Viruses whose host is Bacillus. Frequently encountered Bacillus phages include bacteriophage phi 29 and bacteriophage phi 105.
Viruses whose hosts are bacterial cells.
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
A species of gram-positive bacteria that is a common soil and water saprophyte.
A species of rod-shaped bacteria that is a common soil saprophyte. Its spores are widespread and multiplication has been observed chiefly in foods. Contamination may lead to food poisoning.
A species of bacteria that causes ANTHRAX in humans and animals.
A species of gram-positive bacteria which may be pathogenic for certain insects. It is used for the biological control of the Gypsy moth.
A species of bacteria whose spores vary from round to elongate. It is a common soil saprophyte.
Viruses whose host is Salmonella. A frequently encountered Salmonella phage is BACTERIOPHAGE P22.
Heat and stain resistant, metabolically inactive bodies formed within the vegetative cells of bacteria of the genera Bacillus and Clostridium.
Viruses whose host is Pseudomonas. A frequently encountered Pseudomonas phage is BACTERIOPHAGE PHI 6.
Proteins found in any species of bacterium.
The phenomenon by which a temperate phage incorporates itself into the DNA of a bacterial host, establishing a kind of symbiotic relation between PROPHAGE and bacterium which results in the perpetuation of the prophage in all the descendants of the bacterium. Upon induction (VIRUS ACTIVATION) by various agents, such as ultraviolet radiation, the phage is released, which then becomes virulent and lyses the bacterium.
Viruses whose host is Streptococcus.
Bacteriophages whose genetic material is RNA, which is single-stranded in all except the Pseudomonas phage phi 6 (BACTERIOPHAGE PHI 6). All RNA phages infect their host bacteria via the host's surface pili. Some frequently encountered RNA phages are: BF23, F2, R17, fr, PhiCb5, PhiCb12r, PhiCb8r, PhiCb23r, 7s, PP7, Q beta phage, MS2 phage, and BACTERIOPHAGE PHI 6.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A collection of cloned peptides, or chemically synthesized peptides, frequently consisting of all possible combinations of amino acids making up an n-amino acid peptide.
Viruses whose host is Escherichia coli.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The functional hereditary units of BACTERIA.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A technique of bacterial typing which differentiates between bacteria or strains of bacteria by their susceptibility to one or more bacteriophages.
A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by long, non-contractile tails.
A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by complex contractile tails.
A temperate inducible phage and type species of the genus lambda-like viruses, in the family SIPHOVIRIDAE. Its natural host is E. coli K12. Its VIRION contains linear double-stranded DNA with single-stranded 12-base 5' sticky ends. The DNA circularizes on infection.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
An acute infection caused by the spore-forming bacteria BACILLUS ANTHRACIS. It commonly affects hoofed animals such as sheep and goats. Infection in humans often involves the skin (cutaneous anthrax), the lungs (inhalation anthrax), or the gastrointestinal tract. Anthrax is not contagious and can be treated with antibiotics.
A genus of filamentous bacteriophages of the family INOVIRIDAE. Organisms of this genus infect enterobacteria, PSEUDOMONAS; VIBRIO; and XANTHOMONAS.
Rupture of bacterial cells due to mechanical force, chemical action, or the lytic growth of BACTERIOPHAGES.
Proteins from BACTERIA and FUNGI that are soluble enough to be secreted to target ERYTHROCYTES and insert into the membrane to form beta-barrel pores. Biosynthesis may be regulated by HEMOLYSIN FACTORS.
The reproductive elements of lower organisms, such as BACTERIA; FUNGI; and cryptogamic plants.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
A family of bacteriophages which are characterized by short, non-contractile tails.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Virulent bacteriophage and type species of the genus T4-like phages, in the family MYOVIRIDAE. It infects E. coli and is the best known of the T-even phages. Its virion contains linear double-stranded DNA, terminally redundant and circularly permuted.
Messages between computer users via COMPUTER COMMUNICATION NETWORKS. This feature duplicates most of the features of paper mail, such as forwarding, multiple copies, and attachments of images and other file types, but with a speed advantage. The term also refers to an individual message sent in this way.
The study of microorganisms such as fungi, bacteria, algae, archaea, and viruses.
Sudden increase in the incidence of a disease. The concept includes EPIDEMICS and PANDEMICS.
Techniques used in microbiology.
A publication issued at stated, more or less regular, intervals.
A quantitative measure of the frequency on average with which articles in a journal have been cited in a given period of time.
A plant genus of the family ERICACEAE.
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
A collective genome representative of the many organisms, primarily microorganisms, existing in a community.
The ability of bacteria to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).
A parasexual process in BACTERIA; ALGAE; FUNGI; and ciliate EUKARYOTA for achieving exchange of chromosome material during fusion of two cells. In bacteria, this is a uni-directional transfer of genetic material; in protozoa it is a bi-directional exchange. In algae and fungi, it is a form of sexual reproduction, with the union of male and female gametes.
Substances that reduce the growth or reproduction of BACTERIA.
The ability of microorganisms, especially bacteria, to resist or to become tolerant to chemotherapeutic agents, antimicrobial agents, or antibiotics. This resistance may be acquired through gene mutation or foreign DNA in transmissible plasmids (R FACTORS).

Genetic and physical maps of the Bacillus subtilis chromosome. (1/348)

Sequencing of the complete Bacillus subtilis chromosome revealed the presence of approximately 4100 genes, 1000 of which were previously identified and mapped by classical genetic crosses. Comparison of these experimentally determined positions to those derived from the nucleotide sequence showed discrepancies reaching up to 24 degrees (approximately 280 kb). The size of these discrepancies as a function of their position along the chromosome is not random but, apparently, reveals some periodicity. Our analyses demonstrate that the discrepancies can be accounted for by inaccurate positioning of the early reference markers with respect to which all subsequently identified loci were mapped by transduction and transformation. We conclude (i) that specific DNA sequences, such as recombination hotspots or presence of heterologous DNA, had no detectable effect on the results obtained by classical mapping, and (ii) that PBS1 transduction appears to be an accurate and unbiased mapping method in B. subtilis.  (+info)

Selection of antibody probes to correlate protein sequence domains with their structural distribution. (2/348)

We propose a new approach that permits correlation of specific domains defined by their primary sequence with their location in the structure of complex macromolecular aggregates. It is based on the combination of well-established structural analysis methods that incorporate the use of overlapping peptides on cellulose membranes for the isolation and purification of specific antibodies from a polyclonal antiserum. Monospecific antibodies to the connector protein of bacteriophage phi29 were isolated from polyclonal antisera using a new development of the spotscan method. These antibodies can be purified in quantities that allow antigenicity testing in enzyme-linked immunosorbent assays, Western blotting and immunoprecipitations, demonstrating the specificity of this isolation procedure. This approach has allowed us to generate direct antibody probes for immunoelectron microscopy mapping of different connector protein domains in a low resolution three-dimensional epitope map.  (+info)

Virus assembly: Imaging a molecular machine. (3/348)

A recent structural study of a double-stranded DNA bacteriophage has provided remarkable new insights into the assembly of a complex virus particle and ushers in a new era in the imaging of non-icosahedral viruses.  (+info)

Nucleotide sequence of the Bacillus subtilis temperate bacteriophage SPbetac2. (4/348)

The Bacillus subtilis 168 chromosomal region extending from 184 degrees to 195 degrees, corresponding to prophage SPbeta, has been completely sequenced using DNA of the thermoinducible SPbetac2 mutant. This 134416 bp segment comprises 187 putative ORFs which, according to their orientation, were grouped into three clusters. Compared to its host, SPbetac2 is characterized by a lower G+C content, shorter mean ORF length, as well as a different usage of start codons. Nearly 75% of predicted ORFs do not share significant homologies to sequences in available databases. The only highly similar proteins to SPbetac2-encoded ones are host paralogues. SPbetac2 promoter regions contain SOS box consensus sequences and a repeated motif, designated SPbeta repeated element (SPBRE), that is absent from the host genome. Gene sspC, encoding the small acid-soluble protein C, that has been previously sequenced and mapped to the vicinity of the SPbeta region, was found to be part of the prophage.  (+info)

Sequence requirement for hand-in-hand interaction in formation of RNA dimers and hexamers to gear phi29 DNA translocation motor. (5/348)

Translocation of DNA or RNA is a ubiquitous phenomenon. One intricate translocation process is viral DNA packaging. During maturation, the lengthy genome of dsDNA viruses is translocated with remarkable velocity into a limited space within the procapsid. We have revealed that phi29 DNA packaging is accomplished by a mechanism similar to driving a bolt with a hex nut, which consists of six DNA-packaging pRNAs. Four bases in each of the two pRNA loops are involved in RNA/RNA interactions to form a hexagonal complex that gears the DNA translocating machine. Without considering the tertiary interaction, in some cases only two G/C pairs between the interacting loops could provide certain pRNAs with activity. When all four bases were paired, at least one G/C pair was required for DNA packaging. The maximum number of base pairings between the two loops to allow pRNA to retain wild-type activity was five, whereas the minimum number was five for one loop and three for the other. The findings were supported by phylogenetic analysis of seven pRNAs from different phages. A 75-base RNA segment, bases 23-97, was able to form dimer, to interlock into the hexamer, to compete with full-length pRNA for procapsid binding, and therefore to inhibit phi29 assembly in vitro. Our result suggests that segment 23-97 is a self-folded, independent domain involved in procapsid binding and RNA/RNA interaction in dimer and hexamer formation, whereas bases 1-22 and 98-120 are involved in DNA translocation but dispensable for RNA/RNA interaction. Therefore, this 75-base RNA could be a model for structural studies in RNA dimerization.  (+info)

Replication slippage of different DNA polymerases is inversely related to their strand displacement efficiency. (6/348)

Replication slippage is a particular type of error caused by DNA polymerases believed to occur both in bacterial and eukaryotic cells. Previous studies have shown that deletion events can occur in Escherichia coli by replication slippage between short duplications and that the main E. coli polymerase, DNA polymerase III holoenzyme is prone to such slippage. In this work, we present evidence that the two other DNA polymerases of E. coli, DNA polymerase I and DNA polymerase II, as well as polymerases of two phages, T4 (T4 pol) and T7 (T7 pol), undergo slippage in vitro, whereas DNA polymerase from another phage, Phi29, does not. Furthermore, we have measured the strand displacement activity of the different polymerases tested for slippage in the absence and in the presence of the E. coli single-stranded DNA-binding protein (SSB), and we show that: (i) polymerases having a strong strand displacement activity cannot slip (DNA polymerase from Phi29); (ii) polymerases devoid of any strand displacement activity slip very efficiently (DNA polymerase II and T4 pol); and (iii) stimulation of the strand displacement activity by E. coli SSB (DNA polymerase I and T7 pol), by phagic SSB (T4 pol), or by a mutation that affects the 3' --> 5' exonuclease domain (DNA polymerase II exo(-) and T7 pol exo(-)) is correlated with the inhibition of slippage. We propose that these observations can be interpreted in terms of a model, for which we have shown that high strand displacement activity of a polymerase diminishes its propensity to slip.  (+info)

Effect of the ionic environment on the molecular structure of bacteriophage SPP1 portal protein. (7/348)

Bacteriophage SPP1 portal protein is a large cyclical homo-oligomer composed of 13 subunits. The solution structure and assembly behavior of this protein with high-point rotational symmetry was characterized. The purified protein was present as a monodisperse population of 13-mers, named gp6H, at univalent salt concentrations in the hundred millimolar range (>/= 250 mM NaCl) or in the presence of bivalent cations in the millimolar range (>/= 5 mM MgCl2). Gp6H had a slightly higher sedimentation coefficient, a smaller shape-dependent frictional ratio, and a higher rate of intersubunit cross-linking in the presence of magnesium than in its absence. In the absence of bivalent cations and at univalent salt concentrations below 250 mM, the 13-mer molecules dissociated partially into stable monomers, named gp6L. The monomer had a somewhat different shape from the subunit present in the 13-mer, but maintained a defined tertiary structure. The association-dissociation equilibrium was mainly between the monomer and the 13-mer with a minor population of intermediate oligomers. Their interconversion was strongly influenced by the ionic environment. Under physiological conditions, the concentration of Mg2+ found in the Bacillus subtilis cytoplasm (10-50 mM) probably promotes complete association of gp6 into 13-mer rings with a compact conformation.  (+info)

Functional interactions between a phage histone-like protein and a transcriptional factor in regulation of phi29 early-late transcriptional switch. (8/348)

Protein p6 is a nonspecific DNA-binding protein occurring in high abundance in phage phi29-infected cells. Here, we demonstrate a novel role for this versatile histone-like protein: its involvement in regulating the viral switch between early and late transcription. p6 performs this role by exhibiting a reciprocal functional interaction with the regulatory protein p4, also phage encoded, which is required for repression of the early A2b and A2c promoters and activation of the late A3 promoter. On the one hand, p6 promotes p4-mediated repression of the A2b promoter and activation of the A3 promoter by enhancing binding of p4 to its recognition site at PA3; on the other, p4 promotes p6-mediated repression of the A2c promoter by favoring the formation of a stable p6-nucleoprotein complex that interferes with RNA polymerase binding to PA2c. We propose that the observed interplay between proteins p6 and p4 is based on their DNA architectural properties.  (+info)

A phi 29 DNA fragment containing gene 6, required for DNA replication, has been cloned in plasmid pPLc28 under the control of the PL promoter of phage lambda. A polypeptide with an electrophoretic mobility close to that of p6 was labelled with 35S-methionine after heat induction. This protein, repre …
Bacillus phage Azalea complete sequence, 161765 bp including 2452 bp terminal repeat AGGTTTTTCTCTGGTATACGCTTCATGCTAGATAGAGTAGATTGCATCCT TGTACACAAATATATACCCGTTCTACAAACTTGTACAGGTGTTTTAAGGT GTCTCACACTCCGTTACACGTCGTTTTACAAACTAACTGGTACAAATGTA TAAGAACAACAAAAAAGCCCTTCACGACAATGTGAGGGCTTTCCTGCTAT AATGTGGGGTTTTGCTAGTAGCTCACTGGAATGCAAGCGCAACTCCTAGT AGCTCACTGGAACAGAGCCGAAAATCCTTAGTAGCTCCCTAGAACGCATA GGCAACTGTATGGCTTGTCCCTTTAGCTCATGAGCAAATACGCCCATGGA GCCAATCGCAGCATCTGACAATTGTCAGACAATTACGACAACAGGTATCT ACAAAATGTGCATCGACCTGCTTAAACAGAATAGCACATCAAACGACAAT AATACAAGCATAGACAAATTAAAAGTTTTTTATACATATTCTGACTAACT AAATATTCTGACAATTAGCAGCGCATATAAATATCACAGGTCTGTATAAT TGTCAAGTTAAAATAGTATTGCGAATAGTCTGACAATTAGAAGGGTATGA GTATTGCAAATAGTGCTAATAGTCTGACTGTCATAATAGTATGAATTGTG CCATTGTTCGGATTATTCTAAATAGTCTGACAATTAAAATGAAAACCCTC GGGAAAATAGAGTTAATATTCTGACAATAATAATAGTCTGACAATAATAT ACGGACATTTAATAGTCTGACAATTAGAATGTTCGGACTAGTAAGAATAA TCTGACAGTTTGAATGTTATGAATAGTCTAAATAGTCTGACAATTGTAAG AGGCTGCAATAGAATTAACTGACAATTCAAACTATTCAATCAATTATGAT ...
Abstract: It has been a long-standing goal in systems biology to find relations between the topological properties and functional features of protein networks. However, most of the focus in network studies has been on highly connected proteins (hubs). As a complementary notion, we define bottlenecks as proteins with a high betweenness centrality, i.e., network nodes that have a high number of shortest paths going through them. We found that bottlenecks are key connector proteins with surprising functional and dynamic properties. In particular, bottlenecks are more likely to be essential proteins. In fact, in regulatory and other networks with directed edges, betweenness (i.e., bottleneck-ness) is a much more significant indicator of essentiality than degree (i.e., hub-ness). Furthermore, bottlenecks correspond to the dynamic components of the interaction network - they are significantly less well co-expressed with their neighbors than non-bottlenecks, implying that expression dynamics is ...
An electrical connector with at least two connector portions. A first connector portion and a second connector portion may each be mountable on a respective surface, such as a printed circuit board. The first and second connector portions may each include a housing. The housing of the first connector portion may include a bore and an adjacent pin. The housing of the second connector portion may also include a bore and an adjacent pin. The pin of the first connector portion may be received in the bore of the second connector portion, and the pin of the second connector portion may be received in the bore of the first connector portion, when the two connector portions are mated to one another. In one embodiment, the first and second connector portions may be substantially identical to one another.
A connector system for use in coupling an implantable electrical lead to an implantable pulse generator, or other implantable electrical apparatus. The connector system includes a connector pin assembly, typically mounted to the implantable lead and a connector block, typically mounted to the electrical stimulator. The connector block is provided with a lumen, in which a plurality of resilient, elastomeric rings are linearly arranged. The rings are so sized as to frictionally engage a connector pin which is provided with a plurality of conductive pads, each coupled to a conductor within the implantable lead. Certain ones of the elastomeric rings are conductive, and engage with the conductive pads on the connector pin. Others of the rings are nonconductive and act as insulators and fluid seals. The connector pin assembly is also provided with a circumferential groove, which interlocks with the deflectable beam members of a retainer mounted to the connector block. An alternative connector block
A connector system for sterile connection includes a male type patient side connector having a tube connecting portion at a rear end portion thereof, a protective cap for the patient side connector, an inner cap held in the protective cap and including a ring-shaped portion that supports a disinfectant-impregnated member therein, and a female type circuit side connector including an outer cylinder and an inner cylinder fixed at one end of the outer cylinder, where the inner cylinder includes an internal end portion located inside the outer cylinder and an external end portion exposed outside the outer cylinder. When the protective cap is fitted with the patient side connector, the disinfectant-impregnated member contacts with the patient side connector. When the protective cap is removed therefrom, the inner cap becomes retained in the patient side connector. When such a patient side connector is connected with the circuit side connector, the internal end portion of the inner cylinder penetrates through
Hi, The second connect has been called Cannon and XLR, and is not generally recogniced as XLR, which is the product range name. Naming of the first connector as Cannon is at least for me and many others confusing. This is a good example how vendor name for a connector type is not a good thing. The first connector is a circular MIL-STD connector (dont remember the correct notation), and this is a product available from ITT Cannon as well as AMP. Cheers, Magnus On 06/22/2017 08:42 PM, Mark Spencer wrote: , Sorry if I have caused any un due confusion thru my perhaps incorrect use of the terms cannon and XLR. , The green connector with 4 separate female contacts is what I perhaps in correctly referred to as a cannon connector. The silver connector with 3 separate female contacts was what I perhaps incorrectly referred to as a XLR connector. , , Both were in use in my lab powering time nuts gear. , , , , , , , , , , , , , , , Mark Spencer , , mark at alignedsolutions.com , , , , ...
A return pad cable connector, in accordance with the present disclosure, for use with a disposable return pad, includes a cord having a conductive wire disposed therethrough which conductive wire interconnects the return pad cable connector to an electrosurgical energy source. The return pad further includes a connector operatively coupled to the cord, the connector having a conductive surface which is selectively engageable with a corresponding conductive surface disposed on the return pad, the conductive surface of the connector including a conductive adhesive disposed thereon and a non-conductive adhesive disposed above the periphery of the conductive surface of the connector for engagement with a corresponding non-conductive adhesive disposed above the periphery of the conductive surface of the return pad. The connector can include a magnet for magnetically coupling the connector to the conductive surface disposed on the return pad.
4KZ2: Crystal structure of 3WJ core revealing divalent ion-promoted thermostability and assembly of the Phi29 hexameric motor pRNA.
The PowerMod HP (high power) series connector family features touch-safe female housings, cable strain relief, and integral positive latches. These safety features, combined with the ease of connector assembly, establish a new standard for cost effective high power connectors. The series is RoHS compliant and rated up to 450 amps for appropriate applications at a 30ºC temperature rise. Using the companys patented Sterling contact technology, the PowerMod HP offers low electrical resistance, provides a minimum of 500 mating cycles, and is rated for circuit interruption (true hotplug). These connectors are IP 20 rated (touch safe) for user safety. The integral coding key provides further protection by allowing the user to configure unique mating of up to six individual connectors ...
A connector terminal in a cardiac stimulator for receiving a connector pin of an associated lead includes a hollow box member having opposite end walls defining a first bore for receipt of the connector pin. A ring member movably disposed within the box member defines a second bore generally aligned with the first bore for also receiving the connector pin. A threaded neck connected to the ring member extends perpendicular to the second bore and is received within a through bore of the box member that is disposed perpendicular to the first bore. An internally threaded cap threadedly engages the threaded neck and bears in a thrust bearing relationship on the box portion. As the cap is rotated, the ring portion is drawn upwardly as the cap presses downwardly on the box portion, causing the second bore to be moved transversely out of alignment with the first bore. A connector pin received through both first and second bores is clamped therebetween and retained against axial withdrawal from the
It is a declared goal of the Connector pattern to establish a two-way independence between application and Collaboration. As a consequence, many changes in either part can be completely absorbed by just changing the connector. This is key for the maintainability of Connector-based architectures and relies on the fact, that also the Connector is a well defined, concise module. Given that a Connector contains no implementation (or only small chunks of glue-code), it lends itself to manipulation by tools other than typical source-code editors. The Object Teams Development Environment features a dedicated binding editor that provides an editable table of all class bindigs (playedBy) and method bindings (callout/callin) of a given team. An ideal Connector can be created an modified in a very efficient way using only this binding editor. ...
liquid tight conduit connector product listings on SeekPart.com - Choose quality liquid tight conduit connector products from large database of liquid tight conduit connector manufacturers and suppliers at SeekPart.com.
A tissue shaping device adapted to be disposed in a vessel near a patients heart to reshape the patients heart. The tissue shaping device includes a proximal anchor, a distal anchor, and a connector disposed between the proximal anchor and the distal anchor, the connector having a moment of inertia that varies along its length, such as by varying the connector thickness as a function of distance from one of its ends, with the smallest thickness being in the central portion of the connector.
Tighten connectors with a connector wrench. Choose from different types depending on your type of connector, from lock nuts to solar cable connectors.
How is UTP Medium Interface Connector abbreviated? U-MIC stands for UTP Medium Interface Connector. U-MIC is defined as UTP Medium Interface Connector very rarely.
Connector Mold Parts Suppliers ☆ Search 34 connector mold parts suppliers, manufacturers and exporters here at EC21 ☆ Choose quality connector mold parts suppliers now - EC21
Amphenol RJF Field Series connectors at PEI-Genesis. We have a large inventory of Amphenol connectors and can build RJF Field Series connectors to your specs.
Ive no experience running OpenJMS under GCJ, but the exception appears to be coming from the GCJ RMI implementation. You could work around this by using the TCP connector instead. -Tim ShashiKiran Kerur wrote: , , Hello, , I have installed Openjms in Linux and trying to look up connection , factory. , , Installed OPENJMS on Linux , , OpenJMS - openjms-0.7.7-alpha-2 , Linux - (Red Hat Enterprise Linux AS release 4 (Nahant Update 1) , , , openjms.xml , , ,ServerConfiguration host=host ip embeddedJNDI=true /, , , ,Connectors, , ,Connector scheme=tcp, , ,ConnectionFactories, , ,ConnectionFactory name=ConnectionFactory /, , ,/ConnectionFactories, , ,/Connector, , ,Connector scheme=rmi, , ,ConnectionFactories, , ,QueueConnectionFactory name=JmsQueueConnectionFactory /, , ,TopicConnectionFactory name=JmsTopicConnectionFactory /, , ,/ConnectionFactories, , ,/Connector, , ,/Connectors, , , , Client code to look up Connection Factory , import java.util.Hashtable; , import ...
This 041508SMRA Euro style LMI solid mold connector is available in 2 - 24 poles, and can handle high voltages. Each connector block has tiny space requirements.
0415DP Euro style dual pin connector is available in 2 - 3 poles and is able to handle high using large current levels. The connector is solidly constructed and has been rigorously tested.
Find USB Connectors on GlobalSpec by specifications. USB connectors are used with universal serial bus (USB) ports. They can be used to connect USB products together, or to connect USB wires and peripherals to other standard port types.
Latex-Free Extension Tubing with Connector has a plastic connector on one end and is constructed of a heavy gauge vinyl that provides security from leaking. | reviews page 2
Buy Lapp Multi Frame, MHB Series , For Use With Connectors 44423235. Browse our latest Heavy Duty Power Connector Accessories offers. Free Next Day Delivery available.
Buy RS PRO Straight Cable Mount F Connector, Plug, RG59 . Browse our latest Coaxial Connectors offers. Free Next Day Delivery available.
Something just fascinates me about connector hubs. We know they are diversely connected across the brains communities. However, I wanted a mechanistic understanding of their function, not just their topology. I also wanted to know if there is a general optimal network structure for cognitive processing that involves modularity and strong connector hubs. My two…
Instinox are highly acclaimed manufacturers of Monel Female Connector. Due to ready stock of tube fittings , we can provide fast delivery. Contact us.
Get AS014-97PB Standard Circular Connectors specs, pricing, inventory availability, and more from TE Connectivity. Get a sample or request a quote.
Property details for 2345 E West Connector in Austell, GA 30106-6812. This property is one of many commercial real estate listings on Showcase.com, the premier location to search space for rent or commercial property for sale.
USD 21.99 Only, Buy 20FT 4mm2 PV Solar Cable w/MC4 Connector One On Each Cable M/F Black with Worldwide Free Shipping for All Orders at Tmart.com.
The slip tee connector is an innovative push-fit fitting allowing pipe runs to be branched off an existing pipe run without effect to existing pipe setup.
Female Connector installation can be reduced by around 40% when compared to traditional fixing methods with 9/16 - 24 UNEF + 3/8 Compression Threads.
Connector systems with insulation displacement and crimp technology require suitable cables and accurate processing. In order to assure safe function of the connectors they must be processed with Lumberg harnessing equipment (series 97), according to Lumberg harnessing instructions, using cables approved by Lumberg. Do not hesitate to contact us if you have any questions!. The cables listed here have been tested in the laboratory and have been approved suitable for the specified connector type. Lumberg cannot assume warranty for possible modifications on the part of the cable manufacturer. It is the users responsibility to ensure the compatibility of the chosen components and their appropriateness for the intended application.. 02/2020. ...
Cant say whether this type of hardware always stays the same in all cases. Chances are, it varies depending on suppliers/sources. In any case, the USB pin configuration of both 10-pin connectors (of which only 9 are usable and 8 actually wired) and 5-pin connectors (of which only 4 are wired) is the same. The sequence is black-green-white-red --- with the red wire on the last pin. Just check the motherboard manual carefully and compare it to the connectors before plugging it in. Comparing against the plug from a back-panel USB expansion port may also be helpful (such devices come bundled with motherboards ...
Cant say whether this type of hardware always stays the same in all cases. Chances are, it varies depending on suppliers/sources. In any case, the USB pin configuration of both 10-pin connectors (of which only 9 are usable and 8 actually wired) and 5-pin connectors (of which only 4 are wired) is the same. The sequence is black-green-white-red --- with the red wire on the last pin. Just check the motherboard manual carefully and compare it to the connectors before plugging it in. Comparing against the plug from a back-panel USB expansion port may also be helpful (such devices come bundled with motherboards ...
The time interval n, in seconds, between the logged errors is equal to the number of seconds set in the X.400 Connector. To check this setting, open the property pages of the X.400 Connector, select the Override tab, in the Connection Retry Values frame, and read the Open Interval (sec) setting ...
Features - Six independent ports can be used simultaneously. - There are three different types of battery connectors per port - Six independent charging circuit
TY - JOUR. T1 - Models of bacteriophage DNA packaging motors. AU - Serwer, Philip. PY - 2003/3/1. Y1 - 2003/3/1. N2 - An ATP-dependent motor drives a DNA genome into a bacteriophage capsid during morphogenesis of double-stranded DNA bacteriophages both in vivo and in vitro. The DNA molecule enters the capsid through a channel in the center of a symmetric protein ring called a connector. Mechanisms in two classes have been proposed for this motor: (1) An ATP-driven rotating connector pulls a DNA molecule via serial power strokes. (2) The connector rectifies DNA motion that is either thermal, biased thermal, or oscillating electrical field-induced (motor-ratchet hypothesis). Mechanisms in the first class have previously been proposed to explain the detailed structure of DNA packaging motors. The present study demonstrates that the motor-ratchet hypothesis also explains the current data, including data in the following categories: biochemical genetics, energetics, structure, and packaging ...
Bacillus phage phi29 (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, Φ15, BS32, B103, M2Y (M2), Nf and GA-1.[1][2] These phages, which form part of the Podoviridae family, are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ...
4.4.3 Soil cleaning test. The test shall be conducted according to the solvent soil test method described in the appendix. The soil used in this evaluation is MIL-PRF-10924 grease. The acceptable limit for each type of solvent is defined in Table I.. 4.4.4 Total chlorine content. The total chlorine content of the solvent shall be determined by a gas chromatographic method, microcoulometric or by the use of a portable test kit for the quantitative analysis of chlorine (see 6.6). Nonconformance to Table I shall constitute failure of this test.. 5. PACKAGING. 5.1 Packaging. For acquisition purpose, the packaging requirements shall be as specified in the contract or order (see 6.2). When actual packaging of materiel is to be performed by DoD personnel, these personnel need to contact the responsible packaging activity to ascertain requisite packaging requirements. Packaging requirements are maintained by the Inventory Control Points packaging activity with the Military Department or Defense Agency, ...
Recently Added Phages. Bucket Hilltop Retreat Clive Merkle Recently Modified Phages. T3mpyL1t Chrisss Coars20 Aubrey Misaki Recently Finished Phages. Zirkle (None) Ilona (C1) Azalea (C1) Ampersand (C3) FreightTrain (C1) ...
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
Construction and Single molecule studies on phi29 DNA-packaging motor for applications in nanotechnology, therapy, diagnosis, and drug ...
The expression of genes from genomic loci can be relatively complex, utilizing exonic, intronic and flanking sequences to regulate tissue and developmental specificity. Infectious bacterial artificial chromosomes (iBACs) have been shown to deliver and express large genomic loci (up to 135 kb) into primary cells for functional analyses. The delivery of large genomic DNA inserts allows the expression of complex loci and of multiple splice variants. Herein, we demonstrate for the first time that an iBAC will deliver and correctly express in human glioma cells the entire CDKN2A/CDKN2B genomic region, which encodes for at least three important cell-cycle regulatory proteins (p16(INK4a), p14(ARF) and p15(INK4b)). Two of these proteins are expressed from overlapping genes, utilizing alternative splicing and promoter usage. The delivered locus expresses each gene at physiological levels and cellular responses (apoptosis versus growth arrest) occur dependent on cellular p53 status, as expected. The work further
Titering of Bacterial Viruses Related protocols: Preparation of Phage Stocks Commonly Used Media for Phage Growth Agar Overlay Technique When an individual bacterial virus grows in a bacterial host suspended in a top agar lawn, its progeny infect and lyse the surrounding host cells. This causes the appearance of a hole or plaque in…
documentclass{article} \usepackage{newtxtext,newtxmath} \usepackage{amsmath} \DeclareMathOperator{\sn}{sn} \DeclareMathOperator{\cn}{cn} \DeclareMathOperator{\dn}{dn} \begin{document} \begin{equation} \begin{gathered} \omega^3x_{4}(s) = \begin{minipage}[t]{.7\displaywidth} \raggedright\linespread{1.2}\selectfont \begin{math} x_4(\varphi_0) -2 \cos^3 ( \phi )sk^2 +2k^2x_1(\varphi_0) \cos^2( \phi ) +4 \cos^3 ( \phi )E ( s ) k^2+x_3(\varphi_0)\sin ( \phi ) s - \cos^3( \phi ){s}^2E( s ) +2 \cos^3 ( \phi )s ( E (s) ^2 +\cos ( \phi ) {s}^2E ( s ) - 2x_3(\varphi_0)\sin ( \phi ) E ( s ) -1/6\cos ( \phi ) {s}^3-4/3 \cos^3 ( \phi ) E ( s ) ^3 -1/2 x_1(\varphi_0) \cos^2 ( \phi ){s}^2-2 x_1(\varphi_0) \cos^2 ( \phi ) E ( s ) ^2 -2\cos ( \phi) s E ( s ) ^2 -2x_1(\varphi_0)sE( s ) + k\sin (\phi ) \cn(s) {s}^2 \cos^2( \phi ) +2 \cos^3 ( \phi )sk^2 \sn(s) ^2 -2/3\cos ( \phi) E ( s) +4/3k^3\cn(s) \sn(s) ^2\sin( \phi ) \cos^2 ( \phi )+2k\sin ( \phi ) \cn(s) +2/3\cos ( \phi ) s-8/3\cos ( \phi ) k^2\dn (s) \sn(s) ...
China Eight in Two Rows 8ports Degree90/180 Female BNC Connector, Find details about China BNC Connector PCB Mount, Female BNC Connector from Eight in Two Rows 8ports Degree90/180 Female BNC Connector - Renhotec Hardware Electronics Co., Ltd.
China Waterproof Straight Bulkhead Female BNC Connectors IP68, Find details about China BNC Connector, BNC Connectors IP68 from Waterproof Straight Bulkhead Female BNC Connectors IP68 - Renhotec Hardware Electronics Co., Ltd.
This collection of reviews focuses on the most exciting areas of DNA packaging at the current time. Many of the new discoveries are driven by the development of molecular or imaging techniques, and these are providing insights into the complex world of chromatin. As these new techniques continue to improve, we will be able to answer many of the questions we have now, while likely raising many new ones. ...
Buy Hollister Extension Tubing with Connector of HOLLISTER INCORPORATED. On Sale Urinary Tubing and Connectors products. Hollister Extension Tubing with Connector effectively manages high flow with wide-bore tubing. Security and safety are achieved by the non-kink tubing. Easy to adapt the leng...
faucet connector hose product listings on SeekPart.com - Choose quality faucet connector hose products from large database of faucet connector hose manufacturers and suppliers at SeekPart.com.
A spinal fixation system includes a first clip body having a pair of opposed spaced apart arcuate rod engaging hooks depending from a first side thereof for engaging a first elongated spinal rod, and a transverse connector extending laterally from a second side thereof; a second clip body having a pair of opposed spaced apart arcuate rod engaging hooks depending from a first side thereof for engaging a second elongated spinal rod, and a transverse connector extending laterally from a second side thereof; and a fastener for securing the transverse connector of the first elongated clip body and the transverse connector of the second elongated clip body to one another.
China Test Connector manufacturers - Select 2018 high quality Test Connector products in best price from certified Chinese L Connector manufacturers, D Connector suppliers, wholesalers and factory on Made-in-China.com
Barbed Tubing Connectors, Reduction Coupler - HDPE Connectors, Welch - Model 3551K-04 : Chemical-resistant HDPE and Kynar PVDF tubing connectors for
Robokits India Cable Drag Chain Wire Carrier with end connectors 15x20mm 1Meter [RKI-2652] - 15mm x 20mm L1000mm Cable Drag Chain Wire Carrier with end connectors for CNC Router Machine Tools, comes with a 2Pcs Connector (In the drag chains both ends).
Find information for part 08690940 from the Connectors Series Connectors, or search for Other Products and Accessories and more from Littelfuse.
How we see things around us without noticing it! We know the peculiar habit of the sunflower. How it moves with the movement of the sun everyday. But if
30AWG Connector Contacts product list at Newark element14. Competitive prices from the leading 30AWG Connector Contacts distributor. Check our stock now!
CENTRONICS |b|50|/b| POSITIONS|br /||b|FEMALE IDC|/b||br /|MINIATURE RIBBON CONNECTOR|br /|METAL FRONT SHELL|br /|STRAIN RELIEF|br /|SPRING LATCHES|br /|TERMINATES TO .050|br /|FLAT RIBBON CABLE|!--idc connectors --|
Ani.Solar: 1Pair Mc4 Flex Adaptor Cable Y Branch Connector 1F2M 1M2F For Solar … #7732-Ethan Solar Circuit Breakers and more. 1Pair Mc4 Flex Adaptor Cable Y Branch Connector 1F2M 1M2F For Solar … #7732-Ethan - Sun Energy - everything Solar and worldwide shipping at Ani.Solar.
Acetate resin connector link from Zola Elements. This U-shaped (semi-circle) connector features a hole on each end. Mix with other jewelry making components to create a timeless vintage look. Great for use as a pendant link or as a piece for chandelier earrings. Color: Lagoon (pearlescent green, blue, translucent cream
Buy AMP - TE CONNECTIVITY 1761014-1 online at Newark element14. Buy your 1761014-1 from an authorized AMP - TE CONNECTIVITY distributor.
# Intelligent charger (manufacture part#H01680015-US-1) designed for 14.8V (4 cell pack , so called 14.4V) Li-Ion Battery packs that use 2 pins connector. # Worldwide input AC power from 110V --- 240V. # Included one Connector Adaptor: from 2 pins Female Universal to Clip. # 1500 mA (1.5A ) constant charging current for faster charging, save your much more time. # Charging time for 4000mAh battery pack is about 2.6 Hrs. ( Please use it to charge Li-Ion battery with capacity > 1500mAh)
A universal connector for a blood tubing set having a blood tube attached to one end portion and alternative means on the other end portion of said connector for selectively connecting and locking to
Screw Connector Tool from PerkinElmer. An essential option from our full range of Connectors for FIAS 100 from our high quality Atomic Absorption (AA) line.
New and Refurbished Dental Equipment at Affordable Prices 6 Pin Swivel Connector (ISO-C) Multiflex™ [VKS6] - 6 Pin Swivel Connector ISO-C 6 pin swivel with bulb.
Überblick Eukaryonten haben im Vergleich zu Prokaryonten größere Genome. Um ihr Genom in einer Zelle zu speichern, müssen Eukaryonten ihre DNA...
The price of 16mm to 16mm Clamp Single Diaphragm Tight Motor Shaft Connector Coupling Joint is fair while it is also of high value. You can find whatever in you mind at a low price with free shipping at sourcingmap.
VWR Tapered Connectors and Quick Disconnects, Quick Disconnect - Model 82017-980 : Polypropylene and Polyethylene Construction Four Configurations
The Aras Office Connector provides a convenient way to manage Microsoft Office documents in Aras, directly from the user interface of the Office applications.
The Aras Office Connector provides a convenient way to manage Microsoft Office documents in Aras, directly from the user interface of the Office applications.
Help us envision key elements necessary to bring The Promise of Urban Connectors in Pioneer Square into reality to further enhance the experience of Seattles Central Waterfront and neighboring communities. Belltown and Pike Place Market/West Edge areas will be discussed in upcoming sessions ...
Buy 70 Pcs Non-Insulated Test Electrical Alligator Clip Clamp Connector from sourcingmap,you can get reasonable price and fast response worldwide. Please be assured all the products here are quality garanteed.
The Anritsu Calibration kits contain all the precision components and tools required to calibrate your VNA or VNMS for 12-term error-corrected measurements in the connector style of your choice. Components are included for calibrating male and femal
Leading Manufacturer of High Pressure Quick Connectors (Quick Couplings) for all industries as well as CNG & Hydrogen Refuelling Components. Highest quality and safety, worldwide distributors
The type species, Bacillus phage SPbeta, has been fully sequenced. It has about 134k nucleotides, with 185 proteins. The ... There is currently only one species in this genus: the type species Bacillus virus SPbeta. Spbetaviruses are nonenveloped, with ... May 2015). "Renaming of all phage genera" (PDF). International Committee on Taxonomy of Viruses. Retrieved 17 September 2019. ...
ISBN 978-0-199-73438-2. Woese, C. R. (1960). "Phage induction in germinating spores of Bacillus megaterium". Radiation Research ...
"A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus". Mol Microbiol. 63 (#4): ... Howard-Jones N (1973). "Was Kitasato Shibasaburō the discoverer of the plague bacillus?". Perspect Biol Med. 16 (#2): 292-307. ...
Bacillus phage SP8 was assigned to the family Myoviridae in 1995. Bacillus phage SPO1 was assigned to the genus SPO1-like ... Caudovirales in 1998 SPO1-like phages were renamed SPO1-like viruses in 1999 Bacillus phage SP8 was merged into Bacillus phage ... There is currently only one species in this genus: the type species Bacillus phage SPO1. Group: dsDNA Order: Caudovirales ... Okubovirus Bacillus virus Camphawk Bacillus virus SPO1 Viruses in Okubovirus are non-enveloped, with head-tail geometries, and ...
Purification and properties of an enzyme found after infection of Bacillus subtilis with phage SP5C". J. Biol. Chem. 241 (21): ...
Tomita F, Takahashi I (1969). "A novel enzyme, dCTP deaminase, found in Bacillus subtilis infected with phage PBS I". Biochim. ...
... gene 14 of Bacillus subtilis phage phi 29 encodes the functional homolog of lambda S protein". Journal of Bacteriology. 175 (4 ... The phage φ29 gene 14 encodes the protein GP14 (TC# 1.E.10.1.1) which is required for phage φ29-promoted host cell lysis. When ... It is identical to the phage PZA lysis protein and nearly identical to the phage B103 lysis protein. It is 34% identical to the ... gene 14 of Bacillus subtilis phage phi 29 encodes the functional homolog of lambda S protein". Journal of Bacteriology. 175 (4 ...
Vlcek C, Paces V (1986). "Nucleotide sequence of the late region of Bacillus phage Φ29 completes the 19,285-bp sequence of Φ29 ... This was demonstrated by the ability of the enzyme to continue to copy the singly primed circular genome of the M13 phage more ... Blanco L, Bernad A, Lázaro JM, Martín G, Garmendia C, Salas M (May 1989). "Highly efficient DNA synthesis by the phage Φ29 DNA ... Pérez-Arnaiz P, Longás E, Villar L, Lázaro JM, Salas M, de Vega M (2007). "Involvement of phage phi29 DNA polymerase and ...
Phage GA-1 neck appendage CIMCD self-cleaving protein (Bacillus phage GA-1) ...
"Purification and characterization of two phage PBSX-induced lytic enzymes of Bacillus subtilis 168: an N-acetylmuramoyl-L- ... Autolysins and some phage lysins are examples of N-acetylmuramoyl-L-alanine amidases. Phage lysins Autolysins PGLYRP2 Campbell ... Herbold DR, Glaser L (1975). "Bacillus subtilis N-acetylmuramic acid L-alanine amidase". J. Biol. Chem. 250 (5): 1676-82. PMID ...
System validation uses non-pathogenic surrogates such as MS 2 phage or Bacillus subtilis to determine the Reduction Equivalent ...
... and the Bacillus phage SPO1 transcription factor, TF1". Nucleic Acids Research. 21 (6): 1496. doi:10.1093/nar/21.6.1496. PMC ... IHF was discovered as a necessary co-factor for recombination of λ phage into E.coli. In 2016 it was discovered that IHF also ...
... as seen with the prohead of Bacillus subtilis phage φ29. Catalano, C. E.; Cue, D.; Feiss, M. (1995). "Virus DNA packaging: the ... strategy used by phage λ". Molecular Microbiology. 16 (6): 1075-1086. doi:10.1111/j.1365-2958.1995.tb02333.x. Murialdo, H.; ...
A skipping-rope RNA was also found in a purified phage, specifically the phage Bacillus phage SPbeta, which infects Bacillus ... Therefore, skipping-rope RNAs likely function, at least sometimes, to perform a function useful to phages. skipping-rope RNAs ...
... and MS2 phages, but Bacillus cereus spores required four minutes. After some fires were caused by people trying to replicate ...
Examples Bacillus phage AP50 Bacillus phage Bam35 Enterobacteria phage PRD1 Two additional genera - Deltatectivirus and ... homologues of the Rz/Rz1 proteins of phage lambda). Tectiviruses have been classified into three major groups: (1) phages that ... WheeHeim and Rhodococcus phage Toil) infecting Actinobacteria hosts. San Martín, C; Huiskonen, JT; Bamford, JK; Butcher, SJ; ... Epsilontectivirus - have been created for a number of phages and await ICTV ratification (Forthebois, ...
They were studying communication in Bacillus subtilis bacteria - in particular, how bacteria infected with phages warn nearby ... the pathogenic species Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis. They speculate that "the occurrence of ... Many phages, known as temperate phages, when they infect a bacterium, may enter either the lytic or the lysogenic pathway. The ... It is six amino acids long, and is produced when a phage infects a bacterial host. It signals to other phages that a host has ...
These phages, which form part of the Podoviridae family, are the smallest Bacillus phages isolated to date and are among the ... Bacillus virus phi29 (Φ29 phage) is a species of virus that belongs to the bacteriophage order Caudovirales which also includes ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... CS1 maint: discouraged parameter (link) Meijer, W. J. J.; Horcajadas, J. A.; Salas, M. (1 June 2001). "phi29 Family of Phages ...
... is a bacteriophage (phage) that infects Bacillus bacteria. The phage has been reported to have the largest ... European Nucleotide Archive: Bacillus phage G v t e. ... "Evolutionarily conserved orthologous families in phages are ...
Gillis, Annika; Mahillon, Jacques (9 July 2014). "Phages Preying on Bacillus anthracis, Bacillus cereus, and Bacillus ... A Bacillus phage is a member of a group of bacteriophages known to have bacteria in the genus Bacillus as host species. These ... The DNA polymerase of Bacillus phage phi29 is a unique and efficient polymerase with proofreading activity. ... Blanco, L; Salas, M (September 1984). "Characterization and purification of a phage phi 29-encoded DNA polymerase required for ...
... (formerly Phage AP50) is a species of bacteriophage that infects Bacillus anthracis bacteria. Originally ... Nagy, E.; Pragai, B.; Ivanovics, G. (1 July 1976). "Characteristics of Phage AP50, an RNA Phage Containing Phospholipids". ... "Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity". ... thought to be an RNA phage, it contains a DNA genome of about 14,000 base pairs in an icosahedral capsid with a two-layer ...
Kamei K, Hara S, Ikenaka T, Murao S (November 1988). "Amino acid sequence of a lysozyme (B-enzyme) from Bacillus subtilis YT-25 ... There are at least five different classes of lysozymes: C (chicken type), G (goose type), phage-type (T4), fungi (Chalaropsis ... and bacterial (Bacillus subtilis). There are few similarities in the sequences of the different types of lysozymes. Lysozyme ...
... coli and MS2 phages. Bacillus cereus spores were killed at four minutes of microwaving. A 2017 study was less affirmative: ...
... (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, ... are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Bacillus_phage_phi29&oldid=841433724" ...
An invisible microbe that is antagonistic to the dysentery bacillus]. Comptes Rendus (in French). 165: 373-75. Shasha SM, ... Viruses portal Antimicrobial resistance Phage display Phage monographs Phagoburn Prophage "Silent Killers: Fantastic Phages?". ... Bacteriophages, known as phages, are a form of viruses. Phages attach to bacterial cells, and inject a viral genome into the ... Phages are often compared to antibiotics. Phages tend to be more successful than antibiotics where there is a biofilm covered ...
This method was used to evolve Bacillus thuringiensis endotoxin variants that can overcome insect toxin resistance. PACE was ... Phage replication requires E. coli infection, which, for M13 phage, relies on protein III (pIII). When using PACE, the phage ... Phage-assisted continuous evolution (PACE) is a phage-based technique for the automated directed evolution of proteins. It ... Proteins with greater desired activity hence confer greater infectivity to their carrier phage. More infectious phage propagate ...
... is a bacteriophage that infects the spore-forming bacterium Bacillus cereus. Though this lytic phage is a ... Kong, M; Kim, M; Ryu, S (June 2012). "Complete Genome Sequence of Bacillus cereus Bacteriophage PBC1". Journal of Virology. 86 ... member of Siphoviridae, its genome sequence shows little similarity to those of other sequenced phages. ...
Talk:Bacillus phage AP50. *Talk:Bacillus phage G. *Talk:Bacteriophage f2. *Talk:Bacteriophage Mu ...
Since bacteria become resistant against a single phage, d'Herelle suggested using "phage cocktails" containing different phage ... Independently, the discovery of "an invisible, antagonistic microbe of the dysentery bacillus" by d'Herelle was announced on 3 ... D'Hérelle's main legacy lies in the use of phage in the molecular revolution in biology. Max Delbrück and the "phage group" ... Production problems were most likely due to the attempt to mass-produce phages when they were barely understood. The phages may ...
To test their hardiness on a hypothetical mission to Mars, spores of Bacillus subtilis 168 and Bacillus pumilus SAFR-032 were ... study of space environment effect on T7 phage, its DNA and of polycristalline uracil. IMBP (Institute of Biomedical Problems), ... The mutagenic efficiency of space was also studied in spores of Bacillus subtilis 168. The data show the unique mutagenic power ... ADAPT Bacterial endospores of the highly UV-resistant Bacillus subtilis strain MW01 were exposed to low-Earth orbit and ...
Bacillus phage phi29 (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, ... are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Bacillus_phage_phi29&oldid=841433724" ...
Gillis, Annika; Mahillon, Jacques (9 July 2014). "Phages Preying on Bacillus anthracis, Bacillus cereus, and Bacillus ... A Bacillus phage is a member of a group of bacteriophages known to have bacteria in the genus Bacillus as host species. These ... The DNA polymerase of Bacillus phage phi29 is a unique and efficient polymerase with proofreading activity. ... Blanco, L; Salas, M (September 1984). "Characterization and purification of a phage phi 29-encoded DNA polymerase required for ...
Bacillus phage AP50 (formerly Phage AP50) is a species of bacteriophage that infects Bacillus anthracis bacteria. Originally ... Nagy, E.; Pragai, B.; Ivanovics, G. (1 July 1976). "Characteristics of Phage AP50, an RNA Phage Containing Phospholipids". ... "Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity". ... thought to be an RNA phage, it contains a DNA genome of about 14,000 base pairs in an icosahedral capsid with a two-layer ...
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
Phage Bam35 is an icosahedron of about 63 nm in diameter. It has a double capsid with spikes at the vertices, and a tail which ... Partial characterization of a cubic Bacillus phage. Can. J. Microbiol. 24: 986--993. ... The phage contains DNA and, probably, lipids which seem to be located in the inner coat. The phage is Bacillus-specific, UV- ... Partial characterization of a cubic Bacillus phage. Can. J. Microbiol. 24: 986--993. Phage Bam35 is an icosahedron of about 63 ...
Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). Bacillus phage CP-51. Bacillus phage JL. Bacillus phage ... Bacillus phage vB_BsuM-Goe2. Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). 99. UniRef100_P04445. Cluster: ... Bacillus phage vB_BsuM-Goe2. Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). 99. UniRef90_P04445. Cluster: ... sp,P04445,TF1_BPSP1 Transcription factor 1 OS=Bacillus phage SP01 OX=10685 GN=TF1 PE=1 SV=1 ...
The specific virus-host interactions that allow phages to redirect cellular machineries and energy resources to support the ... Global Transcriptional Analysis of Virus-Host Interactions between Phage ϕ29 and Bacillus subtilis J Virol. 2016 Sep 29;90(20): ... Here, we analyze genome-wide interactions of Bacillus subtilis and its lytic phage ϕ29 during the early stage of infection. ... an insight into the genome-wide transcriptional response of the Gram-positive model Bacillus subtilis to phage ϕ29 infection. ...
A CRISPR-Cas9 tool to explore the genetics of Bacillus subtilis phages. Otte K, Kuhne NM, Furrer AD, Baena Lozada LP, Lutz VT, ...
Phage 29 phi protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis.. ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ...
Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning.. R Ahmed, P Sankar-Mistry, S Jackson, H ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ...
The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis ... PBSX and skin are two unusual genetic elements resident on the Bacillus subtilis chromosome. PBSX is a phage-like element ... However two non-phage-like operons in the skin element are expressed and have distinct expression profiles that are dependent ... The phage particles contain bacterial chromosomal DNA and kill sensitive bacteria without injecting DNA. The skin element is ...
Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ...
... a phage-like-particle (approx. 22 nm in diameter) specifically found in stage II sporulating cells of B. medusa and initially ... An improved purification enabled the phage-like-particles (PLP) close to homogenous to be isolated. Electron microscopic ... were subsequently found in Bacillus thuringiensis subsp. israelensis (serotype 14), B. thuringiensis subsp. kyushuensis ( ... A Group Of Phage-like-particles In Three Subspecies Of Bacillus Thuringiensis And Bacillus Medusa ...
The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis ... Krogh, S, OReilly, M, Nolan, N, Devine, KM, The phage-like element PBSX and part of the skin element, which are resident at ... different locations on the Bacillus subtilis chromosome, are highly homologous, MICROBIOLOGY-UK, 142, 1996, 2031-2040 ...
The only known relative of this phage is a string of phage-like genes called BtI1 in the chromosome of B. thuringiensis ... The high degree of divergence and novelty of phage genomes pose challenges in how to describe the phage from its genomic ... Phage 0305φ8-36 and BtI1 are estimated to have diverged 2.0 - 2.5 billion years ago. Positionally biased Blast searches aligned ... A conserved long tape measure gene indicates that a long tail is an evolutionarily stable property of this phage lineage. An ...
... is also present on the two citG transducing phages described. The cloned regions in these two phages include EcoRI-generated ... gene of Bacillus subtilis have been detected by complementation of an Escherichia coli fumarase mutation in lysogen-filled ... The Isolation Of λ; Transducing Phages Carrying the citG and gerA Genes Of Bacillus Subtilis * Anne Moir ... is also present on the two citG transducing phages described. The cloned regions in these two phages include EcoRI-generated ...
10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New Phage Lineage and Characterization of Its ... This phage is the first tadpole-like phage infecting the Bacillus strains. Genomic analysis shows that the phage genome is ... 10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New Phage Lineage and Characterization of Its ... Phylogenetic analysis revealed that the phage was distant from the other Bacillus phages in terms of evolution. The novel ...
Recently Added Phages. Bucket Hilltop Retreat Clive Merkle Recently Modified Phages. T3mpyL1t Chrisss Coars20 Aubrey Misaki Recently Finished Phages. Zirkle (None) Ilona (C1) Azalea (C1) Ampersand (C3) FreightTrain (C1) ...
Local Phage BLAST. This tool will run a local BLAST search against our phage database. This will include some genomes that are ... Bacillus phage Azalea complete sequence, 161765 bp including 2452 bp terminal repeat ...
... abrogates its binding activity specific to the cell wall of Bacillus anthracis. Whether short synthetic peptides representing ... Furthermore, by using B. anthracis (Sterne, 34F2), an animal vaccine and B. cereus-4342, a γ-phage susceptible rare strain as ... phage lysin protein (PlyG) have demonstrated that removal of a short amino acid sequence in the C-terminal region encompassing ... The Bacillus cereus strain (RSVF1 strain 4342), Bacillus cereus ATCC 11778, Bacillus cereus ATCC10876, and Bacillus ...
Semantic Scholar is a free, AI-powered research tool for scientific literature, based at the Allen Institute for AI.. Learn More → ...
Bacillus phage Gamma a.link {text-decoration: none;color: white;} Viruses -> Viruses noname -> Viruses noname -> Caudovirales ... Siphoviridae -> Siphoviridae noname -> Bacillus phage Gamma article { width: 25%; } - Optimal pH - Optimal Temerature - ...
Genome Sequence of Bacillus cereus Group Phage SalinJah. Ivan Erill, Steven M. Caruso on behalf of the 2015 UMBC Phage Hunters ... Genome Sequence of Bacillus cereus Group Phage SalinJah. Ivan Erill, Steven M. Caruso on behalf of the 2015 UMBC Phage Hunters ... information about SalinJah and other Bacillus phages isolated by undergraduate researchers can be found on the Bacillus phages ... and phylogenetic analysis identified Bacillus phage Helga (see BPDB) as the most similar previously sequenced phage, with an ...
These findings provide guidance for documentation of ARG in viromes, and reassert that ARGs are rarely encoded in phages. ... Here we used exploratory and conservative bioinformatic strategies found in the literature to detect ARGs in phage genomes, and ... ARG abundances in 1181 phage genomes were vastly overestimated using exploratory thresholds (421 predicted vs 2 known), due to ... However, recent viral metagenome (virome) analyses suggest that ARGs are frequently carried by phages, which is inconsistent ...
Bacillus phage SPbeta (Bacillus phage SPBc2). Loading... P36549 Uncharacterized 9.7 kDa protein in cwlL 5region. Bacillus ...
Bacillus phage phi29. Loading... P07535 Portal protein. Bacillus phage PZA. Loading... Q37891 Portal protein. Bacillus phage ...
Combining Genes from Multiple Phages for Improved Cell Lysis and DNA Transfer from Escherichia coli to Bacillus subtilis ... Combining Genes from Multiple Phages for Improved Cell Lysis and DNA Transfer from Escherichia coli to Bacillus subtilis. ... Combining Genes from Multiple Phages for Improved Cell Lysis and DNA Transfer from Escherichia coli to Bacillus subtilis. Plos ... such as Escherichia coli and Bacillus subtilis, constitutes one of the major hurdles of the rational genome engineering. Using ...
Bacillus subtilis phage ø 105. Garro and Phillips 1980. Sex-linked recessive lethal mutation. Drosophila melanogaster. Hardin ... Garro AJ, Phillips RA [1980]. Detection of mutagen-induced lesions in isolated DNA by marker rescue of Bacillus subtilis phage ... Bacillus subtilis. Phillips et al. 1980 Bootman et al. 1979. Forward mutation. Schizosaccharomyces pombe. Migliore et al. 1982 ... Phillips RA, Zahler SA, Garro AJ [1980]. Detection of mutagen-induced lesions in isolated DNA using a new Bacillus subtilis ...
Shop for phage Mathematical Art in the Shapeways 3D printing marketplace. Find unique gifts and other personal designs in ...

No FAQ available that match "bacillus phages"