Proteins found in any species of bacterium.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Proteins obtained from ESCHERICHIA COLI.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
Substances elaborated by bacteria that have antigenic activity.
A genus of gram-positive, anaerobic, coccoid bacteria that is part of the normal flora of humans. Its organisms are opportunistic pathogens causing bacteremias and soft tissue infections.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Proteins isolated from the outer membrane of Gram-negative bacteria.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
The first stomach of ruminants. It lies on the left side of the body, occupying the whole of the left side of the abdomen and even stretching across the median plane of the body to the right side. It is capacious, divided into an upper and a lower sac, each of which has a blind sac at its posterior extremity. The rumen is lined by mucous membrane containing no digestive glands, but mucus-secreting glands are present in large numbers. Coarse, partially chewed food is stored and churned in the rumen until the animal finds circumstances convenient for rumination. When this occurs, little balls of food are regurgitated through the esophagus into the mouth, and are subjected to a second more thorough mastication, swallowed, and passed on into other parts of the compound stomach. (From Black's Veterinary Dictionary, 17th ed)
The fourth stomach of ruminating animals. It is also called the "true" stomach. It is an elongated pear-shaped sac lying on the floor of the abdomen, on the right-hand side, and roughly between the seventh and twelfth ribs. It leads to the beginning of the small intestine. (From Black's Veterinary Dictionary, 17th ed)
Bacteria which retain the crystal violet stain when treated by Gram's method.
The space between the inner and outer membranes of a cell that is shared with the cell wall.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The functional hereditary units of BACTERIA.
Those components of an organism that determine its capacity to cause disease but are not required for its viability per se. Two classes have been characterized: TOXINS, BIOLOGICAL and surface adhesion molecules that effect the ability of the microorganism to invade and colonize a host. (From Davis et al., Microbiology, 4th ed. p486)
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Cell-surface components or appendages of bacteria that facilitate adhesion (BACTERIAL ADHESION) to other cells or to inanimate surfaces. Most fimbriae (FIMBRIAE, BACTERIAL) of gram-negative bacteria function as adhesins, but in many cases it is a minor subunit protein at the tip of the fimbriae that is the actual adhesin. In gram-positive bacteria, a protein or polysaccharide surface layer serves as the specific adhesin. What is sometimes called polymeric adhesin (BIOFILMS) is distinct from protein adhesin.
Toxic substances formed in or elaborated by bacteria; they are usually proteins with high molecular weight and antigenicity; some are used as antibiotics and some to skin test for the presence of or susceptibility to certain diseases.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
A protein found in bacteria and eukaryotic mitochondria which delivers aminoacyl-tRNA's to the A site of the ribosome. The aminoacyl-tRNA is first bound to a complex of elongation factor Tu containing a molecule of bound GTP. The resulting complex is then bound to the 70S initiation complex. Simultaneously the GTP is hydrolyzed and a Tu-GDP complex is released from the 70S ribosome. The Tu-GTP complex is regenerated from the Tu-GDP complex by the Ts elongation factor and GTP.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
The interactions between a host and a pathogen, usually resulting in disease.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Compounds which inhibit the synthesis of proteins. They are usually ANTI-BACTERIAL AGENTS or toxins. Mechanism of the action of inhibition includes the interruption of peptide-chain elongation, the blocking the A site of ribosomes, the misreading of the genetic code or the prevention of the attachment of oligosaccharide side chains to glycoproteins.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Proteins prepared by recombinant DNA technology.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
A species of gram-negative, aerobic bacteria that is the causative agent of LEGIONNAIRES' DISEASE. It has been isolated from numerous environmental sites as well as from human lung tissue, respiratory secretions, and blood.
In GRAM NEGATIVE BACTERIA, multiprotein complexes that function to translocate pathogen protein effector molecules across the bacterial cell envelope, often directly into the host. These effectors are involved in producing surface structures for adhesion, bacterial motility, manipulation of host functions, modulation of host defense responses, and other functions involved in facilitating survival of the pathogen. Several of the systems have homologous components functioning similarly in GRAM POSITIVE BACTERIA.
Substances that reduce the growth or reproduction of BACTERIA.
Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
A protein with a molecular weight of 40,000 isolated from bacterial flagella. At appropriate pH and salt concentration, three flagellin monomers can spontaneously reaggregate to form structures which appear identical to intact flagella.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Bacteria which lose crystal violet stain but are stained pink when treated by Gram's method.
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
A serotype of Salmonella enterica that is a frequent agent of Salmonella gastroenteritis in humans. It also causes PARATYPHOID FEVER.
One of the CYCLIC PEPTIDES from Streptomyces that is active against gram-positive bacteria. In veterinary medicine, it has been used in mastitis caused by gram-negative organisms and in dermatologic disorders.
The largest of the three prokaryotic initiation factors with a molecular size of approximately 80 kD. It functions in the transcription initiation process by promoting the binding of formylmethionine-tRNA to the P-site of the 30S ribosome and by preventing the incorrect binding of elongator tRNA to the translation initiation site.
A human and animal pathogen causing mesenteric lymphadenitis, diarrhea, and bacteremia.
An antibiotic first isolated from cultures of Streptomyces venequelae in 1947 but now produced synthetically. It has a relatively simple structure and was the first broad-spectrum antibiotic to be discovered. It acts by interfering with bacterial protein synthesis and is mainly bacteriostatic. (From Martindale, The Extra Pharmacopoeia, 29th ed, p106)
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The process of breakdown of food for metabolism and use by the body.
A species of gram-positive, rod-shaped bacteria widely distributed in nature. It has been isolated from sewage, soil, silage, and from feces of healthy animals and man. Infection with this bacterium leads to encephalitis, meningitis, endocarditis, and abortion.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Transport proteins that carry specific substances in the blood or across cell membranes.
Peptides whose amino and carboxy ends are linked together with a peptide bond forming a circular chain. Some of them are ANTI-INFECTIVE AGENTS. Some of them are biosynthesized non-ribosomally (PEPTIDE BIOSYNTHESIS, NON-RIBOSOMAL).
An element with the atomic symbol N, atomic number 7, and atomic weight [14.00643; 14.00728]. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells.
Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
Cells of the higher organisms, containing a true nucleus bounded by a nuclear membrane.
A species of gram-positive bacteria that is a common soil and water saprophyte.
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
A pattern recognition receptor that binds FLAGELLIN. It mediates cellular responses to certain bacterial pathogens.
Derivatives of oxazolidin-2-one. They represent an important class of synthetic antibiotic agents.
One of the three domains of life (the others being BACTERIA and ARCHAEA), also called Eukarya. These are organisms whose cells are enclosed in membranes and possess a nucleus. They comprise almost all multicellular and many unicellular organisms, and are traditionally divided into groups (sometimes called kingdoms) including ANIMALS; PLANTS; FUNGI; and various algae and other taxa that were previously part of the old kingdom Protista.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
Substances that are toxic to cells; they may be involved in immunity or may be contained in venoms. These are distinguished from CYTOSTATIC AGENTS in degree of effect. Some of them are used as CYTOTOXIC ANTIBIOTICS. The mechanism of action of many of these are as ALKYLATING AGENTS or MITOSIS MODULATORS.
Potentially pathogenic bacteria found in nasal membranes, skin, hair follicles, and perineum of warm-blooded animals. They may cause a wide range of infections and intoxications.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
Physicochemical property of fimbriated (FIMBRIAE, BACTERIAL) and non-fimbriated bacteria of attaching to cells, tissue, and nonbiological surfaces. It is a factor in bacterial colonization and pathogenicity.
The protein complement of an organism coded for by its genome.
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
Anaerobic degradation of GLUCOSE or other organic nutrients to gain energy in the form of ATP. End products vary depending on organisms, substrates, and enzymatic pathways. Common fermentation products include ETHANOL and LACTIC ACID.
The rate dynamics in chemical or physical systems.
Immunoglobulins produced in a response to BACTERIAL ANTIGENS.
Physiological processes and properties of BACTERIA.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.
Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.
Enzymes that catalyze the transfer of glycosyl groups to an acceptor. Most often another carbohydrate molecule acts as an acceptor, but inorganic phosphate can also act as an acceptor, such as in the case of PHOSPHORYLASES. Some of the enzymes in this group also catalyze hydrolysis, which can be regarded as transfer of a glycosyl group from the donor to water. Subclasses include the HEXOSYLTRANSFERASES; PENTOSYLTRANSFERASES; SIALYLTRANSFERASES; and those transferring other glycosyl groups. EC 2.4.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Derivatives of acetamide that are used as solvents, as mild irritants, and in organic synthesis.
Established cell cultures that have the potential to propagate indefinitely.
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
A species of gram-negative, aerobic, rod-shaped bacteria commonly isolated from clinical specimens (wound, burn, and urinary tract infections). It is also found widely distributed in soil and water. P. aeruginosa is a major agent of nosocomial infection.
Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.
Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.
The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.
A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.
A cinnamamido ADENOSINE found in STREPTOMYCES alboniger. It inhibits protein synthesis by binding to RNA. It is an antineoplastic and antitrypanosomal agent and is used in research as an inhibitor of protein synthesis.
Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.
The systematic study of the complete complement of proteins (PROTEOME) of organisms.
A family of cellular proteins that mediate the correct assembly or disassembly of polypeptides and their associated ligands. Although they take part in the assembly process, molecular chaperones are not components of the final structures.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
The degree of 3-dimensional shape similarity between proteins. It can be an indication of distant AMINO ACID SEQUENCE HOMOLOGY and used for rational DRUG DESIGN.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
A colorless alkaline gas. It is formed in the body during decomposition of organic materials during a large number of metabolically important reactions. Note that the aqueous form of ammonia is referred to as AMMONIUM HYDROXIDE.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The relationships of groups of organisms as reflected by their genetic makeup.
Infections with bacteria of the genus SALMONELLA.
Processes involved in the formation of TERTIARY PROTEIN STRUCTURE.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
A spiral bacterium active as a human gastric pathogen. It is a gram-negative, urease-positive, curved or slightly spiral organism initially isolated in 1982 from patients with lesions of gastritis or peptic ulcers in Western Australia. Helicobacter pylori was originally classified in the genus CAMPYLOBACTER, but RNA sequencing, cellular fatty acid profiles, growth patterns, and other taxonomic characteristics indicate that the micro-organism should be included in the genus HELICOBACTER. It has been officially transferred to Helicobacter gen. nov. (see Int J Syst Bacteriol 1989 Oct;39(4):297-405).
The genetic complement of a BACTERIA as represented in its DNA.
The sum of the weight of all the atoms in a molecule.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
A genus of motile or nonmotile gram-positive bacteria of the family Clostridiaceae. Many species have been identified with some being pathogenic. They occur in water, soil, and in the intestinal tract of humans and lower animals.
A gram-positive organism found in the upper respiratory tract, inflammatory exudates, and various body fluids of normal and/or diseased humans and, rarely, domestic animals.
One of the three domains of life (the others being BACTERIA and Eukarya), formerly called Archaebacteria under the taxon Bacteria, but now considered separate and distinct. They are characterized by: (1) the presence of characteristic tRNAs and ribosomal RNAs; (2) the absence of peptidoglycan cell walls; (3) the presence of ether-linked lipids built from branched-chain subunits; and (4) their occurrence in unusual habitats. While archaea resemble bacteria in morphology and genomic organization, they resemble eukarya in their method of genomic replication. The domain contains at least four kingdoms: CRENARCHAEOTA; EURYARCHAEOTA; NANOARCHAEOTA; and KORARCHAEOTA.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
Components of a cell produced by various separation techniques which, though they disrupt the delicate anatomy of a cell, preserve the structure and physiology of its functioning constituents for biochemical and ultrastructural analysis. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p163)
An essential branched-chain amino acid important for hemoglobin formation.
Type species of CHLAMYDIA causing a variety of ocular and urogenital diseases.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.
The engulfing and degradation of microorganisms; other cells that are dead, dying, or pathogenic; and foreign particles by phagocytic cells (PHAGOCYTES).
Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
An analytical method used in determining the identity of a chemical based on its mass using mass analyzers/mass spectrometers.
A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment.
A mass spectrometric technique that is used for the analysis of large biomolecules. Analyte molecules are embedded in an excess matrix of small organic molecules that show a high resonant absorption at the laser wavelength used. The matrix absorbs the laser energy, thus inducing a soft disintegration of the sample-matrix mixture into free (gas phase) matrix and analyte molecules and molecular ions. In general, only molecular ions of the analyte molecules are produced, and almost no fragmentation occurs. This makes the method well suited for molecular weight determinations and mixture analysis.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)
Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The process of cleaving a chemical compound by the addition of a molecule of water.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
Suspensions of attenuated or killed bacteria administered for the prevention or treatment of infectious bacterial disease.
Proteins obtained from foods. They are the main source of the ESSENTIAL AMINO ACIDS.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Electrophoresis in which a second perpendicular electrophoretic transport is performed on the separate components resulting from the first electrophoresis. This technique is usually performed on polyacrylamide gels.
Electron microscopy in which the ELECTRONS or their reaction products that pass down through the specimen are imaged below the plane of the specimen.
Sites on an antigen that interact with specific antibodies.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
The chemical or biochemical addition of carbohydrate or glycosyl groups to other chemicals, especially peptides or proteins. Glycosyl transferases are used in this biochemical reaction.
Methods for determining interaction between PROTEINS.
Proteins which are synthesized in eukaryotic organisms and bacteria in response to hyperthermia and other environmental stresses. They increase thermal tolerance and perform functions essential to cell survival under these conditions.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
The characteristic 3-dimensional shape and arrangement of multimeric proteins (aggregates of more than one polypeptide chain).
The process by which antigen is presented to lymphocytes in a form they can recognize. This is performed by antigen presenting cells (APCs). Some antigens require processing before they can be recognized. Antigen processing consists of ingestion and partial digestion of the antigen by the APC, followed by presentation of fragments on the cell surface. (From Rosen et al., Dictionary of Immunology, 1989)
Peptides composed of between two and twelve amino acids.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
A serine endopeptidase that is formed from TRYPSINOGEN in the pancreas. It is converted into its active form by ENTEROPEPTIDASE in the small intestine. It catalyzes hydrolysis of the carboxyl group of either arginine or lysine. EC 3.4.21.4.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Any liquid or solid preparation made specifically for the growth, storage, or transport of microorganisms or other types of cells. The variety of media that exist allow for the culturing of specific microorganisms and cell types, such as differential media, selective media, test media, and defined media. Solid media consist of liquid media that have been solidified with an agent such as AGAR or GELATIN.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Cell surface proteins that bind signalling molecules external to the cell with high affinity and convert this extracellular event into one or more intracellular signals that alter the behavior of the target cell (From Alberts, Molecular Biology of the Cell, 2nd ed, pp693-5). Cell surface receptors, unlike enzymes, do not chemically alter their ligands.
A species of gram-positive, aerobic bacteria that produces TUBERCULOSIS in humans, other primates, CATTLE; DOGS; and some other animals which have contact with humans. Growth tends to be in serpentine, cordlike masses in which the bacilli show a parallel orientation.
Any tests that demonstrate the relative efficacy of different chemotherapeutic agents against specific microorganisms (i.e., bacteria, fungi, viruses).
Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
Deletion of sequences of nucleic acids from the genetic material of an individual.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.
Intracellular fluid from the cytoplasm after removal of ORGANELLES and other insoluble cytoplasmic components.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
The process by which two molecules of the same chemical composition form a condensation product or polymer.
Granular leukocytes having a nucleus with three to five lobes connected by slender threads of chromatin, and cytoplasm containing fine inconspicuous granules and stainable by neutral dyes.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Elements of limited time intervals, contributing to particular results or situations.
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.

The Drosophila kismet gene is related to chromatin-remodeling factors and is required for both segmentation and segment identity. (1/65263)

The Drosophila kismet gene was identified in a screen for dominant suppressors of Polycomb, a repressor of homeotic genes. Here we show that kismet mutations suppress the Polycomb mutant phenotype by blocking the ectopic transcription of homeotic genes. Loss of zygotic kismet function causes homeotic transformations similar to those associated with loss-of-function mutations in the homeotic genes Sex combs reduced and Abdominal-B. kismet is also required for proper larval body segmentation. Loss of maternal kismet function causes segmentation defects similar to those caused by mutations in the pair-rule gene even-skipped. The kismet gene encodes several large nuclear proteins that are ubiquitously expressed along the anterior-posterior axis. The Kismet proteins contain a domain conserved in the trithorax group protein Brahma and related chromatin-remodeling factors, providing further evidence that alterations in chromatin structure are required to maintain the spatially restricted patterns of homeotic gene transcription.  (+info)

Molecular chaperones: small heat shock proteins in the limelight. (2/65263)

Small heat shock proteins have been the Cinderellas of the molecular chaperone world, but now the crystal structure of a small heat shock protein has been solved and mutation of two human homologues implicated in genetic disease. Intermediate filaments appear to be one of the key targets of their chaperone activity.  (+info)

Insect evolution: Redesigning the fruitfly. (3/65263)

Homeotic mutations in Drosophila can result in dramatic phenotypes that suggest the possibility for rapid morphological evolution, but dissection of the genetic pathway downstream of Ultrabithorax is beginning to reveal how wing morphology may have evolved by more gradual transformations.  (+info)

Telomerase reverse transcriptase gene is a direct target of c-Myc but is not functionally equivalent in cellular transformation. (4/65263)

The telomerase reverse transcriptase component (TERT) is not expressed in most primary somatic human cells and tissues, but is upregulated in the majority of immortalized cell lines and tumors. Here, we identify the c-Myc transcription factor as a direct mediator of telomerase activation in primary human fibroblasts through its ability to specifically induce TERT gene expression. Through the use of a hormone inducible form of c-Myc (c-Myc-ER), we demonstrate that Myc-induced activation of the hTERT promoter requires an evolutionarily conserved E-box and that c-Myc-ER-induced accumulation of hTERT mRNA takes place in the absence of de novo protein synthesis. These findings demonstrate that the TERT gene is a direct transcriptional target of c-Myc. Since telomerase activation frequently correlates with immortalization and telomerase functions to stabilize telomers in cycling cells, we tested whether Myc-induced activation of TERT gene expression represents an important mechanism through which c-Myc acts to immortalize cells. Employing the rat embryo fibroblast cooperation assay, we show that TERT is unable to substitute for c-Myc in the transformation of primary rodent fibroblasts, suggesting that the transforming activities of Myc extend beyond its ability to activate TERT gene expression and hence telomerase activity.  (+info)

A single membrane-embedded negative charge is critical for recognizing positively charged drugs by the Escherichia coli multidrug resistance protein MdfA. (5/65263)

The nature of the broad substrate specificity phenomenon, as manifested by multidrug resistance proteins, is not yet understood. In the Escherichia coli multidrug transporter, MdfA, the hydrophobicity profile and PhoA fusion analysis have so far identified only one membrane-embedded charged amino acid residue (E26). In order to determine whether this negatively charged residue may play a role in multidrug recognition, we evaluated the expression and function of MdfA constructs mutated at this position. Replacing E26 with the positively charged residue lysine abolished the multidrug resistance activity against positively charged drugs, but retained chloramphenicol efflux and resistance. In contrast, when the negative charge was preserved in a mutant with aspartate instead of E26, chloramphenicol recognition and transport were drastically inhibited; however, the mutant exhibited almost wild-type multidrug resistance activity against lipophilic cations. These results suggest that although the negative charge at position 26 is not essential for active transport, it dictates the multidrug resistance character of MdfA. We show that such a negative charge is also found in other drug resistance transporters, and its possible significance regarding multidrug resistance is discussed.  (+info)

Evidence for F-actin-dependent and -independent mechanisms involved in assembly and stability of the medial actomyosin ring in fission yeast. (6/65263)

Cell division in a number of eukaryotes, including the fission yeast Schizosaccharomyces pombe, is achieved through a medially placed actomyosin-based contractile ring. Although several components of the actomyosin ring have been identified, the mechanisms regulating ring assembly are still not understood. Here, we show by biochemical and mutational studies that the S.pombe actomyosin ring component Cdc4p is a light chain associated with Myo2p, a myosin II heavy chain. Localization of Myo2p to the medial ring depended on Cdc4p function, whereas localization of Cdc4p at the division site was independent of Myo2p. Interestingly, the actin-binding and motor domains of Myo2p are not required for its accumulation at the division site although the motor activity of Myo2p is essential for assembly of a normal actomyosin ring. The initial assembly of Myo2p and Cdc4p at the division site requires a functional F-actin cytoskeleton. Once established, however, F-actin is not required for the maintenance of Cdc4p and Myo2p medial rings, suggesting that the attachment of Cdc4p and Myo2p to the division site involves proteins other than actin itself.  (+info)

Membrane deinsertion of SecA underlying proton motive force-dependent stimulation of protein translocation. (7/65263)

The proton motive force (PMF) renders protein translocation across the Escherichia coli membrane highly efficient, although the underlying mechanism has not been clarified. The membrane insertion and deinsertion of SecA coupled to ATP binding and hydrolysis, respectively, are thought to drive the translocation. We report here that PMF significantly decreases the level of membrane-inserted SecA. The prlA4 mutation of SecY, which causes efficient protein translocation in the absence of PMF, was found to reduce the membrane-inserted SecA irrespective of the presence or absence of PMF. The PMF-dependent decrease in the membrane-inserted SecA caused an increase in the amount of SecA released into the extra-membrane milieu, indicating that PMF deinserts SecA from the membrane. The PMF-dependent deinsertion reduced the amount of SecA required for maximal translocation activity. Neither ATP hydrolysis nor exchange with external SecA was required for the PMF-dependent deinsertion of SecA. These results indicate that the SecA deinsertion is a limiting step of protein translocation and is accelerated by PMF, efficient protein translocation thereby being caused in the presence of PMF.  (+info)

Cloning and characterisation of a novel ompB operon from Vibrio cholerae 569B. (8/65263)

The ompB operon of Vibrio cholerae 569B has been cloned and fully sequenced. The operon encodes two proteins, OmpR and EnvZ, which share sequence identity with the OmpR and EnvZ proteins of a variety of other bacteria. Although the order of the ompR and envZ genes of V. cholerae is similar to that of the ompB operon of E. coli, S. typhimurium and X. nematophilus, the Vibrio operon exhibits a number of novel features. The structural organisation and features of the V. cholerae ompB operon are described.  (+info)

Shop Glutamate/aspartate import solute-binding protein ELISA Kit, Recombinant Protein and Glutamate/aspartate import solute-binding protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
K12340 tolC; outer membrane protein K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12531 rtxE; ATP-binding cassette, subfamily B, bacterial RtxE K12532 rtxD; membrane fusion protein, RTX toxin transport system K12532 rtxD; membrane fusion protein, RTX toxin transport system K12536 hasD; ATP-binding cassette, subfamily C, bacterial exporter for protease/lipase K12537 hasE; membrane fusion protein, protease secretion system K13408 raxA; membrane fusion protein K13409 raxB; ATP-binding cassette, subfamily B, bacterial RaxB K02452 gspC; general secretion pathway protein C K02453 gspD; general secretion pathway protein D K02454 gspE; general secretion pathway protein E [EC:7.4.2.8] K02455 gspF; general secretion pathway protein F K02456 gspG; general secretion pathway protein G K02457 gspH; general secretion pathway protein H K02458 gspI; general secretion pathway protein I K02459 gspJ; general secretion pathway protein J ...
K12340 tolC; outer membrane protein K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12531 rtxE; ATP-binding cassette, subfamily B, bacterial RtxE K12532 rtxD; membrane fusion protein, RTX toxin transport system K12532 rtxD; membrane fusion protein, RTX toxin transport system K12536 hasD; ATP-binding cassette, subfamily C, bacterial exporter for protease/lipase K12537 hasE; membrane fusion protein, protease secretion system K13408 raxA; membrane fusion protein K13409 raxB; ATP-binding cassette, subfamily B, bacterial RaxB K02452 gspC; general secretion pathway protein C K02453 gspD; general secretion pathway protein D K02454 gspE; general secretion pathway protein E [EC:7.4.2.8] K02455 gspF; general secretion pathway protein F K02456 gspG; general secretion pathway protein G K02457 gspH; general secretion pathway protein H K02458 gspI; general secretion pathway protein I K02459 gspJ; general secretion pathway protein J ...
We have identified and analysed a putative response regulator two-component gene (CaSSK1) from Candida albicans and its encoding protein (CaSsk1p). CaSSK1 has an open reading frame of 2022 bp. In the promotor region of CaSSK1 a short sequence is found that matches the consensus sequence of the stres …
The molecular determinants necessary and sufficient for recognition of its specific DNA target are contained in the C-domain (H-NSctd) of nucleoid-associated protein H-NS. H-NSctd protects from DNaseI cleavage a few short DNA segments of the H-NS-sensitive hns promoter whose sequences closely match the recently identified H-NS consensus motif (tCGt/aTa/tAATT) and, ... read more alone or fused to the protein oligomerization domain of phage λ CI repressor, inhibits transcription from the hns promoter in vitro and in vivo. The importance of H-NS oligomerization is indicated by the fact that with an extended hns promoter construct (400 bp), which allows protein oligomerization, DNA binding and transcriptional repression are highly and almost equally efficient with native H-NS and H-NSctd::λCI and much less effective with the monomeric H-NSctd. With a shorter (110 bp) construct, which does not sustain extensive protein oligomerization, transcriptional repression is less effective, but native H-NS, ...
This study revealed that AlgO binds specifically to the algO-algS intergenic region in the alginate genetic cluster and alginate-degraded products function as an effector for the dissociation of AlgO from the algO-algS intergenic region. Primary structure analysis of AlgO and gel mobility shift assays suggest that the C-terminal domain of AlgO contains the structural fold common to periplasmic solute-binding proteins. The strain A1 alginate-binding proteins (AlgQ1 and AlgQ2) are typical periplasmic solute-binding proteins (9). To investigate the binding mode of AlgO to alginate oligosaccharides, the tertiary structure of the C-terminal domain of AlgO was built by homology modeling with a SWISS-MODEL program (Fig. 1C, bottom). The structural architecture shows that the C-terminal domain comprises two domains with an α/β fold. The two domains are connected by a long linker and separated by a cleft. These structural features are also observed in AlgQ1 and AlgQ2 (39, 40). X-ray crystallography of ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Link to Pubmed [PMID] - 26374675. Sci Rep 2015 Sep;5:14223. Many Gram-negative bacteria use Type I secretion systems, T1SS, to secrete virulence factors that contain calcium-binding Repeat-in-ToXin (RTX) motifs. Here, we present structural models of an RTX protein, RD, in both its intrinsically disordered calcium-free Apo-state and its folded calcium-bound Holo-state. Apo-RD behaves as a disordered polymer chain comprising several statistical elements that exhibit local rigidity with residual secondary structure. Holo-RD is a folded multi-domain protein with an anisometric shape. RTX motifs thus appear remarkably adapted to the structural and mechanistic constraints of the secretion process. In the low calcium environment of the bacterial cytosol, Apo-RD is an elongated disordered coil appropriately sized for transport through the narrow secretion machinery. The progressive folding of Holo-RD in the extracellular calcium-rich environment as it emerges form the T1SS may then favor its ...
Genome-wide transcriptional analysis using DNA macroarrays.According to the results of the initial adhesion tests, the factor(s) involved in increased adherence was expressed in the exponential growth phase. In order to assess differences in the transcription profiles of exponentially growing planktonic cells (M63 medium, 37°C) of wild-type strain 536 and the isogenic rfaH mutant, E. coli K-12 strain MG1655-specific DNA arrays (Panorama E. coli gene arrays; Sigma-Genosys, Cambridge, United Kingdom) were used in combination with the so called E. coli pathoarray carrying an assortment of probes specific for many of the known pathogenicity island- or virulence-associated genes of uropathogenic E. coli strain 536, as well as other extraintestinal pathogenic and intestinal pathogenic E. coli strains (26). For each strain, four different RNA preparations from independent cultures were used for cDNA synthesis as follows. DNA-free total RNA was reverse transcribed and radioactively labeled. In short, ...
complex with c-di-GMP. C-di-GMP binds to the protein as an intercalated dimer, displacing the C-terminal 310 helix found in the apo form. The N-terminal part of ...
A search for factors that are necessary for the pathogenicity of Gram-negative microbes has identified many gene clusters that are closely related among different bacterial species (1). Several of these genetic loci encode type III secretion machines for the translocation of polypeptides across the bacterial double membrane envelope (1). Some mammalian pathogens such as Yersinia, Salmonella, Escherichia coli, Pseudomonas, and Shigella use type III machines for the injection of virulence factors into the cytosol of eukaryotic cells (2-7). A similar strategy is thought to be used by several plant pathogens; however, a direct demonstration of their protein injection has not yet been achieved (7). Salmonella typhimurium and perhaps other Gram-negative bacteria harbor two gene clusters that each specifies a type III machine (2). Mutants that abolish the function of individual type III machines arrest pathogenicity at distinct steps during Salmonella infection, indicating that protein secretion is ...
Our main project is on Type III Secretion Apparatus which is one of the most amazing biological devices. This apparatus which looks like a syringe can pass a whole protein molecule from a bacterial cell to a target eukaryotic cell. However, this apparatus is an organelle of pathogenic gram-negative bacterium such as Salmonella and Yersinia. So we are aiming at making this device safely available using E. coli. ...
nbsp;  Our main project is on Type III Secretion Apparatus which is one of the most amazing biological devices. This apparatus which looks like a syringe can pass a whole protein molecule from a bacterial cell to a target eukaryotic cell. However, this apparatus is an organelle of pathogenic gram-negative bacterium such as Salmonella and Yersinia. So we are aiming at making this device safely available using E. coli ...
Sara V. Pais. PhD Student. Project: Characterization of novel type III secretion effectors of Chlamydia trachomatis. Phone: +351 21 294 8530 ...
Approximately 20% of bacterial proteins have functions outside the cytoplasm ( 1 ). Consequently, all bacteria possess protein export pathways that transport proteins made in the cytoplasm beyond the cytoplasmic membrane. These exported proteins may remain in the bacterial cell envelope or be further secreted to the extracellular environment. Many exported proteins function in essential physiological processes. Additionally, in bacterial pathogens, many exported proteins have functions in virulence. Consequently, the pathways that export proteins are commonly essential and/or are important for pathogenesis. Across bacteria, including mycobacteria, there are conserved protein export pathways: the general secretion (Sec) and the twin-arginine translocation (Tat) pathways. Both Sec and Tat pathways are essential to the viability of Mycobacterium tuberculosis and both also contribute to virulence (L. Rank and M. Braunstein, unpublished; 2 - 4 ). In addition to these conserved pathways, bacterial pathogens
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
An adaptive response to environmental stimuli is essential for life. The most widespread response mechanism involves the transfer of a phosphoryl group amongst the proteins in a signalling process. Two-component signal transduction systems are the chief signalling devices in bacteria and archaea. Actually, they are found in all life domains, although not in animals. A single bacteria can contain tens to hundreds of two-component systems controlling vital processes such as metabolism, development, motility, response to stress or virulence. These systems offer enormous possibilities for the development of new antimicrobials because they play a paramount role in bacterial physiology and in virulence processes, allowing adaptation of a parasite to its human host, or even triggering resistance to known antibiotics.. Although there are numerous variations in the details, two components systems obey the same basic pattern. The prototype consists of two proteins. One of them is a homodimeric membrane ...
Protecting Yourself in Hostile Environments | SHIELD offers a self-protection course that learns you to operate under extreme conditions in conflict areas.
The type III secretion system (TTSS) is a key mechanism for host cell interaction used by a variety of bacterial pathogens and symbionts of plants and animals including humans. The TTSS represents a molecular syringe with which the bacteria deliver effector proteins directly into the host cell cytosol. Despite the importance of the TTSS for bacterial pathogenesis, recognition and targeting of type III secreted proteins has up until now been poorly understood. Several hypotheses are discussed, including an mRNA-based signal, a chaperon-mediated process, or an N-terminal signal peptide. In this study, we systematically analyzed the amino acid composition and secondary structure of N-termini of 100 experimentally verified effector proteins. Based on this, we developed a machine-learning approach for the prediction of TTSS effector proteins, taking into account N-terminal sequence features such as frequencies of amino acids, short peptides, or residues with certain physico-chemical properties. The ...
The type III secretion system (TTSS) is a key mechanism for host cell interaction used by a variety of bacterial pathogens and symbionts of plants and animals including humans. The TTSS represents a molecular syringe with which the bacteria deliver effector proteins directly into the host cell cytosol. Despite the importance of the TTSS for bacterial pathogenesis, recognition and targeting of type III secreted proteins has up until now been poorly understood. Several hypotheses are discussed, including an mRNA-based signal, a chaperon-mediated process, or an N-terminal signal peptide. In this study, we systematically analyzed the amino acid composition and secondary structure of N-termini of 100 experimentally verified effector proteins. Based on this, we developed a machine-learning approach for the prediction of TTSS effector proteins, taking into account N-terminal sequence features such as frequencies of amino acids, short peptides, or residues with certain physico-chemical properties. The ...
The proposed mathematical model was found to be reasonable in characterizing bacterial growth and predicting the fitness cost of resistance. This simple method appears robust in the assessment of fitness cost associated with drug resistance and warrants further investigations.
Bacterial protein structures can expedite the development of novel antibiotics. Here is the latest research on bacterial proteins and the resolution of their structures. ...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
During infection, senses and responds to stress; such responses may be modulated by MisRS (NGO0177 and NGO0176), a two-component system that is a homolog of CpxRA. In , CpxRA senses and responds to envelope stress; CpxA is a sensor kinase/phosphatase for CpxR, a response regulator. When a mutant is grown in medium containing glucose, CpxR is phosphorylated by acetyl phosphate but cannot be dephosphorylated, resulting in constitutive activation. Kandler and coworkers (J. L. Kandler, C. L. Holley, J. L. Reimche, V. Dhulipala, J. T. Balthazar, A. Muszynski, R. W. Carlson, and W. M. Shafer, Antimicrob Agents Chemother 60:4690-4700, 2016, https://doi.org/10.1128/AAC.00823-16) showed that MisR (CpxR) is required for the maintenance of membrane integrity and resistance to antimicrobial peptides, suggesting a role in gonococcal survival Here, we evaluated the contributions of MisR and MisS (CpxA) to gonococcal infection in a murine model of cervicovaginal colonization and identified MisR-regulated genes ...
Our aims in this competitive renewal application are shaped by our observations during the previous funding period that confirmed the critical role of cyclooxyg...
Bacterial proteins exported to the cell surface play key cellular functions. However, despite the interest to study the localisation of surface proteins such
MIT researchers have discovered why an unusually short bacterial protein can have many more interactions than would normally be expected of something its size.
Open full size. Functional types of settlements. The map Functional types of settlements is created using conventional symbols. It shows the distribution of settlements within the Baikal basin and their economic significance. The main content of the map is the network of urban and rural settlements with their population. The size of population is shown by the symbols of different sizes in accordance with the selected scale of nine gradations of the population size. The color of symbols shows the functional type of settlements determined based on the structure of employment of the local population in various sectors of economy.. A dominant role in the settlement network formed in the Baikal basin is played by large multi-functional industrial-transport, administrative-cultural, and scientific centers of the state (Ulaanbaatar) and regional (Irkutsk, Ulan-Ude, and Chita) significance.. Various specialized industrial and transport centers are almost exclusively confined to the railway lines. ...
Virulence, Disease and DefenseResistance to antibiotics and toxic compoundsCobalt-zinc-cadmium resistance Transcriptional regulator, MerR family ...
Gentaur molecular products has all kinds of products like :search , GenWay \ Hypothetical protein STARD7 - \ 10-288-22258F for more molecular products just contact us
Debby Brown, National Handi Quilter Educator, demonstrates how to use the TruStitch™ Stitch Regulation System on the HQ Sweet Sixteen sit-down machine. Clip is from Debbys video Sit-Down .... ...
hypothetical protein [hypothetical protein] GTGAGCGCGCCGCCGGCCGCCCTGTCGCCCACCGAGCGGGGCACGGAGTGCGACGCGCTG ATCGACGACTGGCTCGGGACCGACCTCGACGCGTGGACACGGAAGGTGGTGGCGCGGCAC TTCCACCCGGAGACCGGCAGTCCGTACTGGCTGCGGCGCGCCGCTGGACTGGGCTTCGAC GCGCGGGACATCACCCGCTATGACCAGCTCACGGCGTTCGGACCGTTCCCGGTGGACATC CTGCGCTCCCAGGACCCGGCGGATCTGGTGCCGCTCGACGTGCCGCGCCCGCTGACCGGC CGCGTCTGGGACACCGGCGGCACGACCGGCGCGCCCTGTCGGCTGTTCTACACACCCGCC ATGCTGCTGCACCGGGGCGCGTGGCGCCGCTGGTCCTTCGTCACCGAGGGGTTCACCCAG GGGCGGACCTGGCTCCAGGCGACCCCCACGGGACCGCATCTGATCGGCAACGGCATGTGG GAGGTGTCGGACCTGTACGCCGGTCAGGTGTACGGCGTCGACATGGACCCGCGCTGGGTC AAGCGGCTCATCCGGGCCGGCCGGCTGGCGGACGCGACCGAGTACACCACCCATCTGCTG GAGCAGGTCACCGACGTGCTCATCCACGGCCGGATCGACTACCTCAACACCACTCCCGCG CTCTTCCTGGCGCTGGTGCGCCGCCATCCCGAACTGGTCGCACCGCTGCGGGGGGTGCGG CTGAGCGGCACGCAGCTGAGCCCGGACATGTACCGGGACTTCATGGCCGCGATGGACGAC GGAATCTGCGGCCGCAGCTACGGCAACACCTTCGGCAACGCGGCGGGGCTGCCCGTCGAG CAGAACGCCGAACTCATGCCCTATGTTCCGAATTATCCACAGGTGACAATGAACGTCGTA ...
1.Grow cells to mid-log (~1x107 cells/ml; A600 = 0.7 or klett 80) and collect 1.5 ml cells in 1.5 ml microfuge tube (1 minute, 14000xg). It is important not to grow the cells to a high density as this method will not work well ...
hypothetical protein] GTGACCCATCACCGCCGCCGCGCCGCCCGGCGCCGCGACCGCACTCGCCGGATCACACCC CGCACCCATTGGCTGCTGCTCAGCGTGTTCGCGGTCACCTTGTCCACGGCCCTGCTGCTC CAGGGCTACACCCACCACATGTTCGGCATCACCTCGGACGCCGTGACCGGCGTCCGGGGC AGGAGCGACATGGTGCCCGCCCGGGTGGCCCACGGCGGCCCCGTGATCGCGGGCGCCGCC ACCTCTCCCCACACCGCCCGGGTGCGGCCCCGCACCATCGCGCTGACCTTCGACGACGGC CCGGACCCCACCTGGACGCCACGCATCCTGGAGGTGCTGCGCCGCAACCACGTGCACGCG ACCTTCTTCGTCGTCGGGACCCAGGTCGTCGCCCACCCCGAGCTGGTCCGCCGTATCGTC GCCGACGGCCACCAGATCGGCATCCACACCTTCACCCATCCCGACCTGGCCCGTCTCGCC CCGTGGCAACGCTCGCTGGAGTTGCGTGAGACGCAGTTGGCGGTGGCCGGCGCCGCGGGG GTCACCACCGCACTGCTCAGGCCGCCGTACTCCTCGGAGAACGGCGCGCTGGACGACGCC GACTGGTCCGTCCTGAAGCAGGCCGACGCGGCGGGTTACGTCACGGTGCTGTCCACCCAG GACGCCGAGGACTGGCAGCGCCCCGGTGCGCGCCGCATCCTCGCGAACGCGACACCACAC GGGCACGGCGGGCAGGTCCTGCTCATGCACGACGCCGGCGGCGACCGCTCCCAGACCGTC GCCGCGCTGGCTGCCCTGGTCCCACGCCTCAAGGCGCAGGGCTTCAGGTTCGCGACGGTC TCCGACGCGGTCGGCATGGCCGCACCCGTACAGCCCGCCGGCCTGGGCGATCACCTGCAA GGACTGGCCCTCGTCAGGGCCCTCCAGGGCGGTGACCGGGTCGTCCGGCTGCTGGGCTGG ...
The type 2 secretion system (often referred to as the type II secretion system or the T2SS) is protein secretion machinery found in various species of Gram-negative bacteria, including various human pathogens such as Pseudomonas aeruginosa and Vibrio cholerae. The type II secretion system is one of six protein secretory systems that are commonly found in gram negative bacteria along with the type I secretion system, the type III secretion system, The type IV secretion system, the chaperone/usher pathway, the autotransporter pathway/type V secretion system and the type VI secretion system (some bacteria also utilize the type VII secretion system). Like these other systems, the type II secretion system enables the transport of cytoplasmic proteins across the lipid bilayers that make up the cell membranes in gram negative bacteria. The type II secretion system is a membrane bound protein complex found in Gram-negative bacteria that is used to secrete proteins found in the cytoplasm of the bacteria ...
Type III secretion systems enable plant and animal bacterial pathogens to deliver virulence proteins into the cytosol of eukaryotic host cells, causing a broad spectrum of diseases including bacteremia, septicemia, typhoid fever, and bubonic plague in mammals, and localized lesions, systemic wilting, and blights in plants. In addition, type III secretion systems are also required for biogenesis of the bacterial flagellum. The HrcQ(B) protein, a component of the secretion apparatus of Pseudomonas syringae with homologues in all type III systems, has a variable N-terminal and a conserved C-terminal domain (HrcQ(B)-C). Here, we report the crystal structure of HrcQ(B)-C and show that this domain retains the ability of the full-length protein to interact with other type III components. A 3D analysis of sequence conservation patterns reveals two clusters of residues potentially involved in protein-protein interactions. Based on the analogies between HrcQ(B) and its flagellum homologues, we propose ...
Many Gram-negative bacterial pathogens utilize type III secretion systems (TTSSs) for subverting the normal cellular functions of their target eukaryotic cells. The type III secretion apparatus (TTSA) functions like a syringe to inject proteins through an external needle and into a target cells membrane and cytosol. The TTSA basal body spans the bacterial inner and outer membranes, and the external needle is topped with a tip complex that controls the secretion and delivery of translocator and effector proteins. The needle is formed by the polymerization of ~120 copies of a small acidic protein that is conserved among diverse pathogens. At the tip of the needle, a tip complex is assembled by tip proteins into a ring-like structure which serves as a platform for the assembly of the translocon by translocator proteins. We use NMR spectroscopy to understand how the needle is assembled and how the tip complex is assembled on top of the needle. We determined the solution structures of the BsaL ...
Since their discovery in the 20th century, antibiotics have been prescribed for patients with bacterial infections. The first commercially available antibiotic was penicillin, which was discovered in 1928 by Alexander Fleming in St. Marys Hospital, UK. Penicillin was effective to inhibit the growth of disease-causing microorganisms. However, in 1947, four years after the mass-production of penicillin, the first penicillin resistance case was identified. Since then, scientists have been looking for new targets to inhibit the bacterial growth. Among them, the bacterial cell division protein, filament temperature-sensitive Z (FtsZ), is a promising target for the development of new antibiotics. FtsZ protein is an essential protein in bacterial cytoplasmic division. A GTPase active site is formed when two FtsZ monomers are joined together in head-to-tail manner. The presence of GTP induces the polymerization of FtsZ in the middle of the cell. FtsZ polymers act as a platform to recruit other cell ...
FtsZ plays an important role in bacterial cell division by polymerizing to form the Z ring at the site of cytokinesis. Phytochemicals are known to disrupt bacterial cell division through inhibition of FtsZ assembly. In the present study phytochemicals like eugenol, trans-cinnamic acid, 4-formyl cinnamic acid, naringenin and caffeic acid were were tested for their potential to inhibit cell division. Effect of these antimicrobial compounds on the growth of E. coli was determined and the inhibition of FtsZ assembly in vitro was investigated. The present study revealed trans-cinnamic acid as the most potent inhibitor of FtsZ assembly ...
Protein secretion in Pseudomonas aeruginosa involves different mechanisms. The type II and type III secretory pathways control the extracellular release of a wide range of substrates. The type I secretion process, or ABC transporter, was believed to be exclusively involved in alkaline protease secretion. Recently, it was discovered that a P. aeruginosa heme binding protein, HasAp, is also secreted by a type I process. We present here the identification of a third putative type I-dependent protein of P. aeruginosa, AprX. The function of this protein has not yet been elucidated but very interestingly it appears to be linked to the apr cluster, and organized in one single operon together with the aprD, -E and -F genes.
We have characterized the self-association of FtsZ in its GDP-bound state (GDP-FtsZ) and the heteroassociation of FtsZ and a soluble recombinant ZipA (sZipA) lacking the N-terminal transmembrane domain by means of composition gradient−static light scattering (CG−SLS) and by measurement of sedimentation equilibrium. CG−SLS experiments at high ionic strengths and in the presence of 5 mM Mg2+ show that, while FtsZ self-associates in a noncooperative fashion, sZipA acts as a monomer. CG−SLS data obtained from mixtures of FtsZ (A) and sZipA (B) in the presence of Mg2+ are quantitatively described by an equilibrium model that takes into account significant scattering contributions from B, A1, A2, A3, A4, A5, A6, A1B, A2B, A3B, and A4B. However, in the absence of Mg2+ (with EDTA), the data are best explained by an equilibrium model in which only B, A1, A2, A3, A1B, and A2B contribute significantly to scattering. The best-fit molecular weights of monomeric A and B are in good agreement with ...
A wide variety of drug-resistant microorganisms are continuously emerging, restricting the therapeutic options for common bacterial infections. Antimicrobial agents that were originally potent are now...
Bacteria propel themselves through liquid environments using rotation of a propeller like organelle, the flagellum. Flagella are energized by the membrane ion gradient and enable bacteria to swim towards nutrients and away from harmful substances. This unique nanomachine shares structural and functional similarities to the needle-like injectisome complex that pathogenic bacteria employ to inject virulence factors into eukaryotic host cells. Bacterial flagella and injectisomes contain a specialized protein export system, termed type III secretion, that functions to deliver structural subunits and effector proteins to the outside of the cytoplasmic membrane. Type III secretion systems are made of multiple proteins, however, the function of individual subunits and the molecular mechanism of protein translocation is poorly understood.,br /,The first part of this thesis reports that the flagellar type III secretion system functions as a proton-driven protein exporter and demonstrates that many ...
1. PugsleyAP. 1993 The complete general secretory pathway in gram-negative bacteria. Microbiol Rev 57 50 108. 2. SandkvistM. 2001 Biology of type II secretion. Mol Microbiol 40 271 283. 3. TauschekM. GorrellRJ. StrugnellRA. Robins-BrowneRM. 2002 Identification of a protein secretory pathway for the secretion of heat-labile enterotoxin by an enterotoxigenic strain of Escherichia coli. Proc Natl Acad Sci U S A 99 7066 7071. 4. OverbyeLJ. SandkvistM. BagdasarianM. 1993 Genes required for extracellular secretion of enterotoxin are clustered in Vibrio cholerae. Gene 132 101 106. 5. SandkvistM. MoralesV. BagdasarianM. 1993 A protein required for secretion of cholera toxin through the outer membrane of Vibrio cholerae. Gene 123 81 86. 6. HueckCJ. 1998 Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62 379 433. 7. KuboriT. MatsushimaY. NakamuraD. UralilJ. Lara-TejeroM. 1998 Supramolecular structure of the Salmonella typhimurium type III protein ...
Pss may be transmitted from one generation of its host to the next via seeds. Hence, inoculation of bean seeds with relatively small numbers of bacteria at the time of planting was selected as a way to naturally initiate the plant-bacterial interaction in the field. The apparently normal growth of the type III secretion mutants on preemergent bean plants was unexpected given the in planta growth defects of hrp mutants observed in laboratory experiments (16, 23). After plant emergence, however, leaf population sizes of the hrcC and hrpJ mutants were significantly lower than B728a. Numbers of the mutants tended to remain constant or decline, even under conditions of intense rains, when population sizes of B728a and the hrpZ mutant increased significantly. The hrcC and hrpJ mutants behaved similarly, although the specific genes mutated and the nature of the mutations differed in the two constructs. Thus, mutations in hrp genes that affected the Hrp secretion system substantially reduced growth and, ...
Web server == https://rostlab.org/services/pEffect/ == Introduction == The type III secretion system is one of the causes of a wide range of bacterial infections in human, animals and plants. This system comprises a hollow needle-like structure localized on the surface of bacterial cells that injects specific bacterial proteins, the so-called effectors, directly into the cytoplasm of a host cell. During infection, effectors convert host resources to their advantage and promote pathogenicity. We - Tatyana Goldberg, Burkhard Rost and Yana Bromberg - at [http://bromberglab.org BrombergLab] and [http://rostlab.org/cms/ RostLab] developed a novel method, pEffect that predicts bacterial type III effector proteins. In our method, we combine sequence-based homology searches and advanced machine learning to accurately predict effector proteins. We use information encoded in the entire protein sequence for our predictions. == Method design == pEffect is a method that combines sequence ...
1. OlsenSJMacKinnonLCGouldingJSBeanNHSlutskerL 2000 Surveillance for foodborne-disease outbreaks-United States, 1993-1997. MMWR CDC Surveill Summ 49 1 62. 2. SchmidtHHenselM 2004 Pathogenicity islands in bacterial pathogenesis. Clin Microbiol Rev 17 14 56. 3. GalanJEWolf-WatzH 2006 Protein delivery into eukaryotic cells by type III secretion machines. Nature 444 567 573. 4. AbrahamsGLHenselM 2006 Manipulating cellular transport and immune responses: dynamic interactions between intracellular Salmonella enterica and its host cells. Cell Microbiol 8 728 737. 5. GalanJE 2001 Salmonella interactions with host cells: type III secretion at work. Annu Rev Cell Dev Biol 17 53 86. 6. WatermanSRHoldenDW 2003 Functions and effectors of the Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol 5 501 511. 7. HueckCJ 1998 Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62 379 433. 8. EllermeierJRSlauchJM 2007 Adaptation to the host ...
The LysR-family regulator MexT modulates the expression of the MexEF-OprN efflux system in the human pathogen Pseudomonas aeruginosa. Recently, we demonstrated that MexT regulates certain virulence phenotypes, including the type-three secretion system and early attachment independent of its role in regulating MexEF-OprN. In this study, transcriptome profiling was utilized to investigate the global nature of MexT regulation in P. aeruginosa PAO1 and an isogenic mexEF mutant. Twelve genes of unknown function were highly induced by overexpressing MexT independent of MexEF-OprN. A well-conserved DNA motif was identified in the upstream regulatory region of nine of these genes and upstream of mexE. Reporter fusion analysis demonstrated that the expression of the genes was significantly induced by MexT in P. aeruginosa and a heterogenous Escherichia coli strain and that the conserved sequence was required for this induction. The conserved DNA motif was further characterized as the MexT binding site by ...
HilA activates the expression of Salmonella enterica serovar Typhimurium invasion genes. To learn more about regulation of hilA, we isolated Tn5 mutants exhibiting reduced hilA and/or invasion gene expression. In addition to expected mutations, we identified Tn5 insertions in pstS, fadD, flhD, flhC, and fliA. Analysis of the pstS mutant indicates that hilA and invasion genes are repressed by the response regulator PhoB in the absence of the Pst high-affinity inorganic phosphate uptake system. This system is required for negative control of the PhoR-PhoB two-component regulatory system, suggesting that hilA expression may be repressed by PhoRPhoB under low extracellular inorganic phosphate conditions. FadD is required for uptake and degradation of long-chain fatty acids, and our analysis of the fadD mutant indicates that hilA is regulated by a FadDdependent, FadR-independent mechanism. Thus, fatty acid derivatives may act as intracellular signals to regulate hilA expression. flhDC and fliA encode
Sensor kinases play a key role in sensing and responding to environmental and physiological signals in bacteria. In this study we characterized a previously unknown orphan hybrid sensor kinase from Pseudomonas putida, which is conserved in several Pseudomonads. Inactivation of the gene coding for this sensor kinase, which we have named HskA, modified the expression of at least 85 genes in cells growing in a complete medium. HskA showed a strong influence on the composition of the electron transport chain. In cells growing exponentially in a complete medium, the absence of HskA led to a significant reduction in the expression of the genes coding for the bc1 complex and for the CIO and Cbb3-1 terminal oxidases. In stationary phase cells, however, lack of HskA caused a higher expression of the Cyo terminal oxidase and a lower expression of the Aa3 terminal oxidase. The HskA polypeptide shows two PAS (signal-sensing) domains, a transmitter domain containing the invariant phosphorylatable histidine ...
Summary The gram-positive bacterium Bacillus subtilis is well-known for its contributions to agricultural, medical, and food biotechnology and for the production of recombinant proteins. At present, about 60% of the commercially available technical enzymes are produced by Bacillus species. Furthermore, a large body of information concerning transcription, translation, protein folding and secretion mechanisms, genetic manipulation, and large-scale fermentation has been acquired. But so far, efficient and inexpensive expression vectors for B. subtilis are still missing. To fill this gap, a glycine-inducible expression system and a lysine-autoinducible one were explored and IPTG-inducible expression plasmids that allow overexpression and purification of proteins were constructed and analyzed. Furthermore, a technique with a useful promoter-probe plasmid to analyze strong promoters in B. subtilis was established, which allowed to study promoter and mRNA stabilizing elements to enhance the transcript ...
DnaA protein (a trans-acting element) and its binding sequence, DnaA-box: (a cis-acting element) are two elements essential for the initiation of chromosomal replication in Escherichia coli and other enteric bacteria. Recently these two elements have been found to be conserved in three Gram-positive bacteria (Bacillus subtilis, Micrococcus luteus and Mycoplasma capricolum) as well as in Gram-negative pseudomonads. DnaA protein was also found to be essential in the initiation of the replication of the B. subtilis chromosome, and regions containing multiple repeats of DnaA-box (DnaA-box region) are found to be active as autonomously replicating elements both in B. subtilis and pseudomonads. In this MicroReview we compare first the structures of these DnaA-box regions and their locations on the chromosome and then functional aspects of DnaA protein and DnaA-box regions in the initiation and regulation of chromosomal replication. From these observations we propose evolutionary relationships between ...
Our research seeks to elucidate the molecular basis for the temporal and spatial control of cell division. From bacteria to yeast to humans, cell division is initiated by the formation of a ring of a cytoskeletal protein at the nascent division site. This ring establishes the location of the division septum and serves as a framework for assembly of the division apparatus. In bacteria this ring is composed of the essential tubulin-like GTPase FtsZ. In response to an unidentified cell cycle signal, FtsZ polymerizes into a ring structure that serves as a framework on which the division machinery is assembled. As division proceeds, the FtsZ ring constricts, like a drawstring, at the leading edge of the invaginating septum. We focus our research on the regulatory networks that govern FtsZ ring formation in three model organisms, the soil bacterium Bacillus subtilis, E. coli, and the pathogen Staphylococcus aureus. To date, the signals that couple FtsZ ring formation and constriction to the cell cycle ...
The chromosome of Y. enterocolitica encodes a heat-stable enterotoxin, Yst, being related to STI. The capacity to produce Yst generally disappears during storage of the strains. In these strains, the yst gene is intact but remains silent. The pYV plasmid encodes the eleven secreted antihost proteins called Yops as well as the outer membrane protein YadA. The Yops are secreted by a novel, pYV-encoded secretion mechanism. This mechanism which does not involve the removal of an N-terminal signal sequence, is encoded by the pYV virA and virC loci. The virC locus contains 13 genes called yscA-M. The virA locus encodes the LcrD membrane protein. The yop, yadA and ysc genes form the yop regulon controlled by transcriptional activator VirF. Transcription of the yop, yadA, ysc and virF genes is controlled by temperature. A chromosome-encoded histone-like protein, called YmoA, is involved in the thermoregulation of the yop regulon, which suggests that this thermoregulation could result from ...
TY - JOUR. T1 - Heterogeneity in ess transcriptional organization and variable contribution of the Ess/Type VII protein secretion system to virulence across closely related Staphylocccus aureus strains. AU - Kneuper, Holger. AU - Cao, Zhen Ping. AU - Twomey, Kate B.. AU - Zoltner, Martin. AU - Jäger, Franziska. AU - Cargill, James S.. AU - Chalmers, James. AU - van der Kooi-Pol, Magdalena M.. AU - van Dijl, Jan Maarten. AU - Ryan, Robert P.. AU - Hunter, William N.. AU - Palmer, Tracy. N1 - © 2014 The Authors. Molecular Microbiology published by John Wiley & Sons Ltd.. PY - 2014/7/30. Y1 - 2014/7/30. N2 - The Type VII protein secretion system, found in Gram-positive bacteria, secretes small proteins, containing a conserved W-x-G amino acid sequence motif, to the growth medium. Staphylococcus aureus has a conserved Type VII secretion system, termed Ess, which is dispensable for laboratory growth but required for virulence. In this study we show that there are unexpected differences in the ...
Protein acylation is critical for many cellular functions across all domains of life. In bacteria, lipoproteins have important roles in virulence and are targets for the development of antimicrobials and vaccines. Bacterial lipoproteins are secreted from the cytosol via the Sec pathway and acylated on an N-terminal cysteine residue through the action of three enzymes. In Gram-negative bacteria, the Lol pathway transports lipoproteins to the outer membrane. Here, we demonstrate that the Aat secretion system is a composite system sharing similarity with elements of a type I secretion systems and the Lol pathway. During secretion, the AatD subunit acylates the substrate CexE on a highly conserved N-terminal glycine residue. Mutations disrupting glycine acylation interfere with membrane incorporation and trafficking. Our data reveal CexE as the first member of a new class of glycine-acylated lipoprotein, while Aat represents a new secretion system that displays the substrate lipoprotein on the cell ...
The CRP-family transcription factor NtcA, universally found in cyanobacteria, was initially discovered as a regulator operating N control. It responds to the N regime signaled by the internal 2-oxoglutarate levels, an indicator of the C to N balance of the cells. Canonical NtcA-activated promoters bear an NtcA-consensus binding site (GTAN8TAC) centered at about 41.5 nucleotides upstream from the transcription start point. In strains of the Anabaena/Nostoc genera NtcA is pivotal for the differentiation of heterocysts in response to N stress. In this study, we have used chromatin immunoprecipitation followed by high-throughput sequencing to identify the whole catalog of NtcA-binding sites in cells of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 three hours after the withdrawal of combined N. NtcA has been found to bind to 2,424 DNA regions in the genome of Anabaena, which have been ascribed to 2,153 genes. Interestingly, only a small proportion of those genes are involved in N
The σE-dependent extracytoplasmic stress response.σE is held at the membrane by the antisigma factor RseA. RseB binds to the periplasmic domain of RseA and pr
Shop Tryptophan-rich sensory protein ELISA Kit, Recombinant Protein and Tryptophan-rich sensory protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
The RTX toxin superfamily is a group of cytolysins and cytotoxins produced by bacteria. There are over 1000 known members with a variety of functions. The RTX family is defined by two common features: characteristic repeats in the toxin protein sequences, and extracellular secretion by the type I secretion systems (T1SS). The name RTX (repeats in toxin) refers to the glycine and aspartate-rich repeats located at the C-terminus of the toxin proteins, which facilitate export by a dedicated T1SS encoded within the rtx operon. RTX proteins range from 40 to over 600 kDa in size and all contain C-terminally located glycine and aspartate-rich repeat sequences of nine amino acids. The repeats contain the common sequence structure [GGXGXDX[L/I/V/W/Y/F]X], (where X represents any amino acid), but the number of repeats varies within RTX protein family members. These consensus regions function as sites for Ca2+ binding, which facilitate folding of the RTX protein following export via an ATP-mediated type 1 ...
The earliest stage in bacterial cell division is the formation of a ring, composed of the tubulin-like protein FtsZ, at the division site. Tight spatial and temporal regulation of Z-ring formation is required to ensure that division occurs precisely at midcell between two replicated chromosomes. However, the mechanism of Z-ring formation and its regulation in vivo remain unresolved. Here we identify the defect of an interesting temperature-sensitive ftsZ mutant (ts1) of Bacillus subtilis. At the nonpermissive temperature, the mutant protein, FtsZ(Ts1), assembles into spiral-like structures between chromosomes. When shifted back down to the permissive temperature, functional Z rings form and division resumes. Our observations support a model in which Z-ring formation at the division site arises from reorganization of a long cytoskeletal spiral form of FtsZ and suggest that the FtsZ(Ts1) protein is captured as a shorter spiral-forming intermediate that is unable to complete this reorganization ...
Type III secretion systems (T3SS) in phytopathogenic bacteria were first described in the 80s. However, whereas numerous characterization studies have revealed the basic processes of assembly, structure and function in animal/human pathogenic systems, our knowledge about these processes in plant type III biosystems is considerably small in comparison. Nonetheless, in recent years we have witnessed important breakthroughs in our understanding on how phytopathogens employ, build and regulate their T3SS: new master transcriptional regulators have been discovered, the activity of already described regulators of the system have been thoroughly investigated, quorum sensing regulators and population dynamics have been found to determine the fine activation of the system, new plant-derived signals have been found to upregulate the phytopathogenic T3SS, and more. Moreover, a considerable weaponry of effectors targeting and tuning the plant responses have been identified and protein components of the core
An overview was made to understand the regulation system of a bacterial cell such as Escherichia coli in response to nutrient limitation such as carbon, nitrogen, phosphate, sulfur, ion sources, and environmental stresses such as oxidative stress, acid shock, heat shock, and solvent stresses. It is quite important to understand how the cell detects environmental signals, integrate such information, and how the cell system is regulated. As for catabolite regulation, F1,6B P (FDP), PEP, and PYR play important roles in enzyme level regulation together with transcriptional regulation by such transcription factors as Cra, Fis, CsrA, and cAMP-Crp. αKG plays an important role in the coordinated control between carbon (C)- and nitrogen (N)-limitations, where αKG inhibits enzyme I (EI) of phosphotransferase system (PTS), thus regulating the glucose uptake rate in accordance with N level. As such, multiple regulation systems are co-ordinated for the cell synthesis and energy generation against nutrient
An overview was made to understand the regulation system of a bacterial cell such as Escherichia coli in response to nutrient limitation such as carbon, nitrogen, phosphate, sulfur, ion sources, and environmental stresses such as oxidative stress, acid shock, heat shock, and solvent stresses. It is quite important to understand how the cell detects environmental signals, integrate such information, and how the cell system is regulated. As for catabolite regulation, F1,6B P (FDP), PEP, and PYR play important roles in enzyme level regulation together with transcriptional regulation by such transcription factors as Cra, Fis, CsrA, and cAMP-Crp. αKG plays an important role in the coordinated control between carbon (C)- and nitrogen (N)-limitations, where αKG inhibits enzyme I (EI) of phosphotransferase system (PTS), thus regulating the glucose uptake rate in accordance with N level. As such, multiple regulation systems are co-ordinated for the cell synthesis and energy generation against nutrient
Typically comprised of ~12 different scaffold components, prokaryotic type IV secretion systems (T4SSs) translocate a variety of substrates across the cell envelope. Due to the ability to translocate large DNA segments (i.e., mobile genetic elements), some T4SSs contribute to the spread of antimicrobial resistance and virulence genes. Other T4SSs translocate smaller DNA segments and/or proteins into eukaryotic cells (e.g., arthropod, plant and human) in order to benefit bacterial survival. At least eight major groups of T4SSs are described and each group consists of minor variations on a common structural theme. Within a given bacterial genome, combinations of different T4SS groups can be encoded, and sometimes multiple copies of the same T4SS group can be present. As an example, two functionally divergent T4SSs (vir and trw) are found in many species of Bartonella, bacteria that are transmitted by arthropods such as ticks and fleas and cause a range of diseases including endocarditis. In species of
Klein JA, Dave BM, Raphenya AR, McArthur AG, Knodler LA.. Mol Microbiol. 2017 Mar;103(6):973-991.. Type III Secretion Systems (T3SSs) are structurally conserved nanomachines that span the inner and outer bacterial membranes, and via a protruding needle complex contact host cell membranes and deliver type III effector proteins. T3SS are phylogenetically divided into several families based on structural basal body components. Here we have studied the evolutionary and functional conservation of four T3SS proteins from the Inv/Mxi-Spa family: a cytosolic chaperone, two hydrophobic translocators that form a plasma membrane-integral pore, and the hydrophilic tip complex translocator that connects the T3SS needle to the translocon pore. Salmonella enterica serovar Typhimurium (S. Typhimurium), a common cause of food-borne gastroenteritis, possesses two T3SSs, one belonging to the Inv/Mxi-Spa family. We used invasion-deficient S. Typhimurium mutants as surrogates for expression of translocator ...
bacterial surface protein extraction - posted in Protein Expression and Purification: Hi, I want to prepare a lysis buffer for bacterial surface protein extraction. How can i prepare 8 M (Tris-buffered) urea containing 5 mM EDTA or is there anyone who have another idea for protein extraction?
Mutations showing specificity for normal growth or Mn(II)-dependent post-exponential phase cell division in Deinococcus radiodurans
We investigated the mechanism by which type-A ARRs regulate cytokinin signaling. Two distinct, but not mutually exclusive, models for this mechanism are proposed: one invokes phosphocompetition between the type-A and type-B ARRs, and the other involves phospho-dependent interactions of the type-A ARRs with target proteins (Figure 1A). To test these models, we generated two site-directed mutants targeting the Asp-87 residue of ARR5, ARR5D87A, and ARR5D87E. This Asp residue is conserved among response regulator family proteins and has been shown to be the target of bacterial two-component phosphorelay (Bourret et al., 1990; Stock et al., 2000; West and Stock, 2001). Substitutions at this conserved Asp have also been shown to abolish receiver domain phosphorylation in other ARRs (Kim et al., 2006; Lee et al., 2007a). In bacterial response regulators, this invariant Asp resides in the conserved active site of the receiver domain that actively catalyzes phosphotransfer from histidine kinases, Hpts, ...
Bacillus subtilis uses two-component signal transduction systems to sense intra- and extracellular stimuli to adapt to fluctuating environmental situations. Regulator aspartate phosphatases (Raps) have important roles in these processes, as they can dephosphorylate certain response-regulators, and are themselves subject to cell-density-controlled inhibition by secreted Phr (phosphate regulator) peptides. Eleven chromosomal genes encode this family of phosphatases, but in addition, certain strains contain endogenous plasmids with genes for homologous Rap-Phr systems. Plasmid pTA1060 encodes Rap60 and its antagonistic signalling molecule Phr60. Strikingly, expression of Rap60 in B. subtilis 168 strongly repressed the production of proteolytic enzymes. In fact, the transcription of the aprE gene, encoding a major extracellular protease, was shown to be decreased upon Rap60 expression, whereas this effect could be antagonized by the extracellular addition of synthetic Phr60 pentapeptide. Finally,
TY - JOUR. T1 - How Bacteria Subvert Animal Cell Structure and Function. AU - Jimenez, Alyssa. AU - Chen, Didi. AU - Alto, Neal M.. PY - 2016/10/6. Y1 - 2016/10/6. N2 - Bacterial pathogens encode a wide variety of effectors and toxins that hijack host cell structure and function. Of particular importance are virulence factors that target actin cytoskeleton dynamics critical for cell shape, stability, motility, phagocytosis, and division. In addition, many bacteria target organelles of the general secretory pathway (e.g., the endoplasmic reticulum and the Golgi complex) and recycling pathways (e.g., the endolysosomal system) to establish and maintain an intracellular replicative niche. Recent research on the biochemistry and structural biology of bacterial effector proteins and toxins has begun to shed light on the molecular underpinnings of these host-pathogen interactions. This exciting work is revealing how pathogens gain control of the complex and dynamic host cellular environments, which ...
Cell division in bacteria is a highly controlled and regulated process. FtsZ, a bacterial cytoskeletal protein, forms a ring-like structure known as the Z-ring and recruits more than a dozen other cell division proteins. The Min system oscillates between the poles and inhibits the Z-ring formation at the poles by perturbing FtsZ assembly. This leads to an increase in the FtsZ concentration at the mid-cell and helps in Z-ring positioning. MinC, the effector protein, interferes with Z-ring formation through two different mechanisms mediated by its two domains with the help of MinD. However, the mechanism by which MinD triggers MinC activity is not yet known. We showed that MinD directly interacts with FtsZ with an affinity stronger than the reported MinC-FtsZ interaction. We determined the MinD-binding site of FtsZ using computational, mutational and biochemical analyses. Our study showed that MinD binds to the H10 helix of FtsZ. Single-point mutations at the charged residues in the H10 helix ...
Salton, MR (1987). "Bacterial membrane proteins". Microbiological sciences. 4 (4): 100-5. PMID 3153178. Frigaard, NU; Bryant, ... In purple bacteria, such as Rhodospirillum rubrum, the light-harvesting proteins are intrinsic to the chromatophore membranes. ...
2012). "Bacterial Protein Toxins". Todar's Online Textbook of Bacteriology. Madison, Wisconsin. Edwin, Chitra, Parsonnet, ... Based on studies of various mutations of the protein it appears that the superantigenic and lethal portions of the protein are ... This three-dimensional structure of the TSST-1 protein was determined by purifying the crystals of the protein. The two domains ... which is why it is an important factor in menstrual TSS When the protein is translated, it is in a pro-protein form, and can ...
It inhibits bacterial protein synthesis. The combination of quinupristin and dalfopristin is not active against Enterococcus ...
This list covers bacterial proteins. For other protein-related codes, see List of MeSH codes (D12.776). Codes before these are ... MeSH D12.776.097.120.050.040 - adhesins, escherichia coli MeSH D12.776.097.120.300.500 - transferrin-binding protein a MeSH ... D12.776.097.120.300.750 - transferrin-binding protein b The list continues at List of MeSH codes (D12.776.124).. ...
"New massive dataset of bacterial proteins". EurekAlert!. Retrieved 2018-10-07. "Matthias Heinemann - Google Scholar Citations ... Kotte, Oliver; Zaugg, Judith B.; Heinemann, Matthias (2010-01-01). "Bacterial adaptation through distributed sensing of ... "Protein biogenesis machinery is a driver of replicative aging in yeast". eLife. 4: e08527. doi:10.7554/eLife.08527. ISSN 2050- ... "Bacterial persistence is an active σS stress response to metabolic flux limitation". Molecular Systems Biology. 12 (9): 882. ...
"The protein network of bacterial motility". Mol Syst Biol. 3: 128. doi:10.1038/msb4100166. PMC 1943423. PMID 17667950. Titz B, ... It is correct to say that a set of simultaneous mutations that form a complex protein structure is so unlikely as to be ... The needle's base has ten elements in common with the flagellum, but it is missing forty of the proteins that make a flagellum ... In contrast to Behe's claims, many proteins can be deleted or mutated and the flagellum still works, even though sometimes at ...
... encoding for 11 VirB proteins involved in the transfer process of T-DNA and bacterial proteins into host plant cells (see ... Bignell C, Thomas CM (September 2001). "The bacterial ParA-ParB partitioning proteins". Journal of Biotechnology. 91 (1): 1-34 ... The replication of the Ti plasmid is driven by the RepC initiator protein (P05684), which possesses two protein domains: an N- ... This activation is necessary for the production of Vir proteins and the transfer of DNA and proteins into host plant cells. ...
"Bacterial proteins pinpoint a single eukaryotic root". Proceedings of the National Academy of Sciences. 112 (7): E693-E699. ... Cavalier-Smith, Thomas (2017-09-05). "Kingdom Chromista and its eight phyla: a new synthesis emphasising periplastid protein ...
The Bacterial protein tyrosine-kinase database (BYKdb) is a specialized database of computer-annotated bacterial tyrosine- ... the Bacterial protein tYrosine Kinase database". Nucleic Acids Res. England. 40 (Database issue): D321-4. doi:10.1093/nar/ ...
This method aids the prediction of cell surface and secreted proteins in a bacterial cell that may be suitable drug targets, ... Gardy, J.L., and F.S.L. Brinkman (2006). Methods for predicting bacterial protein subcellular localization. Nature Reviews ... Expanded prediction of bacterial protein subcellular localization and insights gained from comparative proteome analysis. ... She is noted for developing PSORTb, the most precise method available for computational protein subcellular localization ...
"Bacterial proteins pinpoint a single eukaryotic root". Proceedings of the National Academy of Sciences. 112 (7): E693-E699. doi ... a new synthesis emphasising periplastid protein targeting, cytoskeletal and periplastid evolution, and ancient divergences". ...
"Bacterial proteins pinpoint a single eukaryotic root". Proceedings of the National Academy of Sciences. 112 (7): E693-E699. doi ... encode a single protein with two functions. The genes are separately translated in unikonts. Some research suggests that a ...
"Bacterial protein acts as aphrodisiac for choanoflagellates". King N, Westbrook MJ, Young SL, Kuo A, Abedin M, Chapman J, et al ... Large fragments of the nuclear SSU and LSU ribosomal RNA, alpha tubulin, and heat-shock protein 90 coding genes were used to ... The lorica is composed of individual costal strips, made of a silica-protein biocomposite. Each costal strip is formed within ... A single V. fischeri protein, EroS fully recapitulates the aphrodisiac-like activity of live V. fisheri. An EST dataset from ...
... a similar protein complex transports polypeptides across the (inner) plasma membrane or integrates membrane proteins. Bacterial ... SecY protein Bacterial secretion system Johnson, A.E.; van Waes, M.A. (1999). "The translocon: a dynamic gateway at the ER ... ER-proteins are degraded in the cytosol by the 26S proteasome, a process known as endoplasmic-reticulum-associated protein ... In either case, the protein complex are formed from Sec proteins (Sec: secretory), with the hetrotrimeric Sec61 being the ...
The diameter of spherical bacterial inclusion bodies varies from 0.5-1.3 μm and the protein aggregates have either an amorphous ... Singh, Surinder Mohan; Panda, Amulya Kumar (2005-04-01). "Solubilization and refolding of bacterial inclusion body proteins". ... Singh, Surinder Mohan; Panda, Amulya Kumar (April 2005). "Solubilization and refolding of bacterial inclusion body proteins". ... Protein inclusion bodies are classically thought to contain misfolded protein. However, this has been contested, as green ...
Bern, Marshall; Goldberg, David (November 2, 2004). "Automatic selection of representative proteins for bacterial phylogeny". ... Protein sequences can provide data about the biological function and evolution of proteins and protein domains. Grouping and ... Representative sequences are short regions within protein sequences that can be used to approximate the evolutionary ... Representative sequences are contiguous subsequences (typically 300 residues) from ubiquitous, conserved proteins, such that ...
They block protein synthesis hence preventing bacterial reproduction. Both classes of antibiotics bind to the 30S ribosomal ...
Bern, M; Goldberg, D (2005). "Automatic selection of representative proteins for bacterial phylogeny". BMC Evolutionary Biology ... 2020). A rooted phylogeny resolves early bacterial evolution. Biorxiv. Hug, L. A. et al. 2016, A new view of the tree of life. ... 2017, Global metagenomic survey reveals a new bacterial candidate phylum in geothermal springs. Nature Communications 7 · ...
Effective is a database of predicted bacterial secreted proteins. secreted proteins Jehl, Marc-André; Arnold Roland; Rattei ... a database of predicted secreted bacterial proteins". Nucleic Acids Res. England. 39 (Database issue): D591-5. doi:10.1093/nar/ ...
"Bacterial proteins pinpoint a single eukaryotic root". Proceedings of the National Academy of Sciences. 112 (7): E693-E699. ... Plants protect themselves from frost and dehydration stress with antifreeze proteins, heat-shock proteins and sugars (sucrose ... "LEA proteins prevent protein aggregation due to water stress". Biochemical Journal. 388 (Part , 1): 151-157. doi:10.1042/ ... protein expression is induced by stresses and protects other proteins from aggregation as a result of desiccation and freezing. ...
... s are electron-transfer proteins. Flavodoxin is a bacterial protein that includes flavin mononucleotide. The ...
As with other bacterial pathogens, M. tuberculosis produces a number of surface and secreted proteins that contribute to its ... Bacterial Secreted Proteins: Secretory Mechanisms and Role in Pathogenesis. Norfolk, UK: Caister Academic Press. pp. 265-97. ... Additionally, 14 proteins are found only in the species from the genera Mycobacterium and Nocardia, suggesting that these two ... For instance, the genome of M. vulneris encodes 6,653 proteins, which is larger than that of small eukaryotes such as yeast ( ...
Only Gram-negative bacterial proteins have been functionally characterized. The E. coli NhaB is 58% identical to the ... Although the latter protein is predicted to exhibit 10 TMSs, construction of NhaB-phoA fusions led to evidence for a 9 TMS ... NhaB homologues also exhibit a region with limited sequence similarity to a 46 kDa membrane protein of unknown function from ... A representative list of proteins belonging to the NhaB family can be found in the Transporter Classification Database. NhaB ...
KEGG COMPOUND Mukhtar, T. A.; Wright, G.D. (2005). "Streptogramins, Oxazolidinones, and Other Inhibitors of Bacterial Protein ... Its gene cluster codes for a hybrid PKS-NRPS protein that consists of eight PKS modules and two NRPS modules. Other enzymes are ... Upon binding the ribosome (which streptogramin B can accomplish at any stage of protein synthesis), streptogramin B prevents ... However, when used in conjunction with one another, the streptogramins can inhibit bacterial growth and are bactericidal. ...
Collinson, I (2005). "The structure of the bacterial protein translocation complex SecYEG". Biochemical Society Transactions. ... Structural studies of reversible protein phosphorylation and protein phosphatases". Biochemical Society Transactions. 27 (6): ... Rouse, J (2009). "Control of genome stability by SLX protein complexes". Biochemical Society Transactions. 37 (Pt 3): 495-510. ... Boulton, S. J. (2006). "Cellular functions of the BRCA tumour-suppressor proteins". Biochemical Society Transactions. 34 (Pt 5 ...
Matsunaga, Okamura; Okamura, Y (2003). "Genes and proteins involved in bacterial magnetic particle formation". Trends in ... the second group consists of heat shock proteins (HSPs) involved in the degradation of badly folded proteins. Other than the ... the magnetite crystal nucleation is by action of transmembrane proteins with acidic and basic domains. One of these proteins, ... a structural motif mediating protein-protein interactions". BioEssays. 21 (11): 932-9. doi:10.1002/(SICI)1521-1878(199911)21:11 ...
"Bacterial Birth Scar Proteins Mark Future Flagellum Assembly Site". Cell. 124 (5): 1025-37. doi:10.1016/j.cell.2006.01.019. ... The DnaA protein acts at the origin of replication to initiate the replication of the chromosome. The CtrA protein, in contrast ... These five proteins directly control the timing of expression of over 200 genes. The five master regulatory proteins are ... Cell development involves many such proteins working together. Fig#1 shows how TipN interact with two other polar proteins : ...
Autotransporter proteins: novel targets at the bacterial cell surface. (2007) 274(2), 163-72 Alan J. Barrett, Neil D. Rawlings ... Viral coat proteins Autotransporter proteins Intein-containing proteins There are five families of viral coat proteins (N1, N2 ... Autotransporter proteins are outer membrane or secreted proteins found in a broad variety of Gram-negative bacteria. These ... An intein is a protein contained within another protein, the extein. Parasitic DNA infects an intein gene, which encodes an ...
Harvard University Press, Cambridge, MA ISBN 978-0-674-03116-6. Wooldridge K (editor) (2009). Bacterial Secreted Proteins: ... It is a simple system, which consists of only three protein subunits: the ABC protein, membrane fusion protein (MFP), and outer ... It serves primarily as a site for acid hydrolysis of microbial and dietary protein, preparing these protein sources for further ... As protein enters the stomach, it binds to hydrogen ions, which raises the pH of the stomach. Inhibition of gastrin and gastric ...
... s comprise more than 1/3 of all bacterial protein toxins. Bacterial protein toxins can be highly poisonous to human. ... recognized C. perfringens α-toxin's molecular mechanism in 1941, which marked the pioneering work on any bacterial protein ... Alouf, J. E. "Pore-forming bacterial protein toxins: an overview." Pore-forming toxins. Springer Berlin Heidelberg, 2001. 1-14 ... Most receptors are proteins, but they can be other molecules as well, such as lipids or sugars. With the help of receptors, ...
... and proteins. These polymers have a dual role as supplies of energy as well as building blocks; the part that functions as ... "Bacterial biomineralization: new insights from Myxococcus-induced mineral precipitation". Geological Society, London, Special ...
Natural bacterial transformation involves the transfer of DNA from one bacterium to another through the surrounding medium. ... Atromentin and leucomelone possess antibacterial activity, inhibiting the enzyme enoyl-acyl carrier protein reductase, ( ... van de Beek, Diederik; de Gans, Jan; Tunkel, Allan R.; Wijdicks, Eelco F.M. (5 January 2006). "Community-Acquired Bacterial ... Type strain of Streptococcus pneumoniae at BacDive - the Bacterial Diversity Metadatabase ...
... which code for proteins with antiviral properties.[51] EBOV's V24 protein blocks the production of these antiviral proteins by ... balance as well as treating any bacterial infections that may develop.[33] Dialysis may be needed for kidney failure, and ... which are then translated into structural and nonstructural proteins. The most abundant protein produced is the nucleoprotein, ... EBOV replication overwhelms protein synthesis of infected cells and the host immune defences. The GP forms a trimeric complex, ...
ER Translocon complex.[2] Many protein complexes are involved in protein synthesis. The actual production takes place in the ... Lizak C, Gerber S, Numao S, Aebi M, Locher KP (June 2011). "X-ray structure of a bacterial oligosaccharyltransferase". Nature. ... Sec61 is the protein-conducting channel and the OST adds sugar moieties to the nascent protein. ... Oligosaccharyltransferase or OST (EC 2.4.1.119) is a membrane protein complex that transfers a 14-sugar oligosaccharide from ...
"Protein structures forming the shell of primitive bacterial organelles.". Science 309 (5736): 936-8. Bibcode 2005Sci...309.. ...
Because it is similar to bacterial amino acid transporters and the mitochondrial import protein Tim17[38] (translocase on the i ... Protein targeting and importEdit. See also: Protein targeting. The movement of so many chloroplast genes to the nucleus means ... A protein kinase drifting around on the outer chloroplast membrane can use ATP to add a phosphate group to the Toc34 protein, ... Protein synthesisEdit. See also: Transcription and translation. Protein synthesis within chloroplasts relies on an RNA ...
... protein.[45] PPARα increases the activity of activator protein 1 (AP-1) and NF-κB, thereby leading to the recruitment of ... The anaerobic bacterial species Cutibacterium acnes (formerly Propionibacterium acnes) contributes to the development of acne, ... These free radicals likely interfere with the bacterium's metabolism and ability to make proteins.[79][80] Additionally, ... Squalene oxidation activates NF-κB (a protein complex) and consequently increases IL-1α levels.[45] Additionally, squalene ...
This adhesion involves adhesins (e.g., hyphal wall protein 1), and extracellular polymeric materials (e.g., mannoprotein). ... "Medically important bacterial-fungal interactions." Nature Reviews Microbiology 8.5 (2010): 340-349. Kourkoumpetis, ...
"Bacterial Birth Scar Proteins Mark Future Flagellum Assembly Site". Cell. 124 (5): 1025-37. doi:10.1016/j.cell.2006.01.019. ... Cell development involves many such proteins working together. Fig#1 shows how TipN interact with two other polar proteins : ... "A Landmark Protein Essential for Establishing and Perpetuating the Polarity of a Bacterial Cell". Cell. 124 (5): 1011-23. doi: ... The DnaA protein acts at the origin of replication to initiate the replication of the chromosome. The CtrA protein, in contrast ...
... vitamins and proteins. Since higher concentration of fat and protein in the sake would lead to off-flavors and contribute rough ... The government started hailing the use of enamel tanks as easy to clean, lasting forever, and being devoid of bacterial ... and contains less protein and lipid than the ordinary rice eaten by the Japanese. Sake rice is used only for making sake, ...
... has been introduced into tomato plants and in vivo studies show significant resistance to bacterial wilt and bacterial spot.[27 ... Kurstaki Insect Control Protein". Nature Biotechnology. 7 (12): 1265-1269. doi:10.1038/nbt1289-1265.. ... "Fruit Cell Wall Proteins Help Fungus Turn Tomatoes From Ripe To Rotten". Science Daily. Jan 31, 2008. Retrieved 29 August 2010. ... This tomato gained the moniker "fish tomato".[16] The antifreeze protein was found to inhibit ice recrystallization in the ...
Small acid-soluble proteins (SASPs) are found in endospores. These proteins tightly bind and condense the DNA, and are in part ... Abel-Santos, E (editor) (2012). Bacterial Spores: Current Research and Applications. Caister Academic Press. ISBN 978-1-908230- ... The dipicolinic acid helps stabilize the proteins and DNA in the endospore.[14]:141 Next the peptidoglycan cortex forms between ... In Bacillus subtilus endospores, the spore coat is estimated to contain more than 70 coat proteins, which are organized into an ...
Loman, N.J.; Quick, J.; Simpson, J.T. (2015). "A complete bacterial genome assembled de novo using only nanopore sequencing ... Deamer and Branton demonstrated that the freeze-etch method split the lipid bilayer of membranes to reveal integral proteins ...
Non-coding RNA or "RNA genes". These are a broad class of genes that encode RNA which is not translated into protein. The most ... All are similar and related to each other and to bacterial RNAP:. *RNA polymerase I synthesizes a pre-rRNA which will form the ... Transfer RNA (tRNA)-transfers specific amino acids to growing polypeptide chains at the ribosomal site of protein synthesis ... Eukaryotic chloroplasts have an RNAP very similar to bacterial RNAP ("plastid-encoded polymerase"). Eukaryotic chloroplasts ...
Therefore, macrophage membranes become susceptibile to bacterial infections.[11] Reproductive system[edit]. In experiments with ... This process increases transcription of certain genes, notably CYP1A1, followed by increased CYP1A1 protein production.[28] ... pyrene confers enhanced susceptibility to bacterial infection". Environ Research. 146: 173-84. doi:10.1016/j.envres.2015.12.027 ... which is a eucaryotic receptor for bacterial surface structures such as lipoteichoic acid. ...
... family members are homologous to the bacterial RecA, Archaeal RadA and yeast Rad51.[5][6] The protein is highly conserved ... protein C-terminus binding. • protein binding. • four-way junction DNA binding. • identical protein binding. • ... This protein can interact with the ssDNA-binding protein RPA, BRCA2, PALB2[10] and RAD52. ... Protein domains in homologous recombination-related proteins are conserved across the three main groups of life: archaea, ...
As an example of the relationship between the IMP (in this case the bacterial phototrapping pigment, bacteriorhodopsin) and the ... Integral polytopic proteinEdit. Main article: Transmembrane protein. The most common type of IMP is the transmembrane protein ( ... Integral monotopic proteinsEdit. Main article: Integral monotopic protein. Integral monotopic proteins are associated with the ... An integral membrane protein (IMP) is a type of membrane protein that is permanently attached to the biological membrane. All ...
... s are most occasionally found in nature as residues in proteins. They are formed from ribosomally-derived D-amino ... The D-alanine in peptidoglycans that comprise bacterial cell walls helps its host resist attack by proteolytic enzymes. Several ...
Mcintosh, M (19 October 2004). "Curdlan and other bacterial (1→3)-β-D-glucans". Applied Microbiology and Biotechnology. 68 (2 ... In addition, these side-chains can be attached to other types of molecules, like proteins, as in polysaccharide-K. ...
Calcium channel, voltage-dependent, L type, alpha 1C subunit (also known as Cav1.2) is a protein that in humans is encoded by ... Click on genes, proteins and metabolites below to link to respective Wikipedia articles. [§ 1] ... protein binding. • alpha-actinin binding. • voltage-gated calcium channel activity. • voltage-gated calcium channel activity ... It depolarizes at -30mV and helps define the shape of the action potential in cardiac and smooth muscle.[8] The protein encoded ...
... while archaeal flagella appear to have evolved from bacterial type IV pili.[106] In contrast to the bacterial flagellum, which ... Proteins related to the cytoskeleton components of other organisms exist in archaea,[89] and filaments form within their cells, ... Middle, a bacterial or eukaryotic phospholipid: 5, fatty acid chains; 6, ester linkages; 7, D-glycerol moiety; 8, phosphate ... The bacterial flagellum shares a common ancestor with the type III secretion system,[104][105] ...
If you go into a hospital and have a blood test which measures viral proteins, cancer proteins, hormones, vitamins, bacterial ... Members of the marine bacterial family Shewanellaceae, Shewanella hanedai and Shewanella woodyi are bioluminescent. ... In some squid species bacterial bioluminescence is used for counterillumination so the animal matches the overhead ... proteins, drugs, it will almost certainly use this technique".[8] The structure of photophores, the light producing organs in ...
TATA-binding protein (TBP) can be recruited in two ways, by SAGA, a cofactor for RNA polymerase II, or by TFIID.[11] When ... bacterial RNA polymerase: rpoB. *eukaryotic RNA polymerase: RNA polymerase II. Termination. (bacterial,. eukaryotic). * ... "TATA-binding protein recognition and bending of a consensus promoter are protein species dependent". Biochemistry. 47 (27): ... The TATA-binding protein (TBP) could also be targeted by viruses as a means of viral transcription.[6] ...
This bacterial protein complex is a machine for folding other proteins, which get trapped within the shell. Fatty acid synthase ... Proteins in vitreous ice usually adopt a random distribution of orientations (or viewing angles), allowing a fairly isotropic ... Important information on protein synthesis, ligand binding and RNA interaction can be obtained using this novel technique at ... These often enable the user to manually dock in protein coordinates (structures from X-ray crystallography or NMR) of subunits ...
Neutrophil primary granule proteins HBP and HNP1-3 boost bacterial phagocytosis by human and murine macrophages. J. Clin. ... Ernst J. D. and Stendahl O., (editors), Phagocytosis of Bacteria and Bacterial Pathogenicity, Cambridge University Press, 2006 ... Soehnlein O, Kenne E, Rotzius P, Eriksson EE, Lindbom L. Neutrophil secretion products regulate anti-bacterial activity in ...
... redundancy is that some errors in the genetic code cause only a silent mutation or an error that would not affect the protein ... "Genetic Algorithms and Recursive Ensemble Mutagenesis in Protein Engineering". Complexity International. 1. Archived from the ...
Wnt-protein binding. • protein binding. • protein kinase binding. • ubiquitin protein ligase binding. • transmembrane signaling ... cellular response to molecule of bacterial origin. • positive regulation of interferon-gamma production. • embryonic axis ... gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD5 protein is believed ... G-protein coupled receptor activity. Cellular component. • clathrin-coated endocytic vesicle membrane. • Golgi apparatus. • ...
"The Size, Shape, And Arrangement of Bacterial Cells". classes.midlandstech.edu. Archived from the original on 9 August 2016. ... The cell membrane consists of lipids and proteins which accounts for its hydrophobicity as a result of being non-polar ... The main constituents of the general molecular composition of the cell includes: proteins and lipids which are either free ...
Some diseases, such as tetanus, cause disease not by bacterial growth but by bacterial production of a toxin. Tetanus toxin is ... even death from this procedure because the human body sometimes recognizes antibodies from other animals as foreign proteins.[ ...
List of conditions caused by problems with junctional proteins. References[edit]. *^ Rapini RP, Bolognia JL, Jorizzo JL (2007 ... One of the exotoxins is encoded on the bacterial chromosome, while the other is encoded on a plasmid. These exotoxins are ...
Mattoo, Seema; Lee, Yvonne M; Dixon, Jack E (August 2007). "Interactions of bacterial effector proteins with host proteins". ... Bacterial effectors are proteins secreted by pathogenic bacteria into the cells of their host, usually using a type 3 secretion ... Bacterial Effector Proteins and their domains/motifs (from Paul Deans lab) T3DB - A database of Type 3 Secretion System (T3SS ... Gram negative microbes are also suspected to deploy bacterial outer membrane vesicles to translocate effector proteins and ...
In molecular biology, bacterial DNA binding proteins are a family of small, usually basic proteins of about 90 residues that ... Research suggests that bacterial DNA binding protein has an important role during DNA replication; the protein is involved in ... These proteins participate in all DNA-dependent functions; in these processes, bacterial DNA binding proteins have an ... Initially, bacterial DNA binding proteins were thought to help stabilize bacterial DNA. Currently, many more functions of ...
... as well as the polymeric surface proteins YadA of yersinias and the A-protein of Aeromonas. Some of these bacterial proteins ... The best-characterized bacterial proteins active in these interactions are the mycobacterial fibronectin-binding proteins, the ... The interactions can be based on a protein-protein or on a protein-carbohydrate interaction, or on a bridging mechanism ... Bacterial proteins binding to the mammalian extracellular matrix.. Westerlund B1, Korhonen TK. ...
Bacterial protein toxins. [J E Alouf; Centre national de la recherche scientifique (France); Federation of European ... proteins> # Bacterial Proteins. a schema:Intangible ;. schema:name "Bacterial Proteins"@en ;. .. ... Bacterial proteins. a schema:Intangible ;. schema:name "Bacterial proteins"@en ;. .. ... Bacterial proteins. a schema:Intangible ;. schema:name "Bacterial proteins"@en ;. .. ...
Bacterial toxins inhibiting or activating small GTP-binding proteins.. Boquet P1. ... However, exoenzyme C3 is not a toxin, and chimeric proteins fusing C3 with the B moiety of either diphtheria toxin or ... acids located on the switch 1 or switch 2 domains of small GTPases of the Ras and Rho family are targets of several bacterial ...
Make research projects and school reports about Bacterial proteins easy with credible articles from our FREE, online ... and pictures about Bacterial proteins at Encyclopedia.com. ... See also Bacteria and bacterial infection; Epidemics, bacterial ... Soon after becoming a doctor, Émile Roux began doing research on bacterial diseases for Louis Pasteur . It has taken a century ... A toxoid is a bacterial toxin that is treated to make it harmless but still can induce immunity to the disease. ...
A TolC-Like Protein Is Required for Heterocyst Development in Anabaena sp. Strain PCC 7120 Suncana Moslavac, Kerstin Nicolaisen ... Five Genes Encoding Surface-Exposed LPXTG Proteins Are Enriched in Hospital-Adapted Enterococcus faecium Clonal Complex 17 ... Fitting Periplasmic Membrane Fusion Proteins to Inner Membrane Transporters: Mutations That Enable Escherichia coli AcrA To ... Involvement of the DNA Binding Protein ApxR Xueqi Wang, Zhihui Cheng, Chunbin Zhang, Takane Kikuchi, Yasuko Rikihisa ...
for proteins from GC-poor bacteria; % for proteins from bacteria with average genomic G + C; and just % for proteins from GC- ... proteins, 10% were all alpha proteins, and 4% were all beta proteins, while 23% of them were mixed proteins. So, most of the ... That is why we decided to study Mn2+ binding sites in three groups of bacterial proteins: from bacterial species with low, ... in proteins from GC-poor bacteria (b); in proteins from bacteria with average genomic GC-content (c); in proteins from GC-rich ...
We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their ... InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites ... Bacterial microcompartments protein, conserved site (IPR020808). Short name: Bact_microcomp_CS Description. This domain is ... six shell proteins, CsoS1A, CsoS1B, CsoS1C, Cso2A, Cso2B and CsoS3 (carbonic anhydrase) [PMID: 14729686], one protein of ...
Antibodies produced by the body against this protein also react with the main satiety hormone, which is similar in structure. ... Inserm Researchers have demonstrated the involvement of a protein produced by some intestinal bacteria that may be the source ... Variations in food intake in the presence of the bacterial protein. To obtain these results, the researchers modified the ... Bacterial ClpB heat-shock protein, an antigen-mimetic of the anorexigenic peptide α-MSH, at the origin of eating disorders ...
Protein localization and dynamics within a bacterial organelle. H. Velocity Hughes, Edgar Huitema, Sean Pritchard, Kenneth C. ... Protein localization and dynamics within a bacterial organelle. H. Velocity Hughes, Edgar Huitema, Sean Pritchard, Kenneth C. ... Protein localization and dynamics within a bacterial organelle. H. Velocity Hughes, Edgar Huitema, Sean Pritchard, Kenneth C. ... 2006) Bacterial birth scar proteins mark future flagellum assembly site. Cell 124:1025-1037. ...
Purchase The Comprehensive Sourcebook of Bacterial Protein Toxins - 4th Edition. Print Book & E-Book. ISBN 9780128001882, ... His research has been mainly focused on the study of the molecular mechanisms that underlie protein-protein and protein- ... The Comprehensive Sourcebook of Bacterial Protein Toxins 4th Edition. 0 star rating Write a review ... His 40-year research work relates to the field of bacterial protein toxins and immunology of infectious diseases. He is also ...
... Fleetwood, Filippa KTH, School of Biotechnology (BIO), Protein ... Bacterial display is an emerging technology for isolation of new affinity proteins from such combinatorial libraries. Cells ... Bacterial display, Combinatorial protein engineering, Nanobodies, Phage display, Recombinant antibodies National Category ... Affibody molecule, Bacterial display, Directed evolution, Combinatorial protein engineering, AIDA-I, Autotransporter, FACS, ...
Phosphorylation of bacterial response regulator proteins by low molecular weight phospho-donors. G S Lukat, W R McCleary, A M ... Phosphorylation of bacterial response regulator proteins by low molecular weight phospho-donors ... Phosphorylation of bacterial response regulator proteins by low molecular weight phospho-donors ... Phosphorylation of bacterial response regulator proteins by low molecular weight phospho-donors ...
Pastor N, Davila S, Perez-Rueda E, Segovia L, Martinez-Anaya C (2014) Electrostatic analysis of bacterial expansins. Proteins. ... An oat coleoptile wall protein that induces wall extension in vitro and that is antigenically related to a similar protein from ... Wang WC, Liu C, Ma YY, Liu XW, Zhang K, Zhang MH (2014) Improved production of two expansin-like proteins in Pichia pastoris ... Lee HJ, Lee S, Ko HJ, Kim KH, Choi IG (2010) An expansin-like protein from Hahella chejuensis binds cellulose and enhances ...
Active "Par"-titioning of Bacterial Chemotaxis Proteins Message Subject. (Your Name) has forwarded a page to you from Science ... Bacterial ParA-like ATPases mediate cell cycle-dependent localization of chemotaxis proteins to cell poles. ... Bacterial ParA-like ATPases mediate cell cycle-dependent localization of chemotaxis proteins to cell poles. ...
... protein from Vibrio vulnificus can inhibit tumor cell growth by cutting the protein Ras. This protein is central to cell ... Bacterial sepsis protein may inhibit cancer cell growth. Northwestern University. Journal. Nature Communications. Funder. ... The scientists plan to continue to study the mechanisms and biochemistry of the MARTX toxin specificity to the Ras protein. ... The bacterium uses the MARTX toxin protein to inactivate Ras, increasing its own virulence and allowing it to spread throughout ...
Since most aphids harbor Buchnera, and likely have GroEL in their saliva, this bacterial protein may generally alert plants of ... Bacterial Protein In Aphid Saliva Triggers Plant Defense Against Aphids. by editor ... They discovered these proteins were of both aphid and Buchnera origins. One of these Buchnera proteins, GroEL, was found to ... "A protein from the bacterium, found in the aphid saliva and likely delivered inside the plant host by the aphid, triggers plant ...
This bacterial advantage has long been a mystery. Now engineers think theyve solved at least part of the puzzle. Wus team and ... The protein then anchors itself to the cellulose, and the well organized enzymes begin their work. The orderliness is a ... Engineers have shown that a protein vital to the ability of certain bacteria to break down cellulose, one of the most ... As far as I know, this is the first protein discovered that organizes enzymes in this way. The discovery clarifies a ...
GroES Protein Research. Integration Host Factors Research. Luciferases, Bacterial Research. Staphylococcal Protein A Research. ... Bacterial Outer Membrane Proteins Research. Bacteriocins Research. Botulinum Toxins Research. Colicins Research. Escherichia ... Factor For Inversion Stimulation Protein Research. Ferredoxins Research. Flagellin Research. Flavodoxin Research. GroEL Protein ...
A bacterial protein is a protein thats part of the structure of a bacterium or is produced by a bacterium. Researchers study ... In addition to being a unique structure, a bacterial protein also has the ability to bind with other proteins. Protein binding ... A bacterial protein is a protein which is either part of the structure of a bacterium, or produced by a bacterium as part of ... Some bacteria produce proteins which have a deleterious effect on the human body. A bacterial protein can be toxic, causing ...
For now, Martin and Abramovitch are working to find which proteins AvrPtoB acts on, and what role those proteins play in host ... a protein from a disease-causing bacterium slips into plant cells and imitates a key host protein in order to cripple the plant ... but also because bacteria don t use ubiquitin to recycle their own proteins. "An interesting question is where this protein ... an enzyme plant and animal cells use to attach the small protein ubiquitin to unneeded or defective proteins. Other enzymes ...
Thus, bacterial T3Es target sub-component specific PP2A complexes to manipulate host immunity and cause disease symptoms during ... tomato, each target protein phosphatase 2A (PP2A) complexes in susceptible hosts via direct interaction/association with ... proteins to suppress host immunity and promote disease symptoms. AvrE-family T3Es, which are widely distributed among plant- ... which is perhaps the most common symptom of bacterial diseases and likely results in the release of nutrients from host cells ...
Recent studies have revealed that viruses and bacterial pathogens exploit the host ubiquitination pathways to gain entry and to ... Recent studies have revealed that viruses and bacterial pathogens exploit the host ubiquitination pathways to gain entry and to ... Ubiquitination is the main pathway for protein degradation that governs a variety of eukaryotic cellular processes, including ... Ubiquitination is the main pathway for protein degradation that governs a variety of eukaryotic cellular processes, including ...
... Daniel Y. Bargieri,1 ... Are Bacterial Flagellin Fusion Proteins the Bridge between Mouse and Humans?," Journal of Parasitology Research, vol. 2011, ...
In this chapter, a novel method for identifying bacterial surface proteins is presented,... ... Bacterial surface proteins are often investigated as potential vaccine candidates and biomarkers of virulence. ... Bacterial surface proteins are often investigated as potential vaccine candidates and biomarkers of virulence. In this chapter ... These pre-absorbed sera were used in Western blotting after 2-DE to find bacterial surface protein antigens. This new method ...
Bacterial Outer Membrane Proteins · Bacterial Proteins · Chromosomes, Bacterial · DNA, Bacterial · Gene Expression Regulation, ... Bacterial Proteins; kinA protein, Bacillus subtilis; Protein Kinases, EC 2.7.1.37; protein-histidine kinase, EC 2.7.3.- ... outer membrane proteins, transport proteins, stress-related proteins and translation-related proteins. In addition, a protein ... Nutrition · Bacterial protein · Binding protein · Collagen binding s protein · Unclassified drug · Bacterium adherence · Gene ...
... (Nanowerk News) "Pharmaceutical residues are becoming increasingly a ... For this, the researchers need to integrate the individual components which include bacterial proteins, dyes, and aptamers into ... They are extracted from the envelope proteins of bacteria which are cultivated by the researchers in a lab. "The proteins form ... "The color molecules are located on a nanostructured surface consisting of bacterial proteins. The dyes are so close to one ...
"Bacterial Proteins" by people in Harvard Catalyst Profiles by year, and whether "Bacterial Proteins" was a major or minor topic ... "Bacterial Proteins" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical ... Below are the most recent publications written about "Bacterial Proteins" by people in Profiles. ... Below are MeSH descriptors whose meaning is more general than "Bacterial Proteins". ...
Characterization of Sec-dependent bacterial protein transport has often relied on an in vitro protein translocation system ... Substrate Proteins Take Shape at an Improved Bacterial Translocon Message Subject (Your Name) has forwarded a page to you from ... indicating that more nuanced transport models that respond to differences in protein sequence and structure are needed. ... finds that inclusion of SecA protein during SecYEG proteoliposome reconstitution dramatically improves the number of active ...
  • Bacterial ice-nucleation proteins is a family of proteins that enable Gram-negative bacteria to promote nucleation of ice at relatively high temperatures (above -5C). (wikipedia.org)
  • Bacterial effectors are proteins secreted by pathogenic bacteria into the cells of their host, usually using a type 3 secretion system (TTSS/T3SS), a type 4 secretion system (TFSS/T4SS) or a Type VI secretion system (T6SS). (wikipedia.org)
  • Phagocytes recognize bacteria directly [e.g., through the so-called scavenger receptor A which recognizes bacterial lipopolysaccharide (LPS) ] or indirectly through antibodies (IgG) and complement proteins (C3bi) which coat the bacteria and are recognized by the Fcγ receptors and integrinαmβ2 (complement receptor 3). (wikipedia.org)
  • Pathogenic bacteria frequently express surface proteins with affinity for components of the mammalian extracellular matrix, i.e. collagens, laminin, fibronectin or proteoglycans. (nih.gov)
  • They are extracted from the envelope proteins of bacteria which are cultivated by the researchers in a lab. (ecnmag.com)
  • This domain is found in a variety of polyhedral organelle shell proteins (CcmK), including CsoS1A, CsoS1B and CsoS1C of Thiobacillus neapolitanus (Halothiobacillus neapolitanus) and their orthologs from other bacteria. (ebi.ac.uk)
  • Researchers at Inserm Unit 1073, "Nutrition, inflammation and dysfunction of the gut-brain axis" (Inserm/University of Rouen) have demonstrated the involvement of a protein produced by some intestinal bacteria that may be the source of these disorders. (eurekalert.org)
  • This protein (ClpB) is produced by certain bacteria, such as Escherichia coli, which are naturally present in the intestinal flora. (eurekalert.org)
  • Bacterial toxins are involved in the pathogenesis of many bacteria, some of which are responsible for severe diseases in human and animals, but can also be used as tools in cell biology to dissect cellular processes or used as therapeutic agents. (elsevier.com)
  • Expansins are wall-loosening proteins that are universal in the plant kingdom and are also found in a small set of phylogenetically diverse bacteria, fungi, and other organisms, most of which colonize plant surfaces. (springer.com)
  • GroEL and additional proteins from insect bacteria probably are delivered to plants through insect saliva and contribute to shaping plant-insect interactions. (redorbit.com)
  • Engineers have shown that a protein vital to the ability of certain bacteria to break down cellulose, one of the most widespread biochemical processes on earth, speeds up the process by corralling enzymes together and ushering them into action. (rochester.edu)
  • Pound for pound, certain bacteria are the real giants of the cellulose-degradation world: They can be 50 times as effective at breaking down cellulose per protein base, says Wu, associate professor of chemical engineering and microbiology and immunology at the University of Rochester. (rochester.edu)
  • Proteins are an important part of all living organisms, and bacteria are no exception. (wisegeek.com)
  • Thanks to the fact that many bacteria are easy to culture in the laboratory, a great deal of research on bacterial proteins has been performed with the goal of learning more about specific proteins and their functions. (wisegeek.com)
  • Understanding bacterial proteins is important both because bacteria play a very active role in human health, and because the information can be extrapolated to gather more data about the proteins associated with larger organisms, including humans. (wisegeek.com)
  • Over time, many bacteria have evolved to produce proteins which target particular locations on human and animal cells. (wisegeek.com)
  • Understanding which proteins are involved in the structure of particular bacteria can help researchers develop medications which identify and target a particular bacterial protein, allowing the researchers to create antibacterial drugs which target specific organisms. (wisegeek.com)
  • Some bacteria produce proteins which have a deleterious effect on the human body. (wisegeek.com)
  • A bacterial protein can be toxic, causing illness or death in an organism which has been infected by the bacteria, and bacterial proteins can also bind with specific proteins in the body to cause a variety of symptoms. (wisegeek.com)
  • AvrPtoB s function is remarkable not only because its amino acid sequence is so different from other ubiquitin ligases, but also because bacteria don t use ubiquitin to recycle their own proteins. (innovations-report.com)
  • Correct protein compartmentalization is a key step for molecular function and cell viability, and this is especially true for membrane and externalized proteins of bacteria. (nih.gov)
  • Most people don't realize that they actually are walking around with more bacterial cells in their bodies than their own cells, so we are really bags of bacteria," explains Dr. Pal. (genengnews.com)
  • We analyzed the amino acid sequences of DnaK from many bacteria and found that the DnaK proteins from bacteria associated with cancer grouped together were different DnaK sequences from bacteria that are not associated with cancer," said Dr. Tettelin . (biospace.com)
  • According to Dr. Gallo , "This hit-and-run, or hide, mechanism mediated by a protein common to many cancer-associated bacteria changes how we need to think about infection and at least some cancers. (biospace.com)
  • In Gram-negative bacteria, a wide range of proteins are secreted to modulate the interactions of bacteria with their environments and other bacteria via various secretion systems. (scirp.org)
  • These proteins are essential for the virulence of bacteria, so it is crucial to study them for the pathogenesis of diseases and the development of drugs. (scirp.org)
  • In a recent paper in the journal PLoS One ,* researchers at NIST and Vilnius University (Vilnius, Lithuania) reported that they were able to reveal the presence of G. vaginalis by rapidly detecting and quantifying vaginolysin (VLY), a protein toxin produced exclusively by the bacteria, using the NIST model of cell membranes known as a tethered bilayer lipid membrane (tBLM). (medindia.net)
  • The Sln1 protein of the yeast Saccharomyces cerevisiae has sequence similarities to both the histidine kinase and the response regulator proteins of bacteria. (sciencemag.org)
  • Bacteria hunker down and survive antibiotic attack when a protein flips a chemical switch that throws them into a dormant state until treatment abates, researchers at The University of Texas M. D. Anderson Cancer Center report in the Jan.16 edition of Science. (rxpgnews.com)
  • HipA is a type of protein kinase that is uncommon in bacteria, said lead author Maria Schumacher, Ph.D., associate professor of biochemistry and molecular biology. (rxpgnews.com)
  • While other types of phosphorylation occur in bacteria, HipA phosphorylates proteins at their serine or threonine amino acids. (rxpgnews.com)
  • HipA is active in other types of gram-negative bacteria, which cause significant human bacterial infections. (rxpgnews.com)
  • Protein kinases often bind to more than one protein, so there are likely multiple targets for the protein in E. coli and other gram-negative bacteria, Schumacher and Brennan said. (rxpgnews.com)
  • A bacterial library is a large number of different DNA sequences (hundreds, millions or even billions), each of which is cloned into a vector and introduced into a bacterial cell , so there are a great many different DNA sequences represented within the individual bacteria in the library - one in each bacterium. (sciencelearn.org.nz)
  • To use the library, scientists test the bacteria within it to see which of the many protein variants function best. (sciencelearn.org.nz)
  • Scientists have uncovered the structure of the protein complex that assembles the tiny hair-like strands that cover the outside of bacteria. (ucl.ac.uk)
  • Published in Nature, scientists at the Institute of Structural and Molecular Biology (a joint institute between University College London (UCL) and Birkbeck) have revealed the structure of a complex protein called FimD that acts as an assembly platform for the pili of cystitis bacteria. (ucl.ac.uk)
  • Pili protein subunits are made inside bacteria and initially transported through the inner cell wall. (ucl.ac.uk)
  • This research, funded by the Medical Research Council, has isolated and crystallised the usher protein in cystitis bacteria, FimD, while it's bound to the chaperone/subunit combination. (ucl.ac.uk)
  • Mass spectrometry approaches generally rely upon introduction of the bacteria into a matrix-assisted laser-desorption time-of-flight (MALDI-TOF) mass spectrometer with mass spectrometric recognition of proteins specific to that organism that form a reliable fingerprint. (mdpi.com)
  • With some bacteria, such as Bacillus anthracis and Clostridium botulinum , the health threat posed by these organisms is not the organism itself, but rather the protein toxins produced by the organisms. (mdpi.com)
  • Spatial organization within bacteria is fundamental to many cellular processes, although the basic mechanisms underlying localization of proteins to specific sites within bacteria are poorly understood. (harvard.edu)
  • To do this, Lamont and his colleagues compared the proteins secreted by P. gingivalis when grown in a medium containing human gum cell proteins with the proteins produced by the bacteria when grown in a neutral medium. (bio-medicine.org)
  • Computer-generated image of anaerobic, spore-forming, Clostridium bacteria CDC, JAMES ARCHER Researchers at Harvard Medical School used software to run through roughly 60,000 bacterial genomes in search of proteins that, in yeast, would be predicted to behave as prions -that is, become misfolded in a way that passes on the errant structure to like proteins. (the-scientist.com)
  • The study, published last week (January 13) in Science , is the first to identify a prion-like protein in bacteria, " suggesting that the emergence of prions predates the evolutionary split between eukaryotes and bacteria," the authors, from Harvard Medical School, wrote. (the-scientist.com)
  • Because prions pass on their misfolded shape to like proteins, they may allow bacteria evolve without genomic changes. (the-scientist.com)
  • Bacteria might need quick responses to their environment, such as dealing with antibiotics," Peter Chien, a bacterial biochemist at the University of Massachusetts Amherst, who was not involved in the research, told Nature . (the-scientist.com)
  • Nevertheless, the discovery of a prion-like protein in bacteria suggests that this molecular behavior is more common than researchers realized, coauthor Ann Hochschild, a bacterial geneticist at Harvard Medical School, told Nature . (the-scientist.com)
  • We believe other prion-forming proteins will be uncovered in bacteria. (the-scientist.com)
  • Bacteria use a variety of secretion systems to transport proteins beyond their cell membrane to interact with their environment. (mcponline.org)
  • A group of proteins that act as the bodys built-in line of defense against invading bacteria use a molecular trick to induce bacteria to destroy themselves, researchers at the Indiana University School of Medicine have determined. (infectioncontroltoday.com)
  • The proteins, called Peptidoglycan Recognition Proteins (PGRPs), are able to detect and target bacteria because bacteria are unique in having peptidoglycan polymers in their cellular walls. (infectioncontroltoday.com)
  • These systems, which normally enable the bacteria to detect and eject malformed proteins, interpret the PGRPs as just such malformed proteins. (infectioncontroltoday.com)
  • Surface proteins on bacteria play a key role in immune system defences and are studied as part of research into vaccines. (sciencephoto.com)
  • It is known as a twitching motility protein, and forms part of the motor complex that enables movement and retraction of the bacterium's pilus, the hair-like appendage used to exchange genetic material with other bacteria (conjugation). (sciencephoto.com)
  • Detailed molecular understanding of how proteins localize in bacteria is incomplete. (asm.org)
  • In rod-shaped bacteria, a subset of proteins localize to the bacterial pole. (asm.org)
  • Among these are autotransporter proteins, the largest group of secreted proteins in Gram-negative bacteria. (asm.org)
  • IMPORTANCE The bacterial cell wall component LPS is a strong inducer of inflammation and is responsible for much of the toxicity of Gram-negative bacteria. (asm.org)
  • How to get electrons from the inside of bacteria to the outside is important for many different things, such as bacterial fuel cells, how carbon cycles through the environment and how to make new nanomaterials for applications like biocomputers," said Reardon. (bio-medicine.org)
  • A group of related bacteria makes these bendy, stretchy structures out of a protein called pilin, and an even smaller group uses these structures like electrical wires. (bio-medicine.org)
  • Bacteria produce electrons while respiring and use the wires to run electrons out of their little bacterial bodies. (bio-medicine.org)
  • Co-Lead researcher Dr. Hugh Reid, from Monash University, said the team showed, at the molecular level, how receptors isolated from immune T cells from celiac disease patients can recognize protein fragments from certain bacteria that mimic those fragments from gluten. (scitechdaily.com)
  • In celiac disease you get aberrant reactivity to gluten and we have provided a proof-of-principle that there's a link between gluten proteins and proteins that are found in some bacteria," he said. (scitechdaily.com)
  • Two of these, transcription and translation, allow the genetic information stored in DNA to be deciphered into the proteins that form all living things, from bacteria to humans to plants. (wisc.edu)
  • In bacteria, the machine that reads DNA to turn it into a message and the machine that translates the message into protein are combined into single complex or "supermachine. (wisc.edu)
  • Following that process, another molecular machine called a ribosome translates the RNA, more specifically called messenger RNA, into proteins the bacteria can use to function. (wisc.edu)
  • We use this to measure the geometric localization of proteins responsible for the characteristic shape of Gram-negative bacteria (straight rod Escherichia coli , curved rod Vibrio cholerae , and helical rod Helicobacter pylori) . (aps.org)
  • 2,5,6 However, the efficiency of these methods is low when compared to the recently, developed approaches using bacterial N -linked and O -linked glycosylation machinery to produce glycoproteins directly in bacteria. (rsc.org)
  • However, the requirement to generate lipid-linked glycosyl donors and the localization of protein glycosylation in the periplasm makes it challenging to integrate these approaches with the impressive array of oligosaccharides that have been produced in the cytosol of engineered bacteria. (rsc.org)
  • Within the scope of the AptaSens project, her team developed such a receptor for the antibiotic kanamycin which is used, for example, for the treatment of such bacterial infections of the eye as conjunctivitis, or in veterinary medicine. (ecnmag.com)
  • The study was published today in the Proceedings of the National Academy of Sciences and suggests that bacterial infections may contribute to far more cancers than previously thought. (biospace.com)
  • The study also provides a mechanism for how some bacterial infections can interfere with specific cancer drugs. (biospace.com)
  • Thus, we attribute what may be a novel role for PMN granule proteins in regulating the immune response to bacterial infections. (jci.org)
  • The discovery of GBPs as regulators of OMV-mediated inflammation paves the way toward a mechanistic understanding of the host response toward bacterial OMVs and may lead to effective strategies to ameliorate inflammation induced by bacterial infections. (asm.org)
  • Research led by St. Jude Children's Research Hospital scientists has identified a possible new approach to defeating bacterial infections by targeting an innate immune system component in a bid to invigorate the immune response. (infectioncontroltoday.com)
  • Investigators showed the protein works by inhibiting two pathways that control production of specialized molecules that fight infections. (infectioncontroltoday.com)
  • Despite the availability of antibiotics, bacterial infections continue to extract a heavy toll of suffering and death. (infectioncontroltoday.com)
  • The type III secretion system is one of the causes of a wide range of bacterial infections in human, animals and plants. (rostlab.org)
  • In adult studies, TREM-1 has been shown to be specifically expressed in bacterial infections. (clinicaltrials.gov)
  • Scientists at the University of California, San Diego and Yale University have discovered that a natural protein produced by Bacillus thuringiensis, a bacterium sprayed on crops by organic farmers to reduce insect damage, is highly effective at treating hookworm infections in laboratory animals. (bio-medicine.org)
  • The UCSD-Yale team found that a protein produced by the bacterium Bacillus thuringiensis, or Bt, given orally to laboratory hamsters infected with hookworms was as effective in eliminating the parasites, curing anemia and restoring weight gain in the hamsters as mebendazole, one of the drugs currently recommended to treat infections in humans. (bio-medicine.org)
  • Recent proteomic reports of Bacillus subtilis have shown that many proteins with Sec-like signal peptides and absence of a transmembrane helix domain are still observed in membrane-enriched fractions, but further evidence about signal peptide cleavage or soluble protein contamination is still needed. (nih.gov)
  • Label-free quantitation of all proteins identified in each fraction showed that the majority of these proteins with uncleaved signal peptides are, indeed, enriched in the Triton X-114 lipid phase. (nih.gov)
  • The protein influences host IFN [interferon] responses as well as suppresses multiple host microbicidal activities involving serum complement, neutrophils, and antimicrobial peptides," write the investigators. (genengnews.com)
  • Using amino acid composition (AAC), position-specific scoring matrix (PSSM) and N-terminal signal peptides, two different substitution models are firstly constructed to transform protein sequences into numerical vectors. (scirp.org)
  • According to the presence of N-terminal signal peptides or not, secreted proteins can be simply classified into two groups: classically secreted proteins (CSPs) (e.g. (scirp.org)
  • thorough investigation revealed heparin-binding protein (HBP) and human neutrophil peptides 1-3 (HNP1-3) as the mediators of the macrophage response to PMN secretion. (jci.org)
  • Dissecting the underlying molecular mechanisms for localization is facilitated by the availability of suitable proteins that can be used as molecular probes. (pnas.org)
  • Abramovitch and Martin compared AvrPtoB s amino acid sequence to known proteins in other microbes and in higher organisms, but found no matches that might hint at how the protein works at the molecular level. (innovations-report.com)
  • To confirm that AvrPtoB was a molecular mimic, Martin and Abramovitch altered parts of the protein that correspond to crucial sites on ubiquitin ligase. (innovations-report.com)
  • In a paper published in Molecular Cell in December, Walker and others reported that UmuD had an unexpected role involving yet another protein in the SOS system. (phys.org)
  • Enhancement of the nonresonant second order molecular hyperpolarizabilities {gamma} were observed in stacked macrocyclic molecular systems, previously in a {micro}-oxo silicon phthalocyanine (SiPcO) monomer, dimer and trimer series, and now in bacteriochlorophyll a (BChla) arrays of light harvesting (LH) proteins. (unt.edu)
  • for each macrocycle was enhanced in naturally occurring stacked macrocyclic molecular systems in the bacterial photosynthetic LH proteins where BChla`s are arranged in tilted face-to-face arrays. (unt.edu)
  • In this study, they used cutting-edge molecular research techniques to map all the proteins ?known as the proteome ?produced by P. gingivalis. (bio-medicine.org)
  • The approach used in this study is very exciting,?said Hansel Fletcher, Ph.D., an associate professor of microbiology and molecular genetics at Loma Linda University in Loma Linda, Calif. "For the first time, we are able to see that the more than 200 so-called 'hypothetical?proteins in P. gingivalis are expressed and have specific functions. (bio-medicine.org)
  • Molecular model of a surface protein from the bacterium Streptococcus pneumoniae, a major cause of many diseases including pneumonia. (sciencephoto.com)
  • The bacterial SRP, which contains the minimal ribonucleoprotein core of this universally conserved targeting machine, has served as a paradigm for understanding the molecular basis of protein localization in all cells. (caltech.edu)
  • In this review, we highlight recent biochemical and structural insights into the molecular mechanisms by which fundamental challenges faced by protein targeting machineries are met in the SRP pathway. (caltech.edu)
  • Ishu Saraogi, Shu-ou Shan, Co-translational protein targeting to the bacterial membrane, Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, Volume 1843, Issue 8, August 2014, Pages 1433-1441, ISSN 0167-4889, http://dx.doi.org/10.1016/j.bbamcr.2013.10.013. (caltech.edu)
  • With the ultimate goal of discovery of novel antibacterial agents that inhibit the AraC family proteins, here I have investigated the molecular mechanism of transcription activation by Rns and RhaR. (ku.edu)
  • Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. (jove.com)
  • Effector proteins are usually critical for virulence. (wikipedia.org)
  • Gram negative microbes are also suspected to deploy bacterial outer membrane vesicles to translocate effector proteins and virulence factors via a membrane vesicle trafficking secretory pathway, in order to modify their environment or attack/invade target cells, for example, at the host-pathogen interface. (wikipedia.org)
  • The bacterium uses the MARTX toxin protein to inactivate Ras, increasing its own virulence and allowing it to spread throughout the host. (eurekalert.org)
  • Bacterial surface proteins are often investigated as potential vaccine candidates and biomarkers of virulence. (springer.com)
  • Autotransporters, widely distributed bacterial virulence proteins, are secreted at the bacterial pole. (harvard.edu)
  • For bacterial pathogens, these systems are key virulence determinants that transport bacterial proteins into host cells. (mcponline.org)
  • We show that this method is able to specifically monitor the ESX-1 system protein secretion system, a major virulence determinant in both mycobacterial and Gram-positive pathogens that is refractory to reporter analysis. (mcponline.org)
  • Using Dictyostelium discoideum as a model host, we have identified a virulence mechanism in a non-O1/non-O139 V. cholerae strain that involves extracellular translocation of proteins that lack N-terminal hydrophobic leader sequences. (pnas.org)
  • Mutations in vas homologs in other bacterial species have been reported to attenuate virulence in animals and cultured macrophages. (pnas.org)
  • A protein from the bacterium, found in the aphid saliva and likely delivered inside the plant host by the aphid, triggers plant immune responses against the aphid. (redorbit.com)
  • Wu's team and an MIT group headed by renowned industrial microbiologist Arnold Demain discovered that a protein called CipA in the bacterium Clostridium thermocellum organizes several cellulase enzymes into a cohesive unit which it leads to the cellulose material, like a platoon of soldiers following its commander. (rochester.edu)
  • Proteins found in any species of bacterium. (molecularstation.com)
  • A bacterial protein is a protein which is either part of the structure of a bacterium , or produced by a bacterium as part of its life cycle. (wisegeek.com)
  • Researchers can spend years identifying all of the proteins associated with a single type of bacterium, and this process can be complicated by rapid mutations, as seen in the case of the wily Staphylococcus bacterium. (wisegeek.com)
  • Like a wolf in sheep s clothing, a protein from a disease-causing bacterium slips into plant cells and imitates a key host protein in order to cripple the plant s defenses. (innovations-report.com)
  • He has also observed a phenomena demonstrating that even without this protein and with the immune system responding perfectly, the bacterium can spring back in the body weeks later. (genengnews.com)
  • Now scientists have identified the thousands of proteins the bacterium. (bio-medicine.org)
  • Now scientists have identified the thousands of proteins the bacterium produces, shedding light on how it interacts with healthy cells in order to thrive, according to dental researchers from the University of Florida and the University of Washington. (bio-medicine.org)
  • The bacterium that causes Legionnaires' disease recruits a host protein that regulates vesicle trafficking by mimicking host-activating proteins. (sciencemag.org)
  • Studies on monomolecular layers of phospholipids containing the antenna protein B800-850 (LHCP) and in some cases additionally the reaction center of the photosynthetic bacterium Rhodopseudomonas sphaeroides are reported. (uni-muenchen.de)
  • We - Tatyana Goldberg, Burkhard Rost and Yana Bromberg - at BrombergLab and RostLab developed a novel method, pEffect that predicts bacterial type III effector proteins. (rostlab.org)
  • Antibodies produced by the body against this protein also react with the main satiety hormone, which is similar in structure. (eurekalert.org)
  • Where this protein is present, antibodies are produced against it by the body. (eurekalert.org)
  • According to our initial observations, it would indeed be possible to neutralise this bacterial protein using specific antibodies, without affecting the satiety hormone," they conclude. (eurekalert.org)
  • The serum pre-absorption process in our method was developed from cross-absorption but modified to remove antibodies that recognized bacterial surface antigens, thereby generating pre-absorbed sera. (springer.com)
  • Antibodies to stabilize the membrane protein, and 3. (medgadget.com)
  • Directed evolution is a powerful method for engineering of specific affinity proteins such as antibodies and alternative scaffold proteins. (albanova.se)
  • The beauty of this finding is that if we can generate monoclonal neutralizing antibodies against this protein, we can block bacterial infection. (infectioncontroltoday.com)
  • Monoclonal antibodies are laboratory-produced versions of natural antibodies and are designed to detect specific proteins. (infectioncontroltoday.com)
  • Recent studies have revealed that viruses and bacterial pathogens exploit the host ubiquitination pathways to gain entry and to aid their survival/replication inside host cells. (frontiersin.org)
  • This review will summarize recent developments in understanding the biochemical and structural mechanisms utilized by bacterial pathogens to interact with the host ubiquitination pathways. (frontiersin.org)
  • A large number of Gram-negative bacterial pathogens carry genes homologous to vas genes and potential effector proteins secreted by this pathway (i.e., hemolysin-coregulated protein and VgrG). (pnas.org)
  • Identification and characterisation of these surface proteins from L. fermentum are of vital importance for developing new therapeutics against enteric pathogens. (amrita.edu)
  • Bacterial pathogens secrete proteins into the host that target crucial biological processes. (jove.com)
  • Characterization of Sec-dependent bacterial protein transport has often relied on an in vitro protein translocation system comprised in part of Escherichia coli inverted inner membrane vesicles or, more recently, purified SecYEG translocons reconstituted into liposomes using mostly a single substrate (proOmpA). (asm.org)
  • Working in Escherichia coli, the team solved the structure of HipA and several of its protein complexes down to the atomic level, confirming that HipA is a protein kinase - an enzyme that works by transferring phosphate groups to its target molecules. (rxpgnews.com)
  • We developed a genetic reporter system for protein localization to the pole within the bacterial cytoplasm that allows saturation screening for mutants in Escherichia coli in which protein localization is altered. (harvard.edu)
  • In addition,λ encodes another recombinase, Orf, which participates in the initial stages of genetic exchange and supplies a frmction equivalent to that of the Escherichia coli RecFOR proteins. (bl.uk)
  • However, exoenzyme C3 is not a toxin, and chimeric proteins fusing C3 with the B moiety of either diphtheria toxin or Pseudomonas aeruginosa exotoxin A have been produced to intoxicate cells with low concentration of C3. (nih.gov)
  • Given the multifaceted aspects of toxin research and the multidisciplinary approaches adopted, toxins are of great interest in many scientific areas from microbiology, virology, cell biology to biochemistry and protein structure. (elsevier.com)
  • Karla Satchell, a professor in microbiology-immunology at Northwestern University Feinberg School of Medicine, and her team demonstrated in a paper in Nature Communications , that a multifunctional-autoprocessing repeats-in-toxin (MARTX) protein from Vibrio vulnificus can inhibit tumor cell growth by cutting the protein Ras. (eurekalert.org)
  • The scientists plan to continue to study the mechanisms and biochemistry of the MARTX toxin specificity to the Ras protein. (eurekalert.org)
  • 11 We have devised an alternative strategy for glycoprotein production that uses the toxin B glucosyltransferase from Clostridium difficile to produce site-specific homogeneous glucosylated proteins. (rsc.org)
  • In vitro analysis shows similar protein glucosylation activity in the isolated domain as in the full length toxin. (rsc.org)
  • 14 Here, we report the discovery and characterization of a nine amino acid peptide substrate for the toxin B glucosyltransferase domain (GTD) and its applications as a protein tag for site-specific and homogenous glycoprotein engineering ( Fig. 1 ). (rsc.org)
  • Fig. 1 Glucosylation of peptide consensus on a protein of interest (POI) with C. difficile toxin B. (rsc.org)
  • We developed a genetic reporter assay that enables screening of bacterial populations for changes in localization of proteins to the bacterial pole, and we demonstrate the utility of the system in identifying factors required for proper localization of the polar Shigella autotransporter protein IcsA. (asm.org)
  • Proteins are encoded in the genes, with certain proteins being expressed while an organism develops, with others are produced by an organism with the goal of accomplishing specific tasks. (wisegeek.com)
  • The genes themselves are only important in that they encode the proteins,?Lamont said. (bio-medicine.org)
  • When they injected Cb- -Rho into E. coli to examine the protein's function, they found that the protein misfolded in a prion-like manner, rendering it nonfunctional and allowing genes normally suppressed by Rho to be expressed. (the-scientist.com)
  • Genetic screens to identify bacterial genes required for export have relied on enzymatic or fluorescent reporters fused to known substrates to monitor secretion. (mcponline.org)
  • Crucial to all cells, this protein machine carries out a fundamental process in which genes within the DNA blueprint are copied into RNA. (nanowerk.com)
  • These vectors can also be used as a source of different fluorescent protein coding sequences (genes), which can be amplified by PCR, or easily excised by using the flanking restriction sites and cloned into any other expression vector of choice. (clontech.com)
  • Scientists believe that antibiotics could be developed that disrupt the FimD protein, and therefore the production line of pili proteins. (ucl.ac.uk)
  • The iron-sequestering polymer is capable of delaying bacterial growth and increasing the sensitivity of wild type (wt) P. aeruginosa to the antibiotics ciprofloxacin and gentamicin. (ku.edu)
  • This will help physicians to prescribe antibiotics to only those with bacterial pneumonia and avoid antibiotic use in those with pure viral pneumonia, thus help to limit health-care cost and to decrease emergence of antibiotic resistance. (clinicaltrials.gov)
  • The 17-gene ethanolamine (eut) operon of Salmonella typhimurium encodes five homologues of carboxysome shell proteins. (ebi.ac.uk)
  • Heterologous protein synthesis is widely used for production of recombinant proteins. (frontiersin.org)
  • Papers presented at the Workshop Conference on Bacterial Protein Toxins, held in Seillac on June 26-30, 1983, and sponsored by the Centre national de la recherche scientifique and the Federation of European Microbiological Societies. (worldcat.org)
  • Bacterial toxins inhibiting or activating small GTP-binding proteins. (nih.gov)
  • Amino acids located on the switch 1 or switch 2 domains of small GTPases of the Ras and Rho family are targets of several bacterial toxins. (nih.gov)
  • The Comprehensive Sourcebook of Bacterial Protein Toxins, Fourth Edition, contains chapters written by internationally known and well-respected specialists. (elsevier.com)
  • Many bacterial signaling pathways involve a two-component design. (sciencemag.org)
  • In these pathways, a sensor kinase, when activated by a signal, phosphorylates its own histidine, which then serves as a phosphoryl donor to an aspartate in a response regulator protein. (sciencemag.org)
  • Researchers went on to show that NLRP6 suppressed activity in pathways that trigger production of proteins called cytokines, which promote inflammation to combat the infection. (infectioncontroltoday.com)
  • The results show that NLRP6 regulates the nuclear factor-kappa B (NF-kB) and mitogen-activated protein kinase (MAPK) pathways. (infectioncontroltoday.com)
  • This is the first member from the NLR family of proteins that inhibits rather than activates pathways involved in the innate immune response. (infectioncontroltoday.com)
  • This thesis focuses on determining the function of Orf in phage and bacterial recombination pathways by analysing its impact on recombinases encoded by λ and E. coli. (bl.uk)
  • An H, Statsyuk AV (2013) Development of activity-based probes for ubiquitin and ubiquitin-like protein signaling pathways. (springer.com)
  • In contrast, antibody level and food intake did vary in the 2nd group of animals, which received E. coli producing ClpB protein. (eurekalert.org)
  • Researchers studying water-soluble proteins often use commercial E. coli -based systems to express, or produce, copies of the protein. (medgadget.com)
  • When membrane proteins are produced in E. coli , they overload the cell's bi-layers and cause the cells to die. (medgadget.com)
  • Now we have cloned all of the membrane proteins of E. coli and are continuing production. (medgadget.com)
  • EF-Tu is the most abundant protein in E.coli and plays an essential role in protein synthesis. (rxpgnews.com)
  • As a model system, E. coli BL21(DE3) with pET 21C plasmid containing the gene encoding for the GFP fusion protein have been used. (scribd.com)
  • In E. coli, the bacterial actin MreB localizes away from positive Gaussian curvature and toward low curvature. (aps.org)
  • I am wanting to extract a transmembrane protein localised in the cytoplasmic membrane of E. coli for western blotting and hence I bought B Per from Pierce Scientific. (protocol-online.org)
  • Once proteins bind, they can trigger a reaction which may vary from an immune system response to an infection to the onset of a disease. (wisegeek.com)
  • Our work provides an explanation for how a bacterial infection can trigger a series of events that lead to cancer. (biospace.com)
  • Of particular importance, the infection did not need to persist and the protein did not need to be continuously present in all cancer cells. (biospace.com)
  • The researchers found that mycoplasma infection caused the mice to develop lymphoma earlier in life than noninfected immune-compromised mice and that some, but not all, of the cancer cells had bacterial DNA. (biospace.com)
  • Finding only a small amount of bacterial DNA in the cancer cells suggested that the infection did not have to persist to trigger cancer. (biospace.com)
  • By demonstrating in detail how the HipA protein freezes bacterial activity, the researchers have opened the possibility of adding a new class of drugs to therapy against chronic and multidrug resistant bacterial infection. (rxpgnews.com)
  • Host guanylate binding proteins (GBPs) promote infection-induced caspase-11 activation in tissue culture models, and yet their in vivo role in LPS-mediated sepsis has remained unexplored. (asm.org)
  • 3 years of age are at increased risk of clinically undetectable serious bacterial infection (SBI). (aappublications.org)
  • 6 Other causes of SBI include occult bacterial pneumonia (3%), 7 meningitis, or less commonly bone and joint infection, deep soft tissue abscess, or bacterial enteritis. (aappublications.org)
  • Potential applications of biomarkers in infectious diseases include distinguishing bacterial from nonbacterial infection, monitoring response to therapy, and predicting outcomes. (scielo.br)
  • These proteins are localised at the outer membrane surface and can cause frost damage to many plants. (wikipedia.org)
  • The stalk is a cylindrical protrusion of all envelope layers (inner membrane, periplasm, outer membrane, and S-layer) at the old cell pole and encloses cytoplasmic material that is free of chromosomal DNA, ribosomes, and most cytoplasmic proteins ( 7 , 8 ). (pnas.org)
  • Some of these proteins are likely to be located in the inner membrane while others may be outer membrane proteins. (nih.gov)
  • In this process, Gram-negative bacterial secreted proteins should cross two lipid bilayers including the cytoplasmic membrane (CM) and the outer membrane (OM), while Gram-positive bacterial secreted proteins just need cross the CM [1]. (scirp.org)
  • 7-10 The enzymes involved transfer lipid-linked glycans, generated en masse in the cytoplasm, to protein targets in the periplasm. (rsc.org)
  • This approach will enable glycoproteins to be produced in the bacterial cytoplasm with endogenous nucleotide sugar donors. (rsc.org)
  • This system comprises a hollow needle-like structure localized on the surface of bacterial cells that injects specific bacterial proteins, the so-called effectors, directly into the cytoplasm of a host cell. (rostlab.org)
  • Proteins are lengthy chains of amino acids which are folded back upon themselves. (wisegeek.com)
  • Proteins, which consist of chains of amino acids, locally fold themselves into one of two structures--a helix or a pleated sheet. (phys.org)
  • A protein like UmuD, which is made of fewer amino acids, would not be expected to have enough binding sites to interact with very many other proteins. (phys.org)
  • The primary structure of the proteins contains a highly repetitive domain that dominates the sequence. (wikipedia.org)
  • Once a pathogen genome has been sequenced, effectors can be predicted based on protein sequence similarity, but such predictions are not always precise. (wikipedia.org)
  • Ethanolamine utilization in Salmonella typhimurium: nucleotide sequence, protein expression, and mutational analysis of the cchA cchB eutE eutJ eutG eutH gene cluster. (ebi.ac.uk)
  • Furthermore, determination of the rate-limiting transport step for nine different substrates implicates the mature region distal to the signal peptide in the observed rate constant differences, indicating that more nuanced transport models that respond to differences in protein sequence and structure are needed. (asm.org)
  • As the intrinsically disordered proteins bind with other proteins, they may change their shape, allowing them to then interact with different proteins, potentially creating a chronological sequence of interactions as proteins bind and then are cast off. (phys.org)
  • Because the variants all differ slightly in their DNA sequence, there will be many slightly different versions of the protein too. (sciencelearn.org.nz)
  • Ultimately, the researchers were able to fill hundreds of gaps in the organism's sequence of roughly 2,000 proteins. (bio-medicine.org)
  • Note that the 'protein existence' evidence does not give information on the accuracy or correctness of the sequence(s) displayed. (uniprot.org)
  • p>This section provides information about the protein and gene name(s) and synonym(s) and about the organism that is the source of the protein sequence. (uniprot.org)
  • section indicates the name(s) of the gene(s) that code for the protein sequence(s) described in the entry. (uniprot.org)
  • Using this sequence, homogenous glucosylated proteins could be readily produced. (rsc.org)
  • In our method, we combine sequence-based homology searches and advanced machine learning to accurately predict effector proteins. (rostlab.org)
  • We use information encoded in the entire protein sequence for our predictions. (rostlab.org)
  • This review summarizes our current knowledge on the mechanisms of bacterial adherence to extracellular matrices and on the biological significance of these interactions. (nih.gov)
  • Protein localization mechanisms dictate the functional and structural specialization of cells. (pnas.org)
  • Mechanisms exist in prokaryotic and eukaryotic cells to direct specialized proteins to distinct subcellular sites where they execute topologically constrained functions, for example, morphogenesis ( 1 ). (pnas.org)
  • Utpal Pal, Ph.D., professor in veterinary medicine, isolated a protein produced by Borrelia burgdorferi that disables one of the body's first immune responses, giving insight into mechanisms that are largely not understood. (genengnews.com)
  • This review summarises the different families of bacterial metal-sensing transcriptional regulators and discusses current knowledge regarding the mechanisms of metal-regulated gene expression and the structural features of sensory metal- binding sites focusing on the ArsR-SmtB family. (rsc.org)
  • This approach is different than those employed by other anti-bacterial mechanisms, such as the immune systems white blood cells, Dziarski says. (infectioncontroltoday.com)
  • The mechanisms that underlie protein localization are incompletely understood, in part because of the paucity of methods that allow saturation screening for mutants in which protein localization is altered. (asm.org)
  • Streptococcus pneumoniae and Neisseria meningitidis have very similar mechanisms of resistance to penicillin G, which are mediated by the decreased affinity of penicillin-binding proteins (PBPs) ( 1 - 3 ). (cdc.gov)
  • This project aims to repurpose these mechanisms to facilitate the delivery of therapeutic proteins to neurones. (bl.uk)
  • We would like to understand how these proteins are able to modulate host metabolism and identify their host targets," she said. (redorbit.com)
  • SE-1 did not detectably inhibit the growth or metabolism of the bacterial or eukaryotic host cells, respectively, indicating that the inhibition of invasion was not due to general toxicity. (ku.edu)
  • IMPORTANCE Many proteins localize to specific sites within bacterial cells, and localization to these sites is frequently critical to proper protein function. (asm.org)
  • SecA is a central component of the general secretion system that is essential for bacterial growth and thus an ideal target for antimicrobial agents. (wiley.com)
  • We were able to detect peptide sequencing evidence that shows that the predicted signal peptide was kept uncleaved for several types of proteins such as mammalian cell entry (Mce) proteins and PE or PE-PGRS proteins. (nih.gov)
  • Proteins released via the T1SS are called type I secreted proteins (T1SPs), and other types of proteins are known by analogy with this. (scirp.org)
  • This proves the quantitative reconstitution of both types of proteins and indicates protein aggregation also in the monolayer. (uni-muenchen.de)
  • Finally, even within the same bacterial species, different strains often have different repertoires of effectors. (wikipedia.org)
  • That, he said, motivated him and his collaborators to re-examine spore germination, in an effort to resolve the controversy, so that the science could move on to addressing the spoilage and illness caused by the relevant bacterial species. (phys.org)
  • This is the first atomic resolution structure of this protein from an electrically conductive bacterial species, and it sets the foundation for understanding how these nanowires work," said structural biologist Patrick Reardon of the Department of Energy's Pacific Northwest National Laboratory. (bio-medicine.org)
  • Many bacterial species wave fingerlike projections along their bodies. (bio-medicine.org)
  • However, the natural history of colonization differs in these two bacterial species. (cdc.gov)
  • However, these models are based on a priori hypotheses which, in general, assume that the impact of antibiotic exposure does not differ according to the mechanism of resistance and do not consider the particular natural history of the colonization of the bacterial species. (cdc.gov)
  • The bacterial kingdom exhibits a wide variety of cell shapes and sizes which are crucial for the lifestyle of each species. (aps.org)
  • The new method simplifies production by utilizing squaric acid chemistry for conjugating the free amine-containing species (e.g. polysaccharides) directly to amine-containing species (e.g. proteins) without prior modification of either component. (nih.gov)
  • We focused on a protein called DnaK, which is part of a family of proteins that function as a 'chaperone' for other proteins protecting them from damage or helping them to fold," said Dr. Zella . (biospace.com)
  • NLRP6 belongs to a family of proteins that are part of the innate immune response that serves as the first line of defense. (infectioncontroltoday.com)
  • Cheng, X., Xiao, X. and Chou, K.C. (2018) pLoc-mGneg Predict Subcellular Localization of Gram-Negative Bacterial Proteins by Deep Gene Ontology Learning via General PseAAC. (scirp.org)
  • Expression, detergent solubilization, and purification of a membrane transporter, the MexB multidrug resistance protein. (currentprotocols.com)
  • A dual-purpose expression vector was designed, allowing efficient display of Affibody molecules, as well as small-scale protein production and purification of selected candidates without the need for sub-cloning. (albanova.se)
  • Norgen Biotek Corp., an innovative privately held Canadian biotechnology company focusing primarily on nucleic acid and protein stabilization and purification, as well as providing high quality services to the scientific community, today announced that it has become Propel-Certified through Illumina as a Next Generation Sequencing (NGS) service provider. (the-scientist.com)
  • The SoluLyse Reagent is tested to be compatible with all popular purification methods, such as Ni and glutathione resins for purifying poly-His and GST-tagged proteins. (amsbio.com)
  • This thesis describes the development, evaluation and use of bacterial display technologies for the engineering of affinity proteins. (albanova.se)
  • Affinity proteins used in therapeutic and diagnostic applications commonly aim to specifically bind to disease-related drug targets. (albanova.se)
  • The results demonstrate great potential of these display systems and the generated affinity proteins for future biotechnological and therapeutic use. (albanova.se)
  • Protein binding involves the formation of very strong links between two different proteins. (wisegeek.com)
  • The Gram-negative bacterial cell wall component lipopolysaccharide (LPS) is recognized by the noncanonical inflammasome protein caspase-11 in the cytosol of infected host cells and thereby prompts an inflammatory immune response linked to sepsis. (asm.org)
  • The invention includes a new method to conjugate the O-specific polysaccharide-core part of the bacterial lipopolysaccharide and protein subcomponents. (nih.gov)
  • Changes inSpore Small Molecules, rRNA, Germination and Outgrowth After Extended Sub-Lethal Exposure to Various Temperatures: Evidence That Protein Synthesis is not Essential for Spore Germination, Journal of Bacteriology (2016). (phys.org)
  • The best-characterized bacterial proteins active in these interactions are the mycobacterial fibronectin-binding proteins, the fibronectin- and the collagen-binding proteins of staphylococci and streptococci, specific enterobacterial fimbrial types, as well as the polymeric surface proteins YadA of yersinias and the A-protein of Aeromonas. (nih.gov)
  • The interactions can be based on a protein-protein or on a protein-carbohydrate interaction, or on a bridging mechanism mediated by a bivalent soluble target protein. (nih.gov)
  • Many of the interactions have also been demonstrated on tissue sections or in vivo, and adherence to the extracellular matrix has been shown to promote bacterial colonization of damaged tissues. (nih.gov)
  • MIT researchers have discovered why an unusually short bacterial protein can have many more interactions than would normally be expected of something its size. (phys.org)
  • In addition to being a unique structure, a bacterial protein also has the ability to bind with other proteins. (wisegeek.com)
  • For this, the researchers need to integrate the individual components - which include bacterial proteins, dyes, and aptamers - into a sensor chip. (ecnmag.com)
  • In this new study, the researchers have identified a protein that happens to be a mimic of the satiety hormone (melanotropin). (eurekalert.org)
  • At the same time, the researchers are using mice to study how to correct the action of the bacterial protein in order to prevent the dysregulation of food intake that it generates. (eurekalert.org)
  • To identify the protein composition of the aphid saliva, the researchers collected saliva from more than 100,000 aphids. (redorbit.com)
  • Understanding individual proteins can also allow researchers to monitor mutations and to keep track of the ways in which these mutations occurred, and how they can be addressed. (wisegeek.com)
  • Researchers will test the reagents on the membrane proteins produced in the Rhodobacter 'factory. (medgadget.com)
  • A NIST-developed model of a simplified cell membrane has been discovered by researchers, which may now accurately detect and measure protein associated with bacterial vaginosis. (medindia.net)
  • Researchers studying the protein that makes up one such wire have determined the protein's structure. (bio-medicine.org)
  • The researchers said in their paper that because this naturally-produced protein is safe to humans and other vertebrates and can be produced inexpensively in large quantities, it has the potential to substantially improve this global health problem. (bio-medicine.org)
  • The genetic code of an organism holds the blueprints for numerous proteins. (wisegeek.com)
  • Proteins are important to study because they are the foundation of the cellular structure of every living organism, Lamont said. (bio-medicine.org)
  • We've identified the complete protein complement of the organism, and we've looked at how those proteins are expressed when the organism is in an environment that closely mimics an oral situation. (bio-medicine.org)
  • Some of the proteins we previously thought were important when they were expressed in the lab proved not to be when the organism is in an environment that mimics the oral cavity,?Lamont said. (bio-medicine.org)
  • To put it simply, the behavior, or protein expression, of the organism when it's at work in the human mouth is very different from its behavior when it's vacationing in a Petri dish. (bio-medicine.org)
  • For these conditions, 0 IBs formation was minimized and the 27⁰C 30⁰C 33⁰C 37⁰C amount of soluble protein produced Temperature improved by a factor of 10 (Fig. 1). (scribd.com)
  • Fig. 1 - Fluorescence intensity of the soluble protein fraction produced at different growth temperatures and 1mM IPTG concentration. (scribd.com)
  • Interestingly, widely used lysozyme and Bugbuster reagent failed in most our cases to completely release the soluble protein. (genlantis.com)
  • In 2019, a predictor called "pLoc_bal-mEuk" was developed for identifying the subcellular localization of eukaryotic proteins. (scirp.org)
  • In the present paper, an approach to identify the multiple physicochemical and structural properties of amino acid sequences associated with soluble expression of eukaryotic proteins in cell-free bacterial extracts is presented. (frontiersin.org)
  • However, the folding of eukaryotic proteins is greatly compromised in bacterial extracts due to intrinsic differences between the cytoplasmic environments of prokaryotic and eukaryotic cells. (frontiersin.org)
  • Moreover, many eukaryotic proteins require multiple post-translational modifications (PTMs) to attain a native, biologically active state. (frontiersin.org)
  • In the present paper, we describe an approach aimed at identification of numerous physicochemical, structural and functional properties of amino acid sequences, including the sites of multiple PTMs, associated with soluble expression of eukaryotic proteins in bacterial cell-free extracts, and highlight major correlations obtained using this approach. (frontiersin.org)
  • Here, the focus is set on the processing of experimental data with the purpose of identification of multiple physicochemical and structural properties associated with soluble expression of eukaryotic proteins in cell-free bacterial extracts. (frontiersin.org)
  • Strikingly, the majority of the aphid salivary proteins predicted for secretion were of unknown function and different from those typically secreted by microbes into plants," Kaloshian said. (redorbit.com)
  • Bacterial proteins capable of acting like prions could help the microbes to adapt to environmental changes. (the-scientist.com)
  • The structure of AvrPtoB revealed that the protein looks very much like a ubiquitin ligase, an enzyme plant and animal cells use to attach the small protein ubiquitin to unneeded or defective proteins. (innovations-report.com)
  • Little or no mycoplasma DnaK DNA sequences were found associated with the tumor, which was fully developed, suggesting a hit-and-run or hide mechanism of transformation, indicating that the damage is done early but the protein may not be needed once the cancer cells are formed. (biospace.com)
  • Therefore, the secretion process of the former is more complex than that of the latter, and more secretion systems are existing in Gram-negative bacterial cells. (scirp.org)
  • Persistent cells are a one-in-a-million-cells occurrence because HipA is normally kept in check by a protein called HipB. (rxpgnews.com)
  • In a bacterial library, many different DNA sequences are introduced into the cells of a bacterial culture. (sciencelearn.org.nz)
  • We demonstrate further that this system can be applied to the study of proteins other than autotransporters that display polar positioning within bacterial cells. (harvard.edu)
  • The PGRP proteins are normally expressed in phagocytic cells in blood and on body surface areas such as skin, mouth, intestine and other tissues that have direct or indirect contact with the external world, Dziarski noted. (infectioncontroltoday.com)
  • Exposure to such bacterial proteins may be involved in the generation of aberrant recognition of gluten by these same T cells when susceptible individuals eat cereals containing gluten, he said. (scitechdaily.com)
  • We tend to think about human biology as what goes on in human cells but there's at least as many bacterial cells as human cells on and in our bodies," he says. (wisc.edu)
  • It states that it is an easy to use, one reagent method for gentle lysis of bacterial cells to extract both soluble and insoluble proteins and soluble proteins from inclusion bodies. (protocol-online.org)
  • These proteins serve as sentinels working inside cells to recognize and response to infectious agents. (infectioncontroltoday.com)
  • SoluLyse Protein Extraction Reagents are optimized for the most efficient extraction of soluble proteins from bacterial and mammalian cells. (amsbio.com)
  • The SoluLyse Protein Extraction Reagent is a proprietary formulation of nonionic detergents that is optimized for the most efficient extraction of soluble proteins from bacterial cells. (amsbio.com)
  • The cells will be disrupted and soluble proteins released. (amsbio.com)
  • Bacterial proteins binding to the mammalian extracellular matrix. (nih.gov)
  • It provides a general method for the study of activated response regulators in the absence of kinase proteins. (pnas.org)
  • Using X-ray crystallography to determine and then compare the structures of several HipA complexes, they showed that HipA has a serine/threonine protein kinase fold and that it binds tightly to adenosine triphosphate (ATP), a common characteristic of kinases. (rxpgnews.com)
  • As they continue to manufacture different membrane proteins, the team is tackling the next step to creating a pathway to protein crystallization for membrane proteins by developing specialized molecules, or reagents. (medgadget.com)
  • BioRad has a large variety of extraction reagents including one that specifically speaks to membrane proteins (including bacterial - I think), ReadyPrep Membrane II. (protocol-online.org)
  • Side-by-side comparisons between SoluLyze and another leading commercial lysis reagents showed that SoluLyse yields about 10-fold more soluble proteins. (genlantis.com)
  • This method will be broadly applicable to study other bacterial protein export systems and for the identification of compounds that inhibit bacterial protein secretion. (mcponline.org)
  • that during translation the ribosomal A site is not blocked by unspecific binding of the non-cognate tRNAs which would inhibit the speed of protein synthesis. (diva-portal.org)
  • Very importantly, the potency of these fluorescein analogues in inhibiting the truncated SecA ATPase correlates with their ability to inhibit the biologically relevant protein translocation activity of SecA. (wiley.com)
  • More importantly, it is difficult to prove experimentally that a predicted effector is actually secreted into a host cell because the amount of each effector protein is tiny. (wikipedia.org)
  • Boddi S, Comparini C, Calamassi R, Pazzagli L, Cappugi G, Scala A (2004) Cerato-platanin protein is located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f. sp. (springer.com)
  • Bacterial ParA-like ATPases mediate cell cycle-dependent localization of chemotaxis proteins to cell poles. (sciencemag.org)
  • This protein is central to cell division and survival, and mutations in the gene that codes for Ras are a common cause of human malignancies. (eurekalert.org)
  • Ubiquitination is the main pathway for protein degradation that governs a variety of eukaryotic cellular processes, including the cell-cycle, vesicle trafficking, antigen presentation, and signal transduction. (frontiersin.org)
  • The lysosome was initially given credence for the responsibility of protein turnover in a cell. (frontiersin.org)
  • Hempel K, Pane-Farre J, Otto A, Sievers S, Hecker M, Becher D (2010) Quantitative cell surface proteome profiling for SigB-dependent protein expression in the human pathogen Staphylococcus aureus via biotinylation approach. (springer.com)
  • The first step in studying most proteins is to dissolve them in water," Hanson said, "but that does not work with membrane proteins that live in the oily, lipid bi-layer that surrounds the cell. (medgadget.com)
  • Overexpression of HipA previously had been associated with cell dormancy and bacterial persistence. (rxpgnews.com)
  • We show that the conserved cell division protein FtsQ is required for localization of IcsA and other autotransporters to the pole. (harvard.edu)
  • The PGRPs accomplish the mission by binding to specific sites in bacterial cell walls in ways that exploit a bacterial defense mechanism known as protein-sensing two-component systems. (infectioncontroltoday.com)
  • Using this method, we identify the conserved cell division protein FtsQ as being required for positioning of IcsA to the bacterial pole. (asm.org)
  • Normally the electrons build up or break down minerals in rock, but the system can also be used to clean up toxic heavy metals or to run a bacterial fuel cell. (bio-medicine.org)
  • In the bacterial carcinogen H. pylori , we have begun to examine the localization of many cell shape determinants with various curvature preferences. (aps.org)
  • In the living cell the availability of cognate tRNAs versus the demand for them (the frequency of codon usage) is finely balanced to ensure critical protein synthesis in stress conditions. (diva-portal.org)
  • It allows perforation of bacterial cell wall without denaturing proteins, and there is no need for secondary treatment such as sonication or freeze-thaw. (amsbio.com)
  • In addition, SoluLyse does not compromise protein activities in cell lysates. (amsbio.com)
  • Isolated cell surface associated proteins from L. fermentum were sufficient for this adhesion exclusion. (amrita.edu)
  • In addition, SoluLyse reagent does not compromise protein activities in cell lysates. (genlantis.com)
  • Vast data volumes have been accumulated in cell-free expression databases, covering a whole range of existing proteins. (frontiersin.org)
  • Most often, the purpose of heterologous cell-free synthesis is to produce properly folded and functionally active protein product in the amounts sufficient for structural and functional studies. (frontiersin.org)
  • The developed method is intended for analysis of output from an existing cell-free protein production pipeline. (frontiersin.org)
  • The distinct signals evoked by specific enzymes play a crucial role in, for instance, proteasome-mediated protein degradation, cell cycle regulation, and DNA damage responses. (springer.com)
  • These pre-absorbed sera were used in Western blotting after 2-DE to find bacterial surface protein antigens. (springer.com)
  • Here we report a unique innate immune evasion strategy of B. burgdorferi , orchestrated by a surface protein annotated as BBA57, through its modulation of multiple spirochete virulent determinants. (genengnews.com)
  • I want to prepare a lysis buffer for bacterial surface protein extraction. (protocol-online.org)
  • AraC family proteins are transcriptional regulators that are defined by the presence of a conserved DNA binding domain (DBD). (ku.edu)
  • We propose that the level of TREM-1 will be significantly elevated in the lung fluid of children with bacterial pneumonia and viral with co-existing bacterial pneumonia than in children with pure viral pneumonia. (clinicaltrials.gov)
  • However, viral pneumonias are frequently associated with secondary bacterial pneumonia. (clinicaltrials.gov)
  • It is important, though difficult, to differentiate patients who only have viral pneumonia from those who have viral pneumonia with secondary bacterial pneumonia. (clinicaltrials.gov)
  • Community acquired meningitis refers to bacterial meningitis caused by Haemophilus influenzae (mostly type b), Streptococcus pneumonia or Neisseria meningitidis . (scielo.br)
  • Effector proteins may have many different activities, but usually help the pathogen to invade host tissue, suppress its immune system, or otherwise help the pathogen to survive. (wikipedia.org)
  • Yersinia inhibits phagocytosis through the concerted actions of several effector proteins, including YopE which acts as a RhoGAP and inhibits Rac-dependent actin polymerization. (wikipedia.org)
  • For a query protein it first runs PSI-BLAST to identify a homolog in the set of known and annotated effector proteins. (rostlab.org)
  • If such a homolog is available, then its annotation ( i.e. type III effector) is being transferred to a query protein. (rostlab.org)
  • If a homolog is not available, pEffect triggers an SVM that predicts effector proteins through searches of k -consecutive residues that are known from annotated proteins. (rostlab.org)
  • The graphs were obtained using the homology-reduced sets of 115 type III effector and 3,460 non-effector proteins in five-fold cross-validation. (rostlab.org)
  • When making a library for improving a protein, scientists usually aim to clone as many different DNA sequences as possible. (sciencelearn.org.nz)
  • The larger the number of unique DNA sequences, the more likely it is that one of the sequences will encode an improved protein. (sciencelearn.org.nz)
  • 1. one or more FASTA-formatted protein sequences. (rostlab.org)
  • While PSI-BLAST searches are fast, SVM's runtime depends on the number of query protein sequences. (rostlab.org)
  • For novel protein sequences for which we don't have PSI-BLAST profiles in the cache the runtimes increases substantially. (rostlab.org)
  • Optimization of Mutation Pressure in Relation to Properties of Protein-Coding Sequences in Bacterial Genomes. (sigmaaldrich.com)
  • The artificial matrices were optimized on real protein-coding sequences based on Evolutionary Strategies approach to minimize or maximize the probability of non-synonymous substitutions and costs of amino acid replacements depending on their physicochemical properties. (sigmaaldrich.com)
  • We observed no substantial differences between the effects of mutational matrices on protein-coding sequences in genomes under study in respect of differently replicated DNA strands, mutational cost types and properties of the referenced artificial matrices. (sigmaaldrich.com)
  • We are presently working to develop a blood test based on detection of the bacterial protein ClpB. (eurekalert.org)
  • Zhang W, Liu G, Tang F, Shao J, Lu Y, Bao Y, Yao H, Lu C (2011) Pre-absorbed immunoproteomics: a novel method for the detection of Streptococcus suis surface proteins. (springer.com)
  • The in vitro translocation of proOmpA precursors into membrane vesicles is strongly inhibited by RB with IC 50 values of approximately 0.25 μ M , making RB the most potent inhibitor of SecA ATPase and SecA-dependent protein translocation reported thus far. (wiley.com)
  • The present study examines the translocation HCO_3-, CO_2 and O_2 through the central pores of different isoforms of shell protein complexes from alpha and beta cyanobacteria. (caltech.edu)
  • Collectively, these studies elucidate how an essential SRP RNA and two regulatory GTPases in the SRP and SRP receptor (SR) enable this targeting machinery to recognize, sense and respond to its biological effectors, i.e. the cargo protein, the target membrane and the translocation machinery, thus driving efficient and faithful co-translational protein targeting. (caltech.edu)
  • This new method has been proven to be a useful tool for identifying surface proteins, and aid in the development of new vaccine subunits and disease diagnostics. (springer.com)
  • It's the proteins that are most responsible for disease, and in most cases it's proteins that are vaccine and drug targets. (bio-medicine.org)
  • When this approach is combined with the intermediates of bacterial O -antigen biosynthesis the resulting conjugates are valuable as potential anti-bacterial vaccine components. (rsc.org)
  • In order to study the optimization of the pressure, we compared mutational transition probability matrices from bacterial genomes with artificial matrices fulfilling the same general features as the real ones, e.g., the stationary distribution and the speed of convergence to the stationarity. (sigmaaldrich.com)
  • Some of these bacterial proteins are highly specific for an extracellular matrix protein, some are multifunctional and express binding activities towards a number of target proteins. (nih.gov)
  • These data thus confirm the involvement of the bacterial protein in the regulation of appetite, and open up new perspectives for the diagnosis and specific treatment of eating disorders. (eurekalert.org)
  • In vivo , the specific lysine modification used in the polyubiquitin chain translates into the fate of the protein (Figure 1 ). (frontiersin.org)
  • Normally, proteins form a specific structure with binding sites where other proteins can attach. (phys.org)
  • Here we apply a powerful experimental scheme that integrates genetics with high-throughput localization to discover StpX, an uncharacterized bitopic membrane protein that modulates stalk elongation and is sequestered to the stalk. (pnas.org)
  • The sources that have yielded the majority of the few known membrane-protein structures are organisms in which the target membrane protein is naturally abundant. (medgadget.com)
  • The biologists developed a system that successfully expresses hundreds of copies of a chosen membrane protein in Rhodobacter while simultaneously synthesizing the internal membranes they want to live in. (medgadget.com)
  • 1. Designer detergents that remove the membrane protein from the lipid bi-layer where it resides, 2. (medgadget.com)
  • Bacterial motility and gene expression are controlled by a family of phosphorylated response regulators whose activities are modulated by an associated family of protein-histidine kinases. (pnas.org)
  • It is also used to enable bacterial movement (motility). (sciencephoto.com)
  • Extracellular and endocytosed LPS is recognized by the transmembrane protein Toll-like receptor 4 (TLR4) and prompts discrete signaling events originating from the plasma membrane and from endosomes ( 2 , 3 ). (asm.org)
  • The story started with a search for a non-lysosomal pathway for protein degradation. (frontiersin.org)
  • Significantly, this would direct recombination down the bacterial RecA pathway of break restoration rather than the phage Red pathway with potentially important consequences for the outcome of the exchange reaction. (bl.uk)
  • Co-translational protein targeting by the Signal Recognition Particle (SRP) is an essential cellular pathway that couples the synthesis of nascent proteins to their proper cellular localization. (caltech.edu)
  • Bacterial meningitis affects fewer people than the viral form, but it often results in more serious health consequences. (proteinlounge.com)
  • The purpose of this study is to determine whether a protein called TREM-1 can be used to differentiate viral and bacterial pneumonias in children who are on ventilator support. (clinicaltrials.gov)
  • 30 patients diagnosed with acute bacterial meningitis, 30 viral meningitis, and 30 subjects with normal CSF findings. (scielo.br)
  • Cerebrospinal fluid HBP levels averaged 0.82 ± 0.3 ng/mL in controls, 3.3 ± 1.7 ng/mL in viral and 174.8 ± 46.7 ng/mL in bacterial meningitis. (scielo.br)
  • Mean serum level was 0.84 ± 0.3 ng/mL in the controls, 3.7 ± 1.9 ng/mL in viral, and 192.2 ± 56.6 ng/mL in bacterial meningitis. (scielo.br)
  • The clinical distinction between viral and acute bacterial meningitis is difficult in the acute phase of illness because the symptoms are often similar. (scielo.br)
  • According to WHO guidelines, CSF (cerebrospinal fluid) analysis is essential to establish the diagnosis, distinguish bacterial from viral meningitis, and to identify the etiological agent. (scielo.br)
  • Wolters DA, Washburn MP, Yates JR III (2001) An automated multidimensional protein identification technology for shotgun proteomics. (springer.com)
  • The research, conducted by a Rockefeller team led by Elizabeth Campbell, in collaboration with scientists at Memorial Sloan Kettering, focuses on a cluster of interacting proteins called RNA polymerase. (nanowerk.com)
  • In the bacterial expressome, the polymerase and ribosome form one complex structure to carry out these two processes in a coupled manner, and this newly solved structure provides a snapshot of this taking place, says Rachel Mooney, a research scientist in Biochemistry and co-author on the paper. (wisc.edu)
  • The finding of SLN1 demonstrates that a mode of signal transduction similar to the bacterial two-component design operates in eukaryotes as well. (sciencemag.org)
  • SoluLyse Protein Extraction Reagent is supplied in 1X solution in 50mM NaHPO 4 , pH 7.4. (genlantis.com)
  • Bacterial proteins from the two conditions were separated using a new technique called Multidimensional Protein Identification Technology, or MudPIT. (bio-medicine.org)
  • Here we show that the response regulators catalyze their own phosphorylation in that both CheY and CheB can be phosphorylated in the complete absence of any auxiliary protein. (pnas.org)
  • Phosphorylation occurs when an enzyme binds to both ATP and to its target protein. (rxpgnews.com)
  • Long thought to be the sole LPS sensor in mammals, TLR4 has been studied in great detail, leading to the discovery and characterization of several auxiliary proteins required for the activation of TLR4 signaling ( 2 ). (asm.org)
  • In this article, we demonstrate that activator of G-protein signaling 3 (AGS3), an LPS-inducible protein in macrophages, affects both lysosomal biogenesis and activity. (jimmunol.org)