Bacillus Phages: Viruses whose host is Bacillus. Frequently encountered Bacillus phages include bacteriophage phi 29 and bacteriophage phi 105.Bacteriophages: Viruses whose hosts are bacterial cells.Bacillus: A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.Bacillus subtilis: A species of gram-positive bacteria that is a common soil and water saprophyte.Bacillus cereus: A species of rod-shaped bacteria that is a common soil saprophyte. Its spores are widespread and multiplication has been observed chiefly in foods. Contamination may lead to food poisoning.Bacillus anthracis: A species of bacteria that causes ANTHRAX in humans and animals.Bacillus thuringiensis: A species of gram-positive bacteria which may be pathogenic for certain insects. It is used for the biological control of the Gypsy moth.Bacillus megaterium: A species of bacteria whose spores vary from round to elongate. It is a common soil saprophyte.Salmonella Phages: Viruses whose host is Salmonella. A frequently encountered Salmonella phage is BACTERIOPHAGE P22.Spores, Bacterial: Heat and stain resistant, metabolically inactive bodies formed within the vegetative cells of bacteria of the genera Bacillus and Clostridium.Pseudomonas Phages: Viruses whose host is Pseudomonas. A frequently encountered Pseudomonas phage is BACTERIOPHAGE PHI 6.Bacterial Proteins: Proteins found in any species of bacterium.Lysogeny: The phenomenon by which a temperate phage incorporates itself into the DNA of a bacterial host, establishing a kind of symbiotic relation between PROPHAGE and bacterium which results in the perpetuation of the prophage in all the descendants of the bacterium. Upon induction (VIRUS ACTIVATION) by various agents, such as ultraviolet radiation, the phage is released, which then becomes virulent and lyses the bacterium.Streptococcus Phages: Viruses whose host is Streptococcus.RNA Phages: Bacteriophages whose genetic material is RNA, which is single-stranded in all except the Pseudomonas phage phi 6 (BACTERIOPHAGE PHI 6). All RNA phages infect their host bacteria via the host's surface pili. Some frequently encountered RNA phages are: BF23, F2, R17, fr, PhiCb5, PhiCb12r, PhiCb8r, PhiCb23r, 7s, PP7, Q beta phage, MS2 phage, and BACTERIOPHAGE PHI 6.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Peptide Library: A collection of cloned peptides, or chemically synthesized peptides, frequently consisting of all possible combinations of amino acids making up an n-amino acid peptide.Coliphages: Viruses whose host is Escherichia coli.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Genes, Bacterial: The functional hereditary units of BACTERIA.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Bacteriophage Typing: A technique of bacterial typing which differentiates between bacteria or strains of bacteria by their susceptibility to one or more bacteriophages.Siphoviridae: A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by long, non-contractile tails.Myoviridae: A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by complex contractile tails.Bacteriophage lambda: A temperate inducible phage and type species of the genus lambda-like viruses, in the family SIPHOVIRIDAE. Its natural host is E. coli K12. Its VIRION contains linear double-stranded DNA with single-stranded 12-base 5' sticky ends. The DNA circularizes on infection.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Anthrax: An acute infection caused by the spore-forming bacteria BACILLUS ANTHRACIS. It commonly affects hoofed animals such as sheep and goats. Infection in humans often involves the skin (cutaneous anthrax), the lungs (inhalation anthrax), or the gastrointestinal tract. Anthrax is not contagious and can be treated with antibiotics.Inovirus: A genus of filamentous bacteriophages of the family INOVIRIDAE. Organisms of this genus infect enterobacteria, PSEUDOMONAS; VIBRIO; and XANTHOMONAS.Bacteriolysis: Rupture of bacterial cells due to mechanical force, chemical action, or the lytic growth of BACTERIOPHAGES.Hemolysin Proteins: Proteins from BACTERIA and FUNGI that are soluble enough to be secreted to target ERYTHROCYTES and insert into the membrane to form beta-barrel pores. Biosynthesis may be regulated by HEMOLYSIN FACTORS.Spores: The reproductive elements of lower organisms, such as BACTERIA; FUNGI; and cryptogamic plants.Operon: In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.Electronic Mail: Messages between computer users via COMPUTER COMMUNICATION NETWORKS. This feature duplicates most of the features of paper mail, such as forwarding, multiple copies, and attachments of images and other file types, but with a speed advantage. The term also refers to an individual message sent in this way.Microbiology: The study of microorganisms such as fungi, bacteria, algae, archaea, and viruses.Disease Outbreaks: Sudden increase in the incidence of a disease. The concept includes EPIDEMICS and PANDEMICS.Microbiological Techniques: Techniques used in microbiology.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.Journal Impact Factor: A quantitative measure of the frequency on average with which articles in a journal have been cited in a given period of time.Rhododendron: A plant genus of the family ERICACEAE.Internet: A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.Fatigue: The state of weariness following a period of exertion, mental or physical, characterized by a decreased capacity for work and reduced efficiency to respond to stimuli.Databases, Protein: Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.Sequence Analysis, Protein: A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.Systems Integration: The procedures involved in combining separately developed modules, components, or subsystems so that they work together as a complete system. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Proteome: The protein complement of an organism coded for by its genome.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.

Genetic and physical maps of the Bacillus subtilis chromosome. (1/348)

Sequencing of the complete Bacillus subtilis chromosome revealed the presence of approximately 4100 genes, 1000 of which were previously identified and mapped by classical genetic crosses. Comparison of these experimentally determined positions to those derived from the nucleotide sequence showed discrepancies reaching up to 24 degrees (approximately 280 kb). The size of these discrepancies as a function of their position along the chromosome is not random but, apparently, reveals some periodicity. Our analyses demonstrate that the discrepancies can be accounted for by inaccurate positioning of the early reference markers with respect to which all subsequently identified loci were mapped by transduction and transformation. We conclude (i) that specific DNA sequences, such as recombination hotspots or presence of heterologous DNA, had no detectable effect on the results obtained by classical mapping, and (ii) that PBS1 transduction appears to be an accurate and unbiased mapping method in B. subtilis.  (+info)

Selection of antibody probes to correlate protein sequence domains with their structural distribution. (2/348)

We propose a new approach that permits correlation of specific domains defined by their primary sequence with their location in the structure of complex macromolecular aggregates. It is based on the combination of well-established structural analysis methods that incorporate the use of overlapping peptides on cellulose membranes for the isolation and purification of specific antibodies from a polyclonal antiserum. Monospecific antibodies to the connector protein of bacteriophage phi29 were isolated from polyclonal antisera using a new development of the spotscan method. These antibodies can be purified in quantities that allow antigenicity testing in enzyme-linked immunosorbent assays, Western blotting and immunoprecipitations, demonstrating the specificity of this isolation procedure. This approach has allowed us to generate direct antibody probes for immunoelectron microscopy mapping of different connector protein domains in a low resolution three-dimensional epitope map.  (+info)

Virus assembly: Imaging a molecular machine. (3/348)

A recent structural study of a double-stranded DNA bacteriophage has provided remarkable new insights into the assembly of a complex virus particle and ushers in a new era in the imaging of non-icosahedral viruses.  (+info)

Nucleotide sequence of the Bacillus subtilis temperate bacteriophage SPbetac2. (4/348)

The Bacillus subtilis 168 chromosomal region extending from 184 degrees to 195 degrees, corresponding to prophage SPbeta, has been completely sequenced using DNA of the thermoinducible SPbetac2 mutant. This 134416 bp segment comprises 187 putative ORFs which, according to their orientation, were grouped into three clusters. Compared to its host, SPbetac2 is characterized by a lower G+C content, shorter mean ORF length, as well as a different usage of start codons. Nearly 75% of predicted ORFs do not share significant homologies to sequences in available databases. The only highly similar proteins to SPbetac2-encoded ones are host paralogues. SPbetac2 promoter regions contain SOS box consensus sequences and a repeated motif, designated SPbeta repeated element (SPBRE), that is absent from the host genome. Gene sspC, encoding the small acid-soluble protein C, that has been previously sequenced and mapped to the vicinity of the SPbeta region, was found to be part of the prophage.  (+info)

Sequence requirement for hand-in-hand interaction in formation of RNA dimers and hexamers to gear phi29 DNA translocation motor. (5/348)

Translocation of DNA or RNA is a ubiquitous phenomenon. One intricate translocation process is viral DNA packaging. During maturation, the lengthy genome of dsDNA viruses is translocated with remarkable velocity into a limited space within the procapsid. We have revealed that phi29 DNA packaging is accomplished by a mechanism similar to driving a bolt with a hex nut, which consists of six DNA-packaging pRNAs. Four bases in each of the two pRNA loops are involved in RNA/RNA interactions to form a hexagonal complex that gears the DNA translocating machine. Without considering the tertiary interaction, in some cases only two G/C pairs between the interacting loops could provide certain pRNAs with activity. When all four bases were paired, at least one G/C pair was required for DNA packaging. The maximum number of base pairings between the two loops to allow pRNA to retain wild-type activity was five, whereas the minimum number was five for one loop and three for the other. The findings were supported by phylogenetic analysis of seven pRNAs from different phages. A 75-base RNA segment, bases 23-97, was able to form dimer, to interlock into the hexamer, to compete with full-length pRNA for procapsid binding, and therefore to inhibit phi29 assembly in vitro. Our result suggests that segment 23-97 is a self-folded, independent domain involved in procapsid binding and RNA/RNA interaction in dimer and hexamer formation, whereas bases 1-22 and 98-120 are involved in DNA translocation but dispensable for RNA/RNA interaction. Therefore, this 75-base RNA could be a model for structural studies in RNA dimerization.  (+info)

Replication slippage of different DNA polymerases is inversely related to their strand displacement efficiency. (6/348)

Replication slippage is a particular type of error caused by DNA polymerases believed to occur both in bacterial and eukaryotic cells. Previous studies have shown that deletion events can occur in Escherichia coli by replication slippage between short duplications and that the main E. coli polymerase, DNA polymerase III holoenzyme is prone to such slippage. In this work, we present evidence that the two other DNA polymerases of E. coli, DNA polymerase I and DNA polymerase II, as well as polymerases of two phages, T4 (T4 pol) and T7 (T7 pol), undergo slippage in vitro, whereas DNA polymerase from another phage, Phi29, does not. Furthermore, we have measured the strand displacement activity of the different polymerases tested for slippage in the absence and in the presence of the E. coli single-stranded DNA-binding protein (SSB), and we show that: (i) polymerases having a strong strand displacement activity cannot slip (DNA polymerase from Phi29); (ii) polymerases devoid of any strand displacement activity slip very efficiently (DNA polymerase II and T4 pol); and (iii) stimulation of the strand displacement activity by E. coli SSB (DNA polymerase I and T7 pol), by phagic SSB (T4 pol), or by a mutation that affects the 3' --> 5' exonuclease domain (DNA polymerase II exo(-) and T7 pol exo(-)) is correlated with the inhibition of slippage. We propose that these observations can be interpreted in terms of a model, for which we have shown that high strand displacement activity of a polymerase diminishes its propensity to slip.  (+info)

Effect of the ionic environment on the molecular structure of bacteriophage SPP1 portal protein. (7/348)

Bacteriophage SPP1 portal protein is a large cyclical homo-oligomer composed of 13 subunits. The solution structure and assembly behavior of this protein with high-point rotational symmetry was characterized. The purified protein was present as a monodisperse population of 13-mers, named gp6H, at univalent salt concentrations in the hundred millimolar range (>/= 250 mM NaCl) or in the presence of bivalent cations in the millimolar range (>/= 5 mM MgCl2). Gp6H had a slightly higher sedimentation coefficient, a smaller shape-dependent frictional ratio, and a higher rate of intersubunit cross-linking in the presence of magnesium than in its absence. In the absence of bivalent cations and at univalent salt concentrations below 250 mM, the 13-mer molecules dissociated partially into stable monomers, named gp6L. The monomer had a somewhat different shape from the subunit present in the 13-mer, but maintained a defined tertiary structure. The association-dissociation equilibrium was mainly between the monomer and the 13-mer with a minor population of intermediate oligomers. Their interconversion was strongly influenced by the ionic environment. Under physiological conditions, the concentration of Mg2+ found in the Bacillus subtilis cytoplasm (10-50 mM) probably promotes complete association of gp6 into 13-mer rings with a compact conformation.  (+info)

Functional interactions between a phage histone-like protein and a transcriptional factor in regulation of phi29 early-late transcriptional switch. (8/348)

Protein p6 is a nonspecific DNA-binding protein occurring in high abundance in phage phi29-infected cells. Here, we demonstrate a novel role for this versatile histone-like protein: its involvement in regulating the viral switch between early and late transcription. p6 performs this role by exhibiting a reciprocal functional interaction with the regulatory protein p4, also phage encoded, which is required for repression of the early A2b and A2c promoters and activation of the late A3 promoter. On the one hand, p6 promotes p4-mediated repression of the A2b promoter and activation of the A3 promoter by enhancing binding of p4 to its recognition site at PA3; on the other, p4 promotes p6-mediated repression of the A2c promoter by favoring the formation of a stable p6-nucleoprotein complex that interferes with RNA polymerase binding to PA2c. We propose that the observed interplay between proteins p6 and p4 is based on their DNA architectural properties.  (+info)

Bacillus phage Azalea complete sequence, 161765 bp including 2452 bp terminal repeat AGGTTTTTCTCTGGTATACGCTTCATGCTAGATAGAGTAGATTGCATCCT TGTACACAAATATATACCCGTTCTACAAACTTGTACAGGTGTTTTAAGGT GTCTCACACTCCGTTACACGTCGTTTTACAAACTAACTGGTACAAATGTA TAAGAACAACAAAAAAGCCCTTCACGACAATGTGAGGGCTTTCCTGCTAT AATGTGGGGTTTTGCTAGTAGCTCACTGGAATGCAAGCGCAACTCCTAGT AGCTCACTGGAACAGAGCCGAAAATCCTTAGTAGCTCCCTAGAACGCATA GGCAACTGTATGGCTTGTCCCTTTAGCTCATGAGCAAATACGCCCATGGA GCCAATCGCAGCATCTGACAATTGTCAGACAATTACGACAACAGGTATCT ACAAAATGTGCATCGACCTGCTTAAACAGAATAGCACATCAAACGACAAT AATACAAGCATAGACAAATTAAAAGTTTTTTATACATATTCTGACTAACT AAATATTCTGACAATTAGCAGCGCATATAAATATCACAGGTCTGTATAAT TGTCAAGTTAAAATAGTATTGCGAATAGTCTGACAATTAGAAGGGTATGA GTATTGCAAATAGTGCTAATAGTCTGACTGTCATAATAGTATGAATTGTG CCATTGTTCGGATTATTCTAAATAGTCTGACAATTAAAATGAAAACCCTC GGGAAAATAGAGTTAATATTCTGACAATAATAATAGTCTGACAATAATAT ACGGACATTTAATAGTCTGACAATTAGAATGTTCGGACTAGTAAGAATAA TCTGACAGTTTGAATGTTATGAATAGTCTAAATAGTCTGACAATTGTAAG AGGCTGCAATAGAATTAACTGACAATTCAAACTATTCAATCAATTATGAT ...
Abstract: It has been a long-standing goal in systems biology to find relations between the topological properties and functional features of protein networks. However, most of the focus in network studies has been on highly connected proteins ("hubs"). As a complementary notion, we define bottlenecks as proteins with a high betweenness centrality, i.e., network nodes that have a high number of shortest paths going through them. We found that bottlenecks are key connector proteins with surprising functional and dynamic properties. In particular, bottlenecks are more likely to be essential proteins. In fact, in regulatory and other networks with directed edges, betweenness (i.e., "bottleneck-ness") is a much more significant indicator of essentiality than degree (i.e., "hub-ness"). Furthermore, bottlenecks correspond to the dynamic components of the interaction network - they are significantly less well co-expressed with their neighbors than non-bottlenecks, implying that expression dynamics is ...
An electrical connector with at least two connector portions. A first connector portion and a second connector portion may each be mountable on a respective surface, such as a printed circuit board. The first and second connector portions may each include a housing. The housing of the first connector portion may include a bore and an adjacent pin. The housing of the second connector portion may also include a bore and an adjacent pin. The pin of the first connector portion may be received in the bore of the second connector portion, and the pin of the second connector portion may be received in the bore of the first connector portion, when the two connector portions are mated to one another. In one embodiment, the first and second connector portions may be substantially identical to one another.
A connector system for use in coupling an implantable electrical lead to an implantable pulse generator, or other implantable electrical apparatus. The connector system includes a connector pin assembly, typically mounted to the implantable lead and a connector block, typically mounted to the electrical stimulator. The connector block is provided with a lumen, in which a plurality of resilient, elastomeric rings are linearly arranged. The rings are so sized as to frictionally engage a connector pin which is provided with a plurality of conductive pads, each coupled to a conductor within the implantable lead. Certain ones of the elastomeric rings are conductive, and engage with the conductive pads on the connector pin. Others of the rings are nonconductive and act as insulators and fluid seals. The connector pin assembly is also provided with a circumferential groove, which interlocks with the deflectable beam members of a retainer mounted to the connector block. An alternative connector block
A connector system for sterile connection includes a male type patient side connector having a tube connecting portion at a rear end portion thereof, a protective cap for the patient side connector, an inner cap held in the protective cap and including a ring-shaped portion that supports a disinfectant-impregnated member therein, and a female type circuit side connector including an outer cylinder and an inner cylinder fixed at one end of the outer cylinder, where the inner cylinder includes an internal end portion located inside the outer cylinder and an external end portion exposed outside the outer cylinder. When the protective cap is fitted with the patient side connector, the disinfectant-impregnated member contacts with the patient side connector. When the protective cap is removed therefrom, the inner cap becomes retained in the patient side connector. When such a patient side connector is connected with the circuit side connector, the internal end portion of the inner cylinder penetrates through
Hi, The second connect has been called Cannon and XLR, and is not generally recogniced as XLR, which is the product range name. Naming of the first connector as Cannon is at least for me and many others confusing. This is a good example how vendor name for a connector type is not a good thing. The first connector is a circular MIL-STD connector (dont remember the correct notation), and this is a product available from ITT Cannon as well as AMP. Cheers, Magnus On 06/22/2017 08:42 PM, Mark Spencer wrote: , Sorry if I have caused any un due confusion thru my perhaps incorrect use of the terms cannon and XLR. , The green connector with 4 separate female contacts is what I perhaps in correctly referred to as a cannon connector. The silver connector with 3 separate female contacts was what I perhaps incorrectly referred to as a XLR connector. , , Both were in use in my lab powering time nuts gear. , , , , , , , , , , , , , , , Mark Spencer , , mark at alignedsolutions.com , , , , ...
A return pad cable connector, in accordance with the present disclosure, for use with a disposable return pad, includes a cord having a conductive wire disposed therethrough which conductive wire interconnects the return pad cable connector to an electrosurgical energy source. The return pad further includes a connector operatively coupled to the cord, the connector having a conductive surface which is selectively engageable with a corresponding conductive surface disposed on the return pad, the conductive surface of the connector including a conductive adhesive disposed thereon and a non-conductive adhesive disposed above the periphery of the conductive surface of the connector for engagement with a corresponding non-conductive adhesive disposed above the periphery of the conductive surface of the return pad. The connector can include a magnet for magnetically coupling the connector to the conductive surface disposed on the return pad.
4KZ2: Crystal structure of 3WJ core revealing divalent ion-promoted thermostability and assembly of the Phi29 hexameric motor pRNA.
The PowerMod HP (high power) series connector family features touch-safe female housings, cable strain relief, and integral positive latches. These safety features, combined with the ease of connector assembly, establish a new standard for cost effective high power connectors. The series is RoHS compliant and rated up to 450 amps for appropriate applications at a 30ºC temperature rise. Using the companys patented Sterling contact technology, the PowerMod HP offers low electrical resistance, provides a minimum of 500 mating cycles, and is rated for circuit interruption (true hotplug). These connectors are IP 20 rated (touch safe) for user safety. The integral coding key provides further protection by allowing the user to configure unique mating of up to six individual connectors ...
A connector terminal in a cardiac stimulator for receiving a connector pin of an associated lead includes a hollow box member having opposite end walls defining a first bore for receipt of the connector pin. A ring member movably disposed within the box member defines a second bore generally aligned with the first bore for also receiving the connector pin. A threaded neck connected to the ring member extends perpendicular to the second bore and is received within a through bore of the box member that is disposed perpendicular to the first bore. An internally threaded cap threadedly engages the threaded neck and bears in a thrust bearing relationship on the box portion. As the cap is rotated, the ring portion is drawn upwardly as the cap presses downwardly on the box portion, causing the second bore to be moved transversely out of alignment with the first bore. A connector pin received through both first and second bores is clamped therebetween and retained against axial withdrawal from the
liquid tight conduit connector product listings on SeekPart.com - Choose quality liquid tight conduit connector products from large database of liquid tight conduit connector manufacturers and suppliers at SeekPart.com.
A tissue shaping device adapted to be disposed in a vessel near a patients heart to reshape the patients heart. The tissue shaping device includes a proximal anchor, a distal anchor, and a connector disposed between the proximal anchor and the distal anchor, the connector having a moment of inertia that varies along its length, such as by varying the connector thickness as a function of distance from one of its ends, with the smallest thickness being in the central portion of the connector.
How is UTP Medium Interface Connector abbreviated? U-MIC stands for UTP Medium Interface Connector. U-MIC is defined as UTP Medium Interface Connector very rarely.
Connector Mold Parts Suppliers ☆ Search 34 connector mold parts suppliers, manufacturers and exporters here at EC21 ☆ Choose quality connector mold parts suppliers now - EC21
Ive no experience running OpenJMS under GCJ, but the exception appears to be coming from the GCJ RMI implementation. You could work around this by using the TCP connector instead. -Tim ShashiKiran Kerur wrote: , , Hello, , I have installed Openjms in Linux and trying to look up connection , factory. , , Installed OPENJMS on Linux , , OpenJMS - openjms-0.7.7-alpha-2 , Linux - (Red Hat Enterprise Linux AS release 4 (Nahant Update 1) , , , openjms.xml , , ,ServerConfiguration host=host ip embeddedJNDI=true /, , , ,Connectors, , ,Connector scheme=tcp, , ,ConnectionFactories, , ,ConnectionFactory name=ConnectionFactory /, , ,/ConnectionFactories, , ,/Connector, , ,Connector scheme=rmi, , ,ConnectionFactories, , ,QueueConnectionFactory name=JmsQueueConnectionFactory /, , ,TopicConnectionFactory name=JmsTopicConnectionFactory /, , ,/ConnectionFactories, , ,/Connector, , ,/Connectors, , , , Client code to look up Connection Factory , import java.util.Hashtable; , import ...
0415DP Euro style dual pin connector is available in 2 - 3 poles and is able to handle high using large current levels. The connector is solidly constructed and has been rigorously tested.
Find USB Connectors on GlobalSpec by specifications. USB connectors are used with universal serial bus (USB) ports. They can be used to connect USB products together, or to connect USB wires and peripherals to other standard port types.
Get AS014-97PB Standard Circular Connectors specs, pricing, inventory availability, and more from TE Connectivity. Get a sample or request a quote.
Property details for 2345 E West Connector in Austell, GA 30106-6812. This property is one of many commercial real estate listings on Showcase.com, the premier location to search space for rent or commercial property for sale.
USD 21.99 Only, Buy 20FT 4mm2 PV Solar Cable w/MC4 Connector One On Each Cable M/F Black with Worldwide Free Shipping for All Orders at Tmart.com.
Cant say whether this type of hardware always stays the same in all cases. Chances are, it varies depending on suppliers/sources. In any case, the USB pin configuration of both 10-pin connectors (of which only 9 are usable and 8 actually wired) and 5-pin connectors (of which only 4 are wired) is the same. The sequence is black-green-white-red --- with the red wire on the last pin. Just check the motherboard manual carefully and compare it to the connectors before plugging it in. Comparing against the plug from a back-panel USB expansion port may also be helpful (such devices come bundled with motherboards ...
Cant say whether this type of hardware always stays the same in all cases. Chances are, it varies depending on suppliers/sources. In any case, the USB pin configuration of both 10-pin connectors (of which only 9 are usable and 8 actually wired) and 5-pin connectors (of which only 4 are wired) is the same. The sequence is black-green-white-red --- with the red wire on the last pin. Just check the motherboard manual carefully and compare it to the connectors before plugging it in. Comparing against the plug from a back-panel USB expansion port may also be helpful (such devices come bundled with motherboards ...
TY - JOUR. T1 - Models of bacteriophage DNA packaging motors. AU - Serwer, Philip. PY - 2003/3/1. Y1 - 2003/3/1. N2 - An ATP-dependent motor drives a DNA genome into a bacteriophage capsid during morphogenesis of double-stranded DNA bacteriophages both in vivo and in vitro. The DNA molecule enters the capsid through a channel in the center of a symmetric protein ring called a connector. Mechanisms in two classes have been proposed for this motor: (1) An ATP-driven rotating connector pulls a DNA molecule via serial power strokes. (2) The connector rectifies DNA motion that is either thermal, biased thermal, or oscillating electrical field-induced (motor-ratchet hypothesis). Mechanisms in the first class have previously been proposed to explain the detailed structure of DNA packaging motors. The present study demonstrates that the motor-ratchet hypothesis also explains the current data, including data in the following categories: biochemical genetics, energetics, structure, and packaging ...
Recently Added Phages. Bucket Hilltop Retreat Clive Merkle Recently Modified Phages. T3mpyL1t Chrisss Coars20 Aubrey Misaki Recently Finished Phages. Zirkle (None) Ilona (C1) Azalea (C1) Ampersand (C3) FreightTrain (C1) ...
Construction and Single molecule studies on phi29 DNA-packaging motor for applications in nanotechnology, therapy, diagnosis, and drug ...
Titering of Bacterial Viruses Related protocols: Preparation of Phage Stocks Commonly Used Media for Phage Growth Agar Overlay Technique When an individual bacterial virus grows in a bacterial host suspended in a top agar lawn, its progeny infect and lyse the surrounding host cells. This causes the appearance of a hole or plaque in…
documentclass{article} \usepackage{newtxtext,newtxmath} \usepackage{amsmath} \DeclareMathOperator{\sn}{sn} \DeclareMathOperator{\cn}{cn} \DeclareMathOperator{\dn}{dn} \begin{document} \begin{equation} \begin{gathered} \omega^3x_{4}(s) = \begin{minipage}[t]{.7\displaywidth} \raggedright\linespread{1.2}\selectfont \begin{math} x_4(\varphi_0) -2 \cos^3 ( \phi )sk^2 +2k^2x_1(\varphi_0) \cos^2( \phi ) +4 \cos^3 ( \phi )E ( s ) k^2+x_3(\varphi_0)\sin ( \phi ) s - \cos^3( \phi ){s}^2E( s ) +2 \cos^3 ( \phi )s ( E (s) ^2 +\cos ( \phi ) {s}^2E ( s ) - 2x_3(\varphi_0)\sin ( \phi ) E ( s ) -1/6\cos ( \phi ) {s}^3-4/3 \cos^3 ( \phi ) E ( s ) ^3 -1/2 x_1(\varphi_0) \cos^2 ( \phi ){s}^2-2 x_1(\varphi_0) \cos^2 ( \phi ) E ( s ) ^2 -2\cos ( \phi) s E ( s ) ^2 -2x_1(\varphi_0)sE( s ) + k\sin (\phi ) \cn(s) {s}^2 \cos^2( \phi ) +2 \cos^3 ( \phi )sk^2 \sn(s) ^2 -2/3\cos ( \phi) E ( s) +4/3k^3\cn(s) \sn(s) ^2\sin( \phi ) \cos^2 ( \phi )+2k\sin ( \phi ) \cn(s) +2/3\cos ( \phi ) s-8/3\cos ( \phi ) k^2\dn (s) \sn(s) ...
China Eight in Two Rows 8ports Degree90/180 Female BNC Connector, Find details about China BNC Connector PCB Mount, Female BNC Connector from Eight in Two Rows 8ports Degree90/180 Female BNC Connector - Renhotec Hardware Electronics Co., Ltd.
China Waterproof Straight Bulkhead Female BNC Connectors IP68, Find details about China BNC Connector, BNC Connectors IP68 from Waterproof Straight Bulkhead Female BNC Connectors IP68 - Renhotec Hardware Electronics Co., Ltd.
This collection of reviews focuses on the most exciting areas of DNA packaging at the current time. Many of the new discoveries are driven by the development of molecular or imaging techniques, and these are providing insights into the complex world of chromatin. As these new techniques continue to improve, we will be able to answer many of the questions we have now, while likely raising many new ones. ...
Buy Hollister Extension Tubing with Connector of HOLLISTER INCORPORATED. On Sale Urinary Tubing and Connectors products. Hollister Extension Tubing with Connector effectively manages high flow with wide-bore tubing. Security and safety are achieved by the non-kink tubing. Easy to adapt the leng...
faucet connector hose product listings on SeekPart.com - Choose quality faucet connector hose products from large database of faucet connector hose manufacturers and suppliers at SeekPart.com.
A spinal fixation system includes a first clip body having a pair of opposed spaced apart arcuate rod engaging hooks depending from a first side thereof for engaging a first elongated spinal rod, and a transverse connector extending laterally from a second side thereof; a second clip body having a pair of opposed spaced apart arcuate rod engaging hooks depending from a first side thereof for engaging a second elongated spinal rod, and a transverse connector extending laterally from a second side thereof; and a fastener for securing the transverse connector of the first elongated clip body and the transverse connector of the second elongated clip body to one another.
China Test Connector manufacturers - Select 2018 high quality Test Connector products in best price from certified Chinese L Connector manufacturers, D Connector suppliers, wholesalers and factory on Made-in-China.com
Robokits India Cable Drag Chain Wire Carrier with end connectors 15x20mm 1Meter [RKI-2652] - 15mm x 20mm L1000mm Cable Drag Chain Wire Carrier with end connectors for CNC Router Machine Tools, comes with a 2Pcs Connector (In the drag chains both ends).
Find information for part 08690940 from the Connectors Series Connectors, or search for Other Products and Accessories and more from Littelfuse.
How we see things around us without noticing it! We know the peculiar habit of the sunflower. How it moves with the movement of the sun everyday. But if
30AWG Connector Contacts product list at Newark element14. Competitive prices from the leading 30AWG Connector Contacts distributor. Check our stock now!
# Intelligent charger (manufacture part#H01680015-US-1) designed for 14.8V (4 cell pack , so called 14.4V) Li-Ion Battery packs that use 2 pins connector. # Worldwide input AC power from 110V --- 240V. # Included one Connector Adaptor: from 2 pins Female Universal to Clip. # 1500 mA (1.5A ) constant charging current for faster charging, save your much more time. # Charging time for 4000mAh battery pack is about 2.6 Hrs. ( Please use it to charge Li-Ion battery with capacity > 1500mAh)
A universal connector for a blood tubing set having a blood tube attached to one end portion and alternative means on the other end portion of said connector for selectively connecting and locking to
Screw Connector Tool from PerkinElmer. An essential option from our full range of Connectors for FIAS 100 from our high quality Atomic Absorption (AA) line.
New and Refurbished Dental Equipment at Affordable Prices 6 Pin Swivel Connector (ISO-C) Multiflex™ [VKS6] - 6 Pin Swivel Connector ISO-C 6 pin swivel with bulb.
Überblick Eukaryonten haben im Vergleich zu Prokaryonten größere Genome. Um ihr Genom in einer Zelle zu speichern, müssen Eukaryonten ihre DNA...
The price of 16mm to 16mm Clamp Single Diaphragm Tight Motor Shaft Connector Coupling Joint is fair while it is also of high value. You can find whatever in you mind at a low price with free shipping at sourcingmap.
VWR Tapered Connectors and Quick Disconnects, Quick Disconnect - Model 82017-980 : Polypropylene and Polyethylene Construction Four Configurations
The Aras Office Connector provides a convenient way to manage Microsoft Office documents in Aras, directly from the user interface of the Office applications.
The Aras Office Connector provides a convenient way to manage Microsoft Office documents in Aras, directly from the user interface of the Office applications.
Help us envision key elements necessary to bring The Promise of Urban Connectors in Pioneer Square into reality to further enhance the experience of Seattles Central Waterfront and neighboring communities. Belltown and Pike Place Market/West Edge areas will be discussed in upcoming sessions ...
Buy 70 Pcs Non-Insulated Test Electrical Alligator Clip Clamp Connector from sourcingmap,you can get reasonable price and fast response worldwide. Please be assured all the products here are quality garanteed.
The Anritsu Calibration kits contain all the precision components and tools required to calibrate your VNA or VNMS for 12-term error-corrected measurements in the connector style of your choice. Components are included for calibrating male and femal
50 long connecting pieces (~1, flexible) work to further your investigation of organic and inorganic compounds. Work with all of our atomic model kits. Contains small items.
BELKIN CABLE USB2.0/ USB-C TO USB-A UPTO 480 MBIT/ S/ 3000MA/ BLACK/ 1M CHAR (F2CU032BT06-BLK) - Type: USB - Connector 1: USB A - Connector 2: USB C
Hi, Ive bought a new HDD Seagate 1Tb, but i didint notice that it was Sata 3. Ok, seeing that i can place it on sata 2 connectors. The problem is that when i format it in the fast formatting&q
Message :heavy series over braided interlocked Liquid tight Conduit,swivel flexible conduit fittings HEAVY SERIES FLEXIBLE SHEATH connector for industry ...
To provide for the easy removal of a damaged or broken pipe, in any case where there is a considerable run of pipe or where there are several fittings, a Connector (Fig. 103) should always be inserted...
What is everyone doing with the battery and ESC connections on the 600? Is anyone using the included connectors or changing them for something else?
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
ID O64130_BPSPB Unreviewed; 270 AA. AC O64130; DT 01-AUG-1998, integrated into UniProtKB/TrEMBL. DT 01-AUG-1998, sequence version 1. DT 07-JUN-2017, entry version 62. DE SubName: Full=YoqV protein {ECO:0000313,EMBL:AAC13090.1}; GN Name=yoqV {ECO:0000313,EMBL:AAC13090.1}; OS Bacillus phage SPbeta (Bacillus phage SPBc2) (Bacteriophage SP-beta). OC Viruses; dsDNA viruses, no RNA stage; Caudovirales; Siphoviridae; OC Spbetavirus. OX NCBI_TaxID=66797 {ECO:0000313,EMBL:AAC13090.1, ECO:0000313,Proteomes:UP000009091}; OH NCBI_TaxID=1408; Bacillus pumilus (Bacillus mesentericus). OH NCBI_TaxID=1423; Bacillus subtilis. RN [1] {ECO:0000313,Proteomes:UP000009091} RP NUCLEOTIDE SEQUENCE. RX PubMed=9465078; DOI=10.1073/pnas.95.4.1692; RA Lazarevic V., Soldo B., Dusterhoft A., Hilbert H., Mauel C., RA Karamata D.; RT "Introns and intein coding sequence in the ribonucleotide reductase RT genes of Bacillus subtilis temperate bacteriophage SPbeta."; RL Proc. Natl. Acad. Sci. U.S.A. 95:1692-1697(1998). CC ...
The LC connector developed by Lucent Technologies and shown in Fig.3.10 is a more evolutionary approach to achieving the goals of a SFF connector. The LC connector utilizes the traditional components of a SC duplex connector having independent ceramic ferrules and housings, with the overall size scaled down by one-half. The LC family of connectors includes a stand-alone simplex design; a "behind the wall" (BTW) connector and the duplex connector available in both single-mode and multimode tolerances are all designed using the RJ-style latch.. The outward appearance and physical size of the LC connector varies slightly depending on the application and vendor preference. Although all the connectors in the LC family have similar latch styles modeled after the copper RJ latch, the simplex version of the connector has a slightly longer body than either the duplex or BTW version, and the latch has an additional latch actuator arm that is designed to assist in plugging as well to prevent snagging in ...
Connectors are designed to join tubing together or to facilitate the joining of tubing to other fluid pathway components. IDEX offer multiport connectors with different thread and port configurations to meet nearly all system requirements and connection needs. Some of their connectors feature a true ZDV (Zero Dead Volume) internal configuration that helps minimize the formation of dead volume in the fluidic pathway. Their versatile adapters help bring two connectors with different configurations together. Connectors are manufactured from 316 stainless steel or from inert polymers to ensure chemical compatibility with the fluid passing through. Peristaltic tube connectors are ideal for making connections with soft-walled, peristaltic tubing. IDEX extensive line of connectors includes tees, crosses, luer adapters, barbed and threaded Adapters and a variety of other options. ...
China 2.54mm Pitch FPC Connector (HY-254YM40), Find details about China FPC Connector, Connector from 2.54mm Pitch FPC Connector (HY-254YM40) - ShenZhen Homyet Parts Electronic Co., Ltd.
A card edge connector for printed circuit boards is disclosed which employs a double-decker design. The connector may have the same length and width as conventional connectors used on Industry Standard Architecture (ISA) personal computers but is deeper. Conventional 8- and 16-bit ISA accessory circuit boards may be plugged into a corresponding socket which is also disclosed herein until they reach a stop upon which they rest, working as they would in an ISA personal computer. 32-bit Extended Industry Standard Architecture accessory circuit boards have a second row of connectors and a notch so they slide farther down into the socket, lining up with a second row of contacts. This design uses less physical space for connectors, allowing more room for logic circuitry on the motherboard.
A connection device for connecting a headgear and a mask and a system for supplying a flow of gas to a patient that incorporates such a connection device. The connection device allows independent rotation of each of two independently disconnecting headgear connectors. The gas delivery mask includes a shell, a first connector associated with the shell, a second connector connected to a headgear and realeasably and rotateably connected to the first connector.
Devices are available in a standard version for data transfer rates of up to 3.5Gbps and a high-speed version that can master up to 20Gbps and above.. With a highly flexible design concept, the pin assignments of the components can be adjusted to future demands.. The connector interface is designed to support demand for higher signal density in small-system slot pitches.. The Z-Pack Slim UHD connector system is upgradeable and fits in 15mm-system slot-pitch applications and above.. The connector features a high contact density (55 pins/cm2) and high signal performance.. The board designer can implement pin assignments in such a way that they fulfil the application signal requirements for today or for at a later point in time during the applications project life.. A 2.0 differential pair-per-column assignment, for example, results in 24 differential pairs per connector module.. If signal speeds of over 20Gbps are specified, a 1.5 differential pair-per-column assignment can be selected.. Two ...
A medical graft connector or plug is made, for example, by cutting end portions of a tube of highly elastic material axially at numerous locations spaced circumferentially around the tube to produce a plurality of fingers which extend axially from each end of an uncut medial portion of the tube. The fingers are deflected radially outwardly from the medial portion and set in that condition. For a graft connector, the medial portion is coaxially connected to an end portion of a tubular graft. The connector is then installed through an aperture in the side wall of a patients tubular body conduit, for example, by using a delivery tube in which the fingers are elastically deflected back to approximately their initial positions. When the delivery conduit is withdrawn from the connector, the fingers spring out to engage the inner and outer surfaces of the body conduit wall. For a plug, the medial portion is occluded and then the structure is installed through the aperture to be plugged in a manner similar to
China Model Connector manufacturers - Select 2017 high quality Model Connector products in best price from certified Chinese L Connector manufacturers, D Connector suppliers, wholesalers and factory on Made-in-China.com
90 Degree Non-metal Liquid-tight Conduit Rapid Connectors (RCB90 Series),complete details about 90 Degree Non-metal Liquid-tight Conduit Rapid Connectors (RCB90 Series) provided by KT-Flex Co., Ltd.. You may also find other latest 90 Degree Non-metal Liquid-tight Conduit Rapid Connectors (RCB90 Series) selling and buying leads on weiku.com.
NIH thinks that a biological motor from bacteriophage phi29 indeed has a potential for the future of nanomedicine, for a number of reasons. The press offic
Buy 6026144PWCOND1, Circular connector, 602GB (MIL-DTL-26482), size 14, pins, 4 contacts, Olive Drab Cadmium or other Connector products from Acal BFi UK. Get a quote from Europes leading industrial electronics and photonics specialist today.
Mil-Spec Connectors from the EngNet Engineering directory and search engine. Find suppliers, manufacturers and distributors for Mil-Spec Connectors.
SELECTIVE AMPLIFICATION OF OVERLAPPING AMPLICONS | METHODS AND COMPOSITIONS FOR LABELING TARGETS | DNA DETECTION METHOD AND DNA DETECTION DEVICE | ROLLING CIRCLE AMPLIFICATION METHOD | METHOD AND DEVICE FOR DETECTING MOLECULES OR PARTICLES USING FRACTIONALIZED VOLUMES |
In another TTI Insights post on the tti|MarketEye blog, Lew LaFornara, who is TTIs Vice President of Product Management for Connectors, announces reduced lead times for value added connector assembly for TTI customers.
Looking for cheap welding machine quick connectors, coupler devices, sets. Terminals,Red and black cable connectors,100Amp 200Amp 300Amp 400Amp 500Amp 600Amp Welding and cutting Tools store
A surgical connector for cable comprises a body having a pair of opposed ends and a first side extending between the ends. Outwardly extending projections adjacent the first side and ends may be provided to facilitate securance of the connector in a desired position. Cable-receiving bores extend from each of the ends inwardly toward each other, typically at an obtuse angle of less than 180 . The bores have inner ends that communicate with a central aperture which is open to at least the side of the body which is opposed to the first side. Alternatively, the central aperture may extend entirely through the body and be open to both the first side and the opposed side. Also, a novel retention technique for cable is disclosed, for more general use, if desired.
The PerkinElmer UniFit Connector with 1.3mm OD x 0.50mm ID x 700mm Long Sample Tube is replacement connector and sample tubing for U-Series concentric nebulizers.
Buy the Countryman MEMWS05B-MI EMW Omnidirectional Lavalier with Screw on TA4F Connector for Mipro, Black at Full Compass. The MEMWS05B-MI has a connector that fits the Mipro bodypacks ACT707TS(TE), ACT801TS(TE), MT103, MT303, MT801 and MT808.The EMW omni lavalier microphone was designed for extreme conditions, the E
The linear model connector is quite different - its a proof of concept (like the New York song: if you can make it here, you can make it anywhere). The structure of the output data from a linear model procedure is nuanced. This means that if I can write a fully functional and correct syntax connector for the linear model (which I have already done in the current software version), then it is very plausible to do so for any statistical procedure: mixed model, factor analysis, survival analysis, etc ...
Lost suction to drain into hose connector Dehumidifer was draining into the hose connector until I cleaned the vent. - LG DH30 GoldStar Dehumidifier question
Jumper Assemblies - hose conduit with optical or electrical connectors at either end. Key elements in both optical and electrical distribution systems are:. • Jumper Assemblies - Hose conduit with optical or electrical connectors at either end.. • Distribution Harness - Can have multiple "legs" with either connectors or sensors terminated to the end of each leg.. • Umbilical Termination Assemblies - Provide the interface between the optical or electrical element of the umbilical and SEACON wetmate connector(s).. • Cable Hang-Offs - Specially designed cable strength member terminations that provide support for the individual cable elements at the top side of some umbilical cables.. • Abandonment Caps or Connectors - When the top side of an umbilical needs to be abandoned subsea for a period, these provide watertight protection of the umbilical cable.. Although many design features make these products successful, highlights for Jumper Assemblies/Distribution Harnesses include:. • ...
You can use this Beadalon Gold-Plated Medium Quick Link Connector to bring together unique design elements. This Beadalon Gold-Plated Medium Quick Link Connector features a unique, bean-like shape with an open end. Use it to connect links or jump rings in interesting ways. Put one link or jump ring on one end of the bean shape and pinch half of the connector quick link shut around it using pliers. Add the other link or jump ring to the other end of the bean shape and do the same. You can even use it as a bail if you want to display a link as a pendant. This medium connector quick link will give you room to work with a wide variety of components. It shines with luxurious golden color ...
In a plug connector for electronic circuit elements, comprising an elongated housing made of insulating material and contact elements received therein, at least a portion of the contact elements are p
PIM product data: StarTech.com Cat6 Patch Cable with Molded RJ45 Connectors - 50 ft. - Blue C6PATCH50BL networking cables StarTech.com Cat5 Ethernet Cable - 50 ft - Blue - Patch Cable - Molded Cat5 Cable - Long Network Cable - Ethernet Cord - Cat 5 Cable - 50ft, compare, review, comparison, specifications, price, brochure, catalog, product information, content syndication, product info, product data, datasheet
I want to double check on the mechanical spec. As it is written, the CSI port is 20mm from the bottom of the board. Its quite in the way, especially with respect to real estate for connectors exiting on the same side as the USB connector. For my board, I moved the CSI connector down about 10mm, which allows me to put three connectors on this side, but still lines up east-west with the CSI cable and easy feed through the slot. See image below ...
Device connector for front wall, straight, shielded: Yes, SPEEDCON locking, M23, No. of pos.: 7, type of contact: Pin, Crimp connection, Axial seal, Central fastening M20 x 1.5
Changing market conditions, shifting base material costs, lead time volatility and the constant challenge of forecasting bring out the best in speciality, authorized distributors like TTI. We are even more committed to offering our expertise and increasing levels of support to our purchasing professional partners. There are many questions we are asked when it comes to supporting the connector buyer and in this article Ill address the most common ones.
Global acute care needleless connectors market was valued at USD 494.9 million in 2013 and is expected to grow at a CAGR of 10.2% from 2014 to 2020, to reach an estimated value of USD 972.0 million in 2020
A team of Chinese and Danish researchers has identified 500 new species of gut-residing microorganisms and 800 new bacterial viruses which could attack them. The findings could lead to promising new t...
Connector: 362..., 363.... Pole number: 1-12. Pitch: 5,0 mm. State of delivery of connectors: in chain. Processable conductor: discrete conductor, notched flat cable 5.0 mm ...
Hyphens and dashes are internal punctuation marks used for linkage and clarity of expression. | The hyphen is a connector; it may join
A nanomotor is a molecular or nanoscale device capable of converting energy into movement. It can typically generate forces on the order of piconewtons. While nanoparticles have been utilized by artists for centuries, such as in the famous Lycurgus cup, actual research into nanotechnology did not come about until recently. In 1959, Richard Feynman gave a famous talk entitled "Theres Plenty of Room at the Bottom" at the American Physical Societys conference hosted at Caltech. He went on to wage a scientific bet that no one person could design a motor smaller than 400 µm on any side. The purpose of the bet (as with most scientific bets) was to inspire scientists to develop new technologies, and anyone who could develop a nanomotor could claim the $1,000 USD prize. However, his purpose was thwarted by William McLellan, who fabricated a nanomotor without developing new methods. Nonetheless, Richard Feynmans speech inspired a new generation of scientists to pursue research into nanotechnology. ...
TY - JOUR. T1 - Proliferation and differentiation characteristics of neural stem cells during course of cerebral cortical histogenesis. AU - Mitsuhashi, Takayuki. AU - Takahashi, Takao. PY - 2016/1/1. Y1 - 2016/1/1. N2 - Recent advancements in the research field of stem cell biology have enabled the realization of regenerative medicine in various systems of the body, including the central nervous system. However, fundamental knowledge regarding how neural stem cells divide and generate young neurons in mammals, especially in vivo, is still inadequate. In this article, we shall summarize the concept of cell cycle/division of neural stem cells that generate projection neurons in the murine cerebral cortex. We shall also review the molecular mechanisms that modulate the critical parameters related to the cell cycle regulatory mechanisms, with special reference to the cell cycle regulatory protein p27Kip1, an inhibitor of progression of the cell cycle at the G1 phase. A better understanding of the ...
The demand for rapid and sensitive bacterial detection is continuously increasing due to the significant requirements of various applications. In this study, a terahertz (THz) biosensor based on rolling circle amplification (RCA) was developed for the isothermal detection of bacterial DNA. The synthetic bact
A cell-free system has been developed from cells of an Escherichia coli strain, carrying cloned genes 1 (DNA polymerase) and 8 (terminal protein) of bacteriophage PRD1, that catalyzes protein-primed DNA synthesis. DNA synthesis in vitro is entirely dependent upon the addition of PRD1 DNA-terminal protein complex as template, Mg²⁺, and four deoxyribonucleoside triphosphates. The origin and direction of PRD1 DNA replication in vitro were determined by restriction enzyme analysis of ³²P-labeled PRD1 DNA synthesized in this system. Replication starts at either end of the linear PRD1 DNA template. Analysis by alkaline sucrose gradient centrifugation and alkaline agarose gel electrophoresis of DNA synthesized in vitro showed that full-length PRD1 DNA is synthesized. DNA elongation in this system is inhibited by the drug aphidicolin. On the other hand, DNA initiation is inhibited by phenylglyoxal, an arginine-specific α-dicarbonyl reagent. In vitro studies have also demonstrated that linear ...
Global Thermoform Sealed Packaging Market Report illustrates the present development status of Thermoform Sealed Packaging along with the growth of Thermoform Sealed Packaging expected during the forecast period during 2017-2022. Thermoform Sealed Packaging Market analyses the industry based on different factors like growth trends, consumer volume, Thermoform Sealed Packaging market size and demand and supply status. Thermoform Sealed Packaging Market is a beneficial research material which conducts a competitive analysis of the Thermoform Sealed Packaging market. This report also portrays the Thermoform Sealed Packaging industry structure based on the product cost, major industry players, product applications, import/export details and Thermoform Sealed Packaging market competition.. A complete study of Thermoform Sealed Packaging based on emerging and dominant market segments, major geographical regions, supply chain analysis, Thermoform Sealed Packaging revenue analysis will drive important ...
We report here the complete EM structure of a lactococcal phage determined by single-particle analysis. Phage p2 is the flagship of the 936 group, which are the most prevalent lactococcal phages in industrial dairy fermentations worldwide. This phage is highly virulent and requires Ca2+ to infect specific L. lactis cells, which is in contrast with the less prevalent lactococcal phages belonging to the P335 subgroup II (e.g., TP901-1 and Tuc2009) (15).. The shape of p2 icosahedral capsid is comparable to that of other siphophages. The capsid pentons are, however, more prominent than those of phage TP901-1 but akin to those of coliphage HK97. In contrast, the size of the p2 portal protein (ORF-4) is among the smallest, particularly in comparison to those of phage TP901-1 and Bacillus phage SPP1 (Table 3). The two putative head completion proteins of p2 (ORF-8 and ORF-9) are comparable to those of phage SPP1. The fit of the SPP1 portal and head completion protein 1 (gp15) into the p2 connector EM ...
0026] Referring now to FIG. 2, therein illustrated is an example of an embodiment of a rotatable electrical connector 200. In this example of connector 200, a base housing 205 has a bottom surface 210. A top housing 220 is rotatably engaged with base housing 205. A plurality of contact pads 214 are arranged radially within base housing 205. This example of connector 200 includes five contact pads 214, with four of them being visible in FIG. 2. Contact pads 214 each have a top surface 216 including symmetrical slopes defining a central, shallow channel therein; and pads 214 each also have a bottom surface 218. With reference to FIGS. 2 and 2A, a plurality of signal pins 212A-E are individually associated with contact pads 214, with each signal pin 212A-E correspondingly projecting outwardly from bottom surface 218 of an associated contact pad 214 and outwardly from bottom surface 210 of base housing 205. This example of connector 200 includes six signal pins: 212A-E, and a ground pin 212G as will ...

*Carl Woese

ISBN 978-0-199-73438-2. Woese, C. R. (1960). "Phage induction in germinating spores of Bacillus megaterium". Radiation research ...

*Spbetalikevirus

... the type species Bacillus phage SPbeta. Group: dsDNA Order: Caudovirales Family: Siphoviridae Genus: Spbetalikevirus Bacillus ... The type species, Bacillus phage SPbeta, has been fully sequenced. It has about 134k nucleotides, with 185 proteins. The ... phage SPbeta Spbetalikeviruses are nonenveloped, with a head and tail. The head is about 81 nm in diameter. The tail is long, ...

*Spounalikevirus

Bacillus phage SP8 was assigned to the family Myoviridae in 1995. Bacillus phage SPO1 was assigned to the genus SPO1-like ... Caudovirales in 1998 SPO1-like phages were renamed SPO1-like viruses in 1999 Bacillus phage SP8 was merged into Bacillus phage ... There is currently only one species in this genus: the type species Bacillus phage SPO1. Group: dsDNA Order: Caudovirales ... Bacillus phage SPO1 Viruses in Spounalikevirus are non-enveloped, with head-tail geometries, and T=16 symmetry. The diameter is ...

*Thymidylate 5'-phosphatase

Purification and properties of an enzyme found after infection of Bacillus subtilis with phage SP5C". J. Biol. Chem. 241 (21): ...

*DCTP deaminase

Tomita F, Takahashi I (1969). "A novel enzyme, dCTP deaminase, found in Bacillus subtilis infected with phage PBS I". Biochim. ...

*Φ29 DNA polymerase

Vlcek C, Paces V (1986). "Nucleotide sequence of the late region of Bacillus phage Φ29 completes the 19,285-bp sequence of Φ29 ... "RNA polymerase binding sites and transcription map of the DNA of Bacillus subtilis phage phi29". J Mol Biol. 127 (4): 411-36. ... This was demonstrated by the ability of the enzyme to continue to copy the singly primed circular genome of the M13 phage more ... Blanco L, Bernad A, Lázaro JM, Martín G, Garmendia C, Salas M (May 1989). "Highly efficient DNA synthesis by the phage Φ29 DNA ...

*Phi29likevirus

Bacillus phage B103 Bacillus phage GA-1 Bacillus phage phi29 Kurthia phage 6 Phi29likeviruses are nonenveloped, with a head and ... There are currently four species in this genus, including the type species Bacillus phage phi29. Group: dsDNA Order: ... Phi29likevirus (synonyms Phi29-like phages, Phi29-like viruses) is a genus of viruses in the order Caudovirales, in the family ... According to ICTV, the genus Phi29likevirus was first accepted under the name phi29-like phages in 1996, assigned only to ...

*Phi29 holin family

... gene 14 of Bacillus subtilis phage phi 29 encodes the functional homolog of lambda S protein". Journal of Bacteriology. 175 (4 ... The phage φ29 gene 14 encodes the protein GP14 (TC# 1.E.10.1.1) which is required for phage φ29-promoted host cell lysis. When ... It is identical to the phage PZA lysis protein and nearly identical to the phage B103 lysis protein. It is 34% identical to the ... gene 14 of Bacillus subtilis phage phi 29 encodes the functional homolog of lambda S protein". Journal of Bacteriology. 175 (4 ...

*Catalytic triad

Phage GA-1 neck appendage CIMCD self-cleaving protein (Bacillus phage GA-1) ...

*Yersinia pestis

"A horizontally acquired filamentous phage contributes to the pathogenicity of the plague bacillus". Mol Microbiol. 63 (4): 1145 ... Howard-Jones N (1973). "Was Kitasato Shibasaburō the discoverer of the plague bacillus?". Perspect Biol Med. 16 (2): 292-307. ...

*DNA

α-glutamythymidine is found in the Bacillus phage SP01 and 5-dihydroxypentyluracil is found in the Bacillus phage SP15. The ... α-putrescinylthymine occurs in both the genomes of the Delftia phage ΦW-14 and the Bacillus phage SP10. ... 5-hydroxymethyldeoxyuracil (hm5dU) is also known to replace thymidine in several genomes including the Bacillus phages SPO1, ϕe ... Another phage - Staphylococcal phage S6 - has been identified with a genome where thymine has been replaced by uracil. ...

*N-acetylmuramoyl-L-alanine amidase

"Purification and characterization of two phage PBSX-induced lytic enzymes of Bacillus subtilis 168: an N-acetylmuramoyl-L- ... Autolysins and some phage lysins are examples of N-acetylmuramoyl-L-alanine amidases. Phage lysins Autolysins PGLYRP2 Campbell ... Herbold DR, Glaser L (1975). "Bacillus subtilis N-acetylmuramic acid L-alanine amidase". J. Biol. Chem. 250 (5): 1676-82. PMID ...

*Molecular microbiology

The first DNA-genome project to be completed was the phage Φ-X174 in 1977. Φ29 phage, a phage of Bacillus, is a paradigm for ... Bacteriophages, or "phage", have been fundamental in the development of the science of molecular biology and became "model ... ISBN 978-1-904455-14-1. Graumann P (editor). (2007). Bacillus: Cellular and Molecular Biology. Caister Academic Press. ISBN 978 ...

*Ultraviolet germicidal irradiation

System validation uses non-pathogenic surrogates such as MS 2 phage or Bacillus subtilis to determine the Reduction Equivalent ...

*Prohead

... as seen with the prohead of Bacillus subtilis phage φ29. Catalano, C. E.; Cue, D.; Feiss, M. (1995). "Virus DNA packaging: the ... strategy used by phage λ". Molecular Microbiology. 16 (6): 1075-1086. doi:10.1111/j.1365-2958.1995.tb02333.x. Murialdo, H.; ...

*Sponge (material)

... and MS2 phages, but Bacillus cereus spores required four minutes. After some fires were caused by people trying to replicate ...

*Podoviridae

Bacillus phage B103 Bacillus phage GA-1 Bacillus phage phi29 Kurthia phage 6 Genus: Unassigned Actinomyces phage Av-1 ... phage APSE-1 Lactococcus phage KSY1 Phormidium phage Pf-WMP3 Phormidium phage Pf-WMP4 Pseudomonas phage 119X Pseudomonas phage ... Escherichia phage N4 Genus: P22likevirus Enterobacteria phage P22 Salmonella phage HK620 Salmonella phage ST64T Shigella phage ... Enterobacteria phage K5 Enterobacteria phage K1-5 Enterobacteria phage K1E Enterobacteria phage SP6 Erwinia amylovora phage ...

*Picovirinae

Bacillus phage B103 Bacillus phage GA-1 Bacillus phage phi29 Kurthia phage 6 Genus: Unassigned Actinomyces phage Av-1 ... Another virus (Weissella phage phiYS61) that has been isolated is so unlike the known members that it may belong to a new genus ... Staphylococcus phage 44AHJD Streptococcus phage C1 Genus: Phi29likevirus ... Mycoplasma phage P1 Streptococcus phage Cp-1 Two bacteriophages in this family have been found to infect and lyse Clostridium ...

*Taxonomic list of viruses

Bacillus phage andromeda Bacillus phage blastoid Bacillus phage curly Bacillus phage eoghan Bacillus phage finn Bacillus phage ... Bacillus phage B103 Bacillus phage GA-1 Bacillus phage phi29 Kurthia phage 6 Genus: Unassigned Actinomyces phage Av-1 ... Bacillus phage AP50 Bacillus phage Bam35 Enterobacteria phage PRD1 Thermus phage P37-14 Genus: Unassigned Bacillus phage ... phage Pf3 Vibrio phage 493 Vibrio phage CTX Vibrio phage fs1 Vibrio phage fs2 Vibrio phage v6 Vibrio phage Vf12 Vibrio phage ...

*Siphoviridae

Bacillus phage andromeda Bacillus phage blastoid Bacillus phage curly Bacillus phage eoghan Bacillus phage finn Bacillus phage ... Bacillus phage 250 Bacillus phage IEBH Genus: Jerseylikevirus Salmonella phage Ent1 Salmonella phage jersey Salmonella phage ... Bacillus phage Wbeta Genus: Xp10likevirus Xanthomonas phage CP1 Xanthomonas phage OP1 Xanthomonas phage phil7 Xanthomonas phage ... Bacillus phage BMBtp2 Bacillus phage TP21 Genus: Tunalikevirus Cronobacter phage Esp2949-1 Enterobacter phage F20 ...

*Spounavirinae

Bacillus phage SPO1 Genus: Twortlikevirus Listeria phage A511 Listeria phage P100 Staphylococcus phage G1 Staphylococcus phage ... K Staphylococcus phage Twort Genus: Unassigned Enterococcus phage phiEC24C Lactobacillus phage LP65 Viruses in Spounavirinae ...

*Myoviridae

Aeromonas phage 43 Enterobacteria phage P1 Genus: Unassigned Bacillus phage G Bacillus phage PBS1 Microcystis aeruginosa phage ... Bacillus phage SPO1 Genus: Twortlikevirus Listeria phage A511 Listeria phage P100 Staphylococcus phage G1 Staphylococcus phage ... Aeromonas phage phiO18P Haemophilus phage HP1 Haemophilus phage HP2 Pasteurella phage F108 Vibrio phage K139 Vibrio phage Kappa ... phage Cba120 Escherichia phage PhaxI Salmonella phage Sfp10 Salmonella phage Sh19 Salmonella phage ViI Shigella phage Ag3 The ...

*Bacillus phage AP50

... (formerly Phage AP50) is a species of bacteriophage that infects Bacillus anthracis bacteria. Originally ... Nagy, E.; Pragai, B.; Ivanovics, G. (1 July 1976). "Characteristics of Phage AP50, an RNA Phage Containing Phospholipids". ... "Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity". ... thought to be an RNA phage, it contains a DNA genome of about 14,000 base pairs in an icosahedral capsid with a two-layer ...

*Bacillus phage phi29

... (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, ... are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Bacillus_phage_phi29&oldid=841433724" ...

*Bacillus phage

Gillis, Annika; Mahillon, Jacques (9 July 2014). "Phages Preying on Bacillus anthracis, Bacillus cereus, and Bacillus ... A Bacillus phage is a member of a group of bacteriophages known to have bacteria in the genus Bacillus as host species. These ... The DNA polymerase of Bacillus phage phi29 is a unique and efficient polymerase with proofreading activity. ... doi:10.1007/s00705-010-0783-0. Gentry-Weeks, C; Coburn, PS; Gilmore, MS (2002). "Phages and other mobile virulence elements in ...

*Bacillus phage G

... is a bacteriophage (phage) that infects Bacillus bacteria. The phage has been reported to have the largest ... Kristensen, DM; Cai X; Mushegian A (Apr 2011). "Evolutionarily conserved orthologous families in phages are relatively rare in ...

*Category:Low-importance virus articles

Talk:Bacillus phage AP50. *Talk:Bacillus phage G. *Talk:Bacteriophage f2. *Talk:Bacteriophage Mu ...

*Glycoside hydrolase family 22

Kamei K, Hara S, Ikenaka T, Murao S (November 1988). "Amino acid sequence of a lysozyme (B-enzyme) from Bacillus subtilis YT-25 ... There are at least five different classes of lysozymes: C (chicken type), G (goose type), phage-type (T4), fungi (Chalaropsis ... and bacterial (Bacillus subtilis). There are few similarities in the sequences of the different types of lysozymes. Lysozyme ...

Bacillus phage phi29 - WikipediaBacillus phage phi29 - Wikipedia

Bacillus phage phi29 (Φ29 phage) belongs to a family of related Bacteriophages which includes, in addition to Φ29, phages PZA, ... are the smallest Bacillus phages isolated to date and are among the smallest known dsDNA phages.[3] ... "Assembly of Bacillus subtilis Phage Phi29. 1. Mutants in the Cistrons Coding for the Structural Proteins". European Journal of ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Bacillus_phage_phi29&oldid=841433724" ...
more infohttps://en.wikipedia.org/wiki/Bacillus_phage_phi29

Bacillus phage AP50 - WikipediaBacillus phage AP50 - Wikipedia

Bacillus phage AP50 (formerly Phage AP50) is a species of bacteriophage that infects Bacillus anthracis bacteria. Originally ... Nagy, E.; Pragai, B.; Ivanovics, G. (1 July 1976). "Characteristics of Phage AP50, an RNA Phage Containing Phospholipids". ... "Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity". ... thought to be an RNA phage, it contains a DNA genome of about 14,000 base pairs in an icosahedral capsid with a two-layer ...
more infohttps://en.wikipedia.org/wiki/Bacillus_phage_AP50

Bacillus phage - WikipediaBacillus phage - Wikipedia

Gillis, Annika; Mahillon, Jacques (9 July 2014). "Phages Preying on Bacillus anthracis, Bacillus cereus, and Bacillus ... A Bacillus phage is a member of a group of bacteriophages known to have bacteria in the genus Bacillus as host species. These ... The DNA polymerase of Bacillus phage phi29 is a unique and efficient polymerase with proofreading activity. ... doi:10.1007/s00705-010-0783-0. Gentry-Weeks, C; Coburn, PS; Gilmore, MS (2002). "Phages and other mobile virulence elements in ...
more infohttps://en.wikipedia.org/wiki/Bacillus_phage

Bacillus phage phi3T (Bacteriophage phi-3T)Bacillus phage phi3T (Bacteriophage phi-3T)

Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
more infohttps://www.uniprot.org/taxonomy/10736

TF1 - Transcription factor 1 - Bacillus phage SP01 - TF1 gene & proteinTF1 - Transcription factor 1 - Bacillus phage SP01 - TF1 gene & protein

Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). Bacillus phage CP-51. Bacillus phage JL. Bacillus phage ... Bacillus phage vB_BsuM-Goe2. Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). 99. UniRef100_P04445. Cluster: ... Bacillus phage vB_BsuM-Goe2. Bacillus phage CampHawk. Bacillus phage SP01 (Bacteriophage SP01). 99. UniRef90_P04445. Cluster: ... sp,P04445,TF1_BPSP1 Transcription factor 1 OS=Bacillus phage SP01 OX=10685 GN=TF1 PE=1 SV=1 ...
more infohttp://www.uniprot.org/uniprot/P04445

Phage 29 phi protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis.  - PubMed ...Phage 29 phi protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis. - PubMed ...

Phage 29 phi protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis.. ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ... Phage ϕ29 protein p1 promotes replication by associating with the FtsZ ring of the divisome in Bacillus subtilis ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/23836667

Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. | Journal of Clinical MicrobiologyBacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. | Journal of Clinical Microbiology

Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning.. R Ahmed, P Sankar-Mistry, S Jackson, H ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ... Bacillus cereus phage typing as an epidemiological tool in outbreaks of food poisoning. ...
more infohttps://jcm.asm.org/content/33/3/636/article-info

The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis...The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis...

The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis ... PBSX and skin are two unusual genetic elements resident on the Bacillus subtilis chromosome. PBSX is a phage-like element ... However two non-phage-like operons in the skin element are expressed and have distinct expression profiles that are dependent ... The phage particles contain bacterial chromosomal DNA and kill sensitive bacteria without injecting DNA. The skin element is ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/8760915?dopt=Abstract

Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg...Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg...

Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ... Inactivation of Murine Norovirus 1, Coliphage φX174, and Bacillus fragilis Phage B40-8 on Surfaces and Fresh-Cut Iceberg ...
more infohttps://aem.asm.org/content/77/4/1399?ijkey=dcdc943d139898d12fe5b341301865f5630998d3&keytype2=tf_ipsecsha

Bacillus anthracis gamma phage lysis among soil bacteria: an update on test specificity | BMC Research Notes | Full TextBacillus anthracis gamma phage lysis among soil bacteria: an update on test specificity | BMC Research Notes | Full Text

To date, susceptibility to gamma phage lysis has not been reported in genera other than Bacillus. Though these isolates are not ... and identified susceptible isolates outside the Bacillus genus. In this study we found gamma phage susceptibility to be ... The gamma phage lysis assay is a common diagnostic method for identification of B. anthracis and is based on the bacteriums ... anthracis are being developed based on gamma phage lysis or gamma phage proteins. ...
more infohttps://bmcresnotes.biomedcentral.com/articles/10.1186/s13104-017-2919-8

The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis...The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis...

The phage-like element PBSX and part of the skin element, which are resident at different locations on the Bacillus subtilis ... Krogh, S, OReilly, M, Nolan, N, Devine, KM, The phage-like element PBSX and part of the skin element, which are resident at ... different locations on the Bacillus subtilis chromosome, are highly homologous, MICROBIOLOGY-UK, 142, 1996, 2031-2040 ...
more infohttp://www.tara.tcd.ie/handle/2262/71600

Comparative genomics of Bacillus thuringiensis phage 0305φ8-36: defining patterns of descent in a novel ancient phage lineage |...Comparative genomics of Bacillus thuringiensis phage 0305φ8-36: defining patterns of descent in a novel ancient phage lineage |...

The only known relative of this phage is a string of phage-like genes called BtI1 in the chromosome of B. thuringiensis ... The high degree of divergence and novelty of phage genomes pose challenges in how to describe the phage from its genomic ... Phage 0305φ8-36 and BtI1 are estimated to have diverged 2.0 - 2.5 billion years ago. Positionally biased Blast searches aligned ... A conserved long tape measure gene indicates that a long tail is an evolutionarily stable property of this phage lineage. An ...
more infohttps://virologyj.biomedcentral.com/articles/10.1186/1743-422X-4-97

The Isolation Of λ; Transducing Phages Carrying the citG and gerA Genes Of Bacillus Subtilis | Microbiology SocietyThe Isolation Of λ; Transducing Phages Carrying the citG and gerA Genes Of Bacillus Subtilis | Microbiology Society

... is also present on the two citG transducing phages described. The cloned regions in these two phages include EcoRI-generated ... gene of Bacillus subtilis have been detected by complementation of an Escherichia coli fumarase mutation in lysogen-filled ... The Isolation Of λ; Transducing Phages Carrying the citG and gerA Genes Of Bacillus Subtilis * Anne Moir ... is also present on the two citG transducing phages described. The cloned regions in these two phages include EcoRI-generated ...
more infohttps://www.microbiologyresearch.org/content/journal/micro/10.1099/00221287-129-2-303

MyJournals.org - Science - Viruses, Vol. 10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New...MyJournals.org - Science - 'Viruses, Vol. 10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New...

10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New Phage Lineage and Characterization of Its ... This phage is the first tadpole-like phage infecting the Bacillus strains. Genomic analysis shows that the phage genome is ... 10, Pages 611: Isolation of A Novel Bacillus thuringiensis Phage Representing A New Phage Lineage and Characterization of Its ... Phylogenetic analysis revealed that the phage was distant from the other Bacillus phages in terms of evolution. The novel ...
more infohttp://www.myjournals.org/index.php?nr=441727

Bacillus Phage Database| LoginBacillus Phage Database| Login

Recently Added Phages. Bucket Hilltop Retreat Clive Merkle Recently Modified Phages. T3mpyL1t Chrisss Coars20 Aubrey Misaki Recently Finished Phages. Zirkle (None) Ilona (C1) Azalea (C1) Ampersand (C3) FreightTrain (C1) ...
more infohttp://bacillus.phagesdb.org/accounts/login/?next=/thumbnails/Clive/

Bacillus Phage Database | BLASTBacillus Phage Database | BLAST

Local Phage BLAST. This tool will run a local BLAST search against our phage database. This will include some genomes that are ... Bacillus phage Azalea complete sequence, 161765 bp including 2452 bp terminal repeat ...
more infohttp://bacillus.phagesdb.org/blast/Azalea/

Gamma-phage lysin PlyG sequence-based synthetic peptides coupled with Qdot-nanocrystals are useful for developing detection...Gamma-phage lysin PlyG sequence-based synthetic peptides coupled with Qdot-nanocrystals are useful for developing detection...

... abrogates its binding activity specific to the cell wall of Bacillus anthracis. Whether short synthetic peptides representing ... Furthermore, by using B. anthracis (Sterne, 34F2), an animal vaccine and B. cereus-4342, a γ-phage susceptible rare strain as ... phage lysin protein (PlyG) have demonstrated that removal of a short amino acid sequence in the C-terminal region encompassing ... The Bacillus cereus strain (RSVF1 strain 4342), Bacillus cereus ATCC 11778, Bacillus cereus ATCC10876, and Bacillus ...
more infohttps://bmcbiotechnol.biomedcentral.com/articles/10.1186/1472-6750-9-67

Bacillus phage Gamma | The Microbe DirectoryBacillus phage Gamma | The Microbe Directory

Bacillus phage Gamma a.link {text-decoration: none;color: white;} Viruses -> Viruses noname -> Viruses noname -> Caudovirales ... Siphoviridae -> Siphoviridae noname -> Bacillus phage Gamma article { width: 25%; } - Optimal pH - Optimal Temerature - ...
more infohttps://microbe.directory/species/Bacillus+phage+Gamma

Genome Sequence of Bacillus cereus Group Phage SalinJah | Microbiology Resource AnnouncementsGenome Sequence of Bacillus cereus Group Phage SalinJah | Microbiology Resource Announcements

Genome Sequence of Bacillus cereus Group Phage SalinJah. Ivan Erill, Steven M. Caruso on behalf of the 2015 UMBC Phage Hunters ... Genome Sequence of Bacillus cereus Group Phage SalinJah. Ivan Erill, Steven M. Caruso on behalf of the 2015 UMBC Phage Hunters ... information about SalinJah and other Bacillus phages isolated by undergraduate researchers can be found on the Bacillus phages ... and phylogenetic analysis identified Bacillus phage Helga (see BPDB) as the most similar previously sequenced phage, with an ...
more infohttps://mra.asm.org/content/4/5/e00953-16

Proteins matched: Holin SPP1 (PD008023) | InterPro | EMBL-EBIProteins matched: Holin SPP1 (PD008023) | InterPro | EMBL-EBI

Bacillus phage SPbeta (Bacillus phage SPBc2). Loading... P36549 Uncharacterized 9.7 kDa protein in cwlL 5region. Bacillus ...
more infohttp://www.ebi.ac.uk/interpro/ISignatureProteins?sig=PD008023&query=D

Proteins matched: SSF56826 (SSF56826) | InterPro | EMBL-EBIProteins matched: SSF56826 (SSF56826) | InterPro | EMBL-EBI

Bacillus phage phi29. Loading... P07535 Portal protein. Bacillus phage PZA. Loading... Q37891 Portal protein. Bacillus phage ...
more infohttp://www.ebi.ac.uk/interpro/ISignatureProteins?sig=SSF56826&query=Y

CDC - NIOSH Publications and Products - Carcinogenic Effects of Exposure to Propylene Oxide (89-111)CDC - NIOSH Publications and Products - Carcinogenic Effects of Exposure to Propylene Oxide (89-111)

Bacillus subtilis phage ø 105. Garro and Phillips 1980. Sex-linked recessive lethal mutation. Drosophila melanogaster. Hardin ... Garro AJ, Phillips RA [1980]. Detection of mutagen-induced lesions in isolated DNA by marker rescue of Bacillus subtilis phage ... Bacillus subtilis. Phillips et al. 1980 Bootman et al. 1979. Forward mutation. Schizosaccharomyces pombe. Migliore et al. 1982 ... Phillips RA, Zahler SA, Garro AJ [1980]. Detection of mutagen-induced lesions in isolated DNA using a new Bacillus subtilis ...
more infohttps://www.cdc.gov/niosh/docs/89-111/default.html

Antibodies  | Free Full-Text | Selection and Characterization of Single Domain Antibodies Specific for Bacillus anthracis Spore...Antibodies | Free Full-Text | Selection and Characterization of Single Domain Antibodies Specific for Bacillus anthracis Spore...

Peripheral blood lymphocytes were used to construct a phage display library from which single domain antibodies (sdAbs) ... anthracis spores and not to other Bacillus species. Additionally, SODA1 and p5303 binding sdAbs detected spores in sandwich ... To obtain thermostable immunoreagents specific for the spore form of Bacillus anthracis two llamas were immunized with a ... Bacillus anthracis is highly similar, morphologically, to other members of the Bacillus cereus group which complicates the ...
more infohttp://www.mdpi.com/2073-4468/2/1/152/htm

Bacillus - microbewikiBacillus - microbewiki

A recently discovered bacteriophage, the gamma phage, attacks Bacillus anthracis, and researches are optimistic about its ... Bacillus anthracis, Bacillus cereus, Bacillus halodurans, Bacillus subtilis, Bacillus thuringiensis, Bacillus insolitus, ... Bacillus cereus G9241, Bacillus cereus NVH391-98, Bacillus cereus E33L, Bacillus clausii KSM-K16 , Bacillus halodurans C-125, ... Bacillus licheniformis ATCC 14580, Bacillus pumilus, Bacillus pumilus SAFR-032, Bacillus sp. NRRL B-14911, Bacillus subtilis ...
more infohttps://microbewiki.kenyon.edu/index.php?title=Bacillus&

RCSB PDB 









- 1LQG: ESCHERICHIA COLI URACIL-DNA GLYCOSYLASE COMPLEX WITH URACIL-DNA GLYCOSYLASE INHIBITOR PROTEIN...RCSB PDB - 1LQG: ESCHERICHIA COLI URACIL-DNA GLYCOSYLASE COMPLEX WITH URACIL-DNA GLYCOSYLASE INHIBITOR PROTEIN...

Organism: Escherichia coli , Bacillus phage PBS2 * Expression System: Escherichia coli Experimental Data Snapshot ...
more infohttp://www.rcsb.org/pdb/explore/explore.do?structureId=1LQG
  • A specialized phage can infect only a narrow range of hosts, so phage typing schemes are used in epidemiological studies of many bacterial pathogens, such as Staphylococcus aureus ( 2 ), Salmonella enterica serovar Typhimurium ( 3 ), Vibrio cholerae ( 4 , 5 ), and Mycobacterium tuberculosis ( 6 - 8 ). (asm.org)
  • The pathogen evolution can thus be regarded as a constant dynamic exchange of genes between plasmids and temperate phages integrated or not into the bacterial chromosome. (hindawi.com)
  • Host recognition by lactic acid bacterial phages. (univ-mrs.fr)
  • Tailed phages with double-stranded genomes are by far the most studied bacterial viruses, as over 95% of the known phages are grouped within the Caudovirales order ( 1 ). (asm.org)
  • Phage therapy is the use of viruses to treat bacterial infections. (openwetware.org)
  • DNA and RNA-based approaches are being employed for real-time assessment of contamination levels, bacterial stress responses, and regulation of virulence gene expression in toxigenic Bacillus spp. (bsu.edu)
  • Five 16-nm tail fibers with splayed tips probably lead the phage along the flagellar filament to the cell surface, where they act as specific adsorption organelles that attach the phage to its final receptor. (biomedcentral.com)
  • Microtiter Plate Assays for the Measurement of Phage Adsorption and Infection in Lactococcus", Analytical Biochemistry 192:362-366 (1991). (patentgenius.com)
  • The high degree of divergence and novelty of phage genomes pose challenges in how to describe the phage from its genomic sequences. (biomedcentral.com)
  • We present here the complete genomes of 18 phages that infect Paenibacillus larvae, the causative agent of American foulbrood in honeybees. (stanford.edu)
  • One concern of phage therapy is the rapid lysing of pathogenic cells which may contain endotoxins. (openwetware.org)
  • Complete genomic sequence and mass spectrometric analysis of highly diverse, atypical Bacillus thuringiensis phage 0305Φ8-36," Virology , vol. 368, no. 2, pp. 405-421, 2007. (hindawi.com)
  • S. C. Hardies, J. A. Thomas, and P. Serwer, "Comparative genomics of Bacillus thuringiensis phage 0305 φ 8-36: defining patterns of descent in a novel ancient phage lineage," Virology Journal , vol. 4, p. 97, 2007. (hindawi.com)
  • SalinJah and Helga share high similarity with members of cluster C, subcluster C1, such as Bacillus phages Hakuna (accession no. (asm.org)
  • Phage Blastoid is a siphophage that infects Bacillus pumilus. (biomedsearch.com)
  • The flagellotropic phage 7-7-1 infects motile cells of Agrobacterium sp H13-3 by attaching to and traveling along the rotating flagellar filament to the secondary receptor at the base, where it injects its DNA into the host cell. (biomedcentral.com)
  • In addition to medical uses, bacillus spores, due to their extreme tolerance to both heat and disinfectants, are used to test heat sterilization techniques and chemical disinfectants. (kenyon.edu)
  • Three different enrichment strategies were used for metagenomic DNA isolation, based either on the ability of B. cereus sensu lato to form heat-resistant spores, the sensitivity of B. anthracis to the PlyG lysin, or the selective amplification of environmental phages cocultured with B. anthracis . (pubmedcentralcanada.ca)
  • A decade of Streptococcus thermophilus phage evolution in an Irish dairy plant. (univ-mrs.fr)
  • The authors' 'phage' sensu lato definition allows them to include a couple of archaeal viruses and two viruses of eukaryotic microbes (Mimivirus and yeast virus L-A). Phages were chosen to encompass not only diversity but also to illustrate unorthodox ways of life. (asmblog.org)
  • A notable illustration of such prophage-plasmid coevolution is the similarity between the genome of a large phage 0305f8-36, isolated from B. thuringiensis and a contig of genome of the strain B. weihenstephanensis KBAB4 [ 13 , 14 ]. (hindawi.com)
  • Loeffler's best-known work is the elucidation of the characteristics of the diphtheria bacillus and its growth in pure culture (1884), which again clearly revealed the imprint of Koch, with whom he was then so closely associated. (encyclopedia.com)
  • In this report, a detailed study is made of the genomic organization and vertical descent of phage 0305φ8-36 in comparison with BtI1/BwK1. (biomedcentral.com)
  • Genomic analysis shows that the phage genome is dissimilar to all those of previously characterized phages, only exhibiting low similarities with partial regions of the B. thuringiensis prophages. (myjournals.org)
  • Both genomic comparisons and phylogenetic analyses support the conclusion that the sequenced phages (BM5 and BM10) belong to different sub-clusters (L5 and L7, respectively), within the L-cluster, and display different lifestyles (lysogenic and lytic, respectively). (peerj.com)
  • Findings from this work indicate that B. cereus sensu lato and its phages are common inhabitants of earthworm intestines. (pubmedcentralcanada.ca)
  • The notorious animal pathogen Bacillus anthracis is considered to be a genetically monomorphic variant of the large, well-studied B. cereus sensu lato (s.l.) lineage of often ubiquitous soil organisms like B. cereus sensu stricto (referred to here as simply B. cereus ), B. thuringiensis , B. pseudomycoides , B. weihenstephanensis , and B. mycoides ( 20 , 21 , 25 , 38 ). (pubmedcentralcanada.ca)
  • In this study, the novel phage vB_BthS_BMBphi, infecting the Bacillus thuringiensis strain BMB171, is isolated and characterized together with its endolysin. (myjournals.org)
  • Furthermore, by using B. anthracis (Sterne, 34F2), an animal vaccine and B. cereus - 4342 , a γ-phage susceptible rare strain as surrogates of B. anthracis , development of proof-of-concepts for B. anthracis are feasible. (biomedcentral.com)
  • In this review we use the well-known plant-associated Bacillus amyloliquefaciens type strain FZB42 as example for the successful application of different techniques offered today by comparative, evolutionary and functional genomics, site-directed mutagenesis and strain construction including marker removal, for paving the way for preparing a novel generation of BC agents. (frontiersin.org)
  • Strain-specific single-nucleotide polymorphism assays for the Bacillus anthracis Ames strain, Journal of clinical microbiology . (umaryland.edu)
  • Phylogenetic analysis revealed that the phage was distant from the other Bacillus phages in terms of evolution. (myjournals.org)
  • A comparison of SalinJah with other Bacillus phages by nucleotide identity, synteny, and phylogenetic analysis identified Bacillus phage Helga (see BPDB) as the most similar previously sequenced phage, with an average nucleotide identity (ANI) of 0.92 ( 4 ). (asm.org)
  • B ) Phage ϕ29-infected B. subtilis cells were analyzed by immunofluorescence (IF) using anti-p1 antibodies (green) 20 and 30 min after infection. (nih.gov)
  • Therefore, the mechanism of VP4 infection may provide a basis for subtyping the phage. (asm.org)
  • DspB is produced during infection, and released after the cell is lysed, along with new phage. (openwetware.org)
  • A recent report relates the evolution of temperate phages and the regulatory elements involved in adaptation of B. anthracis to the animal host [ 7 ]. (hindawi.com)
  • We found during analysis of the ATCC35646 contigs, corresponding to 3,500-3,800 kb of the 5.4 Mb B. cereus ATCC14579 genome sequenced earlier [ 17 ], that several temperate phages were integrated in this area into the genome of ATCC35646. (hindawi.com)
  • Filament associated phage particles initially possess DNA-filled heads, which are subsequently found emptied when attached to the phage receptor at the flagellar base. (biomedcentral.com)
  • Spodoptera frugiperda (J. E. Smith) aminopeptidase N1 is functional receptor of Bacillus thuringiensis Cry1Ca toxin Applied and Environmental Microbiology, 84, UNSP e01089-18. (unam.mx)
  • Comparative analyses showed that the architecture of the phage p2 baseplate differs largely from that of lactococcal phage TP901-1. (asm.org)
  • Identification of Bacillus thuringiensis Cry3Aa toxin domain II loop 1 as the binding site of Tenebrio molitor cadherin repeat CR12 Insect Biochemistry and Molecular Biology, 59, 50-57. (unam.mx)
  • But the discovery of penicillin and other antibiotics eclipsed phage treatments in the West, although research continued in the Soviet Union. (medicalnewstoday.com)
  • The development and mass production of antibiotics in the late 1940s halted research into phage therapy in the West, due to the efficacy of antibiotics. (openwetware.org)
  • Phage therapy can also be used in conjunction with antibiotics, even when the target has antibiotic resistance. (openwetware.org)
  • Therefore, phage that kill the targeted pathogen without disrupted the cell's integrity are of interest. (openwetware.org)
  • Two teams in 2008 had similar approaches to modifying phage therapy: using a host that would be used as a probiotic to carry a phage targeting a gut pathogen. (openwetware.org)
  • The goal of Team Hiedelberg's "EcoLicense to Kill" was to make a lambda phage that can transfer to a pathogen by conjugation. (openwetware.org)
  • Once inside the pathogen, the phage would immediately begin replication (due to knocking out the lysogenic cycle of lambda). (openwetware.org)
  • Still others, namely Bacillus subtilis , inhabit the rhizosphere, which is the interface between plant roots and the surrounding soil. (kenyon.edu)
  • Lysogeny with any of a series of soil-, fern rhizosphere-, and earthworm gut-derived phages was found to reduce or block sporulation, favor biofilm formation, and promote long-term survival in both soil microcosms and the intestinal tract of Eisenia fetida worms ( 30 ). (pubmedcentralcanada.ca)