posttranscriptional activation of gene expressi... - Xenbase Paper  Mortensen RD et al. (2011), Posttranscriptional activation of gene expressi... - Xenbase Paper
Fig. 4. Myt1 mRNA translation is up-regulated by a 5′ variant xlmiR16. (A) Myt1 3′-UTR has seven putative xlmiR16 sites (dashes). Mutation of the site at 1,284 nt (mt3Myt1 3′-UTR) in the 528-nt or full-length Myt1 3′-UTR failed to demonstrate translation activation and was unaffected by xlmiR16 presence or depletion (SI Methods; siRNAs antisense to pre-miR16 reduced mature xlmiR16 after 6 h, likely because of interference with processing or stability instead of cleavage activity; Fig. S4A). Translation activation is restored by addition of a compensatorily mutated xlmt3miR16 that can base pair to the mutated site (SI Methods). Both B1/xlmiR16 (shown) and B3/xlmiR16 (Fig. 4C shows base pairing) are able to rescue. (B) Northern analyses of Firefly reporters containing the 528-nt Myt1 3′-UTR and mt3Myt1 3′-UTR and REN RNA levels after treatment with si-pre-miR16 with or without mt3xlmiR16 add-back. (Right) Endogenous Myt1 mRNA levels with or without si-pre-miR16 treatment; U6 RNA is a ...
http://www.xenbase.org/literature/article.do?method=display&articleId=43201
Brevet US7537408 - Modular connection for orthopedic component - Google Brevets  Brevet US7537408 - Modular connection for orthopedic component - Google Brevets
An orthopedic component comprising a first element and a second element, with the first element and the second element being secured to one another with a modular connection, wherein the modular connection comprises a taper junction and an engaged-fit junction.
http://www.google.fr/patents/US7537408
Base Sequence Analysis  Base Sequence Analysis
1997-2006 Healthboard.com. Healthboard.com is a purely informational website, and should not be used as a substitute for professional legal, medical or technical advice. ...
http://healthboard.com/Encyclopedia/Biotech/term/base_sequence_analysis.html
Clarkson Laboratory and Supply Inc - Information  Clarkson Laboratory and Supply Inc - Information
PCR The polymerase chain reaction (PCR) is a biochemical technology in molecular biology to amplify a single or a few copies of a piece of DNA across several orders of magnitude, generating thousands to millions of copies of a particular DNA sequence ...
http://store.clarksonlab.com/information.aspx
Base Flipping  Base Flipping
... involves rotation of backbone bondsin double‐stranded deoxyribonucleic acid (DNA) to expose an out‐of‐stack base, which can then be a substrate for an enzyme‐catalysed chemical reaction or for a specific protein binding interaction
http://www.els.net/WileyCDA/ElsArticle/refId-a0002714.html
Complement facts | Factolex  Complement facts | Factolex
Complement (complementary DNA) -- In genetics, complementary DNA (cDNA) is DNA synthesized from a mature mRNA template in a reaction catalyzed by the enzyme reverse transcriptase. cDNA is often used to clone eukaryotic genes in prokaryotes. cDNA is also produced by retroviruses (such. fact lexicon with terms going straight to the point. Facts are sorted by community importance and you can build your personalized lexicon
http://en.factolex.com/Complement:dna
Epidemiological studies using computerized data bases iii. examples of epidemiological studies using computerized data bases  Epidemiological studies using computerized data bases iii. examples of epidemiological studies using computerized data bases
Thrusfield, M. V., 1986: Epidemiological studies using computerized data bases iii. examples of epidemiological studies using computerized data bases
https://eurekamag.com/research/005/375/005375528.php
Transcriptional promoter of the human α1(V) collagen gene (COL5A1) | Biochemical Journal  Transcriptional promoter of the human α1(V) collagen gene (COL5A1) | Biochemical Journal
We have characterized the 5′ region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of housekeeping and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5′ sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained ...
http://www.biochemj.org/content/310/1/15
Cell Type-Specific Chromatin Signatures Underline Regulatory DNA Elements in Human Induced Pluripotent Stem Cells and Somatic...  Cell Type-Specific Chromatin Signatures Underline Regulatory DNA Elements in Human Induced Pluripotent Stem Cells and Somatic...
RATIONALE: Regulatory DNA elements in the human genome play important roles in determining the transcriptional abundance and spatiotemporal gene expression during embryonic heart development and somatic cell reprogramming. It is not well known how chromatin marks in regulatory DNA elements are modulated to establish cell type-specific gene expression in the human heart. OBJECTIVE: We aimed to decipher the cell type-specific epigenetic signatures in regulatory DNA elements and how they modulate heart-specific gene expression. METHODS AND RESULTS: We profiled genome-wide transcriptional activity and a variety of epigenetic marks in the regulatory DNA elements using massive RNA-seq (n=12) and ChIP-seq (chromatin immunoprecipitation combined with high-throughput sequencing; n=84) in human endothelial cells (CD31(+)CD144(+)), cardiac progenitor cells (Sca-1(+)), fibroblasts (DDR2(+)), and their respective induced pluripotent stem cells. We uncovered 2 classes of regulatory DNA elements: class I was ...
https://www.cirm.ca.gov/node/143668/
Primary structure of guinea pig preprodynorphin and preproenkephalin mRNAs : multiple transcription initiation sites for...  Primary structure of guinea pig preprodynorphin and preproenkephalin mRNAs : multiple transcription initiation sites for...
The endogenous opioid enkephalin neuropeptides are mediators of pain perception and have been implicated in human addictions. The preproenkephalin gene and its mRNA have also provided many examples of tissue- and species-specific variations in mRNA structure produced through a variety of transcriptional and post-transcriptional mechanisms. Resultant differences in mRNA structure, in several cases, have impact on translation of enkephalin prepropeptide. The reports and discussion presented herein describe studies of the preproenkephalin gene and mRNA structure in the guinea pig, an animal that may have specific advantages for modeling the human endogenous opioid system. A guinea pig brain cDNA library was constructed and screened for clones of preproenkephalin and preprodynorphin, which were then sequenced. These studies confirmed the predicted mRNA structure that had been previously proposed based on homology with gene sequences and other methods. Multiple transcription initiation sites for each ...
http://uu.diva-portal.org/smash/record.jsf?pid=diva2:164133
Essential role of NF-κB in transactivation of the human immunodeficiency virus long terminal repeat by the human...  Essential role of NF-κB in transactivation of the human immunodeficiency virus long terminal repeat by the human...
The 72 kDa IE1 protein of human cytomegalovirus (HCMV) is one of a few viral regulatory proteins expressed immediately after infection of a host cell. Although it is now well-established that IE1 is a potent transcriptional activator of the human immunodeficiency virus (HIV) long terminal repeat (LTR), the identity of the nucleotide sequence responsive to IE1 remains elusive and the molecular mechanism of this interaction is not well-understood. We have constructed various LTR mutants and tested them for their ability to be activated by IE1 using transient transfection assays. Mutations in the NF-κB sites, of either a few changes in the nucleotide sequence or a deletion of the entire region, abrogated IE1-driven transactivation. Deletion of the Tat-responsive element (TAR) had no significant effect on reporter expression. Mutations in the Sp1 sites or the TATA box significantly lowered LTR activity, but this is probably due to an effect on the general transcription system, as these elements are also
https://www.microbiologyresearch.org/content/journal/jgv/10.1099/0022-1317-77-1-83
Mung bean nuclease - Wikipedia  Mung bean nuclease - Wikipedia
Mung bean nuclease is a nuclease derived from sprouts of the mung bean Vigna radiata that removes nucleotides in a step-wise manner from single-stranded DNA molecules (ssDNA) and is used in biotechnological applications to remove such ssDNA from a mixture also containing double-stranded DNA (dsDNA). This enzyme is useful for transcript mapping, removal of single-stranded regions in DNA hybrids or single-stranded overhangs produced by restriction enzymes, etc. The enzyme degrades single-stranded DNA or RNA to nucleoside 5-monophosphates, but does not digest double-stranded DNA, double-stranded RNA, or DNA / RNA hybrids. Mung Bean Nuclease catalyzes the specific degradation of single-stranded DNA or RNA, and produces mono and oligonucleotides carrying a 5′-P terminus. Mung bean nuclease has a theoretical molecular weight of 39 kDa. Mung bean nuclease has a stringent single-stranded specificity for DNA or RNA and produces 5-phosphoryl oligo- and mononucleotides. Mung bean nuclease requires ...
https://en.wikipedia.org/wiki/Mung_bean_nuclease
TFBSbank: a dedicated and comprehensive platform to dissect the big data of protein-DNA interaction in model species  TFBSbank: a dedicated and comprehensive platform to dissect the big data of protein-DNA interaction in model species
GO Terms Descrition:, periodic partitioning by pair rule gene, central nervous system development, RNA polymerase II distal enhancer sequence-specific DNA binding, positive regulation of transcription from RNA polymerase II promoter, trunk segmentation, cell fate specification, RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity, RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription, regulation of transcription from RNA polymerase II promoter, blastoderm segmentation, negative regulation of transcription from RNA polymerase II promoter, regulation of transcription, DNA-templated, sequence-specific DNA binding transcription factor activity, nucleus, sequence-specific DNA binding, gonadal mesoderm development, segmentation, posterior head segmentation, germ cell migration ...
http://tfbsbank.co.uk/result.php?jobdir=Results/DB0073/
Quantification of an arbuscular mycorrhizal fungus, Glomus mosseae, within plant roots by competitive polymerase chain reaction...  Quantification of an arbuscular mycorrhizal fungus, Glomus mosseae, within plant roots by competitive polymerase chain reaction...
An assay based on the competitive polymerase chain reaction (PCR) was developed to quantify Glomus mosseae, an arbuscular mycorrhizal (AM) fungus, within plant roots. Using previously designed G. mosseae specific primers, a heterologous internal standard was constructed by amplifying Pseudomonas DNA under low stringency annealing conditions. Go-amplification of G. mosseae and internal standard DNA within leek root extracts provided accurate quantification of target DNA. Colonization of leek roots by G. mosseae was monitored in a comparative study by competitive PCR and microscopy, a conventional method of quantification. These two methods gave closely parallel data for G. mosseae colonization from three different inoculum levels over a 6 week period Results indicate that competitive PCR is a sensitive and accurate method of quantification. The major advantage of competitive PCR over microscopy is that it can quantify specific AM fungi. ...
http://eprints.whiterose.ac.uk/1536/
Development of specific nucleic acid probes for the differentiation of porcine rotavirus serotypes<...  Development of specific nucleic acid probes for the differentiation of porcine rotavirus serotypes<...
TY - JOUR. T1 - Development of specific nucleic acid probes for the differentiation of porcine rotavirus serotypes. AU - Johnson, Michael E.. AU - Paul, Prem S.. AU - Gorziglia, Mario. AU - Rosenbusch, Ricardo. PY - 1990/9. Y1 - 1990/9. N2 - A dot blot hybridization assay is described for the detection and differentiation of porcine rotavirus serotypes. Recombinant complementary DNA (cDNA) representing gene 9 (the gene encoding the neutralization antigens in VP7 glycoprotein) from OSU (porcine rotavirus serotype 1) and Gottfried (porcine rotavirus serotype 2) strains were used to determine the optimal hybridization conditions which allow specific detection of group A porcine rotaviruses. Probes were prepared by excision of the inserts from the recombinant plasmids and radiolabeling of cDNA with 32P by the random primer extension method. Probes were hybridized at various stringencies with viral RNA from different rotavirus serotypes bound to nylon membranes. Hybridization at low stringency (26% ...
https://nebraska.pure.elsevier.com/en/publications/development-of-specific-nucleic-acid-probes-for-the-differentiati
The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members from | Beneficial Effects of RAF Inhibitor...  The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members from | Beneficial Effects of RAF Inhibitor...
The chicken ovalbumin upstream promoter transcription factors (COUP-TFs) are members from the steroid/thyroid hormone receptor superfamily and function in transcriptional regulation of a multitude of genes. of the ovalbumin gene (Bagchi et al., 1987; Pastorcic et al., 1986; Wang et Procyanidin B3 inhibitor Mouse monoclonal to Human Albumin al., 1987). It was found to bind an element (COUP) between C90 and C70 within the ovalbumin promoter that is much like thyroid and estrogen response elements (Pastorcic et al., 1986). The COUP-TF has also been shown to bind cis-elements involved in positive transcription rules in the rat insulin II (Hwung et al., 1988; Hwung et al., 1988b), chicken VLDL II (Wijnholds et Procyanidin B3 inhibitor al., 1988), and human being apolipoprotein AI and CIII genes (Ladias and Karathanasis, 1991). It was also reported to bind to bad regulatory elements in the proopiomelanocortin (Drouin et al., 1989a; Drouin et al., 1989b) and HIV-1 (Cooney et al., 1991) promoters. The ...
http://biodiversityhotspot.org/2019/06/the-chicken-ovalbumin-upstream-promoter-transcription-factors-coup-tfs-are-members-from/
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation ScienceHealth Care
Base SequenceBase PairingNucleic Acid ConformationDNABase CompositionNucleic Acid DenaturationMolecular Sequence DataNucleic Acid RenaturationOligonucleotidesNucleic Acid HybridizationOligodeoxyribonucleotidesPolydeoxyribonucleotidesAminacrineDNA, ViralDNA, BacterialRNA, Ribosomal, 18SEscherichia coliPoly dA-dTCloning, MolecularRNA, RibosomalSkull BaseGuanineSequence Homology, Nucleic AcidDNA, CircularAmino Acid SequenceGenesSaccharomycesSchiff BasesIntercalating AgentsPlasmidsModels, MolecularRNAAdenineSaccharomycetalesDNA Restriction EnzymesMutationRepetitive Sequences, Nucleic AcidRNA, ViralTranscription, GeneticDNA, Single-StrandedDeoxyribonucleotidesSpecies SpecificityThermodynamicsPoly ATritiumColiphagesRNA, MessengerKineticsOligoribonucleotidesHybridization, GeneticTemperatureChemistryGenes, BacterialRNA, BacterialChemical PhenomenaNucleotidesRNA, FungalBinding SitesGenes, ViralRestriction MappingHot TemperatureTransformation, GeneticMagnetic Resonance SpectroscopyTemplates, GeneticMolecular WeightCentrifugation, Density GradientDNA, RecombinantRibonucleasesEndonucleasesPhylogenySubstrate SpecificityDNA ProbesCell LineStructure-Activity RelationshipDNA ReplicationPolymerase Chain ReactionSkull Base NeoplasmsPromoter Regions, GeneticDNA PrimersModels, ChemicalBiological EvolutionBase Pair MismatchCircular DichroismSequence Analysis, DNADNA-Directed RNA PolymerasesSequence AlignmentMicroscopy, ElectronProtein BiosynthesisElectrophoresis, Polyacrylamide GelDenture BasesBacterial ProteinsComputer SimulationViral ProteinsDNA, RibosomalDNA-Binding ProteinsProtein BindingDNA DamageKnowledge BasesMannich BasesDNA GlycosylasesDNA RepairThymineHydrogen BondingUracil

*Knuth's up-arrow notation

Numeration systems based on the hyperoperation sequence[edit]. R. L. Goodstein,[2] with a system of notation different from ... This compares to ordinary base-2 representation when the latter is written out in terms of the base b; e.g., in ordinary base-2 ... Note that in this type of base-b hereditary representation, the base itself appears in the expressions, as well as "digits" ... It is closely related to the Ackermann function and especially to the hyperoperation sequence. The idea is based on the fact ...

*Affinity chromatography

Complementary base sequence 5 Hormone Receptor 6 Avidin Biotin 7 Calmodulin Calmodulin binding molecule ... WAC is an affinity-based liquid chromatographic technique that separates chemical compounds based on their different weak ... The way that the desired enzyme would be eluted would be from the mixture based on the strong interaction of enzyme and the ... Affinity chromatography is a method of separating biochemical mixture based on a highly specific interaction between antigen ...

*Vampire number

Base-dependent integer sequences. Hidden categories: *Articles lacking in-text citations from September 2010 ... This sequence starts (sequence A020342 in the OEIS): 126, 153, 688, 1206, 1255, 1260, 1395, .... A prime vampire number, as ... There are many known sequences of infinitely many vampire numbers following a pattern, such as: 1530 = 30×51, 150300 = 300×501 ...

*Parasitic number

Sequence OEIS: A092697 in the On-Line Encyclopedia of Integer Sequences.. *. Bernstein, Leon (1968), "Multiplicative twins and ... it will find them in base 8 and base 16 as well. Look at line 15 in Table Two. The fix, when this condition is identified and ... Other bases[edit]. In duodecimal system, the smallest n-parasitic numbers are: (using inverted two and three for ten and eleven ... An n-parasitic number (in base 10) is a positive natural number which can be multiplied by n by moving the rightmost digit of ...

*Repunit

Thus, the number Rn = Rn(10) consists of n copies of the digit 1 in base 10 representation. The sequence of repunits base 10 ... Base 9 repunit primes[edit]. There are no base 9 repunit primes. 9. n. −. 1. =. (. 3. n. +. 1. ). (. 3. n. −. 1. ). {\ ... Base 4 repunit primes[edit]. The only base 4 repunit prime is 5 (. 11. 4. {\displaystyle 11_{4}}. ). 4. n. −. 1. =. (. 2. n. + ... 5, 13, 131, 149, 1699, ... (sequence A004063 in the OEIS).. Base 8 repunit primes[edit]. The only base 8 repunit prime is 73 ( ...

*Microviridae

Gene K overlaps genes A, B, and C. The origin of replication lies within a 30 base sequence. The entire 30 base sequence is ... Viruses are assigned according to their similarity to known lab based strains-the ΦX174-like clade, G4-like clade and the α3- ... Zsak L, Day JM, Oakley BB, Seal BS (2011) The complete genome sequence and genetic analysis of ΦCA82 a novel uncultured ... Kodaira K, Nakano K, Okada S, Taketo A (1992) Nucleotide sequence of the genome of the bacteriophage alpha 3: interrelationship ...

*Heredity

The sequence of bases along a particular DNA molecule specifies the genetic information: this is comparable to a sequence of ... If the DNA sequence at a particular locus varies between individuals, the different forms of this sequence are called alleles. ... different genes have different sequences of bases. Within cells, the long strands of DNA form condensed structures called ... containing a unique combination of DNA sequences that code for genes. The specific location of a DNA sequence within a ...

*Human genetic variation

... of all sequence variants.[13] Other sequence variations are single base exchanges, deletions and insertions.[14] SNPs occur on ... affecting 20 million bases of sequence"; the latter figure corresponds to 0.6% of total number of base pairs.[3] Nearly all (, ... This added to the two haploid sequences which were amalgamations of sequences from many individuals, published by the Human ... in the genetic sequence, but structural variations account for a greater number of base-pairs than the SNPs and indels.[3][12] ...

*Dennstaedtiaceae

1995). "Fern Phylogeny Based on rbcL Nucleotide Sequences." American Fern Journal 85(4): 134-181 ... a b Wolf, P. G. (1995). "Phylogenetic Analyses of rbcL and Nuclear Ribosomal RNA Gene Sequences in Dennstaedtiaceae." American ... Wolf, P. G. (1997). "Evaluation of atpB Nucleotide Sequences for Phylogenetic Studies of Ferns and Other Pteridophytes." ...

*核酸热力学 - 维基百科，自由的百科全

Predicting DNA Duplex Stability from the Base Sequence. Proc. Natl. Acad. Sci. USA. 1986, 83 (11): 3746-3750. PMC 323600. PMID ... Owczarzy R., Vallone P.M., Gallo F.J., Paner T.M., Lane M.J. and Benight A.S. Predicting sequence-dependent melting stability ... Detection and Localization of Single Base Changes by Denaturing Gradient Gel Electrophoresis. Methods in Enzymology. Methods in ...

*Sistema APG III - Wikipédia, a enciclopédia livre

Phylogeny of basal eudicots based on three molecular data sets: atpB, rbcL, and 18S nuclear ribosomal DNA sequences. Annals of ... Phylogenetics of flowering plants based on combined analysis of plastid atpB and rbcL gene sequences. Syst. Biol. 49: 306-362. ... Phylogeny of the eudicots: a nearly complete familial analysis based on rbcL gene sequences. Kew Bull. 55: 257-309. ... Phylogenetics of flowering plants based upon a combined analysis of plastid atpB and rbcL gene sequences. Systematic Biology 49 ...

*Agavoideae

David J. Bogler and Beryl B. Simpson (September 1996). "Phylogeny of Agavaceae Based on ITS rDNA Sequence Variation". American ... This is based on data from molecular systematics.[3] Stevens comments that "The broad concept of Agavoideae [...] may not seem ... David J. Bogler, J. Chris Pires and Javier Francisco-Ortega (2006). "Phylogeny of Agavaceae based on ndhF, rbcL, and ITS ... sequences: implications of molecular data for classification". Aliso. 22 (Monocots: Comparative Biology and Evolution): 313-328 ...

*Wollemia

"Familial Concepts and Relationships in the Conifer Based on rbcL and matK Sequence Comparisons". Kew Bulletin. 57 (3): 513-31. ... "Phylogenetic relationships within Araucariaceae based on rbcL gene sequences". American Journal of Botany. 85 (11): 1507-16. ... "Phylogenetic relationships and divergence times of the family Araucariaceae based on the DNA sequences of eight genes". Chinese ... They are arranged spirally on the shoot but twisted at the base to appear in two or four flattened ranks. As the leaves mature ...

*Pendon Museum

This sequence is based on timetables of the period. They are all modelled in 4 mm to 1 foot scale (1:76), and run on track of ... Operation consists of a sequence of trains, showing what one could have seen passing by on a summer day and night, in the mid- ... The model trains are hand built, to represent individual locomotives, carriages, and wagons as exactly possible, based on ...

*Molecular phylogenetics

At any location within such a sequence, the bases found in a given position may vary between organisms. The particular sequence ... These have been replaced in recent times largely by DNA sequencing, which produces the exact sequences of nucleotides or bases ... The base sequences for the haplotypes are then compared. In the simplest case, the difference between two haplotypes is ... The advantage claimed for using hybridisation rather than gene sequencing was that it was based on the entire genotype, rather ...

*Operational taxonomic unit

Sequences can be clustered according to their similarity to one another, and operational taxonomic units are defined based on ... Typically, OTUs are based on similar 16S rRNA sequences. It remains debatable how well this commonly-used method recapitulates ... W. Chen, C. K. Zhang, Y. Cheng, S. Zhang, H. Zhao: A comparison of methods for clustering 16S rRNA sequences into OTUs. In: ... grouped by DNA sequence similarity of a specific taxonomic marker gene.[2] In other words, OTUs are pragmatic proxies for ...

*Complementarity (molecular biology)

... the nucleotide bases at each position in the sequences will be complementary, much like looking in the mirror and seeing the ... Base pair. References[edit]. *^ a b c d e f g h Watson, James, Cold Spring Harbor Laboratory, Tania A. Baker, Massachusetts ... The base complement A=T shares two hydrogen bonds, while the base pair G≡C has three hydrogen bonds. All other configurations ... A complementary strand of DNA or RNA may be constructed based on nucleobase complementarity.[2] Each base pair, A=T vs. G≡C, ...

*GFAJ-1

Phylogeny of GFAJ-1 based on ribosomal DNA sequences.[12] Molecular analysis based on 16S rRNA sequences shows GFAJ-1 to be ... The sequence of the genome of the bacterium GFAJ-1 is now posted in GenBank.[14] ... 16S rRNA sequence identity to other known species[16] and metabolic differences allowing them to be discerned apart. In ... "Arsenate-based DNA: a big idea with big holes". Science Blogs - We, Beasties blog]. Archived from the original on 8 December ...

*Chloroplast

Over time, base changes in the DNA sequence can arise from deamination mutations. When adenine is deaminated, it becomes ... Hypoxanthine can bind to cytosine, and when the XC base pair is replicated, it becomes a GC (thus, an A → G base change).[77] ... Its existence was first proved in 1962,[43] and first sequenced in 1986-when two Japanese research teams sequenced the ... See also: List of sequenced plastomes. Chloroplasts have their own DNA,[61] often abbreviated as ctDNA,[62] or cpDNA.[63] It is ...

*Brassicaceae

Hall, J.C.; Sytsma, K.J.; Iltis, H.H. (2002). "Phylogeny of Capparaceae and Brassicaceae based on chloroplast sequence data". ... There is one superior pistil that consists of two carpels that may either sit directly above the base of the stamens or on a ... The leaves do not have stipules, but there may be a pair of glands at base of leafstalks and flowerstalks. The leaf may be ... The receptacle carries a variable number of nectaries, but these are always present opposite the base of the lateral stamens.[ ...

*Apiaceae

Plunkett, G. M.; Soltis, D. E.; Soltis, P. S. (1996). "Evolutionary Patterns in Apiaceae: Inferences Based on matK Sequence ... Based on Phylogenetic Analysis of rbcL Sequences". Botanical Society of America. 83 (4): 499-515. doi:10.2307/2446219.. ... Most Apiaceae are annual, biennial or perennial herbs (frequently with the leaves aggregated toward the base), though a ... Traditionally groups within the family have been delimited largely based on fruit morphology, and the results from this have ...

*Xanthomonadales

"Evolutionary placement of Xanthomonadales based on conserved protein signature sequences". Mol Phylogenet Evol. 54 (2): 524-34 ... 2005). "The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice". Nucleic ... Chen J, Xie G, Han S, Chertkov O, Sims D, Civerolo EL (2010). "Whole genome sequences of two Xylella fastidiosa strains (M12 ... Christensen P, Cook F (1978). "Lysobacter, a New Genus of Nonfruiting, Gliding Bacteria with a High Base Ratio". Int J Syst ...

*Nematode

Ahrén D, Ursing BM, Tunlid A (1998). "Phylogeny of nematode-trapping fungi based on 18S rDNA sequences". FEMS Microbiology ... More recent, fact-based estimates have placed the true figure closer to 40,000 species worldwide.[8] ... C. elegans has had its entire genome sequenced, the developmental fate of every cell determined, and every neuron mapped. ... Initial studies of incomplete DNA sequences[29] suggested the existence of five clades:[30] ...

*Kingfisher

Cladogram based on combined analysis of RAG1 and ND2 sequences. The mitochondrial ND2 sequences used alone suggests an ...

*Zellige

There are also sequences based on five and on eight.) Within a single star pattern, variations abound-by the mix of colors, the ... Star-based patterns are identified by their number of points-'itnashari for 12, 'ishrini for 20, arba' wa 'ishrini for 24 and ... is mosaic tilework made from individually chiseled geometric tiles set into a plaster base.[1] This form of Islamic art is one ... because geometry requires that the number of points of any star in this sequence be divisible by six. ( ...

*Nanga Punga Dost

It is based on Aamir's nude sequence in the film."[4] Regarding the vocals by Ghoshal in the song, Moitra stated: "Shreya has ... based on Aamir Khan's naked sequence in the film. Moitra confirmed the news: "Nanga Punga is an amazing, crazy and wild song, ...

*Ariosa v. Sequenom

Courts these days are making policy-based decisions, untethered from any rule of law, aimed at killing patents they don't like. ... So they wanted to focus on genetic fragments containing paternally inherited sequences the mother did not share, but had ... mc2 and based on a requirement to keep speculator trolls out: [I]f the breadth of the claim is sufficiently limited to a ...

*Viridans streptococci

Some taxonomists have lumped the S. sanguinis group in with the S. mitis group based on 16S rRNA gene sequence analysis, but S ... sequence homology in this gene. In light of the high degree of 16S rRNA gene sequence similarity, sequencing of alternative ... Other sequence-based identification systems have subsequently been introduced for VGS species level identification. In general ... Sequence-based identification. Historically, DNA-DNA hybridization studies have been used to confirm species level ...
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation ScienceHealth Care
Base SequenceBase PairingNucleic Acid ConformationDNABase CompositionNucleic Acid DenaturationMolecular Sequence DataNucleic Acid RenaturationOligonucleotidesNucleic Acid HybridizationOligodeoxyribonucleotidesPolydeoxyribonucleotidesAminacrineDNA, ViralDNA, BacterialRNA, Ribosomal, 18SEscherichia coliPoly dA-dTCloning, MolecularRNA, RibosomalSkull BaseGuanineSequence Homology, Nucleic AcidDNA, CircularAmino Acid SequenceGenesSaccharomycesSchiff BasesIntercalating AgentsPlasmidsModels, MolecularRNAAdenineSaccharomycetalesDNA Restriction EnzymesMutationRepetitive Sequences, Nucleic AcidRNA, ViralTranscription, GeneticDNA, Single-StrandedDeoxyribonucleotidesSpecies SpecificityThermodynamicsPoly ATritiumColiphagesRNA, MessengerKineticsOligoribonucleotidesHybridization, GeneticTemperatureChemistryGenes, BacterialRNA, BacterialChemical PhenomenaNucleotidesRNA, FungalBinding SitesGenes, ViralRestriction MappingHot TemperatureTransformation, GeneticMagnetic Resonance SpectroscopyTemplates, GeneticMolecular WeightCentrifugation, Density GradientDNA, RecombinantRibonucleasesEndonucleasesPhylogenySubstrate SpecificityDNA ProbesCell LineStructure-Activity RelationshipDNA ReplicationPolymerase Chain ReactionSkull Base NeoplasmsPromoter Regions, GeneticDNA PrimersModels, ChemicalBiological EvolutionBase Pair MismatchCircular DichroismSequence Analysis, DNADNA-Directed RNA PolymerasesSequence AlignmentMicroscopy, ElectronProtein BiosynthesisElectrophoresis, Polyacrylamide GelDenture BasesBacterial ProteinsComputer SimulationViral ProteinsDNA, RibosomalDNA-Binding ProteinsProtein BindingDNA DamageKnowledge BasesMannich BasesDNA GlycosylasesDNA RepairThymineHydrogen BondingUracil
Converting a 16/9 sequence into a 4/3 video | Slade Knowledge BaseConverting a 16/9 sequence into a 4/3 video | Slade Knowledge Base
In fact, I had a client this morning that needed to convert a DVCPro-50 16:9 sequence into a DV 4:3 video. Heres how to do it. ... 4) The movie will export - and will take a while to do so, depending upon the length of the sequence you are exporting. Use ... I just wanted to mention a minor problem I discovered with your "converting a 16:9 sequence to 4:3 video" article. I was ... Slade Knowledge Base is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License, 2018 ...
more infohttps://www.ucl.ac.uk/slade/know/3305
CiteSeerX - Search Results - Local alignment of two-base encoded DNA sequenceCiteSeerX - Search Results - Local alignment of two-base encoded DNA sequence
Local alignment of two-base encoded DNA sequence ... Multiple DNA and protein sequence alignment based on segment-to ... Whole methylome analysis by ultra-deep sequencing using two-base encoding by Christina A. Bormann Chung, Victoria L. Boyd, ... Insertion sequences by Jacques Mahillon, Michael Ch, Jacques Mahillon, Michael Chandler - Microbiol Mol. Biol. Rev , 1998 ... Local Alignments of DNA Sequences by unknown authors , 2002 "... Abstract This paper presents aheuristic for finding close to ...
more infohttps://citeseerx.ist.psu.edu/search?q=Local+alignment+of+two-base+encoded+DNA+sequence
MOABS: model based analysis of bisulfite sequencing data. - PubMed - NCBIMOABS: model based analysis of bisulfite sequencing data. - PubMed - NCBI
MOABS: model based analysis of bisulfite sequencing data.. Sun D, Xi Y, Rodriguez B, Park HJ, Tong P, Meong M, Goodell MA, Li W ... e) and (f) Same as (c) and (d) with 4X sequencing depth by random sampling. The 10000 times of random shuffle of TFBSs ... Sequencing depth is randomly sampled from 5-fold to 50-fold. The Y-axis shows the percentage of true DMCs predicted at 5% FDR. ... Bisulfite sequencing (BS-seq) is the gold standard for studying genome-wide DNA methylation. We developed MOABS to increase the ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/24565500
HTG Molecular Launches Next-Generation Sequencing-Based Immuno-Oncology AssayHTG Molecular Launches Next-Generation Sequencing-Based Immuno-Oncology Assay
... Published 7:30 AM ET Thu, 1 Oct 2015 Globe ... These forward-looking statements are based upon managements current expectations, are subject to known and unknown risks, and ... HTG EdgeSeq Immuno-Oncology Assay couples HTGs proprietary nuclease protection chemistry with next-generation sequencing (NGS ... system capabilities have been expanded to fully automate sample and targeted library preparation for next-generation sequencing ...
more infohttps://www.cnbc.com/2015/10/01/globe-newswire-htg-molecular-launches-next-generation-sequencing-based-immuno-oncology-assay.html
Sequences of Generalized Happy Numbers with Small BasesSequences of Generalized Happy Numbers with Small Bases
Journal of Integer Sequences, Vol. 10 (2007), Article 07.1.8. Sequences of Generalized Happy Numbers with Small Bases H. G. ... For bases b ≤ 5 and exponents e ≥ 2, there exist arbitrarily long finite sequences of d-consecutive e-power b-happy numbers for ... Published in Journal of Integer Sequences January 8 2007. Return to Journal of Integer Sequences home page ... Concerned with sequence A000108 .) Received June 29 2006; revised version received January 8 2007. ...
more infohttp://www.emis.de/journals/JIS/VOL10/Grundman/grundman5.html
Numerical Characterization of DNA Sequence Based on DinucleotidesNumerical Characterization of DNA Sequence Based on Dinucleotides
"Analysis of similarity/dissimilarity of DNA sequences based on nonoverlapping triplets of nucleotide bases," Journal of ... Numerical Characterization of DNA Sequence Based on Dinucleotides. Xingqin Qi,1 Edgar Fuller,2 Qin Wu,3 and Cun-Quan Zhang2 ... Z. H. Qi and X. Q. Qi, "Numerical characterization of DNA sequences based on digital signal method," Computers in Biology and ... B. Liao, R. Li, W. Zhu, and X. Xiang, "On the similarity of DNA primary sequences based on 5-D representation," Journal of ...
more infohttps://www.hindawi.com/journals/tswj/2012/104269/ref/
Enzyme Finder - Sequence | 6 Bases | NEBEnzyme Finder - Sequence | 6 Bases | NEB
Sequence Cut Site Overhang Properties (NEB Enzymes Only) Nb ... Enzyme Finder - Sequence , 6 Bases. Enzyme. Sequence. Cut Site ... Home Tools & Resources Selection Charts Enzyme Finder - Sequence , 6 Bases ... DNA Library Prep Kit with novel fragmentation reagent meets the dual challenge of generating high quality next gen sequencing ... DNA Library Prep Kit with novel fragmentation reagent meets the dual challenge of generating high quality next gen sequencing ...
more infohttps://www.neb.com/tools-and-resources/selection-charts/enzyme-finder---sequence-6-bases
BiO BB] Web Based Sequence ManipulationsBiO BB] Web Based Sequence Manipulations
... hz5 at njit.edu hz5 at njit.edu Tue Jun 11 13:35:46 EDT 2002 *Previous message (by ... I am hoping that your collective brains can help me find a web based , software suite to do some simple DNA sequence ... We will complete the class by cloning and sequenceing a gene, , and , we would like to do some sequence analysis with the ... Simply , looking at the sequence, translation, rev/comp sorts of things. , However, , we dont really want to install software ...
more infohttp://bioinformatics.org/pipermail/bbb/2002-June/000729.html
Ubuntu Manpage: gnu debug:: Safe sequence baseUbuntu Manpage: gnu debug:: Safe sequence base
... sequence_base::_M_swap (_Safe_sequence_base &__x) [protected] Swap this sequence with the given sequence. This operation also ... gnu_debug::_Safe_sequence_base::~_Safe_sequence_base () [inline, protected] Notify all iterators that reference this sequence ... gnu_debug::_Safe_sequence_base - SYNOPSIS. Inherited by __gnu_debug::_Safe_sequence, _Sequence ,, __gnu_debug::_Safe_sequence, ... sequence, _Sequence ,::_M_transfer_iter(). _Safe_iterator_base* __gnu_debug::_Safe_sequence_base::_M_iterators The list of ...
more infohttp://manpages.ubuntu.com/manpages/precise/man3/__gnu_debug__Safe_sequence_base.3cxx.html
Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome. - PubMed - NCBIDeep sequencing-based discovery of the Chlamydia trachomatis transcriptome. - PubMed - NCBI
Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome.. Albrecht M1, Sharma CM, Reinhardt R, Vogel J, ... A) Calculated sequence graphs for C. trachomatis cryptic plasmid. Graphs show the number of sequence reads for every nucleotide ... Shown are relative numbers of groups of sequence length in relation to the total number of reads per library. (B) Sequence read ... We used deep sequencing to define the transcriptome of purified elementary bodies (EB) and reticulate bodies (RB) of C. ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/19923228?dopt=Abstract
Modeling and automation of sequencing-based characterization of RNA structure | PNASModeling and automation of sequencing-based characterization of RNA structure | PNAS
Modeling and automation of sequencing-based characterization of RNA structure. Sharon Aviran, Cole Trapnell, Julius B. Lucks, ... Modeling and automation of sequencing-based characterization of RNA structure. Sharon Aviran, Cole Trapnell, Julius B. Lucks, ... Modeling and automation of sequencing-based characterization of RNA structure. Sharon Aviran, Cole Trapnell, Julius B. Lucks, ... Modeling and automation of sequencing-based characterization of RNA structure Message Subject (Your Name) has sent you a ...
more infohttps://www.pnas.org/content/108/27/11069.full
Gait Recognition Based on Fusion of Multi-view Gait Sequences | SpringerLinkGait Recognition Based on Fusion of Multi-view Gait Sequences | SpringerLink
In this paper,we present a new gait recognition scheme based on multi-view... ... Wang Y., Yu S., Wang Y., Tan T. (2005) Gait Recognition Based on Fusion of Multi-view Gait Sequences. In: Zhang D., Jain A.K. ( ... In this paper,we present a new gait recognition scheme based on multi-view gait sequence fusion. An experimental comparison of ... On the other hand, we also find that fusion of gait sequences with an angle difference greater than or equal to 90° can achieve ...
more infohttps://link.springer.com/chapter/10.1007/11608288_80
Exon: A Web-Based Software Toolkit for DNA Sequence Analysis | SpringerLinkExon: A Web-Based Software Toolkit for DNA Sequence Analysis | SpringerLink
Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. ... web-based software toolkit DNA sequence analysis DNA compression This is a preview of subscription content, log in to check ... Pratas D., Pinho A.J., Garcia S.P. (2012) Exon: A Web-Based Software Toolkit for DNA Sequence Analysis. In: Rocha M., Luscombe ... Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. ...
more infohttps://link.springer.com/chapter/10.1007/978-3-642-28839-5_25
Context-based segmentation of image sequences - IEEE Journals & MagazineContext-based segmentation of image sequences - IEEE Journals & Magazine
New frames in an image sequence (video) are segmented based on the prior segmentati ... We describe an algorithm for context-based segmentation of visual data. ...
more infohttp://ieeexplore.ieee.org/document/1580490/keywords?reload=true
Streaming Support for Data Intensive Cloud-Based Sequence AnalysisStreaming Support for Data Intensive Cloud-Based Sequence Analysis
... Shadi A. Issa,1 Romeo Kienzler,2 Mohamed El-Kalioby,1 Peter ... Majid Hajibaba, Saed Gorgin, and Mohsen Sharifi, "Sequence similarity parallelization over heterogeneous computer clusters ... "Optimization of data-intensive workflows in stream-based data processing models," Journal of Supercomputing, vol. 73, no. 9, pp ... "Data-intensive workflow optimization based on application task graph partitioning in heterogeneous computing systems," ...
more infohttps://www.hindawi.com/journals/bmri/2013/791051/citations/
Checking missing file based on sequence numberChecking missing file based on sequence number
Have you tried doing a script for checking if there is a missing file based on the sequence number? Im tried doing it but I ... Have you tried doing a script for checking if there is a missing file based on the sequence number? Im tried doing it but I ... save the previous sequence number lcnt=seqno } input > output ... Solved] Move Files based on Filename time. *› i want to find ...
more infohttps://www.computing.net/answers/unix/checking-missing-file-based-on-sequence-number/9110.html
Optimization of Proving Ground Durability Test Sequence Based on Relative Damage SpectrumOptimization of Proving Ground Durability Test Sequence Based on Relative Damage Spectrum
Citation: P, P., J, P., and Palanisamy, K., "Optimization of Proving Ground Durability Test Sequence Based on Relative Damage ... Optimization of Proving Ground Durability Test Sequence Based on Relative Damage Spectrum 2018-01-0101. ... Hence the PG test sequence must be optimal enough such that it includes all the range of frequencies representing the actual ... PG validation requires a specific durability test sequence for every segment of commercial vehicles due to different customer ...
more infohttps://www.sae.org/publications/technical-papers/content/2018-01-0101/
UK Government Funding Development of Sequencing-Based Cancer Tests | GenomeWebUK Government Funding Development of Sequencing-Based Cancer Tests | GenomeWeb
... aim to develop tests based on several platforms, including the Ion Torrent PGM and Illumina HiSeq. ... A new program funded by the UK government aims to bring sequencing-based cancer tests to the market as part of a broad ... UK Government Funding Development of Sequencing-Based Cancer Tests. Jun 21, 2011 ... Exosome-Based Treatment Targeting KRAS G12D-Mutated Pancreatic Cancer to Enter Human Studies Next Month. Premium ...
more infohttps://www.genomeweb.com/sequencing/uk-government-funding-development-sequencing-based-cancer-tests
Gene-Based Sequence Diversity Analysis of Field Pea (Pisum) | GeneticsGene-Based Sequence Diversity Analysis of Field Pea (Pisum) | Genetics
Gene sequence-based diversity in Pisum:. Alignments were generated for each of the 39 gene segment sequence sets. Nucleotide ... Sequence-based diversity trees:. To investigate the tree structure of the complete sequence set, the aligned gene-derived ... 2005). One aim of the present study was to compare SSAP-based diversity analysis with gene-based sequence diversity analysis, ... DNA sequencing:. Sequencing PCR reactions used 0.33 μl Big Dye Terminator v3.1 Cycle Sequencing RR-100 (Perkin-Elmer, Norwalk, ...
more infohttps://www.genetics.org/content/177/4/2263
ASHG Panelists Discuss Interest in Sequencing-based Newborn Screening | GenomeWebASHG Panelists Discuss Interest in Sequencing-based Newborn Screening | GenomeWeb
... annual meeting on Saturday said that the public is cautiously interested in including whole-exome or whole-genome sequencing as ... ASHG Panelists Discuss Interest in Sequencing-based Newborn Screening. Oct 28, 2013 ... annual meeting on Saturday said that the public is cautiously interested in including whole-exome or whole-genome sequencing as ...
more infohttps://www.genomeweb.com/sequencing/ashg-panelists-discuss-interest-sequencing-based-newborn-screening
set sequence name (ActiveRecord::Base) - APIdockset sequence name (ActiveRecord::Base) - APIdock
File activerecord/lib/active_record/base.rb, line 672 def set_sequence_name(value = nil, &block) define_attr_method :sequence_ ... class Project , ActiveRecord::Base set_sequence_name projectseq # default would have been project_seq end. ... set_sequence_name(value = nil, &block). public Sets the name of the sequence to use when generating ids to the given value, or ... If a sequence name is not explicitly set when using PostgreSQL, it will discover the sequence corresponding to your primary key ...
more infohttps://apidock.com/rails/v3.0.9/ActiveRecord/Base/set_sequence_name/class
Genetic characterization of worldwide Prunus domestica (plum) germplasm using sequence-based genotyping | Horticulture ResearchGenetic characterization of worldwide Prunus domestica (plum) germplasm using sequence-based genotyping | Horticulture Research
Here, we used a sequence-based genotyping approach to characterize worldwide plum germplasm including the potential progenitor ... The sequence-based genotyping method used here has limitations caused by the lack of a plum reference assembly and the reliance ... In the present study, we generated a set of sequence-based SNP markers densely distributed across the Prunus genome in order to ... Genetic characterization of worldwide Prunus domestica (plum) germplasm using sequence-based genotyping. *Tetyana Zhebentyayeva ...
more infohttps://www.nature.com/articles/s41438-018-0090-6?error=cookies_not_supported&code=97eabbbd-2474-4d13-a0ca-84f2319abfb0
A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast | PNASA 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast | PNAS
A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast. J A Nickoloff, E Y Chen, and F ... A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast ... A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast ... A 24-base-pair DNA sequence from the MAT locus stimulates intergenic recombination in yeast ...
more infohttps://www.pnas.org/content/83/20/7831
CiteSeerX - Index-Based Processing of Similarity Queries for Set and Sequence-Valued AttributesCiteSeerX - Index-Based Processing of Similarity Queries for Set and Sequence-Valued Attributes
We present the notion of a similarity query and we review similarity measures proposed so far for sets and sequences. We ... We introduce a new similarity measure that can be successfully used with sequences. We present algorithms for efficient ... Attributes containing sets or sequences of elements appear in various application domains, e.g. in telecommunication and retail ... Currently available database systems support neither indexing nor advanced querying of attributes containing sets or sequences ...
more infohttp://citeseer.ist.psu.edu/viewdoc/summary?doi=10.1.1.103.6526
PATCH 6/6] user32: Add support for sequence-based animated cursors.PATCH 6/6] user32: Add support for sequence-based animated cursors.
PATCH 6/6] user32: Add support for sequence-based animated cursors.. Henri Verbeet hverbeet at gmail.com Thu Mar 10 10:41:13 ... Next message: [PATCH 6/6] user32: Add support for sequence-based animated cursors. ... Next message: [PATCH 6/6] user32: Add support for sequence-based animated cursors. ... but I doubt theres much point in having two different defines for sequence chunks. *Previous message: winecfg: Protect from ...
more infohttps://www.winehq.org/pipermail/wine-devel/2011-March/089186.html
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation ScienceHealth Care
Base SequenceBase PairingNucleic Acid ConformationDNABase CompositionNucleic Acid DenaturationMolecular Sequence DataNucleic Acid RenaturationOligonucleotidesNucleic Acid HybridizationOligodeoxyribonucleotidesPolydeoxyribonucleotidesAminacrineDNA, ViralDNA, BacterialRNA, Ribosomal, 18SEscherichia coliPoly dA-dTCloning, MolecularRNA, RibosomalSkull BaseGuanineSequence Homology, Nucleic AcidDNA, CircularAmino Acid SequenceGenesSaccharomycesSchiff BasesIntercalating AgentsPlasmidsModels, MolecularRNAAdenineSaccharomycetalesDNA Restriction EnzymesMutationRepetitive Sequences, Nucleic AcidRNA, ViralTranscription, GeneticDNA, Single-StrandedDeoxyribonucleotidesSpecies SpecificityThermodynamicsPoly ATritiumColiphagesRNA, MessengerKineticsOligoribonucleotidesHybridization, GeneticTemperatureChemistryGenes, BacterialRNA, BacterialChemical PhenomenaNucleotidesRNA, FungalBinding SitesGenes, ViralRestriction MappingHot TemperatureTransformation, GeneticMagnetic Resonance SpectroscopyTemplates, GeneticMolecular WeightCentrifugation, Density GradientDNA, RecombinantRibonucleasesEndonucleasesPhylogenySubstrate SpecificityDNA ProbesCell LineStructure-Activity RelationshipDNA ReplicationPolymerase Chain ReactionSkull Base NeoplasmsPromoter Regions, GeneticDNA PrimersModels, ChemicalBiological EvolutionBase Pair MismatchCircular DichroismSequence Analysis, DNADNA-Directed RNA PolymerasesSequence AlignmentMicroscopy, ElectronProtein BiosynthesisElectrophoresis, Polyacrylamide GelDenture BasesBacterial ProteinsComputer SimulationViral ProteinsDNA, RibosomalDNA-Binding ProteinsProtein BindingDNA DamageKnowledge BasesMannich BasesDNA GlycosylasesDNA RepairThymineHydrogen BondingUracil
Image sequencesGeneticGenesWhole-genomeMethylationNucleotide sequenceAnalyzeBisulfiteInteger SequencesNucleic acidApproachAssemblerChemistrySpecific DNA sequencesCharacterizationSimilar sequencesSequencerTaxonomicAminoIdenticalBiologicalContiguousIsolatesAlgorithmsOrganismsBacterialPredictionSpecimensBioinformaticsCDNAMethodologyComparativeProkaryoticSchemeClustersRibosomalTypingTerminatorFragmentsResearchersPolymeraseSensitivityStructuresTumorRecognitionProtein of interestComplementaryOvercomeCompute

Image sequences3

search
  • Visual motion is one of the most important cues for the interpretation of image sequences. (bl.uk)
  • Research interest has naturally focused on the development of techniques that enable arbitrary image sequences to be efficiently decomposed into their constituent layers. (bl.uk)
  • This cognitive analysis of human movements recorded in image sequences is here referred to as Human Sequence Evaluation (HSE) which defines a set of transformation modules involved in the automatic generation of semantic descriptions from pixel values. (upc.edu)

Genetic18

search
  • Overall, these data emphasize the artificiality of simple tree structures for representing genomic sequence variation within Pisum and emphasize the need for fine structure haplotype analysis to accurately define the genetic structure of the species. (genetics.org)
  • THE genetic diversity of a species is the sum of its total DNA sequence variation, resulting from millions of years of cumulative mutation, recombination, and selection. (genetics.org)
  • Attributes containing sets or sequences of elements appear in various application domains, e.g. in telecommunication and retail databases, multimedia systems, web server logs, genetic and molecular databases, etc. (psu.edu)
  • Such analyses require methods for sequence alignment, phylogenetics reconstruction (for functional analysis), elucidation of genome structures, functional analysis of non-coding DNA, expression analysis, and determining genetic variation. (nbic.nl)
  • Whole genome sequencing (WGS) allows researchers to pinpoint genetic differences between individuals and significantly shortcuts the costly and time-consuming part of forward genetic analysis in model organism systems. (genetics.org)
  • In combination with a variant-based mapping procedure, CloudMap allows users to sharply define genetic map intervals graphically and to retrieve very short lists of candidate variants with a few simple clicks. (genetics.org)
  • The basic premise of genetic mapping is simple: out of the millions of base positions in a mutagenized, sequenced genome, we aim to find the region of genome that is linked to the phenotype-causing mutation and identify the causal variant. (genetics.org)
  • The guidances provide recommendations for designing, developing, and validating tests that use the technology, called next generation sequencing (NGS), and will play an important role in the continued advancement of individualized, genetic-based medicine. (fda.gov)
  • The first guidance issued today, " Use of Public Human Genetic Variant Databases to Support Clinical Validity for Genetic and Genomic-Based In Vitro Diagnostics ," describes an approach where test developers may rely on clinical evidence from FDA-recognized public databases to support clinical claims for their tests and help provide assurance of the accurate clinical evaluation of genomic test results. (fda.gov)
  • The second guidance issued today, " Considerations for Design, Development, and Analytical Validation of Next Generation Sequencing (NGS)-Based In Vitro Diagnostics (IVDs) Intended to Aid in the Diagnosis of Suspected Germline Diseases ," provides recommendations for designing, developing, and validating NGS-based tests used to diagnose individuals with suspected genetic diseases. (fda.gov)
  • In 2017, the FDA took several actions to streamline the development and review of a variety of genetic-based tests - authorizing a third-party option for conducting reviews NGS tumor profiling tests and making clearance recommendations to FDA , as well as outlining standardized development criteria for carrier screening tests to allow for their marketing without prior agency review. (fda.gov)
  • In order to access their genetic diversity and perform phylogenetic and demographic analyses, we captured and sequenced ~2,300 Ultra Conserved Elements. (usp.br)
  • To date the most reliable method of determining a genetic sequence is through the use of the Sanger chain termination chemistry, however a typical mammalian sequence costs millions of dollars and requires many months for completion. (nsti.org)
  • However, the underlying genetic bases for most of these events remain elusive. (sciencemag.org)
  • Here we combined a population genetic mathematical model of CRISPR-virus coevolution with six years of metagenomic sequencing to link the recoverable genomic dynamics of CRISPR loci to the unknown population dynamics of virus and host in natural communities. (nih.gov)
  • Researchers at California NanoSystems Institute at UCLA, Stockholm University and Uppsala University are working on a smartphone-based microscope in hopes of developing a cost-effective and accessible way for DNA sequencing and genetic mutation analysis. (mobihealthnews.com)
  • It can capture multi-color fluorescence and bright-field images at the same quality of those created by a traditional light microscope, and can analyze specific DNA sequences and genetic mutations in tumor cells and tissue samples without the need to first extract DNA from the samples. (mobihealthnews.com)
  • This can show extracted tumor's sequenced DNA bases or the genetic mutations directly inside the tumor tissue. (mobihealthnews.com)

Genes8

search

Whole-genome5

search

Methylation4

search

Nucleotide sequence1

search
  • If you're curious to see how P ROB C ONS performs on nucleotide sequence, try out P ROB C ONS RNA , an experimental version of P ROB C ONS with parameters estimated via unsupervised training on BRAliBASE II ! (stanford.edu)

Analyze2

search

Bisulfite1

search

Integer Sequences1

search

Nucleic acid2

search

Approach14

search
  • We focus on a novel assay utilizing this approach, called s elective 2′- h ydroxyl a cylation analyzed by p rimer e xtension sequencing (SHAPE-Seq), that can be used to characterize RNA secondary and tertiary structure. (pnas.org)
  • Here, we used a sequence-based genotyping approach to characterize worldwide plum germplasm including the potential progenitor Eurasian plum species. (nature.com)
  • This approach allows a single electrophoresis experiment to process two sequences, using the same quantity of reagents and machine hours as for a single sequence. (mit.edu)
  • This paper describes a new approach of generating suitable recommendations based on the active user's navigation stream. (inria.fr)
  • As disease detection technologies rapidly evolve, so too must the FDA's approach to reviewing these new innovations," said FDA Commissioner Scott Gottlieb, M.D. "The new policies issued today provide a modern and flexible framework to generate data needed to support the FDA's review of NGS-based tests, and give developers new tools to support the efficient development and validation of these technologies. (fda.gov)
  • In this new approach, the bases forming the backbone of the typical DNA molecule are viewed one by one in the act of replicating. (nanotech-now.com)
  • The approach has led to the definition of more than 73,000 fungal species hypotheses, which together rely on and combine more than half of the system's 817,130 public reference DNA sequences. (gbif.org)
  • Research is now underway to create a vision system for hardwood log inspection using a knowledge-based approach. (usda.gov)
  • To this end, we propose an alternative to the traditional subject domain specific design approach which is based on the use of competence description ontology and learner's competence records. (sciweavers.org)
  • MRI of acute myocarditis: a comprehensive approach based on various imaging sequences. (biomedsearch.com)
  • Using this approach, we have sequenced ~14,000 protein-coding positions inferred to have changed on the human lineage since the last common ancestor shared with chimpanzees. (sciencemag.org)
  • A new approach of H.264/AVC deblocking filter based on motion activity in video sequences is proposed. (go.jp)
  • In this approach, a modified deblocking filter is used for low to moderate motion video sequences. (go.jp)
  • The use of logistic map to generate strong cryptographic sequences is novel in approach in terms of its use with a range of transmission techniques for wireless communication because it is easy to conceive and requires simple devices to generate the sequence. (igi-global.com)

Assembler3

search

Chemistry3

search

Specific DNA sequences1

search

Characterization1

search

Similar sequences3

search

Sequencer2

search
  • The present invention relates to a method and apparatus for determining the base sequence of a DNA or the like of biological or non-biological origin and, more particularly, to a so-called ultrahigh-speed DNA sequencer used to sequence the bases of DNA or the like at high speed. (freepatentsonline.com)
  • After size selection, all the resulting ChIP-DNA fragments are sequenced simultaneously using a genome sequencer. (wikipedia.org)

Taxonomic2

search
  • By combining name-based information from dozens of different authoritative sources like the Catalogue of Life , IRMNG and the World Register of Marine Species (affectionately known as 'WoRMS'), the backbone provides a consistent means of organizing all species-related content on GBIF.org-like datasets, occurrences and species pages-and enables all forms of taxonomic searching, browsing and reporting. (gbif.org)
  • For some taxonomic groups, advances in molecular sequencing have made it increasingly possible to observe and examine organisms and ecological communities using DNA-based sequences alone. (gbif.org)

Amino4

search
  • Humm A, Huber R, Mann K. The amino acid sequences of human and pig L-arginine:glycine amidinotransferase. (labome.org)
  • Can Foldit be used to predict a tertiary structure based on the primary sequence or amino acid sequence? (fold.it)
  • By generating the sequence of one Neandertal and 50 present-day humans at these positions, we have identified 88 amino acid substitutions that have become fixed in humans since our divergence from the Neandertals. (sciencemag.org)
  • citation needed] In F1 phage, a class of viruses that infect bacteria, the sequence coding for the first few amino acids often contains termination triplets in the two unused reading frames. (wikipedia.org)

Identical2

search
  • The mature proteins were 94% identical to each other and 36% identical to the sequences of bacterial L-arginine:inosamine phosphate amidinotransferases. (labome.org)
  • This came from their observation that the 3' terminal sequences of 18S rRNA from Drosophila melanogaster, Saccharomyces cerevisiae, and rabbit cells are identical: GAUCAUUA -3'OH. (wikipedia.org)

Biological3

search
  • The advent of DNA sequencing has revolutionized biological research by providing virtual blueprints of living organisms and offering insights into complicated biochemical processes. (mit.edu)
  • But without physical specimens or accepted scientific names, these sequences cannot not be linked to the Linnaean-based nomenclature Codes that set the rules governing the biological classification system. (gbif.org)
  • We evaluate the method on simulated and real datasets from droplet-based and full-length protocols, and show that the flexible inference framework is capable of yielding biological insights through a clear interpretation of the data. (biorxiv.org)

Contiguous1

search
  • Results show that the use of exponential decay weighting schemes when taking into account non contiguous sequences to compute recommendations enhances the accuracy. (inria.fr)

Isolates1

search

Algorithms1

search

Organisms4

search
  • Each species hypothesis is assigned a DOI , establishing a stable, permanent reference for that particular hypothesis (sequences known to derive from organisms already in possession of formally described Linnaean scientific names can, of course, rely on those). (gbif.org)
  • However, it is now clear that inheritance not based on DNA sequence exists in multiple organisms, with examples found in microbes, plants, and invertebrate and vertebrate animals. (sciencemag.org)
  • Yet, it appears that biology is much richer: Many phenomena and mechanisms of nongenetic and/or non-DNA sequence-based inheritance have been described in a range of model organisms, challenging our perception of the well-established relationship between transmitted genotype and phenotype. (sciencemag.org)
  • Examples of non-DNA sequence-based inheritance and/or the inheritance of acquired traits have recently been reviewed elsewhere ( 7 - 11 ) and span many diverse organisms. (sciencemag.org)

Bacterial2

search
  • The Shine-Dalgarno (SD) sequence is a ribosomal binding site in bacterial and archaeal messenger RNA, generally located around 8 bases upstream of the start codon AUG. The RNA sequence helps recruit the ribosome to the messenger RNA (mRNA) to initiate protein synthesis by aligning the ribosome with the start codon. (wikipedia.org)
  • Many studies have confirmed that base pairing between the Shine-Dalgarno sequence in mRNA and the 3' end of 16S rRNA is of prime importance for initiation of translation by bacterial ribosomes. (wikipedia.org)

Prediction1

search
  • In order to use sequence prediction, we need to sequentialize these logical forms. (inria.fr)

Specimens4

search
  • A typing assay based on a diagnostic mgpB gene PCR was developed, evaluated, and applied directly to urogenital specimens. (asm.org)
  • Forty had the same sequence type in consecutive specimens. (asm.org)
  • Specimens collected from two men were repeatedly positive at intervals of 472 and 1,395 days, respectively, but the sequence types had changed. (asm.org)
  • Seventy-nine M. genitalium -positive specimens from 19 couples were investigated, and all partners initially had concordant sequence types, but one couple had discordant types at one time point before a newly introduced strain took over. (asm.org)

Bioinformatics3

search
  • https://bioinformatics.org/sms/ It contains all basic manipulations to a DNA sequence, it is implemented by javascript, and is web based, you can also download and have a local copy on you computer, it only need unzip, no installation. (bioinformatics.org)
  • Multiple sequence alignment is a central problem in Bioinformatics. (sciweavers.org)
  • 1 Background Multiple sequence alignment (MSA) is a central problem in Bioinformatics and is known to be NP-complete . (sciweavers.org)

CDNA2

search
  • The detection can be performed by direct sequencing of the cDNA fragments using high-throughput sequencing technology ( 2 ). (pnas.org)
  • The identification of adduct formation can be performed by capillary electrophoresis (SHAPE-CE) or by high-throughput sequencing of cDNA fragments (SHAPE-Seq) ( 2 ) ( Fig. 1 ). (pnas.org)

Methodology2

search
  • For building the optimized test schedule, frequency based pseudo damage methodology called Relative Damage Spectrum (RDS) is incorporated.This method enhances the proving ground durability validation process by providing optimized test schedules to prevent redundant vehicle testing. (sae.org)
  • The Cr-based compound structure shows excellent sensitivity and selectivity which can make it a promising methodology for DNA sequencing. (osapublishing.org)

Comparative1

search

Prokaryotic1

search
  • Given the complementary relationship between rRNA and the Shine-Dalgarno sequence in mRNA, it was proposed that the sequence at the 3'-end of the rRNA determines the capacity of the prokaryotic ribosome to translate a particular gene in an mRNA. (wikipedia.org)

Scheme4

search
  • In this paper,we present a new gait recognition scheme based on multi-view gait sequence fusion. (springer.com)
  • In this paper, the authors propose a new music retrieval and recommendation scheme based on the mood sequence of music clips. (igi-global.com)
  • With a simple DNA sequencing library preparation scheme and the capability to image NGS reactions, mobile-phone-enabled imaging and sensing tools may soon be used for targeted DNA sequencing in clinical settings and POC offices, with the potential to dramatically decrease the cost of NGS-based diagnostics globally. (mobihealthnews.com)
  • The performance of this developed method will be comparable to the orthogonal frequency division multiplexing-based long-term evolution scheme, without the need to build any additional infrastructure. (techrepublic.com)

Clusters1

search

Ribosomal2

search
  • In hope of addressing this gap in scientific knowledge, experts from the University of Tartu Natural History Museum (home to the GBIF Estonia node) and the University of Gothenburg developed UNITE , a system that uses ribosomal DNA-based sequences to give an identity to these cryptic elements of fungal biodiversity. (gbif.org)
  • Using a method developed by Hunt, Shine and Dalgarno showed that the nucleotide tract at the 3' end of E. coli 16S ribosomal RNA (rRNA) is pyrimidine-rich and has the sequence -PyACCUCCUUA 3' OH. (wikipedia.org)

Typing3

search
  • Our sequence-based strain typing can help you map your microbial environment. (criver.com)
  • SeCore® Kits are our latest line of high-resolution HLA typing products based on sequence-based typing-the 'gold standard' of allele identification. (thermofisher.com)
  • The aim of the present study was to document, by DNA-based typing, that M. genitalium is transmissible through sexual contact. (asm.org)

Terminator1

search

Fragments1

search
  • Sequencing of fragments produces data in the form of fragment counts ( X ). Similarly, a control experiment ( Right ) measures natural drop-off (fragments labeled Y ). The model parameters consist of the adduct probabilities (Θ), the Poisson rate for the number of adducts per molecule ( c ), and the drop-off probabilities in the control experiment (Γ). (pnas.org)

Researchers2

search
  • The work has now been published in Biomaterials Science ( http://pubs.rsc.org/en/content/articlelanding/2013/bm/c3bm60126a#!divAbstract ) and presentations on the work by first author, Giovanna Sicilia, have won First Prizes at the UK and Ireland Controlled Release Society and the Macro Group UK Young Researchers' Meeting. (nottingham.ac.uk)
  • InfoSci®-OnDemand Plus, a subscription-based service, provides researchers the ability to access full-text content from over 100,000 peer-reviewed book chapters and 26,000+ scholarly journal articles covering 11 core subjects. (igi-global.com)

Polymerase2

search

Sensitivity2

search
  • citation needed] Sensitivity of this technology depends on the depth of the sequencing run (i.e. the number of mapped sequence tags), the size of the genome and the distribution of the target factor. (wikipedia.org)
  • If abundant binders in large genomes have to be mapped with high sensitivity, costs are high as an enormously high number of sequence tags will be required. (wikipedia.org)

Structures1

search
  • Using nanopore, bowtie, and bowtie-nanopore compound structures, probable application of the surface plasmon resonance (SPR) in DNA sequencing is investigated by employing the discrete dipole approximation method. (osapublishing.org)

Tumor1

search

Recognition4

search
  • Sugie, Y., Kobayashi, T.: Media-integrated biometric person recognition based on the dempster-shafer theory. (springer.com)
  • Wang Y., Yu S., Wang Y., Tan T. (2005) Gait Recognition Based on Fusion of Multi-view Gait Sequences. (springer.com)
  • Digestion of these substrates with HO in vitro reveals that the minimal recognition site is 18 base pairs long, although several shorter substrates and substrates containing point mutations are cleaved at low levels in vitro. (pnas.org)
  • A 24-base-pair HO recognition site stimulates homologous recombination when present in a region unrelated to MAT. (pnas.org)

Protein of interest1

search
  • Oligonucleotide adaptors are then added to the small stretches of DNA that were bound to the protein of interest to enable massively parallel sequencing. (wikipedia.org)

Complementary3

search
  • A family of quaternary periodic complementary sequence (PCS) or Z-complementary sequence (PZCS) sets is presented. (aimsciences.org)
  • In 1973 Dalgarno and Shine proposed that in eukaryotes, the 3'-end of the small 18S rRNA may play a role in the termination of protein synthesis by complementary base pairing with termination codons. (wikipedia.org)
  • further explanation needed] In a commentary on this paper, it was noted that complementary base pairing with the 3'-terminus of 16S rRNA might serve to abort peptide bond formation after out-of-phase initiation. (wikipedia.org)

Overcome2

search
  • is merely fit for even length of sub-sequences is overcome. (aimsciences.org)
  • In the current study, we have undertaken construction of a sequence-based physical map of pea to address the challenge in the assembly of these repetitive sequences and overcome the shortcomings of traditional restriction digestion based physical maps. (frontiersin.org)

Compute1

search
  • The original code can only compute the "next" element of the sequence. (fsu.edu)