The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The reformation of all, or part of, the native conformation of a nucleic acid molecule after the molecule has undergone denaturation.
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
A group of 13 or more deoxyribonucleotides in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
A highly fluorescent anti-infective dye used clinically as a topical antiseptic and experimentally as a mutagen, due to its interaction with DNA. It is also used as an intracellular pH indicator.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Polydeoxyribonucleotides made up of deoxyadenine nucleotides and thymine nucleotides. Present in DNA preparations isolated from crab species. Synthetic preparations have been used extensively in the study of DNA.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
The inferior region of the skull consisting of an internal (cerebral), and an external (basilar) surface.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
Any of the covalently closed DNA molecules found in bacteria, many viruses, mitochondria, plastids, and plasmids. Small, polydisperse circular DNA's have also been observed in a number of eukaryotic organisms and are suggested to have homology with chromosomal DNA and the capacity to be inserted into, and excised from, chromosomal DNA. It is a fragment of DNA formed by a process of looping out and deletion, containing a constant region of the mu heavy chain and the 3'-part of the mu switch region. Circular DNA is a normal product of rearrangement among gene segments encoding the variable regions of immunoglobulin light and heavy chains, as well as the T-cell receptor. (Riger et al., Glossary of Genetics, 5th ed & Segen, Dictionary of Modern Medicine, 1992)
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.
Condensation products of aromatic amines and aldehydes forming azomethines substituted on the N atom, containing the general formula R-N:CHR. (From Grant & Hackh's Chemical Dictionary, 5th ed)
Agents that are capable of inserting themselves between the successive bases in DNA, thus kinking, uncoiling or otherwise deforming it and therefore preventing its proper functioning. They are used in the study of DNA.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
A purine base and a fundamental unit of ADENINE NUCLEOTIDES.
An order of fungi in the phylum Ascomycota that multiply by budding. They include the telomorphic ascomycetous yeasts which are found in a very wide range of habitats.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Ribonucleic acid that makes up the genetic material of viruses.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.
A purine or pyrimidine base bonded to a DEOXYRIBOSE containing a bond to a phosphate group.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Viruses whose host is Escherichia coli.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The rate dynamics in chemical or physical systems.
A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
The genetic process of crossbreeding between genetically dissimilar parents to produce a hybrid.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
A basic science concerned with the composition, structure, and properties of matter; and the reactions that occur between substances and the associated energy exchange.
The functional hereditary units of BACTERIA.
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
The composition, conformation, and properties of atoms and molecules, and their reaction and interaction processes.
The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)
Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
The functional hereditary units of VIRUSES.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
Presence of warmth or heat or a temperature notably higher than an accustomed norm.
Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.
Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
The sum of the weight of all the atoms in a molecule.
Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.
Enzymes that catalyze the hydrolysis of the internal bonds and thereby the formation of polynucleotides or oligonucleotides from ribo- or deoxyribonucleotide chains. EC 3.1.-.
The relationships of groups of organisms as reflected by their genetic makeup.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Established cell cultures that have the potential to propagate indefinitely.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
The process by which a DNA molecule is duplicated.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Neoplasms of the base of the skull specifically, differentiated from neoplasms of unspecified sites or bones of the skull (SKULL NEOPLASMS).
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.
The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.
The presence of an uncomplimentary base in double-stranded DNA caused by spontaneous deamination of cytosine or adenine, mismatching during homologous recombination, or errors in DNA replication. Multiple, sequential base pair mismatches lead to formation of heteroduplex DNA; (NUCLEIC ACID HETERODUPLEXES).
A change from planar to elliptic polarization when an initially plane-polarized light wave traverses an optically active medium. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The part of a denture that overlies the soft tissue and supports the supplied teeth and is supported in turn by abutment teeth or the residual alveolar ridge. It is usually made of resins or metal or their combination.
Proteins found in any species of bacterium.
Computer-based representation of physical systems and phenomena such as chemical processes.
Proteins found in any species of virus.
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.
Collections of facts, assumptions, beliefs, and heuristics that are used in combination with databases to achieve desired results, such as a diagnosis, an interpretation, or a solution to a problem (From McGraw Hill Dictionary of Scientific and Technical Terms, 6th ed).
Ketonic amines prepared from the condensation of a ketone with formaldehyde and ammonia or a primary or secondary amine. A Mannich base can act as the equivalent of an alpha,beta unsaturated ketone in synthesis or can be reduced to form physiologically active amino alcohols.
A family of DNA repair enzymes that recognize damaged nucleotide bases and remove them by hydrolyzing the N-glycosidic bond that attaches them to the sugar backbone of the DNA molecule. The process called BASE EXCISION REPAIR can be completed by a DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE which excises the remaining RIBOSE sugar from the DNA.
The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.
A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.

Evidence on the conformation of HeLa-cell 5.8S ribosomal ribonucleic acid from the reaction of specific cytidine residues with sodium bisulphite. (1/178859)

The reaction of HeLa-cell 5.8S rRNA with NaHSO3 under conditions in which exposed cytidine residues are deaminated to uridine was studied. It was possible to estimate the reactivities of most of the 46 cytidine residues in the nucleotide sequence by comparing 'fingerprints' of the bisulphite-treated RNA with those of untreated RNA. The findings were consistent with the main features of the secondary-structure model for mammalian 5.85S rRNA proposed by Nazar, Sitz, & Busch [J. Biol. Chem (1975) 250, 8591--8597]. Five out of six regions that are depicted in the model as single-stranded loops contain cytidine residues that are reactive towards bisulphite at 25 degrees C (the other loop contains no cytidine). The cytidine residue nearest to the 3'-terminus is also reactive. Several cytidines residues that are internally located within proposed double-helical regions show little or no reactivity towards bisulphite, but the cytidine residues of several C.G pairs at the ends of helical regions show some reactivity, and one of the proposed loops appears to contain six nucleotides, rather than the minimum of four suggested by the primary structure. Two cytidine residues that are thought to be 'looped out' by small helix imperfections also show some reactivity.  (+info)

Marker effects on reversion of T4rII mutants. (2/178859)

The frequencies of 2-aminopurine- and 5-bromouracil-induced A:T leads to G:C transitions were compared at nonsense sites throughout the rII region of bacteriophage T4. These frequencies are influenced both by adjacent base pairs within the nonsense codons and by extracodonic factors. Following 2AP treatment, they are high in amber (UAG) and lower in opal (UGA) codons than in allelic ochre (UAA) codons. In general, 5BU-induced transitions are more frequent in both amber and opal codons than in the allelic ochre codons. 2AP- and 5BU-induced transition frequencies in the first and third positions of opal codons are correlated with those in the corresponding positions of the allelic ochre codons. Similarly, the frequencies of 2AP-induced transition in the first and second positions of amber codons and their ochre alleles are correlated. However, there is little correlation between the frequencies of 5BU-induced transitions in the first and second positions of allelic amber and ochre codons.  (+info)

Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region. (3/178859)

On the basis of developmental gene expression, the vertebrate central nervous system comprises: a forebrain plus anterior midbrain, a midbrain-hindbrain boundary region (MHB) having organizer properties, and a rhombospinal domain. The vertebrate MHB is characterized by position, by organizer properties and by being the early site of action of Wnt1 and engrailed genes, and of genes of the Pax2/5/8 subfamily. Wada and others (Wada, H., Saiga, H., Satoh, N. and Holland, P. W. H. (1998) Development 125, 1113-1122) suggested that ascidian tunicates have a vertebrate-like MHB on the basis of ascidian Pax258 expression there. In another invertebrate chordate, amphioxus, comparable gene expression evidence for a vertebrate-like MHB is lacking. We, therefore, isolated and characterized AmphiPax2/5/8, the sole member of this subfamily in amphioxus. AmphiPax2/5/8 is initially expressed well back in the rhombospinal domain and not where a MHB would be expected. In contrast, most of the other expression domains of AmphiPax2/5/8 correspond to expression domains of vertebrate Pax2, Pax5 and Pax8 in structures that are probably homologous - support cells of the eye, nephridium, thyroid-like structures and pharyngeal gill slits; although AmphiPax2/5/8 is not transcribed in any structures that could be interpreted as homologues of vertebrate otic placodes or otic vesicles. In sum, the developmental expression of AmphiPax2/5/8 indicates that the amphioxus central nervous system lacks a MHB resembling the vertebrate isthmic region. Additional gene expression data for the developing ascidian and amphioxus nervous systems would help determine whether a MHB is a basal chordate character secondarily lost in amphioxus. The alternative is that the MHB is a vertebrate innovation.  (+info)

Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. (4/178859)

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

Activation of systemic acquired silencing by localised introduction of DNA. (5/178859)

BACKGROUND: In plants, post-transcriptional gene silencing results in RNA degradation after transcription. Among tobacco transformants carrying a nitrate reductase (Nia) construct under the control of the cauliflower mosaic virus 35S promoter (35S-Nia2), one class of transformants spontaneously triggers Nia post-transcriptional gene silencing (class II) whereas another class does not (class I). Non-silenced plants of both classes become silenced when grafted onto silenced stocks, indicating the existence of a systemic silencing signal. Graft-transmitted silencing is maintained in class II but not in class I plants when removed from silenced stocks, indicating similar requirements for spontaneous triggering and maintenance. RESULTS: Introduction of 35S-Nia2 DNA by the gene transfer method called biolistics led to localised acquired silencing (LAS) in bombarded leaves of wild-type, class I and class II plants, and to systemic acquired silencing (SAS) in class II plants. SAS occurred even if the targeted leaf was removed 2 days after bombardment, indicating that the systemic signal is produced, transmitted and amplified rapidly. SAS was activated by sense, antisense and promoterless Nia2 DNA constructs, indicating that transcription is not required although it does stimulate SAS. CONCLUSIONS: SAS was activated by biolistic introduction of promoterless constructs, indicating that the DNA itself is a potent activator of post-transcriptional gene silencing. The systemic silencing signal invaded the whole plant by cell-to-cell and long-distance propagation, and reamplification of the signal.  (+info)

Molecular cloning and epitope analysis of the peanut allergen Ara h 3. (6/178859)

Peanut allergy is a significant IgE-mediated health problem because of the increased prevalence, potential severity, and chronicity of the reaction. Following our characterization of the two peanut allergens Ara h 1 and Ara h 2, we have isolated a cDNA clone encoding a third peanut allergen, Ara h 3. The deduced amino acid sequence of Ara h 3 shows homology to 11S seed-storage proteins. The recombinant form of this protein was expressed in a bacterial system and was recognized by serum IgE from approximately 45% of our peanut-allergic patient population. Serum IgE from these patients and overlapping, synthetic peptides were used to map the linear, IgE-binding epitopes of Ara h 3. Four epitopes, between 10 and 15 amino acids in length, were found within the primary sequence, with no obvious sequence motif shared by the peptides. One epitope is recognized by all Ara h 3-allergic patients. Mutational analysis of the epitopes revealed that single amino acid changes within these peptides could lead to a reduction or loss of IgE binding. By determining which amino acids are critical for IgE binding, it might be possible to alter the Ara h 3 cDNA to encode a protein with a reduced IgE-binding capacity. These results will enable the design of improved diagnostic and therapeutic approaches for food-hypersensitivity reactions.  (+info)

TIF1gamma, a novel member of the transcriptional intermediary factor 1 family. (7/178859)

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. (8/178859)

The telomerase reverse transcriptase component (TERT) is not expressed in most primary somatic human cells and tissues, but is upregulated in the majority of immortalized cell lines and tumors. Here, we identify the c-Myc transcription factor as a direct mediator of telomerase activation in primary human fibroblasts through its ability to specifically induce TERT gene expression. Through the use of a hormone inducible form of c-Myc (c-Myc-ER), we demonstrate that Myc-induced activation of the hTERT promoter requires an evolutionarily conserved E-box and that c-Myc-ER-induced accumulation of hTERT mRNA takes place in the absence of de novo protein synthesis. These findings demonstrate that the TERT gene is a direct transcriptional target of c-Myc. Since telomerase activation frequently correlates with immortalization and telomerase functions to stabilize telomers in cycling cells, we tested whether Myc-induced activation of TERT gene expression represents an important mechanism through which c-Myc acts to immortalize cells. Employing the rat embryo fibroblast cooperation assay, we show that TERT is unable to substitute for c-Myc in the transformation of primary rodent fibroblasts, suggesting that the transforming activities of Myc extend beyond its ability to activate TERT gene expression and hence telomerase activity.  (+info)

We describe the effect of nearest-neighbor sequence context on mismatch-dependent activation of hMSH2-hMSH6. Examination of the intrinsic sequences that occur around symmetric mismatched nucleotides suggests little if any effect of non-nearest-neighbor base pairs on hMSH2-hMSH6 mismatch recognition and ATPase activation (20), although longer-range effects have been reported (22). Although a sequence context effect is not novel in MMR (21), the underlying mechanism is unknown. Our studies have suggested that when a significant nearest-neighbor sequence context effect is manifest, 2 × 3′-purines enhanced, and 2 × 3′-pyrimidines reduced hMSH2-hMSH6 ATPase activation (kcat). A similar trend is observed for mismatch binding (KD), whereas an inverse effect was observed for the Tm of unbound mismatched oligonucleotides. Importantly, the KD and Tm do not accurately account for hMSH2-hMSH6 ATPase activation. Interestingly, the effect of sequence context on KD appears associated with alteration of ...
Specific cis-acting sequences within the carlavirus potato virus S (PVS) genomic RNA molecule appear to control gene expression at the translational level. Two sequences have been investigated, the untranslated sequence upstream from the initiation codon of the viral coat protein gene, designated VTE and the 5 untranslated leader sequence from the genomic RNA molecule (PVS 5). In vitro and in vivo, either of these sequences enhance the translation of a downstream open reading frame when provided as the untranslated leader in a transcript molecule. Translational enhancement was also detected at the transgenic plant level. Both PVS sequences were deleted in an attempt to identify the core regulatory element responsible for this translational enhancement phenomenon. Results indicate that in vitro and in vivo, the functional motif is contained within the 5 promixal portion of both sequences. When the sequences of these important regions were compared, a homologous block of nucleotides was ...
TY - JOUR. T1 - Determination of binding constants for cooperative site-specific protein-DNA interactions using the gel mobility-shift assay. AU - Senear, D. F.. AU - Brenowitz, M.. PY - 1991/9/9. Y1 - 1991/9/9. N2 - We have investigated the question of whether the gel mobility-shift assay can provide data that are useful to the demonstration of cooperativity in the site-specific binding of proteins to DNA. Three common patterns of protein-DNA interaction were considered: (i) the cooperative binding of a protein to two sites (illustrated by the Escherichia coli Gal repressor); (ii) the cooperative binding of a bidentate protein to two sites (illustrated by the E. coli Lac repressor); and (iii) the cooperative binding of a protein to three sites (illustrated by the λcI repressor). A simple, rigorous, and easily extendable statistical mechanical approach to the derivation of the binding equations for the different patterns is presented. Both stimulated and experimental data for each case are ...
Cbf1p is a basic-helix-loop-helix-zipper protein of Saccharomyces cerevisiae required for the function of centromeres and MET gene promoters, where it binds DNA via the consensus core motif CACRTG (R = A or G). At MET genes Cbf1p appears to function in both activator recruitment and chromatin-remodeling. Cbf1p has been implicated in the regulation of other genes, and CACRTG motifs are common in potential gene regulatory DNA. A recent genome-wide location analysis showed that the majority of intergenic CACGTG palindromes are bound by Cbf1p. Here we tested whether all potential Cbf1p binding motifs in the yeast genome are likely to be bound by Cbf1p using chromatin immunoprecipitation. We also tested which of the motifs are actually functional by assaying for Cbf1p-dependent chromatin remodeling. We show that Cbf1p binding and activity is restricted to palindromic CACGTG motifs in promoter-proximal regions. Cbf1p does not function through CACGTG motifs that occur in promoter-distal locations within coding
Methods for in-depth characterization of transcriptomes and quantification of transcript levels have emerged as valuable tools for understanding cellular physiology and human disease biology, and have begun to be utilized in various clinical diagnostic applications. Today, current methods utilized by the scientific community typically require RNA to be converted to cDNA prior to comprehensive measurements. However, this cDNA conversion process has been shown to introduce many biases and artifacts that interfere with the proper characterization and quantitation of transcripts. We have developed a direct RNA sequencing (DRS) approach, in which, unlike other technologies, RNA is sequenced directly without prior conversion to cDNA. The benefits of DRS include the ability to use minute quantities (e.g. on the order of several femtomoles) of RNA with minimal sample preparation, the ability to analyze short RNAs which pose unique challenges for analysis using cDNA-based approaches, and the ability to ...
Fingerprint Dive into the research topics of Characterization of single stranded viral DNA sequences present during replication of adenovirus types 2 and 5. Together they form a unique fingerprint. ...
The full-length ORF clone contains only the coding sequence of the full-length protein, while the other full-length cDNA clones contain some untranslated sequences, such as the 5side or 3′ side non translation. It is well known that these untranslated sequences may have a negative effect on the transcription and translation processes of the encoded proteins in the host.. If it is the ORF expressed clone, it can be transfected into cells and expressed in cells.. In the general situation, the carrier of cDNA clone is not the expression vector, so it can not be directly used for transfection of cells.. The difference between ORF, cDNA and CDS:. 1.what is a full-length ORF clone?. A full-length ORF clone is a plasmid inserted into a DNA fragment encoding a full-length protein. The inserted DNA fragment only contains sequence incoding a full-length protein, and does not contain the untranslated region of 5 or 3 end (UTRs) or intron.. 2.why should the full length ORF cDNA clones are used instead ...
Fibroblast growth factor-2 (FGF-2) or basic FGF is a multifunctional protein that, through interaction with specific cell surface receptors, plays important roles in the growth and development of tissues and organs. Thus, considerable attention has focused on the control of FGF-2 gene expression, including assessments of RNA levels through blotting and the use of radiolabeled FGF-2 cDNA probes. Multiple transcripts of different sizes have been reported for FGF-2 by this approach, however, more recent evidence indicates that at least one of these RNAs of about 1.5 kb, is not an authentic FGF-2 transcript. A major band of 4.7 kb and a minor band of 6.1 kb were detected in total rat glial tumor cell RNA, using the intact rat ovarian FGF-2 cDNA as a probe at high stringency. This cDNA contains both coding and 5′-untranslated sequences. Although the 6.1 kb transcript levels were increased in RNA enriched for polyadenylated species, the levels of the 4.7 kb band were decreased and also shared a mobility
In the preceding paper we described an experiment that determined the in vivo forward mutation rate in a single replication cycle for spleen necrosis virus. In addition to substitutions, frameshifts, and hypermutations, the mutated proviruses contained two classes of deletions. One class of deletions contained short direct repeats at the deletion junctions. Another class of deletions had short stretches of sequences inserted at the deletion junctions. In this report, we describe the deletion mutations, and we present models for their generation. Detailed analysis of two deletions with insertions indicates that these mutations occurred as a result of template switching during plus-strand DNA synthesis. The analysis also indicates that fragments of viral RNA generated by the viral RNase H endonuclease are used as templates and contribute to the sequences inserted at the deletion junctions.. ...
The Pem gene encodes an atypical homeodomain protein, distantly related to Prd/Pax family members, that we demonstrate is regulated in a complex transcriptional and post-transcriptional manner. We show that the rat Pem genomic structure includes three 5-untranslated (5-UT) exons and four coding exons, three of which encode the homeodomain. Several alternatively spliced transcripts were identified, including one that skips an internal coding exon, enabling this mRNA to express a novel form of the Pem protein. Other alternatively spliced mRNAs were characterized that possess different 5-UT regions, including a muscle-specific transcript. The different 5-UT termini present in Pem transcripts conferred different levels of translatability in vitro. Two promoters containing multiple transcription initiation sites were identified: a distal promoter (Pd) in the first 5-UT exon and a proximal promoter (Pp) located in the intron upstream of the first coding exon. The Pd was active in placenta, ovary, tumor
Gene expression is the process by which the genetic code - the nucleotide sequence - of a gene is used to direct protein synthesis and produce the structures of the cell. Genes that code for amino acid sequences are known as structural genes.. Gene control regions:. A promoter. A region a few hundred nucleotides upstream of the gene (toward the 5′ end). It is not transcribed into mRNA, but plays a role in controlling the transcription of the gene. Transcription factors bind to specific nucleotide sequences in the promoter region and assist in the binding of RNA polymerases.. Enhancers. Some transcription factors (called activators) bind to regions called enhancers that increase the rate of transcription. These sites may be thousands of nucleotides from the coding sequences or within an intron. Some enhancers are conditional and only work in the presence of other factors as well as transcription factors ...
Comparison with MarA structure.Both of the amino acids in H-T-H 1 of RhaS that make sequence-specific DNA contacts align with MarA residues also predicted to make specific DNA contacts. Arg202 of RhaS aligns with MarA Trp42. One of the base pairs contacted by each of these amino acids is a G-C base pair in the analogous position in the two binding sites (−56 at marRAB and −67 atrhaBAD), while each of these residues also makes additional, different contacts (Fig. 4). Arg206 of RhaS aligns with Arg46 of MarA. In this case, the identical amino acid contacts the identical base pair in the analogous position in the two binding sites (G-C at −56 inmarRAB and −67 in rhaBAD), and each amino acid also contacts a C-G base pair (−55 at marRAB and −65 atrhaBAD). MarA has a third amino acid in H-T-H 1 that contacts DNA (Gln45). MarA Gln45 aligns with RhaS His205, which was found to be important for DNA binding by RhaS but not specific for any base positions. It seems likely that only Arg202 and ...
The Base Position feature in the Genome Browser annotations track image shows the genomic coordinates of the displayed region and -- when zoomed in to the base level -- the base composition of the sequence underlying the annotation tracks display. To quickly zoom in to the base level, click the base zoom-in button. The base button may also be used to automatically zoom the window to maximize the base display when the image is resized. Click the arrow to the left of the base display to show the base complement. To toggle between dense and full display mode, click anywhere on the base composition line. In dense display mode, clicking anywhere on the genome coordinate line will zoom-in the display, centered on the coordinate of the click. The degree of the zoom may be configured through the Zoom configuration buttons (the default is 3X). In full display mode, the track shows three frames of translation when viewed at the base level. Methionines (including potential start codons) are displayed in ...
ProtoScript II First Strand cDNA Synthesis Kit features two optimized mixes, ProtoScript II Enzyme Mix and ProtoScript II Reaction Mix.
The invention provides in situ nucleic acid sequencing to be conducted in biological specimens that have been physically expanded. The invention leverages the techniques for expansion microscopy (ExM) to provide new methods for in situ sequencing of nucleic acids as well as new methods for fluorescent in situ sequencing (FISSEQ) in a new process referred to herein as
Figure 1. Library preparation workflow and PCR strategy for TCR profiling using the SMARTer approach. Panel A. Reverse transcription and PCR amplification of TCR subunit mRNA sequences. First-strand cDNA synthesis is primed by the TCR dT Primer and performed by an MMLV-derived reverse transcriptase (RT). Upon reaching the 5′ end of each mRNA molecule, the RT adds non-templated nucleotides to the first-strand cDNA. The SMART-Seq v4 Oligonucleotide contains a sequence that is complementary to the non-templated nucleotides added by the RT, and the oligo hybridizes to the first-strand cDNA. In the template-switching step, the RT uses the remainder of the SMART-Seq v4 Oligonucleotide as a template for the incorporation of an additional sequence on the end of the first-strand cDNA. Full-length variable regions of TCR cDNA are selectively amplified by PCR using primers that are complementary to the oligonucleotide-templated sequence (SMART Primer 1) and the constant region(s) of TCR-α and/or TCR-β ...
Figure 1. Library preparation workflow and PCR strategy for TCR profiling using the SMARTer approach. Panel A. Reverse transcription and PCR amplification of TCR subunit mRNA sequences. First-strand cDNA synthesis is primed by the TCR dT Primer and performed by an MMLV-derived reverse transcriptase (RT). Upon reaching the 5′ end of each mRNA molecule, the RT adds non-templated nucleotides to the first-strand cDNA. The SMART-Seq v4 Oligonucleotide contains a sequence that is complementary to the non-templated nucleotides added by the RT, and the oligo hybridizes to the first-strand cDNA. In the template-switching step, the RT uses the remainder of the SMART-Seq v4 Oligonucleotide as a template for the incorporation of an additional sequence on the end of the first-strand cDNA. Full-length variable regions of TCR cDNA are selectively amplified by PCR using primers that are complementary to the oligonucleotide-templated sequence (SMART Primer 1) and the constant region(s) of TCR-α and/or TCR-β ...
In the current study, we applied cDNA cloning and RNA-Seq methods to identify two alternative CYP3A4 mRNA transcripts, one of which contained partial intron-6 retention and the other with a shorter 3′-UTR.. The CYP3A4 mRNA transcript with partial intron-6 retention can potentially be translated into a novel protein with a shortened amino acid sequence as a result of a translational stop codon in intron 6. However, the absence of a heme-binding signature in the encoded polypeptide precludes a catalytically active protein. Proportion of this transcript in all examined samples is less than 2% of total CYP3A4 mRNA. Therefore, its influence on CYP3A4 function is considered to be limited; as a result, we did not investigate function of this transcript in the current study. Although RNA-Seq also showed faint peaks in intron 11, Cufflinks did not assemble a transcript with intron-11 retention. Thus, the possible existence of intron-11 retention cannot be excluded based on the current evidence, and ...
king interactions (hydrogen bonding merely provides specificity of the pairing, not stability). As a result, it is both the percentage of GC base pairs and the overall length of a DNA double helix that determine the strength of the association between the two strands of DNA. Long DNA helices with a high GC content have stronger-interacting strands, while short helices with high AT content have weaker-interacting strands. In biology, parts of the DNA double helix that need to separate easily, such as the TATAAT Pribnow box in some promoters, tend to have a high AT content, making the strands easier to pull apart. In the laboratory, the strength of this interaction can be measured by finding the temperature required to break the hydrogen bonds, their melting temperature (also called Tm value). When all the base pairs in a DNA double helix melt, the strands separate and exist in solution as two entirely independent molecules. These single-stranded DNA molecules have no single common shape, but some ...
Not so many people are aware that extensions method are possible to implemented also on JavaScript code. Here you have quick example how to achieve that:1. Lets create class definition function MyClass(imput){ this.myProperty = input; } 2. Lets create object of our class var myObject = new MyClass(test); 3. Now, we are ready to add…
It transports the genetic information into the cytoplasm, where the ribosomes use it as a template to produce a specific protein (translation). TGC-TTA. mRNA that is transcribed is normally a copy of the sense strand, however, it is the antisense strand that is transcribed. The RNA product is complementary to the template strand of DNA and is almost identical to the nontemplate DNA strand, or the sense strand. As shown schematically above, messenger RNA is synthesized complementary and antiparallel to the template strand (anticodons) of DNA, so the resulting mRNA consists of codons corresponding to those in the coding strand of DNA. cDNA is often used to clone eukaryotic genes in prokaryotes. Use the RNA base-pairing rules. The type of amino acid is determined by the anticodon sequence of the transferRNA. The only difference is that in RNA, all of the T nucleotides are replaced with U nucleotides; during RNA synthesis, U is incorporated when there is an A in the complementary antisense strand. ...
Luciferase Assay Reagents. OVERVIEW Control of gene expression in eukaryotic cells is regulated on transcriptional and post-transcriptional levels. Transcription factors are important regulators of transcription rates, and microRNAs are key mediators of mRNA stability and translation efficiency.. Regulation of transcription. DNA-encoded elements like promoters interact with transcription factors and other regulatory proteins to determine when, where, and how much of a genes mRNA product gets made. Reporter assays are a powerful technique for measuring the activity of promoters in living cells. Promoter GoClone Reporter Constructs are created by isolating a promoter from the human genome and cloning it upstream of the RenSP luciferase reporter gene on a plasmid. Once this plasmid is transfected into a living cell, a change in promoter activity causes a change in reporter signal (light output).. SwitchGear Promoter GoClone Reporter Assays can be used to monitor the activity of any promoter in a ...
cloning of non-coding region for protein expression - posted in Protein Expression and Purification: Hi! I am trying to see the function of my non-coding region in protein expression. I have clone my gene and its non-coding region upstream of 5UTR to find if non-coding region plays any role in expression of cloned protein. I have other clones with no non-coding region just 5UTR and coding region. Has anybody cloned these type construct in mammalian expression vector and does...
A simplified method for isolating primer extension products and generating them in a form appropriate for electrophoresis is disclosed. The method is compatible with automated DNA sequencing procedures.
Gel shift assay: (aka gel mobility shift assay (GMSA), band shift assay (BSA), electrophoretic mobility shift assay (EMSA)) A method by which one can determine whether a particular protein preparation contains factors which bind to a particular DNA fragment. When a radiolabeled DNA fragment is run on a gel, it shows a characteristic mobility. If it is first incubated with a cellular extract of proteins (or with purified protein), any protein-DNA complexes will migrate slower than the naked DNA - a shifted band.. Gene: A unit of DNA which performs one function. Usually, this is equated with the production of one RNA or one protein. A gene contains coding regions, introns, untranslated regions and control regions.. Genome: The total DNA contained in each cell of an organism. Mammalian genomic DNA (including that of humans) contains 6x109 base pairs of DNA per diploid cell. There are somewhere in the order of a hundred thousand genes, including coding regions, 5 and 3 untranslated regions, ...
Hire Steelcraft Infant Carrier Capsule Additional Base - 6 Months Details: The Steelcraft Infant Carrier Capsule base pairs with the Steelcraft Infant Carrier to complete the set, allowing for easy travel in the car. A second base is handy for easy travel between two cars. Fitting of the base into your vehicle by our registered fitters will cost $15.00. We have the most experienced, trained and accredited installers on the Gold Coast with over 20 years experience fitting seats. In order to hire the Steelcraft Infant Carrier Capsule additional base please see below: $50 cash deposit Photo identification required for hire card Pick up in store only Fitting by appointment Monday through to Friday - $15.00
ChiP (Chromosome Immunoprecipitation) is a technique where DNA binding proteins, like transcription factors, can be localized to regions of a DNA molecule. We can use this method to identify which DNA sequences control expression and regulation for diverse genes. In the ChIP procedure, cells are treated with a reversible cross-linking agent to fix proteins to other proteins that are nearby, as well as the chromosomal DNA where theyre bound. The DNA is then purified and broken into smaller chunks by digestion or shearing and antibodies are used to precipitate any protein-DNA complexes that contain their target antigen. After the immunoprecipitation step, unbound DNA fragments are washed away, the bound DNA fragments are released, and their sequences are analyzed to determine the DNA sequences that the proteins were bound to. Only few years ago, this procedure was much more complicated than it is today, for example, the fragments had to be cloned before they could be sequenced. When microarrays ...
View Notes - BIOL 112 - Practice Qs from 2008 from BIOL 112 at UBC. sheet. 71. The initiator sequence and promoter sequences must exhibit a large degree of overlap. 72. If the lac operon was designed
A novel method for detecting and isolating DNA sequences commonly held by different DNA preparations or repeated or amplified within a complex genome has been provided. The DNA preparations of interest are digested with the same restriction enzyme and a portion of at least one preparation is labeled with 32 P. The labeled and unlabeled DNA preparations are combined and electrophoresed in an agarose gel. Following electrophoresis, the DNA is denatured in situ and allowed to reanneal within the gel so that homologous DNA sequences present within restriction fragments of the same size can reanneal. After reannealing, unhybridized single-stranded DNA is digested in situ followed by detection of the reannealed DNA by autoradiography. When labeled and unlabeled DNAs are derived from different DNA preparations, only the restriction fragments commonly held by these two preparations are detected. When a restriction digest of total eukaryotic DNA is reassociated in the gel by this procedure, repeated restriction
Bottom line: What are the sequences of phage polymerase termination signals? Yes, I am still trying to get good in vitro transcription of a particular sequence for use in RNase protection analysis. Basically I can only really use one region and this is next to a T7 promoter so I am fiddling with the conditions. The transcript I get is mainly full length but the yield is awful. I tried 15degC for 3 h. It was worse then 37degC for 1 h. I tried the Maslak & Martin buffer and this may have improved things but the salt/detergent in the buffer screw up the gel purification of the probe (I am working on this). I tried beefing up the amount of enzyme or the amount of limiting nucleotide (32P-CTP) but this didnt really help. I have yet to try T4g32 protein or its equivalent. In the back of the Ambion MAXIscript guide their is a vague reference to accidental incorporation of phage RNA polymerase termination signals in a template being a reason for poor yield. No information is given as to what these ...
An analysis of the base pair doublet geometries in available crystal structures indicates that the often reported intrinsic curvature of DNA containing oligo-(d(A).d(T)) tracts may also depend on the nature of the flanking sequences. The presence of CA/TG doublet in particular at the 5 end of these tracts is expected to enhance their intrinsic bending property. To test this proposition, three oligonucleotides, d(GAAAAACCCCCC), d(CCCCCCAAAAAG), d(GAAAAATTTTTC), and their complementary sequences were synthesized to study the effect of various flanking sequences, at the 5 and 3 ends of the A-tracts, on the curvature of DNA in solution. An analysis of the polyacrylamide gel electrophoretic mobilities of these sequences under different conditions of salts and temperatures (below their melting points) clearly showed that the oligomer with CA/TG sequence in the center was always more retarded than the oligomer with AC/GT sequence, as well as the oligomer with AT/AT sequence. Hydroxyl radical probing ...
DNA. Computer artwork of a DNA (deoxyribonucleic acid) double helix seen against autoradiograms of genetic sequences (upper right). The spiralling strands of the DNA helix (blue) are composed of complex chemical groups called nucleotides, which consist of a sugar phosphate and a base group. Complementary pairing between the base groups of nucleotides on opposite strands holds the helix together. The sequence of the 4 base groups (adenine, cytosine, guanine and thymine; coloured rods) along the DNA helix is unique for every individual and is known as the genetic code. The autoradiograms depict DNA base sequences, each band (dark blue) representing an individual base. - Stock Image G110/0642
Knowledge of the sequence of a DNA segment has many uses, and some examples follow. First, it can be used to find genes, segments of DNA that code for a specific protein or phenotype. If a region of DNA has been sequenced, it can be screened for characteristic features of genes. For example, open reading frames (ORFs)-long sequences that begin with a start codon (three adjacent nucleotides; the sequence of a codon dictates amino acid production) and are uninterrupted by stop codons (except for one at their termination)-suggest a protein-coding region. Also, human genes are generally adjacent to so-called CpG islands-clusters of cytosine and guanine, two of the nucleotides that make up DNA. If a gene with a known phenotype (such as a disease gene in humans) is known to be in the chromosomal region sequenced, then unassigned genes in the region will become candidates for that function. Second, homologous DNA sequences of different organisms can be compared in order to plot evolutionary ...
The kinetic theory of replication has been extended to include dual mechanisms for conversion of self-annealed single-strand RNA to double-strand molecules, which do not replicate. An analysis of experimental results established that the replicate-template annealing reaction during transcription significantly retarded replication in vitro among three RNA variants copied by Qβ replicase. Annealing between complementary RNA strands free in solution had far less significance. The finding that an RNA variant can be replicated in a multiple hairpin configuration, but not as its single, long hairpin conformer, the correlation between stability of strand secondary structure and replicative fitness, and a lack of homology in the internal sequence of RNA variants copied by Qβ replicase support the conclusion that template competence depends on strand configuration, independent of most of the underlying base sequence. Occurrence of self-annealed strands in the Qβ replicase system was attributed to its ...
Oxford Nanopore’s MinION is a small sensing device which can sequence DNA and RNA directly, without the need to perform an enzymatic synthesis reaction. The device is portable and is po
However, in cases 5 and 6 we seem to come to a radical discontinuity. In both of these cases, there can be an analogical (and therefore meaningful) relationship between the nucleotide sequence ACA in DNA and the corresponding amino acid sequence in a translated polypeptide, either in vitro or in a cell. What makes this difference possible (and what may make it necessary) is the analogical relationship between the nucleotide sequence and the corresponding amino acid sequence (if one exists). If the DNA sequence ACA is located in the template strand of an actively transcribed DNA sequence (i.e. a DNA sequence beginning with a promoter to which RNA polymerase can bind) and furthermore its complementary RNA analog is located in an mRNA molecule following the start codon AUG but not following a stop codon (either UAA, UAG, or UGA, assuming a three-base reading frame), then that the DNA sequence does indeed contain meaningful information: it is encoded in one medium, is translated into another ...
However, in cases 5 and 6 we seem to come to a radical discontinuity. In both of these cases, there can be an analogical (and therefore meaningful) relationship between the nucleotide sequence ACA in DNA and the corresponding amino acid sequence in a translated polypeptide, either in vitro or in a cell. What makes this difference possible (and what may make it necessary) is the analogical relationship between the nucleotide sequence and the corresponding amino acid sequence (if one exists). If the DNA sequence ACA is located in the template strand of an actively transcribed DNA sequence (i.e. a DNA sequence beginning with a promoter to which RNA polymerase can bind) and furthermore its complementary RNA analog is located in an mRNA molecule following the start codon AUG but not following a stop codon (either UAA, UAG, or UGA, assuming a three-base reading frame), then that the DNA sequence does indeed contain meaningful information: it is encoded in one medium, is translated into another ...
The human genome is densely populated with transposons and transposon-like repetitive elements. Although the impact of these transposons and elements on human genome evolution is recognized, the significance of subtle variations in their sequence remains mostly unexplored. This study reports homozygosity mapping of an infantile neurodegenerative disease locus in a genetic isolate. Complete DNA sequencing of the 400-kb linkage locus revealed a point mutation in a primate-specific retrotransposon that was transcribed as part of a unique noncoding RNA, which was expressed in the brain. In vitro knockdown of this RNA increased neuronal apoptosis, consistent with the inappropriate dosage of this RNA in vivo and with the phenotype. Moreover, structural analysis of the sequence revealed a small RNA-like hairpin that was consistent with the putative gain of a functional site when mutated. This study show here that a mutation in a unique transposable element-containing RNA is associated with lethal ...
The invention relates to methods for the use of the polymerase chain reaction to amplify a segment of a cloned gene of interest in such a way as to allow a simplified introduction of alterations such as deletions, insertions, repetitions (both direct and inverted) and substitutions into the cloned gene in a specific and precise manner. The unique, amplified segment of the cloned gene so amplified is a common substrate for each of the different approaches to introducing the various alterations into the gene. Choice of the primer sites within the amplified segment coupled with choice of the orientation of the molecule once ligated to itself results in the various resulting embodiments of the invention.
LOC FOR DETECTION OF HYBRIDIZATION OF NUCLEIC ACID SEQUENCES WITH PRIMER-LINKED STEM-AND-LOOP PROBES - diagram, schematic, and image 20 ...
Gene - A length of DNA that codes for one (or more) polypeptides.. Polypeptide - A polymer consisting of a chain of amino acids, joined together by peptide bonds.. Genome - The entire DNA sequence (nucleotide base pairs) of an organism.. Protein - A large polypeptide (usually 100 or more amino acids). Some consist of more than one polypeptide chain e.g. Haemoglobin.. Locus - A specific position on a chromosome, occupied by a specific gene.. In the human genome, there are about 25,000 genes. A few are in the mitochondria, but most genes are found on the chromosomes within the nucleus. Each gene occupies a specific locus on the chromosome. The DNA in the chromosomes is associated with histone proteins.. Remember each chromosome consists of one molecule of DNA, and each gene is just a part of a DNA molecule.. Genes code for polypeptides such as:. ...
On the other hand, if the same series of reaction is done not on purified DNA, but rather on DNA that has been allowed to interact with extracts containing DNA-binding proteins, these DNA-binding proteins can, if condition are appropriate, bind specifically to regions of DNA. Such a binding will interfere both with the Maxam-Gilbert sequencing reactions and with the cleavage of DNA by the deoxyribonuclease. As a result, those fragments that are produced by cleavage near a protein-binding site will fail to be formed or be formed at a much lower level leaving a gap in the ladder of reaction products. Such a gap is called a footprint and is evidence for the existence of a specific DNA-binding complex. A similar logic allows the DNA binding regions to be determined by using the Exonuclease III protection* approach. Although the basic idea of doing a footprint is straight forward executing one in practice is more complex because of the difficulty of non-specific binding reactions. DNA is a highly ...
The mod-5(knu383) allele repair oligonucleotide contained a 3-frame stop of TAAATAAATAAA surrounded by filler sequence of CCTCCCGTTCGCCTGGGACATC and GATGTCCCAGGCGAACGGGAGG. The homology arms were designed to give perfect homology for each of the sgRNA cut sites with 35 nucleotides of perfect homology on the 5 side and 34 nucleotides on the 3 side. These homology arms are 12,775bp apart from each other in the genomic sequence. The deletion was created using the CRISPR/Cas9 technology (Paix 2014, Kim 2014). The guide sequences were caaaagaaaagagcagccga and caaaagaaaagagcagccga provided in the injection mix as synthetic RNA. The deletion was detected by a three-primer PCR approach where an 813bp band would amplify in the deletion and a 614bp band would amplify in N2 wild-type, Figure 1A ...
92118DNAArtificial SequenceA synthetic DNA fragment 1aaggagcgat cgccatgn 18210DNAArtificial SequenceA synthetic DNA fragment, wherein nnn is the first codon which is 3 to the start codon followed by the remainder of an open reading frame 2cgccatgnnn 10312DNAArtificial SequenceA synthetic DNA fragment 3nnnnnngtct tc 12410DNAArtificial SequenceA synthetic DNA fragment 4nnnngaagag 10513DNAArtificial SequenceA synthetic DNA fragment 5gcagcnnnnn nnn 13611DNAArtificial SequenceA synthetic DNA fragment 6nnnnngagac g 11711DNAArtificial SequenceA synthetic DNA fragment 7gccnnnnngg c 11814DNAArtificial SequenceA synthetic DNA fragment 8ggatgnnnnn nnnn 14911DNAArtificial SequenceA synthetic DNA fragment 9nnnnngagac c 111010DNAArtificial SequenceA synthetic DNA fragment 10gacgcnnnnn 101111DNAArtificial SequenceA synthetic DNA fragment 11ccnnnnnnng g 111211DNAArtificial SequenceA synthetic DNA fragment 12gcnnnnnnng c 111310DNAArtificial SequenceA synthetic DNA fragment 13nnnnngagac 101411DNAArtificial ...
We have characterized the 5′ region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of housekeeping and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5′ sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained ...
TY - JOUR. T1 - Inhibition of sequence-specific protein-DNA interaction and restriction endonuclease cleavage via triplex stabilization by poly(L-lysine)-graft-dextran copolymer. AU - Ferdous, Anwarul. AU - Akaike, Toshihiro. AU - Maruyama, Atsushi. PY - 2000/6. Y1 - 2000/6. N2 - Triplex stabilization by poly(L-lysine)-graft-dextran copolymer within a mammalian gene promoter inhibits the DNA binding activity of nuclear proteins from HeLa cells as well as restriction endonuclease cleavage at physiological pH and ionic conditions in vitro. Electrophoretic mobility shift assays using a 30-mer hornopurine-homopyrimidine stretch (located between -170 and -141 bp) of rat α1 (I) collagen gene promoter reveal that the copolymer, at its wide range of charge ratio with DNA, stabilizes triplex DNA and enhances triplex-specific inhibition of the protein - DNA interaction. When the triplex-forming region (located between -165 and -146 bp) of the promoter is engineered at the Bam H1 and Pst 1 sites of a ...
In cells productively infected with adenovirus type 5, transcription is not terminated between the E1a gene and the adjacent downstream E1b gene. Insertion of the mouse beta(maj)-globin transcription termination sequence (GGT) into the E1a coding region dramatically reduces early, but not late, E1b expression (E. Falck-Pedersen, J. Logan, T. Shenk, and J. E. Darnell, Jr., Cell 40:897-905, 1985). In the study described herein, we showed that base substitution mutations in the globin DNA that specifically relieved transcription termination also restored early E1b promoter activity in cis, establishing that maximal early E1b expression requires readthrough transcription originating from the adjacent upstream gene. To identify potential targets of readthrough activation, a series of recombinant viruses with double mutations was constructed. Each double-mutant virus strain had the transcription termination sequences in the first exon of E1a and a deletion within the transcription control region of ...
The major transcription initiation site (cap site) of PCNA is localized 89 bp upstream from the ATG codon. Neither a TATA box nor a CAAT box is found within the 600-bp region upstream of the cap site. Clusters of 10 bp of sequence, similar to the binding sites for Drosophila proteins containing homeodomains, were found in the region from -127 to -413. DNase I footprint analysis reveals that the Drosophila homeodomain proteins coded by even-skipped and zerknullt genes can specifically bind to these sites. There are two sequences, starting at -52 and -39, of which 8 and 7 (respectively) of 10 nucleotides match the consensus sequence for HeLa cell transcription factor Sp 1 binding. These results suggest that the expression of the PCNA gene is under the control of genes coding for homeodomain proteins (Yamaguchi, 1990). The proliferating-cell nuclear antigen (PCNA) promoter function resides within a 192-bp region (-168 to +24 with respect to the transcription initiation site). Cotransfection with a ...
Invitrogen™ Cloned AMV First-Strand cDNA Synthesis Kit 100 reactions Invitrogen™ Cloned AMV First-Strand cDNA Synthesis Kit RT-PCR Kits
Over the last 20 years several observations at the peptide level have indicated the possible existence of additional members of the vasopressin (VP)-oxytocin (OT) gene family in mammals. In this study, the human genome was analyzed for the existence of genes structurally related to the VP and OT genes. Human genomic blots probed under low stringency conditions with exon B of the human OT gene, that codes for the conserved constant region of neurophysin, revealed the presence of two distinct bands in addition to the known VP and OT gene fragments. Five clones were obtained from a library of genomic EcoRI fragments ranging from 4-8 kb, that comprised both low stringency signals, by low stringency hybridization with the OT exon B probe. One clone of 7 kb hybridized at high stringency conditions to bands of the same size as previously detected with OT exon B on a human genomic blot. However, no similarity was observed between the open reading frames of this clone and the neurophysin portion of the ...
EasyScript® First-Strand cDNA Synthesis SuperMix,RT-PCR,PCR, RT-PCR, qPCR, qRT-PCR,Products,Beijing TransGen Biotech Co.Ltd,OverviewContents& storageCitations & referencesRelated ImagesDownloadOverviewDescriptionEasyScript® First-Strand cDNA
The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5 LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the
The target site specificity of Tos17 was revealed clearly by large-scale analysis of target sequences. The insertion site consensus sequence is the palindrome ANGTT-TSD-AACNT. Interestingly, in vitro studies of retroviral integrase activity revealed that palindromic sequences that form cruciform structures are preferred targets for retroviral integrase (Katz et al., 1998). Indeed, for retroviral integrase, a cruciform structure is a more important determinant of target preference than the specific sequence of the site. The fact that the Tos17 target site consensus sequence is a palindrome suggests that the integrase encoded by Tos17 also may have a preference for cruciform structures. However, because the nucleotide sequence is well conserved at the target sites of Tos17, it is likely that the sequence itself also is a determinant of target specificity for this retrotransposon. The conserved sequence may act as a recognition sequence for Tos17 integrase. Interestingly, a small-scale analysis of ...
Transcription from the Rous sarcoma virus (RSV) Long terminal repeat (LTR) in untransformed rat 3Yl fibroblasts is dependent on the presence of serum. Within an hour of addition of serum to a serum-deprived culture there is a 5 fold stimulation in the level of transcripts initiated at the LTR. This stimulation does not require synthesis of new proteins. Mutations in the RSV LTR revealed that serum-stimulated transcription was mostly dependent on two CCAAT boxes in the LTR, though other upstream sequences may play a secondary role. Serum caused the rapid appearance of a nuclear protein that binds to the two CCAAT boxes. This serum-induced CCAAT factor was also bound by CCAAT sequences from other promoters, e.g. those of human heat shock protein 70, human c-Ha-ras, human histone 1 etc, but not by the adenovirus origin of replication, or the SV40 enhancer core sequence. This data suggests that the serum induced CCAAT factor is related to CPl or CP2 rather than the NFl or CjEBP types of CCAAT binding
The gene spans approximately 23 kilobases and is composed of 21 exons interrupted by 20 introns. Exon sizes range from 52 bases (exon 7) to over 1200 bases (exon 21), intron sizes from 68 bases (intron L) to 10.8 kilobases (intron A). The splice sites for donor and acceptor were in agreement with the canonical GT/AG rule. Functional regions of beta ARK are described with respect to their location within the exon-intron organization of the gene. Primer extension and RNase protection assays suggest a major transcription start site approximately 246 bases upstream of the start ATG. Sequence analysis of the 5-flanking/promoter region reveals many features characteristic of mammalian housekeeping genes, i.e. the lack of a TATA box, an absent or nonstandard positioned CAAT box, high GC content, and the presence of Sp1-binding sites. The extraordinarily high GC content of the 5-flanking region (, 80%) helps define this region as a CpG island that may be a principal regulator of beta ARK ...
Alternative splicing of transcripts from a single gene is often used as a mechanism for generating protein variants with diverse functions (reviewed by McKeown, 1992). In the case of transcription factor genes, alternative splicing frequently gives rise to protein isoforms with distinct or even opposing transcriptional activities (reviewed by Foulkes and Sassone‐Corsi, 1992). However, few cases are known where the DNA sequence specificity of a transcription factor is altered by alternative splicing. Pax6 belongs to this class of genes which normally code for transcription factors with modular DNA‐binding domains such as the mammalian WT‐1, the Drosophila Tramtrack and CF2 zinc finger proteins (Bickmore et al., 1992; Gogos et al., 1992; Read and Manley, 1992). Here we have demonstrated that a second Pax gene, Pax8, also codes for alternative splice products with drastically different DNA‐binding specificities.. The paired domain is a bipartite DNA‐binding region consisting of an ...
Transcription factors (TFs) regulate gene transcription and play pivotal roles in various biological processes such as development, cell cycle progression, cell differentiation and tumor suppression. Identifying cis-regulatory elements associated with TF-encoding genes is a crucial step in understanding gene regulatory networks. To this end, we have used a comparative genomics approach to identify putative cis-regulatory elements associated with TF-encoding genes in vertebrates. We have created a database named TFCONES (T ranscription F actor Genes & Associated CO nserved N oncoding E lementS) ( http://tfcones.fugu-sg.org ) which contains all human, mouse and fugu TF-encoding genes and conserved noncoding elements (CNEs) associated with them. The CNEs were identified by gene-by-gene alignments of orthologous TF-encoding gene loci using MLAGAN. We also predicted putative transcription factor binding sites within the CNEs. A significant proportion
Fibulin-1 is a multifunctional extracellular protein involved in diverse biological processes including cardiovascular development, haemostasis and cancer. To investigate the transcriptional regulation of the gene encoding fibulin-1 we cloned and analysed about 4.0kb of the 5′-flanking regions of both the human and mouse fibulin-1 genes. The human and mouse fibulin-1 promoters share little sequence similarity except for a short region of approx. 150-170bp immediately upstream of the translation start site. The conserved region contains a TATA-like sequence (ATAATT) and multiple consensus binding sites for Sp1 and activator protein 2 (AP-2). That the short conserved region in each gene confers basal promoter activity is demonstrated by transient transfections of promoter deletion constructs for both the human and mouse genes into cells that express fibulin-1 constitutively. Co-transfections of promoter constructs with expression plasmids for Sp1, Sp3 and Sp4 into Drosophila SL2 cells indicate ...
We report the isolation and complete sequence of the gene encoding the rabbit erythroid-cell-specific 15-lipoxygenase (RBC 15-LOX), containing 14 exons spanning 8.0 kb. The transcription start point was mapped by S1 nuclease-protection experiments and comparison with the sequence of the RBC 15-LOX mRNA, as defined previously by primer extension experiments. The promoter contains a TATA-like motif, but no CCAAT motif in the canonical position, and lies within a CpG-rich island. Functional analysis of the immediate 5-flanking DNA by transfection experiments shows that a 150 nucleotide (nt) 5 fragment linked to the chloramphenicol acetyltransferase gene acts as a functional promoter in both erythroid and nonerythroid cell lines and responds in an erythroid-specific manner to the enhancer from the Friend murine leukaemia virus long terminal repeat, whereas a 40-nt fragment is inactive. Intron 7 contains eight copies of a 54-nt repeat containing a region with homology to the simian virus ...
Today, there are several algorithms and tools available for aligning nucleotide sequences locally. In this master thesis is especially MegaBlast, bu also other tools in the BLAST family, used in the construction of two different applications. What these applications have in common, is that they aim to find all perfect matches when aligning short nucleotide sequences to a large nucleotide database. Both accuracy and time efficiency is emphasized in the applications. UniquePrimers, one of the applications, is constructed in the context of verifying potential primers for a polymerase chain reactions. The application uses the primers as input, and returns all sequences that include the primers within a specified distance between the primers. This means that the application verifies whether or not a pair of primers are unique for only one specific database sequence. A search takes approximately from 15 seconds up to 5 minutes to execute. By using MegaBlast and word length (W) 12, it is guaranteed ...
The present invention relates to a method for detecting gene polymorphism by PCR, using, as a primer, an oligonucleotide, wherein the third nucleotide from the 3′-end thereof is a 2′-O,4′-C-ethylene nucleotide (ENA) unit, the other oligonucleotides are natural oligonucleotides, the 3′-end position thereof is a nucleotide complementary to the nucleotide of the reference sequence of a polymorphic sequence of a target gene, and the other positions are nucleotides complementary to the nucleotide sequence of the target gene, or an oligonucleotide, wherein the 3′-end of the nucleotide sequence thereof is a polymorphic position, the second nucleotide from the 3′-end thereof is a nucleotide having a base that is not complementary to a gene to be detected, and the third nucleotide from the 3′-end thereof is a 2′-O,4′-C-ethylene nucleotide (ENA) unit; oligonucleotides used in detection of gene polymorphism; and a kit for detecting gene polymorphism, comprising the above oligonucleotides.
Transcription initiation is an important step in the process of gene regulation in prokaryotes. Promoters are stretches of DNA sequence that are present in the upstream region of transcription start sites (TSSs), where RNA polymerase and other transcription factors bind to initiate transcription. Recent advancement in sequencing technologies has resulted in huge amount of raw data in the form of whole genome sequences. This sequence data has to be annotated, in order to identify coding, non-coding and regulatory regions. Computational tools are useful for a quick and fairly reliable annotation of many genome sequences. Promoter prediction is an important step in genome annotation process which is needed, not only for the validation of predicted genes, but also for the identification of novel genes, especially those coding for non-coding RNA, which are missed by gene prediction programs. DNA sequence dependent structural properties such as DNA duplex stability, bendability and intrinsic ...
Fingerprint Dive into the research topics of Multiple positive and negative 5 regulatory elements control the cell-type-specific expression of the embryonic skeletal myosin heavy-chain gene.. Together they form a unique fingerprint. ...
We have isolated recombinant lambda (A) phages which contain a part of the rat choline acetyltransferase (ChAT) gene. Restriction and Southern blot analyses using synthetic oligonucleotides indicate that these clones overlap one another and contain at least four exons which reside in 16.4 kb of sequence encoding from the middle to the 3 end, but not the 5-region, of the rat ChAT gene. Partial sequence analyses revealed that the clones contain an exon whose nucleotide sequence corresponds to a highly conserved region of ChAT during evolution. RNase protection mapping experiments show that sequences represented by this exon are expressed at high levels in the spinal cord of adult rats and at low but detectable levels in PC12 cells. By using the genomic sequences, including the exon, as a hybridization probe, we have detected ChAT mRNAs in situ in rat tissues. In situ hybridization experiments using radioactive and non-radioactive probes revealed that cholinergic motoneurons in the spinal cord, ...
In the present study, we sought to examine the molecular basis for the differential regulation of several members of the IFN-α/β gene family (IFNA and IFNB) by IRF-3 and IRF-7. The IFNB, IFNA1, IFNA2, and RANTES promoters were activated by coexpression of either IRF-3 or IRF-7, whereas the IFNA4, IFNA7, and IFNA14 promoters were exclusively activated by IRF-7 and not by IRF-3. Analysis of protein-DNA interactions revealed that recombinant IRF-3 and IRF-7 selectively bound to different regions of the IFNB promoter; IRF-3 bound preferentially to the PRDIII domain of the IFNB promoter, while IRF-7 interacted exclusively with the PRDI domain. PCR-mediated DNA binding site selection results demonstrated that IRF-3 recognized the IRF consensus element 5′-GAAANNGAAANN-3′. Replacement of a single nucleotide within the GAAA core half-site was sufficient to preclude IRF-3 DNA binding. IRF-7 bound to a related sequence motif but with greater flexibility than IRF-3; a single nucleotide replacement did ...
Comparison of cDNA sequences of TaMSH7 gene and Triticum aestivum 3B chromosome revealed that TaMSH7 containі 15 introns and is localized in the position from 119371926 to 119373011 on 3B chromosome. Analysis of nine MSH7 5UTR derived from different plants species, including cereals Oryza sativa and Zea mays, indicates that the cDNA sequence of TaMSH7 is probably shortened from 5-end. Considering these data, a possible translation initiation codon ATG is located at 433-435 nucleotides upstream to the available cDNA gene sequence. Based on the analysis of the predicted promoter region of TaMH7 gene, a large number of CpG methylation points were determined. The methylation level of such points can reveal the features of gene expression regulation in the genomes of introgressive lines. An 816 bp sequence upstream to predicted TaMSH7 translation initiation site contains 75 CpG methylation sites and becomes a target for bisulfite sequencing to establish the predicted promoter region methylation ...
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different
In this study, we developed a new strategy to detect DNA palindromes by coupling fast annealing genomic DNA treated by S1 nuclease (GAPF) with high-throughput sequencing (GAP-Seq) and recovery of novel palindrome junctions. We chose to use the MCF-7 breast cancer cell line for this initial proof-of-principle study because it has been extensively analyzed at the genomic level, allowing us to determine if our approach could generate novel data. In fact, none of our palindrome junctions had been identified by either sequence analysis or novel breakpoint analyses of MCF-7 [22, 25, 26]. This difference may be a result of either or both of two constraints presented by the characteristics of palindromes: 1) the breakpoint analysis was done from BAC clones, where palindromes are not stable during E.coli propagation, and 2) most of novel breakpoints identified here are located in or near to repeat-masked regions and would not be recovered by mapping of high-throughput sequencing data without knowing more ...
Functional RNAs (fRNAs) are being recognized as an important regulatory component in biological processes. Interestingly, recent computational studies suggest that the number and biological significance of functional RNAs within coding regions (coding fRNAs) may have been underestimated. We hypothesized that such coding fRNAs will impose additional constraint on sequence evolution because the DNA primary sequence has to simultaneously code for functional RNA secondary structures on the messenger RNA in addition to the amino acid codons for the protein sequence. To test this prediction, we first utilized computational methods to predict conserved fRNA secondary structures within multiple species alignments of Saccharomyces sensu strico genomes. We predict that as much as 5% of the genes in the yeast genome contain at least one functional RNA secondary structure within their protein-coding region. We then analyzed the impact of coding fRNAs on the evolutionary rate of protein-coding genes because a
Although mutations causing monogenic disorders most frequently lie within the affected gene, sequence variation in complex disorders is more commonly found in noncoding regions. Furthermore, recent genome- wide studies have shown that common DNA sequence variants in noncoding regions are associated with normal variation in gene expression resulting in cell-specific and/or allele-specific differences. The mechanism by which such sequence variation causes changes in gene expression is largely unknown. We have addressed this by studying natural variation in the binding of key transcription factors (TFs) in the well-defined, purified cell system of erythropoiesis. We have shown that common polymorphisms frequently directly perturb the binding sites of key TFs, and detailed analysis shows how this causes considerable (∼10-fold) changes in expression from a single allele in a tissue-specific manner. We also show how a SNP, located at some distance from the recognized TF binding site, may affect ...
Gene conversion-like events between rearranged IGHV3-23*01 gene sequences and germline VH sequences superimposed by somatic hypermutation (SHM). IGHV3-23*01 mut
The regulation of gene expression is a fundamental process within every cell that often allows exquisite control over a genes activity (for review see [1]). Altering transcription rates is an effective strategy for regulating gene activity. It is well established that transcription of a given gene is dependent upon a promoter sequence located within a few hundred base pairs of the transcriptional start site. Promoter activity is modulated by sequence-specific transcription factors that physically interact either with the protein complexes that make up the core transcriptional machinery or with the promoter sequence itself.. In eukaryotes, the activity of a promoter can be modified by transcription factors binding to DNA sequences (frequently termed cis-regulatory modules or enhancers) that are located from hundreds to hundreds of thousands of base pairs away from the promoter. These regulatory modules can either increase or decrease the rate of transcription for a target gene, depending on the ...
Pjevac, P.; Schauberger, C.; Poghosyan, L.; Herbold, C.W.; Kessel, M.A.H.J. van; Daebeler, A.; Steinberger, M.; Jetten, M.S.M. ; Lücker, S.; Wagner, M.; Daims, H. ...
Various enhancer lengths and compositions result in similar levels of virus propagation.To characterize the synthetic enhancer sequences acquired by enhancerless SV40, viral DNA was isolated from cell lysates and subcloned. After a sequencing step, selected clones were reanalyzed by retransfecting cells to identify opportunistic genomes, which had replicated without having incorporated a functional enhancer of their own. In the case of HCMV oligonucleotides, we found all four enhancer motifs in various combinations and orientations in different isolates (Fig. 1C), which upon retesting were similarly infective (first signs of cytopathic effects [CPE] at around day 10 and full infection at around day 14 after transfection). Thus, although the lengths and compositions of the isolated enhancers were quite variable, our experimental setup apparently selected for viral enhancers with similar activities. Of note, the 18-bp repeat, which harbors a previously described binding site for NF-κB (23), was ...
Considerable insights into important cis regulatory elements in a gene can be gleaned from the identification of sequence homologies among different species. To extend and optimize the sequence comparison between human and mouse erythropoietin (Epo) genes, we have obtained new human sequence from 5,547 to 385 bp upstream of the cap site and extended the 3 flank by 489 bp. In addition, we have obtained new sequence information on the mouse Epo gene extending from within the 3 untranslated region (UTR) to 1,001 bp downstream of the polyadenylation site. Analysis of these additional sequences shows considerable homology between human and mouse Epo genes as far as 4 kb (human) or 3 kb (mouse) upstream of the cap sites, as well as far more homology at the 3 end than was previously realized. In addition, both species were found to have a high frequency of short interspersed (SINE) repetitive sequences that interrupt homologies in both the 5 flank and within the transcription unit.
mRNA maturation in Trypanosoma brucei depends upon trans splicing, and variations in trans-splicing efficiency could be an important step in controlling the levels of individual mRNAs. RNA splicing requires specific sequence elements, including conserved 5′ splice sites, branch points, pyrimidine-rich regions [poly(Y) tracts],3′ splice sites (3′SS), and sometimes enhancer elements. To analyze sequence requirements for efficient trans splicing in the poly(Y) tract and around the 3′SS, we constructed a luciferase-β-galactosidase double-reporter system. By testing ∼90 sequences, we demonstrated that the optimum poly(Y) tract length is ∼25 nucleotides. Interspersing a purely undine-containing poly(Y) tract with cytidine resulted in increased ironssplicing efficiency, whereas purines led to a large decrease. The position of the poly(Y) tract relative to the 3′SS is important, and an AC dinucleotide at positions -3 and -4 can lead to a 20-fold decrease in irons splicing. However, ...
A sizing catheter and method of measuring a preselected internal opening within a patient to provide a rapid and precise determination of a stretched diameter of the preselected internal opening. The sizing catheter includes a dilation balloon constructed of a thin expandable plastic which is inflatable and is utilized to determine a size of the preselected opening. The dilation balloon is inflated to an inflation threshold, wherein the dilation balloon deforms about the preselected opening and the size of the dilation balloon adjacent the preselected opening approximates a stretched diameter of the preselected opening. The sizing catheter and method may be utilized to determine an appropriate sized occluding device to thereby occlude the preselected opening.
Complementary base definition, either of the nucleotide bases linked by a hydrogen bond on opposite strands of DNA or double-stranded RNA: guanine is the complementary base of cytosine, and adenine is the complementary base of thymine in DNA and of uracil in RNA. See more.
According to the IncF replicon sequence typing (RST) scheme, which demonstrates a higher discriminatory power than PBRT (13), blaCTX-M-15-carrying plasmids pCA14 and pCA28 are assigned to FII, FIA, FIB (FAB) formula F31:A4:B1, whereas the blaCTX-M-14-carrying plasmid pCA08 is assigned to F2:A2:B20. These findings are consistent with the BLAST analysis, which indicates that pCA14 is closely related to pCA28, with 99% to 100% identity and 92% coverage, including the conserved backbone region and MRRs. pCA14 shares all backbone genes with pCA28, including genes for replication, plasmid maintenance, and conjugal transfer, as well as modules associated with virulence and biochemical pathways. A total of 20 nucleotide differences are observed between their backbone regions. A one-nucleotide difference and a two-nucleotide difference are found in the genes traE and iucC, respectively, with the remainder observed in genes of hypothetical proteins or intergenic regions. In addition, pCA14 shares all ...
An accurate identification of gene promoters remains an important challenge. Computational approaches for this problem rely on promoter sequence attributes that are believed to be critical for transcription initiation. Here we report a probabilistic model that captures two important properties of promoters, not used by previous methods, viz., the location preference and co-occurrence of promoter elements. Additionally, we found that many of the position-specific DNA elements are strongly linked with the function of the gene product. For instance, a highly conserved motif CCTTT at -1 position is strongly associated with protein synthesis, cellular and tissue development. Our comparative analysis of promoter classes reveals that the promoters devoid of CpG islands are more conserved and have fewer alternative transcription start sites. The discovered links between promoter elements and gene function allows us to infer genetic networks from promoter elements. The web server for the PSPA promoter ...
In general, primers are designed to identify specific locations within a long region of DNA, either plasmid or genomic. Primer binding sites are ideally unique within the range of DNA found in the reaction tube. Single primers are used to amplify and label DNA fragments for sequencing reactions, or as probes for Southern blots. Pairs of primers are used to delimit the range of DNA amplified during a PCR reaction. Because biological enzymes selectively add bases on the 3 end of primed double stranded DNA, the binding of the 3 end of the primer is especially important, while the 5 end of the primer can either bind or not, with relatively little effect on most uses of the primer. The binding of the 4-e 3 to the 5 end, the opposite from the DNA synthesis direction found in biological systems. Synthesis starts with a glass bead filled column containing a specific 3 base bound to the glass. Chemically activated nucleotides, termed phosphoramidites, are linked in 3 to 5 order to fabricate the ...
In general, primers are designed to identify specific locations within a long region of DNA, either plasmid or genomic. Primer binding sites are ideally unique within the range of DNA found in the reaction tube. Single primers are used to amplify and label DNA fragments for sequencing reactions, or as probes for Southern blots. Pairs of primers are used to delimit the range of DNA amplified during a PCR reaction. Because biological enzymes selectively add bases on the 3 end of primed double stranded DNA, the binding of the 3 end of the primer is especially important, while the 5 end of the primer can either bind or not, with relatively little effect on most uses of the primer. The binding of the 4-e 3 to the 5 end, the opposite from the DNA synthesis direction found in biological systems. Synthesis starts with a glass bead filled column containing a specific 3 base bound to the glass. Chemically activated nucleotides, termed phosphoramidites, are linked in 3 to 5 order to fabricate the ...
Non-coding transcripts play an important role in gene expression regulation in all species, including budding and fission yeast. Such regulatory transcripts include intergenic ncRNA (non-coding RNA), 5 and 3 UTRs, introns and antisense transcripts. In the present review, we discuss advantages and limitations of recently developed sequencing techniques, such as ESTs, DNA microarrays, RNA-Seq (RNA sequencing), DRS (direct RNA sequencing) and TIF-Seq (transcript isoform sequencing). We provide an overview of methods applied in yeast and how each of them has contributed to our knowledge of gene expression regulation and transcription.
Oligonucleotides are short sequences of nucleotides (RNA or DNA), typically with twenty or fewer bases. Automated synthesizers allow the synthesis of oligonucleotides up to 160 to 200 bases. The length of a synthesized base is usually denoted by mer (from Greek meros part). For example, a fragment of 25 bases would be called a 25-mer. Oligonucleotides are often used as probes for detecting complementary DNA or RNA because they bind readily to their complements. Examples of procedures that use oligonucleotides are DNA microarrays, Southern blots, fluorescent in situ hybridization (FISH), and the synthesis of artificial genes. Oligonucleotides composed of DNA (deoxyoligonucleotides) are often used in the polymerase chain reaction (PCR), a procedure that can be employed to amplify almost any piece of DNA. In this instance, the oligonucleotide is often referred to as a primer, or a short piece of DNA that binds to its complementary target sequence. This generates a place for a polymerase to ...
A complex secondary structure in U1A pre-mRNA that binds two molecules of U1A protein is required for regulation of polyadenylation.: The human U1A protein-U1A
This thesis is based on nine research publications (I - IX) on structure and reactivity of RNA vis-à-vis DNA. The DNA and RNA are made of flexible pentose sugar units, polyelectrolytic phosphodiester backbone, and heterocyclic nucleobases. DNA stores our genetic code, whereas RNA is involved both in protein biosynthesis and catalysis. Various ligand-binding and recognition properties of DNA/RNA are mediated through inter- and intra-molecular H-bonding and stacking interactions, beside hydration, van der Waal and London dispersion forces. In this work the pH dependant chemical shift, pKa values of 2-OH group as well as those the nucleobases in different sequence context, alkaline hydrolysis of the internucleotidic phosphodiester bonds and analysis of NOESY footprints along with NMR constrained molecular dynamics simulation were used as tools to explore and understand the physico-chemical behavior of various nucleic acid sequences, and the forces involved in their self-assembly process. Papers I ...
On Feb 8, 2012, at 8:52 AM, Brad Kemper wrote: , On Feb 8, 2012, at 1:28 AM, Alex Mogilevsky ,[email protected], wrote: , ,,, From: Brad Kemper [mailto:[email protected]] ,,, Sent: Tuesday, February 07, 2012 6:34 PM ,,, ,,, What it the purpose of this restriction? If authors wants that behavior, they can ,,, just set position:relative on the first block. Why must it be prescribed as a ,,, containing block? ,, ,, Set position:relative on first region or root element of named flow? , , Im confused by the question, because root element of named flow is meaningless to me (or, has been meaningless, or should be meaningless). The root of any HTML document Id the HTML element viewport, and there is only one root per document. , , I had meant that the author could set position:relative on first region, instead of the first region being the ICB. It seems like that would amount to the same effect, except that it wouldnt be mandatory (the author could leave the first region as static, and ...
Proteins are assembled from amino acids making use of information encoded in genes. Every single protein has its own unique amino acid sequence that may be specified through the nucleotide sequence of your gene encoding this protein. The genetic code is actually a list of three-nucleotide sets called codons and every three-nucleotide blend designates an amino acid, for instance AUG (adenine-uracil-guanine) would be the code for methionine. Because DNA is made up of four nucleotides, the full variety of doable codons is 64; thats why, You can find some redundancy from the genetic code, with a few amino acids specified by multiple codon.[6] Genes encoded in DNA are very first transcribed into pre-messenger RNA (mRNA) by proteins which include RNA polymerase ...
Numeration systems based on the hyperoperation sequence[edit]. R. L. Goodstein,[2] with a system of notation different from ... This compares to ordinary base-2 representation when the latter is written out in terms of the base b; e.g., in ordinary base-2 ... Note that in this type of base-b hereditary representation, the base itself appears in the expressions, as well as "digits" ... It is closely related to the Ackermann function and especially to the hyperoperation sequence. The idea is based on the fact ...
Sequence-based identifiers[edit]. In sequence-based software versioning schemes, each software release is assigned a unique ... In some schemes, sequence-based identifiers are used to convey the significance of changes between releases. Changes are ... When a period is used to separate sequences, it may or may not represent a decimal point, - see "Incrementing sequences" ... Separating sequences. When printed, the sequences may be separated with characters. The choice of characters and their usage ...
Sequence-based classification[edit]. Sequence-based classifications are among the most powerful predictive method for ... the sequence-based families have been classified into 'clans' of related structure. Recent progress in glycosidase sequence ... A classification system for glycosyl hydrolases, based on sequence similarity, has led to the definition of more than 100 ... Glycoside hydrolases may also be classified by sequence or structure based methods.[4] ...
Complementary base sequence 5 Hormone Receptor 6 Avidin Biotin 7 Calmodulin Calmodulin binding molecule ... WAC is an affinity-based liquid chromatographic technique that separates chemical compounds based on their different weak ... The way that the desired enzyme would be eluted would be from the mixture based on the strong interaction of enzyme and the ... Affinity chromatography is a method of separating biochemical mixture based on a highly specific interaction between antigen ...
Some taxonomists have lumped the S. sanguinis group in with the S. mitis group based on 16S rRNA gene sequence analysis, but S ... sequence homology in this gene. In light of the high degree of 16S rRNA gene sequence similarity, sequencing of alternative ... Other sequence-based identification systems have subsequently been introduced for VGS species level identification. In general ... Sequence-based identification. Historically, DNA-DNA hybridization studies have been used to confirm species level ...
Base-dependent integer sequences. Hidden categories: *Articles lacking in-text citations from September 2010 ... This sequence starts (sequence A020342 in the OEIS): 126, 153, 688, 1206, 1255, 1260, 1395, .... A prime vampire number, as ... There are many known sequences of infinitely many vampire numbers following a pattern, such as: 1530 = 30×51, 150300 = 300×501 ...
Sequence OEIS: A092697 in the On-Line Encyclopedia of Integer Sequences.. *. Bernstein, Leon (1968), "Multiplicative twins and ... it will find them in base 8 and base 16 as well. Look at line 15 in Table Two. The fix, when this condition is identified and ... Other bases[edit]. In duodecimal system, the smallest n-parasitic numbers are: (using inverted two and three for ten and eleven ... An n-parasitic number (in base 10) is a positive natural number which can be multiplied by n by moving the rightmost digit of ...
Nucleic acid sequence based amplification (NASBA) is a method in molecular biology which is used to amplify RNA sequences. ... Mugasa, CM; Laurent, T; Schoone, GJ; Kager, PA; Lubega, GW; Schallig, HD (2009). "Nucleic acid sequence-based amplification ... Compton, J (1991). "Nucleic acid sequence-based amplification". Nature. 350 (6313): 91-2. doi:10.1038/350091a0. PMID 1706072. ... "Real-time nucleic acid sequence-based amplification is more convenient than real-time PCR for quantification of Plasmodium ...
Thus, the number Rn = Rn(10) consists of n copies of the digit 1 in base 10 representation. The sequence of repunits base 10 ... Base 9 repunit primes[edit]. There are no base 9 repunit primes. 9. n. −. 1. =. (. 3. n. +. 1. ). (. 3. n. −. 1. ). {\ ... Base 4 repunit primes[edit]. The only base 4 repunit prime is 5 (. 11. 4. {\displaystyle 11_{4}}. ). 4. n. −. 1. =. (. 2. n. + ... 5, 13, 131, 149, 1699, ... (sequence A004063 in the OEIS).. Base 8 repunit primes[edit]. The only base 8 repunit prime is 73 ( ...
Base sequence of the recognition site". Journal of Molecular Biology. 51 (2): 393-409. doi:10.1016/0022-2836(70)90150-6. PMID ... Kelly determined the DNA sequences recognized by type II restriction enzymes, which subsequently became major tools in ...
whole genome sequencing . wobble base pair . wood The inner layer of the stems of woody plants, composed of xylem. xanthophyll ... nucleotide bases are matched to synthesize the new partner strands. DNA sequencing . dynein A motor protein (also called ... Biomass can be used as a source of energy and it most often refers to plants or plant-based materials which are not used for ... nucleic acid . nucleic acid sequence . nucleobase . nucleoid . nucleolus . nucleotide . Contents: 0-9 A B C D E F G H I J K L M ...
Gene K overlaps genes A, B, and C. The origin of replication lies within a 30 base sequence. The entire 30 base sequence is ... Viruses are assigned according to their similarity to known lab based strains-the ΦX174-like clade, G4-like clade and the α3- ... Zsak L, Day JM, Oakley BB, Seal BS (2011) The complete genome sequence and genetic analysis of ΦCA82 a novel uncultured ... Kodaira K, Nakano K, Okada S, Taketo A (1992) Nucleotide sequence of the genome of the bacteriophage alpha 3: interrelationship ...
Sequence-based classificationEdit. Sequence-based classifications are among the most powerful predictive method for suggesting ... the sequence-based families have been classified into 'clans' of related structure. Recent progress in glycosidase sequence ... A classification system for glycosyl hydrolases, based on sequence similarity, has led to the definition of more than 100 ... Henrissat, Bernard; Davies, Gideon (1997). "Structural and sequence-based classification of glycoside hydrolases". Current ...
Meyer F, Kurtz S, Backofen R, Will S, Beckstette M (2011). "Structator: fast index-based search for RNA sequence-structure ... Andrew Xiang Li; Jing Qin; Manja Marz; Christian M. Reidys (2011). "RNA-RNA interaction prediction based on multiple sequence ... Weinberg Z, Ruzzo WL (2006). "Sequence-based heuristics for faster annotation of non-coding RNA families". Bioinformatics. 22 ( ... R Kleinkauf; M Mann; R Backofen (2015). "antaRNA: ant colony-based RNA sequence design". Bioinformatics. 31 (19): 3114-3121. ...
Xavier Didelot (2010). "Sequence-Based Analysis of Bacterial Population Structures". In D. Ashley Robinson; Daniel Falush; ... Usually used for trees based on DNA or protein sequence data, the algorithm requires knowledge of the distance between each ... Based on a distance matrix relating the n {\displaystyle n} taxa, calculate Q {\displaystyle Q} as follows: where d ( i , j ... Based on the current distance matrix calculate the matrix Q {\displaystyle Q} (defined below). Find the pair of distinct taxa i ...
Based on the peptide sequence tag approach. MS/MS Ion Search Identify fragment ions from uninterpreted MS/MS data of one or ... Mascot generates a randomized sequence of the same length for every sequence in the target database. The decoy sequence is ... Perkins DN, Pappin DJ, Creasy DM, Cottrell JS (December 1999). "Probability-based protein identification by searching sequence ... Sequence query Combines peptide mass data with amino acid sequence and composition information usually obtained from MS/MS ...
2000). "Phylogeography of Peromyscus furvus (Rodentia; Muridae) based on cytochrome b sequence data". Molecular Ecology. 9 (12 ...
Compositae, Anthemideae) based on cpDNA sequence variation. Plant Systematics and Evolution 298(7), 1407-14. Leucanthemum. ... The base of the head is layered with up to 60 or more rough-edged phyllaries. The Leucanthemum head has about 13 to 34 ray ... Some leaves are borne on petioles, and others are sessile, attached to the stem at their bases. They vary in shape, and some ...
... is an open source probabilistic consistency-based multiple alignment of amino acid sequences. It is an efficient ... Probabilistic Consistency-based Multiple Sequence Alignment". Genome Research. 15 (2): 330-340. doi:10.1101/gr.2821705. PMC ... All pairs of sequences x,y from the set of all sequences S {\displaystyle {\mathcal {S}}} are now re-estimated using all ... Calculate expected accuracy of each sequence: E P r [ a , x , y ] ( a c c ( a ∗ , a ) ) = ∑ a P r [ a , x , y ] a c c ( a ∗ , a ...
Angiosperm phylogeny based on matK sequence information. American Journal of Botany 90: 1758-1776. Rohwer JG & Rudolph B. 2005 ... based on different analyses of trnK intron sequences. Annals of the Missouri Botanical Garden 92: 153-178. Kimoto Y, Utami N, ... Based on the trnK intron, a common phylogenetic marker for classifying angiosperms, Rohwer and Rudolph (2005) created a ... Most early systems of classification based on morphological characters divided the Lauraceae into two subfamilies: ...
Chunyang Xiao; Marc Dymetman; Claire Gardent (7-12 August 2016). "Sequence-based Structured Prediction for Semantic Parsing". ... BizTalk is message-based system similar to TIBCO which companies integrate across realms. The server is coded using .NET but ... This proved challenging as was one of the first uses of FTP based Web Services in a SOAP-like protocol of messages and ... After 4 years of successful implementations using the JWS pattern exclusively based on Server Side Includes and JSP, Carlos ...
Naylor G J P, Caira J N, Jensen K, Rosana K A M, White W T, Last P R (2012): A DNA sequence-based approach to the ... based on DNA sequences. Chinese Journal of Oceanology and Limnology, doi:10.1007/s00343-018-7056-2. Pavan-Kumar A, Kumar R, ... based on cytochrome-oxidase I gene sequences and spotting patterns. Comptes Rendus Biologies, 336 (4): 221-232.[2] Borsa, P. ( ... as well as in the CO1 and ND2 gene sequences. Within the genus Neotrygon, species can be diagnosed by their nucleotide sequence ...
based on molecular sequences". Mycotaxon. 82: 315-322. Krüger, D.; Petersen, R.H.; Hughes, K.W. (2006). "Molecular phylogenies ... Krüger, D.; Gargas A. (2004). "The basidiomycete genus Polyporus-an emendation based on phylogeny and putative secondary ... Polyporales, Basidiomycota) from China based on morphological and molecular data" (PDF). Mycological Progress. 13 (3): 811-817 ...
The sequence of bases along a particular DNA molecule specifies the genetic information: this is comparable to a sequence of ... If the DNA sequence at a particular locus varies between individuals, the different forms of this sequence are called alleles. ... different genes have different sequences of bases. Within cells, the long strands of DNA form condensed structures called ... containing a unique combination of DNA sequences that code for genes. The specific location of a DNA sequence within a ...
The tone sequence is based on just intonation; a good player can produce a wide tonal range. The sound of the lurs is powerful ...
The base pairing in pseudoknots is not well nested; that is, base pairs occur that "overlap" one another in sequence position. ... T and A rich sequences are more easily melted than C and G rich regions. Particular base steps are also susceptible to DNA ... Breslauer KJ, Frank R, Blöcker H, Marky LA (1986). "Predicting DNA duplex stability from the base sequence". PNAS. 83 (11): ... In RNA, thymine is replaced by uracil (U). Alternate hydrogen bonding patterns, such as the wobble base pair and Hoogsteen base ...
A classification system for glycosyl hydrolases, based on sequence similarity, has led to the definition of numerous different ... Henrissat B, Bairoch A (June 1996). "Updating the sequence-based classification of glycosyl hydrolases". Biochem. J. 316 (2): ... Because the fold of proteins is better conserved than their sequences, some of the families can be grouped in 'clans'. As of ...
Henrissat, B.; Davies, G. (1997). "Structural and sequence-based classification of glycoside hydrolases". Current Opinion in ... Carbohydrates: A feast of structural glycobiology • Sequences and topology: Computational studies of protein-protein ...
The mRNA sequence is 1,140 base pairs long. There is an upstream stop codon located at nucleotides 65 - 67. The 23rd amino acid ... C11orf52 spans 155658 base pairs and is orientated on the positive strand. Gene C11orf52 has a molecular weight of 14kDa and is ... the most distantly related to Homo Sapiens C11orf52 sequence. Gene duplication first occurred approximately 324.5 million years ...
"Sequence-based feature prediction and annotation of proteins". Genome Biology. 10 (2): 206. doi:10.1186/gb-2009-10-2-206. PMC ... studying the evolution of protein function using sequence- and structure-based approaches. In 1994 Valencia formed the Protein ... 2011). "Exome sequencing identifies recurrent mutations of the splicing factor SF3B1 gene in chronic lymphocytic leukemia". ... 2011). "Whole-genome sequencing identifies recurrent mutations in chronic lymphocytic leukaemia". Nature. 475 (7354): 101-5. ...
Courts these days are making policy-based decisions, untethered from any rule of law, aimed at killing patents they don't like. ... So they wanted to focus on genetic fragments containing paternally inherited sequences the mother did not share, but had ... mc2 and based on a requirement to keep speculator trolls out: [I]f the breadth of the claim is sufficiently limited to a ...
The Vistula estuary was settled by Slavs in the 7th and 8th century.[26] Based on archeological and linguistic findings, it has ... "Record of the Vistula ice lobe advances in the Late Weichselian glacial sequence in north-central Poland". Quaternary ... and considerable predisposition of its older base. The asymmetry of the river basin (right-hand to left-hand side) is 73-27%. ...
... base added to ketone, using weak or insoluble bases, e.g., NaOEt in EtOH, or NaH) provides the more-substituted thermodynamic ... Ozonolysis, and related dihydroxylation/oxidative sequences, cleave alkenes to give aldehydes or ketones, depending on alkene ... Acid/base properties of ketonesEdit. Ketones are far more acidic (pKa ≈ 20) than a regular alkane (pKa ≈ 50). This difference ... with either stoichiometric and catalytic base. Using very strong bases like lithium diisopropylamide (LDA, pKa of conjugate ...
... based on morphological and DNA sequence comparisons, Chalara fraxinea was suggested to be the asexual stage (anamorph) of the ... The sequence has been published on the website OpenAshDieBack and offers clues to how the fungus infects trees. The study has ... Teams from The Sainsbury Laboratory (TSL) and the John Innes Centre in Norwich sequenced the genome of the fungus in December ... In December 2016, writing in Nature Dr Richard Buggs reported that the common ash (Fraxinus excelsior)had been sequenced for ...
She then appeared in some movie shorts with sequences based on famous paintings. She received critical recognition for the 1921 ... On January 2, 1930, while filming sequences for the Fox movie Such Men Are Dangerous, Kenneth Hawks was killed in a mid-air ... but her small part in a dream sequence wound up on the cutting room floor. Paramount let her contract lapse. ...
Lamin A/C gene and a related sequence map to human chromosomes 1q12.1-q23 and 10. Somat. Cell Mol. Genet. March 1993, 19 (2): ... PDB rendering based on 1ifr.. 有效结构. PDB. 直系同源检索:PDBe, RCSB ...
Family-pedigree based mapping[edit]. Family based QTL mapping, or Family-pedigree based mapping (Linkage and association ... Once a region of DNA is identified as contributing to a phenotype, it can be sequenced. The DNA sequence of any genes in this ... This can be done using BLAST, an online tool that allows users to enter a primary sequence and search for similar sequences ... Using family-pedigree based approach has been discussed (Bink et al. 2008). Family-based linkage and association has been ...
The two major types, are silicate based and carbonate based. The majority of silica cements are composed of quartz but can ... Thick sequences of sedimentary (colluvial) breccias are generally formed next to fault scarps in grabens. ... Classification schemes for mudrocks tend to vary but most are based on the grain size of the major constituents. In mudrocks, ... However, others have used the term shale to further divide mudrocks based on the percentage of clay constituents. The plate- ...
... (formerly known as Ingenuity Systems, Inc) is a company based in Redwood City, California, USA, to ... Laboratory Corporation and Quest Diagnostics to develop a solution for scoring genetic variation for next generation sequencing ... All QIAGEN Silicon Valley use the Ingenuity Knowledge Base, which contains biological and chemical interactions and functional ... BD Cell Pathways "Ingenuity Systems Announces Immediate Availability Of The Ingenuity Pathways Knowledge Base" (Press release ...
Rossini's opera La gazza ladra and The Adventures of Tintin comic The Castafiore Emerald are based on this theme. However, one ... An analysis of mitochondrial DNA sequences published in 2003 confirmed that the black-billed magpie and the yellow-billed ... Union decided to treat the black-billed magpie as a separate species based on studies of the vocalization and behaviour that ...
Minimum magnitude sequence. (1, 4, 4, 4, 4, and 4 goes on for the rest) -- Positive sequence. Multiply the right most digit by ... For example, in base 10, the factors of 101 include 2, 5, and 10. Therefore, divisibility by 2, 5, and 10 only depend on ... Positive sequence Multiply the right most digit by the left most digit in the sequence and multiply the second right most digit ... Minimum magnitude sequence (1, 3, 2, 6, 4, 5, cycle repeats for the next six digits) Period: 6 digits. Recurring numbers: 1, 3 ...
... the attack-point sequence of the two measures is reversed. Most salsa is in 2-3 clave and most salsa piano guajeos are based on ... The following guajeo is based on the clave motif in a 2-3 sequence. The cinquillo rhythm is now in the second measure. ... 8 clave-based music is generated from cross-rhythm, it is possible to count or feel the 6. 8 clave in several different ways. ... The following afrobeat guitar part is a variant of the 2-3 onbeat/offbeat motif.[83] Even the melodic contour is guajeo-based. ...
The genome of S. pneumoniae is a closed, circular DNA structure that contains between 2.0 and 2.1 million base pairs depending ... The recent advances in next-generation sequencing and comparative genomics have enabled the development of robust and reliable ... S. pneumoniae can also be distinguished based on its sensitivity to lysis by bile, the so-called "bile solubility test". The ... For instance, the Xisco gene was recently described as a biomarker for PCR-based detection of S. pneumoniae and differentiation ...
What is accepted as the standard form today in both West Bengal and Bangladesh is based on the West-Central dialect of Nadia ... There is yet to be a uniform standard collating sequence (sorting order of graphemes to be used in dictionaries, indices, ... The modern literary form of Bengali was developed during the 19th and early 20th centuries based on the dialect spoken in the ... In spite of some modifications in the 19th century, the Bengali spelling system continues to be based on the one used for ...
Pyykkö, Pekka (2011). "A suggested periodic table up to Z ≤ 172, based on Dirac-Fock calculations on atoms and ions". Physical ... to this debate on the basis of moving to a 32-column table and consideration of which option results in a continuous sequence ... Exclusion of all elements is based on properties of earlier actinides, which show a much wider variety of chemistry (for ...
Statistical, likelihood-based approaches: Statistical, likelihood-based [37][38] iterative expectation-maximization algorithms ... Because the two scans can be performed in immediate sequence during the same session, with the patient not changing position ... based regularization in a wavelet or other domain), such as via Ulf Grenander's Sieve estimator[41][42] or via Bayes penalty ... Neurology: PET neuroimaging is based on an assumption that areas of high radioactivity are associated with brain activity. What ...
More than one main vein (nerve) at the base. Lateral secondary veins branching from a point above the base of the leaf. Usually ... There is a regularity in these angles and they follow the numbers in a Fibonacci sequence: 1/2, 2/3, 3/5, 5/8, 8/13, 13/21, 21/ ... BaseEdit. Acuminate. Coming to a sharp, narrow, prolonged point.. Acute. Coming to a sharp, but not prolonged point.. ... When the leaf base completely surrounds the stem, the leaves are said to be perfoliate, such as in Eupatorium perfoliatum. ...
Genome-sequencing showed that this outbreak was not related to the 2014-15 West Africa Ebola virus outbreak, but was the same ... Developments in organ-on-a-chip technology have led to a chip-based model for Ebola haemorrhagic syndrome.[262] ... Genome sequencing suggests that this outbreak, the 11th outbreak since the virus was first discovered in the country in 1976, ... December 1999). "Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the ...
The clinical diagnosis must be based on the presence of one or more of the symptoms listed below, because the syndrome itself ... The CRH test uses recombinant human or bovine-sequence CRH, which is administered via a 100μg intravenous bolus dose. The ... A population-based study". Journal of Clinical Endocrinology and Metabolism. 86 (1): 117-123. doi:10.1210/jcem.86.1.7093. PMID ... Aidan Carney and based on statistical evidence, was that the basophil adenoma Minnie might have harbored underwent partial ...
... residue in the sequence Asn-X-Ser or Asn-X-Thr where X is any amino acid except proline. This sequence is called a ... Marquardt T, Denecke J (June 2003). "Congenital disorders of glycosylation: review of their molecular bases, clinical ... The high sequence similarity between the prokaryotic and the eukaryotic STT3 suggests that their structures are similar. ...
Henceforth, batteries were designated in a single alphabetical sequence in order of seniority from date of formation[24] and ... it has been based in England, initially at Aldershot but latterly at Colchester.[61] ... currently based in Merville Barracks in Colchester. ...
A sequence of two high-profile studies by a team from the Massachusetts Institute of Technology and the Harvard School of ... Similarly, if a child lives with someone other than a parent, he may still be eligible based on its individual status.[74] ... Unlike Medicare, Medicaid is a means-tested, needs-based social welfare or social protection program rather than a social ... The Low-Income Wage Rate: State welfare programs base the level of assistance they provide on some concept of what is minimally ...
The mallard is omnivorous and very flexible in its choice of food.[61] Its diet may vary based on several factors, including ... Mitochondrial DNA data for the D-loop sequence suggests that mallards may have evolved in the general area of Siberia. Mallard ... The genome of Anas platyrhynchos was sequenced in 2013.[6] ...
"Sex-Based Roles Gave Modern Humans an Edge, Study Says". National Geographic News. Retrieved 2008-02-03.. ... "Callaway, Ewen (22 September 2011), "First Aboriginal genome sequenced", Nature, Nature News, doi:10.1038/news.2011.551 ... An artist's rendering of a temporary wood house, based on evidence found at Terra Amata (in Nice, France) and dated to the ... In general, their actual diet in the wild is about 95% plant-based, with the remaining 5% filled with insects, eggs, and baby ...
Over time, base changes in the DNA sequence can arise from deamination mutations. When adenine is deaminated, it becomes ... Hypoxanthine can bind to cytosine, and when the XC base pair is replicated, it becomes a GC (thus, an A → G base change).[20] ... Its existence was first proven in 1962,[4] and first sequenced in 1986-when two Japanese research teams sequenced the ... both very common in chloroplast transit sequences-making up 20-30% of the sequence)[45] are often the amino acids that accept ...
... vulgaris is diagnosed based on a medical professional's clinical judgment.[15] The evaluation of a person with suspected ... scientists reported the first genome sequencing of a C. acnes bacteriophage (PA6). The authors proposed applying this research ... June 2012). "Topical antimicrobial treatment of acne vulgaris: an evidence-based review". American Journal of Clinical ... Levy LL, Zeichner JA (October 2012). "Management of acne scarring, part II: a comparative review of non-laser-based, minimally ...
Flats Sequencing System. *Locatable Address Conversion System. *United States Postal Savings System ... Information-Based Indicia. *The Inspectors. *Intelligent Mail barcode. *Label 228. *List of postal killings ...
Huston JP, Hasenöhrl RU, Boix F, Gerhardt P, Schwarting RK (1993). "Sequence-specific effects of neurokinin substance P on ... the peptide based NK1RA) against cisplatin-induced emesis in the ferret.[75] It is likely that some peripheral exposure ... The deduced amino acid sequence of substance P is as follows:[3] ...
... mismatch as small as a single DNA base pair is significant so perfect matches require knowledge of the exact DNA sequence of ... One study based on a survey of medical teams covered approximately 24,000 peripheral blood HSCT cases between 1993 and 2005, ...
... a vertex sequence such that each edge goes from an earlier vertex to a later vertex in the sequence.. totally disconnected. ... based on vertex removals.. strong. 1. For strong connectivity and strongly connected components of directed graphs, see ... The degree sequence is the collection of degrees of all vertices, in sorted order from largest to smallest. In a directed graph ... A path may either be a walk (a sequence of vertices and edges, with both endpoints of an edge appearing adjacent to it in the ...
In fact, I had a client this morning that needed to convert a DVCPro-50 16:9 sequence into a DV 4:3 video. Heres how to do it. ... 4) The movie will export - and will take a while to do so, depending upon the length of the sequence you are exporting. Use ... I just wanted to mention a minor problem I discovered with your "converting a 16:9 sequence to 4:3 video" article. I was ... Slade Knowledge Base is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License, 2018 ...
Local alignment of two-base encoded DNA sequence ... Multiple DNA and protein sequence alignment based on segment-to ... Whole methylome analysis by ultra-deep sequencing using two-base encoding by Christina A. Bormann Chung, Victoria L. Boyd, ... Insertion sequences by Jacques Mahillon, Michael Ch, Jacques Mahillon, Michael Chandler - Microbiol Mol. Biol. Rev , 1998 ... Local Alignments of DNA Sequences by unknown authors , 2002 "... Abstract This paper presents aheuristic for finding close to ...
MOABS: model based analysis of bisulfite sequencing data.. Sun D, Xi Y, Rodriguez B, Park HJ, Tong P, Meong M, Goodell MA, Li W ... e) and (f) Same as (c) and (d) with 4X sequencing depth by random sampling. The 10000 times of random shuffle of TFBSs ... Sequencing depth is randomly sampled from 5-fold to 50-fold. The Y-axis shows the percentage of true DMCs predicted at 5% FDR. ... Bisulfite sequencing (BS-seq) is the gold standard for studying genome-wide DNA methylation. We developed MOABS to increase the ...
... Published 7:30 AM ET Thu, 1 Oct 2015 Globe ... These forward-looking statements are based upon managements current expectations, are subject to known and unknown risks, and ... HTG EdgeSeq Immuno-Oncology Assay couples HTGs proprietary nuclease protection chemistry with next-generation sequencing (NGS ... system capabilities have been expanded to fully automate sample and targeted library preparation for next-generation sequencing ...
Journal of Integer Sequences, Vol. 10 (2007), Article 07.1.8. Sequences of Generalized Happy Numbers with Small Bases H. G. ... For bases b ≤ 5 and exponents e ≥ 2, there exist arbitrarily long finite sequences of d-consecutive e-power b-happy numbers for ... Published in Journal of Integer Sequences January 8 2007. Return to Journal of Integer Sequences home page ... Concerned with sequence A000108 .) Received June 29 2006; revised version received January 8 2007. ...
"Analysis of similarity/dissimilarity of DNA sequences based on nonoverlapping triplets of nucleotide bases," Journal of ... Numerical Characterization of DNA Sequence Based on Dinucleotides. Xingqin Qi,1 Edgar Fuller,2 Qin Wu,3 and Cun-Quan Zhang2 ... Z. H. Qi and X. Q. Qi, "Numerical characterization of DNA sequences based on digital signal method," Computers in Biology and ... B. Liao, R. Li, W. Zhu, and X. Xiang, "On the similarity of DNA primary sequences based on 5-D representation," Journal of ...
Sequence Cut Site Overhang Properties (NEB Enzymes Only) Nb ... Enzyme Finder - Sequence , 6 Bases. Enzyme. Sequence. Cut Site ... Home Tools & Resources Selection Charts Enzyme Finder - Sequence , 6 Bases ... DNA Library Prep Kit with novel fragmentation reagent meets the dual challenge of generating high quality next gen sequencing ... DNA Library Prep Kit with novel fragmentation reagent meets the dual challenge of generating high quality next gen sequencing ...
... hz5 at njit.edu hz5 at njit.edu Tue Jun 11 13:35:46 EDT 2002 *Previous message (by ... I am hoping that your collective brains can help me find a web based , software suite to do some simple DNA sequence ... We will complete the class by cloning and sequenceing a gene, , and , we would like to do some sequence analysis with the ... Simply , looking at the sequence, translation, rev/comp sorts of things. , However, , we dont really want to install software ...
... sequence_base::_M_swap (_Safe_sequence_base &__x) [protected] Swap this sequence with the given sequence. This operation also ... gnu_debug::_Safe_sequence_base::~_Safe_sequence_base () [inline, protected] Notify all iterators that reference this sequence ... gnu_debug::_Safe_sequence_base - SYNOPSIS. Inherited by __gnu_debug::_Safe_sequence, _Sequence ,, __gnu_debug::_Safe_sequence, ... sequence, _Sequence ,::_M_transfer_iter(). _Safe_iterator_base* __gnu_debug::_Safe_sequence_base::_M_iterators The list of ...
Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome.. Albrecht M1, Sharma CM, Reinhardt R, Vogel J, ... A) Calculated sequence graphs for C. trachomatis cryptic plasmid. Graphs show the number of sequence reads for every nucleotide ... Shown are relative numbers of groups of sequence length in relation to the total number of reads per library. (B) Sequence read ... We used deep sequencing to define the transcriptome of purified elementary bodies (EB) and reticulate bodies (RB) of C. ...
Modeling and automation of sequencing-based characterization of RNA structure. Sharon Aviran, Cole Trapnell, Julius B. Lucks, ... Modeling and automation of sequencing-based characterization of RNA structure. Sharon Aviran, Cole Trapnell, Julius B. Lucks, ... Modeling and automation of sequencing-based characterization of RNA structure. Sharon Aviran, Cole Trapnell, Julius B. Lucks, ... Modeling and automation of sequencing-based characterization of RNA structure Message Subject (Your Name) has sent you a ...
In this paper,we present a new gait recognition scheme based on multi-view... ... Wang Y., Yu S., Wang Y., Tan T. (2005) Gait Recognition Based on Fusion of Multi-view Gait Sequences. In: Zhang D., Jain A.K. ( ... In this paper,we present a new gait recognition scheme based on multi-view gait sequence fusion. An experimental comparison of ... On the other hand, we also find that fusion of gait sequences with an angle difference greater than or equal to 90° can achieve ...
Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. ... web-based software toolkit DNA sequence analysis DNA compression This is a preview of subscription content, log in to check ... Pratas D., Pinho A.J., Garcia S.P. (2012) Exon: A Web-Based Software Toolkit for DNA Sequence Analysis. In: Rocha M., Luscombe ... Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. ...
New frames in an image sequence (video) are segmented based on the prior segmentati ... We describe an algorithm for context-based segmentation of visual data. ...
... Shadi A. Issa,1 Romeo Kienzler,2 Mohamed El-Kalioby,1 Peter ... Majid Hajibaba, Saed Gorgin, and Mohsen Sharifi, "Sequence similarity parallelization over heterogeneous computer clusters ... "Optimization of data-intensive workflows in stream-based data processing models," Journal of Supercomputing, vol. 73, no. 9, pp ... "Data-intensive workflow optimization based on application task graph partitioning in heterogeneous computing systems," ...
Have you tried doing a script for checking if there is a missing file based on the sequence number? Im tried doing it but I ... Have you tried doing a script for checking if there is a missing file based on the sequence number? Im tried doing it but I ... save the previous sequence number lcnt=seqno } input > output ... Solved] Move Files based on Filename time. *› i want to find ...
Citation: P, P., J, P., and Palanisamy, K., "Optimization of Proving Ground Durability Test Sequence Based on Relative Damage ... Optimization of Proving Ground Durability Test Sequence Based on Relative Damage Spectrum 2018-01-0101. ... Hence the PG test sequence must be optimal enough such that it includes all the range of frequencies representing the actual ... PG validation requires a specific durability test sequence for every segment of commercial vehicles due to different customer ...
... aim to develop tests based on several platforms, including the Ion Torrent PGM and Illumina HiSeq. ... A new program funded by the UK government aims to bring sequencing-based cancer tests to the market as part of a broad ... UK Government Funding Development of Sequencing-Based Cancer Tests. Jun 21, 2011 ... Exosome-Based Treatment Targeting KRAS G12D-Mutated Pancreatic Cancer to Enter Human Studies Next Month. Premium ...
Gene sequence-based diversity in Pisum:. Alignments were generated for each of the 39 gene segment sequence sets. Nucleotide ... Sequence-based diversity trees:. To investigate the tree structure of the complete sequence set, the aligned gene-derived ... 2005). One aim of the present study was to compare SSAP-based diversity analysis with gene-based sequence diversity analysis, ... DNA sequencing:. Sequencing PCR reactions used 0.33 μl Big Dye Terminator v3.1 Cycle Sequencing RR-100 (Perkin-Elmer, Norwalk, ...
This has led to considerable interest in PCR-based markers, in particular those based on simple sequence repeats (SSR). ... A total of 568 new simple sequence repeat (SSR)-based markers for barley have been developed from a combination of database ... Sequence checking and primer design: The systematic checking of the sequences, against an in-house database of SSR-containing ... SSR isolation and characterization: SSR-containing DNA sequences were derived from public access sequence databases and from ...
... annual meeting on Saturday said that the public is cautiously interested in including whole-exome or whole-genome sequencing as ... ASHG Panelists Discuss Interest in Sequencing-based Newborn Screening. Oct 28, 2013 ... annual meeting on Saturday said that the public is cautiously interested in including whole-exome or whole-genome sequencing as ...
File activerecord/lib/active_record/base.rb, line 672 def set_sequence_name(value = nil, &block) define_attr_method :sequence_ ... class Project , ActiveRecord::Base set_sequence_name projectseq # default would have been project_seq end. ... set_sequence_name(value = nil, &block). public Sets the name of the sequence to use when generating ids to the given value, or ... If a sequence name is not explicitly set when using PostgreSQL, it will discover the sequence corresponding to your primary key ...
Here, we used a sequence-based genotyping approach to characterize worldwide plum germplasm including the potential progenitor ... The sequence-based genotyping method used here has limitations caused by the lack of a plum reference assembly and the reliance ... In the present study, we generated a set of sequence-based SNP markers densely distributed across the Prunus genome in order to ... Genetic characterization of worldwide Prunus domestica (plum) germplasm using sequence-based genotyping. *Tetyana Zhebentyayeva ...
We present the notion of a similarity query and we review similarity measures proposed so far for sets and sequences. We ... We introduce a new similarity measure that can be successfully used with sequences. We present algorithms for efficient ... Attributes containing sets or sequences of elements appear in various application domains, e.g. in telecommunication and retail ... Currently available database systems support neither indexing nor advanced querying of attributes containing sets or sequences ...
Sequence-based bioinformatics. The analysis of DNA, RNA and protein sequences is traditionally one of the major application ... Such analyses require methods for sequence alignment, phylogenetics reconstruction (for functional analysis), elucidation of ... a pressing need for novel bioinformatics methods that can infer biological functions and processes directly from sequence-level ...
... ability to detect piconewton scale forces in order to read off sequencing information based on the interaction of nucleotides ... Many new sequencing technologies are being developed to achieve these goals. Our technique takes advantage of the atomic force ... We have successfully completed two of the major pieces needed to sequence DNA with an AFM. The problem of nonspecific adhesion ... The desire to sequence DNA is fueled by the knowledge that the information locked inside of genomes can help fields as varied ...
sequor: A sequence labeler based on Collinss sequence perceptron.. [ bsd3, library, natural-language-processing, program ] [ ... array (,=0.2), base (,=3 && ,5), binary (,=0.5), bytestring (,=0.9.2), containers (,=0.2), mtl (,=1.1), nlp-scores (,=0.6.0), ...
sequor: A sequence labeler based on Collinss sequence perceptron. The sequor package. [ Tags: bsd3, library, natural-language- ... sequor 0.2.2 AUTHOR: Grzegorz Chrupała ,[email protected], Sequor is a sequence labeler based on Collinss sequence ... If passed a sequence they are applied to each of its elements. For example (Suffix 3 (Row 0)) will return the sequence of ... array (,=0.2), base (,=3 && ,5), binary (,=0.5), bytestring (,=0.9), containers (,=0.2), mtl (,=1.1), pretty (,=1.0), text (,= ...
HaloPlexHS is a high-sensitivity, amplicon-based targeted sequencing method that incorporates molecular barcodes in ... Agilent׷ SureMASTR technology is based on multiplex PCR and amplifies multiple genomic targets through a simple PCR experiment ... Agilent offers other hybridization-based target enrichment technology options, also, for finding specific regions-of-interest. ... amplicon-based technologies for target enrichment and amplification include HaloPlex / HaloPlexHS and SureMASTR. ...
Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well ... including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear ... below the frequency of errors in currently available methods for sequence analysis, ... DNA sequence analysis Is the Subject Area "DNA sequence analysis" applicable to this article? Yes. No. ...
  • Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. (psu.edu)
  • Bisulfite sequencing (BS-seq) is the gold standard for studying genome-wide DNA methylation. (nih.gov)
  • The detailed map of TSS in a thus far unprecedented resolution as a complement to the genome sequence will help to understand the organization, control and function of genes of this important pathogen. (nih.gov)
  • BOSTON (GenomeWeb Daily News) - While panelists at a session at the American Society of Human Genetics annual meeting on Saturday said that the public is cautiously interested in including whole-exome or whole-genome sequencing as part of newborn screening efforts, there are concerns regarding privacy as well as the technologies' ability to meet the technical criteria required for such public health screening. (genomeweb.com)
  • Such analyses require methods for sequence alignment, phylogenetics reconstruction (for functional analysis), elucidation of genome structures, functional analysis of non-coding DNA, expression analysis, and determining genetic variation. (nbic.nl)
  • Its genome has been sequenced but little is known about the occurrence and distribution of small non-coding RNAs in this biotechnologically relevant organism. (nih.gov)
  • Base-calling on the major alone yields accuracy commensurate with single sequence approaches, and joint base-calling provides results for the minor which, while being of lesser quality, incurs no additional cost and can be ultimately used in the genome assembly process. (mit.edu)
  • Increased discrimination at the strain level can be achieved by sequencing, analyzing and comparing highly variable loci (regions) in the organism's genome. (criver.com)
  • Here, for the heritable thyroid traits thyrotropin (TSH) and free thyroxine (FT4), we analyse whole-genome sequence data from the UK10K project (N=2,287). (harvard.edu)
  • Using additional whole-genome sequence and deeply imputed data sets, we report meta-analysis results for common variants (MAF≥1%) associated with TSH and FT4 (N=16,335). (harvard.edu)
  • Manassas, VA - October 1, 2019 - ATCC launched its new ATCC Genome Portal , a publicly available database of reference-quality genome sequences matched to authenticated ATCC biological materials that will help researchers interpret and reproduce their results with confidence. (atcc.org)
  • The portal, which launched with an initial 250 genome sequences of widely used bacterial strains, delivers on ATCC's Enhanced Authentication Initiative , a component of the first of five core pledges under the Incredible 2020 Initiative aimed at increasing reproducibility in biological research. (atcc.org)
  • This problem is exacerbated by the absence of standardized methods for developing and validating reference-quality genome sequences. (atcc.org)
  • Through our Enhanced Authentication Initiative, we have identified the key challenges with existing publicly available data and have developed a solution for improving the quality of reference genome sequences. (atcc.org)
  • Researchers can download high-quality genome sequences for use in bioinformatic analyses, view annotated data, and search for genomes using their own data. (atcc.org)
  • Methylation of the cytosine base in eukaryotic DNA (5mC) is an important epigenetic mark involved in gene silencing and genome stability. (sciencemag.org)
  • We set out to identify the origins of the Árpád Dynasty based on genome sequencing of DNA derived from the skeletal remains of Hungarian King Béla III (1172-1196) and eight additional individuals (six males, two females) originally interred at the Royal Basilica of Székesfehérvár. (nature.com)
  • Nanopore-based methods have come under intense investigation recently due to the promise of inexpensive ultra high-throughput sequencing of DNA, with an entire mammalian sequence being determined at a cost of under $1,000 (goal set forth by the National Human Genome Research Institute located at http://www.genome.gov). (nsti.org)
  • While whole-genome sequencing may capture all possible mutations, whole-exome sequencing remains cost-effective and captures most phenotype-altering mutations. (sigmaaldrich.com)
  • Further characterization is necessary for those isolates that have identical 16S sequences and can be done using SLST or MLST. (criver.com)
  • Robinson K, Schreier H. Isolation, sequence and characterization of the maltose-regulated mlrA gene from the hyperthermophilic archaeum Pyrococcus furiosus. (labome.org)
  • Next-generation sequencing has aided characterization of genomic variation. (sigmaaldrich.com)
  • Automated on the HTG EdgeSeq system, HTG EdgeSeq Immuno-Oncology Assay couples HTG's proprietary nuclease protection chemistry with next-generation sequencing (NGS). (cnbc.com)
  • Our new technology, software, and chemistry overcome this bottleneck and give sequence reads that are typically twice as long as those from previous PyroMark systems. (qiagen.com)
  • p. 934 , published online 26 April) developed a 5hmC sequencing chemistry that selectively oxidizes 5hmC to 5-formylcytosine and then to uracil while leaving 5mC unchanged. (sciencemag.org)
  • Combining synthetic polymers with protein-inspired chemistry and DNA sequences allows the formation of soft gels, held together by DNA base pairing and disulfide links, which in turn allow recognition of DNA or RNA sequences and an amplified response as the gel swells. (nottingham.ac.uk)
  • To date the most reliable method of determining a genetic sequence is through the use of the Sanger chain termination chemistry, however a typical mammalian sequence costs millions of dollars and requires many months for completion. (nsti.org)
  • A Study of Specific Pair Bonding of Nucleic Acid Bases by Ultra-Red Spectroscopy" (in Japanese), Yoshimasa Kyogoku, The Field of Chemistry, vol. 22, No. 4, pp. 364-374 (1968). (freepatentsonline.com)
  • The prior art DNA base sequencing is a wet chemistry technique consisting principally of DNA length separation making use of electrophoresis. (freepatentsonline.com)
  • Visual motion is one of the most important cues for the interpretation of image sequences. (bl.uk)
  • Research interest has naturally focused on the development of techniques that enable arbitrary image sequences to be efficiently decomposed into their constituent layers. (bl.uk)
  • Evaluation of Hybridization Capture Versus Amplicon-Based Methods for Whole-Exome Sequencing. (sigmaaldrich.com)
  • We evaluated two hybridization capture-based and two amplicon-based whole-exome sequencing approaches, utilizing both Illumina and Ion Torrent sequencers, comparing on-target alignment, uniformity, and variant calling. (sigmaaldrich.com)
  • This study illustrates some differences between whole-exome sequencing approaches, highlights the need for selecting appropriate variant calling based on capture method, and will aid laboratories in selecting their preferred approach. (sigmaaldrich.com)
  • MOABS: model based analysis of bisulfite sequencing data. (nih.gov)
  • A. Nandy, "A new graphical representation and analysis of DNA sequence structure: I. Methodology and Application to Globin Genes," Current Science , vol. 66, pp. 309-314, 1994. (hindawi.com)
  • we would like to do some sequence analysis with the students. (bioinformatics.org)
  • We describe a fully automated data analysis pipeline for SHAPE-Seq analysis that includes read processing, mapping, and structural inference based on a model of the experiment. (pnas.org)
  • Our approach is inspired by probabilistic models used in RNA sequencing (RNA-Seq) analysis to measure transcript identity and abundance ( 8 ) and should be easily generalizable to any chemical probing technique that characterizes different aspects of RNA structure. (pnas.org)
  • In this paper, we present Exon, a user-friendly solution containing tools for online analysis of DNA sequences through compression based profiles. (springer.com)
  • Sequence mosaic analysis of aligned sequences identifies nine loci showing evidence for intragenic recombination. (genetics.org)
  • Overall, these data emphasize the artificiality of simple tree structures for representing genomic sequence variation within Pisum and emphasize the need for fine structure haplotype analysis to accurately define the genetic structure of the species. (genetics.org)
  • The analysis of DNA, RNA and protein sequences is traditionally one of the major application areas for bioinformatics tools and methods. (nbic.nl)
  • Is the Subject Area "DNA sequence analysis" applicable to this article? (plos.org)
  • The target genes are PCR amplified using the gene-specific primers and subjected to comparative DNA sequence analysis. (criver.com)
  • Combined with its uniquely low DNA and RNA sample input requirements from Formalin-Fixed Paraffin-Embedded (FFPE) tissues (as little as 10ng extracted nucleic acid per reaction), the Ion Torrent-based sequencing platform and reagents offer comprehensive sequence analysis of a wider variety of tumor samples, including limited or compromised specimens derived from FFPE tissue or fine needle aspirates. (businesswire.com)
  • DNA Baser Assembler is easy to use software for simple and batch DNA sequence assembly, DNA sequence analysis, contig editing, metadata integration and mutation detection. (softpile.com)
  • The real-time, high-resolution sequence output makes the technology highly suitable for applications including complex mutation analysis, microbial identification, and DNA methylation quantification. (qiagen.com)
  • Furthermore, based on restriction enzyme analysis, it was found in 1991 that the region amplified with these primers was somewhat heterogeneous ( 15 ). (asm.org)
  • We have developed a computational tool, rVISTA, for high-throughput discovery of cis-regulatory elements that combines transcription factor binding site prediction and the analysis of inter-species sequence conservation. (unt.edu)
  • The exploitation of orthologous human-mouse data set resulted in the elimination of 95 percent of the 38,000 binding sites predicted upon analysis of the human sequence alone, while it identified 87 percent of the experimentally verified binding sites in this region. (unt.edu)
  • Results from this comparative analysis indicate that the proposed method generally yields a greater number of reliable, unpredictable and random bits than existing techniques under the same conditions and can be practically implemented for DS-SS scheme as a spreading sequence. (igi-global.com)
  • The analysis of a PN sequence includes generation of the sequence, testing its inherent properties and verifying the sequence under some existing criteria. (igi-global.com)
  • Thus, we introduce a pattern-based analysis of random number sequences. (ebscohost.com)
  • This pattern analysis is based on the Damerau-Levenshtein distance, which counts the number of edit operations that are needed to convert one string into another. (ebscohost.com)
  • In conclusion, the pattern-based analysis using the Levenshtein-Damarau distance is both able to predict humanly generated random number sequences and to identify person-specific information within a humanly generated random number sequence. (ebscohost.com)
  • THE genetic diversity of a species is the sum of its total DNA sequence variation, resulting from millions of years of cumulative mutation, recombination, and selection. (genetics.org)
  • Attributes containing sets or sequences of elements appear in various application domains, e.g. in telecommunication and retail databases, multimedia systems, web server logs, genetic and molecular databases, etc. (psu.edu)
  • Here we combined a population genetic mathematical model of CRISPR-virus coevolution with six years of metagenomic sequencing to link the recoverable genomic dynamics of CRISPR loci to the unknown population dynamics of virus and host in natural communities. (nih.gov)
  • The guidances provide recommendations for designing, developing, and validating tests that use the technology, called next generation sequencing (NGS), and will play an important role in the continued advancement of individualized, genetic-based medicine. (fda.gov)
  • The first guidance issued today, " Use of Public Human Genetic Variant Databases to Support Clinical Validity for Genetic and Genomic-Based In Vitro Diagnostics ," describes an approach where test developers may rely on clinical evidence from FDA-recognized public databases to support clinical claims for their tests and help provide assurance of the accurate clinical evaluation of genomic test results. (fda.gov)
  • The second guidance issued today, " Considerations for Design, Development, and Analytical Validation of Next Generation Sequencing (NGS)-Based In Vitro Diagnostics (IVDs) Intended to Aid in the Diagnosis of Suspected Germline Diseases ," provides recommendations for designing, developing, and validating NGS-based tests used to diagnose individuals with suspected genetic diseases. (fda.gov)
  • In 2017, the FDA took several actions to streamline the development and review of a variety of genetic-based tests - authorizing a third-party option for conducting reviews NGS tumor profiling tests and making clearance recommendations to FDA , as well as outlining standardized development criteria for carrier screening tests to allow for their marketing without prior agency review. (fda.gov)
  • In order to access their genetic diversity and perform phylogenetic and demographic analyses, we captured and sequenced ~2,300 Ultra Conserved Elements. (usp.br)
  • Furthermore, the genomic compartment in which the markers reside might affect the diversity pattern seen, and it is possible that markers residing mainly in junk DNA might produce different results from markers based upon genes, which are predominantly euchromatic. (genetics.org)
  • Like our AccuGENX-ID ® methods for identification of bacteria and fungi using the 16S and ITS2 genes, our AccuGENX-ST ® sequence typing uses standard molecular biological methods of DNA extraction, PCR amplification and DNA sequencing of protein coding target genes to characterize your isolates to the strain level. (criver.com)
  • MLST and SLST analyze essential protein coding genes, or housekeeping genes, that encode for proteins necessary for the normal cellular functions of the bacterium all of which contain more variability in their sequences. (criver.com)
  • Both the NGS platform and Oncomine reagents leverage the Ion AmpliSeq technology, which enables simultaneous sequencing of hundreds of genes, with high reproducibility and rapid turnaround time. (businesswire.com)
  • Employing the topological features in the protein interaction network and the sequence properties, we have built a machine learning classifier capable of predicting essential genes . (rsc.org)
  • In this paper, we show that taxonomic designations in Reticulitermes from California (USA) suggested in light of diVerences among CHC phenotypes are corroborated by phylogenetic analyses using mtDNA sequences. (usda.gov)
  • This approach allows a single electrophoresis experiment to process two sequences, using the same quantity of reagents and machine hours as for a single sequence. (mit.edu)
  • Although the genomes of several strains have been sequenced, very little information is available on the gene structure of these bacteria. (nih.gov)
  • If the 16S sequence is different, you can be sure that the isolates are different strains. (criver.com)
  • Since then, sequencing has shown the presence of several mutations in the few available clinical strains compared to the sequence of the type strain M. genitalium G37 ( 13 ). (asm.org)
  • We determined the discriminatory index (DI), i.e., the likelihood that unrelated strains sampled from the test population would be placed into different typing groups ( 10 ), by sequencing specimens from unrelated patients. (asm.org)
  • Agilent׷ amplicon-based technologies for target enrichment and amplification include HaloPlex / HaloPlex HS and SureMASTR. (agilent.com)
  • HaloPlex HS is a high-sensitivity, amplicon-based targeted sequencing method that incorporates molecular barcodes in the DNA library. (agilent.com)
  • Recently, amplicon-based methods were designed to simplify preparation and utilize smaller DNA inputs. (sigmaaldrich.com)
  • All methods identified many of the same single-nucleotide variants, but each amplicon-based method missed variants detected by the other three methods and reported additional variants discordant with all three other technologies. (sigmaaldrich.com)
  • Sequencing of this bisulfite-treated DNA permits the detection of methylation at specific sites. (psu.edu)
  • We introduce oxidative bisulfite sequencing (oxBS-Seq), the first method for quantitative mapping of 5hmC in genomic DNA at single-nucleotide resolution. (sciencemag.org)
  • Published in Journal of Integer Sequences January 8 2007. (emis.de)
  • Sequence census methods reduce molecular measurements such as transcript abundance and protein-nucleic acid interactions to counting problems via DNA sequencing. (pnas.org)
  • New DNA-based materials have been developed which can be programmed to respond to specific nucleic acid sequences, with potential applications in sensing and controlled release. (nottingham.ac.uk)
  • In particular, we examine the possibility of jointly base-calling two superposed DNA sequences by applying the sum-product algorithm on factor graphs. (mit.edu)
  • Bennett Fox, Algorithm 647: Implementation and Relative Efficiency of Quasirandom Sequence Generators, ACM Transactions on Mathematical Software, Volume 12, Number 4, pages 362-376, 1986. (fsu.edu)
  • Applying the particle filter (PF) technique, this paper proposes a PF-based algorithm to blindly demodulate the chaotic direct sequence spread spectrum (CDS-SS) signals under the colored or non-Gaussian noises condition. (mdpi.com)
  • Simulations show that the proposed PF-based algorithm can obtain a good bit-error rate performance when extracting the original binary message from the CDS-SS signals without any knowledge of the transmitter's chaotic map, or initial value, even when colored or non-Gaussian noises exist. (mdpi.com)
  • For music retrieval, the authors use the Smith-Waterman (SW) algorithm to measure the similarity between mood sequences. (igi-global.com)
  • When provided with two sequences from the same subject and one from a different subject, an algorithm identifies the foreign sequence in up to 88% of the cases. (ebscohost.com)
  • The desire to sequence DNA is fueled by the knowledge that the information locked inside of genomes can help fields as varied as molecular medicine, bioarcheology, forensics, and environmental science. (nsti.org)
  • Therefore, much works have focused on designing the DNA sequences to archive a reliable molecular computation and many algorithms have been proposed to obtain a set of good DNA sequences. (actapress.com)
  • For some taxonomic groups, advances in molecular sequencing have made it increasingly possible to observe and examine organisms and ecological communities using DNA-based sequences alone. (gbif.org)
  • Advances in molecular biology in the second half of the 20th century firmly established DNA sequence as the molecular substrate of inheritance ( 1 ). (sciencemag.org)
  • Sequence diversity of 39 dispersed gene loci was analyzed in 48 diverse individuals representative of the genus Pisum. (genetics.org)
  • Metagenomic reconstructions in an acid-mine drainage system document CRISPR loci conserving ancestral immune elements to the base-pair across thousands of microbial generations. (nih.gov)
  • The polyclonal viruses bloom even though they share sequences previously targeted by host CRISPR loci. (nih.gov)
  • Simulations show how increasing random genomic deletions in CRISPR loci purges immunological controls on long-lived viral sequences, allowing polyclonal viruses to bloom and depressing host fitness. (nih.gov)
  • The main building block for UNITE is the 'species hypothesis' (SH), which groups similar sequences into provisional species-level clusters. (gbif.org)
  • The identification of similar sequences in this report is based on clustering as described here . (rcsb.org)
  • In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff. (rcsb.org)
  • We focus on a novel assay utilizing this approach, called s elective 2′- h ydroxyl a cylation analyzed by p rimer e xtension sequencing (SHAPE-Seq), that can be used to characterize RNA secondary and tertiary structure. (pnas.org)
  • Here, we used a sequence-based genotyping approach to characterize worldwide plum germplasm including the potential progenitor Eurasian plum species. (nature.com)
  • This paper describes a new approach of generating suitable recommendations based on the active user's navigation stream. (inria.fr)
  • As disease detection technologies rapidly evolve, so too must the FDA's approach to reviewing these new innovations," said FDA Commissioner Scott Gottlieb, M.D. "The new policies issued today provide a modern and flexible framework to generate data needed to support the FDA's review of NGS-based tests, and give developers new tools to support the efficient development and validation of these technologies. (fda.gov)
  • In this new approach, the bases forming the backbone of the typical DNA molecule are viewed one by one in the act of replicating. (nanotech-now.com)
  • Starting with low-passaged, authenticated ATCC materials and using a standardized next-generation sequencing and hybrid assembly approach, ATCC produced complete reference-quality genomes by combining highly accurate short reads with the scaffolding ability of ultra-long reads. (atcc.org)
  • The approach has led to the definition of more than 73,000 fungal species hypotheses, which together rely on and combine more than half of the system's 817,130 public reference DNA sequences. (gbif.org)
  • Research is now underway to create a vision system for hardwood log inspection using a knowledge-based approach. (usda.gov)
  • To this end, we propose an alternative to the traditional subject domain specific design approach which is based on the use of competence description ontology and learner's competence records. (sciweavers.org)
  • Initial strategies for exome enrichment utilized a hybridization-based capture approach. (sigmaaldrich.com)
  • MRI of acute myocarditis: a comprehensive approach based on various imaging sequences. (biomedsearch.com)
  • A new approach of H.264/AVC deblocking filter based on motion activity in video sequences is proposed. (go.jp)
  • In this approach, a modified deblocking filter is used for low to moderate motion video sequences. (go.jp)
  • The use of logistic map to generate strong cryptographic sequences is novel in approach in terms of its use with a range of transmission techniques for wireless communication because it is easy to conceive and requires simple devices to generate the sequence. (igi-global.com)
  • sequence A090822 in the OEIS) The sequence is similar in definition to the Kolakoski sequence, but instead of counting the longest run of single terms, the sequence counts the longest run of blocks of terms of any length. (wikipedia.org)
  • sequence A124095 in the OEIS). (wikipedia.org)
  • A total of 568 new simple sequence repeat (SSR)-based markers for barley have been developed from a combination of database sequences and small insert genomic libraries enriched for a range of short simple sequence repeats. (genetics.org)
  • This has led to considerable interest in PCR-based markers, in particular those based on simple sequence repeats (SSR). (genetics.org)
  • MOABS detects differential methylation with 10-fold coverage at single-CpG resolution based on a Beta-Binomial hierarchical model and is capable of processing two billion reads in 24 CPU hours. (nih.gov)
  • Dash curves indicate inferred methylation ratio Beta distributions from low (Sample #1) or high sequencing depth (Sample #2). (nih.gov)
  • In this paper,we present a new gait recognition scheme based on multi-view gait sequence fusion. (springer.com)
  • Sugie, Y., Kobayashi, T.: Media-integrated biometric person recognition based on the dempster-shafer theory. (springer.com)
  • Wang Y., Yu S., Wang Y., Tan T. (2005) Gait Recognition Based on Fusion of Multi-view Gait Sequences. (springer.com)
  • Digestion of these substrates with HO in vitro reveals that the minimal recognition site is 18 base pairs long, although several shorter substrates and substrates containing point mutations are cleaved at low levels in vitro. (pnas.org)
  • A 24-base-pair HO recognition site stimulates homologous recombination when present in a region unrelated to MAT. (pnas.org)
  • By combining name-based information from dozens of different authoritative sources like the Catalogue of Life , IRMNG and the World Register of Marine Species (affectionately known as 'WoRMS'), the backbone provides a consistent means of organizing all species-related content on GBIF.org-like datasets, occurrences and species pages-and enables all forms of taxonomic searching, browsing and reporting. (gbif.org)
  • The resulting product is treated with ExoSAP-IT™, prior to sequencing, to degrade the unincorporated primers and hydrolyze the free nucleotides. (thermofisher.com)
  • A comparison between the sequencing results and bioinformatic sRNA predictions using Dynalign and RNAz revealed only a small overlap between the different approaches. (nih.gov)
  • the hybridization-based markers deployed in these studies have genetical and practical disadvantages, particularly in the context of applied agricultural research. (genetics.org)
  • Agilent offers other hybridization-based target enrichment technology options, also, for finding specific regions-of-interest. (agilent.com)
  • Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. (springer.com)
  • Using deep sequencing we analyzed the transcriptome at the end of exponential growth, which corresponds to the onset of secondary metabolism. (nih.gov)
  • Different marker methods can give different views of diversity, depending upon the evolutionary parameters of the underlying DNA sequence variation. (genetics.org)
  • and transposon insertion-based marker methods should lie between these two, reflecting their intermediate mutation rate, although few studies have been carried out to test this. (genetics.org)
  • All this, combined with the limited availability or complete lack of other experimental data, creates a pressing need for novel bioinformatics methods that can infer biological functions and processes directly from sequence-level information. (nbic.nl)
  • The few available non-cluster-based methods only assess broad differences in gene expression between lineages, hence failing to pinpoint the exact types of divergence. (biorxiv.org)
  • We analyze a 680 base pair fragment of the mitochondrial DNA cytochrome oxidase (COII) gene from 45 new (21 collection localities) and two previously recorded samples of Reticulitermes from California using parsimony and maximum likelihood methods. (usda.gov)
  • s methods allows us to construct quaternary PCS/PZCS sets from binary PCS/PZCS sets with sub-sequences of arbitrary length. (aimsciences.org)
  • While the amplicon methods had higher on-target rates, the hybridization capture-based approaches demonstrated better uniformity. (sigmaaldrich.com)
  • and uses ordered sequences as logical and physical structures. (sciweavers.org)
  • We propose novel nano-plasmonic-based structures for rapid sequencing of DNA molecules. (osapublishing.org)
  • Using nanopore, bowtie, and bowtie-nanopore compound structures, probable application of the surface plasmon resonance (SPR) in DNA sequencing is investigated by employing the discrete dipole approximation method. (osapublishing.org)
  • A ) Expression of eight out of twelve new candidate sRNAs could be confirmed by northern blotting whereas the length of the probed RNA corresponded to the calculated length from the sequencing data. (nih.gov)
  • Sequencing of fragments produces data in the form of fragment counts ( X ). Similarly, a control experiment ( Right ) measures natural drop-off (fragments labeled Y ). The model parameters consist of the adduct probabilities (Θ), the Poisson rate for the number of adducts per molecule ( c ), and the drop-off probabilities in the control experiment (Γ). (pnas.org)
  • INSTALLATION See installation instructions: http://code.google.com/p/sequor/wiki/INSTALL USAGE With Sequor you can learn a model from sequences manually annotated with labels, and then apply this model to new data in order to add labels. (haskell.org)
  • In this thesis, we focus on the base-calling stage, during which base order is estimated from data collected through electrophoresis and florescence detection. (mit.edu)
  • All the sequences from each gene target are aligned and compared to the other organisms' sequence data and the level of divergence or conservation between the organisms is calculated and displayed with a phylogenetic tree. (criver.com)
  • We will interpret the data for you and state whether the isolates are indistinguishable by the sequencing of the particular gene targets or whether the isolates are different sequence types. (criver.com)
  • As a first attempt to construct a phylogenetic framework for the genus, data from morphology and nuclear ITS sequences for 53 species and four outgroup taxa were analyzed. (bioone.org)
  • Its main advantages are: fast and selective data access plans, and intelligent combination of such plans, based on a summary of the document paths. (sciweavers.org)
  • Comparison of the sequence data with that of other known actin-capping and severing proteins shows no significant homologies, suggesting that Cap Z may be a member of a unique group of capping, nonsevering proteins. (labome.org)
  • This Ph.D. Dissertation inferred the historical processes that seem to have built the avian community assemblage restricted to the Amazonian floodplains based on their patterns of diversification and geological and climatic data. (usp.br)
  • We evaluate the method on simulated and real datasets from droplet-based and full-length protocols, and show that the flexible inference framework is capable of yielding biological insights through a clear interpretation of the data. (biorxiv.org)
  • Results show that the use of exponential decay weighting schemes when taking into account non contiguous sequences to compute recommendations enhances the accuracy. (inria.fr)
  • We will first identify the isolates by 16S rDNA sequencing. (criver.com)
  • Sequences of isolates from 52 unrelated patients were divided into 29 different sequence types, giving a discriminatory index of 0.95. (asm.org)
  • Deep sequencing-based discovery of the Chlamydia trachomatis transcriptome. (nih.gov)
  • We used deep sequencing to define the transcriptome of purified elementary bodies (EB) and reticulate bodies (RB) of C. trachomatis L2b, respectively. (nih.gov)
  • If you're curious to see how P ROB C ONS performs on nucleotide sequence, try out P ROB C ONS RNA , an experimental version of P ROB C ONS with parameters estimated via unsupervised training on BRAliBASE II ! (stanford.edu)
  • Gabel C, Maier R. Nucleotide sequence of the coxA gene encoding subunit I of cytochrome aa3 of Bradyrhizobium japonicum. (labome.org)
  • Algorithms that use such sequences may have superior convergence. (fsu.edu)
  • The advent of DNA sequencing has revolutionized biological research by providing virtual blueprints of living organisms and offering insights into complicated biochemical processes. (mit.edu)
  • Each species hypothesis is assigned a DOI , establishing a stable, permanent reference for that particular hypothesis (sequences known to derive from organisms already in possession of formally described Linnaean scientific names can, of course, rely on those). (gbif.org)
  • However, it is now clear that inheritance not based on DNA sequence exists in multiple organisms, with examples found in microbes, plants, and invertebrate and vertebrate animals. (sciencemag.org)
  • Yet, it appears that biology is much richer: Many phenomena and mechanisms of nongenetic and/or non-DNA sequence-based inheritance have been described in a range of model organisms, challenging our perception of the well-established relationship between transmitted genotype and phenotype. (sciencemag.org)
  • Examples of non-DNA sequence-based inheritance and/or the inheritance of acquired traits have recently been reviewed elsewhere ( 7 - 11 ) and span many diverse organisms. (sciencemag.org)
  • The mature proteins were 94% identical to each other and 36% identical to the sequences of bacterial L-arginine:inosamine phosphate amidinotransferases. (labome.org)
  • The resulting DNA sequences, or sequence types, are compared to others in a database and the relationships displayed in a phylogenetic tree. (criver.com)
  • We present a phylogenetic hypothesis for 40 species in the bird family Paridae, based on comparisons of nucleotide sequences of the mitochondrial cytochrome- b gene. (bioone.org)
  • 7 ] and determined the phylogenetic origins and closest kinship of the Árpád Dynasty based on shared Y chromosome haplogroup derivation in the context of 40 Eurasian populations. (nature.com)
  • HTG Edge system capabilities have been expanded to fully automate sample and targeted library preparation for next-generation sequencing. (cnbc.com)
  • CARLSBAD, Calif.--( BUSINESS WIRE )-- Thermo Fisher Scientific , the world leader in serving science, has entered into a long-term agreement with Novartis and Pfizer to develop and commercialize a multi-marker, universal next-generation sequencing (NGS) oncology test that will serve as a companion diagnostic (CDx) for non-small cell lung cancer (NSCLC) across multiple drug development programs. (businesswire.com)
  • Developments in next-generation sequencing (NGS) during the past decade have made it possible to economically sequence the mitochondrial and Y chromosomes in large number of individuals [ 12 ]. (nature.com)
  • Our new NEBNext® Ultra™ II FS DNA Library Prep Kit with novel fragmentation reagent meets the dual challenge of generating high quality next gen sequencing libraries from ever-decreasing input amounts AND simple scalability. (neb.com)
  • A ) Length distribution of reads after 5′ end-linker and polyA-tail clipping of four sequenced C. trachomatis cDNA libraries generated from either total RNA or total RNA enriched for primary transcripts of reticulate bodies (RB) or elementary bodies (EB), respectively. (nih.gov)
  • B ) Sequence read distribution of the four cDNA libraries grouped into different classes of RNAs. (nih.gov)
  • Here we report the discovery, characteristics, development, and linkage mapping of 568 new barley SSRs from enriched small insert libraries and from new sequences in the public databases. (genetics.org)
  • In order to use sequence prediction, we need to sequentialize these logical forms. (inria.fr)
  • A typing assay based on a diagnostic mgpB gene PCR was developed, evaluated, and applied directly to urogenital specimens. (asm.org)
  • Forty had the same sequence type in consecutive specimens. (asm.org)
  • Specimens collected from two men were repeatedly positive at intervals of 472 and 1,395 days, respectively, but the sequence types had changed. (asm.org)
  • Seventy-nine M. genitalium -positive specimens from 19 couples were investigated, and all partners initially had concordant sequence types, but one couple had discordant types at one time point before a newly introduced strain took over. (asm.org)
  • But without physical specimens or accepted scientific names, these sequences cannot not be linked to the Linnaean-based nomenclature Codes that set the rules governing the biological classification system. (gbif.org)
  • The detection can be performed by direct sequencing of the cDNA fragments using high-throughput sequencing technology ( 2 ). (pnas.org)
  • The identification of adduct formation can be performed by capillary electrophoresis (SHAPE-CE) or by high-throughput sequencing of cDNA fragments (SHAPE-Seq) ( 2 ) ( Fig. 1 ). (pnas.org)
  • Our technique takes advantage of the atomic force microscope's (AFM) ability to detect piconewton scale forces in order to read off sequencing information based on the interaction of nucleotides with a cyclodextrin. (nsti.org)
  • Obvious reasons for preferential realization of pairing phase 3 are the elevated GC content and the near equi- valent frequencies of base pairing nucleotides (A C25 U, C C25 G) at the third codon site, relative to other sites (Supplementary Table 1). (psu.edu)
  • Shuffling of nucleotides at the third synonymous codon sites which retained nucleotide composi- tion and amino acid sequence of the native mRNAs affected nucleotide base pairing to some extend due to changes in codon context (Table 1). (psu.edu)
  • For building the optimized test schedule, frequency based pseudo damage methodology called Relative Damage Spectrum (RDS) is incorporated.This method enhances the proving ground durability validation process by providing optimized test schedules to prevent redundant vehicle testing. (sae.org)
  • The Cr-based compound structure shows excellent sensitivity and selectivity which can make it a promising methodology for DNA sequencing. (osapublishing.org)
  • In this paper we investigate similarity queries for set and sequence-valued attributes. (psu.edu)
  • We present the notion of a similarity query and we review similarity measures proposed so far for sets and sequences. (psu.edu)
  • We introduce a new similarity measure that can be successfully used with sequences. (psu.edu)
  • However, for music recommendation, user preferences are retrieved from a recent music playlist or user interaction through the interface, which generates a music recommendation list based on the mood sequence similarity. (igi-global.com)
  • Comparative phylogeography of floodplain specialist birds based on sequences of ultra. (usp.br)
  • Humm A, Huber R, Mann K. The amino acid sequences of human and pig L-arginine:glycine amidinotransferase. (labome.org)
  • Can Foldit be used to predict a tertiary structure based on the primary sequence or amino acid sequence? (fold.it)
  • Our sequence-based strain typing can help you map your microbial environment. (criver.com)
  • SeCore® Kits are our latest line of high-resolution HLA typing products based on sequence-based typing-the 'gold standard' of allele identification. (thermofisher.com)
  • The aim of the present study was to document, by DNA-based typing, that M. genitalium is transmissible through sexual contact. (asm.org)
  • Sequencing provides a means of detecting the presence of fungal species in the absence of fruiting bodies. (gbif.org)
  • For sequences known only from environmental samples, this system has the advantage of giving unambiguous identities to species hypotheses. (gbif.org)
  • Based on the Training Sequence (TS), this paper develops three Frequency Domain (FD) channel estimation approaches for diffuse wireless optical channels. (techrepublic.com)
  • For bases b ≤ 5 and exponents e ≥ 2, there exist arbitrarily long finite sequences of d -consecutive e -power b -happy numbers for a specific d = d ( e,b ), which is shown to be minimal possible. (emis.de)
  • Though it is known that each natural number occurs at a finite position within the sequence, it has been conjectured that the sequence may have a finite mean. (wikipedia.org)
  • The DNA sequence of 168 promoter regions (-50 to +10) for Escherichia coli RNA polymerase were compiled. (psu.edu)
  • Our results can be easily extended to other chemical probes of RNA structure, and also generalized to modeling polymerase drop-off in other sequence census-based experiments. (pnas.org)
  • The work has now been published in Biomaterials Science ( http://pubs.rsc.org/en/content/articlelanding/2013/bm/c3bm60126a#!divAbstract ) and presentations on the work by first author, Giovanna Sicilia, have won First Prizes at the UK and Ireland Controlled Release Society and the Macro Group UK Young Researchers' Meeting. (nottingham.ac.uk)
  • InfoSci®-OnDemand Plus, a subscription-based service, provides researchers the ability to access full-text content from over 100,000 peer-reviewed book chapters and 26,000+ scholarly journal articles covering 11 core subjects. (igi-global.com)
  • Shown are relative numbers of groups of sequence length in relation to the total number of reads per library. (nih.gov)
  • Following sequencing, reads are mapped back to the RNA sequence and are classified by their end location. (pnas.org)
  • Sequences that track iterators must derived from _Safe_sequence_base publicly, so that safe iterators (which inherit _Safe_iterator_base ) can attach to them. (ubuntu.com)
  • The original code can only compute the "next" element of the sequence. (fsu.edu)
  • This work examines the neural bases for holding time intervals in working memory and the effect of changing the amount of information in these sequences determined by the temporal variability and number of intervals. (frontiersin.org)
  • This allowed us to examine the effects of the variability and number of intervals in the sequence on the precision (reciprocal of standard deviation) for probed interval reproduction ( Teki and Griffiths, 2014 ). (frontiersin.org)
  • The present study sought to address the neural bases for the core working memory resource, determined by both temporal variability and number of intervals. (frontiersin.org)
  • The Sequence Based Recommender we propose is inspired from Language Modeling and integrates skipping techniques. (inria.fr)
  • Today, genetics is usually and appropriately equated with DNA sequence-based mechanisms. (sciencemag.org)