Basal Metabolism: Heat production, or its measurement, of an organism at the lowest level of cell chemistry in an inactive, awake, fasting state. It may be determined directly by means of a calorimeter or indirectly by calculating the heat production from an analysis of the end products of oxidation within the organism or from the amount of oxygen utilized.Energy Metabolism: The chemical reactions involved in the production and utilization of various forms of energy in cells.Oxygen Consumption: The rate at which oxygen is used by a tissue; microliters of oxygen STPD used per milligram of tissue per hour; the rate at which oxygen enters the blood from alveolar gas, equal in the steady state to the consumption of oxygen by tissue metabolism throughout the body. (Stedman, 25th ed, p346)Myocardial Contraction: Contractile activity of the MYOCARDIUM.Lipid Metabolism: Physiological processes in biosynthesis (anabolism) and degradation (catabolism) of LIPIDS.1-Phosphatidylinositol 4-Kinase: An enzyme that catalyzes the conversion of phosphatidylinositol (PHOSPHATIDYLINOSITOLS) to phosphatidylinositol 4-phosphate, the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate.Plants, Genetically Modified: PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.Starch: Any of a group of polysaccharides of the general formula (C6-H10-O5)n, composed of a long-chain polymer of glucose in the form of amylose and amylopectin. It is the chief storage form of energy reserve (carbohydrates) in plants.Inositol 1,4,5-Trisphosphate: Intracellular messenger formed by the action of phospholipase C on phosphatidylinositol 4,5-bisphosphate, which is one of the phospholipids that make up the cell membrane. Inositol 1,4,5-trisphosphate is released into the cytoplasm where it releases calcium ions from internal stores within the cell's endoplasmic reticulum. These calcium ions stimulate the activity of B kinase or calmodulin.Plant Leaves: Expanded structures, usually green, of vascular plants, characteristically consisting of a bladelike expansion attached to a stem, and functioning as the principal organ of photosynthesis and transpiration. (American Heritage Dictionary, 2d ed)Phosphatidylinositol 3-Kinases: Phosphotransferases that catalyzes the conversion of 1-phosphatidylinositol to 1-phosphatidylinositol 3-phosphate. Many members of this enzyme class are involved in RECEPTOR MEDIATED SIGNAL TRANSDUCTION and regulation of vesicular transport with the cell. Phosphatidylinositol 3-Kinases have been classified both according to their substrate specificity and their mode of action within the cell.Anthocyanins: A group of FLAVONOIDS derived from FLAVONOLS, which lack the ketone oxygen at the 4-position. They are glycosylated versions of cyanidin, pelargonidin or delphinidin. The conjugated bonds result in blue, red, and purple colors in flowers of plants.Ammonia: A colorless alkaline gas. It is formed in the body during decomposition of organic materials during a large number of metabolically important reactions. Note that the aqueous form of ammonia is referred to as AMMONIUM HYDROXIDE.Glutamate-Ammonia Ligase: An enzyme that catalyzes the conversion of ATP, L-glutamate, and NH3 to ADP, orthophosphate, and L-glutamine. It also acts more slowly on 4-methylene-L-glutamate. (From Enzyme Nomenclature, 1992) EC 6.3.1.2.Acidosis: A pathologic condition of acid accumulation or depletion of base in the body. The two main types are RESPIRATORY ACIDOSIS and metabolic acidosis, due to metabolic acid build up.Glutamine: A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.Kidney Tubules, Proximal: The renal tubule portion that extends from the BOWMAN CAPSULE in the KIDNEY CORTEX into the KIDNEY MEDULLA. The proximal tubule consists of a convoluted proximal segment in the cortex, and a distal straight segment descending into the medulla where it forms the U-shaped LOOP OF HENLE.Acid-Base Equilibrium: The balance between acids and bases in the BODY FLUIDS. The pH (HYDROGEN-ION CONCENTRATION) of the arterial BLOOD provides an index for the total body acid-base balance.GlutaminaseElectrogalvanism, Intraoral: Chemical reaction that occurs when saliva comes into contact with the metals in dental fillings. This reaction can send electric currents through the brain causing negative symptoms.Dental Prosthesis: An artificial replacement for one or more natural teeth or part of a tooth, or associated structures, ranging from a portion of a tooth to a complete denture. The dental prosthesis is used for cosmetic or functional reasons, or both. DENTURES and specific types of dentures are also available. (From Boucher's Clinical Dental Terminology, 4th ed, p244 & Jablonski, Dictionary of Dentistry, 1992, p643)Magnetic Field Therapy: The magnetic stimulation of specific target tissues or areas of the body for therapeutic purposes via the application of magnetic fields generated by MAGNETS or ELECTROMAGNETS.Potentiometry: Solution titration in which the end point is read from the electrode-potential variations with the concentrations of potential determining ions. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Membrane Potentials: The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).Electromagnetic Fields: Fields representing the joint interplay of electric and magnetic forces.Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Osmosis: Tendency of fluids (e.g., water) to move from the less concentrated to the more concentrated side of a semipermeable membrane.Thermometry: Measurement of the temperature of a material, or of the body or an organ by various temperature sensing devices which measure changes in properties of the material that vary with temperature, such as ELASTICITY; MAGNETIC FIELDS; or LUMINESCENCE.MedlinePlus: NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.Toxoplasma: A genus of protozoa parasitic to birds and mammals. T. gondii is one of the most common infectious pathogenic animal parasites of man.Toxoplasmosis, Animal: Acquired infection of non-human animals by organisms of the genus TOXOPLASMA.Hemorrhoids: Swollen veins in the lower part of the RECTUM or ANUS. Hemorrhoids can be inside the anus (internal), under the skin around the anus (external), or protruding from inside to outside of the anus. People with hemorrhoids may or may not exhibit symptoms which include bleeding, itching, and pain.Rubber: A high-molecular-weight polymeric elastomer derived from the milk juice (LATEX) of HEVEA brasiliensis and other trees and plants. It is a substance that can be stretched at room temperature to at least twice its original length and after releasing the stress, retract rapidly, and recover its original dimensions fully.Scrotum: A cutaneous pouch of skin containing the testicles and spermatic cords.Burial: The act or ceremony of putting a corpse into the ground or a vault, or into the sea; or the inurnment of CREMAINS.Terminology as Topic: The terms, expressions, designations, or symbols used in a particular science, discipline, or specialized subject area.Light Coagulation: The coagulation of tissue by an intense beam of light, including laser (LASER COAGULATION). In the eye it is used in the treatment of retinal detachments, retinal holes, aneurysms, hemorrhages, and malignant and benign neoplasms. (Dictionary of Visual Science, 3d ed)Dictionaries as Topic: Lists of words, usually in alphabetical order, giving information about form, pronunciation, etymology, grammar, and meaning.Ichthyosis: Any of several generalized skin disorders characterized by dryness, roughness, and scaliness, due to hypertrophy of the stratum corneum epidermis. Most are genetic, but some are acquired, developing in association with other systemic disease or genetic syndrome.Ichthyosis, Lamellar: A chronic, congenital ichthyosis inherited as an autosomal recessive trait. Infants are usually born encased in a collodion membrane which sheds within a few weeks. Scaling is generalized and marked with grayish-brown quadrilateral scales, adherent at their centers and free at the edges. In some cases, scales are so thick that they resemble armored plate.Ichthyosis Vulgaris: Most common form of ICHTHYOSIS characterized by prominent scaling especially on the exterior surfaces of the extremities. It is inherited as an autosomal dominant trait.Ichthyosis, X-Linked: Chronic form of ichthyosis that is inherited as a sex-linked recessive trait carried on the X-chromosome and transmitted to the male offspring. It is characterized by severe scaling, especially on the extremities, and is associated with steroid sulfatase deficiency.American Medical Association: Professional society representing the field of medicine.Ichthyosiform Erythroderma, Congenital: Designation for several severe forms of ichthyosis, present at birth, that are characterized by hyperkeratotic scaling. Infants may be born encased in a collodion membrane which begins shedding within 24 hours. This is followed in about two weeks by persistent generalized scaling. The forms include bullous (HYPERKERATOSIS, EPIDERMOLYTIC), non-bullous (ICHTHYOSIS, LAMELLAR), wet type, and dry type.BooksWeight Loss: Decrease in existing BODY WEIGHT.Dietary Fiber: The remnants of plant cell walls that are resistant to digestion by the alimentary enzymes of man. It comprises various polysaccharides and lignins.Diet, Reducing: A diet designed to cause an individual to lose weight.Food Analysis: Measurement and evaluation of the components of substances to be taken as FOOD.Body Weight: The mass or quantity of heaviness of an individual. It is expressed by units of pounds or kilograms.Coriolis Force: The apparent deflection (Coriolis acceleration) of a body in motion with respect to the earth, as seen by an observer on the earth, attributed to a fictitious force (Coriolis force) but actually caused by the rotation of the earth. In a medical context it refers to the physiological effects (nausea, vertigo, dizziness, etc.) felt by a person moving radially in a rotating system, as a rotating space station. (From Random House Unabridged Dictionary, 2d ed & McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Hydrodynamics: The motion of fluids, especially noncompressible liquids, under the influence of internal and external forces.Water: A clear, odorless, tasteless liquid that is essential for most animal and plant life and is an excellent solvent for many substances. The chemical formula is hydrogen oxide (H2O). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Gravity, Altered: A change in, or manipulation of, gravitational force. This may be a natural or artificial effect.Water Quality: A rating of a body of water based on measurable physical, chemical, and biological characteristics.Rivers: Large natural streams of FRESH WATER formed by converging tributaries and which empty into a body of water (lake or ocean).Air Movements: The motion of air currents.

Bioelectrical impedance plethysmographic analysis of body composition in critically injured and healthy subjects. (1/1143)

BACKGROUND: Determination of body composition during critical illness is complex because of various patient-related and technical factors. Bioelectrical impedance is a promising technique for the analysis of body composition; however, its clinical utility in critically injured patients is unknown. OBJECTIVE: The purpose of this study was to compare bioelectrical impedance with metabolic activity in healthy and critically injured patients. If bioelectrical impedance accurately determines body composition during critical illness, the slope between body-composition variables and oxygen consumption would be the same in critically injured and healthy subjects. DESIGN: There is a strong linear relation between body composition and metabolic activity. In the present study, body composition (fat-free mass and body cell mass) was determined by using bioelectrical impedance and resting metabolic activity (metabolic rate and oxygen consumption) by using gas exchange analysis in a group of healthy and critically injured subjects. The relation between these variables was compared by using linear regression to a similar relation established by hydrostatic weighing in a large historical control group. RESULTS: The slope of the line relating fat-free mass to resting metabolic rate was the same in the healthy and critically ill groups (P = 0.62) and each was similar to the slope of the line for the control group. However, in 37% of the critically injured group, overhydration contributed to an increase in fat-free mass, disturbing the relation with resting metabolic rate. The slope of the line relating body cell mass to oxygen consumption in our healthy and critically ill groups was almost identical. CONCLUSION: These results support the use of bioelectrical impedance to determine body cell mass in healthy and critically ill subjects.  (+info)

Comparison of indirect calorimetry, the Fick method, and prediction equations in estimating the energy requirements of critically ill patients. (2/1143)

BACKGROUND: Accurate measurement of resting energy expenditure (REE) is helpful in determining the energy needs of critically ill patients requiring nutritional support. Currently, the most accurate clinical tool used to measure REE is indirect calorimetry, which is expensive, requires trained personnel, and has significant error at higher inspired oxygen concentrations. OBJECTIVE: The purpose of this study was to compare REE measured by indirect calorimetry with REE calculated by using the Fick method and prediction equations by Harris-Benedict, Ireton-Jones, Fusco, and Frankenfield. DESIGN: REEs of 36 patients [12 men and 24 women, mean age 58+/-22 y and mean Acute Physiology and Chronic Health Evaluation II score 22+/-8] in a hospital intensive care unit and receiving mechanical ventilation and total parenteral nutrition (TPN) were measured for > or = 15 min by using indirect calorimetry and compared with REEs calculated from a mean of 2 sets of hemodynamic measurements taken during the metabolic testing period with an oximetric pulmonary artery catheter. RESULTS: Mean REE by indirect calorimetry was 8381+/-1940 kJ/d and correlated poorly with the other methods tested (r = 0.057-0.154). This correlation did not improve after adjusting for changes in respiratory quotient (r2 = 0.28). CONCLUSIONS: These data do not support previous findings showing a strong correlation between REE determined by the Fick method and other prediction equations and indirect calorimetry. In critically ill patients receiving TPN, indirect calorimetry, if available, remains the most appropriate clinical tool for accurate measurement of REE.  (+info)

Anthropometric, lifestyle and metabolic determinants of resting heart rate. A population study. (3/1143)

AIM: To clarify the determinants of resting heart rate at the population level in a random sample of the Belgian population. METHODS AND RESULTS: Data of 5027 men and 4150 women aged 25-74 years obtained from a Belgian nationwide survey were analysed. In multivariate analysis, blood pressure strongly correlated with heart rate in men (t = 12.4 for systolic; t = 8.8 for diastolic) and women (t = 12.0 for systolic; t = 7.7 for diastolic). Age (t = -3.4 in men; t = -8.1 in women) and height (t = -3.7 in men; t = -3.1 in women) correlated negatively with heart rate. Smoking raised heart rate in men (1-19 cigarettes.day-1, t = 6.1; > or = 20 cigarettes.day-1, t = 10.3) and women (> or = 20 cigarettes.day-1, t = 3.5). Serum phosphorus correlated negatively with heart rate (t = -3.5 in men; t = -8.3 in women). Serum log alkaline phosphatase (t = 6.7 in men; t = 7.2 in women) and serum protein (t = 5.3 in men; t = 4.4 in women) correlated positively with heart rate. CONCLUSION: At the population level, blood pressure, cigarette smoking, serum alkaline phosphatase and serum protein correlate independently, significantly and positively with heart rate, and age, height and serum phosphorus negatively.  (+info)

Longitudinal assessment of energy balance in well-nourished, pregnant women. (4/1143)

BACKGROUND: Clinicians often recommend an additional energy intake of 1250 kJ/d to their pregnant patients. Previous studies have shown considerable variation in the metabolic response to pregnancy and thus in the additional energy required to support a pregnancy. OBJECTIVE: The purpose of this study was to assess how well-nourished women meet the energy demands of pregnancy and to identify factors that predict an individual's metabolic response. DESIGN: Resting metabolic rate (RMR), diet-induced thermogenesis (DIT), total energy expenditure (TEE), activity energy expenditure (AEE), energy intake (EI), and body fat mass (FM) were measured longitudinally in 10 women preconception; at 8-10, 24-26, and 34-36 wk of gestation; and 4-6 wk postpartum. RESULTS: Compared with preconception values, individual RMRs increased from 456 to 3389 kJ/d by late pregnancy. DIT varied from -266 to 110 kJ/meal, TEE from -105 to 3421 kJ/d, AEE from -2301 to 2929 kJ/d, EI from -259 to 2176 kJ/d, and FM from a 0.6-kg loss to a 10.6-kg gain. The only prepregnant factor that predicted FM gain was RMR (r = 0.65, P < 0.05). Women with the largest cumulative increase in RMR deposited the least FM (r = -0.64, P < 0.05). CONCLUSIONS: Well-nourished women use different strategies to meet the energy demands of pregnancy, including reductions in DIT or AEE, increases in EI, and deposition of less FM than anticipated. The combination of strategies used by individual women is not wholly predictable from prepregnant indexes. The use of a single recommendation for increased energy intake in all pregnant women is not justified.  (+info)

Energy and substrate metabolism in patients with active Crohn's disease. (5/1143)

The aim of the study was to evaluate the possible contribution of changes in energy metabolism and substrate oxidation rates to malnutrition in Crohn's disease and to assess the effect of enteral nutrition on these parameters. Energy metabolism was evaluated by indirect calorimetry in 32 patients with active Crohn's disease and 19 age- and sex-matched healthy individuals. Measurements were done in the postabsorptive state. Seven out of 32 patients received enteral nutrition via a nasogastric tube. In these patients, resting energy metabolism was determined at d 0 (postabsorptive), 7, 14 (during full enteral nutrition) and 15 (postabsorptive). Resting energy expenditure was not significantly different between patients and controls, whereas the respiratory quotient (RQ) was lower in patients (0.78 +/- 0.05 vs. 0.86 +/- 0.05; P < 0.05). During enteral nutrition in 7 patients with Crohn's disease, the RQ increased on d 7 compared with d 0 and remained high even after cessation of enteral nutrition (d 0, 0.78 +/- 0.03; d 7, 0.91 +/- 0.04; d 15, 0. 84 +/- 0.05; P < 0.05; d 7 and 15 vs. d 0). No effects of enteral nutrition on resting energy expenditure were found. Active Crohn's disease is associated with changes in substrate metabolism that resemble a starvation pattern. These changes appear not to be specific to Crohn's disease but to malnutrition and are readily reversed by enteral nutrition. Enteral nutrition did not affect resting energy expenditure. Wasting is a consequence of malnutrition but not of hypermetabolism in Crohn's disease.  (+info)

Direct and correlated responses to selection for efficiency of lean gain in mice. (6/1143)

Improvement in feed efficiency when selection is based on gain:feed ratio has often been accompanied by a reduction in feed intake. The following four criteria were used in mass selection for improved lean gain efficiency in mice with an objective of evaluating changes in lean gain and intake: 1) gain deviation, animals selected had the greatest gain in fat-free mass (FFM) after adjustment to a constant intake; 2) intake deviation, mice selected had the least feed intake after adjustment to a constant gain in FFM; 3) intrinsic efficiency, similar to the second criterion except that adjustment was also made for average weight maintained during the period; and 4) a positive control that used the ratio of gain in FFM: feed intake as the selection criterion. A fifth line, in which a male and a female were selected at random from each litter, served as a negative control. Experimental animals were outbred mice of the CF1 strain. Two replicates of the five lines were included in the study. Twelve males and females were pair-mated within each line-replicate combination each generation. Feed disappearance was measured from 25 to 42 d. Mice were scanned to obtain an electrical conductivity measurement for prediction of FFM. After six generations of selection, realized heritabilities for gain:feed, gain deviation, intake deviation, and intrinsic efficiency were .00 +/- .04, .04 +/- .29, .35 +/- .08, and .28 +/- .06, respectively. There were no differences among lines for gain:feed ratio. The correlated response in feed intake reduction was significant in the intake deviation and intrinsic efficiency lines (-.17 +/- .05 and -.21 +/- .04 g x d(-1) x generation(-1), respectively). The realized genetic correlations between the ratio and gain deviation, intake deviation, and intrinsic efficiency were .83 +/- .15, .01 +/- .04, and .21 +/- .12, respectively. Litter size was depressed in all selected lines.  (+info)

Endogenous thermoregulatory rhythms of squirrel monkeys in thermoneutrality and cold. (7/1143)

Whole body heat production (HP) and heat loss (HL) were examined to determine if the free-running circadian rhythm in body temperature (Tb) results from coordinated changes in HP and HL rhythms in thermoneutrality (27 degrees C) as well as mild cold (17 degrees C). Squirrel monkey metabolism (n = 6) was monitored by both indirect and direct calorimetry, with telemetered measurement of Tb and activity. Feeding was also measured. Rhythms of HP, HL, and conductance were tightly coupled with the circadian Tb rhythm at both ambient temperatures (TA). At 17 degrees C, increased HP compensated for higher HL at all phases of the Tb rhythm, resulting in only minor changes to Tb. Parallel compensatory changes of HP and HL were seen at all rhythm phases at both TA. Similar time courses of Tb, HP, and HL in their respective rhythms and the relative stability of Tb during both active and rest periods suggest action of the circadian timing system on Tb set point.  (+info)

The value of basal serum follicle stimulating hormone, luteinizing hormone and oestradiol concentrations following pituitary down-regulation in predicting ovarian response to stimulation with highly purified follicle stimulating hormone. (8/1143)

The value of gonadotrophin and oestradiol concentrations following pituitary down-regulation with leuprolide acetate in predicting ovarian response to stimulation was evaluated in three groups of women undergoing ovarian stimulation for in-vitro fertilization with highly purified follicle stimulating hormone (FSH). Leuprolide acetate was started in the midluteal phase, and either stopped at menses (IVF-SL group, n = 3), or continued throughout stimulation (IVF-LL group, n = 38; oocyte donors, n = 58). Ovarian stimulation was started on cycle day 3, after blood was drawn for down-regulated FSH, luteinizing hormone (LH) and oestradiol. Higher down-regulated LH was predictive of higher oestradiol on day 5 of stimulation in both IVF groups, and of need for fewer ampoules in the IVF-LL group, but not of oestradiol on day of human chorionic gonadotrophin (HCG) administration or number of oocytes retrieved. Higher FSH after down-regulation predicted yield of fewer oocytes in the donor and IVF-LL groups, and higher oestradiol on day 5 of stimulation, need for fewer ampoules and a shorter duration of therapy in both IVF groups. Higher oestradiol after down-regulation was associated with higher oestradiol on day 5 of stimulation and on day of HCG administration, a shorter duration of therapy and need for fewer ampoules in all groups. Whereas these results do not ascribe any predictive significance to LH, they suggest that oestradiol and FSH concentrations after down-regulation are predictive of the pattern of ovarian response to stimulation and of oocyte yield.  (+info)

Twelve girls who trained in rowing were examined twice a year for 4 years. Their initial age was 11.7 ± (SD) 0.2 yrs. Control groups consisted of 13 girls age 11.5±0.3 yrs and 18 girls age 14.4±0.3 yrs examined simultaneously with trained girls in the first and last year of the study, respectively. The examination involved basic anthropometry, estimation of sexual maturation (Tanner scale), 2-day food records, measurements of resting metabolic rate, energy expenditure following glucose ingestion (50 g), and determinations of blood glucose and plasma insulin concentrations prior to and 2 hrs after glucose load. Body mass, height, and fat content were slightly greater in trained girls. None of the subjects reported disturbances in menstrual function, and the age of menarche was similar for all. Both trained and untrained girls reported similar daily energy intake closer to the lower limit or slightly below the estimates of energy requirements for adolescents. Resting metabolic rate calculated ...
BMR Calculator is a Windows software program designed to calculate your Basal Metabolic Rate the amount of calories required to sustain life in your body when at rest Both health care professionals like dietitians and their patients who
Our metabolic rates are definitely not compatible - in the sense that photosynthesis would never b able to supply enough glucose for our high metabolic rate. But thats exactly the catch: with our high metabolic rate, hemoglobin and accessory systems needs to move a lot more CO2 from the body to the lungs than it would require to move from the lungs to the photosynthetic organs(and the same goes for oxygen). No, i think that just because we have evolved to have such a high metabolic rate moving the gases would not be a problem ...
A fundamental but unanswered biological question asks how much energy, on average, Earths different life forms spend per unit mass per unit time to remain alive. Here, using the largest database to date, for 3,006 species that includes most of the range of biological diversity on the planet - from bacteria to elephants, and algae to sapling trees - we show that metabolism displays a striking degree of homeostasis across all of life. We demonstrate that, despite the enormous biochemical, physiological, and ecological differences between the surveyed species that vary over 1020-fold in body mass, mean metabolic rates of major taxonomic groups displayed at physiological rest converge on a narrow range from 0.3 to 9 W kg-1. This 30-fold variation among lifes disparate forms represents a remarkably small range compared with the 4,000- to 65,000-fold difference between the mean metabolic rates of the smallest and largest organisms that would be observed if life as a whole conformed to universal ...
Introduction Basal metabolic rate (BMR) is defined as the minimum energy consumption needed to sustain all cellular functions and is responsible for 60 to 70% of humans daily energy expenditure(1). It therefore represents the principal component of total energy consumption(2), particularly when one is determining the day the energy needs of inactive people(3). In 1951, Quenouille et al proposed to the World Health Organization (WHO) the hypothesis that BMR could be useful for estimating the energy requirements of population groups and that BMR could be multiplied by factors representing different levels of physical activity(4). In 1985, the WHO(5) proposed new equations in response to the impossibility of measuring BMR by direct calorimetry. These equations originated from a review of studies analyzed by Schofield(6), including approximately 11,000 BMR measurements taken using indirect calorimetry. However, several studies demonstrated that those equations overestimated BMR when used with ...
International Scholarly Research Notices is a peer-reviewed, Open Access journal covering a wide range of subjects in science, technology, and medicine. The journals Editorial Board as well as its Table of Contents are divided into 108 subject areas that are covered within the journals scope.
Any parent that takes their kid out for a walk knows that children tire more quickly than adults, but why is that? Do kids and small adults walk differently from taller people or do they tire faster for some other reason? Peter Weyand from Southern Methodist University, USA, is fascinated by the effect that body size has on physiological function. This goes back to Max Kleibers work on resting metabolic rates for different sized animals. He found that the bigger you are the slower each gram of tissue uses energy, explains Weyand, who adds, Its interesting to know how and why metabolism is regulated that way. Intrigued by the question of why smaller people use more energy per kilogram body mass than larger individuals when walking, Weyand teamed up with Maurice Puyau and Nancy Butte, from the USDA/ARS Childrens Nutrition Research Center at Baylor College of Medicine, and undergraduate Bethany Smith. Together they decided to measure the metabolic rates of children and adults, ranging from 5 ...
High metabolic rates are associated normally with small differences of electric potential, whereas low metabolic rates are associated with large differences of electric potential as measured on the extremities of the body.. Within the normal range of metabolism there appears to be a definite correlation between the metabolic rates and the difference of electric potential over a specified area of the skin, provided the person under test has no abnormalities of the circulatory system or of the functions of the skin.. If there are no dysfunctions of the circulation or of the skin, the metabolic rate may be calculated, within ±4 points, from the expression. See PDF for Equation. where x is the metabolic rate and y is the difference of electric potential across the specified areas of skin (electrodes 12 cm. apart).. In general, there are abnormalities of the circulation of the blood or of the functions of the skin of persons for whom the metabolic rates determined by the two methods (difference of ...
A: The study was actually designed to find out why individuals do not lose weight, especially because they are burning more calories. The study examined all possibilities using a rigorous mathematical approach. The study established that vigorous exercise did result in increased food consumption. The study also determined that metabolism slowed during vigorous exercise if intake remained unchanged. Additionally, the study also established that lean (muscle) mass decreased less during aerobic exercise in comparison to diet restriction. We found that a larger fraction of weight gained (if one gained weight) during exercise is gained as lean mass. That is, if you lose weight through exercise, you lose mostly fat mass, and if you gain weight during exercise, you gain mostly lean mass. This is good news for all of us who want to lose fat.. 1. Martin, C.K., et al., Effect of calorie restriction on resting metabolic rate and spontaneous physical activity. Obesity (Silver Spring), 2007. 15(12): p. ...
Learn you Basal Metabolic Rate (BMR) - Calculate your RMR here, BMR calculator will tell you how many calories (kilojoules) you burn in a day.
... are the best indicators of success for a person who is struggling to lose weight. This offers proof of your success in easily measurable terms.
Your BMR (basal metabolic rate) is the rate at which you expend calories while resting. This rate assumes youre resting at room temperature during the post-absorptive stage of digestion, meaning ...
Dear Fatty and Skinny,. It seems that men are bombarded with messages about being muscular, lean, and ripped. Before you start to make some changes, consider doing a little self-exploration. Do you recognize that body size, shape, muscularity, or weight do not determine your identity as a man? Do you know men who have lots of muscles, yet who are not happy? Whats your level of awarness related to the idea that who you are is more than just your body? If you are truly interested in making some changes, consider working toward accepting your current appearance first and know that making changes to your weight in either direction takes considerable energy. If you are interested in adding muscle, you can anticipate that it will take effort, time, and a focused plan.. Your assumption about metabolism playing a role is correct. A persons basal metabolism represents the minimum energy expended to keep a resting, awake, body alive. The energy used in basal metabolism depends primarily on lean body ...
Basal Metabolic Rate of 1,373 means that your body will burn 1,373 calories each day if you engage in no activity for the entire day.
Basal Metabolic Rate of 1,808 means that your body will burn 1,808 calories each day if you engage in no activity for the entire day.
Losing weight is not easy and resting metabolic rate is easy to blame. Products abound that claim to boost the bodys natural ability to burn...
Resting Metabolic Rate Calculator - This is the amount of energy expended (spent) while at rest for Java Free Download in Calculators Tag
Use the basal metabolic rate calculator to find out how many calories or kilojoules your body needs at rest. Input your height, weight, age and gender to find out.
This investigation evaluated the effects of nanoparticles of silver (AgNano) and gold (AuNano) on metabolic rate (O(2) consumption, CO(2) production and heat production-HP) and the development of embryos from different breeds of broiler and layer chicken. Gaseous exchange was measured in an open-air-circuit respiration unit, and HP was calculated for 10, 13, 16 and 19-day-old embryos. Relative chick and muscle weights were used as a measure of growth rate and development. AgNano but not AuNano increased the rates of O(2) consumption and HP of the layer embryos. The metabolic rate of broiler embryos was not affected by either of the treatments, but it was significantly higher compared to the layer embryos. Neither of the nanoparticles promoted nor depressed growth and development of the embryos, irrespective of breed. Although the metabolic rate of AgNano-injected layer embryos was significantly increased, their BW and muscle weights at hatching were similar to those of the control group, which suggests
FYI-Resting Metabolic Rate (RMR) & Basal Metabolic Rate (BMR): It is important to have an assessment of your RMR/BMR caloric requirements for daily living and your TDEE (Total Daily Energy Expenditure) for each day. This information would be used to create a nutrition plan. In combination with a strength and conditioning program you will be able to maximize your body fat reduction or lean muscle gain efforts ...
Your Basal Metabolic Rate (BMR) is the number of calories your body burns while sleeping. Many factors can affect your BMR, including your age, health, stress level, and even the temperature of your environment. Your BMR, like all of your metabolic elements, decreases as you age. This means that it is harder for your body to burn calories and harder for you to lose fat the older you get. Increases in BMR are possible but this increase comes about through the actions of the next three components.. Your Resting Metabolic Rate (RMR) is a measure of the amount of calories / kilojoules your body burns at rest just to maintain it. The RMR accounts for 50-80 per cent of the energy we use doing nothing whilst being awake.. In reality even when lazing around or just chilling out watching DVDs our bodys metabolism is still active. The total lean mass of our body, especially muscle mass, is largely responsible for the RMR.. So, anything that reduces your lean mass will reduce your RMR. RMR is the ...
Sedentary living. // Healthy Weight Journal;Mar/Apr97, Vol. 11 Issue 2, p26 Presents the results of a Tufts University, Massachusetts study on the impact of reducing sedentary behavior on obesity in children. Ratio of total daily energy expenditure to resting metabolic rate measurement; Reasons why reducing sedentary behavior is more effective than engaging in exercise... ...
How much do you know about metabolic syndrome?. It is often mistaken for diabetes, but the truth is, metabolic syndrome is a cluster of conditions - including increased blood pressure, high blood sugar, excess body fat around the waist, and abnormal cholesterol. When these occur together, your risk of heart disease, stroke and diabetes is increased.. Determining whether or not a patient has metabolic syndrome is a complex process, with basic measurements including height and weight, as well as tests for insulin, leptin (a hunger-suppressing hormone) and adiponectin (a hormone inversely related to dangerous internal fat) factoring in to a comprehensive scientific investigation.. The first step in this investigation is often a test for Basal Metabolic Rate (BMR), which is the rate at which the body consumes calories for basic bodily processes - eg. maintaining internal temperature, repairing cells, pumping blood and powering muscles.. With the results of your Basal Metabolic Rate at hand, the ...
So several studies have pointed to this effect of adaptive thermogenesis, some of which is expected. But found a nice recent one that covered several effects at once nicely.. First, the totally expected part. Ill try not to use the term metabolism as an all day type thing including all activities when that is really TDEE. Metabolism is mainly the lower level functions, some base and required though can be slowed down, some higher level functions like cell replacement for skin, hair, nail, muscle growth which can really be slowed down or skipped, and even higher level stuff like processing foods which probably shouldnt be considered metabolism normally, but some do (kick start your metabolism by eating breakfast misunderstanding).. Your TDEE is composed of your BMR (Basal metabolism) + NEAT (Non-Exercise activity) + TEF (energy burned processing food eaten) + EAT (Exercise activity).. If you eat less, your TEF burn (usually about 10% of what you eat) goes down, so TDEE goes down. So eating ...
The impact hormones have on the body is great and so is the impact the food we eat on our hormones. Zane Bokmeldere, one of the Team Monster Ambassadors has gone into great depths about this topic to help explain why you must understand this. Once you do, fat loss becomes much easier!Its not just about calorie counting:The Thermic effect of food in fat loss is very important!Studies show that its not the calories but macro content that dictates body composition. There is one caveat; you can eat yourself out of any exercise regime. But a lot of your form is down to the types of calories you utilise. By eating more protein in a diet, more of the energy was turned into lean mass and increased your resting metabolism (basal metabolic rate or BMR) by 11% and diets low in protein and high in carbs showed a decrease in BMR by 2% compounded by muscle loss. Researchers estimate that 90% of energy consumed on high carb/low protein diet was turned into fat. High protein/ high fat and low carb diet will give you
The impact hormones have on the body is great and so is the impact the food we eat on our hormones. Zane Bokmeldere, one of the Team Monster Ambassadors has gone into great depths about this topic to help explain why you must understand this. Once you do, fat loss becomes much easier!Its not just about calorie counting:The Thermic effect of food in fat loss is very important!Studies show that its not the calories but macro content that dictates body composition. There is one caveat; you can eat yourself out of any exercise regime. But a lot of your form is down to the types of calories you utilise. By eating more protein in a diet, more of the energy was turned into lean mass and increased your resting metabolism (basal metabolic rate or BMR) by 11% and diets low in protein and high in carbs showed a decrease in BMR by 2% compounded by muscle loss. Researchers estimate that 90% of energy consumed on high carb/low protein diet was turned into fat. High protein/ high fat and low carb diet will give you
Nutritional status" is a term critical to an understanding of anthropometrics. It encompasses more than simply diet, i.e. the intake of calories and nutrients, and is thus distinct from the more common term "nutrition." While nutrition refers to the quantity and quality of food inputs to the human biological system, it makes no reference to the amounts needed for healthy functioning resulting from nutrient demand placed on the individual. Nutritional status, or synonymously "net nutrition," refers to the summing up of nutrient input and demand on those nutrients. While work intensity is the most obvious demand, it is just one of many. Energy is required to resist infection. Pregnancy adds caloric and nutrient demands, as does breast-feeding. Calories expended in any of these fashions are available neither for basal metabolism, nor for growth. The difference between nutrition and nutritional status/net nutrition is important for anthropometrics, because it is the latter, not the former, for which ...
The mammalian kidney consumes a large amount of energy to support the reabsorptive work it needs to excrete metabolic wastes and to maintain homeostasis. Part of that energy is supplied via the metabolism of glucose. To gain insights into the transport and metabolic processes in the kidney, we have developed a detailed model of the renal medulla of the rat kidney. The model represents water and solute flows, transmural fluxes, and biochemical reactions in the luminal fluid of the nephrons and vessels. In particular, the model simulates the metabolism of oxygen and glucose. Using that model, we have identified parameters concerning glucose transport and basal metabolism that yield predicted blood glucose concentrations that are consistent with experimental measurements. The model predicts substantial axial gradients in blood glucose levels along various medullary structures. Furthermore, the model predicts that in the inner medulla, owing to the relatively limited blood flow and low tissue oxygen ...
We saw recently with the Biggest Loser study that basal metabolism plummets when you lose weight with calorie reduction. As contestants lose weight, they burn a lot less energy - up to 800 calories per day less than before!
When the basal metabolism is below normal, a person tends to be slow in his movements. He feels cold more and may have marked dryness of the skin, along with constipation and a tendency to put on weight. His hair is dry, thin, and coarse and the skin appears dry, scaly and thickened. There may be puffiness in the face, especially around the eyes. The tongue is usually large, the pulse is slow and regular, and the patient often complains of vague pains in the back and stiffness in the joints. ...
Free BMR calculator, use our free BMR calculator to calculate your basal metabolic rate so you can determine how many daily calories to lose or gain weight
So, how does the body do this? Leptin is a hormone which is found in our adipose tissue (fat tissue in case your wondering) and tells our brain (the hypothalamus to be exact), all about the environment around us and the current condition of our reserves for dealing with the environment. Think about it logically (like I do), the body has to have someway of deciding how much energy to expend or it runs the risk of grinding to a halt (death). You may have said it yourself or you may of heard somebody else claiming to have a naturally low resting metabolic rate, so it is not their fault. Its not physically possible to be at the surrender of an ominous metabolic rate that leaves you overweight no matter what you do. It is simply responding to the environment we put it in. Yes we do see babies born overweight and kids that seemingly have a "genetically" low metabolic rate, but, during the final 3 months of pregnancy a baby is preparing to support itself and live outside the womb. To do this it ...
This list is based on what was entered into the organiser field in a talk. It may not mean that Denise Schofield actually organised the talk, they may have been responsible only for entering the talk into the talks.cam system.. ...
New in Heritage Box with papers, 5" Schofield model, fired case, slight cylinder line (all of them have this) from factory te for sale by RDKEP on GunsAmerica - 976979440
Dr Peter Schofield is a specialist consultant at Spire Cambridge Lea Hospital. Get in touch now for expert advice and treatments provided at Spire Healthcare.
So, how does the body do this? Leptin is a hormone which is found in our adipose tissue (fat tissue in case youre wondering) that tells our brain (the hypothalamus to be exact), all about the environment around us and the current condition of our reserves for dealing with the environment. Think about it logically, the body has to have someway of deciding how much energy to expend or it runs the risk of grinding to a halt (death). You may have said it yourself, or you may of heard somebody else claiming to have a naturally low resting metabolic rate, so it is not their fault. It is not physically possible to be at the surrender of an ominous metabolic rate that leaves you overweight no matter what you do. It simply responds to the environment we put it in. Yes we do see babies born overweight, and kids that seemingly have a "genetically" low metabolic rate, but, during the final 3 months of pregnancy a baby is preparing to support itself and live outside the womb. To do this it needs to ...
A persons metabolism, known as basal metabolic rate, is the number of calories needed by the body to function daily. Everyone has a different metabolic rate, according to age, gender, weight and body composition. A high metabolism is most desired because of its ability to burn calories and fat quicker, often ...
How you fuel your body and the nutrients that you give it to repair are vital when it comes to building muscle. The key is to eat enough calories to allow the body to recover and muscles to repair, but not too many, or your body fat will increase. Calorie requirements will vary, but a good starting point might be 20 per cent above your basal metabolic rate (BMR), which can be calculated loosely by adding a zero to your weight in pounds. So, if you weigh 120lbs, your BMR is roughly 1,200 and your calorie intake should be around 1,440.. ...
I think this hasnt really been thought through here. First off, no system really uses actual CALORIES. We use KCAL, which are kilocalories. But people refer to them as calories, maybe for convenience. I have serious doubts that ten reps of some exercise (lasting roughly under 30s) burns 500s. Given the fact that an average person has a resting metabolism of 2500kcal +/- a couple of hundred calories PER DAY. Youd add 500kcal of energy need with only one set? Think again ...
As an example of calculating calories and daily caloric need, I plugged my stats into the BMR (basal metabolic rate) calculator I referenced earlier. It gives me a value of 1767 - lets call it 1800. There will be some variation in that number with lifestyle. For example, if I was a couch potato, 1800…
Do Cardio and Resistance Exercise: Exercise is one of the most important factors when it comes to increasing your metabolism. Do intense cardio for 30 minutes or more per day, and your metabolism can stay spiked for up to 2 hours afterwards. Break up your workout into two segments for even more benefits. Do resistance exercises 2-3 times per week to increase your muscle mass and therefore increase your resting metabolic rate to burn more calories 24/7! ...
Theres a secret weapon in the fight against flab. Its strength training.Research has shown that adding just 3 pounds of muscle can increase resting metabolic rate by 7 percent. This means that
Exercise prescription needs to be specific when dealing with diabetes. Intense programs can cause rapid changes in blood sugar that can stress the adrenal glands and slow metabolism. Easy Rx…ercise for Diabetics is designed to increase basal metabolic rate (metabolism) and minimize stress and adrenaline production. It offers a protocol that includes a handful of gentle exercises to improve circulation in the feet, lower legs and mid-section, specifically to meet the needs of the diabetic population.. ...
The human body contains more than 600 muscles, assisting in movement and in the formation of your resting and basal metabolic rates. Crash dieting, severe...
Metabolism gets blamed for a lot when it comes to weight. But thankfully there are ways you can speed it up and make your metabolic rate work for you.
IMDbs advanced search allows you to run extremely powerful queries over all people and titles in the database. Find exactly what youre looking for!
quickBMR is your number one stop for quickly calculating your BMR or TDEE. We offer a wide array of tools to help you quickly and easily calculate your BMR and TDEE anywhere, any time. We also offer a set of resources to help you better understand BMR ...
Metabolism is the process by which the body converts the calories from food into energy necessary for its vital functions. Most of us think that skinny people are the ones with a
BMR1_03g01685-bio-His sequence 7269 bps CATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATA TATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCA TTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG AGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGA CGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGG CAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTG GATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCA CCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCCCGCCCCGTTGACGCAAATGGGCGGTAGGCGT GTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCCTCACTCTCTTCCGCATCG CTGTCTGCGAGGGCCAGCTGTTGGGCTCGCGGTTGAGGACAAACTCTTCGCGGTCTTTCCAGTACTCTTG GATCGGAAACCCGTCGGCCTCCGAACGGTACTCCGCCACCGAGGGACCTGAGCGAGTCCGCATCGACCGG ATCGGAAAACCTCTCGAGAAAGGCGTCTAACCAGTCACAGTCGCAAGGTAGGCTGAGCACCGTGGCGGGC GGCAGCGGGTGGCGGTCGGGGTTGTTTCTGGCGGAGGTGCTGCTGATGATGTAATTAAAGTAGGCGGTCT ...
Your bmibmr calculator results: bmi: bmr: kcalday. Bmr wactivity factor: kcalday. Bmi calculator chart: body fat chart. Your bmr calculator generates the.
Kissing burns calories, 2-3 calories a minute and can double your metabolic rate. Research claims that three passionate kisses a day (at least lasting 20 seconds each) will cause you to loose an entire extra pound. ...
1. Some patients with the emphysematous type of tobacco-related chronic obstructive pulmonary disease are hypermetabolic. Since the likely mechanism is the increased work of breathing, other groups of patients with chronic obstructive pulmonary disease should be similar. We have now measured basal metabolic rate and diet-induced thermogenesis in six patients with chronic obstructive pulmonary disease with an arterial partial pressure of CO2 of ,5kPa (emphysematous), nine patients with chronic obstructive pulmonary disease with an arterial partial pressure of CO2 of ,6kPa (bronchitic), eight patients with chronic obstructive pulmonary disease due to chronic asthma and seven control subjects. Diet-induced thermogenesis was measured for 4h after a meal of 87% carbohydrate, 11% protein and 2% fat as energy, with a total energy content of 40% of basal metabolic rate.. 2. There was no difference between measured and predicted basal metabolic rate in the control (5541 ± 272 versus 5881 ± 245 kJ/24h) ...
1. Our objectives were to measure total energy expenditure, the daily variation in total energy expenditure and the physical activity level in a group of HIV-positive subjects using the bicarbonate-urea method. The study also aimed to asses the practicalities of using the bicarbonate-urea technique in free-living conditions. 2. Total energy expenditure was measured with the bicarbonate-urea method over 2 consecutive days (1 day in one subject) in 10 male patients with HIV infection (median CD4 count = 30). Resting energy expenditure was measured by indirect calorimetry. Physical activity level (total energy expenditure/resting energy expenditure) was calculated from these measurements and from activity diaries. 3. Resting energy expenditure was found to be 7.46 +/- 0.87 MJ/day, 5% higher than predicted values. Total energy expenditure was 10.69 +/- 1.95 MJ/day with an intra-individual day-to-day variation of 6 +/- 6%. The measured physical activity level was 1.42 +/- 0.14, higher than the diary estimate
The purpose of this study was to examine the effects of acute ingestion of a pre-workout dietary supplement (PWS) with and without p-synephrine (S) on perceptions of readiness to perform, cognitive function, exercise performance, and markers of safety. In a randomized, double-blind, and counterbalanced manner; 25 healthy and recreationally active male and female participants ingested a flavored maltodextrin placebo (PLA), a PWS containing beta-alanine (3 g), creatine nitrate as a salt (2 g), arginine alpha-ketoglutarate (2 g), N-Acetyl-L-Tyrosine (300 mg), caffeine (284 mg), Mucuna pruiriens extract standardized for 15% L-Dopa (15 mg), Vitamin C as Ascorbic Acid (500 mg), niacin (60 mg), folate as folic acid (50 mg), and Vitamin B12 as Methylcobalamin (70 mg) with 2 g of maltodextrin and flavoring; or, the PWS with Citrus aurantium (PWS + S) extract standardized for 30% p-synephrine (20 mg). Participants had heart rate (HR), blood pressure, resting energy expenditure (REE), 12-lead electrocardiograms
We investigated the relationship between the basal metabolic rate (BMR) and muscle strength through measurement of handgrip strength. We conducted a cross-sectional study of a population representative of older Korean from the 2014–2016 Korean National Health and Nutrition Examination Survey. A total of 2512 community-dwelling men and women aged 65 years and older were included. The BMR was calculated with the Singapore equation and handgrip strength was measured using a digital dynamometer. The patients were categorized into handgrip strength quartiles and a weighted one-way analysis of variance (ANOVA) for continuous variables and a weighted chi-squared test for categorical variables were performed. Pearson, Spearman correlation analysis, univariate, and multivariate linear regression were performed. Analysis of covariance (ANCOVA) was also performed to determine the association between basal metabolic rate and handgrip strength quartiles after adjusting for confounding factors. The BMR
The overall goal is to determine whether any energy expenditure compensation in response to 16 weeks of aerobic exercise at a higher-dose is greater compared to a lower-dose intervention in older women, and to begin to investigate underlying physiological mechanisms that influence energy expenditure changes in older women. Changes in all components of energy expenditure, as well as concentrations of plasma leptin and serum free T3, in response to the two different exercise programs (14 and 8 kcal/kg body weight weekly, 60-65% VO2max, 4 days/wk) will be compared in older, non-obese women (60-75 yrs, BMI=18-30 kg/m2).. Specific Aim 1: To determine whether differential changes in total daily energy expenditure and its components occur in older women in response to two exercise programs of different doses. State-of-the-art methods will be used (total daily energy expenditure by doubly labeled water; non-exercise activity thermogenesis using Physical Activity Monitoring System; resting metabolic rate ...
ContextWeight loss elicits physiological adaptations relating to energy intake and expenditure that antagonize ongoing weight loss.ObjectiveTo test whether die
Objective- To evaluate the nutritional effect of an oral supplement enriched in beta-hydroxy-beta-methylbutyrate, glutamine and arginine (HMB/Glu/Arg) on resting metabolic rate (RMR) following laparoscopic gastric bypass (LGB). Although, LGB is a highly effective approach to induce weight loss in morbid obesity, most patients regain 10-15% of this weight over time. Studies indicate, this is due to a decrease in RMR which is largely determined by loss in lean body mass (LBM) after LGB. There is evidence that HMB/Glu/Arg helps restore LBM in cachexia due to cancer and critically ill trauma patients. If this effect can help modulate RMR in bariatric patients, more stable weight maintenance may be achieved.. Method- Patients scheduled to undergo LGB were randomized to an experimental arm receiving (HMB/Glu/Arg) and to a control arm not receiving it. The experimental group was required to consume 24g of supplement dissolved in water, twice daily and record their consumption. Primary outcomes of ...
The ability to assess energy expenditure (EE) and estimate physical activity (PA) in free-living individuals is extremely important in the global context of non-communicable diseases including malnutrition, overnutrition (obesity), and diabetes. It is also important to appreciate that PA and EE are different constructs with PA defined as any bodily movement that results in EE and accordingly, energy is expended as a result of PA. However, total energy expenditure, best assessed using the criterion doubly labeled water (DLW) technique, includes components in addition to physical activity energy expenditure, namely resting energy expenditure and the thermic effect of food. Given the large number of assessment techniques currently used to estimate PA in humans, it is imperative to understand the relative merits of each. The goal of this review is to provide information on the utility and limitations of a range of objective measures of PA and their relationship with EE. The measures discussed include those
Do you know your Basal Metabolic Rate? Do you know how weight loss and dieting can be effected by this key indicator? check weightlossforgood.co.uk
We have done some solid research to provide you with an accurate guide on the types of Aloe pills out there that are effective and safe to take. Glass and Stainless steel are unaffected by coffee acids compared to latex rubber bags.
In order to monitor their energy requirements, athletes may desire to assess energy expenditure (EE) during training and competition. Recent technological advances and increased customer interest have created a market for wearable devices that measure physiological variables and bodily movement over prolonged time periods and convert this information into EE data. This mini-review provides an overview of the applicability of the SenseWear armband (SWA), which combines accelerometry with measurements of heat production and skin conductivity, to measure total daily energy expenditure (TDEE) and its components such as exercise energy expenditure (ExEE) in athletic populations. While the SWA has been shown to provide valid estimates of EE in the general population, validation studies in athletic populations indicate a tendency towards underestimation of ExEE particularly during high-intensity exercise (|10 METs) with an increasing underestimation as exercise intensity increases. Although limited information
Respirometry is a general term that encompasses a number of techniques for obtaining estimates of the rates of metabolism of vertebrates, invertebrates, plants, tissues, cells, or microorganisms via an indirect measure of heat production (calorimetry). The metabolism of an animal is estimated by determining rates of carbon dioxide production (VCO2) and oxygen consumption (VO2) of individual animals, either in a closed or an open-circuit respirometry system. Two measures are typically obtained: standard (SMR) or basal metabolic rate (BMR) and maximal rate (VO2max). SMR is measured while the animal is at rest (but not asleep) under specific laboratory (temperature, hydration) and subject-specific conditions (e.g., size or allometry), age, reproduction status, post-absorptive to avoid thermic effect of food). VO2max is typically determined during aerobic exercise at or near physiological limits. In contrast, field metabolic rate (FMR) refers to the metabolic rate of an unrestrained, active animal ...
The average total daily energy expenditure is higher in obese than lean individuals when measured at stable weight. However, energy expenditure falls as weight is lost, due in part to loss of lean body mass and to decreased sympathetic nerve activity. When reduced to near-normal weight and maintained there for a while, (some) obese individuals have lower energy expenditure than (some) lean individuals. There is also a tendency for those who will develop obesity as infants or children to have lower resting energy expenditure rates than those who remain lean. ...
Objective i - The first phase of the proposed work (Phase I) will involve two laboratory-based examinations of the acute metabolic and behavioural responses to extended fasting relative to ingestion of a standardised breakfast. These trials will be applied in a randomised and counterbalanced order with 3-28 days interval except for eumenorrheic women, whose trials will be separated by 28 ± 2 days and only at least 3 and at most 10 days after the onset of menses (i.e. follicular phase) to ensure that the effects of menstrual cycle on the majority of hormones and therefore resting metabolic rate (RMR) and appetite will be both minimal and standardised between trials [69-71]. These acute trials will be conducted in our resting metabolism laboratory in accordance with current guidelines for best practice in measuring resting metabolic rate [72]. Most notably, ambient temperature in this laboratory is maintained between 20 and 25°C (with intra-individual trials standardised within 2°C) and ...
The scaling of metabolic rates to body size is widely considered to be of great biological and ecological importance, and much attention has been devoted to determining its theoretical and empirical value. Most debate centres on whether the underlying power law determining metabolic rates is 2/3 (as predicted by scaling of surface area/volume relationships) or 3/4 (Kleibers Law). Although recent evidence suggests that empirically derived exponents vary among clades with radically different metabolic strategies, such as ectotherms and endotherms, models, such as the Metabolic Theory of Ecology, depend on the assumption that there is at least a predominant, if not universal, metabolic scaling exponent. Most analyses claimed to support the predictions of general models however fail to control for phylogeny. We used phylogenetic generalised least squares models to estimate allometric slopes for both basal metabolic rates (BMR) and field metabolic rates (FMR) in mammals. Metabolic rate scaling ...
The term MET, which was used in the national recommendations for exercise, is often used to estimate energy expenditure and work rate. A MET is defined as a multiple of resting metabolic rate or energy expenditure. One MET is between 0.200 to 0.250 liters of oxygenVmin, or approximately one kcal min, depending on the weight and body type of the person. Two METS would be two times resting metabolic rate or approximately 0.5 liters 2 X 0.200 to 0.250 of oxygen min, or 2 kcal min. Likewise, 3.... ...
The question of the selection forces which initiated the evolution of endothermy in birds and mammals is one of the most intriguing in the evolutionary physiology of vertebrates. Many students regard the aerobic capacity model as the most plausible hypothesis. This paper presents an alternative model, in which the evolution of endothermy in birds and mammals was driven by two factors: (i) a selection for intense post-hatching parental care, particularly feeding offspring, and (ii) the high cost of maintaining the increased capacity of the visceral organs necessary to support high rates of total daily energy expenditures.. ...
Differences in BMRs are associated with changes in energy balance. Energy balance reflects the difference between the amount of calories one eats and the amount of calories the body uses. If a high BMR is induced by the administration of drugs, such as amphetamines, animals often have a negative energy balance which leads to weight loss. Based on such studies many people have concluded that changes in thyroid hormone levels, which lead to changes in BMR, should also cause changes in energy balance and similar changes in body weight. However, BMRs are not the whole story relating weight and thyroid. For example, when metabolic rates are reduced in animals by various means (for example by decreasing the body temperature), these animals often do not show the expected excess weight gain. Thus, the relationship between metabolic rates, energy balance, and weight changes is very complex. There are many other hormones (besides thyroid hormone), proteins, and other chemicals that are very important for ...
In allometric scaling, maximum potential life span (MPLS) is directly related to metabolic rate (MR), where MR is the recharge rate of a biomass made up of covalent bonds. That biomass (W) is subjected to deterioration over time from thermodynamic, entropic pressure. Metabolism is essentially understood as redox coupling, and has nothing to do with thermogenesis. Metabolic efficiency (ME) is then expressed as the efficiency of this coupling, a ratio of amperes[clarification needed] captured and used by biomass, to the amperes available for that purpose. MR is measured in watts, W is measured in grams. These factors are combined in a power law, an elaboration on Kleibers law relating MR to W and MPLS, that appears as MR = W^ (4ME-1)/4ME.[clarification needed] When ME is 100%, MR = W^3/4; this is popularly known as quarter power scaling, a version of allometric scaling that is premised upon unrealistic estimates of biological efficiency.. The equation reveals that as ME drops below 20%, for W , ...
My BMR: Android app (4.0 ★, 10,000+ downloads) → Calculate your daily caloric expenditure (basal metabolic rate or even basal metabolic rate) 24 hours in idle state. The...
Fitness. All I can say is: Ugh. I have to do something drastic on this front. My biggest issue is excess body mass, which stems from two key things: diet and exercise. Not very earth shattering, is it? Nope, but this isnt really rocket science. Our bodies are nothing more than energy processing devices. The engineer in me tends to think of the human form in terms of free body diagrams. Energy cant be created or destroyed, so what goes in the mouth that isnt used up by the body for basal metabolism needs, either comes out in the form of useful work performed or as waste, and whats left over gets stored away as fat. Its an energy balance thing, and of course there are lots of variables (e.g., efficiency of the body, types of calories consumed, etc.) but... well, like I said, its not rocket science. I hereby resolve to eat better and exercise more. I might also dedicate a couple of off-topic blog posts in the coming year to just how Im going to tackle this gorilla ...
While driving down to the in-laws to spend the holidays, we listened to several of Jimmy Moores podcast shows and one of them was a two-part Q&A with Dr. Mary C. Vernon, a physician who treats diabetes and other ailments by putting her patients on a low-carb diet. At one point, she pointed out that all diets (presuming fat loss is the objective) are high fat diets. Get it? Lets say you have 50 pounds of excess fat youd like to lose in order to get down to around 15% body fat or thereabouts. Assuming youll be successful, what does that imply? It means, necessarily, that youre going to metabolize 50 pounds of your own fat in order to accomplish your objective. So, even if you do this by means of a low-fat diet, its still high-fat, as youve got 50 pounds or 175,000 calories worth of fat to burn through. If you do it in six months, thats almost 1,000 calories of fat per day. Presuming a basal metabolism of 2,500 calories, and what you do eat is 20% fat (a low-fat diet), then youd be eating 300
1. Weight training tones your muscles which looks great and raises your basal metabolism ... which causes you to burn more kilojoules 24 hours-a-day. Youll even burn more kilojoules while youre sleeping. 2. Weight training can … [Read more...] ...
I am going to go along with the theory that free radicals are what causes mutations, and thus aging (breaking down of the organic machine). And free radicals are caused by all the metabolic reactions that go on in a cell (mitochondria mostly in my opinion). So if you slow down the metabolilc reactions, and a basal metabolism is established (in which there are no deficiencies), then I think that the consequence would be less mutations caused by the free radicals and less aging ...
Bouchard, C., Warwick, D.E., Rice, T., Pérusse, L., Gagnon, J., Province, M.A., Leon, A.S., Rao, D.C., Skinner, J.S. & Wilmore, J.H. 1998. Familial resemblance for VO2max in the sedentary state: the HERITAGE family study. Med. Sci. Sports Exerc. 30: 252-258 ...
Diet Soda Keto Diet Drinking on Atkins or keto? The good news, bad news and how to drink for weight loss. Low carb alcohol list: liquor, beer, wine, mixers. First Aerobics Instructor A female aerobics instructor meets a male reporter doing a story on health clubs, but it isnt love at first sight. Freestyle aerobics is an aerobics style. Strength training is the key to replacing muscle that atrophies during. you should increase your muscle mass by three pounds and your resting metabolism by 6 percent after just 10 weeks. So how should you start your strength.. Strength training is the key to replacing muscle that atrophies during inactive aging. If you commit to two 20-minutes strength training sessions a week, you should increase your muscle mass by three pounds and your resting.. Strength training is the key to replacing muscle that atrophies during. you should increase your muscle mass by three pounds and your resting metabolism by 6 percent after just 10 weeks. So how should you start your ...
Thesis (Ph.D.)--University of Tasmania, 1997. Includes bibliographical references. Contents: Serotonin inhibition of 1-methylxanthine metabolism indicative of enhanced non-nutritive flow in muscle -- Evidence for vessels supplying septa and tendons acting as functional shunts in the perfused hindlimb -- Vasoconstrictor-mediated control of lactate metabolism -- Influence of vasoconstrictors on fat metabolism of perfused hindlimb ...
1. Intragastric feeding (40 kJ) produced a 17% rise in metabolic rate in lean Zucker rats but only an 8% increase in obese (fa/fa) rats, and both of these responses were significantly reduced by...
DEAR DR. DONOHUE: Excluding exercise other than normal, everyday activities, how many calories does a person have to consume to maintain his or her current weight?I have seen numerous references to a persons metabolic rate, but have never seen an explanation of it or the effect of a low or high metabolic rate. Does a…
Small lizards can be carnivorous, herbivorous or omnivorous. Small lizards may eat a variety of insects, plants or a mixture of the two. Most lizards have a high metabolic rate and need to eat...
Fact: muscles use more calories than fat. Weight training is the type of exercising which will typically have the greatest effect on your long-term metabolic rate. By strengthening your muscles your body generates more lean muscles mass tissue, which will then increase your basal metabolic rate and allow you to burn more calories at rest.. Fueling your Body While it might sound easy to just add a couple workouts every week, thats actually not the case. Many people underestimate, especially women, how much you should be eating throughout the day. Without sufficient nutrients, cells will readjust and begin to function on smaller amounts of energy and in turn, store more fat. Under eating will slow your metabolism down. Proper nutrition along with weight training is key in optimizing your metabolic rate. Eating larger, balanced meals with the right amounts of protein, carbohydrate and fat keeps your blood sugar stable, reduces cravings and keeps your bodys energy supply constant steadily ...
Health, ...CHAPEL HILL N.C. It is not unusual to hear people blame their metabo...In fact differences in metabolic rates are known to exist between nor...The finding which will appear in the February 19 issue of the journal... We have discovered an entirely new layer of control of metabolism s...,Chemical,tags,likely,to,affect,metabolism,,cancer,development,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
Roll on more tour posts! Following the pre-Stage 15 prediction, we will keep the posts coming as thick and fast as the attacks we have seen in Le Tour the past couple of days. In this short post we will get into what it takes to fuel a cyclist through a stage race like Le Tour, and this will serve as a spring board to talk more in the future about exercise metabolism and all its implications. So we all know that the energy demands placed on tour riders are pretty astronomical, but lets think about the basic energy needs of a 75 kg cyclist. His resting metabolic rate, or the amount of energy he requires to sit there the whole day and not do anything, probably clocks in at around 1500-1800 calories, depending on his body mass. That is the amount of energy he requires just to keep his body alive and functioning.. Before we delve into energy requirements, it is first important to remember that the cost of moving your body through space is a function of the distance, and not the speed at which you ...
We now know that obesity is a problem. The pot belly is a house of disease. Obesity and high blood pressure go hand in hand. So do obesity and diabetes and obesity and coronary heart disease (chest pain and heart attack). Losing weight is the need of the hour. Weight loss is no more a goal for mere good looks. It is essential if one wants to lead a healthy life. Diet is the key to weight loss. I have written on diet and weight loss, the pot belly and the evils of sugar. For some people, diet alone may not be enough. Their basal metabolic rate (B.M.R) is so low that changes in food habits are not enough to bring about the weight loss. In simple words they are just not burning enough calories. The fat burning engines of their body have gone to sleep. Exercise is the only way to increase their metabolic rate. All of us think of walking when we are considering exercise. We feel it is the best exercise to do the job. In fact it is the first exercise that comes to our mind. Many of us have taken up ...
Regular mealtime protein optimizes your basal metabolic rate and allows you the building block amino acids to build and maintain more muscle mass. More muscle means higher metabolic rates. This means you can get away with eating a bit more without putting on body fat. I like the idea of meal replacements to optimize and maintain your weight . It has worked for me personally and I know using the R90 program and now the recently available TR 90 program folks can make a big dent in getting their weight optimized. Earlier this year I had blogged about the dramatic benefits noted in a trial looking at managing Obesity In The Setting of Atrial Fibrillation. By using an aggressive up front meal replacement program combined with dietary counseling the treatment group had a dramatic improved weight measured 15 months (over a year past the study start). Now for the recipes: I keep many of the ingredients in the freezer if I cant keep up with the purchased quantity to avoid spoilage. Remember if you are ...
According to the report of the International Association for the Study of Obesity (34), the PA level that was defined as the ratio of average daily metabolic rate to resting metabolic rate ranged from 1.5-1.6 for men and 1.4-1.5 for women in sedentary groups. Additionally, in general, the minimum PA volume for avoiding a sedentary lifestyle was indicated to be 30 min of daily activity at 3 METs of intensity (34). In the studies in the current meta-analysis, the mean PA dose in the lowest group was at most 30 MET-h/day in terms of EE (i.e., 1.25 [= 30/24] in the PA level unit) or 30 min/day of LTPA. Therefore, these PA levels can be considered to represent inactivity. The results of the current meta-analysis can be interpreted to indicate that a high PA in patients with diabetes was associated with a 40 and 29% lower risk of ACM and CVD, respectively, in comparison with inactivity, although definitions of high PA varied among studies. In comparison with other lifestyle factors, these values ...
Download BMI Calculator - BMI Calculator is free software to estimate your Body Mass Index (BMI) and Basal Metabolic Rate (BMR). This information tells you about your body composition, metabolism and if you need to start dieting to prevent health risk related to obesity.
Finally, a slow metabolism can cause high blood sugar because the body is not properly digesting food. This can lead to type 2 diabetes which can lead to more serious health issues if it is not taken care of.. Can You Fix a Slow Metabolism?. The good news is that if you do find you have a slow metabolism, there are things you can do to speed it up. A few lifestyle modifications are all that is required to get your metabolism working a little faster than it is.. One of the easiest ways to speed up your metabolism is to start an exercise program if you are not already on one. Aim to exercise most days of the week, but make sure your program includes both cardiovascular exercise and weight training. The more muscle you have, the higher your resting metabolic rate will be because each pound of muscle uses about six calories a day (fat only burns two calories).. Your cardiovascular activity should also be more than just a stroll around your neighborhood. In order to really make your metabolism pick ...
Humans, like all animals, have a sophisticated system of hormones and brain regions whose function is to maintain a proper energy balance. Part of the systems job is to keep fat mass at an appropriate level. With a properly functioning system, feedback loops inhibit hunger once fat mass has reached a certain level, and also increase resting metabolic rate to burn excess calories. If the system is working properly, its very difficult to gain weight. There have been a number of overfeeding studies in which subjects have consumed huge amounts of excess calories. Some people gain weight, many dont. ...
Due to the strict protocol and technical difficulties associated with obtaining an accurate measurement of RMR, prediction equations have been developed to estimate RMR based on parameters more easily measured. Research studies indicate that prediction equations which account for both fat and fat-free mass provide the most accurate estimates of RMR. Therefore, the equation of Nelson et al (American Journal of Nutrition 56:848-56, 1992), which includes accurately measured fat and fat-free mass as predictors, provides a reliable and accurate assessment of your RMR. This equation is also useful in tracking RMR changes that occur with a change in either fat or fat-free mass.. ...
Measures Body Weight, Body Fat Percentage, Body Mass Index (Bmi), Skeletal Muscle, Resting Metabolism, Visceral Fat & Body Age; Full Body Sensing, With Hand-To-Foot Technology For More Accurate Readings Than Foot-To-Foot Monitors; 4-Person Memory Settings
Metabolic heart rate is a measure of the amount of energy that you use each day at rest. It measures the calories that you burn to perform basic body functions when sleeping or engaging in no physical activity. Metabolic heart rate may refer to your basal metabolic rate -- calculated using an equation -- or to your ...
Coffee contains caffeine, a stimulant substance that is proven to increase the release of fats from the fat tissues and boost the resting metabolic rate.
We have performed a chemical library screen and identified molecules that increase energy expenditure. Our lead molecule increases metabolic rate by 30% and promotes fat loss. In collaboration with chemists, we are developing and testing next-generation molecules with different potencies and pharmacokinetic properties.. We are seeking an Honours student to screen new molecules and test the best ones for beneficial effects in cultured cells and mice. Students will learn cellular bioenergetics, mitochondrial function and mouse physiology.. ...
However at times it has been alleged that since aerobic exercising does not increase the basal metabolic rate it is not very effective in causing weight loss
Video created by 펜실베이니아 대학교 for the course Vital Signs: Understanding What the Body Is Telling Us. This week we will explore metabolism. We will discuss anabolism and catabolism, basal metabolic rate, how the body generates heat. You will also ...
When youre in your 20s, being fit is almost too easy. After all, your body is at its physical peak. At least according to Robert Kail and John Cavanaugh. Their book, "Human Development: A Life-Span View" details how sensory abilities peak in the early 20s, muscle mass peaks anywhere between 20 and 30 years of age and heart rate and metabolism in early adulthood.. Its all downhill from there, apparently.. After reaching the peak, physical strength will slowly decline as one goes through his remaining years. Vision will start to deteriorate by middle age. Heck, hearing actually starts declining as early as the late 20s. And while muscle strength can be maintained for over 2 decades as long as youre not suffering from disease or injury, once the middle age hits, the decline in muscular performance is around 5% every 10 years.. Skeletal bone mass is typically lost when women hit menopause. In men, it usually happens after 65. At retirement age for both sexes, resting metabolism will have ...
Energy balance & metabolic rate. Metabolism means changes , it is used to refer to all chemical and energy transformation processes that occur in the body. It is divided into two processes : 1- anabolism which means formation of proteins, fats, complex Slideshow 182010 by salena
Weak immunity reduces our metabolic rate and thus, suppresses the bodys ability to fight diseases, so stay hydrated and increase fiber intake.
The Basal Metabolic Rate (BMR) is considered to be one of the main components that condition the expenditure of the athletes total energy. Therefore an elaboration of a classification of BMR based on high level athletes would be of value in order to establish reference points. This studys objective was to compare BMR among champion athletes some with prevailing "long-term energy system" (L-TES) (marathon, route cyclism, athletic march, n = 16, 25.58 ± 2.79yrs; 173 ± 5.98cm) and others with "short-term energy system" (S-TES) (rowing, n = 10; 23.79 ± 2,79 years; 189 ± 3.84 cm), male athletes. The date of evaluation of BMR gathered after the Olympic and World games is characterized in the Sport Calendar as a period of "post competition". A Mijjnhardt gas analyzer was used for calculating of VO2 and VCO2. Routine procedures were strictly followed in the preparation of basal conditions and during its measurements for BMR calculation. The measurement of the oxygen consumption was taken within 35 ...
Looking for online definition of resting energy expenditure in the Medical Dictionary? resting energy expenditure explanation free. What is resting energy expenditure? Meaning of resting energy expenditure medical term. What does resting energy expenditure mean?
TY - JOUR. T1 - Nonprotein caloric requirements for patients with pancreatic abscess as measured by indirect calorimetry. AU - Arouni, M. A.. AU - Fagan, D. R.. AU - Jasnowski, J.. AU - Watson, P.. AU - Lanspa, Stephen J.. PY - 1990. Y1 - 1990. N2 - Few data exist regarding nutritional assessment during pancreatic abscess. We compared nonprotein caloric requirements calculated by Harris-Benedict equation and measured by indirect calorimetry in patients with pancreatic abscess. Seven patients with pancreatitis and pancreatic abscess had determinations of resting energy expenditure via Medicor metabolic cart with 20% added for activity. Caloric requirements were also estimated using the Harris-Benedict equation with stress factors. Determinations from indirect calorimetry ranged from 22.4-46.8 (mean 36.1) kcal/kg/d. Harris-Benedict calculations with stress factor 1.7 differed from indirect calorimetry by at least 15% in seven of ten determinations. Stress factor 1.9 results overestimated indirect ...
In the present study, we found that individuals with COPD had higher REE and resting carbohydrate oxidation than the controls, regardless of body composition, since both groups had similar muscle mass.. Other studies have also found that patients with COPD have higher REE (approximately 15 to 26%) [6, 19]. The greater energy expenditure of individuals with COPD is probably due to increased respiratory muscle effort and inflammatory mediators, in addition to the effects of medication (oral or systemic corticosteroids, theophylline, hormones, benzodiazepines and antipsychotics) [19-21].. This study found that mean RQ and carbohydrate oxidation were higher in the COPD group, while fat oxidation was similar in both groups. Increased carbohydrate oxidation in the COPD group was probably caused by increased anaerobic metabolism due to reduced ability to capture oxygen [22]. When carbohydrates are oxidized in the absence of oxygen, only 2 ATP molecules per millimol of carbohydrates are generated, while ...
TY - JOUR. T1 - Effect of Late-Onset Sepsis on Energy Expenditure in Extremely Premature Infants. AU - Torine, Ilana J.. AU - Denne, Scott C.. AU - Wright-Coltart, Shirley. AU - Leitch, Catherine. PY - 2007/5. Y1 - 2007/5. N2 - The purpose of this study was to compare total energy expenditure (TEE) in extremely premature infants during and after an episode of sepsis. We hypothesized that TEE in the sepsis group (SEP) would be higher during the septic period and higher than an age-matched control group (CTL). We further hypothesized that the TEE of the SEP group during the recovery period would be similar to that of the CTL group. The doubly labeled water method was used to determine TEE in both groups. Infant characteristics were as follows: SEP group, n = 10, gestation = 26 ± 1 wk, birth weight = 854 ± 218 g; CTL group, n = 10, gestation = 26 ± 1 wk, birth weight = 880 ± 158 g. TEE of the SEP group during the septic period was significantly greater than during the recovery period (96 ± 25 ...
Obesity is a growing epidemic with no consensus regarding solutions. Thirty healthy overweight and obese female subjects (41.9 ± 12 years, 166 cm ± 7 cm, a 100.5 kg ± 19.6 kg, 46.0% ± 4.0% body fat, and BMI 37.4 ± 6.9) participated in the study. A 14-day dietary intervention examined acute effects of energy balance and macronutrient type on dietary intake, REE, body weight, body composition, and thyroid panel. Significant changes occurred in weight loss over time (p , 0.001); body fat mass over time (p , 0.001) and time x diet (p = 0.02); body fat percentage over time (p , 0.002) and time x diet (p = 0.023); REE over time (p = 0.03), and thyroid panel. Body weight continued to decrease during positive energy balance, yet metabolism rebounded. Results suggest energy balance has a greater overall effect on REE and weight loss than macronutrient type ...
DISCUSSION. We can consider that our population has a differential in relation to other studies evaluating the effect of DMPA, considering that our group was paired with the control group at baseline for BMI (± 1 kg/m2) and age (± 1 year), becoming a homogeneous group. Our study found that after 12 months of follow-up the injectable DMPA users had significant weight gain (3.01 kg). As most prospective studies evaluating the effect of DMPA were for at least 30 months (6,8,9), we can consider that the follow-up period of our study is short compared to the others, but we can already observe significant changes in important variables studied.. To better assess changes in weight and body composition, we made a subdivision of the DMPA group for weight gain (, 3 kg and , 3 kg), and observed significant changes in weight and body composition in both groups, but the group which gained , 3 kg had the more pronounced changes. This group had a mean gain of 5.53 kg, increased fat mass (2.3 kg) and fat-free ...
Purpose: Study purposes were to develop energy expenditure (EE) prediction models from raw accelerometer data and to investigate the performance of three different accelerometers on five different wear positions in preschoolers. Methods: Fourty-one children (54% boys; 3-6.3 years) wore two Actigraph GT3X (left and right hip), three GENEActiv (right hip, left and right wrist), and one activPAL (right thigh) while completing a semi-structured protocol of 10 age-appropriate activities. Participants wore a portable indirect calorimeter to estimate EE. Utilized models to estimate EE included a linear model (LM), a mixed linear model (MLM), a random forest model (RF), and an artificial neural network model (ANN). For each accelerometer, model, and wear position, we assessed prediction accuracy via leave-one-out cross-validation and calculated the root-mean-squared-error (RMSE). Results: Mean RMSE ranged from 2.56-2.76 kJ/min for the RF, 2.72-3.08 kJ/min for the ANN, 2.83-2.94 kJ/min for the LM, and ...

*Black-body radiation

"A Biometric Study of Human Basal Metabolism". Proc Natl Acad Sci USA. 4 (12): 370-3. Bibcode:1918PNAS....4..370H. doi:10.1073/ ... The total energy radiated in one day is about 8 MJ, or 2000 kcal (food calories). Basal metabolic rate for a 40-year-old male ... However, the mean metabolic rate of sedentary adults is about 50% to 70% greater than their basal rate.[40] ...

*Metabolic rate - Simple English Wikipedia, the free encyclopedia

Basal metabolism[change , change source]. Basal metabolism is usually by far the largest component of total energy used. The ... Metabolic rate is the rate of metabolism, the amount of energy used by an animal per unit of time. Basal metabolic rate (BMR) ... Energy metabolism as related to body size and respiratory surfaces, and its evolution. Rep. Steno. Mem. Hosp. 9, 1-110. ... On a log-log scale, the metabolism of mammals as related to their body size forms a straight line with a slope of about 0.75. ...

*Resting metabolic rate

On the Utility of Uniformity in the Definition of Basal Rate of Metabolism. Physiol. Zool. Vol.70; 718-720. Speakman, J.R., ... Sanborn M.S., Frank B (1922). Basal metabolism: its determination and application. p. 20. Retrieved 21 March 2016. McNab, B. K ... RMR differs from basal metabolic rate (BMR) because BMR measurements must meet total physiological equilibrium whereas RMR ... "Measuring Your Metabolism: Breezing at QS15 - Quantified Self". Quantified Self. Retrieved 2016-01-22. Manore, Melinda; Meyer, ...

*Human evolution

... faster basal metabolism;[56] loss of body hair; evolution of sweat glands; a change in the shape of the dental arcade from ... Other similar basal primates were widespread in Eurasia and Africa during the tropical conditions of the Paleocene and Eocene. ... as well as changes in metabolism due to changes in diet, such as lactase persistence. ... "Effects of brain evolution on human nutrition and metabolism". Annual Review of Nutrition. 27: 311-327. doi:10.1146/annurev. ...

*Harris-Benedict equation

A Biometric Study of Basal Metabolism in Man. J. Arthur Harris and Francis G. Benedict. Washington, DC: Carnegie Institution, ... Food energy Basal metabolic rate Resting metabolic rate Harris JA, Benedict FG (1918). "A Biometric Study of Human Basal ... which was published in 1919 by the Carnegie Institution of Washington in the monograph A Biometric Study Of Basal Metabolism In ... The Harris-Benedict equation (also called the Harris-Benedict principle) is a method used to estimate an individual's basal ...

*Arthur H. Steinhaus

"The influence of physical work on the basal metabolism : graduation thesis in candidacy for the degree of Master of Physical ... "The influence of physical work on the basal metabolism" PhD, University of Chicago, 1928. Dissertation: "Studies on the ... I. Exercise and basal metabolism in dogs .." https://libcat.uchicago.edu Archived August 15, 2013, at the Wayback Machine.). ... Thesis: "The influence of exercise on the basal metabolic rate" and Crerar Library, University of Chicago, record Master of ...

*Compensatory growth (organism)

First, during nutrient starvation, a reduction of basal metabolism takes place. The gut tissues are the first tissues to be ... an increase in feeding enables more dietary protein and energy to be contributed for tissue growth instead of basal metabolism ... though it is clear that in some animals the endocrine system is involved in the metabolism and nutrient partitioning in the ...

*Kleiber's law

Thus, basal metabolism is no a pure power law anymore but the weighted sum of two. This evolutive tradeoff can explain several ... This leads to the idea that thermogenesis is part of metabolism, Kleiber's original treatment, and rules out that metabolism is ... Dodds, P. S.; Rothman, D. H.; Weitz, J. S. (2001). "Re-examination of the 3/4 law of metabolism". J. Theor. Biol. 209: 9-27. ... Concepts of efficiency in the use of energy by the metabolism[edit]. This limit to blood flow considerations is problematic ...

*Heliophyte

... they have a higher basal metabolism comparing to the other leaves. Xerophyte Thermophyte Hydrophyte Halophyte Sofradžija A., ... metabolism). Solar plants, for example, are mullein, ling, thyme and soft velcro, white clover, and most roses. They are common ...

*Operating temperature

In humans, the hypothalamus regulates metabolism, and hence the basal metabolic rate. Amongst its functions is the regulation ... The lowest normal temperature of a mammal, the basal body temperature, is achieved during sleep. In women, it is affected by ... whereas hypothermia is a condition in which the body's core temperature drops below that required for normal metabolism, and ...

*Eugene Floyd DuBois

DuBois mapped out basal metabolism for aging men, which he published in 1916. The Aub-DuBois table is still in use today. He ... DuBois thought his "chief contribution was popularizing the simple, fundamental principles of metabolism in disease so that ...

*Brain

Most vertebrate species devote between 2% and 8% of basal metabolism to the brain. In primates, however, the percentage is much ... The basal ganglia are the central site at which decisions are made: the basal ganglia exert a sustained inhibitory control over ... The basal ganglia are a group of interconnected structures in the forebrain. The primary function of the basal ganglia appears ... All vertebrates have a blood-brain barrier that allows metabolism inside the brain to operate differently from metabolism in ...

*Human power

Normal human metabolism produces heat at a basal metabolic rate of around 80 watts. During a bicycle race, a well trained ...

*Thermoregulation

Arends, A; Bonaccorso, FJ; Genoud, M (1995). "Basal rates of metabolism of nectarivorous bats (Phyllostomidae) from a semiarid ... The basal body temperature ranges between 36.7-37.3 °C (98.1-99.2 °F) throughout the luteal phase, and drops down to pre- ... The effect of too extreme a cold is to decrease metabolism, and hence to lessen the production of heat. Both catabolic and ... However, too high a temperature speeds up the metabolism of different tissues to such a rate that their metabolic capital is ...

*Kleptothermy

doi:10.1111/j.1442-9993.2008.01923.x Arends A, Bonaccorso FJ, Genoud M. (1995). Basal rates of metabolism of nectarivorous bats ...

*Chronic myelogenous leukemia

It may also present with mild fever and night sweats due to an elevated basal level of metabolism. Some (. 20% basophils in the ...

*Kleiber's law

Hence any limits that affect the scaling of basal metabolic rate would in fact make elevated metabolism - and hence all animal ... Basal metabolic rate is then the convex combination of these two effects: if the proportion of useful work is f, then the basal ... Dodds PS, Rothman DH, Weitz JS (March 2001). "Re-examination of the "3/4-law" of metabolism". Journal of Theoretical Biology. ... In most organisms, metabolism is supported by a circulatory system featuring branching tubules (i.e., plant vascular systems, ...

*Thermoregulation

Arends, A; Bonaccorso, FJ; Genoud, M (1995). "Basal rates of metabolism of nectarivorous bats (Phyllostomidae) from a semiarid ... The basal body temperature ranges between 36.7-37.3 °C (98.1-99.2 °F) throughout the luteal phase, and drops down to pre- ... The effect of too extreme a cold is to decrease metabolism, and hence to lessen the production of heat. Both catabolic and ... During the follicular phase (which lasts from the first day of menstruation until the day of ovulation), the average basal body ...

*Brain

... of basal metabolism to the brain. In primates, however, the percentage is much higher-in humans it rises to 20-25%.[76] The ... The basal ganglia are a group of interconnected structures in the forebrain. The primary function of the basal ganglia appears ... Metabolism. All vertebrates have a blood-brain barrier that allows metabolism inside the brain to operate differently from ... at the heart of which lie the basal ganglia, a set of interconnected areas at the base of the forebrain.[47] The basal ganglia ...

*Black-bellied fruit bat

They have a basal rate metabolism of only 74% of what is expected for a mammal of its size. Black-bellied fruit bats may enter ...

*Metabolic equivalent

Anthropogenic metabolism Basal metabolic rate Calorimetry VO2max vVO2max ANSI/ASHRAE Standard 55, Thermal Environmental ... This is illustrated by the fact that sleeping has a MET of 0.9, while an individual's normal sleeping metabolism may be greater ... It must not be confused or misused as an approximation of Basal Metabolic Rate (BMR), which is the minimum metabolic rate ... is used by convention and refers to a typical metabolism at rest of an "average" individual. ...

*Miss Veedol

Pisculli was to take blood samples during the flight, and the basal metabolism tests would have been repeated on arrival in ... For the purpose of the first study, the three crew members underwent pre-flight physical examinations, basal metabolism tests, ...

*Treadmill desk

A treadmill desk is not intended to provide aerobic exercise, but rather to keep the user's metabolism over the basal metabolic ...

*Alpha-2B adrenergic receptor

... this polymorphic form is also associated with reduced basal metabolic rate in obese subjects and may therefore contribute to ... The Journal of Clinical Endocrinology and Metabolism. 84 (7): 2429-33. doi:10.1210/jc.84.7.2429. PMID 10404816. Hein L, Altman ... "Identification of a three-amino acid deletion in the alpha2B-adrenergic receptor that is associated with reduced basal ...

*Maude Abbott

"The determination of basal metabolism by the "Respiratory-valve and spirometer method" of indirect calorimetry, with an ...

*Intermittent fasting

... on basal metabolism, maximal strength, body composition, inflammation, and cardiovascular risk factors in resistance-trained ... Intermittent fasting has been found to have beneficial effects in healthy and obese adults for reducing basal insulin, ... Longo, Valter D; Mattson, Mark P (2014). "Fasting: Molecular Mechanisms and Clinical Applications". Cell Metabolism. 19 (2): ...

*Food web

The base or basal species in a food web are those species without prey and can include autotrophs or saprophytic detritivores ( ... basic to metabolism."[28]:1230-1231 The units in energy flow webs are typically a measure mass or energy per m2 per unit time. ... Basal species, such as plants, form the first level and are the resource limited species that feed on no other living creature ... Basal species can be autotrophs or detritivores, including "decomposing organic material and its associated microorganisms ...

*Herbert Gastineau Earle

He carried out researches in metabolism and many of his papers including one on the Basal Metabolism of Chinese and Westerners ... Basal Metabolism with Special Reference to Chinese Students (1923) An Imperial Policy in Education (1926) Report on the Lester ... Basal Metabolism of Chinese and Westerners (1928) "Congregation (1936) - Herbert Gastineau EARLE". University of Hong Kong. " ...

Basal metabolism characteristicsBasal metabolism characteristics

Types of basal metabolism. Depending on how we "burn"calories, we can define the basal metabolism as:. * "Normal" basal ... BASAL METABOLISM DEFINITION. What is basal metabolism?. The amount of energy consumed by a person at rest is known as basal ... Factors that determine basal metabolism. The basal metabolic rate tends to depend on genetic factors. Heredity determines in ... basal Metabolism: the body at rest has a higher caloric expenditure than would be normal. People with this type of metabolism ...
more infohttps://www.botanical-online.com/english/basalmetabolism.htm

What Is Basal Metabolism? | Healthy Eating | SF GateWhat Is Basal Metabolism? | Healthy Eating | SF Gate

Basal metabolism only refers to the basic, or least, amount of energy your body needs to survive when youre resting. It does ... Metabolism comprises everything that goes on inside your body to maintain and build tissues, produce energy and ensure you stay ... Basal Metabolism. Think of basal metabolism as the number of calories your body burns for energy even when youre sleeping. ... Factors Affecting Basal Metabolism. Several factors influence your basal metabolism. Some people have a higher metabolic rate ...
more infohttps://healthyeating.sfgate.com/basal-metabolism-8850.html

The energy requirement of normal three- and four-year-old children under standard basal metabolism conditions and during...The energy requirement of normal three- and four-year-old children under standard basal metabolism conditions and during...

... and four-year-old children under standard basal metabolism conditions and during periods of quiet play,. [Elda Robb] ... metabolism> # Basal Metabolism a schema:Intangible ;. schema:name "Basal Metabolism"@en ;. . ... schema:about basal_metabolism> ; # Basal Metabolism schema: ... Add tags for "The energy requirement of normal three- and four-year-old children under standard basal metabolism conditions and ...
more infohttp://www.worldcat.org/title/energy-requirement-of-normal-three-and-four-year-old-children-under-standard-basal-metabolism-conditions-and-during-periods-of-quiet-play/oclc/4106735

Bone, basal metabolism link depends on vitamin D levelBone, basal metabolism link depends on vitamin D level

... the correlation between bone metabolism and basal metabolism seems to be dependent on serum 25-hydroxyvitamin D (25[OH]D) ... the correlation between bone metabolism and basal metabolism seems to be dependent on serum 25-hydroxyvitamin D (25[OH]D) ... Bone, basal metabolism link depends on vitamin D level. April 5, 2017 ... "Restoration of vitamin D level may be a prerequisite for a normal correlation between bone and basal metabolism in T2DMPW," the ...
more infohttps://medicalxpress.com/news/2017-04-bone-basal-metabolism-link-vitamin.html

Plants | Free Full-Text | Increasing Phosphatidylinositol (4,5)-Bisphosphate Biosynthesis Affects Basal Signaling and...Plants | Free Full-Text | Increasing Phosphatidylinositol (4,5)-Bisphosphate Biosynthesis Affects Basal Signaling and...

In addition, transcripts of genes involved in starch metabolism such as SEX1 (glucan water dikinase) and SEX4 (phosphoglucan ... Plasma membranes from transgenic Arabidopsis expressing HsPIPKIα had 2-3 fold higher PIP5K specific activity, and basal InsP3 ... Our results reveal that increasing the phosphoinositide (PI) pathway affects chloroplast carbon metabolism and suggest that ... InsP3 is one component of an inter-organelle signaling network regulating chloroplast metabolism. ...
more infohttp://mdpi.com/2223-7747/3/1/27

9: You Can Calculate Your Basal Metabolic Rate - 10 Things Dieters Need to Know About Metabolism | HowStuffWorks9: You Can Calculate Your Basal Metabolic Rate - 10 Things Dieters Need to Know About Metabolism | HowStuffWorks

The trick is to figure out how fast or slow your metabolism is -- thats called your Basal Metabolic Rate (BMR) -- and then ... BMR is an important piece of how to work with your metabolism to lose weight because it measures how many calories you burn ...
more infohttps://health.howstuffworks.com/wellness/diet-fitness/weight-loss/10-things-dieters-need-to-know-about-metabolism2.htm

Proximal tubule-specific glutamine synthetase deletion alters basal and acidosis-stimulated ammonia metabolism | Renal...Proximal tubule-specific glutamine synthetase deletion alters basal and acidosis-stimulated ammonia metabolism | Renal...

Proximal tubule-specific glutamine synthetase deletion alters basal and acidosis-stimulated ammonia metabolism. Hyun-Wook Lee, ... This studys purpose was to determine the role of proximal tubule glutamine synthetase in ammonia metabolism under basal ... Proximal tubule-specific glutamine synthetase deletion alters basal and acidosis-stimulated ammonia metabolism ... Proximal tubule-specific glutamine synthetase deletion alters basal and acidosis-stimulated ammonia metabolism ...
more infohttp://ajprenal.physiology.org/content/early/2016/03/17/ajprenal.00547.2015

The Effect of Change of Residence from Temperate to Tropical Climate on the Basal Metabolism, Weight, Pulse Rate, Blood...The Effect of Change of Residence from Temperate to Tropical Climate on the Basal Metabolism, Weight, Pulse Rate, Blood...

The average for the whole series is a rise of 0.3°F. 5. With regard to basal metabolism, two sharply marked types of behaviour ... From the combined study of 21 women in the basal state, the following conclusions may be drawn: 1. The weight tends to decrease ... Both series show a greater rise in temperature in the tropics in those women whose metabolism does not change. Both series also ... Eight, or 38 per cent of these 21 women, showed no significant change in metabolism. Thirteen, or 62 per cent showed a distinct ...
more infohttp://www.ajtmh.org/content/journals/10.4269/ajtmh.1940.s1-20.669

FACTORS INFLUENCING THE CORRELATION BETWEEN DIFFERENCES OF ELECTRIC POTENTIAL IN THE SKIN OF HUMAN SUBJECTS AND BASAL...FACTORS INFLUENCING THE CORRELATION BETWEEN DIFFERENCES OF ELECTRIC POTENTIAL IN THE SKIN OF HUMAN SUBJECTS AND BASAL...

INFLUENCING THE CORRELATION BETWEEN DIFFERENCES OF ELECTRIC POTENTIAL IN THE SKIN OF HUMAN SUBJECTS AND BASAL METABOLISM. ... Within the normal range of metabolism there appears to be a definite correlation between the metabolic rates and the difference ... INFLUENCING THE CORRELATION BETWEEN DIFFERENCES OF ELECTRIC POTENTIAL IN THE SKIN OF HUMAN SUBJECTS AND BASAL METABOLISM ... between electric potentials and the circulation of the blood per se than between electric potentials and the metabolism of the ...
more infohttp://jem.rupress.org/content/54/6/789

Basal metabolism of fifty-four freshman women at Kansas State CollegeBasal metabolism of fifty-four freshman women at Kansas State College

... K-REx Repository. Search K-REx. This Collection. ... Basal metabolism of fifty-four freshman women at Kansas State College. Shinkle, Virginia ...
more infohttp://krex.k-state.edu/dspace/handle/2097/16711

Comparative analyses of basal rate of metabolism in mammals: data selection does matter  - Zurich Open Repository and ArchiveComparative analyses of basal rate of metabolism in mammals: data selection does matter - Zurich Open Repository and Archive

Genoud, Michel; Isler, Karin; Martin, Robert D (2018). Comparative analyses of basal rate of metabolism in mammals: data ... Basal rate of metabolism (BMR) is a physiological parameter that should be measured under strictly defined experimental ... Basal rate of metabolism (BMR) is a physiological parameter that should be measured under strictly defined experimental ... Comparative analyses of basal rate of metabolism in mammals: data selection does matter ...
more infohttps://www.zora.uzh.ch/id/eprint/138674/

Genetic variation in arsenic (+3 oxidation state) methyltransferase (AS3MT), arsenic metabolism and risk of basal cell...Genetic variation in arsenic (+3 oxidation state) methyltransferase (AS3MT), arsenic metabolism and risk of basal cell...

Exposure to inorganic arsenic increases the risk of basal cell carcinoma (BCC). Arsenic metabolism is a susceptibility factor ... Exposure to inorganic arsenic increases the risk of basal cell carcinoma (BCC). Arsenic metabolism is a susceptibility factor ... Genetic variation in arsenic (+3 oxidation state) methyltransferase (AS3MT), arsenic metabolism and risk of basal cell ... The fact that AS3MT haplotype status modified arsenic metabolism, and in turn the arsenic-related BCC risk, supports a causal ...
more infohttps://lup.lub.lu.se/search/publication/45bcb445-d86a-4531-a013-772957920bc9

Coffee and tea consumption in relation to inflammation and basal glucose metabolism in a multi-ethnic Asian population: a cross...Coffee and tea consumption in relation to inflammation and basal glucose metabolism in a multi-ethnic Asian population: a cross...

Coffee and tea consumption in relation to inflammation and basal glucose metabolism in a multi-ethnic Asian population: a cross ... but found no evidence for an association between tea consumption and basal glucose metabolism. ... The aim of this study was to evaluate the associations between habitual coffee and tea consumption and glucose metabolism in a ... Apart from its anti-inflammatory effects, phenolic compounds in coffee have been postulated to affect glucose metabolism ...
more infohttps://nutritionj.biomedcentral.com/articles/10.1186/1475-2891-10-61

THE RELATION OF HEART WEIGHT TO THE BASAL METABOLISM AS VARIED BY THYROID ADMINISTRATION  | Journal of Experimental Medicine |...THE RELATION OF HEART WEIGHT TO THE BASAL METABOLISM AS VARIED BY THYROID ADMINISTRATION | Journal of Experimental Medicine |...

THE RELATION OF HEART WEIGHT TO THE BASAL METABOLISM AS VARIED BY THYROID ADMINISTRATION Francis M. Smith Francis M. Smith ... Francis M. Smith, Eaton M. MacKay; THE RELATION OF HEART WEIGHT TO THE BASAL METABOLISM AS VARIED BY THYROID ADMINISTRATION . J ... It is suggested that this increase in heart weight which follows the increase in metabolism after thyroid is in the nature of a ... A linear relationship exists in the albino rat between the heart weight and the basal metabolic rate when varied by the ...
more infohttps://rupress.org/jem/article/55/6/903/26155/THE-RELATION-OF-HEART-WEIGHT-TO-THE-BASAL

Behavior of the basal metabolism after i.p. injection of serotonin in normal and pregnant rats at 20 C in the daytime]. -...Behavior of the basal metabolism after i.p. injection of serotonin in normal and pregnant rats at 20 C in the daytime]. -...

Behavior of the basal metabolism after i.p. injection of serotonin in normal and pregnant rats at 20 C in the daytime]. by ... Behavior of the basal metabolism after i.p. injection of serotonin in normal and pregnant rats at 20 C in the daytime].. @ ... article{Brizzi1987BehaviorOT, title={[Behavior of the basal metabolism after i.p. injection of serotonin in normal and pregnant ... Disorders of Dopamine & Disorders of Dopamine & Serotonin Metabolism Serotonin Metabolism. Simon Heales • Oct 06, 2016 ...
more infohttps://www.semanticscholar.org/paper/%5BBehavior-of-the-basal-metabolism-after-i.p.-of-in-Brizzi-Balbi/60e6ed85e0f470816ea568f6328e113c24b6a15a

Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal strength, body composition, inflammation,...Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal strength, body composition, inflammation,...

Moro, T., Tinsley, G., Bianco, A. et al. Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal ... Effects of eight weeks of time-restricted feeding (16/8) on basal metabolism, maximal strength, body composition, inflammation ... Table 2 Diet composition and macronutrients distribution at basal level and during the experimental period in both groups. Full ... Effects of modified alternate-day fasting regimens on adipocyte size, triglyceride metabolism, and plasma adiponectin levels in ...
more infohttps://translational-medicine.biomedcentral.com/articles/10.1186/s12967-016-1044-0?__s=ovzgowspzgzjrjm83r95

Whole body and forearm substrate metabolism in hyperthyroidism: Evidence of increased basal muscle protein breakdown<...Whole body and forearm substrate metabolism in hyperthyroidism: Evidence of increased basal muscle protein breakdown<...

Whole body and forearm substrate metabolism in hyperthyroidism: Evidence of increased basal muscle protein breakdown. American ... Whole body and forearm substrate metabolism in hyperthyroidism : Evidence of increased basal muscle protein breakdown. In: ... Whole body and forearm substrate metabolism in hyperthyroidism : Evidence of increased basal muscle protein breakdown. / Riis, ... T1 - Whole body and forearm substrate metabolism in hyperthyroidism. T2 - Evidence of increased basal muscle protein breakdown ...
more infohttps://mayoclinic.pure.elsevier.com/en/publications/whole-body-and-forearm-substrate-metabolism-in-hyperthyroidism-ev

Aberrant basal ganglia metabolism in fragile X syndrome: a magnetic resonance spectroscopy study | Journal of...Aberrant basal ganglia metabolism in fragile X syndrome: a magnetic resonance spectroscopy study | Journal of...

Aberrant basal ganglia metabolism in fragile X syndrome: a magnetic resonance spectroscopy study. ... Mayer D, Zahr NM, Sullivan EV, Pfefferbaum A: In vivo metabolite differences between the basal ganglia and cerebellum of the ... metabolism. Furthermore, sex differences or medication usage may have obscured the relationship between cognitive/behavioral ... because its concentration remains stable regardless of changes in energy metabolism or disease progression [51], although ...
more infohttps://jneurodevdisorders.biomedcentral.com/articles/10.1186/1866-1955-5-20

Basal Metabolic Rate: How To Increase Metabolism FastBasal Metabolic Rate: How To Increase Metabolism Fast

This BMR chart shows you how much your metabolism slows with aging. Only one scientifically proven method will quickly increase ... Basal Metabolic Rate: How To Increase Metabolism Fast. Superfoodly. September 21, 2017. ... Why is my metabolism so slow? (That can be true!). Now it is 100% true that your metabolism can be dramatically slower than the ... I like this article and its possibly the best one Ive read on metabolism. Ive been lucky to have kept my metabolism ...
more infohttps://www.superfoodly.com/basal-metabolic-rate-way-how-to-increase-metabolism-fast/

Metabolic rate - Simple English Wikipedia, the free encyclopediaMetabolic rate - Simple English Wikipedia, the free encyclopedia

Basal metabolism[change , change source]. Basal metabolism is usually by far the largest component of total energy used. The ... Metabolic rate is the rate of metabolism, the amount of energy used by an animal per unit of time. Basal metabolic rate (BMR) ... Energy metabolism as related to body size and respiratory surfaces, and its evolution. Rep. Steno. Mem. Hosp. 9, 1-110. ... On a log-log scale, the metabolism of mammals as related to their body size forms a straight line with a slope of about 0.75. ...
more infohttps://simple.wikipedia.org/wiki/Metabolic_rate

Improved Plasma Glucose Control, Whole-Body Glucose Utilization, and Lipid Profile on a Low-Glycemic Index Diet in Type 2...Improved Plasma Glucose Control, Whole-Body Glucose Utilization, and Lipid Profile on a Low-Glycemic Index Diet in Type 2...

Basal and insulin-mediated glucose metabolism. Whole-body peripheral insulin sensitivity measured by the clamp technique was ... Glucose and insulin metabolism during the metabolic profiles. As shown in Table 3 and Fig. 1, fasting plasma glucose level fell ... McGarry J: Banting Lecture 2001: Dysregulation of fatty acid metabolism in the etiology of type 2 diabetes. Diabetes 51:7-18, ... Groop LC, Bonadonna RC, DelPrato S, Ratheiser K, Zyck K, Ferrannini E, DeFronzo RA: Glucose and free fatty acid metabolism in ...
more infohttps://care.diabetesjournals.org/node/15214.full.print

Glossary of scientific termsGlossary of scientific terms

Basal metabolism. The minimum amount of energy required to maintain vital functions at complete rest, measured by the basal ... Basal cell carcinoma. A type of cancer of the basal cells at the bottom of the epidermis. The most common form of skin cancer. ... through basal metabolism and physical activity. Also the degree to which intake exceeds expenditure (positive energy balance) ... Basal cell carcinomas are usually found on areas of the body exposed to the sun. They rarely metastasise (spread) to other ...
more infohttps://www.wcrf.org/dietandcancer/glossary

Glossary of Veterinary Terms | petMDGlossary of Veterinary Terms | petMD

basal metabolism. The minimum amount of energy require to perform vital bodily functions and cellular activity while at ... basal feed. Any feed that is given to a horse mainly for the energy it can give and not usually for other nutritional benefits. ...
more infohttps://www.petmd.com/veterinaryterms/b

Serotonin and its metabolism in basal deuterostomes: Insights from Strongylocentrotus purpuratus and Xenoturbella bocki<...Serotonin and its metabolism in basal deuterostomes: Insights from Strongylocentrotus purpuratus and Xenoturbella bocki<...

Serotonin and its metabolism in basal deuterostomes: Insights from Strongylocentrotus purpuratus and Xenoturbella bocki. ... Serotonin and its metabolism in basal deuterostomes : Insights from Strongylocentrotus purpuratus and Xenoturbella bocki. / ... Serotonin and its metabolism in basal deuterostomes: Insights from Strongylocentrotus purpuratus and Xenoturbella bocki. ... T1 - Serotonin and its metabolism in basal deuterostomes. T2 - Insights from Strongylocentrotus purpuratus and Xenoturbella ...
more infohttps://experts.illinois.edu/en/publications/serotonin-and-its-metabolism-in-basal-deuterostomes-insights-from
  • An important result of the investigation was the close agreement found in the determination of the metabolism by the direct and indirect methods of calorimetry. (jamanetwork.com)
  • 100 years later in the 19th century for the Connecticut-based Wesleyan University, Professors Atwater and Rosa provided ample evidence of nitrogen, carbon dioxide, and oxygen transport during the metabolism of amino acids, glucose, and fatty acids in human subjects, further establishing the value of indirect calorimetry in determining bioenergetics of free-living humans. (wikipedia.org)
  • In addition, transcripts of genes involved in starch metabolism such as SEX1 (glucan water dikinase) and SEX4 (phosphoglucan phosphatase), DBE (debranching enzyme), MEX1 (maltose transporter), APL3 (ADP-glucose pyrophosphorylase) and glucose-6-phosphate transporter (Glc6PT) were up-regulated in the Hs PIPKIα plants. (mdpi.com)
  • Higher coffee consumption has been associated with a lower risk of type 2 diabetes in cohort studies, but the physiological pathways through which coffee affects glucose metabolism are not fully understood. (biomedcentral.com)
  • The aim of this study was to evaluate the associations between habitual coffee and tea consumption and glucose metabolism in a multi-ethnic Asian population and possible mediation by inflammation. (biomedcentral.com)
  • OBJECTIVE -To determine whether a chronic low-glycemic index (LGI) diet, compared with a high-glycemic index (HGI) diet, has beneficial effects on plasma glucose control, lipid metabolism, total fat mass, and insulin resistance in type 2 diabetic patients. (diabetesjournals.org)
  • Mice with heart-specific overexpression of peroxisome proliferator-activated receptor (PPAR)α showed a metabolic and cardiomyopathic phenotype similar to the diabetic heart, and we determined tissue-specific glucose metabolism and insulin action in vivo during hyperinsulinemic-euglycemic clamps in awake myosin heavy chain (MHC)-PPARα mice (12-14 weeks of age). (diabetesjournals.org)
  • Basal and insulin-stimulated glucose uptake in heart was significantly reduced in the MHC-PPARα mice, and cardiac insulin resistance was mostly attributed to defects in insulin-stimulated activities of insulin receptor substrate (IRS)-1-associated phosphatidylinositol (PI) 3-kinase, Akt, and tyrosine phosphorylation of signal transducer and activator of transcription 3 (STAT3). (diabetesjournals.org)
  • Relationship of dietary fat to glucose metabolism. (nih.gov)
  • The relationship between dietary fat and glucose metabolism has been recognized for at least 60 years. (nih.gov)
  • This impairment is associated with decreased basal and insulin-stimulated glucose metabolism. (nih.gov)
  • Epidemiological data in humans suggest that subjects with higher intakes of fat are more prone to develop disturbances in glucose metabolism, type 2 diabetes or impaired glucose tolerance, than subjects with lower intakes of fat. (nih.gov)
  • Metabolic studies suggest that higher-fat diets containing a higher proportion of unsaturated fat result in better measures of glucose metabolism than high-carbohydrate diet. (nih.gov)
  • Clearly, the area of dietary fat and glucose metabolism has yet to be fully elucidated. (nih.gov)
  • Metabolism is usually divided into two categories: catabolism, the breaking down of organic matter for example, the breaking down of glucose to pyruvate, by cellular respiration, and anabolism, the building up of components of cells such as proteins and nucleic acids. (wikipedia.org)
  • Amino acids also contribute to cellular energy metabolism by providing a carbon source for entry into the citric acid cycle (tricarboxylic acid cycle), especially when a primary source of energy, such as glucose, is scarce, or when cells undergo metabolic stress. (wikipedia.org)
  • Currently he is chair of the Division of Preventive, Occupational and Aerospace Medicine with a joint appointment in the Division of Endocrinology, Diabetes, Metabolism, & Nutrition , and not to mention, an associate professor of preventive medicine and nutrition. (superfoodly.com)
  • article{45bcb445-d86a-4531-a013-772957920bc9, abstract = {Exposure to inorganic arsenic increases the risk of basal cell carcinoma (BCC). (lu.se)
  • Within the normal range of metabolism there appears to be a definite correlation between the metabolic rates and the difference of electric potential over a specified area of the skin, provided the person under test has no abnormalities of the circulatory system or of the functions of the skin. (rupress.org)
  • One study of 150 adults representative of the population in Scotland reported basal metabolic rates from as low as 1027 kcal per day (4301 kJ) to as high as 2499 kcal (10455 kJ). (wikipedia.org)
  • Barceló G, Love OP, Vézina F (2017) Uncoupling basal and summit metabolic rates in white-throated sparrows: digestive demand drives maintenance costs but changes in muscle mass are not needed to improve thermogenic capacity. (springer.com)
  • Genetic variation in arsenic (+3 oxidation state) methyltransferase (AS3MT), arsenic metabolism and risk of basal cell carcinoma in a European population. (lu.se)
  • The peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors belonging to the nuclear receptor superfamily, and of the three identified mammalian PPAR subtypes (α, γ, and δ), PPARα regulates nuclear expression of genes involved in lipid metabolism in various cell types including heart ( 6 , 7 ). (diabetesjournals.org)
  • Address correspondence and reprint requests to Prof. Jason K. Kim, Yale University School of Medicine, Department of Internal Medicine, Section of Endocrinology and Metabolism, The Anlyan Center, S269C, P.O. Box 208020, 300 Cedar St., New Haven, CT 06520-8020. (diabetesjournals.org)
  • We used insulin withdrawal followed by insulin administration as a clinical model to define effects on substrate metabolism and to test whether increased levels of counter-regulatory hormones and cytokines and altered adipose tissue signalling participate in the early phases of DKA. (springer.com)
  • Decreasing your metabolism means you are "turning down" your body's internal furnaces, which lowers your calorie requirements. (wikihow.com)
  • Although your metabolism influences your body's basic energy needs, how much you eat and drink along with how much physical activity you get are the things that ultimately determine your weight. (mayoclinic.org)
  • Maximum strength combination, to protect your immune system, control blood pressure and regulate basal metabolism! (healthplus.co.uk)
  • But because metabolism is a natural process, your body has many mechanisms that regulate it to meet your individual needs. (mayoclinic.org)
  • The deviation in gas composition from atmospheric values occurred concurrently with increased microbial cell concentrations in the basal ice profile, suggesting that in situ microbial processes ( i.e. , aerobic respiration) may have altered the entrapped gas composition. (mdpi.com)
  • en] To study the mechanism of oxygen regulation in inflammation-induced acute kidney injury, we investigate the effects of a bacterial endotoxin (lipopolysaccharide, LPS) on the basal respiration of proximal tubular epithelial cells (HK-2) both by high-resolution respirometry and electron spin resonance spectroscopy. (uliege.be)
  • It tones the muscles and stimulates basal metabolism. (health24.com)
  • On a log-log scale, the metabolism of mammals as related to their body size forms a straight line with a slope of about 0.75. (wikipedia.org)
  • This makes BMR a variant of standard metabolic rate measurement that excludes the temperature data, a practice that has led to problems in defining "standard" rates of metabolism for many mammals. (wikipedia.org)
  • HealthDay)-For postmenopausal women with type 2 diabetes mellitus (T2DMPW), the correlation between bone metabolism and basal metabolism seems to be dependent on serum 25-hydroxyvitamin D (25[OH]D) levels, according to a study published online March 31 in the Journal of Diabetes Investigation . (medicalxpress.com)
  • Restoration of vitamin D level may be a prerequisite for a normal correlation between bone and basal metabolism in T2DMPW," the authors write. (medicalxpress.com)
  • These experimental results indicate that there may be a more direct correlation between electric potentials and the circulation of the blood per se than between electric potentials and the metabolism of the body per se . (rupress.org)
  • We also want to test the potential link between this basal metabolism modification and mitochondrial dysfunction and somatotrope axis, and correlation between the basal metabolism degree and global severity of the disease. (clinicaltrials.gov)
  • Benedict FG (1938) Vital energetics: a study in comparative basal metabolism. (springer.com)
  • The word metabolism can also refer to the sum of all chemical reactions that occur in living organisms, including digestion and the transport of substances into and between different cells, in which case the set of reactions within the cells is called intermediary metabolism or intermediate metabolism. (wikipedia.org)
  • Melatonin influences antioxidant homeostasis and basal metabolism in the BALB/c mouse model. (nel.edu)
  • Pohanka M, Bandouchova H, Pikula J. Melatonin influences antioxidant homeostasis and basal metabolism in the BALB/c mouse model. (nel.edu)
  • To address this latter requirement, first author Usman Khan and colleagues used high-resolution cerebral blood volume (CBV) functional MRI to assess brain metabolism and, by proxy, neuronal activity. (alzforum.org)
  • Eric M. Reiman on Basal cerebral metabolism may modulate the cognitive effects of Abeta in mild cognitive impairment: an example of brain reserve. (alzforum.org)
  • Measurements have been made under basal conditions of weight, pulse, blood pressure, mouth temperature, and metabolism of twelve English and American women changing their residence from temperate to tropical climates (South India). (ajtmh.org)
  • The basal metabolism rate is usually measured indirectly by calculation from measurements of the amounts of oxygen and carbon dioxide exchanged during breathing under certain standard conditions, i.e., complete rest in a room temperature of 68°C (20°C), 12 to 14 hours after ingestion of food. (infoplease.com)
  • The implication of this observation is that contamination of BMR data with non-basal measurements is likely to increase the BMR scaling exponent even if the contamination is randomly distributed with respect to M b . (biologists.org)
  • Artificially elevated scaling exponents can therefore be accounted for by the inclusion of measurements that fail to satisfy the requirements for basal metabolism, which are strictly defined (adult, non-reproductive, postabsorptive animals resting in a thermoneutral environment during the inactive circadian phase). (biologists.org)
  • Studies also showed that by eliminating the sex differences that occur with the accumulation of adipose tissue by expressing metabolic rate per unit of "fat-free" or lean body mass , the values between sexes for basal metabolism are essentially the same. (wikipedia.org)
  • Such an agreement, together with the finding of normal respiratory quotients, makes it probable that the metabolism in heart disease is not of an essentially abnormal type, and justifies the use of the indirect method in future work. (jamanetwork.com)
  • Arsenic metabolism is a susceptibility factor for arsenic toxicity, and specific haplotypes in arsenic (+3 oxidation state) methyltransferase (AS3MT) have been associated with increased urinary fractions of the most toxic arsenic metabolite, methylarsonic acid (MMA). (lu.se)
  • Behavior of the basal metabolism after i.p. injection of serotonin in normal and pregnant rats at 20 C in the daytime]. (semanticscholar.org)
  • Additionally, age-associated hepatic insulin resistance develops in MHC-PPARα mice that may be due to altered cardiac metabolism, functions, and/or inflammatory cytokines. (diabetesjournals.org)