Protons: Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.Proton Pumps: Integral membrane proteins that transport protons across a membrane. This transport can be linked to the hydrolysis of ADENOSINE TRIPHOSPHATE. What is referred to as proton pump inhibitors frequently is about POTASSIUM HYDROGEN ATPASE.Proton-Translocating ATPases: Multisubunit enzymes that reversibly synthesize ADENOSINE TRIPHOSPHATE. They are coupled to the transport of protons across a membrane.Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.Calcium-Transporting ATPases: Cation-transporting proteins that utilize the energy of ATP hydrolysis for the transport of CALCIUM. They differ from CALCIUM CHANNELS which allow calcium to pass through a membrane without the use of energy.Vacuolar Proton-Translocating ATPases: Proton-translocating ATPases that are involved in acidification of a variety of intracellular compartments.Proton Pump Inhibitors: Compounds that inhibit H(+)-K(+)-EXCHANGING ATPASE. They are used as ANTI-ULCER AGENTS and sometimes in place of HISTAMINE H2 ANTAGONISTS for GASTROESOPHAGEAL REFLUX.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Magnetic Resonance Spectroscopy: Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).Adenosine Triphosphate: An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.Proton-Motive Force: Energy that is generated by the transfer of protons or electrons across an energy-transducing membrane and that can be used for chemical, osmotic, or mechanical work. Proton-motive force can be generated by a variety of phenomena including the operation of an electron transport chain, illumination of a PURPLE MEMBRANE, and the hydrolysis of ATP by a proton ATPase. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed, p171)Kinetics: The rate dynamics in chemical or physical systems.Plasma Membrane Calcium-Transporting ATPases: Calcium-transporting ATPases found on the PLASMA MEMBRANE that catalyze the active transport of CALCIUM from the CYTOPLASM into the extracellular space. They play a role in maintaining a CALCIUM gradient across plasma membrane.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Pralidoxime Compounds: Various salts of a quaternary ammonium oxime that reconstitute inactivated acetylcholinesterase, especially at the neuromuscular junction, and may cause neuromuscular blockade. They are used as antidotes to organophosphorus poisoning as chlorides, iodides, methanesulfonates (mesylates), or other salts.H(+)-K(+)-Exchanging ATPaseCation Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.Vacuoles: Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Dicyclohexylcarbodiimide: A carbodiimide that is used as a chemical intermediate and coupling agent in peptide synthesis. (From Hawley's Condensed Chemical Dictionary, 12th ed)Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Sodium-Potassium-Exchanging ATPase: An enzyme that catalyzes the active transport system of sodium and potassium ions across the cell wall. Sodium and potassium ions are closely coupled with membrane ATPase which undergoes phosphorylation and dephosphorylation, thereby providing energy for transport of these ions against concentration gradients.Hydrolysis: The process of cleaving a chemical compound by the addition of a molecule of water.Aspartic Acid: One of the non-essential amino acids commonly occurring in the L-form. It is found in animals and plants, especially in sugar cane and sugar beets. It may be a neurotransmitter.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Bacteriorhodopsins: Rhodopsins found in the PURPLE MEMBRANE of halophilic archaea such as HALOBACTERIUM HALOBIUM. Bacteriorhodopsins function as an energy transducers, converting light energy into electrochemical energy via PROTON PUMPS.Ca(2+) Mg(2+)-ATPaseArchaeoglobus fulgidus: A species of extremely thermophilic, sulfur-reducing archaea. It grows at a maximum temperature of 95 degrees C. in marine or deep-sea geothermal areas.Sarcoplasmic Reticulum Calcium-Transporting ATPases: Calcium-transporting ATPases that catalyze the active transport of CALCIUM into the SARCOPLASMIC RETICULUM vesicles from the CYTOPLASM. They are primarily found in MUSCLE CELLS and play a role in the relaxation of MUSCLES.Ion Transport: The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.Vanadates: Oxyvanadium ions in various states of oxidation. They act primarily as ion transport inhibitors due to their inhibition of Na(+)-, K(+)-, and Ca(+)-ATPase transport systems. They also have insulin-like action, positive inotropic action on cardiac ventricular muscle, and other metabolic effects.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Oxytropis: A plant genus of the family FABACEAE. Members contain SWAINSONINE.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Copper: A heavy metal trace element with the atomic symbol Cu, atomic number 29, and atomic weight 63.55.Hydrogen: The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight [1.00784; 1.00811]. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are PROTONS. Besides the common H1 isotope, hydrogen exists as the stable isotope DEUTERIUM and the unstable, radioactive isotope TRITIUM.Water: A clear, odorless, tasteless liquid that is essential for most animal and plant life and is an excellent solvent for many substances. The chemical formula is hydrogen oxide (H2O). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Valinomycin: A cyclododecadepsipeptide ionophore antibiotic produced by Streptomyces fulvissimus and related to the enniatins. It is composed of 3 moles each of L-valine, D-alpha-hydroxyisovaleric acid, D-valine, and L-lactic acid linked alternately to form a 36-membered ring. (From Merck Index, 11th ed) Valinomycin is a potassium selective ionophore and is commonly used as a tool in biochemical studies.Deoxyribonuclease HindIII: One of the Type II site-specific deoxyribonucleases (EC 3.1.21.4). It recognizes and cleaves the sequence A/AGCTT at the slash. HindIII is from Haemophilus influenzae R(d). Numerous isoschizomers have been identified. EC 3.1.21.-.Uric Acid: An oxidation product, via XANTHINE OXIDASE, of oxypurines such as XANTHINE and HYPOXANTHINE. It is the final oxidation product of purine catabolism in humans and primates, whereas in most other mammals URATE OXIDASE further oxidizes it to ALLANTOIN.Bacterial Proteins: Proteins found in any species of bacterium.Electron Transport Complex IV: A multisubunit enzyme complex containing CYTOCHROME A GROUP; CYTOCHROME A3; two copper atoms; and 13 different protein subunits. It is the terminal oxidase complex of the RESPIRATORY CHAIN and collects electrons that are transferred from the reduced CYTOCHROME C GROUP and donates them to molecular OXYGEN, which is then reduced to water. The redox reaction is simultaneously coupled to the transport of PROTONS across the inner mitochondrial membrane.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Bacterial Proton-Translocating ATPases: Membrane-bound proton-translocating ATPases that serve two important physiological functions in bacteria. One function is to generate ADENOSINE TRIPHOSPHATE by utilizing the energy provided by an electrochemical gradient of protons across the cellular membrane. A second function is to counteract a loss of the transmembrane ion gradient by pumping protons at the expense of adenosine triphosphate hydrolysis.Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.Biological Transport, Active: The movement of materials across cell membranes and epithelial layers against an electrochemical gradient, requiring the expenditure of metabolic energy.Chloroplast Proton-Translocating ATPases: Proton-translocating ATPases which produce ADENOSINE TRIPHOSPHATE in plants. They derive energy from light-driven reactions that develop high concentrations of protons within the membranous cisternae (THYLAKOIDS) of the CHLOROPLASTS.Nigericin: A polyether antibiotic which affects ion transport and ATPase activity in mitochondria. It is produced by Streptomyces hygroscopicus. (From Merck Index, 11th ed)Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Catalysis: The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.Proteolipids: Protein-lipid combinations abundant in brain tissue, but also present in a wide variety of animal and plant tissues. In contrast to lipoproteins, they are insoluble in water, but soluble in a chloroform-methanol mixture. The protein moiety has a high content of hydrophobic amino acids. The associated lipids consist of a mixture of GLYCEROPHOSPHATES; CEREBROSIDES; and SULFOGLYCOSPHINGOLIPIDS; while lipoproteins contain PHOSPHOLIPIDS; CHOLESTEROL; and TRIGLYCERIDES.Metallochaperones: A family of soluble metal binding proteins that are involved in the intracellular transport of specific metal ions and their transfer to the appropriate metalloprotein precursor.Models, Chemical: Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.Hydrogen Bonding: A low-energy attractive force between hydrogen and another element. It plays a major role in determining the properties of water, proteins, and other compounds.Electron Transport: The process by which ELECTRONS are transported from a reduced substrate to molecular OXYGEN. (From Bennington, Saunders Dictionary and Encyclopedia of Laboratory Medicine and Technology, 1984, p270)Shigella dysenteriae: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria that is extremely pathogenic and causes severe dysentery. Infection with this organism often leads to ulceration of the intestinal epithelium.Histidine: An essential amino acid that is required for the production of HISTAMINE.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Adenosine Diphosphate: Adenosine 5'-(trihydrogen diphosphate). An adenine nucleotide containing two phosphate groups esterified to the sugar moiety at the 5'-position.2S Albumins, Plant: A major class of water-soluble seed storage proteins. Many proteins from this class are major PLANT ALLERGENS.Choline: A basic constituent of lecithin that is found in many plants and animal organs. It is important as a precursor of acetylcholine, as a methyl donor in various metabolic processes, and in lipid metabolism.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Ions: An atom or group of atoms that have a positive or negative electric charge due to a gain (negative charge) or loss (positive charge) of one or more electrons. Atoms with a positive charge are known as CATIONS; those with a negative charge are ANIONS.Carbonyl Cyanide p-Trifluoromethoxyphenylhydrazone: A proton ionophore that is commonly used as an uncoupling agent in biochemical studies.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Magnesium: A metallic element that has the atomic symbol Mg, atomic number 12, and atomic weight 24.31. It is important for the activity of many enzymes, especially those involved in OXIDATIVE PHOSPHORYLATION.Schiff Bases: Condensation products of aromatic amines and aldehydes forming azomethines substituted on the N atom, containing the general formula R-N:CHR. (From Grant & Hackh's Chemical Dictionary, 5th ed)Gram-Negative Chemolithotrophic Bacteria: A large group of bacteria including those which oxidize ammonia or nitrite, metabolize sulfur and sulfur compounds, or deposit iron and/or manganese oxides.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Thermodynamics: A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)Crystallography, X-Ray: The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Membrane Potentials: The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).Potassium: An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.DNA Helicases: Proteins that catalyze the unwinding of duplex DNA during replication by binding cooperatively to single-stranded regions of DNA or to short regions of duplex DNA that are undergoing transient opening. In addition DNA helicases are DNA-dependent ATPases that harness the free energy of ATP hydrolysis to translocate DNA strands.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Omeprazole: A 4-methoxy-3,5-dimethylpyridyl, 5-methoxybenzimidazole derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits an H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.Protein Structure, Secondary: The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.Rhodobacter sphaeroides: Spherical phototrophic bacteria found in mud and stagnant water exposed to light.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Archaeal Proteins: Proteins found in any species of archaeon.Gramicidin: A group of peptide antibiotics from BACILLUS brevis. Gramicidin C or S is a cyclic, ten-amino acid polypeptide and gramicidins A, B, D are linear. Gramicidin is one of the two principal components of TYROTHRICIN.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Ion Channels: Gated, ion-selective glycoproteins that traverse membranes. The stimulus for ION CHANNEL GATING can be due to a variety of stimuli such as LIGANDS, a TRANSMEMBRANE POTENTIAL DIFFERENCE, mechanical deformation or through INTRACELLULAR SIGNALING PEPTIDES AND PROTEINS.Intracellular Membranes: Thin structures that encapsulate subcellular structures or ORGANELLES in EUKARYOTIC CELLS. They include a variety of membranes associated with the CELL NUCLEUS; the MITOCHONDRIA; the GOLGI APPARATUS; the ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.Halobacterium salinarum: A species of halophilic archaea found in salt lakes. Some strains form a PURPLE MEMBRANE under anaerobic conditions.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Endopeptidase Clp: An ATP-dependent protease found in prokaryotes, CHLOROPLASTS, and MITOCHONDRIA. It is a soluble multisubunit complex that plays a role in the degradation of many abnormal proteins.Cattle: Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Halobacterium: A genus of HALOBACTERIACEAE whose growth requires a high concentration of salt. Binary fission is by constriction.Molecular Chaperones: A family of cellular proteins that mediate the correct assembly or disassembly of polypeptides and their associated ligands. Although they take part in the assembly process, molecular chaperones are not components of the final structures.Thapsigargin: A sesquiterpene lactone found in roots of THAPSIA. It inhibits CA(2+)-TRANSPORTING ATPASE mediated uptake of CALCIUM into SARCOPLASMIC RETICULUM.Protein Structure, Quaternary: The characteristic 3-dimensional shape and arrangement of multimeric proteins (aggregates of more than one polypeptide chain).Anti-Ulcer Agents: Various agents with different action mechanisms used to treat or ameliorate PEPTIC ULCER or irritation of the gastrointestinal tract. This has included ANTIBIOTICS to treat HELICOBACTER INFECTIONS; HISTAMINE H2 ANTAGONISTS to reduce GASTRIC ACID secretion; and ANTACIDS for symptomatic relief.Arylsulfonates: Organic sulfonic acid esters or salts which contain an aromatic hydrocarbon radical.Membrane Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.Deuterium: Deuterium. The stable isotope of hydrogen. It has one neutron and one proton in the nucleus.Catalytic Domain: The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.Macromolecular Substances: Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.Hepatolenticular Degeneration: A rare autosomal recessive disease characterized by the deposition of copper in the BRAIN; LIVER; CORNEA; and other organs. It is caused by defects in the ATP7B gene encoding copper-transporting ATPase 2 (EC 3.6.3.4), also known as the Wilson disease protein. The overload of copper inevitably leads to progressive liver and neurological dysfunction such as LIVER CIRRHOSIS; TREMOR; ATAXIA and intellectual deterioration. Hepatic dysfunction may precede neurologic dysfunction by several years.Oligomycins: A closely related group of toxic substances elaborated by various strains of Streptomyces. They are 26-membered macrolides with lactone moieties and double bonds and inhibit various ATPases, causing uncoupling of phosphorylation from mitochondrial respiration. Used as tools in cytochemistry. Some specific oligomycins are RUTAMYCIN, peliomycin, and botrycidin (formerly venturicidin X).Menkes Kinky Hair Syndrome: An inherited disorder of copper metabolism transmitted as an X-linked trait and characterized by the infantile onset of HYPOTHERMIA, feeding difficulties, hypotonia, SEIZURES, bony deformities, pili torti (twisted hair), and severely impaired intellectual development. Defective copper transport across plasma and endoplasmic reticulum membranes results in copper being unavailable for the synthesis of several copper containing enzymes, including PROTEIN-LYSINE 6-OXIDASE; CERULOPLASMIN; and SUPEROXIDE DISMUTASE. Pathologic changes include defects in arterial elastin, neuronal loss, and gliosis. (From Menkes, Textbook of Child Neurology, 5th ed, p125)Static Electricity: The accumulation of an electric charge on a objectSarcoplasmic Reticulum: A network of tubules and sacs in the cytoplasm of SKELETAL MUSCLE FIBERS that assist with muscle contraction and relaxation by releasing and storing calcium ions.Molecular Structure: The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.Unfolded Protein Response: A cellular response to environmental insults that cause disruptions in PROTEIN FOLDING and/or accumulation of defectively folded protein in the ENDOPLASMIC RETICULUM. It consists of a group of regulatory cascades that are triggered as a response to altered levels of calcium and/or the redox state of the endoplasmic reticulum. Persistent activation of the unfolded protein response leads to the induction of APOPTOSIS.Endoplasmic Reticulum: A system of cisternae in the CYTOPLASM of many cells. In places the endoplasmic reticulum is continuous with the plasma membrane (CELL MEMBRANE) or outer membrane of the nuclear envelope. If the outer surfaces of the endoplasmic reticulum membranes are coated with ribosomes, the endoplasmic reticulum is said to be rough-surfaced (ENDOPLASMIC RETICULUM, ROUGH); otherwise it is said to be smooth-surfaced (ENDOPLASMIC RETICULUM, SMOOTH). (King & Stansfield, A Dictionary of Genetics, 4th ed)Fungal Proteins: Proteins found in any species of fungus.Nucleotides: The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)Transition Elements: Elements with partially filled d orbitals. They constitute groups 3-12 of the periodic table of elements.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Tamus: A plant genus of the DIOSCOREACEAE plant family.Plants: Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.Nuclear Magnetic Resonance, Biomolecular: NMR spectroscopy on small- to medium-size biological macromolecules. This is often used for structural investigation of proteins and nucleic acids, and often involves more than one isotope.Chromaffin Granules: Organelles in CHROMAFFIN CELLS located in the adrenal glands and various other organs. These granules are the site of the synthesis, storage, metabolism, and secretion of EPINEPHRINE and NOREPINEPHRINE.Cations: Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.Electrochemistry: The study of chemical changes resulting from electrical action and electrical activity resulting from chemical changes.Enzyme Inhibitors: Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.Potassium-Hydrogen Antiporters: Membrane proteins that allow the exchange of hydrogen ions for potassium ions across the cellular membrane. The action of these antiporters influences intracellular pH and potassium ion homeostasis.Terpenes: A class of compounds composed of repeating 5-carbon units of HEMITERPENES.Mitochondria: Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)Recombinant Proteins: Proteins prepared by recombinant DNA technology.Thermoplasma: A genus of facultatively anaerobic heterotrophic archaea, in the order THERMOPLASMALES, isolated from self-heating coal refuse piles and acid hot springs. They are thermophilic and can grow both with and without sulfur.Electrons: Stable elementary particles having the smallest known negative charge, present in all elements; also called negatrons. Positively charged electrons are called positrons. The numbers, energies and arrangement of electrons around atomic nuclei determine the chemical identities of elements. Beams of electrons are called CATHODE RAYS.Molecular Conformation: The characteristic three-dimensional shape of a molecule.Light: That portion of the electromagnetic spectrum in the visible, ultraviolet, and infrared range.Analgesics: Compounds capable of relieving pain without the loss of CONSCIOUSNESS.Zinc: A metallic element of atomic number 30 and atomic weight 65.38. It is a necessary trace element in the diet, forming an essential part of many enzymes, and playing an important role in protein synthesis and in cell division. Zinc deficiency is associated with ANEMIA, short stature, HYPOGONADISM, impaired WOUND HEALING, and geophagia. It is known by the symbol Zn.Ionophores: Chemical agents that increase the permeability of biological or artificial lipid membranes to specific ions. Most ionophores are relatively small organic molecules that act as mobile carriers within membranes or coalesce to form ion permeable channels across membranes. Many are antibiotics, and many act as uncoupling agents by short-circuiting the proton gradient across mitochondrial membranes.Energy Metabolism: The chemical reactions involved in the production and utilization of various forms of energy in cells.CarbodiimidesAcid-Base Equilibrium: The balance between acids and bases in the BODY FLUIDS. The pH (HYDROGEN-ION CONCENTRATION) of the arterial BLOOD provides an index for the total body acid-base balance.Rhodopsins, Microbial: Rhodopsin molecules found in microorganisms such as ARCHAEA and PROTEOBACTERIA.Biocatalysis: The facilitation of biochemical reactions with the aid of naturally occurring catalysts such as ENZYMES.Thermus thermophilus: A species of gram-negative, aerobic, rod-shaped bacteria found in hot springs of neutral to alkaline pH, as well as in hot-water heaters.Neurospora crassa: A species of ascomycetous fungi of the family Sordariaceae, order SORDARIALES, much used in biochemical, genetic, and physiologic studies.Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Amino Acid Motifs: Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.ATP-Dependent Proteases: Proteases that contain proteolytic core domains and ATPase-containing regulatory domains. They are usually comprised of large multi-subunit assemblies. The domains can occur within a single peptide chain or on distinct subunits.Acids: Chemical compounds which yield hydrogen ions or protons when dissolved in water, whose hydrogen can be replaced by metals or basic radicals, or which react with bases to form salts and water (neutralization). An extension of the term includes substances dissolved in media other than water. (Grant & Hackh's Chemical Dictionary, 5th ed)Histamine H2 Antagonists: Drugs that selectively bind to but do not activate histamine H2 receptors, thereby blocking the actions of histamine. Their clinically most important action is the inhibition of acid secretion in the treatment of gastrointestinal ulcers. Smooth muscle may also be affected. Some drugs in this class have strong effects in the central nervous system, but these actions are not well understood.Liposomes: Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.Purple Membrane: Functionally and structurally differentiated, purple-pigmented regions of the cytoplasmic membrane of some strains of Halobacterium halobium. The membrane develops under anaerobic conditions and is made almost entirely of the purple pigment BACTERIORHODOPSINS. (From Singleton & Sainsbury Dictionary of Microbiology and Molecular Biology, 2d ed)Phosphates: Inorganic salts of phosphoric acid.HydroquinonesSulfoxides: Organic compounds that have the general formula R-SO-R. They are obtained by oxidation of mercaptans (analogous to the ketones). (From Hackh's Chemical Dictionary, 4th ed)Archaea: One of the three domains of life (the others being BACTERIA and Eukarya), formerly called Archaebacteria under the taxon Bacteria, but now considered separate and distinct. They are characterized by: (1) the presence of characteristic tRNAs and ribosomal RNAs; (2) the absence of peptidoglycan cell walls; (3) the presence of ether-linked lipids built from branched-chain subunits; and (4) their occurrence in unusual habitats. While archaea resemble bacteria in morphology and genomic organization, they resemble eukarya in their method of genomic replication. The domain contains at least four kingdoms: CRENARCHAEOTA; EURYARCHAEOTA; NANOARCHAEOTA; and KORARCHAEOTA.Vanadium: A metallic element with the atomic symbol V, atomic number 23, and atomic weight 50.94. It is used in the manufacture of vanadium steel. Prolonged exposure can lead to chronic intoxication caused by absorption usually via the lungs.Cations, Divalent: Positively charged atoms, radicals or groups of atoms with a valence of plus 2, which travel to the cathode or negative pole during electrolysis.Metals, Heavy: Metals with high specific gravity, typically larger than 5. They have complex spectra, form colored salts and double salts, have a low electrode potential, are mainly amphoteric, yield weak bases and weak acids, and are oxidizing or reducing agents (From Grant & Hackh's Chemical Dictionary, 5th ed)Heme: The color-furnishing portion of hemoglobin. It is found free in tissues and as the prosthetic group in many hemeproteins.Manganese: A trace element with atomic symbol Mn, atomic number 25, and atomic weight 54.94. It is concentrated in cell mitochondria, mostly in the pituitary gland, liver, pancreas, kidney, and bone, influences the synthesis of mucopolysaccharides, stimulates hepatic synthesis of cholesterol and fatty acids, and is a cofactor in many enzymes, including arginase and alkaline phosphatase in the liver. (From AMA Drug Evaluations Annual 1992, p2035)Rabeprazole: A 4-(3-methoxypropoxy)-3-methylpyridinyl derivative of timoprazole that is used in the therapy of STOMACH ULCERS and ZOLLINGER-ELLISON SYNDROME. The drug inhibits H(+)-K(+)-EXCHANGING ATPASE which is found in GASTRIC PARIETAL CELLS.Quantum Theory: The theory that the radiation and absorption of energy take place in definite quantities called quanta (E) which vary in size and are defined by the equation E=hv in which h is Planck's constant and v is the frequency of the radiation.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Yeasts: A general term for single-celled rounded fungi that reproduce by budding. Brewers' and bakers' yeasts are SACCHAROMYCES CEREVISIAE; therapeutic dried yeast is YEAST, DRIED.Deuterium Oxide: The isotopic compound of hydrogen of mass 2 (deuterium) with oxygen. (From Grant & Hackh's Chemical Dictionary, 5th ed) It is used to study mechanisms and rates of chemical or nuclear reactions, as well as biological processes.Protein Multimerization: The assembly of the QUATERNARY PROTEIN STRUCTURE of multimeric proteins (MULTIPROTEIN COMPLEXES) from their composite PROTEIN SUBUNITS.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.Brain: The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Metals: Electropositive chemical elements characterized by ductility, malleability, luster, and conductance of heat and electricity. They can replace the hydrogen of an acid and form bases with hydroxyl radicals. (Grant & Hackh's Chemical Dictionary, 5th ed)Isoenzymes: Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.Anions: Negatively charged atoms, radicals or groups of atoms which travel to the anode or positive pole during electrolysis.Uncoupling Agents: Chemical agents that uncouple oxidation from phosphorylation in the metabolic cycle so that ATP synthesis does not occur. Included here are those IONOPHORES that disrupt electron transfer by short-circuiting the proton gradient across mitochondrial membranes.Cocaine-Related Disorders: Disorders related or resulting from use of cocaine.Proton Ionophores: Chemical agents that increase the permeability of CELL MEMBRANES to PROTONS.Molecular Motor Proteins: Proteins that are involved in or cause CELL MOVEMENT such as the rotary structures (flagellar motor) or the structures whose movement is directed along cytoskeletal filaments (MYOSIN; KINESIN; and DYNEIN motor families).Polyanhydrides: Anhydride polymers with a repeating structure of RC(=O)OC(=O)R. They readily hydrolyze in water making them useful for DELAYED-ACTION PREPARATIONS.Neurospora: A genus of ascomycetous fungi, family Sordariaceae, order SORDARIALES, comprising bread molds. They are capable of converting tryptophan to nicotinic acid and are used extensively in genetic and enzyme research. (Dorland, 27th ed)Molecular Weight: The sum of the weight of all the atoms in a molecule.Spinocerebellar Degenerations: A heterogenous group of degenerative syndromes marked by progressive cerebellar dysfunction either in isolation or combined with other neurologic manifestations. Sporadic and inherited subtypes occur. Inheritance patterns include autosomal dominant, autosomal recessive, and X-linked.Azides: Organic or inorganic compounds that contain the -N3 group.Ouabain: A cardioactive glycoside consisting of rhamnose and ouabagenin, obtained from the seeds of Strophanthus gratus and other plants of the Apocynaceae; used like DIGITALIS. It is commonly used in cell biological studies as an inhibitor of the NA(+)-K(+)-EXCHANGING ATPASE.Ion Pumps: A general class of integral membrane proteins that transport ions across a membrane against an electrochemical gradient.Gastroesophageal Reflux: Retrograde flow of gastric juice (GASTRIC ACID) and/or duodenal contents (BILE ACIDS; PANCREATIC JUICE) into the distal ESOPHAGUS, commonly due to incompetence of the LOWER ESOPHAGEAL SPHINCTER.Radiotherapy Planning, Computer-Assisted: Computer-assisted mathematical calculations of beam angles, intensities of radiation, and duration of irradiation in radiotherapy.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Solutions: The homogeneous mixtures formed by the mixing of a solid, liquid, or gaseous substance (solute) with a liquid (the solvent), from which the dissolved substances can be recovered by physical processes. (From Grant & Hackh's Chemical Dictionary, 5th ed)Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.Oxygen: An element with atomic symbol O, atomic number 8, and atomic weight [15.99903; 15.99977]. It is the most abundant element on earth and essential for respiration.Chlorides: Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.Cadmium: An element with atomic symbol Cd, atomic number 48, and atomic weight 114. It is a metal and ingestion will lead to CADMIUM POISONING.Homeostasis: The processes whereby the internal environment of an organism tends to remain balanced and stable.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Energy Transfer: The transfer of energy of a given form among different scales of motion. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed). It includes the transfer of kinetic energy and the transfer of chemical energy. The transfer of chemical energy from one molecule to another depends on proximity of molecules so it is often used as in techniques to measure distance such as the use of FORSTER RESONANCE ENERGY TRANSFER.ATP-Binding Cassette Transporters: A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.Enterococcus: A genus of gram-positive, coccoid bacteria consisting of organisms causing variable hemolysis that are normal flora of the intestinal tract. Previously thought to be a member of the genus STREPTOCOCCUS, it is now recognized as a separate genus.Carbonic Anhydrase II: A cytosolic carbonic anhydrase isoenzyme found widely distributed in cells of almost all tissues. Deficiencies of carbonic anhydrase II produce a syndrome characterized by OSTEOPETROSIS, renal tubular acidosis (ACIDOSIS, RENAL TUBULAR) and cerebral calcification. EC 4.2.1.-Spectrophotometry: The art or process of comparing photometrically the relative intensities of the light in different parts of the spectrum.Eukaryotic Cells: Cells of the higher organisms, containing a true nucleus bounded by a nuclear membrane.Neutrons: Electrically neutral elementary particles found in all atomic nuclei except light hydrogen; the mass is equal to that of the proton and electron combined and they are unstable when isolated from the nucleus, undergoing beta decay. Slow, thermal, epithermal, and fast neutrons refer to the energy levels with which the neutrons are ejected from heavier nuclei during their decay.

Mutation of the mitochrondrially encoded ATPase 6 gene modeled in the ATP synthase of Escherichia coli. (1/110)

Defects of respiratory chain protein complexes and the ATP synthase are becoming increasingly implicated in human disease. Recently, mutations in the ATPase 6 gene have been shown to cause several different neurological disorders. The product of this gene is homologous to the a subunit of the ATP synthase of Escherichia coli. Here, mutations equivalent to those described in humans have been introduced into the a subunit of E. coli by site-directed mutagenesis, and the effects of these mutations on the ATPase activity, ATP synthesis and ability of the enzyme to pump protons studied in detail. The effects of the mutations varied considerably. The mutation L262P (9185 T-C equivalent) caused a 70% loss of ATP synthesis activity, reduced DCCD sensitivity, and lowered proton pumping activity. The L207P (8993 T-C equivalent) reduced ATP synthesis by 50%, affected DCCD sensitivity, while proton pumping was only marginally affected when measured by the standard AMCA quenching assay. The other mutations studied affected the functioning of the ATP synthase much less. The results confirm that modeling of these point mutations in the E. coli enzyme is a useful approach to determining how alterations in the ATPase 6 gene affect enzyme function and, therefore, how a pathogenic effect can be exerted.  (+info)

Redox regulation of the rotation of F(1)-ATP synthase. (2/110)

In F(1)-ATPase, the smallest known motor enzyme, unidirectional rotation of the central axis subunit gamma is coupled to ATP hydrolysis. In the present study, we report the redox switching of the rotation of this enzyme. For this purpose, the switch region from the gamma subunit of the redox-sensitive chloroplast F(1)-ATPase was introduced into the bacterial F(1)-ATPase. The ATPase activity of the obtained complex was increased up to 3-fold upon reduction (Bald, D., Noji, H., Stumpp, M. T., Yoshida, M. & Hisabori, T. (2000) J. Biol. Chem. 275, 12757-12762). Here, we successfully observed the modulation of rotation of gamma in this chimeric complex by changes in the redox conditions. In addition we revealed that the suppressed enzymatic activity of the oxidized F(1)-ATPase complex was characterized by more frequent long pauses in the rotation of the gamma subunit. These findings obtained by the single molecule analysis therefore provide new insights into the mechanisms of enzyme regulation.  (+info)

Functions and ATP-binding responses of the twelve histidine residues in the TF1-ATPase beta subunit. (3/110)

The C2 proton signals of all (twelve) histidine residues of the TF1 beta subunit in the 1H-NMR spectrum have been identified and assigned by means of pH change experiments and site-directed substitution of histidines by glutamines. pH and ligand titration experiments were carried out for these signals. Furthermore, the ATPase activity of the reconstituted alpha3beta3gamma complex was examined for the twelve mutant beta subunits. Two of three conserved histidines, namely, His-119 and 324, were found to be important for expression of the ATPase activity. The former fixes the N-terminal domain to the central domain. His-324 is involved in the formation of the interface essential for the alpha3beta3gamma complex assembly. The other conserved residue, His-363, showed a very low pK(a), suggesting that it is involved in the tertiary structure formation. On the binding of a nucleotide, only the signals of His-173, 179, 200, and 324 shifted. These histidines are located in the hinge region, and its proximity, of the beta subunit. This observation provided further support for the conformational change of the beta monomer from the open to the closed form on the binding of a nucleotide proposed by us [Yagi et al. (1999) Biophys. J. 77, 2175-2183]. This conformational change should be one of the essential driving forces in the rotation of the alpha3beta3gamma complex.  (+info)

Genetic diversity of Pasteurella multocida fowl cholera isolates as demonstrated by ribotyping and 16S rRNA and partial atpD sequence comparisons. (4/110)

The genetic diversity of Pasteurella multocida, the aetiological agent of fowl cholera, was investigated. The strain collection comprised 69 clinical isolates representing a wide spectrum of hosts and geographic origin. The three type strains for the subspecies of P. multocida were also included. Avian isolates of P. multocida subsp. multocida and P. multocida subsp. septica did not represent separate lines by HpaII ribotyping and the two type strains of mammalian origin (porcine and cat bite) seemed to be representative of avian strains of P. multocida subspp. multocida and septica. By ribotyping, all P. multocida subsp. gallicida strains, except one chicken isolate and the type strain, clustered together. This indicated that the bovine type strain was not representative of this subspecies and that most strains of P. multocida subsp. gallicida are genetically related and may be distantly related to other P. multocida isolates, including those of avian origin. By 16S rRNA and atpD sequence comparisons of selected strains, including both P. multocida isolated from birds and mammals and selected distantly related Pasteurella species associated with birds and mammals, it was found that P. multocida is monophyletic. Extended DNA-DNA hybridizations are highly indicated since strains may exist which would connect the existing subspecies at species level. The considerable genetic diversity of P. multocida fowl cholera isolates is probably related to the clonal nature of this organism, resulting in many divergent lines.  (+info)

Phylogenies of atpD and recA support the small subunit rRNA-based classification of rhizobia. (5/110)

The current classification of the rhizobia (root-nodule symbionts) assigns them to six genera. It is strongly influenced by the small subunit (16S, SSU) rRNA molecular phylogeny, but such single-gene phylogenies may not reflect the evolution of the genome as a whole. To test this, parts of the atpD and recA genes have been sequenced for 25 type strains within the alpha-Proteobacteria, representing species in Rhizobium, Sinorhizobium, Mesorhizobium, Bradyrhizobium, Azorhizobium, Agrobacterium, Phyllobacterium, Mycoplana and Brevundimonas. The current genera Sinorhizobium and Mesorhizobium are well supported by these genes, each forming a distinct phylogenetic clade with unequivocal bootstrap support. There is good support for a Rhizobium clade that includes Agrobacterium tumefaciens, and the very close relationship between Agrobacterium rhizogenes and Rhizobium tropici is confirmed. There is evidence for recombination within the genera Mesorhizobium and Sinorhizobium, but the congruence of the phylogenies at higher levels indicates that the genera are genetically isolated. rRNA provides a reliable distinction between genera, but genetic relationships within a genus may be disturbed by recombination.  (+info)

Coupling of proton flow to ATP synthesis in Rhodobacter capsulatus: F(0)F(1)-ATP synthase is absent from about half of chromatophores. (6/110)

F(0)F(1)-ATP synthase (H(+)-ATP synthase, F(0)F(1)) utilizes the transmembrane protonmotive force to catalyze the formation of ATP from ADP and inorganic phosphate (P(i)). Structurally the enzyme consists of a membrane-embedded proton-translocating F(0) portion and a protruding hydrophilic F(1) part that catalyzes the synthesis of ATP. In photosynthetic purple bacteria a single turnover of the photosynthetic reaction centers (driven by a short saturating flash of light) generates protonmotive force that is sufficiently large to drive ATP synthesis. Using isolated chromatophore vesicles of Rhodobacter capsulatus, we monitored the flash induced ATP synthesis (by chemoluminescence of luciferin/luciferase) in parallel to the transmembrane charge transfer through F(0)F(1) (by following the decay of electrochromic bandshifts of intrinsic carotenoids). With the help of specific inhibitors of F(1) (efrapeptin) and of F(0) (venturicidin), we decomposed the kinetics of the total proton flow through F(0)F(1) into (i) those coupled to the ATP synthesis and (ii) the de-coupled proton escape through F(0). Taking the coupled proton flow, we calculated the H(+)/ATP ratio; it was found to be 3.3+/-0.6 at a large driving force (after one saturating flash of light) but to increase up to 5.1+/-0.9 at a smaller driving force (after a half-saturating flash). From the results obtained, we conclude that our routine chromatophore preparations contained three subsets of chromatophore vesicles. Chromatophores with coupled F(0)F(1) dominated in fresh material. Freezing/thawing or pre-illumination in the absence of ADP and P(i) led to an increase in the fraction of chromatophores with at least one de-coupled F(0)(F(1)). The disclosed fraction of chromatophores that lacked proton-conducting F(0)(F(1)) (approx. 40% of the total amount) remained constant upon these treatments.  (+info)

The topology of the proton translocating F0 component of the ATP synthase from E. coli K12: studies with proteases. (7/110)

The accessibility of the three F0 subunits a, b and c from the Escherichia coli K12 ATP synthase to various proteases was studied in F1-depleted inverted membrane vesicles. Subunit b was very sensitive to all applied proteases. Chymotrypsin produced a defined fragment of mol. wt. 15,000 which remained tightly bound to the membrane. The cleavage site was located at the C-terminal region of subunit b. Larger amounts of proteases were necessary to attack subunit a (mol. wt. 30,000). There was no detectable cleavage of subunit c. It is suggested that the major hydrophilic part of subunit b extends from the membrane into the cytoplasm and is in contact with the F1 sector. The F1 sector was found to afford some protection against proteolysis of the b subunit in vitro and in vivo. Protease digestion had no influence on the electro-impelled H+ conduction via F0 but ATP-dependent H+ translocation could not be reconstituted upon binding of F1. A possible role for subunit b as a linker between catalytic events on the F1 component and the proton pathway across the membrane is discussed.  (+info)

Membrane integration and function of the three F0 subunits of the ATP synthase of Escherichia coli K12. (8/110)

Integration into the cytoplasmic membrane and function of the three F0 subunits, a, b and c, of the membrane-bound ATP synthase of Escherichia coli K12 were analysed in situations where synthesis of only one or two types of subunits was possible. This was achieved by combined use of atp mutations and plasmids carrying and expressing one or two of the atp genes coding for ATP synthase subunits. AU three F0 subunits were found to be required for the establishment of efficient H+ conduction. Subunits a and b individually as well as together were found to bind F1 ATPase to the membrane while subunit c did not. The ATPase activity bound to either of these single subunits, or in pairwise combinations, was not inhibited by N,N'-dicyclohexylcarbodiimide. Also ATP-dependent H+ translocation was not catalysed unless all three F0 subunits were present in the membrane. The integration into the membrane of the subunits a and b was independent of the presence of other ATP synthase subunits.  (+info)

*List of MeSH codes (D08)

... proton-translocating atpases MeSH D08.811.277.040.025.325.249 --- bacterial proton-translocating atpases MeSH D08.811.277.040. ... proton-translocating atpases MeSH D08.811.913.696.650.150.500.249 --- bacterial proton-translocating atpases MeSH D08.811. ... mitochondrial proton-translocating atpases MeSH D08.811.913.696.650.150.500.875 --- vacuolar proton-translocating atpases MeSH ... mitochondrial proton-translocating atpases MeSH D08.811.277.040.025.325.875 --- vacuolar proton-translocating atpases MeSH ...

*List of MeSH codes (D12.776.157)

... proton-translocating atpases MeSH D12.776.157.530.450.250.875.500.249 -- bacterial proton-translocating atpases MeSH D12.776. ... mitochondrial proton-translocating atpases MeSH D12.776.157.530.450.250.875.500.875 -- vacuolar proton-translocating atpases ... chloroplast proton-translocating atpases MeSH D12.776.157.530.450.250.875.500.625 -- h(+)-k(+)-exchanging atpase MeSH D12.776. ... transporting atpase MeSH D12.776.157.530.450.250.750 -- na(+)-k(+)-exchanging atpase MeSH D12.776.157.530.450.250.812 -- ...

*Transmembrane protein

... from bacteria and mitochondria Proton or sodium translocating F-type and V-type ATPases [6] P-type calcium ATPase (five ... Alpha-helical proteins are present in the inner membranes of bacterial cells or the plasma membrane of eukaryotes, and ... proton glutamate symporter) [13] Monovalent cation/proton antiporter (Sodium/proton antiporter 1 NhaA) [14] Neurotransmitter ... Bacteriorhodopsin-like proteins including rhodopsin (see also opsin)[1] Bacterial photosynthetic reaction centres and ...

*H+, Na+-translocating pyrophosphatase family

Mvp1 resembles bacterial PPases while Mvp2 resembles plant PPases. Mvp2 was shown to translocate 1 H+ per pyrophosphate ... They establish a pmf of similar magnitude to that generated by the H+-translocating ATPases in the same vacuolar membrane. The ... A previously undescribed proton translocation pathway is formed by six core transmembrane helices. Proton pumping can be ... "Identification and analysis of proton-translocating pyrophosphatases in the methanogenic archaeon Methansarcina mazei". Archaea ...

*SecDF protein-export membrane protein

Together with SecY and SecG, SecE forms a multimeric channel through which preproteins are translocated, using both proton ... Breyton C; Haase W; Rapoport TA; Kühlbrandt W; Collinson I (August 2002). "Three-dimensional structure of the bacterial protein ... The translocase itself comprises 7 proteins, including a chaperone protein (SecB), an ATPase (SecA), an integral membrane ... SecD and SecF are required to maintain a proton motive force. Secretion across the inner membrane in some Gram-negative ...

*Proton-pumping pyrophosphatase

"Functional complementation of yeast cytosolic pyrophosphatase by bacterial and plant H+-translocating pyrophosphatases". Proc. ... In plants, vacuoles contain two enzymes for acidifying the interior of the vacuole, the V-ATPase and the V-PPase (V is for ... soluble and transmembrane proton-pumping pyrophosphatases (sPPases and H(+)-PPases, respectively). sPPases are ubiquitous ... couple the energy of PPi hydrolysis to proton movement across biological membranes. The latter type is represented by this ...

*Propionigenium modestum

The ATPase of P. modestum acts about 6 times higher than bacterial membranes, at 6.6 units/mg of protein. The ATPase is ... Mitchell, Peter D. "A chemiosmotic molecular mechanism for proton-translocating adenosine triphosphatases". 43 (2). Amsterdam: ... F-type ATPases (Adenylpyrophosphatase ) typically use protons as the sole coupling ion, but the F1F0 ATPase of Propionigenium ... Instead the F-type ATPase of P. modestum uses only Na+ to drive the reaction, demonstrating the production of H2O from O2 ...

*Sodium-solute symporter

The SMF is generated by primary sodium pumps (e.g. sodium/potassium ATPases, sodium translocating respiratory chain complexes) ... Some bacterial sensor kinases (e.g., 2.A.21.9.1) have N-terminal, 12 TMS, sensor domains that regulate the C-terminal kinase ... or via the action of sodium/proton antiporters. Sodium/substrate transporters are grouped in different families based on ... February 1995). "Response regulators of bacterial signal transduction systems: selective domain shuffling during evolution". ...

*Transporter Classification Database

... or Na+-translocating F-type ATPase, V-type ATPase and A-type ATPase superfamily 3.A.3 The P-type ATPase Superfamily 3.A.4 The ... family 3.D.2 The Proton-translocating Transhydrogenase (PTH) Family 3.D.3 The Proton-translocating Quinol:Cytochrome c ... or Na+-translocating bacterial MotAB flagellar motor/ExbBD outer-membrane transport energizer superfamily 1.A.31 Annexin family ... Superfamily 3.D.4 Proton-translocating Cytochrome Oxidase (COX) Superfamily 3.D.5 The Na+-translocating NADH:Quinone ...

*P-type ATPase

Na+/K+-ATPase), the proton-potassium pump (H+/K+-ATPase), the calcium pump (Ca2+-ATPase) and the plasma membrane proton pump ( ... In some bacterial phyla (e.g. Bacteroidetes, Flavobacteria and Fusobacteria), ATPase gene gain and loss as well as horizontal ... that harbors the binding sites for the translocated ligand(s). The ligand(s) enter through a half-channel to the binding site ... P1 ATPases ATPases (or Type I) consists of the transition/heavy metal ATPases. Topological type I (heavy metal) P-type ATPases ...

*Membrane transport protein

P-type ATPase ; ( "P" related to phosphorylation), such as : Na+/K+-ATPase Plasma membrane Ca2+ ATPase Proton pump F-type ... meaning they do not internally translocate, nor require ATP to function. The substrate is taken in one side of the gated ... which function in export of enzymes that digest bacterial cell walls in an early step of cell lysis. Facilitated diffusion ... CFTR V-type ATPase ; ( "V" related to vacuolar ). ... ATPase; ("F" related to factor), including: mitochondrial ATP ...

*Oxidative phosphorylation

"The cellular biology of proton-motive force generation by V-ATPases". J. Exp. Biol. 203 (Pt 1): 89-95. PMID 10600677. ... Becher B, Müller V (1994). "Delta mu Na+ drives the synthesis of ATP via an delta mu Na(+)-translocating F1F0-ATP synthase in ... Some bacterial electron transport chains use different quinones, such as menaquinone, in addition to ubiquinone. Within ... However, when the proton-motive force is high, the reaction is forced to run in the opposite direction; it proceeds from left ...

*Microbial metabolism

Electron and proton cycling are very complex but as a net result only one proton is translocated across the membrane per ... In all cases, however, a proton motive force is generated and used to drive ATP production via an ATPase. Most photosynthetic ... The different metabolic end products produced by each specific bacterial species are responsible for the different tastes and ... A proton motive force is generated using only the quinone pool. In heliobacteria, Green sulfur, and Green non-sulfur bacteria, ...

*ATPase

F1FO-ATPases) in mitochondria, chloroplasts and bacterial plasma membranes are the prime producers of ATP, using the proton ... Proton or sodium translocating F- and V-type ATPases UMich Orientation of Proteins in Membranes families/superfamily-22 - ... A-ATPases (A1AO-ATPases) are found in Archaea and function like F-ATPases P-ATPases (E1E2-ATPases) are found in bacteria, fungi ... And another example is the hydrogen potassium ATPase (H+/K+ATPase or gastric proton pump) that acidifies the contents of the ...
Membrane-bound proton-translocating ATPases that serve two important physiological functions in bacteria. One function is to generate ADENOSINE TRIPHOSPHATE by utilizing the energy provided by an electrochemical gradient of protons across the cellular membrane. A second function is to counteract a loss of the transmembrane ion gradient by pumping protons at the expense of adenosine triphosphate hydrolysis ...
1IJP: Structure of Ala(20) Pro/Pro(64) Ala substituted subunit c of Escherichia coli ATP synthase in which the essential proline is switched between transmembrane helices.
Ahmad Z. Identification of Phosphate Binding Residues in the Catalytic Sites of Escherichia coli ATP Synthase. Poster presented at 6th Annual Interdisciplinary Biomedical Research Conference; Kirksville, MO; November 1, 2014.. Ahmad Z. Significance of α-subunit VISITDG Sequence Residues in the Catalytic Sites of Escherichia coli ATP Synthase. Poster presented at the FASEB Experimental Biology 2014 Conference; San Diego, CA; April 26-30, 2014. Abstract published in FASEB J. 2014 Apr;28(1): Supplement LB247.. Barrett KL [student], Kondrashov P, Kondrashova T, Clay IS [student], Johnson J. Image Recognition and Development of Hands-on Sonographic Skills by First-Year Kirksville College of Osteopathic Medicine Students as Assessed by Practical Ultrasound Skill Assessment Exam. Poster presented at the 3rd Annual Missouri Osteopathic Student and Post-graduate Research Symposium; Missouri Osteopathic Annual Convention; Branson, MO; April 30-May 4, 2014.. Baum KR [student], Pannu M [student], Choudhry ...
FoF1 ATPase (also known as ATP synthase) exists in mitochondrial inner membranes and bacterial plasma membranes to synthesize ATP (adenosine triphosphate) by using electrochemical gradient of protons (H+) between inside and outside of the membranes. Fo is integrated in the membranes and thought to have a rotor ring that rotates horizontally. F1 has a dome-like structure comprised of three α and three β subunits that are alternately arranged, which is anchored to the membranes to prevent rotation. Shaft-like γ subunit connects the center of the rotor ring of Fo and F1. As protons flow down the gradient across the membranes through Fo, the rotor ring of Fo and γ rotate, and the spin force of γ against αβ complex is used to synthesize ATP molecules. In this drawing, a waterwheel (Fo) is rotated by the gradient of water (represents proton gradient), and series of three coins (which represent ATP) are generated from the apparatus (αβ of F1), which is made from six boards being attached to ...
ATP synthase is a membrane-bound rotary motor enzyme that is critical for cellular energy metabolism in all kingdoms of life. Despite conservation of its basic structure and function, autoinhibition by one of its rotary stalk subunits occurs in bacteria and chloroplasts but not in mitochondria. The crystal structure of the ATP synthase catalytic complex (F(1)) from Escherichia coli described here reveals the structural basis for this inhibition. The C-terminal domain of subunit ɛ adopts a heretofore unknown, highly extended conformation that inserts deeply into the central cavity of the enzyme and engages both rotor and stator subunits in extensive contacts that are incompatible with functional rotation. As a result, the three catalytic subunits are stabilized in a set of conformations and rotational positions distinct from previous F(1) structures.. ...
ATP synthase subunit alpha, mitochondrial OS=Pisum sativum E-value=3e-78; ATP synthase subunit alpha, mitochondrial OS=Glycine max E-value=6e-78; ATP synthase subunit alpha, mitochondrial OS=Phaseolus vulgaris E-value=6e-78; ATP synthase subunit alpha, mitochondrial OS=Helianthus annuus E-value=1e-77; ATP synthase subunit alpha, mitochondrial OS=Nicotiana plumbaginifolia E-value=4e-77 ...
The F-ATPase in bovine mitochondria is a membrane-bound complex of about 30 subunits of 18 different kinds. Currently, ∼85% of its structure is known. The enzyme has a membrane extrinsic catalytic domain, and a membrane intrinsic domain where the turning of the enzymes rotor is generated from the transmembrane proton-motive force. The domains are linked by central and peripheral stalks. The central stalk and a hydrophobic ring of c-subunits in the membrane domain constitute the enzymes rotor. The external surface of the catalytic domain and membrane subunit a are linked by the peripheral stalk, holding them static relative to the rotor. The membrane domain contains six additional subunits named ATP8, e, f, g, DAPIT (diabetes-associated protein in insulin-sensitive tissues), and 6.8PL (6.8-kDa proteolipid), each with a single predicted transmembrane α-helix, but their orientation and topography are unknown. Mutations in ATP8 uncouple the enzyme and interfere with its assembly, but its roles ...
In this study we combined several advanced techniques, such as proteomic analysis using the Proteome Lab PF 2D fractionation system, MALDI-TOF/MS and tissue microarray, with functional analysis to identify novel biomarkers for improved prediction of progression, metastasis and response to therapy for breast cancer. The work was also performed in an attempt to better understand molecular mechanisms involved in breast cancer carcinogenesis and metastasis. Our studies revealed one highly over-expressed protein, the α-subunit of ATP synthase, in breast cancer. This observation was validated, refined and extended through a series of IHC on tissue microarray, immunofluorescence and functional analyses. The over-expression of ATP synthase α-subunit was detected by IHC in several different human tumor samples, including breast cancer, hepatocellular carcinoma, colon cancer and prostate cancer (data not shown). Since ATP synthase α-subunit was highly over-expressed in 94.6% of breast cancer samples ...
Céline Vuillier, Steven Lohard, Aurélie Fétiveau, Jennifer Allègre, Cémile Kayaci, Louise E King, Frédérique Braun, Sophie Barillé‐Nion, Fabien Gautier, Laurence Dubrez, Andrew P Gilmore, Philippe P Juin, Laurent Maillet ...
Despite its limited resolution, this structural model is squarely consistent with the two-half-channel hypothesis outlined above and also helps to rationalize a wide range of biochemical data pertaining to the mechanism and inhibition of the enzyme. By construction, the structure shows one of the proton-binding sites in the c-ring in proximity to both Arg145, the crucial arginine in TM4 of subunit a, and Gln201 in TM5 (Fig. 6 A). The Cα-Cα distance from Glu58 to Arg145 (8 Å) is indeed consistent with a salt bridge, and that to Gln201 (13 Å) implies this same interaction would be feasible if Arg145 and Gln201 were swapped, as has been suggested for the E. coli ATP synthase (Ishmukhametov et al., 2008; Bae and Vik, 2009). A nontrivial finding, however, is that this c-ring binding site is aligned with a series of residues on subunit a that have been inferred to be exposed to the aqueous half-channel on the P side of the membrane (Fig. 6 A). Specifically, these are positions whose equivalent in ...
TY - JOUR. T1 - ATP synthesis by the F0F1 ATP synthase from thermophilic Bacillus PS3 reconstituted into liposomes with bacteriorhodopsin. T2 - 2. Relationships between proton motive force and ATP synthesis. AU - Pitard, Bruno. AU - Richard, Peter. AU - Duñach, Mireia. AU - Rigaud, Jean Louis. PY - 1996/2. Y1 - 1996/2. N2 - The correlation between the rate of ATP synthesis and light-induced proton flux was investigated in proteoliposomes reconstituted with bacteriorhodopsin and ATP synthase from thermophilic Bacillus PS3. By variation of the actinic light intensity it was found that ATP synthase activity depended in a sigmoidal manner on the amplitude of the transmembrane light-induced pH gradient. Maximal rates of ATP synthesis (up to 200 nmol ATP · min-1 · mg protein-1 were obtained at saturating light intensities under a steady-state pH gradient of about pH 1.25. It was demonstrated that this was the maximal ΔpH attainable at 40°C in reconstituted proteoliposomes, due to the feedback ...
Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. Minor subunit located with subunit a in the membrane.
Older research outputs will score higher simply because theyve had more time to accumulate mentions. To account for age we can compare this Altmetric Attention Score to the 260,964 tracked outputs that were published within six weeks on either side of this one in any source. This one has gotten more attention than average, scoring higher than 61% of its contemporaries ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
引用Abcam ATP Synthase免疫捕获试剂盒的参考文献列表。为您列举引用本产品的发表文章,并提供信息包括论文文献数据库中的检索编号以便您搜寻文章。
Subunit c deposits co-localize with Lamp 1 in homozygous CbCln3Δex7/8 and CbCln6nclf cells.A. Representative micrographs of confluency aged wild-type, CbCln3Δ
Tropomyosin 1. (Aliases: TmH-33,2299,TMII,TmH-34,region 3,tmII,Tm,cTmII,cTm,l(3)02299,BcDNA:LD37158,BcDNA:GH09289,Dmel\CG4898,cTM,l(3)S130510,Dm TmH34,BcDNA:SD21996,1305/10,tm1,TnH-34,Dm TmH33,l(3)s2958,TmII,TnH-33,Dm Tm1,PmI,Tmr34,CG4898,tropomyosin,Tmr33,DmTm1,TmH33,mTmII,TmH34,TnH) ...
ATP synthase link the phosphorylation of ADP to ETC during chemiosmosis,resulting in the production of ATP Impermeable to H+ to allow formation and maintenance of ...
Gentaur molecular products has all kinds of products like :search , Herolab \ Cleaning Brush for all Rotors for 50 ml 1 \ 258070 for more molecular products just contact us
quantification of AtpB, ATP synthase, AS03-030, Anti-AtpB, ATP Synthase, Beta subunit of ATP synthase polyclonal antibody, Arabidopsis thaliana chloroplastic ATP synthase subunit beta AtCg00480 and Arabidopsis thaliana mitochondrial ATP synthase subunit
15 min with 200 ml of 50 mM NH4HCO3 at RT. A volume of 200 ml of 100 acetonitrile was added to this solution and incubated for 15 min at room temperature. Solvent was removed and gel plugs were allowed to dry for 30 min at RT under a flow hood. Plugs were rehydrated with 20 ng/ml of modified trypsin (Promega, Madison, WI, USA) in 50 mM NH4HCO3 in a shaking incubator overnight at 37uC. Enough trypsin solution was added in order to completely submerge the gel plugs.sample was acquired for a total of ,2.5 min. MS/MS spectra were searched against the International Protein Index (IPI) database using SEQUEST with the following parameters: two trypsin miscleavages, fixed carbamidomethyl modification, variable methionine oxidation, parent tolerance 10 ppm, and fragment tolerance of 25 mmu or 0.01 Da. Results were filtered with the following criteria: Xcorr1.5, 2.0, 2.5, 3.0 for 1, 2, 3, and 4 charge states, respectively, Delta CN0.1, and P-value (protein and peptide) 0.01. IPI accession numbers were ...
SWISS-MODEL Repository entry for Q03A21 (ATPD_LACP3), ATP synthase subunit delta. Lactobacillus paracasei (strain ATCC 334 / BCRC 17002 / CIP 107868 /KCTC 3260 / NRRL B-441)
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
ID A0A0M0BRM1_9ARCH Unreviewed; 664 AA. AC A0A0M0BRM1; DT 11-NOV-2015, integrated into UniProtKB/TrEMBL. DT 11-NOV-2015, sequence version 1. DT 20-DEC-2017, entry version 11. DE RecName: Full=V-type ATP synthase subunit I {ECO:0000256,RuleBase:RU361189}; GN ORFNames=AC478_03315 {ECO:0000313,EMBL:KON31074.1}; OS miscellaneous Crenarchaeota group-1 archaeon SG8-32-3. OC Archaea; Candidatus Bathyarchaeota; MCG-1. OX NCBI_TaxID=1685125 {ECO:0000313,EMBL:KON31074.1, ECO:0000313,Proteomes:UP000054016}; RN [1] {ECO:0000313,Proteomes:UP000054016} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RA Lazar C.S., Baker B.J., Seitz K.W., Hyde A.S., Dick G.J., RA Hinrichs K.-U., Teske A.P.; RT "New insights into the roles of widespread benthic archaea in carbon RT and nitrogen cycling."; RL Submitted (JUN-2015) to the EMBL/GenBank/DDBJ databases. CC -!- SIMILARITY: Belongs to the V-ATPase 116 kDa subunit family. CC {ECO:0000256,RuleBase:RU361189}. CC -!- CAUTION: The sequence shown here is derived from an CC ...
ID X5DHV8_9BACT Unreviewed; 600 AA. AC X5DHV8; DT 11-JUN-2014, integrated into UniProtKB/TrEMBL. DT 11-JUN-2014, sequence version 1. DT 25-OCT-2017, entry version 20. DE RecName: Full=V-type ATP synthase subunit I {ECO:0000256,RuleBase:RU361189}; GN ORFNames=FH5T_16410 {ECO:0000313,EMBL:AHW60674.1}, SAMN05444285_12320 GN {ECO:0000313,EMBL:SET78049.1}; OS Draconibacterium orientale. OC Bacteria; Bacteroidetes; Bacteroidia; Marinilabiliales; OC Prolixibacteraceae; Draconibacterium. OX NCBI_TaxID=1168034 {ECO:0000313,EMBL:AHW60674.1, ECO:0000313,Proteomes:UP000023772}; RN [1] {ECO:0000313,EMBL:AHW60674.1, ECO:0000313,Proteomes:UP000023772} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=FH5 {ECO:0000313,EMBL:AHW60674.1, RC ECO:0000313,Proteomes:UP000023772}; RA Li X., Wang X., Xie Z., Du Z., Chen G.; RT "Complete genome sequence of a deeply braunched marine Bacteroidia RT bacterium Draconibacterium orientale type strain FH5T."; RL Submitted (MAR-2014) to the EMBL/GenBank/DDBJ databases. ...
ATP Synthase : First Look The following images attempt to illustrate how ATP synthase produces ATP and emphasize the key steps in this process. Clicking on each of the thumbnail images will bring up a larger, labeled version of the described scene.. To see the Flash movie for the following sequence of images, click here.. ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c3 (subunit 9) genome duplicate b [Source:ZFIN;Acc:ZDB-GENE-020814-1 ...
View mouse Atp6v0c Chr17:24163866-24169702 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Looking for ATP synthase? Find out information about ATP synthase. An enzyme that catalyzes the conversion of phosphate and adenosine diphosphate into adenosine triphosphate during oxidative phosphorylation in mitochondria... Explanation of ATP synthase
The crystal structure of the F1 showed alternating alpha and beta subunits (3 of each), arranged like segments of an orange around an asymmetrical gamma subunit. According to the current model of ATP synthesis (known as the alternating catalytic model), the proton-motive force across the inner mitochondrial membrane, generated by the electron transport chain, drives the passage of protons through the membrane via the FO region of ATP synthase. A portion of the FO (the ring of c-subunits) rotates as the protons pass through the membrane. The c-ring is tightly attached to the asymmetric central stalk (consisting primarily of the gamma subunit) which rotates within the alpha3beta3 of F1 causing the 3 catalytic nucleotide binding sites to go through a series of conformational changes that leads to ATP synthesis. The major F1 subunits are prevented from rotating in sympathy with the central stalk rotor by a peripheral stalk that joins the alpha3beta3 to the non-rotating portion of FO. The structure ...
Multi-disciplinary methods reveal a novel type of ion binding in the rotor ring of the F1Fo-ATP synthase from the opportunistic pathogen Fusobacterium nucleatum.
Yeah, so we were replacing the rotors and pads on 93 Prelude S in my driveway... Got through the front fine, and started on the rears. Got the first...
Vacuolar ATP synthase subunit H (EC 3.6.3.14) (V-ATPase H subunit) (Vacuolar proton pump subunit H) (V-ATPase 50/57 kDa subunits) (Vacuolar proton pump subunit SFD) (VMA13) (Nef-binding protein 1) (NBP1). [Source:Uniprot/SWISSPROT;Acc:Q9UI12 ...
Construction of a first atomic model for an intact bacterial ATP synthase allows for a structural understanding of the roles of individual amino acids in the mechanism of ATP synthesis.
A high speed generator with a hydraulic rotor mounting system that dampens rotor vibrations at the rotors critical speeds. Oil is supplied to a gap formed between the outer race of the rotor bearing assembly and the bearing liner. The oil provides soft bearing support for, and viscous damping of, the rotor.
Anyone know what the rotors should be re-torqued to after having them turned? I am doing the front brakes today and the rotors need to come off and be...
DEVICE FOR PRODUCING DISPERSIONS AND METHOD OF PRODUCING DISPERSIONS - The instant invention is a device for producing dispersions and method of producing dispersions. The device for producing dispersions includes a first stator, a second stator, a shell encasing the first stator and the second stator, a rotor being disposed therebetween the first stator and the second stator thereby forming a first chamber and a second chamber, at least one first inlet port into the first chamber, and at least one outlet port out of the second chamber. The device may optionally include at least one additional second inlet port into the second chamber. The method of producing a polyurethane dispersion includes the following steps: (1) providing a device for producing a dispersion including a first stator, a second stator, a shell encasing the first stator and the second stator, a rotor being disposed therebetween the first stator and the second stator thereby forming a first chamber and a second chamber, at ...
Shop ATP synthase assembly factor ELISA Kit, Recombinant Protein and ATP synthase assembly factor Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
6156 bp ATGGACGCTTACTCCACAAGACCATTAACCCTATCTCACGGTTCTTTAGAGCACGTGCTT CTGGTACCAACCGCTTCATTTTTCATTGCTTCGCAATTACAAGAACAATTTAATAAAATT TTGCCCGAACCCACTGAAGGGTTTGCTGCAGATGACGAGCCTACCACACCTGCTGAACTA GTGGGGAAATTCCTTGGCTACGTATCTTCTCTAGTCGAACCTTCCAAGGTCGGTCAATTC GATCAGGTCTTGAACCTTTGCTTAACAGAATTTGAAAACTGTTATTTAGAAGGCAATGAC ATTCACGCCTTGGCTGCTAAACTATTACAGGAAAACGACACAACTTTAGTGAAGACTAAA GAACTAATTAAAAATTATATTACCGCCAGAATAATGGCTAAGAGACCATTTGACAAAAAA TCCAACTCTGCTCTTTTTAGGGCCGTCGGCGAGGGTAACGCACAATTGGTAGCCATTTTC GGTGGTCAAGGTAACACCGACGACTACTTTGAAGAATTGCGTGATCTATATCAAACTTAT CATGTCTTAGTGGGAGATTTAATCAAGTTCTTCGCTGAAACTTTAAGTGAACTGATTAGA ACTACTTTAGATGCTGAAAAAGTCTTTACTCAAGGTTTAAACATATTGGAATGGTTGGAG AACCCTTCAAATACCCCAGACAAGGACTATTTACTTTCCATTCCAATTTCATGCCCCTTA ATTGGTGTCATTCAATTGGCTCACTACGTAGTTACTGCCAAGCTTTTGGGTTTCACTCCA GGTGAGTTAAGATCTTACTTAAAAGGTGCTACAGGTCACTCTCAAGGTTTGGTTACTGCT GTCGCCATAGCTGAGACGGATTCCTGGGAATCCTTCTTCGTCTCCGTAAGAAAAGCAATT ACTGTATTATTCTTCATCGGTGTTCGTTGTTACGAAGCATACCCAAACACTTCCCTACCA ...
Influential bioenergetics and enzyme kinetics researcher Harvey S. Penefsky passed away in July at the age of 92. Penefskys kinetic insights shaped the understanding of the mechanism of ATP synthase. This research provided the groundwork for Paul D. Boyer, who elucidated the enzymatic mechanism of ATP synthase. ...
A self-loading peristaltic pump including a rotor rotatably mounted about a rotor axis, and a race having an internal surface for supporting a flexible tube in a pumping region between the rotor and the race, the surface including points that are at equal radii from the rotor axis in planes that are perpendicular to the rotor axis, the rotor including a roller for intermittently and progressively compressing the flexible tube against the race in the pumping region, the rotor including a radially extending rotor tab located outside of the pumping region for displacing the flexible tube toward the pumping region as the rotor rotates.
Buy your ROTOR NoQ-Ring MTB noQX1 76mm online from ✱starbike.com! ✐ German Quality ✐ Fair Prices ✐ Worldwide Delivery ✐ Large Stock & Quick Delivery
Adenosine triphosphate (ATP) is the universal chemical energy currency for cellular activities provided mainly by the membrane enzyme FoF1-ATP synthase in bacteria, chloroplasts and mitochondria. Synthesis of ATP is accompanied by subunit rotation within the enzyme. Over the past 15 years we have developed a variety of single-molecule FRET (smFRET) experiments to monitor catalytic action of individual bacterial enzymes in vitro. By specifically labeling rotating and static subunits within a single enzyme we were able to observe three-stepped rotation in the F1 motor, ten-stepped rotation in the Fo motor and transient elastic deformation of the connected rotor subunits. However, the spatial and temporal resolution of motor activities measured by smFRET were limited by the photophysics of the FRET fluorophores. Here we evaluate the novel FRET donor mNeonGreen as a fusion to FoF1-ATP synthase and compare it to the previously used fluorophore EGFP. Topics of this manuscript are the biochemical ...
Very little chromium (,2%) in the form of inorganic compounds is absorbed but may be higher with certain organic formulations (14). Once absorbed, chromium is distributed to various tissues of the body, but appears to be most concentrated in the kidney, muscle, and liver (16). The principal carrier protein for chromium is transferrin, which also plays a critical role in the movement of chromium from blood to LMWCr. It has been suggested that migration of transferrin receptors to the plasma membranes of insulin-insensitive cells after insulin stimulation is the initial step in this process. Transferrin containing the plasma-bound chromium is postulated to bind to the transferrin receptors and is internalized by endocytosis (Figs. 1 and 2). The pH of the internalized vesicle is reduced by ATP-driven proton pumps, chromium is released from transferrin, and the resulting free chromium is postulated to be sequestered by LMWCr (15,17). With this step, chromium is transferred from transferrin to LMWCr, ...
Looking for online definition of ATPD or what ATPD stands for? ATPD is listed in the Worlds largest and most authoritative dictionary database of abbreviations and acronyms
An analytical rotor system is configured to perform a plurality of tests selected by a user. The analytical rotor comprises a plurality of rotor blocks and a rotor base. The rotor blocks are each conf
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
visiting the Hong Kong Museum of Medical Sciences, I was so exciting that I cant wait to appreciate the amazing medical sciences here. What I actually
Sex is like lot like pizza- no matter how bad it is its still pretty good. But the thing with sex is that everyone thinks they are the greatest lover, but sex is also like […]
Sex is like lot like pizza- no matter how bad it is its still pretty good. But the thing with sex is that everyone thinks they are the greatest lover, but sex is also like […]
Gentaur molecular products has all kinds of products like :search , Biosan \ R_12_10, Rotor for 12 x 10_15 ml tubes \ BS-010208-BK for more molecular products just contact us
A drive system for providing ac drive power to an induction machine with asymmetrical rotor resistance and for sensorless rotor tracking of the induction machine includes: a signal injector for determining a stator command signal in a reference frame which is aligned with either an estimated rotor reference frame; a signal determiner for determining a feedback stator signal of the induction machine in a stator reference frame; and a rotor position and velocity tracker for using the feedback stator signal to estimate a rotor velocity and position by transforming the feedback stator signal into an orthogonal axis feedback stator signal in the estimated rotor reference frame, isolating a component of the orthogonal axis feedback stator signal which is in-phase with the injected stator command signals, filtering the isolated component to isolate an error term, and generating a position estimate by driving the isolated error term towards zero. In several related embodiments a flux axis stator command signal
Amino Acid Sequence, Animals, Calcium-Transporting ATPases/*biosynthesis/chemistry/genetics, Cell Membrane/enzymology, Cloning; Molecular, Humans, Models; Molecular, Molecular Sequence Data, Phylogeny, Plants/*enzymology, Plants; Genetically Modified/enzymology, Plants; Toxic, Protein Conformation, Proton-Translocating ATPases/*biosynthesis/chemistry/genetics, Recombinant Proteins/biosynthesis/chemistry/metabolism, Tobacco, Vacuoles/enzymology ...
Transverse flux electric motors are made using a unique process where individual components are premade and then assembled together. A stator portion is made by nesting a coil between two stator core portions. In a disclosed example, distinct first and second stator core portions are formed. The stator core portions in disclosed examples are made from laminations or sintered powder materials. In a disclosed arrangement, a coil is supported between the core portions of the stator such that the core portions enclose at least part of axial surfaces on the coil. A rotor that has a core and a plurality of magnets is supported relative to the stator for relative rotary motion such that the plurality of magnets of the rotor interact with the stator core portions during the relative rotary motion.
1] Hayashi, Tanigawara & Kishikawa. Mesearments of the driving forces of bio-motors using the fluctuation theorem. submitted. [2] Hayashi, Ueno, Iino & Noji. Fluctuation theorem applied to F1-ATPase. Phys. Rev. Lett. 104, 218103 (2010). [3] Hayashi. Fluctuation Theorem applied to Bio-motors (Japanese). Seibutsu Butsuri, 51, 188-189 (2011).[4] Usukura, Suzuki, Furuike, Soga, Saita, Hisabori, Kinosita Jr. & Yoshida. Torque generation and utilization in the motor enzyme FoF1-ATP synthase: half-torque F1 with short-sized pushrod helix and reduced ATP synthesis by half-torque FoF1. J. Bio. Chem. 287 1885-1891 (2012). [5] Tanigawara, Tabata, Ito, Ito, Watanabe, Ueno, Ikeguchi & Noji. The role of the DELSEED loop in torque transmission of F1-ATPase. submitted. [6] Yokoyama, Kishikawa, Hayashi, Esma, Noji & Konno. Origin of rotor domain and torque generation in rotary ATPase. in preparation. ...

Bacterial Proton-Translocating ATPases | Profiles RNSBacterial Proton-Translocating ATPases | Profiles RNS

"Bacterial Proton-Translocating ATPases" by people in this website by year, and whether "Bacterial Proton-Translocating ATPases ... Proton-Translocating ATPases [D08.811.913.696.650.150.500]. *Bacterial Proton-Translocating ATPases [D08.811.913.696.650.150. ... Proton-Translocating ATPases [D12.776.157.530.450.250.875.500]. *Bacterial Proton-Translocating ATPases [D12.776.157.530. ... Proton-Translocating ATPases [D12.776.543.585.450.250.875.500]. *Bacterial Proton-Translocating ATPases [D12.776.543.585. ...
more infohttps://profiles.umassmed.edu/display/123270

A label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection based on aggregation-induced emission probe.A label-free fluorometric aptasensor for adenosine triphosphate (ATP) detection based on aggregation-induced emission probe.

Bacterial Proton-translocating Atpases. Membrane-bound proton-translocating ATPases that serve two important physiological ... Proton-translocating Atpases. Multisubunit enzymes that reversibly synthesize ADENOSINE TRIPHOSPHATE. They are coupled to the ...
more infohttps://www.bioportfolio.com/resources/pmarticle/2374678/A-label-free-fluorometric-aptasensor-for-adenosine-triphosphate-ATP-detection-based-on.html

Biochemical and Molecular Insights into Bile Salt Hydrolase in the Gastrointestinal Microflora - A Review - | Korea ScienceBiochemical and Molecular Insights into Bile Salt Hydrolase in the Gastrointestinal Microflora - A Review - | Korea Science

A proton-translocating ATPase regulates pH of the bacterial cytoplasm. J. Biol. Chem. 260:72-76. ... The proposed physiological impact of BSH activity on the host animal as well as on the BSH-producing bacterial cells is ... Bacterial bile salt hydrolase: an intestinal microbiome target for enhanced animal health, Animal Health Research Reviews, 2016 ... Bile salt deconjugation is the most biologically significant reaction among the bacterial alterations of bile acids in the ...
more infohttp://www.koreascience.or.kr/article/ArticleFullRecord.jsp?cn=E1DMBP_2005_v18n10_1505

Binary option delta formulaBinary option delta formula

Heath, J. A proton-translocating ATPase regulates pH of the bacterial cytoplasm. ... of opption values to the predicted curve substantiates the use of this timescale and substitution rate for analyzing bacterial ...
more infohttp://imbc-med.ru/binary-option-delta-formula.html

List of MeSH codes (D08) - WikipediaList of MeSH codes (D08) - Wikipedia

... proton-translocating atpases MeSH D08.811.277.040.025.325.249 --- bacterial proton-translocating atpases MeSH D08.811.277.040. ... proton-translocating atpases MeSH D08.811.913.696.650.150.500.249 --- bacterial proton-translocating atpases MeSH D08.811. ... mitochondrial proton-translocating atpases MeSH D08.811.913.696.650.150.500.875 --- vacuolar proton-translocating atpases MeSH ... mitochondrial proton-translocating atpases MeSH D08.811.277.040.025.325.875 --- vacuolar proton-translocating atpases MeSH ...
more infohttps://en.wikipedia.org/wiki/List_of_MeSH_codes_(D08)

Local Control, Quality of Life and Toxicities in Adults With Benign or Indolent Brain Tumors Undergoing Proton Radiation TherapyLocal Control, Quality of Life and Toxicities in Adults With Benign or Indolent Brain Tumors Undergoing Proton Radiation Therapy

... clinicaltrials.gov This research study is studying Proton Radiation as a possible treatment for brain tumor. The radiation ... which may be used by either MITOCHONDRIAL PROTON-TRANSLOCATING ATPASES or BACTERIAL PROTON-TRANSLOCATING ATPASES. ... The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion. ... A complex of enzymes and PROTON PUMPS located on the inner membrane of the MITOCHONDRIA and in bacterial membranes. The protein ...
more infohttps://www.bioportfolio.com/resources/trial/188697/Local-Control-Quality-of-Life-and-Toxicities-in-Adults-With-Benign-or.html

Proton-Translocating ATPases
      - ATPase, H+
     Summary Report | CureHunterProton-Translocating ATPases - ATPase, H+ Summary Report | CureHunter

Proton-Translocating ATPases: Multisubunit enzymes that reversibly synthesize ADENOSINE TRIPHOSPHATE. They are coupled to the ... Proton-Translocating ATPase; F 0 ATPase; F 1 ATPase; F0 ATPase; H+ Translocating ATPase; Proton Translocating ATPase; Proton ... ATPase; F1 ATPase; H(+)ATPase Complex; Proton-Translocating ATPase; Proton-Translocating ATPase Complex; Proton-Translocating ... H+-Translocating ATPase; Proton-Translocating ATPase, F0 Sector; Proton-Translocating ATPase, F1 Sector; ATPase Complex, Proton ...
more infohttp://www.curehunter.com/public/keywordSummaryD006180-H---ATPase-Complex.do

List of MeSH codes (D12.776.157) - WikipediaList of MeSH codes (D12.776.157) - Wikipedia

... proton-translocating atpases MeSH D12.776.157.530.450.250.875.500.249 -- bacterial proton-translocating atpases MeSH D12.776. ... mitochondrial proton-translocating atpases MeSH D12.776.157.530.450.250.875.500.875 -- vacuolar proton-translocating atpases ... chloroplast proton-translocating atpases MeSH D12.776.157.530.450.250.875.500.625 -- h(+)-k(+)-exchanging atpase MeSH D12.776. ... transporting atpase MeSH D12.776.157.530.450.250.750 -- na(+)-k(+)-exchanging atpase MeSH D12.776.157.530.450.250.812 -- ...
more infohttps://en.wikipedia.org/wiki/List_of_MeSH_codes_(D12.776.157)

Bacterial anion exchange. Use of osmolytes during solubilization and reconstitution of phosphate-linked antiport from...Bacterial anion exchange. Use of osmolytes during solubilization and reconstitution of phosphate-linked antiport from...

... these precautions were not required for the efficient reconstitution of F0F1-ATPase. Antiport in the artificial system was ... title = "Bacterial anion exchange. Use of osmolytes during solubilization and reconstitution of phosphate-linked antiport from ... T1 - Bacterial anion exchange. Use of osmolytes during solubilization and reconstitution of phosphate-linked antiport from ... Bacterial anion exchange. Use of osmolytes during solubilization and reconstitution of phosphate-linked antiport from ...
more infohttps://jhu.pure.elsevier.com/en/publications/bacterial-anion-exchange-use-of-osmolytes-during-solubilization-a-3

Vacuolar Proton-Translocating ATPases | REACHVacuolar Proton-Translocating ATPases | REACH

Molecular basis for the binding and modulation of V-ATPase by a bacterial effector protein. PLoS Pathog. 2017 Jun; 13(6): ... Proton-Translocating ATPases [D08.811.913.696.650.150.500]. *Vacuolar Proton-Translocating ATPases [D08.811.913.696.650.150. ... Proton-Translocating ATPases [D12.776.157.530.450.250.875.500]. *Vacuolar Proton-Translocating ATPases [D12.776.157.530.450.250 ... Proton-Translocating ATPases [D12.776.543.585.450.250.875.500]. *Vacuolar Proton-Translocating ATPases [D12.776.543.585.450.250 ...
more infohttps://reach.sickkids.ca/display/11775

The bacterial flagellar protein export apparatus processively transports flagellar proteins even with extremely infrequent ATP...The bacterial flagellar protein export apparatus processively transports flagellar proteins even with extremely infrequent ATP...

Proton-Translocating ATPases/genetics. *Proton-Translocating ATPases/metabolism*. *Salmonella/genetics. *Salmonella/metabolism* ... a) Relative ATPase activity of His-FliIΔ40. The ATPase activity of His-FliIΔ40 (indicated as Δ40) is normalized to that of His- ... For self-assembly of the bacterial flagellum, a specific protein export apparatus utilizes ATP and proton motive force (PMF) as ... The FliI(6)FliJ complex is structurally similar to the α(3)β(3)γ complex of F(O)F(1)-ATPase. FliJ allows the gate to ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/25531309?dopt=Abstract

Experts and Doctors on escherichia coli proteins in GermanyExperts and Doctors on escherichia coli proteins in Germany

bacterial proton translocating atpases*siderophores. Genomes and Genes. *dnaK products*kdpD *fhuA *fis products*tonB *malE ... ATPase, H(+),K(+)-ATPase, and Ca(2+)-ATPase. .. ... Experts and Doctors on bacterial proteins in Germany*Experts ... The notion that FITC inhibits pNPPase and ATPase activity supports the idea that the catalytic domain of KdpB is much more ... Voelkner P, Puppe W, Altendorf K. Characterization of the KdpD protein, the sensor kinase of the K(+)-translocating Kdp system ...
more infohttp://www.labome.org/locale/experts-and-doctors-on-escherichia-coli-proteins-in-germany-17433.html

Variações nos níveis de ATP em bactérias heterotrofas durante a aderência a superfícies hidrofìlicas e hidrofóbicasVariações nos níveis de ATP em bactérias heterotrofas durante a aderência a superfícies hidrofìlicas e hidrofóbicas

Deckers-Hebestreit G, Altendorf K (1992) The F0 complex of the proton-translocating F-type ATPase of Escherichia coli. J Exp ... Bacterial growth and sample preparation. For initial screening, bacterial suspensions of freshly grown cells (1.0-2.0 × 108 ... Bacterial strains. Table 1 shows the type strains and environmental (marine) bacterial isolates belonging to the 17 genera used ... 6. Bhattacharya S, Schiavone M, Nayak A, Bhattacharya SK (2004) Uniformly oriented immobilized bacterial F0F1 ATPase on semi- ...
more infohttp://scielo.isciii.es/scielo.php?script=sci_arttext&pid=S1139-67092006000100005&lng=pt&nrm=iso&tlng=pt

The Where, When, and How of Organelle Acidification by the Yeast Vacuolar H+-ATPase | Microbiology and Molecular Biology ReviewsThe Where, When, and How of Organelle Acidification by the Yeast Vacuolar H+-ATPase | Microbiology and Molecular Biology Reviews

The central player in organelle acidification in all eukaryotes is the vacuolar proton-translocating ATPase (V-ATPase). ... Eukaryotic V-ATPases appear to have relinquished some of the versatility of their bacterial precursors, but they are still ... The yeast vacuolar proton-translocating ATPase contains a subunit homologous to the Manduca sexta and bovine e subunits that is ... V1-situated stalk subunits of the yeast vacuolar proton-translocating ATPase. J. Biol. Chem.272:26787-26793. ...
more infohttps://mmbr.asm.org/content/70/1/177?ijkey=4cb076990af6c1fd4becb0c3110a1ac1beb231d6&keytype2=tf_ipsecsha

Transmembrane protein - WikipediaTransmembrane protein - Wikipedia

Proton or sodium translocating F-type and V-type ATPases. P-P-bond hydrolysis-driven transporters[edit]. *P-type calcium ATPase ... Bacterial photosynthetic reaction centres and photosystems I and II. *Light-harvesting complexes from bacteria and chloroplasts ... Dicarboxylate/amino acid:cation symporter (proton glutamate symporter). *Monovalent cation/proton antiporter (Sodium/proton ... General bacterial porin family, known as trimeric porins (n=16,S=20) ...
more infohttps://en.wikipedia.org/wiki/Transmembrane_protein

Influence of BrpA on Critical Virulence Attributes of Streptococcus mutans | Journal of BacteriologyInfluence of BrpA on Critical Virulence Attributes of Streptococcus mutans | Journal of Bacteriology

... and those for the F1Fo proton-translocating ATPase (F1Fo-ATPase), which are transcribed as an operon (3, 18). GbpD is unique to ... To allow visualization of the bacterial biofilms by CLSM, we used a green fluorescent protein gene (gfp) as a reporter (37). ... the genes for the F1Fo-ATPase are arranged as an operon (3, 18). To verify the down-regulation of F1Fo-ATPase, real-time PCR ... The F1Fo-ATPase is the major enzyme that is responsible for the maintenance of ΔpH in mutans streptococci (7, 29). In S. mutans ...
more infohttps://jb.asm.org/content/188/8/2983?ijkey=9d42999cd353c3ffdfc3174aaa53cc9b70de0f47&keytype2=tf_ipsecsha

Pairwise alignment of recombinant protein sequences wit | Open-iPairwise alignment of recombinant protein sequences wit | Open-i

Mitochondrial Proton-Translocating ATPases/chemistry*/genetics/metabolism*. *Molecular Chaperones/chemistry*/genetics/ ... Bacterial Proteins/chemistry/genetics/metabolism. *Candida glabrata/genetics/metabolism. *Crystallography, X-Ray ... Mitochondrial Proton-Translocating ATPases/chemistry*/genetics/metabolism*. *Molecular Chaperones/chemistry*/genetics/ ... Mitochondrial F(1)-ATPase contains a hexamer of alternating alpha and beta subunits. The assembly of this structure requires ...
more infohttps://openi.nlm.nih.gov/detailedresult.php?img=PMC2719352_zbc0290979690001&req=4

NADP Transhydrogenase, B-Specific | Profiles RNSNADP Transhydrogenase, B-Specific | Profiles RNS

Bacterial Outer Membrane Proteins. *Bacterial Proton-Translocating ATPases. *Bacteriocins. *Botulinum Toxins. *Cell Wall ...
more infohttps://profiles.viictr.org/display/27546651

MutS DNA Mismatch-Binding Protein | Profiles RNSMutS DNA Mismatch-Binding Protein | Profiles RNS

Bacterial Outer Membrane Proteins. *Bacterial Proton-Translocating ATPases. *Bacteriocins. *Botulinum Toxins. *Cell Wall ... Vanadate inhibits the ATPase activity and DNA binding capability of bacterial MutS. A structural model for the vanadate-MutS ... A methyl-directed mismatch DNA REPAIR protein that has weak ATPASE activity. MutS was originally described in ESCHERICHIA COLI ...
more infohttp://profiles.ouhsc.edu/display/68328

Escherichia coli Proteins | Colorado PROFILESEscherichia coli Proteins | Colorado PROFILES

Bacterial Outer Membrane Proteins. *Bacterial Proton-Translocating ATPases. *Bacteriocins. *Botulinum Toxins. *Cell Wall ... Duster AW, Garza CM, Aydintug BO, Negussie MB, Lin H. Adaptive Partitioning QM/MM for Molecular Dynamics Simulations: 6. Proton ...
more infohttps://profiles.ucdenver.edu/display/207431

Periplasmic Proteins | Colorado PROFILESPeriplasmic Proteins | Colorado PROFILES

Bacterial Outer Membrane Proteins. *Bacterial Proton-Translocating ATPases. *Bacteriocins. *Botulinum Toxins. *Cell Wall ...
more infohttps://profiles.ucdenver.edu/display/201736

Structure and Operation of Bacterial Tripartite Pumps - PubMedStructure and Operation of Bacterial Tripartite Pumps - PubMed

In these tripartite pumps an inner membrane transporter, typically an ATPase or proton antiporter, binds and translocates ... Structure and Operation of Bacterial Tripartite Pumps Philip Hinchliffe 1 , Martyn F Symmons, Colin Hughes, Vassilis Koronakis ... Structure and Operation of Bacterial Tripartite Pumps Philip Hinchliffe et al. Annu Rev Microbiol. 2013 ... The Assembled Structure of a Complete Tripartite Bacterial Multidrug Efflux Pump MF Symmons et al. Proc Natl Acad Sci U S A 106 ...
more infohttps://pubmed.ncbi.nlm.nih.gov/23808339/

Antievolution.org - Antievolution.org Discussion Board -Topic::ATPase originsAntievolution.org - Antievolution.org Discussion Board -Topic::ATPase origins

STRUCTURAL STUDIES OF PROTON TRANSLOCATING PYROPHOSPHATASE Membrane-bound proton translocating pyrophosphatases (H+-PPase) use ... The bacterial H(+)-PPi synthase and two algal vacuolar H(+)-PPases are homologous with this family, as deduced from their ... The first was from a progenitor proton-pumping ATPase to a proton-driven ATP synthase. The second involved transforming the ... They establish a pmf of similar magnitude to that generated by the H+-translocating ATPases in the same vacuolar membrane . The ...
more infohttp://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=50aab1e243fb46f7

Antievolution.org - Antievolution.org Discussion Board -Topic::ATPase originsAntievolution.org - Antievolution.org Discussion Board -Topic::ATPase origins

STRUCTURAL STUDIES OF PROTON TRANSLOCATING PYROPHOSPHATASE Membrane-bound proton translocating pyrophosphatases (H+-PPase) use ... The bacterial H(+)-PPi synthase and two algal vacuolar H(+)-PPases are homologous with this family, as deduced from their ... The first was from a progenitor proton-pumping ATPase to a proton-driven ATP synthase. The second involved transforming the ... They establish a pmf of similar magnitude to that generated by the H+-translocating ATPases in the same vacuolar membrane . The ...
more infohttp://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=50a39c96a8ff9d88