Viruses whose host is Bacillus. Frequently encountered Bacillus phages include bacteriophage phi 29 and bacteriophage phi 105.
Viruses whose hosts are bacterial cells.
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
A species of gram-positive bacteria that is a common soil and water saprophyte.
A species of rod-shaped bacteria that is a common soil saprophyte. Its spores are widespread and multiplication has been observed chiefly in foods. Contamination may lead to food poisoning.
A species of bacteria that causes ANTHRAX in humans and animals.
A species of gram-positive bacteria which may be pathogenic for certain insects. It is used for the biological control of the Gypsy moth.
A species of bacteria whose spores vary from round to elongate. It is a common soil saprophyte.
Viruses whose host is Salmonella. A frequently encountered Salmonella phage is BACTERIOPHAGE P22.
Heat and stain resistant, metabolically inactive bodies formed within the vegetative cells of bacteria of the genera Bacillus and Clostridium.
Viruses whose host is Pseudomonas. A frequently encountered Pseudomonas phage is BACTERIOPHAGE PHI 6.
Proteins found in any species of bacterium.
The phenomenon by which a temperate phage incorporates itself into the DNA of a bacterial host, establishing a kind of symbiotic relation between PROPHAGE and bacterium which results in the perpetuation of the prophage in all the descendants of the bacterium. Upon induction (VIRUS ACTIVATION) by various agents, such as ultraviolet radiation, the phage is released, which then becomes virulent and lyses the bacterium.
Viruses whose host is Streptococcus.
Bacteriophages whose genetic material is RNA, which is single-stranded in all except the Pseudomonas phage phi 6 (BACTERIOPHAGE PHI 6). All RNA phages infect their host bacteria via the host's surface pili. Some frequently encountered RNA phages are: BF23, F2, R17, fr, PhiCb5, PhiCb12r, PhiCb8r, PhiCb23r, 7s, PP7, Q beta phage, MS2 phage, and BACTERIOPHAGE PHI 6.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A collection of cloned peptides, or chemically synthesized peptides, frequently consisting of all possible combinations of amino acids making up an n-amino acid peptide.
Viruses whose host is Escherichia coli.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The functional hereditary units of BACTERIA.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A technique of bacterial typing which differentiates between bacteria or strains of bacteria by their susceptibility to one or more bacteriophages.
A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by long, non-contractile tails.
A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by complex contractile tails.
A temperate inducible phage and type species of the genus lambda-like viruses, in the family SIPHOVIRIDAE. Its natural host is E. coli K12. Its VIRION contains linear double-stranded DNA with single-stranded 12-base 5' sticky ends. The DNA circularizes on infection.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
An acute infection caused by the spore-forming bacteria BACILLUS ANTHRACIS. It commonly affects hoofed animals such as sheep and goats. Infection in humans often involves the skin (cutaneous anthrax), the lungs (inhalation anthrax), or the gastrointestinal tract. Anthrax is not contagious and can be treated with antibiotics.
A genus of filamentous bacteriophages of the family INOVIRIDAE. Organisms of this genus infect enterobacteria, PSEUDOMONAS; VIBRIO; and XANTHOMONAS.
Rupture of bacterial cells due to mechanical force, chemical action, or the lytic growth of BACTERIOPHAGES.
Proteins from BACTERIA and FUNGI that are soluble enough to be secreted to target ERYTHROCYTES and insert into the membrane to form beta-barrel pores. Biosynthesis may be regulated by HEMOLYSIN FACTORS.
The reproductive elements of lower organisms, such as BACTERIA; FUNGI; and cryptogamic plants.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
A family of bacteriophages which are characterized by short, non-contractile tails.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Virulent bacteriophage and type species of the genus T4-like phages, in the family MYOVIRIDAE. It infects E. coli and is the best known of the T-even phages. Its virion contains linear double-stranded DNA, terminally redundant and circularly permuted.
Adaptive antiviral defense mechanisms, in archaea and bacteria, based on DNA repeat arrays called CLUSTERED REGULARLY INTERSPACED SHORT PALINDROMIC REPEATS (CRISPR elements) that function in conjunction with CRISPR-ASSOCIATED PROTEINS (Cas proteins). Several types have been distinguished, including Type I, Type II, and Type III, based on signature motifs of CRISPR-ASSOCIATED PROTEINS.
Protein components of the CRISPR-CAS SYSTEMS for anti-viral defense in ARCHAEA and BACTERIA. These are proteins that carry out a variety of functions during the creation and expansion of the CRISPR ARRAYS, the capture of new CRISPR SPACERS, biogenesis of SMALL INTERFERING RNA (CRISPR or crRNAs), and the targeting and silencing of invading viruses and plasmids. They include DNA HELICASES; RNA-BINDING PROTEINS; ENDONUCLEASES; and RNA and DNA POLYMERASES.
Repetitive nucleic acid sequences that are principal components of the archaeal and bacterial CRISPR-CAS SYSTEMS, which function as adaptive antiviral defense systems.
Messages between computer users via COMPUTER COMMUNICATION NETWORKS. This feature duplicates most of the features of paper mail, such as forwarding, multiple copies, and attachments of images and other file types, but with a speed advantage. The term also refers to an individual message sent in this way.
The study of microorganisms such as fungi, bacteria, algae, archaea, and viruses.
Sudden increase in the incidence of a disease. The concept includes EPIDEMICS and PANDEMICS.
Techniques used in microbiology.
A publication issued at stated, more or less regular, intervals.
A quantitative measure of the frequency on average with which articles in a journal have been cited in a given period of time.
A family of gram-negative, facultatively anaerobic, rod-shaped bacteria that do not form endospores. Its organisms are distributed worldwide with some being saprophytes and others being plant and animal parasites. Many species are of considerable economic importance due to their pathogenic effects on agriculture and livestock.
A group of antibiotics that contain 6-aminopenicillanic acid with a side chain attached to the 6-amino group. The penicillin nucleus is the chief structural requirement for biological activity. The side-chain structure determines many of the antibacterial and pharmacological characteristics. (Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed, p1065)
A penicillin derivative commonly used in the form of its sodium or potassium salts in the treatment of a variety of infections. It is effective against most gram-positive bacteria and against gram-negative cocci. It has also been used as an experimental convulsant because of its actions on GAMMA-AMINOBUTYRIC ACID mediated synaptic transmission.
A broad-spectrum penicillin antibiotic used orally in the treatment of mild to moderate infections by susceptible gram-positive organisms.
The total process by which organisms produce offspring. (Stedman, 25th ed)

Genetic and physical maps of the Bacillus subtilis chromosome. (1/348)

Sequencing of the complete Bacillus subtilis chromosome revealed the presence of approximately 4100 genes, 1000 of which were previously identified and mapped by classical genetic crosses. Comparison of these experimentally determined positions to those derived from the nucleotide sequence showed discrepancies reaching up to 24 degrees (approximately 280 kb). The size of these discrepancies as a function of their position along the chromosome is not random but, apparently, reveals some periodicity. Our analyses demonstrate that the discrepancies can be accounted for by inaccurate positioning of the early reference markers with respect to which all subsequently identified loci were mapped by transduction and transformation. We conclude (i) that specific DNA sequences, such as recombination hotspots or presence of heterologous DNA, had no detectable effect on the results obtained by classical mapping, and (ii) that PBS1 transduction appears to be an accurate and unbiased mapping method in B. subtilis.  (+info)

Selection of antibody probes to correlate protein sequence domains with their structural distribution. (2/348)

We propose a new approach that permits correlation of specific domains defined by their primary sequence with their location in the structure of complex macromolecular aggregates. It is based on the combination of well-established structural analysis methods that incorporate the use of overlapping peptides on cellulose membranes for the isolation and purification of specific antibodies from a polyclonal antiserum. Monospecific antibodies to the connector protein of bacteriophage phi29 were isolated from polyclonal antisera using a new development of the spotscan method. These antibodies can be purified in quantities that allow antigenicity testing in enzyme-linked immunosorbent assays, Western blotting and immunoprecipitations, demonstrating the specificity of this isolation procedure. This approach has allowed us to generate direct antibody probes for immunoelectron microscopy mapping of different connector protein domains in a low resolution three-dimensional epitope map.  (+info)

Virus assembly: Imaging a molecular machine. (3/348)

A recent structural study of a double-stranded DNA bacteriophage has provided remarkable new insights into the assembly of a complex virus particle and ushers in a new era in the imaging of non-icosahedral viruses.  (+info)

Nucleotide sequence of the Bacillus subtilis temperate bacteriophage SPbetac2. (4/348)

The Bacillus subtilis 168 chromosomal region extending from 184 degrees to 195 degrees, corresponding to prophage SPbeta, has been completely sequenced using DNA of the thermoinducible SPbetac2 mutant. This 134416 bp segment comprises 187 putative ORFs which, according to their orientation, were grouped into three clusters. Compared to its host, SPbetac2 is characterized by a lower G+C content, shorter mean ORF length, as well as a different usage of start codons. Nearly 75% of predicted ORFs do not share significant homologies to sequences in available databases. The only highly similar proteins to SPbetac2-encoded ones are host paralogues. SPbetac2 promoter regions contain SOS box consensus sequences and a repeated motif, designated SPbeta repeated element (SPBRE), that is absent from the host genome. Gene sspC, encoding the small acid-soluble protein C, that has been previously sequenced and mapped to the vicinity of the SPbeta region, was found to be part of the prophage.  (+info)

Sequence requirement for hand-in-hand interaction in formation of RNA dimers and hexamers to gear phi29 DNA translocation motor. (5/348)

Translocation of DNA or RNA is a ubiquitous phenomenon. One intricate translocation process is viral DNA packaging. During maturation, the lengthy genome of dsDNA viruses is translocated with remarkable velocity into a limited space within the procapsid. We have revealed that phi29 DNA packaging is accomplished by a mechanism similar to driving a bolt with a hex nut, which consists of six DNA-packaging pRNAs. Four bases in each of the two pRNA loops are involved in RNA/RNA interactions to form a hexagonal complex that gears the DNA translocating machine. Without considering the tertiary interaction, in some cases only two G/C pairs between the interacting loops could provide certain pRNAs with activity. When all four bases were paired, at least one G/C pair was required for DNA packaging. The maximum number of base pairings between the two loops to allow pRNA to retain wild-type activity was five, whereas the minimum number was five for one loop and three for the other. The findings were supported by phylogenetic analysis of seven pRNAs from different phages. A 75-base RNA segment, bases 23-97, was able to form dimer, to interlock into the hexamer, to compete with full-length pRNA for procapsid binding, and therefore to inhibit phi29 assembly in vitro. Our result suggests that segment 23-97 is a self-folded, independent domain involved in procapsid binding and RNA/RNA interaction in dimer and hexamer formation, whereas bases 1-22 and 98-120 are involved in DNA translocation but dispensable for RNA/RNA interaction. Therefore, this 75-base RNA could be a model for structural studies in RNA dimerization.  (+info)

Replication slippage of different DNA polymerases is inversely related to their strand displacement efficiency. (6/348)

Replication slippage is a particular type of error caused by DNA polymerases believed to occur both in bacterial and eukaryotic cells. Previous studies have shown that deletion events can occur in Escherichia coli by replication slippage between short duplications and that the main E. coli polymerase, DNA polymerase III holoenzyme is prone to such slippage. In this work, we present evidence that the two other DNA polymerases of E. coli, DNA polymerase I and DNA polymerase II, as well as polymerases of two phages, T4 (T4 pol) and T7 (T7 pol), undergo slippage in vitro, whereas DNA polymerase from another phage, Phi29, does not. Furthermore, we have measured the strand displacement activity of the different polymerases tested for slippage in the absence and in the presence of the E. coli single-stranded DNA-binding protein (SSB), and we show that: (i) polymerases having a strong strand displacement activity cannot slip (DNA polymerase from Phi29); (ii) polymerases devoid of any strand displacement activity slip very efficiently (DNA polymerase II and T4 pol); and (iii) stimulation of the strand displacement activity by E. coli SSB (DNA polymerase I and T7 pol), by phagic SSB (T4 pol), or by a mutation that affects the 3' --> 5' exonuclease domain (DNA polymerase II exo(-) and T7 pol exo(-)) is correlated with the inhibition of slippage. We propose that these observations can be interpreted in terms of a model, for which we have shown that high strand displacement activity of a polymerase diminishes its propensity to slip.  (+info)

Effect of the ionic environment on the molecular structure of bacteriophage SPP1 portal protein. (7/348)

Bacteriophage SPP1 portal protein is a large cyclical homo-oligomer composed of 13 subunits. The solution structure and assembly behavior of this protein with high-point rotational symmetry was characterized. The purified protein was present as a monodisperse population of 13-mers, named gp6H, at univalent salt concentrations in the hundred millimolar range (>/= 250 mM NaCl) or in the presence of bivalent cations in the millimolar range (>/= 5 mM MgCl2). Gp6H had a slightly higher sedimentation coefficient, a smaller shape-dependent frictional ratio, and a higher rate of intersubunit cross-linking in the presence of magnesium than in its absence. In the absence of bivalent cations and at univalent salt concentrations below 250 mM, the 13-mer molecules dissociated partially into stable monomers, named gp6L. The monomer had a somewhat different shape from the subunit present in the 13-mer, but maintained a defined tertiary structure. The association-dissociation equilibrium was mainly between the monomer and the 13-mer with a minor population of intermediate oligomers. Their interconversion was strongly influenced by the ionic environment. Under physiological conditions, the concentration of Mg2+ found in the Bacillus subtilis cytoplasm (10-50 mM) probably promotes complete association of gp6 into 13-mer rings with a compact conformation.  (+info)

Functional interactions between a phage histone-like protein and a transcriptional factor in regulation of phi29 early-late transcriptional switch. (8/348)

Protein p6 is a nonspecific DNA-binding protein occurring in high abundance in phage phi29-infected cells. Here, we demonstrate a novel role for this versatile histone-like protein: its involvement in regulating the viral switch between early and late transcription. p6 performs this role by exhibiting a reciprocal functional interaction with the regulatory protein p4, also phage encoded, which is required for repression of the early A2b and A2c promoters and activation of the late A3 promoter. On the one hand, p6 promotes p4-mediated repression of the A2b promoter and activation of the A3 promoter by enhancing binding of p4 to its recognition site at PA3; on the other, p4 promotes p6-mediated repression of the A2c promoter by favoring the formation of a stable p6-nucleoprotein complex that interferes with RNA polymerase binding to PA2c. We propose that the observed interplay between proteins p6 and p4 is based on their DNA architectural properties.  (+info)

A phi 29 DNA fragment containing gene 6, required for DNA replication, has been cloned in plasmid pPLc28 under the control of the PL promoter of phage lambda. A polypeptide with an electrophoretic mobility close to that of p6 was labelled with 35S-methionine after heat induction. This protein, repre …
Bacillus phage Azalea complete sequence, 161765 bp including 2452 bp terminal repeat AGGTTTTTCTCTGGTATACGCTTCATGCTAGATAGAGTAGATTGCATCCT TGTACACAAATATATACCCGTTCTACAAACTTGTACAGGTGTTTTAAGGT GTCTCACACTCCGTTACACGTCGTTTTACAAACTAACTGGTACAAATGTA TAAGAACAACAAAAAAGCCCTTCACGACAATGTGAGGGCTTTCCTGCTAT AATGTGGGGTTTTGCTAGTAGCTCACTGGAATGCAAGCGCAACTCCTAGT AGCTCACTGGAACAGAGCCGAAAATCCTTAGTAGCTCCCTAGAACGCATA GGCAACTGTATGGCTTGTCCCTTTAGCTCATGAGCAAATACGCCCATGGA GCCAATCGCAGCATCTGACAATTGTCAGACAATTACGACAACAGGTATCT ACAAAATGTGCATCGACCTGCTTAAACAGAATAGCACATCAAACGACAAT AATACAAGCATAGACAAATTAAAAGTTTTTTATACATATTCTGACTAACT AAATATTCTGACAATTAGCAGCGCATATAAATATCACAGGTCTGTATAAT TGTCAAGTTAAAATAGTATTGCGAATAGTCTGACAATTAGAAGGGTATGA GTATTGCAAATAGTGCTAATAGTCTGACTGTCATAATAGTATGAATTGTG CCATTGTTCGGATTATTCTAAATAGTCTGACAATTAAAATGAAAACCCTC GGGAAAATAGAGTTAATATTCTGACAATAATAATAGTCTGACAATAATAT ACGGACATTTAATAGTCTGACAATTAGAATGTTCGGACTAGTAAGAATAA TCTGACAGTTTGAATGTTATGAATAGTCTAAATAGTCTGACAATTGTAAG AGGCTGCAATAGAATTAACTGACAATTCAAACTATTCAATCAATTATGAT ...
Abstract: It has been a long-standing goal in systems biology to find relations between the topological properties and functional features of protein networks. However, most of the focus in network studies has been on highly connected proteins (hubs). As a complementary notion, we define bottlenecks as proteins with a high betweenness centrality, i.e., network nodes that have a high number of shortest paths going through them. We found that bottlenecks are key connector proteins with surprising functional and dynamic properties. In particular, bottlenecks are more likely to be essential proteins. In fact, in regulatory and other networks with directed edges, betweenness (i.e., bottleneck-ness) is a much more significant indicator of essentiality than degree (i.e., hub-ness). Furthermore, bottlenecks correspond to the dynamic components of the interaction network - they are significantly less well co-expressed with their neighbors than non-bottlenecks, implying that expression dynamics is ...
An electrical connector with at least two connector portions. A first connector portion and a second connector portion may each be mountable on a respective surface, such as a printed circuit board. The first and second connector portions may each include a housing. The housing of the first connector portion may include a bore and an adjacent pin. The housing of the second connector portion may also include a bore and an adjacent pin. The pin of the first connector portion may be received in the bore of the second connector portion, and the pin of the second connector portion may be received in the bore of the first connector portion, when the two connector portions are mated to one another. In one embodiment, the first and second connector portions may be substantially identical to one another.
A connector system for use in coupling an implantable electrical lead to an implantable pulse generator, or other implantable electrical apparatus. The connector system includes a connector pin assembly, typically mounted to the implantable lead and a connector block, typically mounted to the electrical stimulator. The connector block is provided with a lumen, in which a plurality of resilient, elastomeric rings are linearly arranged. The rings are so sized as to frictionally engage a connector pin which is provided with a plurality of conductive pads, each coupled to a conductor within the implantable lead. Certain ones of the elastomeric rings are conductive, and engage with the conductive pads on the connector pin. Others of the rings are nonconductive and act as insulators and fluid seals. The connector pin assembly is also provided with a circumferential groove, which interlocks with the deflectable beam members of a retainer mounted to the connector block. An alternative connector block
A connector system for sterile connection includes a male type patient side connector having a tube connecting portion at a rear end portion thereof, a protective cap for the patient side connector, an inner cap held in the protective cap and including a ring-shaped portion that supports a disinfectant-impregnated member therein, and a female type circuit side connector including an outer cylinder and an inner cylinder fixed at one end of the outer cylinder, where the inner cylinder includes an internal end portion located inside the outer cylinder and an external end portion exposed outside the outer cylinder. When the protective cap is fitted with the patient side connector, the disinfectant-impregnated member contacts with the patient side connector. When the protective cap is removed therefrom, the inner cap becomes retained in the patient side connector. When such a patient side connector is connected with the circuit side connector, the internal end portion of the inner cylinder penetrates through
Large Current M25 Soldering Terminal Waterproof Connector, find complete details about Large Current M25 Soldering Terminal Waterproof Connector, Waterproof Connector, Connector, Pin Connector - Bett
Hi, The second connect has been called Cannon and XLR, and is not generally recogniced as XLR, which is the product range name. Naming of the first connector as Cannon is at least for me and many others confusing. This is a good example how vendor name for a connector type is not a good thing. The first connector is a circular MIL-STD connector (dont remember the correct notation), and this is a product available from ITT Cannon as well as AMP. Cheers, Magnus On 06/22/2017 08:42 PM, Mark Spencer wrote: , Sorry if I have caused any un due confusion thru my perhaps incorrect use of the terms cannon and XLR. , The green connector with 4 separate female contacts is what I perhaps in correctly referred to as a cannon connector. The silver connector with 3 separate female contacts was what I perhaps incorrectly referred to as a XLR connector. , , Both were in use in my lab powering time nuts gear. , , , , , , , , , , , , , , , Mark Spencer , , mark at alignedsolutions.com , , , , ...
A return pad cable connector, in accordance with the present disclosure, for use with a disposable return pad, includes a cord having a conductive wire disposed therethrough which conductive wire interconnects the return pad cable connector to an electrosurgical energy source. The return pad further includes a connector operatively coupled to the cord, the connector having a conductive surface which is selectively engageable with a corresponding conductive surface disposed on the return pad, the conductive surface of the connector including a conductive adhesive disposed thereon and a non-conductive adhesive disposed above the periphery of the conductive surface of the connector for engagement with a corresponding non-conductive adhesive disposed above the periphery of the conductive surface of the return pad. The connector can include a magnet for magnetically coupling the connector to the conductive surface disposed on the return pad.
Historically, coaxial connectors have had two methods for center conductor mating, the hermaphroditic contact and the male pin/slotted female contact. The non-sexed connectors have many advantages, the main being that only one connector type is required. As frequencies got higher, connectors became smaller in order to remain single mode. The success of the SMA connector foretold the end of the non-sexed connectors. Mechanically it is difficult to make butt type connectors. The pin depth tolerances are very critical and the small size makes it difficult . . .
High quality Hot Sale Ip67 Waterproof Connector 2 Pin Connector Female To Male from China, Chinas leading Waterproof Electrical Wire Connector Plug product market, With strict quality control Waterproof Electrical Wire Connector Plug factories, Producing high quality Hot Sale Ip67 Waterproof Connector 2 Pin Connector Female To Male products.
Top Quality 7pin 8pin 9pin LED Assembled Male and Female Connector, find complete details about Top Quality 7pin 8pin 9pin LED Assembled Male and Female Connector, Wire Connector, Pin Connector, Terminal Block - Bett
High quality Yellow 4 Pin IP67 Sealed Circular Waterproof Plug Connector , 500V Plastic Plug Electrical Connectors from China, Chinas leading outdoor plug connectors product, with strict quality control multi plug connector factories, producing high quality multi plug connector products.
High quality USB 3.0 AType Waterproof USB Connector , IP67 Sealed USB Connector With Cable from China, Chinas leading circular usb connector product, with strict quality control water resistant usb connector factories, producing high quality water resistant usb connector products.
4KZ2: Crystal structure of 3WJ core revealing divalent ion-promoted thermostability and assembly of the Phi29 hexameric motor pRNA.
The PowerMod HP (high power) series connector family features touch-safe female housings, cable strain relief, and integral positive latches. These safety features, combined with the ease of connector assembly, establish a new standard for cost effective high power connectors. The series is RoHS compliant and rated up to 450 amps for appropriate applications at a 30ºC temperature rise. Using the companys patented Sterling contact technology, the PowerMod HP offers low electrical resistance, provides a minimum of 500 mating cycles, and is rated for circuit interruption (true hotplug). These connectors are IP 20 rated (touch safe) for user safety. The integral coding key provides further protection by allowing the user to configure unique mating of up to six individual connectors ...
A connector terminal in a cardiac stimulator for receiving a connector pin of an associated lead includes a hollow box member having opposite end walls defining a first bore for receipt of the connector pin. A ring member movably disposed within the box member defines a second bore generally aligned with the first bore for also receiving the connector pin. A threaded neck connected to the ring member extends perpendicular to the second bore and is received within a through bore of the box member that is disposed perpendicular to the first bore. An internally threaded cap threadedly engages the threaded neck and bears in a thrust bearing relationship on the box portion. As the cap is rotated, the ring portion is drawn upwardly as the cap presses downwardly on the box portion, causing the second bore to be moved transversely out of alignment with the first bore. A connector pin received through both first and second bores is clamped therebetween and retained against axial withdrawal from the
It is a declared goal of the Connector pattern to establish a two-way independence between application and Collaboration. As a consequence, many changes in either part can be completely absorbed by just changing the connector. This is key for the maintainability of Connector-based architectures and relies on the fact, that also the Connector is a well defined, concise module. Given that a Connector contains no implementation (or only small chunks of glue-code), it lends itself to manipulation by tools other than typical source-code editors. The Object Teams Development Environment features a dedicated binding editor that provides an editable table of all class bindigs (playedBy) and method bindings (callout/callin) of a given team. An ideal Connector can be created an modified in a very efficient way using only this binding editor. ...
The Connector is the glue of society. They literally bring everyone together, irresistibly. The connector embodies acceptance. Of course we all belong together. Of course nobody is better or worse than anyone else. Of course life is supposed to be fun. Its the perfect balance for a Sensors analysis and prediction. Stop being in your own mind. Be out here with everyone else. Come down from the sky and play. The Connector mind says, Ive got this, everythings fine, look, its fun! when the Sensor mind is still trying to complete an almighty risk assessment before joining in. The Connector actually makes the Sensor feel safe - which is what the Sensor wants. To feel safe to play.. Sensors want cohesion, order. Our minds strive to create this order internally - through processes of analysis, planning and constant reflection and refinement. But the Connector mind knows a short cut. Just go straight to connecting. Bring everyone together. Boost everyone to feel happy, positive and united. Theres ...
High quality 4 Ports Ganged POE RJ45 Connector 10/100/1000 Base -T Tab Up RJ45 Jack With LED from China, Chinas leading POE RJ45 Connector product market, With strict quality control POE RJ45 Connector factories, Producing high quality 4 Ports Ganged POE RJ45 Connector 10/100/1000 Base -T Tab Up RJ45 Jack With LED products.
liquid tight conduit connector product listings on SeekPart.com - Choose quality liquid tight conduit connector products from large database of liquid tight conduit connector manufacturers and suppliers at SeekPart.com.
A tissue shaping device adapted to be disposed in a vessel near a patients heart to reshape the patients heart. The tissue shaping device includes a proximal anchor, a distal anchor, and a connector disposed between the proximal anchor and the distal anchor, the connector having a moment of inertia that varies along its length, such as by varying the connector thickness as a function of distance from one of its ends, with the smallest thickness being in the central portion of the connector.
2021-7-12 · Butt connectors, also known as heat shrink connectors, are widely available in the market. If you ask many people, they will all come up with different answers for the best heat shrink connectors. The truth is, you can only say what the best is based on your experience. There are many things to consider when purchasing a butt connector, but .... Get Price ...
Tighten connectors with a connector wrench. Choose from different types depending on your type of connector, from lock nuts to solar cable connectors.
Lightweight, Strong & Durable Available in Chrome Finish Connectors for any width Plexiglass Easy, No-Drill Technology This Metal Plexiglass Connector is ideally suited for sleek looking modular display systems using any size thickness plexiglass. The Two-Way 90 degree connectors are used for connecting vertical a
How is UTP Medium Interface Connector abbreviated? U-MIC stands for UTP Medium Interface Connector. U-MIC is defined as UTP Medium Interface Connector very rarely.
Amphenol RJF Field Series connectors at PEI-Genesis. We have a large inventory of Amphenol connectors and can build RJF Field Series connectors to your specs.
Connector Mold Parts Suppliers ☆ Search 34 connector mold parts suppliers, manufacturers and exporters here at EC21 ☆ Choose quality connector mold parts suppliers now - EC21
Ive no experience running OpenJMS under GCJ, but the exception appears to be coming from the GCJ RMI implementation. You could work around this by using the TCP connector instead. -Tim ShashiKiran Kerur wrote: , , Hello, , I have installed Openjms in Linux and trying to look up connection , factory. , , Installed OPENJMS on Linux , , OpenJMS - openjms-0.7.7-alpha-2 , Linux - (Red Hat Enterprise Linux AS release 4 (Nahant Update 1) , , , openjms.xml , , ,ServerConfiguration host=host ip embeddedJNDI=true /, , , ,Connectors, , ,Connector scheme=tcp, , ,ConnectionFactories, , ,ConnectionFactory name=ConnectionFactory /, , ,/ConnectionFactories, , ,/Connector, , ,Connector scheme=rmi, , ,ConnectionFactories, , ,QueueConnectionFactory name=JmsQueueConnectionFactory /, , ,TopicConnectionFactory name=JmsTopicConnectionFactory /, , ,/ConnectionFactories, , ,/Connector, , ,/Connectors, , , , Client code to look up Connection Factory , import java.util.Hashtable; , import ...
Acal BFi assemble the widest range of Amphenol connectors in the UK An authorised assembling distributor for Amphenol circular connectors ranging fr
This 041508SMRA Euro style LMI solid mold connector is available in 2 - 24 poles, and can handle high voltages. Each connector block has tiny space requirements.
This Euro style LMI solid mold dual pin connector 04154DP is available in 2 - 24 poles, can handle high voltages. Each connector is very adaptive and is solidly constructed.
Find USB Connectors on GlobalSpec by specifications. USB connectors are used with universal serial bus (USB) ports. They can be used to connect USB products together, or to connect USB wires and peripherals to other standard port types.
Latex-Free Extension Tubing with Connector has a plastic connector on one end and is constructed of a heavy gauge vinyl that provides security from leaking. | reviews page 2
Buy Lapp Multi Frame, MHB Series , For Use With Connectors 44423235. Browse our latest Heavy Duty Power Connector Accessories offers. Free Next Day Delivery available.
I hesitated for a long time to include a serial connection with my 41CL in order not to lose a physical port. Finally decided to try an alternative solution which is not as elegant as Montes serial port design but saved me a physical port and allowed me to utilize the battery charge port on the side (especially since it was missing the cover). I am sure it can be improved. I routed the serial connection wires through the two holes on the side by drilling to the side of one of them. After soldering the stereo female connector, I used a super glue to attach the connector inside the charge port flush to the battery holder. The tip of the stereo jack is almost flush (within ,1mm) with the calculator when you look from the top. I used AeroMicro insta-set glue accelerant with ZAP Plasti-zap Medium CA super glue. If I have to make any repairs in the future, there is still enough room in the side port hole for a fine soldering iron. I hope you find it useful. Now transferring to/from 41CL is a simple ...
Automotive Connectors Market has a significant scope for growth and is expected to cross USD 6.28 Billion by 2021. The reports forecast the automotive connectors market by connection type, application, system type, and region
Buy RS PRO 50Ω Straight Edge Mount, SMA Connector , jack . Browse our latest Coaxial Connectors offers. Free Next Day Delivery available.
Something just fascinates me about connector hubs. We know they are diversely connected across the brains communities. However, I wanted a mechanistic understanding of their function, not just their topology. I also wanted to know if there is a general optimal network structure for cognitive processing that involves modularity and strong connector hubs. My two…
We all need cables and connectors to tie all our mics and other equipment together. There are many places where problems can be introduced into your recording, caused by improper wiring. Even when everything appears to be working properly, poor wiring and connector practices can cause subtle prob...
Hello,. I have heard of one or two instances using the news connector although its never happened personally to me. If its inconsistent it sounds like an issue or bug is causing it as the connector should be consistent when publishing the news.. I would either raise a ticket to support, or raise a bug on the Microsoft Uservoice here (https://microsoftteams.uservoice.com/forums/555103-public?category_id=205564) with prefix BUG: so they will look into it in time, or raise this at the next Teams AMA ...
The Persons settings in Elementor Connector for WooCommerce Bookings allow shop owners to change the design of the Persons shown in the WooCommerce Bookings Form.. To access these settings, navigate to Templates , Theme Builder , Single Bookable Product Template , Edit with Elementor , WC Bookings Form , Persons.. ...
An electrical connector for receiving a central conductor of a coaxial cable adapter includes first and second body portions, a first electrical contact, and a coupling element. The first body portion has a first tubular portion disposed about a first axis and defines a first bore. The second body portion has a second tubular portion disposed about a second axis, which intersects the first axis, and defines a second bore. The second bore is configured to receive a coaxial adapter. The first electrical contact is secured within the first bore and has a first end within the first body portion and a second end outside of the first bore, and the first end of the first electrical contact has an opening in a side wall thereof. The coupling element is disposed in the opening in the side wall of the first electrical contact and extends in a direction of the second axis. The coupling element has a tubular wall and includes a plurality of spring members extending inward from the tubular wall such that the
Instinox are highly acclaimed manufacturers of Monel Female Connector. Due to ready stock of tube fittings , we can provide fast delivery. Contact us.
Product support for AXIS Connector A 2-pin 5.08 Straight, 10 pcs. Where applicable: find software, firmware, manuals, datasheets, technical specifications and other resources here.
TY - JOUR. T1 - Models of bacteriophage DNA packaging motors. AU - Serwer, Philip. PY - 2003/3/1. Y1 - 2003/3/1. N2 - An ATP-dependent motor drives a DNA genome into a bacteriophage capsid during morphogenesis of double-stranded DNA bacteriophages both in vivo and in vitro. The DNA molecule enters the capsid through a channel in the center of a symmetric protein ring called a connector. Mechanisms in two classes have been proposed for this motor: (1) An ATP-driven rotating connector pulls a DNA molecule via serial power strokes. (2) The connector rectifies DNA motion that is either thermal, biased thermal, or oscillating electrical field-induced (motor-ratchet hypothesis). Mechanisms in the first class have previously been proposed to explain the detailed structure of DNA packaging motors. The present study demonstrates that the motor-ratchet hypothesis also explains the current data, including data in the following categories: biochemical genetics, energetics, structure, and packaging ...
Bacillus phage phi29 (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, Φ15, BS32, B103, M2Y (M2), Nf and GA-1.[1][2] These phages, which form part of the Podoviridae family, are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ...
4.4.3 Soil cleaning test. The test shall be conducted according to the solvent soil test method described in the appendix. The soil used in this evaluation is MIL-PRF-10924 grease. The acceptable limit for each type of solvent is defined in Table I.. 4.4.4 Total chlorine content. The total chlorine content of the solvent shall be determined by a gas chromatographic method, microcoulometric or by the use of a portable test kit for the quantitative analysis of chlorine (see 6.6). Nonconformance to Table I shall constitute failure of this test.. 5. PACKAGING. 5.1 Packaging. For acquisition purpose, the packaging requirements shall be as specified in the contract or order (see 6.2). When actual packaging of materiel is to be performed by DoD personnel, these personnel need to contact the responsible packaging activity to ascertain requisite packaging requirements. Packaging requirements are maintained by the Inventory Control Points packaging activity with the Military Department or Defense Agency, ...
Recently Added Phages. Bucket Hilltop Retreat Clive Merkle Recently Modified Phages. T3mpyL1t Chrisss Coars20 Aubrey Misaki Recently Finished Phages. Zirkle (None) Ilona (C1) Azalea (C1) Ampersand (C3) FreightTrain (C1) ...
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
Construction and Single molecule studies on phi29 DNA-packaging motor for applications in nanotechnology, therapy, diagnosis, and drug ...
The expression of genes from genomic loci can be relatively complex, utilizing exonic, intronic and flanking sequences to regulate tissue and developmental specificity. Infectious bacterial artificial chromosomes (iBACs) have been shown to deliver and express large genomic loci (up to 135 kb) into primary cells for functional analyses. The delivery of large genomic DNA inserts allows the expression of complex loci and of multiple splice variants. Herein, we demonstrate for the first time that an iBAC will deliver and correctly express in human glioma cells the entire CDKN2A/CDKN2B genomic region, which encodes for at least three important cell-cycle regulatory proteins (p16(INK4a), p14(ARF) and p15(INK4b)). Two of these proteins are expressed from overlapping genes, utilizing alternative splicing and promoter usage. The delivered locus expresses each gene at physiological levels and cellular responses (apoptosis versus growth arrest) occur dependent on cellular p53 status, as expected. The work further
MMCX JACK MMCX007-JACK for RG178 Connector customized Taiwan, find complete details about MMCX JACK MMCX007-JACK for RG178 Connector customized Taiwan, MCX Connector, F Connector, SMB Connector - Quan Yu Co., Ltd.
Titering of Bacterial Viruses Related protocols: Preparation of Phage Stocks Commonly Used Media for Phage Growth Agar Overlay Technique When an individual bacterial virus grows in a bacterial host suspended in a top agar lawn, its progeny infect and lyse the surrounding host cells. This causes the appearance of a hole or plaque in…
documentclass{article} \usepackage{newtxtext,newtxmath} \usepackage{amsmath} \DeclareMathOperator{\sn}{sn} \DeclareMathOperator{\cn}{cn} \DeclareMathOperator{\dn}{dn} \begin{document} \begin{equation} \begin{gathered} \omega^3x_{4}(s) = \begin{minipage}[t]{.7\displaywidth} \raggedright\linespread{1.2}\selectfont \begin{math} x_4(\varphi_0) -2 \cos^3 ( \phi )sk^2 +2k^2x_1(\varphi_0) \cos^2( \phi ) +4 \cos^3 ( \phi )E ( s ) k^2+x_3(\varphi_0)\sin ( \phi ) s - \cos^3( \phi ){s}^2E( s ) +2 \cos^3 ( \phi )s ( E (s) ^2 +\cos ( \phi ) {s}^2E ( s ) - 2x_3(\varphi_0)\sin ( \phi ) E ( s ) -1/6\cos ( \phi ) {s}^3-4/3 \cos^3 ( \phi ) E ( s ) ^3 -1/2 x_1(\varphi_0) \cos^2 ( \phi ){s}^2-2 x_1(\varphi_0) \cos^2 ( \phi ) E ( s ) ^2 -2\cos ( \phi) s E ( s ) ^2 -2x_1(\varphi_0)sE( s ) + k\sin (\phi ) \cn(s) {s}^2 \cos^2( \phi ) +2 \cos^3 ( \phi )sk^2 \sn(s) ^2 -2/3\cos ( \phi) E ( s) +4/3k^3\cn(s) \sn(s) ^2\sin( \phi ) \cos^2 ( \phi )+2k\sin ( \phi ) \cn(s) +2/3\cos ( \phi ) s-8/3\cos ( \phi ) k^2\dn (s) \sn(s) ...
China Waterproof Straight Bulkhead Female BNC Connectors IP68, Find details about China BNC Connector, BNC Connectors IP68 from Waterproof Straight Bulkhead Female BNC Connectors IP68 - Renhotec Hardware Electronics Co., Ltd.
China Eight in Two Rows 8ports Degree90/180 Female BNC Connector, Find details about China BNC Connector PCB Mount, Female BNC Connector from Eight in Two Rows 8ports Degree90/180 Female BNC Connector - Renhotec Hardware Electronics Co., Ltd.
This collection of reviews focuses on the most exciting areas of DNA packaging at the current time. Many of the new discoveries are driven by the development of molecular or imaging techniques, and these are providing insights into the complex world of chromatin. As these new techniques continue to improve, we will be able to answer many of the questions we have now, while likely raising many new ones. ...
Free PDF download for DNA Packaging to score more marks in exams, prepared by expert Subject teachers from the latest edition of CBSE/NCERT books, Biology . (Updated for 2021-2022) Board Exams Score high with CoolGyan and secure top rank in your exams.
Buy Hollister Extension Tubing with Connector of HOLLISTER INCORPORATED. On Sale Urinary Tubing and Connectors products. Hollister Extension Tubing with Connector effectively manages high flow with wide-bore tubing. Security and safety are achieved by the non-kink tubing. Easy to adapt the leng...
This The Connectors: How Successful Businesspeople Build Relationships and Win Clients for Life book is not really ordinary book, you have it then the world is in your hands. The benefit you get by reading this book is actually information inside this reserve incredible fresh, you will get information which is getting deeper an individual read a lot of information you will get. This kind of The Connectors: How Successful Businesspeople Build Relationships and Win Clients for Life without we recognize teach the one who looking at it become critical in imagining and analyzing. Dont be worry The Connectors: How Successful Businesspeople Build Relationships and Win Clients for Life can bring any time you are and not make your tote space or bookshelves grow to be full because you can have it inside your lovely laptop even cell phone. This The Connectors: How Successful Businesspeople Build Relationships and Win Clients for Life having great arrangement in word and layout, so you will not really ...
faucet connector hose product listings on SeekPart.com - Choose quality faucet connector hose products from large database of faucet connector hose manufacturers and suppliers at SeekPart.com.
A spinal fixation system includes a first clip body having a pair of opposed spaced apart arcuate rod engaging hooks depending from a first side thereof for engaging a first elongated spinal rod, and a transverse connector extending laterally from a second side thereof; a second clip body having a pair of opposed spaced apart arcuate rod engaging hooks depending from a first side thereof for engaging a second elongated spinal rod, and a transverse connector extending laterally from a second side thereof; and a fastener for securing the transverse connector of the first elongated clip body and the transverse connector of the second elongated clip body to one another.
China Test Connector manufacturers - Select 2018 high quality Test Connector products in best price from certified Chinese L Connector manufacturers, D Connector suppliers, wholesalers and factory on Made-in-China.com
Barbed Tubing Connectors, Reduction Coupler - HDPE Connectors, Welch - Model 3551K-04 : Chemical-resistant HDPE and Kynar PVDF tubing connectors for
vierjahreszeiten-frauenwald.de multi-purpose waterproof connector, 2,3mm Waterproof Electrical Connectors, The one with wire is Assembled,For cars, motorcycles, electric vehicles and other wiring harness system connection,Get cheap goods online,Online promotion,Discount Prices, Easy Exchanges,Both comfortable and chic,backed by our low price guarantee.
Robokits India Cable Drag Chain Wire Carrier with end connectors 15x20mm 1Meter [RKI-2652] - 15mm x 20mm L1000mm Cable Drag Chain Wire Carrier with end connectors for CNC Router Machine Tools, comes with a 2Pcs Connector (In the drag chains both ends).
Connector projects are complex and exceptions are bound to happen. It is important that we have the ability to catch, categorize and handle exceptions, so that we do not leave the SailPoint identity platform in an inconsistent state. At SailPoint, we perform rigorous proofreading for preproduction and postproduction errors to improve error-handling techniques to resolve runtime errors or have their impact minimized by adopting reasonable countermeasures.. For background, a connector is the software that connects the SailPoint identity platform system to an external system to load data from and provisioning changes to the external system. An application is an instance of a connector in the SailPoint identity platform. Applications have a default exception strategy to send exception notification to the activity monitor and to log the exception. The default exception strategy itself never actually performs any rollback, commit, or consume activities, but allows for upper layers of the product to ...
Find information for part 08690940 from the Connectors Series Connectors, or search for Other Products and Accessories and more from Littelfuse.
AC WORKS™ Connector - Connecting Us to You - AC WORKS™ powerful solutions. AC Connectors Powerful Solutions. Answers to your most powerful questions. This powerful blog helps you answer EV, RV, Generator, Emergency Power, Welder questions and so much more.
AC WORKS™ Connector - Connecting Us to You - AC WORKS™ powerful solutions. AC Connectors Powerful Solutions. Answers to your most powerful questions. This powerful blog helps you answer EV, RV, Generator, Emergency Power, Welder questions and so much more.
How we see things around us without noticing it! We know the peculiar habit of the sunflower. How it moves with the movement of the sun everyday. But if
High quality Triple Level Pluggable Terminal Block 5.08mm Terminal Block Connector from China, Chinas leading PCB Terminal Block product market, With strict quality control PCB Terminal Block factories, Producing high quality Triple Level Pluggable Terminal Block 5.08mm Terminal Block Connector products.
High quality Magnetic Stacked Rj45 Modular Connector 1000 Base -T Network Switches Application from China, Chinas leading RJ45 Modular Jack product market, With strict quality control RJ45 Modular Jack factories, Producing high quality Magnetic Stacked Rj45 Modular Connector 1000 Base -T Network Switches Application products.
Connectors, Interconnects - Terminal Blocks - Accessories - Marker Strips are in stock at DigiKey. Order Now! Connectors, Interconnects ship same day
30AWG Connector Contacts product list at Newark element14. Competitive prices from the leading 30AWG Connector Contacts distributor. Check our stock now!
CENTRONICS |b|50|/b| POSITIONS|br /||b|FEMALE IDC|/b||br /|MINIATURE RIBBON CONNECTOR|br /|METAL FRONT SHELL|br /|STRAIN RELIEF|br /|SPRING LATCHES|br /|TERMINATES TO .050|br /|FLAT RIBBON CABLE|!--idc connectors --|
Anderson Marine 4 Way Loop Extension 30 E5401Harness extensions available in both 4-way and 5-way flat configurations. Each configuration has trailer connector on one end and trunk connector on other. Perfect for those times when an extension is needed ...
Ani.Solar: 1Pair Mc4 Flex Adaptor Cable Y Branch Connector 1F2M 1M2F For Solar … #7732-Ethan Solar Circuit Breakers and more. 1Pair Mc4 Flex Adaptor Cable Y Branch Connector 1F2M 1M2F For Solar … #7732-Ethan - Sun Energy - everything Solar and worldwide shipping at Ani.Solar.
Acetate resin connector link from Zola Elements. This U-shaped (semi-circle) connector features a hole on each end. Mix with other jewelry making components to create a timeless vintage look. Great for use as a pendant link or as a piece for chandelier earrings. Color: Lagoon (pearlescent green, blue, translucent cream
The type species, Bacillus phage SPbeta, has been fully sequenced. It has about 134k nucleotides, with 185 proteins. The ... There is currently only one species in this genus: the type species Bacillus virus SPbeta. Spbetaviruses are nonenveloped, with ... May 2015). "Renaming of all phage genera" (PDF). International Committee on Taxonomy of Viruses. Retrieved 17 September 2019. ...
ISBN 978-0-199-73438-2. Woese, C. R. (1960). "Phage induction in germinating spores of Bacillus megaterium". Radiation Research ...
"A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus". Mol Microbiol. 63 (#4): ... Howard-Jones N (1973). "Was Kitasato Shibasaburō the discoverer of the plague bacillus?". Perspect Biol Med. 16 (#2): 292-307. ...
Bacillus phage SP8 was assigned to the family Myoviridae in 1995. Bacillus phage SPO1 was assigned to the genus SPO1-like ... Caudovirales in 1998 SPO1-like phages were renamed SPO1-like viruses in 1999 Bacillus phage SP8 was merged into Bacillus phage ... There is currently only one species in this genus: the type species Bacillus phage SPO1. Group: dsDNA Order: Caudovirales ... Okubovirus Bacillus virus Camphawk Bacillus virus SPO1 Viruses in Okubovirus are non-enveloped, with head-tail geometries, and ...
Purification and properties of an enzyme found after infection of Bacillus subtilis with phage SP5C". J. Biol. Chem. 241 (21): ...
Tomita F, Takahashi I (1969). "A novel enzyme, dCTP deaminase, found in Bacillus subtilis infected with phage PBS I". Biochim. ...
... gene 14 of Bacillus subtilis phage phi 29 encodes the functional homolog of lambda S protein". Journal of Bacteriology. 175 (4 ... The phage φ29 gene 14 encodes the protein GP14 (TC# 1.E.10.1.1) which is required for phage φ29-promoted host cell lysis. When ... It is identical to the phage PZA lysis protein and nearly identical to the phage B103 lysis protein. It is 34% identical to the ... gene 14 of Bacillus subtilis phage phi 29 encodes the functional homolog of lambda S protein". Journal of Bacteriology. 175 (4 ...
Vlcek C, Paces V (1986). "Nucleotide sequence of the late region of Bacillus phage Φ29 completes the 19,285-bp sequence of Φ29 ... This was demonstrated by the ability of the enzyme to continue to copy the singly primed circular genome of the M13 phage more ... Blanco L, Bernad A, Lázaro JM, Martín G, Garmendia C, Salas M (May 1989). "Highly efficient DNA synthesis by the phage Φ29 DNA ... Pérez-Arnaiz P, Longás E, Villar L, Lázaro JM, Salas M, de Vega M (2007). "Involvement of phage phi29 DNA polymerase and ...
Phage GA-1 neck appendage CIMCD self-cleaving protein (Bacillus phage GA-1) ...
"Purification and characterization of two phage PBSX-induced lytic enzymes of Bacillus subtilis 168: an N-acetylmuramoyl-L- ... Autolysins and some phage lysins are examples of N-acetylmuramoyl-L-alanine amidases. Phage lysins Autolysins PGLYRP2 Campbell ... Herbold DR, Glaser L (1975). "Bacillus subtilis N-acetylmuramic acid L-alanine amidase". J. Biol. Chem. 250 (5): 1676-82. PMID ...
System validation uses non-pathogenic surrogates such as MS 2 phage or Bacillus subtilis to determine the Reduction Equivalent ...
... and the Bacillus phage SPO1 transcription factor, TF1". Nucleic Acids Research. 21 (6): 1496. doi:10.1093/nar/21.6.1496. PMC ... IHF was discovered as a necessary co-factor for recombination of λ phage into E.coli. In 2016 it was discovered that IHF also ...
... as seen with the prohead of Bacillus subtilis phage φ29. Catalano, C. E.; Cue, D.; Feiss, M. (1995). "Virus DNA packaging: the ... strategy used by phage λ". Molecular Microbiology. 16 (6): 1075-1086. doi:10.1111/j.1365-2958.1995.tb02333.x. Murialdo, H.; ...
A skipping-rope RNA was also found in a purified phage, specifically the phage Bacillus phage SPbeta, which infects Bacillus ... Therefore, skipping-rope RNAs likely function, at least sometimes, to perform a function useful to phages. skipping-rope RNAs ...
... and MS2 phages, but Bacillus cereus spores required four minutes. After some fires were caused by people trying to replicate ...
Examples Bacillus phage AP50 Bacillus phage Bam35 Enterobacteria phage PRD1 Two additional genera - Deltatectivirus and ... homologues of the Rz/Rz1 proteins of phage lambda). Tectiviruses have been classified into three major groups: (1) phages that ... WheeHeim and Rhodococcus phage Toil) infecting Actinobacteria hosts. San Martín, C; Huiskonen, JT; Bamford, JK; Butcher, SJ; ... Epsilontectivirus - have been created for a number of phages and await ICTV ratification (Forthebois, ...
They were studying communication in Bacillus subtilis bacteria - in particular, how bacteria infected with phages warn nearby ... the pathogenic species Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis. They speculate that "the occurrence of ... Many phages, known as temperate phages, when they infect a bacterium, may enter either the lytic or the lysogenic pathway. The ... It is six amino acids long, and is produced when a phage infects a bacterial host. It signals to other phages that a host has ...
These phages, which form part of the Podoviridae family, are the smallest Bacillus phages isolated to date and are among the ... Bacillus virus phi29 (Φ29 phage) is a species of virus that belongs to the bacteriophage order Caudovirales which also includes ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... CS1 maint: discouraged parameter (link) Meijer, W. J. J.; Horcajadas, J. A.; Salas, M. (1 June 2001). "phi29 Family of Phages ...
... is a bacteriophage (phage) that infects Bacillus bacteria. The phage has been reported to have the largest ... European Nucleotide Archive: Bacillus phage G v t e. ... "Evolutionarily conserved orthologous families in phages are ...
Gillis, Annika; Mahillon, Jacques (9 July 2014). "Phages Preying on Bacillus anthracis, Bacillus cereus, and Bacillus ... A Bacillus phage is a member of a group of bacteriophages known to have bacteria in the genus Bacillus as host species. These ... The DNA polymerase of Bacillus phage phi29 is a unique and efficient polymerase with proofreading activity. ... Blanco, L; Salas, M (September 1984). "Characterization and purification of a phage phi 29-encoded DNA polymerase required for ...
... (formerly Phage AP50) is a species of bacteriophage that infects Bacillus anthracis bacteria. Originally ... Nagy, E.; Pragai, B.; Ivanovics, G. (1 July 1976). "Characteristics of Phage AP50, an RNA Phage Containing Phospholipids". ... "Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity". ... thought to be an RNA phage, it contains a DNA genome of about 14,000 base pairs in an icosahedral capsid with a two-layer ...
Kamei K, Hara S, Ikenaka T, Murao S (November 1988). "Amino acid sequence of a lysozyme (B-enzyme) from Bacillus subtilis YT-25 ... There are at least five different classes of lysozymes: C (chicken type), G (goose type), phage-type (T4), fungi (Chalaropsis ... and bacterial (Bacillus subtilis). There are few similarities in the sequences of the different types of lysozymes. Lysozyme ...
... coli and MS2 phages. Bacillus cereus spores were killed at four minutes of microwaving. A 2017 study was less affirmative: ...
... (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, ... are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Bacillus_phage_phi29&oldid=841433724" ...
This method was used to evolve Bacillus thuringiensis endotoxin variants that can overcome insect toxin resistance. PACE was ... Phage replication requires E. coli infection, which, for M13 phage, relies on protein III (pIII). When using PACE, the phage ... Phage-assisted continuous evolution (PACE) is a phage-based technique for the automated directed evolution of proteins. It ... Proteins with greater desired activity hence confer greater infectivity to their carrier phage. More infectious phage propagate ...
An invisible microbe that is antagonistic to the dysentery bacillus]. Comptes Rendus (in French). 165: 373-75. Shasha SM, ... Viruses portal Antimicrobial resistance Phage display Phage monographs Phagoburn Prophage "Silent Killers: Fantastic Phages?". ... Bacteriophages, known as phages, are a form of viruses. Phages attach to bacterial cells, and inject a viral genome into the ... Phages are often compared to antibiotics. Phages tend to be more successful than antibiotics where there is a biofilm covered ...
... is a bacteriophage that infects the spore-forming bacterium Bacillus cereus. Though this lytic phage is a ... Kong, M; Kim, M; Ryu, S (June 2012). "Complete Genome Sequence of Bacillus cereus Bacteriophage PBC1". Journal of Virology. 86 ... member of Siphoviridae, its genome sequence shows little similarity to those of other sequenced phages. ...
Talk:Bacillus phage AP50. *Talk:Bacillus phage G. *Talk:Bacteriophage f2. *Talk:Bacteriophage Mu ...
Since bacteria become resistant against a single phage, d'Herelle suggested using "phage cocktails" containing different phage ... Independently, the discovery of "an invisible, antagonistic microbe of the dysentery bacillus" by d'Herelle was announced on 3 ... D'Hérelle's main legacy lies in the use of phage in the molecular revolution in biology. Max Delbrück and the "phage group" ... Production problems were most likely due to the attempt to mass-produce phages when they were barely understood. The phages may ...
To test their hardiness on a hypothetical mission to Mars, spores of Bacillus subtilis 168 and Bacillus pumilus SAFR-032 were ... study of space environment effect on T7 phage, its DNA and of polycristalline uracil. IMBP (Institute of Biomedical Problems), ... The mutagenic efficiency of space was also studied in spores of Bacillus subtilis 168. The data show the unique mutagenic power ... ADAPT Bacterial endospores of the highly UV-resistant Bacillus subtilis strain MW01 were exposed to low-Earth orbit and ...
In 1883, Robert Koch identified V. cholerae with a microscope as the bacillus causing the disease.[112] ... "Cholera phage discovery". Arch. Dis. Child. 76 (3): 274. doi:10.1136/adc.76.3.274. PMC 1717096 ... "Transmission of Vibrio cholerae is antagonized by lytic phage and entry into the aquatic environment". PLOS Pathogens. 4 (10 ...
Fletcher, R. D. (1965). "Activity and morphology of Vibrio coli phage". American Journal of Veterinary Research. 26 (111): 361- ... Bacilli. *Bacillales. *Lactobacillales. *Aphragmobacteria *Erysipelotrichia *Erysipelotrichiales. *Mollicutes *Mycoplasmatales ...
Lopez D, Vlamakis H, Kolter R (January 2009). "Generation of multiple cell types in Bacillus subtilis". FEMS Microbiol Rev. 33 ... Phage therapy, where applicable, entirely circumvents antibiotic resistance. Antibiotic resistance Antibiotic sensitivity ...
Phage treatment of human infections»։ Bacteriophage 1 (2): 66-85։ March 2011։ PMC 3278644։ PMID 22334863։ doi:10.4161/bact.1.2. ... 10 x '20 Progress--development of new drugs active against gram-negative bacilli: an update from the Infectious Diseases ... բացիլները կարող են ճնշել Bacillus anthracis-ի աճը [122][124]։ Հետագայում 1942 թվականին ամերիկացի մանրէաբան Զելման Վակսմանը նման ... որ Bacillus anthracis-ը չի աճում Penicillum notatum բորբոսասնկերի առկայությամբ։ ...
... is a genus of rod-shaped (bacillus) Gram-negative bacteria of the family Enterobacteriaceae. The two species of ... These developments were enabled by the discovery of the first generalized transducing phage, P22,[76] in Typhimurium that ...
Some of the first Streptococcus phages discovered were Dp-1[23] and ω1.[24][25] In 1981 the Cp (Complutense phage) family was ... "Bacteria-Firmicutes-Bacilli-Lactobacillales-Streptococcaceae-Streptococcus". PATRIC, University of Chicago. Retrieved 12 ... which is actually a Gram-positive bacillus) should not be confused with nonhemolytic streptococci. ... the host ranges of most Streptococcus phages have not been investigated systematically. ...
See geen pärineb mullabakterist Bacillus subtilis.[60] Puuviljad ja köögivaljad[muuda , muuda lähteteksti]. Papaia (Carica ... Circular SV40 DNA Molecules Containing Lambda Phage Genes and the Galactose Operon of Escherichia coli". 1972. Proceedings of ... aastal kiideti heaks Bacillus thuringiensis (Bt) kartul kasvatamiseks, mistõttu see oli esimene Ameerika Ühendriikides heaks ... Toidu ja etanooli jaoks kasutatud maisi on geneetiliselt muundatud herbitsiidide talumiseks ja Bacillus thuringiensis'i (Bt) ...
This may improve the outcomes of those with cystic fibrosis and other respiratory infections.[103] Phage therapy has been used ... "Phage therapy gets revitalized". Nature. 510 (7503): 15-6. Bibcode:2014Natur.510...15R. doi:10.1038/510015a. PMID 24899282 ... concerns that the presence of MRSA in the environment may allow resistance to be transferred to other bacteria through phages ( ...
These roots form interactions with rhizosphere bacteria such as Bacillus megaterium.[13] ... "Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin- and ethylene-independent ...
Use by phagesEdit. Another way for bacteria to defend against phage infection is by having chromosomal islands. A subtype of ... "Double-stranded endonuclease activity in Bacillus halodurans clustered regularly interspaced short palindromic repeats (CRISPR ... To fight off a phage infection, the sequence of the CRISPR spacer must correspond perfectly to the sequence of the target phage ... In second mechanism PICI CpmAB redirect the phage capsid morphogenetic protein to make 95% of SaPI-sized capsid and phage DNA ...
In nature, these enzymes protect bacteria against phage infection by digesting the phage DNA when it enters the bacterial cell ... The discovery of 5-methylcytosine in tuberculinic acid, the nucleic acid of the tubercle bacillus". Journal of the American ... Goff SP, Berg P (December 1976). "Construction of hybrid viruses containing SV40 and lambda phage DNA segments and their ... Hershey and Martha Chase in the Hershey-Chase experiment showed that DNA is the genetic material of the enterobacteria phage T2 ...
by a novel giant phage. ISME J. 2014 Mar 6. doi:10.1038/ismej.2014.29 ... bakteriofag PBS1 dan PBS2 Bacillus subtilis dan bakteriofag piR1-37 Yersinia- timina telah digantikan oleh urasil.[16] Fag ...
The New Leaf potato, a GM food developed using naturally occurring bacteria found in the soil known as Bacillus thuringiensis ( ... Circular SV40 DNA Molecules Containing Lambda Phage Genes and the Galactose Operon of Escherichia coli". Proceedings of the ... Bacillus thuringiensis (Bt) Potato was approved for cultivation, making it the first pesticide producing crop to be approved in ... used for food and ethanol has been genetically modified to tolerate various herbicides and to express a protein from Bacillus ...
a b Canchaya C, Fournous G, Chibani-Chennoufi S, Dillmann ML, Brüssow H. Phage as agents of lateral gene transfer. Current ... D'Herelle F. On an invisible microbe antagonistic toward dysenteric bacilli: brief note by Mr. F. D'Herelle, presented by Mr. ... The study of phages provided insights into the switching on and off of genes, and a useful mechanism for introducing foreign ... Viral enzymes aid in the breakdown of the cell membrane, and, in the case of the T4 phage, in just over twenty minutes after ...
Incorporation of dead tubercle bacilli in the medium was successful. Johne's bacillus had been cultivated for the first time.[ ... Félix d'Herelle discovered phages independently,[13] and Twort's work may have been lost to time, but for Jules Bordet and ... Twort suspected that the leprosy bacillus had a 'close relationship' with the tubercle bacillus, a species that was culturable ... Twort, F. W. (1910). "A Method for Isolating and Growing the Lepra bacillus of Man. (Preliminary Note.)". Proceedings of the ...
λ phage, T5 phage, phi, C2, L5, HK97, N15 Podoviridae. Nonenveloped, noncontractile tail (short). Linear dsDNA. T7 phage, T3 ... antagonistic microbe of the dysentery bacillus". For d'Hérelle, there was no question as to the nature of his discovery: "In a ... Phage therapy[edit]. Main article: Phage therapy. Phages were discovered to be antibacterial agents and were used in the former ... Phage display is a different use of phages involving a library of phages with a variable peptide linked to a surface protein. ...
a b Canchaya C, Fournous G, Chibani-Chennoufi S, Dillmann ML, Brüssow H. Phage as agents of lateral gene transfer. Current ... D'Herelle F. On an invisible microbe antagonistic toward dysenteric bacilli: brief note by Mr. F. D'Herelle, presented by Mr. ... Viral enzymes aid in the breakdown of the cell membrane, and, in the case of the T4 phage, in just over twenty minutes after ... Phage typing of Salmonella Typhimurium - is it still a useful tool for surveillance and outbreak investigation?. ...
Phylogenetic Position of the Tubercle Bacilli within the Genus Mycobacterium The blue triangle corresponds to tubercle bacilli ... bacterial viruses that may be used in the future to treat tuberculosis and related diseases by phage therapy(英语:phage therapy) ...
Phage therapy is another method for treating antibiotic-resistant strains of bacteria. Phage therapy infects pathogenic ... He also observed that when he inoculated laboratory animals with lethal doses of typhoid bacilli together with Penicillium ... releasing new phage able to infect and destroy further bacteria of the same strain.[143] The high specificity of phage protects ... Phages insert their DNA into the bacterium, where it is transcribed and used to make new phages, after which the cell will lyse ...
Streptococcal phages other than T12 may also carry the speA gene.[26] ... The phage itself integrates into a serine tRNA gene on the chromosome.[24] ... "Genetic diversity in temperate bacteriophages of Streptococcus pyogenes: identification of a second attachment site for phages ...
Davis B, Waldor M (2003). "Filamentous phages linked to virulence of Vibrio cholerae". Curr Opin Microbiol. 6 (1): 35-42. doi: ... Bacilli. .mw-parser-output .nobold{font-weight:normal}. Clostridium:. *tetani *Tetanospasmin. *Tetanolysin ...
... bacilli Gram-positive, cocci Gram-negative na bacilli Gram-negative bacilli). Baadhi ya viumbe hutambulika vizuri kwa kutumia ... Brüssow H, Canchaya C, Hardt WD (September 2004). "Phages and the evolution of bacterial pathogens: from genomic rearrangements ... waitwao bacilli (umoja: Bacillus, kutoka neno la Kilatini baculus Kilatini, fimbo). Kurefuka huhusishwa na kuogelea.[26] ... Bacillus, Clostridium au Enterobacteriaceae Umetaboli wa kaboni katika bakteria huwa aidha pale ambapo misombo ya kaboni ...
Virus and phage cultureEdit. Virus or phage cultures require host cells in which the virus or phage multiply. For ... A culture of Bacillus anthracis. There are several types of bacterial culture methods that are selected based on the agent ... The phage can then be isolated from the resulting plaques in a lawn of bacteria on a plate. Virus cultures are obtained from ...
... called bacilli (sing. bacillus, from Latin baculus, stick).[35] Some bacteria, called vibrio, are shaped like slightly curved ... Bacteria resist phage infection through restriction modification systems that degrade foreign DNA,[124] and a system that uses ... Gram-positive bacilli, Gram-negative cocci and Gram-negative bacilli). Some organisms are best identified by stains other than ... Certain genera of Gram-positive bacteria, such as Bacillus, Clostridium, Sporohalobacter, Anaerobacter, and Heliobacterium, can ...
Nevertheless, numerous interactomes have been predicted, e.g. that of Bacillus licheniformis.[19] ... Viral protein interactomes consist of interactions among viral or phage proteins. They were among the first interactome ... "The proteome and interactome of Streptococcus pneumoniae phage Cp-1". J. Bacteriol. 193 (12): 3135-8. doi:10.1128/JB.01481-10 ... "Genome annotation and intraviral interactome for the Streptococcus pneumoniae virulent phage Dp-1". J. Bacteriol. 193 (2): 551 ...
Enterobacteria phage T4 is a bacteriophage virus. It infects its host, Escherichia coli, by injecting its DNA through its tail ... To give a few examples, Bacillus anthracis, the cause of anthrax, is spread by contact with infected domestic animals; its ...
Bacillus phage phi29 (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, ... are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Bacillus_phage_phi29&oldid=841433724" ...
Gillis, Annika; Mahillon, Jacques (9 July 2014). "Phages Preying on Bacillus anthracis, Bacillus cereus, and Bacillus ... A Bacillus phage is a member of a group of bacteriophages known to have bacteria in the genus Bacillus as host species. These ... The DNA polymerase of Bacillus phage phi29 is a unique and efficient polymerase with proofreading activity. ... Blanco, L; Salas, M (September 1984). "Characterization and purification of a phage phi 29-encoded DNA polymerase required for ...
Bacillus phage AP50 (formerly Phage AP50) is a species of bacteriophage that infects Bacillus anthracis bacteria. Originally ... Nagy, E.; Pragai, B.; Ivanovics, G. (1 July 1976). "Characteristics of Phage AP50, an RNA Phage Containing Phospholipids". ... "Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity". ... thought to be an RNA phage, it contains a DNA genome of about 14,000 base pairs in an icosahedral capsid with a two-layer ...
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
Phage Bam35 is an icosahedron of about 63 nm in diameter. It has a double capsid with spikes at the vertices, and a tail which ... Partial characterization of a cubic Bacillus phage. Can. J. Microbiol. 24: 986--993. ... The phage contains DNA and, probably, lipids which seem to be located in the inner coat. The phage is Bacillus-specific, UV- ... Partial characterization of a cubic Bacillus phage. Can. J. Microbiol. 24: 986--993. Phage Bam35 is an icosahedron of about 63 ...
Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). Bacillus phage CP-51. Bacillus phage JL. Bacillus phage ... Bacillus phage vB_BsuM-Goe2. Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). 99. UniRef100_P04445. Cluster: ... Bacillus phage vB_BsuM-Goe2. Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). 99. UniRef90_P04445. Cluster: ... sp,P04445,TF1_BPSP1 Transcription factor 1 OS=Bacillus phage SP01 OX=10685 GN=TF1 PE=1 SV=1 ...
The specific virus-host interactions that allow phages to redirect cellular machineries and energy resources to support the ... Global Transcriptional Analysis of Virus-Host Interactions between Phage ϕ29 and Bacillus subtilis J Virol. 2016 Sep 29;90(20): ... Here, we analyze genome-wide interactions of Bacillus subtilis and its lytic phage ϕ29 during the early stage of infection. ... an insight into the genome-wide transcriptional response of the Gram-positive model Bacillus subtilis to phage ϕ29 infection. ...
A CRISPR-Cas9 tool to explore the genetics of Bacillus subtilis phages. Otte K, Kuhne NM, Furrer AD, Baena Lozada LP, Lutz VT, ...
Phage 29 phi protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis.. ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ...
Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning.. R Ahmed, P Sankar-Mistry, S Jackson, H ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ...
The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis ... PBSX and skin are two unusual genetic elements resident on the Bacillus subtilis chromosome. PBSX is a phage-like element ... However two non-phage-like operons in the skin element are expressed and have distinct expression profiles that are dependent ... The phage particles contain bacterial chromosomal DNA and kill sensitive bacteria without injecting DNA. The skin element is ...
Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ...
... a phage-like-particle (approx. 22 nm in diameter) specifically found in stage II sporulating cells of B. medusa and initially ... An improved purification enabled the phage-like-particles (PLP) close to homogenous to be isolated. Electron microscopic ... were subsequently found in Bacillus thuringiensis subsp. israelensis (serotype 14), B. thuringiensis subsp. kyushuensis ( ... A Group Of Phage-like-particles In Three Subspecies Of Bacillus Thuringiensis And Bacillus Medusa ...
The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis ... Krogh, S, OReilly, M, Nolan, N, Devine, KM, The phage-like element PBSX and part of the skin element, which are resident at ... different locations on the Bacillus subtilis chromosome, are highly homologous, MICROBIOLOGY-UK, 142, 1996, 2031-2040 ...
The only known relative of this phage is a string of phage-like genes called BtI1 in the chromosome of B. thuringiensis ... The high degree of divergence and novelty of phage genomes pose challenges in how to describe the phage from its genomic ... Phage 0305φ8-36 and BtI1 are estimated to have diverged 2.0 - 2.5 billion years ago. Positionally biased Blast searches aligned ... A conserved long tape measure gene indicates that a long tail is an evolutionarily stable property of this phage lineage. An ...
... is also present on the two citG transducing phages described. The cloned regions in these two phages include EcoRI-generated ... gene of Bacillus subtilis have been detected by complementation of an Escherichia coli fumarase mutation in lysogen-filled ... The Isolation Of λ; Transducing Phages Carrying the citG and gerA Genes Of Bacillus Subtilis * Anne Moir ... is also present on the two citG transducing phages described. The cloned regions in these two phages include EcoRI-generated ...
The protoplast-like forms are capable of securing the reproduction of phage, although the phage production is ten times less ... The penicillin does not affect the amount of phage adsorption, but suppresses the intracellular phase of the phages development ... Inasmuch as the protoplast-like formations are capable of securing phage development and at the same time, evidently, possess ... The protoplast-like forms produced from enteric bacilli by the effect of penicillin are capable of adsorbing phage, and are ...
10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New Phage Lineage and Characterization of Its ... This phage is the first tadpole-like phage infecting the Bacillus strains. Genomic analysis shows that the phage genome is ... 10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New Phage Lineage and Characterization of Its ... Phylogenetic analysis revealed that the phage was distant from the other Bacillus phages in terms of evolution. The novel ...
Recently Added Phages. Bucket Hilltop Retreat Clive Merkle Recently Modified Phages. T3mpyL1t Chrisss Coars20 Aubrey Misaki Recently Finished Phages. Zirkle (None) Ilona (C1) Azalea (C1) Ampersand (C3) FreightTrain (C1) ...
Local Phage BLAST. This tool will run a local BLAST search against our phage database. This will include some genomes that are ... Bacillus phage Azalea complete sequence, 161765 bp including 2452 bp terminal repeat ...
... abrogates its binding activity specific to the cell wall of Bacillus anthracis. Whether short synthetic peptides representing ... Furthermore, by using B. anthracis (Sterne, 34F2), an animal vaccine and B. cereus-4342, a γ-phage susceptible rare strain as ... phage lysin protein (PlyG) have demonstrated that removal of a short amino acid sequence in the C-terminal region encompassing ... The Bacillus cereus strain (RSVF1 strain 4342), Bacillus cereus ATCC 11778, Bacillus cereus ATCC10876, and Bacillus ...
Semantic Scholar is a free, AI-powered research tool for scientific literature, based at the Allen Institute for AI.. Learn More → ...
Bacillus phage Gamma a.link {text-decoration: none;color: white;} Viruses -> Viruses noname -> Viruses noname -> Caudovirales ... Siphoviridae -> Siphoviridae noname -> Bacillus phage Gamma article { width: 25%; } - Optimal pH - Optimal Temerature - ...
Genome Sequence of Bacillus cereus Group Phage SalinJah. Ivan Erill, Steven M. Caruso on behalf of the 2015 UMBC Phage Hunters ... Genome Sequence of Bacillus cereus Group Phage SalinJah. Ivan Erill, Steven M. Caruso on behalf of the 2015 UMBC Phage Hunters ... information about SalinJah and other Bacillus phages isolated by undergraduate researchers can be found on the Bacillus phages ... and phylogenetic analysis identified Bacillus phage Helga (see BPDB) as the most similar previously sequenced phage, with an ...
These findings provide guidance for documentation of ARG in viromes, and reassert that ARGs are rarely encoded in phages. ... Here we used exploratory and conservative bioinformatic strategies found in the literature to detect ARGs in phage genomes, and ... ARG abundances in 1181 phage genomes were vastly overestimated using exploratory thresholds (421 predicted vs 2 known), due to ... However, recent viral metagenome (virome) analyses suggest that ARGs are frequently carried by phages, which is inconsistent ...
Bacillus phage SPbeta (Bacillus phage SPBc2). Loading... P36549 Uncharacterized 9.7 kDa protein in cwlL 5region. Bacillus ...
Bacillus phage phi29. Loading... P07535 Portal protein. Bacillus phage PZA. Loading... Q37891 Portal protein. Bacillus phage ...
Combining Genes from Multiple Phages for Improved Cell Lysis and DNA Transfer from Escherichia coli to Bacillus subtilis ... Combining Genes from Multiple Phages for Improved Cell Lysis and DNA Transfer from Escherichia coli to Bacillus subtilis. ... Combining Genes from Multiple Phages for Improved Cell Lysis and DNA Transfer from Escherichia coli to Bacillus subtilis. Plos ... such as Escherichia coli and Bacillus subtilis, constitutes one of the major hurdles of the rational genome engineering. Using ...
Bacillus subtilis phage ø 105. Garro and Phillips 1980. Sex-linked recessive lethal mutation. Drosophila melanogaster. Hardin ... Garro AJ, Phillips RA [1980]. Detection of mutagen-induced lesions in isolated DNA by marker rescue of Bacillus subtilis phage ... Bacillus subtilis. Phillips et al. 1980 Bootman et al. 1979. Forward mutation. Schizosaccharomyces pombe. Migliore et al. 1982 ... Phillips RA, Zahler SA, Garro AJ [1980]. Detection of mutagen-induced lesions in isolated DNA using a new Bacillus subtilis ...
  • Using a phage library, physiological analyses of infection experiments with the model bacterium Bacillus subtilis will be performed. (uni-goettingen.de)
  • Investigating interactions of the Bacillus subtilis spore coat proteins CotY and CotZ using single molecule force spectroscopy. (savba.sk)
  • The molecular mechanisms of observed phage interactions will be investigated via comparative genome, transcriptome and proteome analyses and subsequently validated by directed phage mutagenesis approaches. (uni-goettingen.de)
  • The presence of a complete phage genome in the genome of other phages apparently has not been described previously and might represent a 'fast track' route of virus evolution and horizontal gene transfer. (hw.ac.uk)
  • Another phage (BceA1) nearly identical in sequence to SpaA1, and also including the almost complete MZTP02 genome within its own genome, was isolated from a bacterium of the B. cereus/B. thuringiensis group. (hw.ac.uk)
  • Remarkably, both SpaA1 and BceA1 phages can infect B. cereus and B. thuringiensis, but only one of them, SpaA1, can infect S. pasteuri. (hw.ac.uk)
  • Analysis of the Bacillus cereus SpoIIS antitoxin-toxin system reveals its three-component nature. (savba.sk)
  • A novel bacteriophage infecting Staphylococus pasteuri was isolated during a screen for phages in Antarctic soils. (hw.ac.uk)
  • In two of these regions, the gene sets resemble those in prophages of Bacillus thuringiensis kurstaki str. (hw.ac.uk)
  • The phages as such were unable to control some strains of Bacillus sp and Staphylococcus sp. (centralparkcarriagesofficial.org)
  • A French company, "Pherecydes Pharma" is once again producing phages currently being tested on osteo-articular infections with Staphylococcus aureus at the Croix Rousse hospital in Lyon (Pr. (ouvry.com)
  • Showing sequenced phages that infect this strain. (phagesdb.org)
  • Click here to view all phages that infect this strain. (phagesdb.org)
  • Additionally, it will provide deep insight into the ecology of phages and the diverse viral genetic pool. (uni-goettingen.de)
  • Hence, these assays lack the ability to detect novel natural variations or intentional genetic modifications that circumvent the targets of the detection assays or in the case of a biological attack using an antibiotic resistant or virulence enhanced Bacillus anthracis, to advise on therapeutic treatments. (elsevier.com)
  • Furthermore, using the unfinished draft sequences, we demonstrate that unbiased identification of known as well as heretofore-unreported genetic modifications that include indels and single nucleotide polymorphisms conferring antibiotic and phage resistances is feasible within the next 12 hours. (elsevier.com)
  • The phage named SpaA1 is morphologically similar to phages of the family Siphoviridae. (hw.ac.uk)
  • Research on phages is one of the most rapidly evolving fields of applied life sciences, mainly due to the potential of the bacterial viruses to act as an alternative to antibiotics and fight multidrug-resistant bacterial pathogens. (uni-goettingen.de)
  • Deciphering such mechanisms is of utmost importance for medical applications of bacterial viruses and re-evaluation of the phage cocktail concept. (uni-goettingen.de)
  • It mixes the filtrate of a stool with a bacillus culture and after culture obtains virgin spots similar to those obtained with pathogenic bacteria cultures in the grasshopper. (ouvry.com)
  • The phage was isolated from a soil sample that came from the Pine Grove on the campus of Hope College on 8/18/20 at 11:53 am. (phagesdb.org)
  • In therapy, phages are applied as cocktails comprising many different isolates to ensure high pathogen eradication efficacy, but possible viral interplay within the cocktail is currently not considered. (uni-goettingen.de)
  • This Institute is currently the only institution in the world to hold a bank of 6,000 phages, providing various healing cocktails to Ukraine, Poland and Russia. (ouvry.com)
  • Add or modify phage thumbnail images to appear at the top of this page. (phagesdb.org)
  • Always an entrepreneur, Félix d'Hérelle created in 1923 with one of his students the Eliava Institute dedicated to phage therapy in Tbilisi. (ouvry.com)
  • Until 1930, these were the glory days of phage therapy, but a few failures called into question the validity of this method. (ouvry.com)
  • The ability of phage FR38 to lysis an indigenous Salmonella P38 from faeces of diarrhea patient has been studied, however its effects on food and its safety are not studied yet. (ipb.ac.id)