A family of highly conserved serine-threonine kinases that are involved in the regulation of MITOSIS. They are involved in many aspects of cell division, including centrosome duplication, SPINDLE APPARATUS formation, chromosome alignment, attachment to the spindle, checkpoint activation, and CYTOKINESIS.
An aurora kinase that localizes to the CENTROSOME during MITOSIS and is involved in centrosome regulation and formation of the MITOTIC SPINDLE. Aurora A overexpression in many malignant tumor types suggests that it may be directly involved in NEOPLASTIC CELL TRANSFORMATION.
An aurora kinase that is a component of the chromosomal passenger protein complex and is involved in the regulation of MITOSIS. It mediates proper CHROMOSOME SEGREGATION and contractile ring function during CYTOKINESIS.
Aurora kinase C is a chromosomal passenger protein that interacts with aurora kinase B in the regulation of MITOSIS. It is found primarily in GERM CELLS in the TESTIS, and may mediate CHROMOSOME SEGREGATION during SPERMATOGENESIS.
A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.
Agents that inhibit PROTEIN KINASES.
A type of CELL NUCLEUS division by means of which the two daughter nuclei normally receive identical complements of the number of CHROMOSOMES of the somatic cells of the species.
A family of enzymes that catalyze the conversion of ATP and a protein to ADP and a phosphoprotein.
Phosphotransferases that catalyzes the conversion of 1-phosphatidylinositol to 1-phosphatidylinositol 3-phosphate. Many members of this enzyme class are involved in RECEPTOR MEDIATED SIGNAL TRANSDUCTION and regulation of vesicular transport with the cell. Phosphatidylinositol 3-Kinases have been classified both according to their substrate specificity and their mode of action within the cell.
An intracellular signaling system involving the MAP kinase cascades (three-membered protein kinase cascades). Various upstream activators, which act in response to extracellular stimuli, trigger the cascades by activating the first member of a cascade, MAP KINASE KINASE KINASES; (MAPKKKs). Activated MAPKKKs phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES which in turn phosphorylate the MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs). The MAPKs then act on various downstream targets to affect gene expression. In mammals, there are several distinct MAP kinase pathways including the ERK (extracellular signal-regulated kinase) pathway, the SAPK/JNK (stress-activated protein kinase/c-jun kinase) pathway, and the p38 kinase pathway. There is some sharing of components among the pathways depending on which stimulus originates activation of the cascade.
A microtubule structure that forms during CELL DIVISION. It consists of two SPINDLE POLES, and sets of MICROTUBULES that may include the astral microtubules, the polar microtubules, and the kinetochore microtubules.
The orderly segregation of CHROMOSOMES during MEIOSIS or MITOSIS.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A CALMODULIN-dependent enzyme that catalyzes the phosphorylation of proteins. This enzyme is also sometimes dependent on CALCIUM. A wide range of proteins can act as acceptor, including VIMENTIN; SYNAPSINS; GLYCOGEN SYNTHASE; MYOSIN LIGHT CHAINS; and the MICROTUBULE-ASSOCIATED PROTEINS. (From Enzyme Nomenclature, 1992, p277)
Piperazines are a class of heterocyclic organic compounds containing a seven-membered ring with two nitrogen atoms at positions 1 and 4, often used in pharmaceuticals as smooth muscle relaxants, antipsychotics, antidepressants, and antihistamines, but can also be found as recreational drugs with stimulant and entactogen properties.
A cell line derived from cultured tumor cells.
Large multiprotein complexes that bind the centromeres of the chromosomes to the microtubules of the mitotic spindle during metaphase in the cell cycle.
Seven membered heterocyclic rings containing a NITROGEN atom.
A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.
Carbon-containing phosphoric acid derivatives. Included under this heading are compounds that have CARBON atoms bound to one or more OXYGEN atoms of the P(=O)(O)3 structure. Note that several specific classes of endogenous phosphorus-containing compounds such as NUCLEOTIDES; PHOSPHOLIPIDS; and PHOSPHOPROTEINS are listed elsewhere.
BENZOIC ACID amides.
Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.
The cellular signaling system that halts the progression of cells through MITOSIS or MEIOSIS if a defect that will affect CHROMOSOME SEGREGATION is detected.
An serine-threonine protein kinase that requires the presence of physiological concentrations of CALCIUM and membrane PHOSPHOLIPIDS. The additional presence of DIACYLGLYCEROLS markedly increases its sensitivity to both calcium and phospholipids. The sensitivity of the enzyme can also be increased by PHORBOL ESTERS and it is believed that protein kinase C is the receptor protein of tumor-promoting phorbol esters.
The cell center, consisting of a pair of CENTRIOLES surrounded by a cloud of amorphous material called the pericentriolar region. During interphase, the centrosome nucleates microtubule outgrowth. The centrosome duplicates and, during mitosis, separates to form the two poles of the mitotic spindle (MITOTIC SPINDLE APPARATUS).
The process by which the CYTOPLASM of a cell is divided.
A mitogen-activated protein kinase subfamily that regulates a variety of cellular processes including CELL GROWTH PROCESSES; CELL DIFFERENTIATION; APOPTOSIS; and cellular responses to INFLAMMATION. The P38 MAP kinases are regulated by CYTOKINE RECEPTORS and can be activated in response to bacterial pathogens.
The chromosomal constitution of a cell containing multiples of the normal number of CHROMOSOMES; includes triploidy (symbol: 3N), tetraploidy (symbol: 4N), etc.
A group of enzymes that are dependent on CYCLIC AMP and catalyze the phosphorylation of SERINE or THREONINE residues on proteins. Included under this category are two cyclic-AMP-dependent protein kinase subtypes, each of which is defined by its subunit composition.
A proline-directed serine/threonine protein kinase which mediates signal transduction from the cell surface to the nucleus. Activation of the enzyme by phosphorylation leads to its translocation into the nucleus where it acts upon specific transcription factors. p40 MAPK and p41 MAPK are isoforms.
A benign neoplasm derived from mesodermal cells that form cartilage. It may remain within the substance of a cartilage or bone (true chondroma or enchondroma) or may develop on the surface of a cartilage (ecchondroma or ecchondrosis). (Dorland, 27th ed; Stedman, 25th ed)
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Agents which affect CELL DIVISION and the MITOTIC SPINDLE APPARATUS resulting in the loss or gain of whole CHROMOSOMES, thereby inducing an ANEUPLOIDY.
High molecular weight proteins found in the MICROTUBULES of the cytoskeletal system. Under certain conditions they are required for TUBULIN assembly into the microtubules and stabilize the assembled microtubules.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
A family of 6-membered heterocyclic compounds occurring in nature in a wide variety of forms. They include several nucleic acid constituents (CYTOSINE; THYMINE; and URACIL) and form the basic structure of the barbiturates.
The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.
Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.
A family of serine-threonine kinases that bind to and are activated by MONOMERIC GTP-BINDING PROTEINS such as RAC GTP-BINDING PROTEINS and CDC42 GTP-BINDING PROTEIN. They are intracellular signaling kinases that play a role the regulation of cytoskeletal organization.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
Phosphoprotein with protein kinase activity that functions in the G2/M phase transition of the CELL CYCLE. It is the catalytic subunit of the MATURATION-PROMOTING FACTOR and complexes with both CYCLIN A and CYCLIN B in mammalian cells. The maximal activity of cyclin-dependent kinase 1 is achieved when it is fully dephosphorylated.
A serine-threonine protein kinase family whose members are components in protein kinase cascades activated by diverse stimuli. These MAPK kinases phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES and are themselves phosphorylated by MAP KINASE KINASE KINASES. JNK kinases (also known as SAPK kinases) are a subfamily.
A subgroup of mitogen-activated protein kinases that activate TRANSCRIPTION FACTOR AP-1 via the phosphorylation of C-JUN PROTEINS. They are components of intracellular signaling pathways that regulate CELL PROLIFERATION; APOPTOSIS; and CELL DIFFERENTIATION.
Regulatory signaling systems that control the progression through the CELL CYCLE. They ensure that the cell has completed, in the correct order and without mistakes, all the processes required to replicate the GENOME and CYTOPLASM, and divide them equally between two daughter cells. If cells sense they have not completed these processes or that the environment does not have the nutrients and growth hormones in place to proceed, then the cells are restrained (or "arrested") until the processes are completed and growth conditions are suitable.
A 44-kDa extracellular signal-regulated MAP kinase that may play a role the initiation and regulation of MEIOSIS; MITOSIS; and postmitotic functions in differentiated cells. It phosphorylates a number of TRANSCRIPTION FACTORS; and MICROTUBULE-ASSOCIATED PROTEINS.
Substances that inhibit or prevent the proliferation of NEOPLASMS.
Azoles of two nitrogens at the 1,2 positions, next to each other, in contrast with IMIDAZOLES in which they are at the 1,3 positions.
The phase of cell nucleus division following METAPHASE, in which the CHROMATIDS separate and migrate to opposite poles of the spindle.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.
Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.
A fibrillar collagen found primarily in interstitial CARTILAGE. Collagen type XI is heterotrimer containing alpha1(XI), alpha2(XI) and alpha3(XI) subunits.
Nucleoproteins, which in contrast to HISTONES, are acid insoluble. They are involved in chromosomal functions; e.g. they bind selectively to DNA, stimulate transcription resulting in tissue-specific RNA synthesis and undergo specific changes in response to various hormones or phytomitogens.
Protein kinases that control cell cycle progression in all eukaryotes and require physical association with CYCLINS to achieve full enzymatic activity. Cyclin-dependent kinases are regulated by phosphorylation and dephosphorylation events.
A small whitish spot on the surface of the EGG YOLK where cleavage begins. Upon fertilization the cytoplasm streams from the vegetal pole away from the yolk to the animal pole where cleavage will occur. This germinal area eventually flattens into a layer of cells (BLASTODERM) that covers the yolk completely.
A transferase that catalyzes formation of PHOSPHOCREATINE from ATP + CREATINE. The reaction stores ATP energy as phosphocreatine. Three cytoplasmic ISOENZYMES have been identified in human tissues: the MM type from SKELETAL MUSCLE, the MB type from myocardial tissue and the BB type from nervous tissue as well as a mitochondrial isoenzyme. Macro-creatine kinase refers to creatine kinase complexed with other serum proteins.
Quinazolines are heterocyclic aromatic organic compounds consisting of a benzene ring fused to a pyrazine ring, which are synthesized and used as intermediates in pharmaceuticals, particularly in the production of various drugs such as antimalarials, antihypertensives, and antitumor agents.
Mitogen-activated protein kinase kinase kinases (MAPKKKs) are serine-threonine protein kinases that initiate protein kinase signaling cascades. They phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES; (MAPKKs) which in turn phosphorylate MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs).
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
A family of rat kangaroos found in and around Australia. Genera include Potorous and Bettongia.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
A dsRNA-activated cAMP-independent protein serine/threonine kinase that is induced by interferon. In the presence of dsRNA and ATP, the kinase autophosphorylates on several serine and threonine residues. The phosphorylated enzyme catalyzes the phosphorylation of the alpha subunit of EUKARYOTIC INITIATION FACTOR-2, leading to the inhibition of protein synthesis.
A ubiquitous casein kinase that is comprised of two distinct catalytic subunits and dimeric regulatory subunit. Casein kinase II has been shown to phosphorylate a large number of substrates, many of which are proteins involved in the regulation of gene expression.
A group of protein-serine-threonine kinases that was originally identified as being responsible for the PHOSPHORYLATION of CASEINS. They are ubiquitous enzymes that have a preference for acidic proteins. Casein kinases play a role in SIGNAL TRANSDUCTION by phosphorylating a variety of regulatory cytoplasmic and regulatory nuclear proteins.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Cellular functions, mechanisms, and activities.
ATP:pyruvate 2-O-phosphotransferase. A phosphotransferase that catalyzes reversibly the phosphorylation of pyruvate to phosphoenolpyruvate in the presence of ATP. It has four isozymes (L, R, M1, and M2). Deficiency of the enzyme results in hemolytic anemia. EC 2.7.1.40.
A family of protein serine/threonine kinases which act as intracellular signalling intermediates. Ribosomal protein S6 kinases are activated through phosphorylation in response to a variety of HORMONES and INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS. Phosphorylation of RIBOSOMAL PROTEIN S6 by enzymes in this class results in increased expression of 5' top MRNAs. Although specific for RIBOSOMAL PROTEIN S6 members of this class of kinases can act on a number of substrates within the cell. The immunosuppressant SIROLIMUS inhibits the activation of ribosomal protein S6 kinases.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
An abundant 43-kDa mitogen-activated protein kinase kinase subtype with specificity for MITOGEN-ACTIVATED PROTEIN KINASE 1 and MITOGEN-ACTIVATED PROTEIN KINASE 3.
The clear constricted portion of the chromosome at which the chromatids are joined and by which the chromosome is attached to the spindle during cell division.
A class of cellular receptors that have an intrinsic PROTEIN-TYROSINE KINASE activity.
An enzyme that catalyzes the conversion of ATP and thymidine to ADP and thymidine 5'-phosphate. Deoxyuridine can also act as an acceptor and dGTP as a donor. (From Enzyme Nomenclature, 1992) EC 2.7.1.21.
A mitogen-activated protein kinase subfamily that is widely expressed and plays a role in regulation of MEIOSIS; MITOSIS; and post mitotic functions in differentiated cells. The extracellular signal regulated MAP kinases are regulated by a broad variety of CELL SURFACE RECEPTORS and can be activated by certain CARCINOGENS.
A mitogen-activated protein kinase kinase with specificity for JNK MITOGEN-ACTIVATED PROTEIN KINASES; P38 MITOGEN-ACTIVATED PROTEIN KINASES and the RETINOID X RECEPTORS. It takes part in a SIGNAL TRANSDUCTION pathway that is activated in response to cellular stress.
An amorphous region of electron dense material in the cytoplasm from which the MICROTUBULES polymerization is nucleated. The pericentriolar region of the CENTROSOME which surrounds the CENTRIOLES is an example.
The degree of replication of the chromosome set in the karyotype.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
An enzyme that catalyzes the conversion of phosphatidylinositol (PHOSPHATIDYLINOSITOLS) to phosphatidylinositol 4-phosphate, the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate.
A group of enzymes that transfers a phosphate group onto an alcohol group acceptor. EC 2.7.1.
New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.
A glycogen synthase kinase that was originally described as a key enzyme involved in glycogen metabolism. It regulates a diverse array of functions such as CELL DIVISION, microtubule function and APOPTOSIS.
A superfamily of PROTEIN-SERINE-THREONINE KINASES that are activated by diverse stimuli via protein kinase cascades. They are the final components of the cascades, activated by phosphorylation by MITOGEN-ACTIVATED PROTEIN KINASE KINASES, which in turn are activated by mitogen-activated protein kinase kinase kinases (MAP KINASE KINASE KINASES).
A family of cell cycle-dependent kinases that are related in structure to CDC28 PROTEIN KINASE; S CEREVISIAE; and the CDC2 PROTEIN KINASE found in mammalian species.
Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.
A type of CELL NUCLEUS division, occurring during maturation of the GERM CELLS. Two successive cell nucleus divisions following a single chromosome duplication (S PHASE) result in daughter cells with half the number of CHROMOSOMES as the parent cells.
In vivo methods of screening investigative anticancer drugs, biologic response modifiers or radiotherapies. Human tumor tissue or cells are transplanted into mice or rats followed by tumor treatment regimens. A variety of outcomes are monitored to assess antitumor effectiveness.
Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.
A protein serine-threonine kinase that catalyzes the PHOSPHORYLATION of I KAPPA B PROTEINS. This enzyme also activates the transcription factor NF-KAPPA B and is composed of alpha and beta catalytic subunits, which are protein kinases and gamma, a regulatory subunit.
A group of intracellular-signaling serine threonine kinases that bind to RHO GTP-BINDING PROTEINS. They were originally found to mediate the effects of rhoA GTP-BINDING PROTEIN on the formation of STRESS FIBERS and FOCAL ADHESIONS. Rho-associated kinases have specificity for a variety of substrates including MYOSIN-LIGHT-CHAIN PHOSPHATASE and LIM KINASES.
The action of a drug in promoting or enhancing the effectiveness of another drug.
The chromosomal constitution of cells which deviate from the normal by the addition or subtraction of CHROMOSOMES, chromosome pairs, or chromosome fragments. In a normally diploid cell (DIPLOIDY) the loss of a chromosome pair is termed nullisomy (symbol: 2N-2), the loss of a single chromosome is MONOSOMY (symbol: 2N-1), the addition of a chromosome pair is tetrasomy (symbol: 2N+2), the addition of a single chromosome is TRISOMY (symbol: 2N+1).
In a prokaryotic cell or in the nucleus of a eukaryotic cell, a structure consisting of or containing DNA which carries the genetic information essential to the cell. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
A ubiquitously expressed protein kinase that is involved in a variety of cellular SIGNAL PATHWAYS. Its activity is regulated by a variety of signaling protein tyrosine kinase.
Established cell cultures that have the potential to propagate indefinitely.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
A cytoplasmic serine threonine kinase involved in regulating CELL DIFFERENTIATION and CELLULAR PROLIFERATION. Overexpression of this enzyme has been shown to promote PHOSPHORYLATION of BCL-2 PROTO-ONCOGENE PROTEINS and chemoresistance in human acute leukemia cells.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.
Resistance or diminished response of a neoplasm to an antineoplastic agent in humans, animals, or cell or tissue cultures.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.
Treatments with drugs which interact with or block synthesis of specific cellular components characteristic of the individual's disease in order to stop or interrupt the specific biochemical dysfunction involved in progression of the disease.
The period of the CELL CYCLE following DNA synthesis (S PHASE) and preceding M PHASE (cell division phase). The CHROMOSOMES are tetraploid in this point.
A cyclin B subtype that colocalizes with MICROTUBULES during INTERPHASE and is transported into the CELL NUCLEUS at the end of the G2 PHASE.
The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.
An enzyme of the transferase class that uses ATP to catalyze the phosphorylation of diacylglycerol to a phosphatidate. EC 2.7.1.107.
Methods of investigating the effectiveness of anticancer cytotoxic drugs and biologic inhibitors. These include in vitro cell-kill models and cytostatic dye exclusion tests as well as in vivo measurement of tumor growth parameters in laboratory animals.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Intracellular signaling protein kinases that play a signaling role in the regulation of cellular energy metabolism. Their activity largely depends upon the concentration of cellular AMP which is increased under conditions of low energy or metabolic stress. AMP-activated protein kinases modify enzymes involved in LIPID METABOLISM, which in turn provide substrates needed to convert AMP into ATP.
The relationship between the dose of an administered drug and the response of the organism to the drug.
Mutant mice homozygous for the recessive gene "nude" which fail to develop a thymus. They are useful in tumor studies and studies on immune responses.
Phylum in the domain Eukarya, comprised of animals either with fully developed backbones (VERTEBRATES), or those with notochords only during some developmental stage (CHORDATA, NONVERTEBRATE).
The rate dynamics in chemical or physical systems.
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Phosphoproteins are proteins that have been post-translationally modified with the addition of a phosphate group, usually on serine, threonine or tyrosine residues, which can play a role in their regulation, function, interaction with other molecules, and localization within the cell.
Compounds containing 1,3-diazole, a five membered aromatic ring containing two nitrogen atoms separated by one of the carbons. Chemically reduced ones include IMIDAZOLINES and IMIDAZOLIDINES. Distinguish from 1,2-diazole (PYRAZOLES).
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
A protein-serine-threonine kinase that is activated by PHOSPHORYLATION in response to GROWTH FACTORS or INSULIN. It plays a major role in cell metabolism, growth, and survival as a core component of SIGNAL TRANSDUCTION. Three isoforms have been described in mammalian cells.
An order of fungi in the phylum Ascomycota that multiply by budding. They include the telomorphic ascomycetous yeasts which are found in a very wide range of habitats.
A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.
A non-receptor protein tyrosine kinase that is localized to FOCAL ADHESIONS and is a central component of integrin-mediated SIGNAL TRANSDUCTION PATHWAYS. Focal adhesion kinase 1 interacts with PAXILLIN and undergoes PHOSPHORYLATION in response to adhesion of cell surface integrins to the EXTRACELLULAR MATRIX. Phosphorylated p125FAK protein binds to a variety of SH2 DOMAIN and SH3 DOMAIN containing proteins and helps regulate CELL ADHESION and CELL MIGRATION.
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Compounds with a six membered aromatic ring containing NITROGEN. The saturated version is PIPERIDINES.
Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
An enzyme that phosphorylates myosin light chains in the presence of ATP to yield myosin-light chain phosphate and ADP, and requires calcium and CALMODULIN. The 20-kDa light chain is phosphorylated more rapidly than any other acceptor, but light chains from other myosins and myosin itself can act as acceptors. The enzyme plays a central role in the regulation of smooth muscle contraction.
Thiazoles are heterocyclic organic compounds containing a sulfur atom and a nitrogen atom, which are bound by two carbon atoms to form a five-membered ring, and are widely found in various natural and synthetic substances, including some pharmaceuticals and vitamins.
A Janus kinase subtype that is involved in signaling from GROWTH HORMONE RECEPTORS; PROLACTIN RECEPTORS; and a variety of CYTOKINE RECEPTORS such as ERYTHROPOIETIN RECEPTORS and INTERLEUKIN RECEPTORS. Dysregulation of Janus kinase 2 due to GENETIC TRANSLOCATIONS have been associated with a variety of MYELOPROLIFERATIVE DISORDERS.
Female germ cells derived from OOGONIA and termed OOCYTES when they enter MEIOSIS. The primary oocytes begin meiosis but are arrested at the diplotene state until OVULATION at PUBERTY to give rise to haploid secondary oocytes or ova (OVUM).
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A family of non-receptor, PROLINE-rich protein-tyrosine kinases.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
A family of ribosomal protein S6 kinases that are structurally distinguished from RIBOSOMAL PROTEIN S6 KINASES, 70-KDA by their apparent molecular size and the fact they contain two functional kinase domains. Although considered RIBOSOMAL PROTEIN S6 KINASES, members of this family are activated via the MAP KINASE SIGNALING SYSTEM and have been shown to act on a diverse array of substrates that are involved in cellular regulation such as RIBOSOMAL PROTEIN S6 and CAMP RESPONSE ELEMENT-BINDING PROTEIN.
A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
A protein kinase C subtype that was originally characterized as a CALCIUM-independent, serine-threonine kinase that is activated by PHORBOL ESTERS and DIACYLGLYCEROLS. It is targeted to specific cellular compartments in response to extracellular signals that activate G-PROTEIN-COUPLED RECEPTORS; TYROSINE KINASE RECEPTORS; and intracellular protein tyrosine kinase.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Proteins prepared by recombinant DNA technology.
An increased tendency to acquire CHROMOSOME ABERRATIONS when various processes involved in chromosome replication, repair, or segregation are dysfunctional.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A 195-kDa MAP kinase kinase kinase with broad specificity for MAP KINASE KINASES. It is found localized in the CYTOSKELETON and can activate a variety of MAP kinase-dependent pathways.
A multifunctional calcium-calmodulin-dependent protein kinase subtype that occurs as an oligomeric protein comprised of twelve subunits. It differs from other enzyme subtypes in that it lacks a phosphorylatable activation domain that can respond to CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASE KINASE.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.
Elements of limited time intervals, contributing to particular results or situations.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
PKC beta encodes two proteins (PKCB1 and PKCBII) generated by alternative splicing of C-terminal exons. It is widely distributed with wide-ranging roles in processes such as B-cell receptor regulation, oxidative stress-induced apoptosis, androgen receptor-dependent transcriptional regulation, insulin signaling, and endothelial cell proliferation.

Cell cycle-dependent expression and centrosome localization of a third human aurora/Ipl1-related protein kinase, AIK3. (1/1165)

We earlier isolated cDNAs encoding novel human protein kinases AIK and AIK2 sharing high amino acid sequence identities with Drosophila Aurora and Saccharomyces cerevisiae Ipl1 kinases whose mutations cause abnormal chromosome segregation. In the present study, a third human cDNA (AIK3) highly homologous to aurora/IPL1 was isolated, and the nucleotide sequence was determined. This cDNA encodes 309 amino acids with a predicted molecular mass of 35.9 kDa. C-terminal kinase domain of AIK3 protein shares high amino acid sequence identities with those of Aurora/Ipl1 family protein kinases including human AIK, human AIK2, Xenopus pEg2, Drosophila Aurora, and yeast Ipl1, whereas the N-terminal domain of AIK3 protein shares little homology with any other Aurora/Ipl1 family members. AIK3 gene was assigned to human chromosome 19q13.43, which is a frequently deleted or rearranged region in several tumor tissues, by fluorescence in situ hybridization, somatic cell hybrid panel, and radiation hybrid cell panel. Northern blot analyses revealed that AIK3 expression was limited to testis. The expression levels of AIK3 in several cancer cell lines were elevated severalfold compared with normal fibroblasts. In HeLa cells, the endogenous AIK3 protein level is low in G1/S, accumulates during G2/M, and reduces after mitosis. Immunofluorescence studies using a specific antibody have shown that AIK3 is localized to centrosome during mitosis from anaphase to cytokinesis. These results suggest that AIK3 may play a role(s) in centrosome function at later stages of mitosis.  (+info)

The conserved protein kinase Ipl1 regulates microtubule binding to kinetochores in budding yeast. (2/1165)

Chromosome segregation depends on kinetochores, the structures that mediate chromosome attachment to the mitotic spindle. We isolated mutants in IPL1, which encodes a protein kinase, in a screen for budding yeast mutants that have defects in sister chromatid separation and segregation. Cytological tests show that ipl1 mutants can separate sister chromatids but are defective in chromosome segregation. Kinetochores assembled in extracts from ipl1 mutants show altered binding to microtubules. Ipl1p phosphorylates the kinetochore component Ndc10p in vitro and we propose that Ipl1p regulates kinetochore function via Ndc10p phosphorylation. Ipl1p localizes to the mitotic spindle and its levels are regulated during the cell cycle. This pattern of localization and regulation is similar to that of Ipl1p homologs in higher eukaryotes, such as the human aurora2 protein. Because aurora2 has been implicated in oncogenesis, defects in kinetochore function may contribute to genetic instability in human tumors.  (+info)

Novel protein kinases Ark1p and Prk1p associate with and regulate the cortical actin cytoskeleton in budding yeast. (3/1165)

Ark1p (actin regulating kinase 1) was identified as a yeast protein that binds to Sla2p, an evolutionarily conserved cortical actin cytoskeleton protein. Ark1p and a second yeast protein, Prk1p, contain NH2-terminal kinase domains that are 70% identical. Together with six other putative kinases from a number of organisms, these proteins define a new protein kinase family that we have named the Ark family. Lack of both Ark1p and Prk1p resulted in the formation of large cytoplasmic actin clumps and severe defects in cell growth. These defects were rescued by wild-type, but not by kinase-dead versions of the proteins. Elevated levels of either Ark1p or Prk1p caused a number of actin and cell morphological defects that were not observed when the kinase-dead versions were overexpressed instead. Ark1p and Prk1p were shown to localize to actin cortical patches, making these two kinases the first signaling proteins demonstrated to be patch components. These results suggest that Ark1p and Prk1p may be downstream effectors of signaling pathways that control actin patch organization and function. Furthermore, results of double-mutant analyses suggest that Ark1p and Prk1p function in overlapping but distinct pathways that regulate the cortical actin cytoskeleton.  (+info)

Centrosomal kinase AIK1 is overexpressed in invasive ductal carcinoma of the breast. (4/1165)

A centrosomal serine/threonine kinase, AIK1(3)/breast tumor amplified kinase/aurora2, which was recently identified as an oncogene, shows high amino acid identity with chromosome segregation kinases, fly Aurora, and yeast Ipl1. Immunohistochemical analyses of invasive ductal adenocarcinomas of the breast revealed that overexpression of AIK1 was observed in 94% of the cases, irrespective of the histopathological type, whereas the protein was not detected in normal ductal and lobular cells. Benign breast lesions including fibrocystic disease and fibroadenoma (epithelial components) displayed weakly detectable AIK1 expression in part of the lesions. This is the first immunohistochemical report of AIK1 expression in primary human breast carcinomas. Although the physiological function(s) of AIK1 kinase during cell division remains to be determined, the markedly high positivity of AIK1 staining in the cancer lesions suggested a possible involvement of its overexpression in the tumorigenesis of some of breast cancer cells.  (+info)

The Xenopus laevis aurora-related protein kinase pEg2 associates with and phosphorylates the kinesin-related protein XlEg5. (5/1165)

We have previously reported on the cloning of XlEg5, a Xenopus laevis kinesin-related protein from the bimC family (Le Guellec, R., Paris, J., Couturier, A., Roghi, C., and Philippe, M. (1991) Mol. Cell. Biol. 11, 3395-3408) as well as pEg2, an Aurora-related serine/threonine kinase (Roghi, C., Giet, R., Uzbekov, R., Morin, N., Chartrain, I., Le Guellec, R., Couturier, A., Doree, M., Philippe, M., and Prigent, C. (1998) J. Cell Sci. 111, 557-572). Inhibition of either XlEg5 or pEg2 activity during mitosis in Xenopus egg extract led to monopolar spindle formation. Here, we report that in Xenopus XL2 cells, pEg2 and XlEg5 are both confined to separated centrosomes in prophase, and then to the microtubule spindle poles. We also show that pEg2 co-immunoprecipitates with XlEg5 from egg extracts and XL2 cell lysates. Both proteins can directly interact in vitro, but also through the two-hybrid system. Furthermore immunoprecipitated pEg2 were found to remain active when bound to the beads and phosphorylate XlEg5 present in the precipitate. Two-dimensional mapping of XlEg5 tryptic peptides phosphorylated in vivo first confirmed that XlEg5 was phosphorylated by p34(cdc2) and next revealed that in vitro pEg2 kinase phosphorylated XlEg5 on the same stalk domain serine residue that was phosphorylated in metabolically labeled XL2 cells. The kinesin-related XlEg5 is to our knowledge the first in vivo substrate ever reported for an Aurora-related kinase.  (+info)

Stu-7/air-2 is a C. elegans aurora homologue essential for chromosome segregation during embryonic and post-embryonic development. (6/1165)

We have isolated a new sterile uncoordinated C. elegans mutant, stu-7, which is defective in post-embryonic cell divisions in a regionally-specific fashion. The anterior of the worm is relatively unaffected whereas the mid-body and/or posterior are markedly thin, often resulting in worms having a central 'waist'. We have cloned stu-7 and found that it encodes a member of the recently expanding aurora sub-family of serine/threonine kinases. Elimination of maternal as well as zygotic stu-7 expression reveals that stu-7 is essential for mitosis from the first embryonic cell cycle onwards and is required for chromosome segregation though not for centrosome separation or for setting up a bipolar spindle. Multicopy expression of stu-7 also causes mitotic defects, suggesting that the level of this protein must be tightly controlled in order to maintain genetic stability during development.  (+info)

Cdc20 associates with the kinase aurora2/Aik. (7/1165)

Cdc20/fizzy family proteins are involved in activation of the anaphase-promoting complex/cyclosome, which catalyzes the ubiquitin-dependent proteolysis of cell cycle regulatory proteins such as anaphase inhibitors and mitotic cyclins, leading to chromosome segregation and exit from mitosis. Previous work has shown that human Cdc20 (hCdc20/p55CDC) associates with one or more kinases. We report here that Cdc20-associated myelin basic protein kinase activity peaks sharply in early M phase (embryonic cells) or in G2 phase (somatic cells). In HeLa cells, Cdc20 is associated with the kinase aurora2/Aik. Aurora2/Aik is a member of the aurora/Ipl1 family of kinases that, like Cdc20, previously has been shown to be localized at mitotic spindle poles and is involved in regulating chromosome segregation and maintaining genomic stability. The demonstration that Cdc20 is associated with aurora2/Aik suggests that some function of Cdc20 is carried out or regulated through its association with aurora2/Aik.  (+info)

Sli15 associates with the ipl1 protein kinase to promote proper chromosome segregation in Saccharomyces cerevisiae. (8/1165)

The conserved Ipl1 protein kinase is essential for proper chromosome segregation and thus cell viability in the budding yeast Saccharomyces cerevisiae. Its human homologue has been implicated in the tumorigenesis of diverse forms of cancer. We show here that sister chromatids that have separated from each other are not properly segregated to opposite poles of ipl1-2 cells. Failures in chromosome segregation are often associated with abnormal distribution of the spindle pole-associated Nuf2-GFP protein, thus suggesting a link between potential spindle pole defects and chromosome missegregation in ipl1 mutant cells. A small fraction of ipl1-2 cells also appears to be defective in nuclear migration or bipolar spindle formation. Ipl1 associates, probably directly, with the novel and essential Sli15 protein in vivo, and both proteins are localized to the mitotic spindle. Conditional sli15 mutant cells have cytological phenotypes very similar to those of ipl1 cells, and the ipl1-2 mutation exhibits synthetic lethal genetic interaction with sli15 mutations. sli15 mutant phenotype, like ipl1 mutant phenotype, is partially suppressed by perturbations that reduce protein phosphatase 1 function. These genetic and biochemical studies indicate that Sli15 associates with Ipl1 to promote its function in chromosome segregation.  (+info)

Aurora kinases are a family of serine/threonine protein kinases that play crucial roles in the regulation of cell division. There are three members of the Aurora kinase family, designated as Aurora A, Aurora B, and Aurora C. These kinases are involved in the proper separation of chromosomes during mitosis and meiosis, and their dysregulation has been implicated in various types of cancer.

Aurora A is primarily located at the centrosomes and spindle poles during cell division, where it regulates centrosome maturation, bipolar spindle formation, and chromosome segregation. Aurora B, on the other hand, is a component of the chromosomal passenger complex (CPC) that localizes to the centromeres during prophase and moves to the spindle midzone during anaphase. It plays essential roles in kinetochore-microtubule attachment, chromosome alignment, and cytokinesis. Aurora C is most similar to Aurora B and appears to have overlapping functions with it, although its specific roles are less well understood.

Dysregulation of Aurora kinases has been associated with various types of cancer, including breast, ovarian, colon, and lung cancers. Overexpression or amplification of Aurora A is observed in many cancers, leading to chromosomal instability and aneuploidy. Inhibition of Aurora kinases has emerged as a potential therapeutic strategy for cancer treatment, with several small molecule inhibitors currently under investigation in clinical trials.

Aurora Kinase A is a type of serine/threonine kinase that plays a crucial role in the regulation of cell division and mitosis. It is encoded by the AURKA gene in humans. This enzyme is responsible for proper chromosome alignment and segregation during mitosis, and its dysregulation has been implicated in various types of cancer. Aurora Kinase A is often overexpressed in cancer cells, leading to chromosomal instability and aneuploidy, which contribute to tumor growth and progression. Inhibitors of Aurora Kinase A are being investigated as potential cancer therapeutics.

Aurora Kinase B is a type of enzyme that plays a crucial role in the regulation of cell division and mitosis. It is a member of the Aurora kinase family, which includes three different isoforms (Aurora A, B, and C). Among these, Aurora Kinase B is specifically involved in the proper alignment and separation of chromosomes during cell division.

During mitosis, Aurora Kinase B forms a complex with other proteins to form the chromosomal passenger complex (CPC), which plays a critical role in ensuring accurate chromosome segregation. The CPC is responsible for regulating various events during mitosis, including the attachment of microtubules to kinetochores (protein structures that connect chromosomes to spindle fibers), the correction of erroneous kinetochore-microtubule attachments, and the regulation of the anaphase promoting complex/cyclosome (APC/C), which targets specific proteins for degradation during mitosis.

Dysregulation of Aurora Kinase B has been implicated in various human diseases, including cancer. Overexpression or amplification of this kinase can lead to chromosomal instability and aneuploidy, contributing to tumorigenesis and cancer progression. As a result, Aurora Kinase B is considered a promising target for the development of anti-cancer therapies, with several inhibitors currently being investigated in preclinical and clinical studies.

Aurora Kinase C is a type of serine/threonine protein kinase that is involved in the regulation of cell division and mitosis. It plays a crucial role in the proper separation of chromosomes during cell division, ensuring the genetic stability of cells. Mutations in the gene that encodes Aurora Kinase C have been associated with various types of cancer, including colon, breast, and ovarian cancers. Inhibitors of Aurora Kinase C are being studied as potential cancer therapeutics.

Protein-Serine-Threonine Kinases (PSTKs) are a type of protein kinase that catalyzes the transfer of a phosphate group from ATP to the hydroxyl side chains of serine or threonine residues on target proteins. This phosphorylation process plays a crucial role in various cellular signaling pathways, including regulation of metabolism, gene expression, cell cycle progression, and apoptosis. PSTKs are involved in many physiological and pathological processes, and their dysregulation has been implicated in several diseases, such as cancer, diabetes, and neurodegenerative disorders.

Protein kinase inhibitors (PKIs) are a class of drugs that work by interfering with the function of protein kinases. Protein kinases are enzymes that play a crucial role in many cellular processes by adding a phosphate group to specific proteins, thereby modifying their activity, localization, or interaction with other molecules. This process of adding a phosphate group is known as phosphorylation and is a key mechanism for regulating various cellular functions, including signal transduction, metabolism, and cell division.

In some diseases, such as cancer, protein kinases can become overactive or mutated, leading to uncontrolled cell growth and division. Protein kinase inhibitors are designed to block the activity of these dysregulated kinases, thereby preventing or slowing down the progression of the disease. These drugs can be highly specific, targeting individual protein kinases or families of kinases, making them valuable tools for targeted therapy in cancer and other diseases.

Protein kinase inhibitors can work in various ways to block the activity of protein kinases. Some bind directly to the active site of the enzyme, preventing it from interacting with its substrates. Others bind to allosteric sites, changing the conformation of the enzyme and making it inactive. Still, others target upstream regulators of protein kinases or interfere with their ability to form functional complexes.

Examples of protein kinase inhibitors include imatinib (Gleevec), which targets the BCR-ABL kinase in chronic myeloid leukemia, and gefitinib (Iressa), which inhibits the EGFR kinase in non-small cell lung cancer. These drugs have shown significant clinical benefits in treating these diseases and have become important components of modern cancer therapy.

Mitosis is a type of cell division in which the genetic material of a single cell, called the mother cell, is equally distributed into two identical daughter cells. It's a fundamental process that occurs in multicellular organisms for growth, maintenance, and repair, as well as in unicellular organisms for reproduction.

The process of mitosis can be broken down into several stages: prophase, prometaphase, metaphase, anaphase, and telophase. During prophase, the chromosomes condense and become visible, and the nuclear envelope breaks down. In prometaphase, the nuclear membrane is completely disassembled, and the mitotic spindle fibers attach to the chromosomes at their centromeres.

During metaphase, the chromosomes align at the metaphase plate, an imaginary line equidistant from the two spindle poles. In anaphase, sister chromatids are pulled apart by the spindle fibers and move toward opposite poles of the cell. Finally, in telophase, new nuclear envelopes form around each set of chromosomes, and the chromosomes decondense and become less visible.

Mitosis is followed by cytokinesis, a process that divides the cytoplasm of the mother cell into two separate daughter cells. The result of mitosis and cytokinesis is two genetically identical cells, each with the same number and kind of chromosomes as the original parent cell.

Protein kinases are a group of enzymes that play a crucial role in many cellular processes by adding phosphate groups to other proteins, a process known as phosphorylation. This modification can activate or deactivate the target protein's function, thereby regulating various signaling pathways within the cell. Protein kinases are essential for numerous biological functions, including metabolism, signal transduction, cell cycle progression, and apoptosis (programmed cell death). Abnormal regulation of protein kinases has been implicated in several diseases, such as cancer, diabetes, and neurological disorders.

Phosphatidylinositol 3-Kinases (PI3Ks) are a family of enzymes that play a crucial role in intracellular signal transduction. They phosphorylate the 3-hydroxyl group of the inositol ring in phosphatidylinositol and its derivatives, which results in the production of second messengers that regulate various cellular processes such as cell growth, proliferation, differentiation, motility, and survival.

PI3Ks are divided into three classes based on their structure and substrate specificity. Class I PI3Ks are further subdivided into two categories: class IA and class IB. Class IA PI3Ks are heterodimers consisting of a catalytic subunit (p110α, p110β, or p110δ) and a regulatory subunit (p85α, p85β, p55γ, or p50γ). They are primarily activated by receptor tyrosine kinases and G protein-coupled receptors. Class IB PI3Ks consist of a catalytic subunit (p110γ) and a regulatory subunit (p101 or p84/87). They are mainly activated by G protein-coupled receptors.

Dysregulation of PI3K signaling has been implicated in various human diseases, including cancer, diabetes, and autoimmune disorders. Therefore, PI3Ks have emerged as important targets for drug development in these areas.

Mitogen-activated protein kinase (MAPK) signaling system is a crucial pathway for the transmission and regulation of various cellular responses in eukaryotic cells. It plays a significant role in several biological processes, including proliferation, differentiation, apoptosis, inflammation, and stress response. The MAPK cascade consists of three main components: MAP kinase kinase kinase (MAP3K or MEKK), MAP kinase kinase (MAP2K or MEK), and MAP kinase (MAPK).

The signaling system is activated by various extracellular stimuli, such as growth factors, cytokines, hormones, and stress signals. These stimuli initiate a phosphorylation cascade that ultimately leads to the activation of MAPKs. The activated MAPKs then translocate into the nucleus and regulate gene expression by phosphorylating various transcription factors and other regulatory proteins.

There are four major MAPK families: extracellular signal-regulated kinases (ERK1/2), c-Jun N-terminal kinases (JNK1/2/3), p38 MAPKs (p38α/β/γ/δ), and ERK5. Each family has distinct functions, substrates, and upstream activators. Dysregulation of the MAPK signaling system can lead to various diseases, including cancer, diabetes, cardiovascular diseases, and neurological disorders. Therefore, understanding the molecular mechanisms underlying this pathway is crucial for developing novel therapeutic strategies.

The spindle apparatus is a microtubule-based structure that plays a crucial role in the process of cell division, specifically during mitosis and meiosis. It consists of three main components:

1. The spindle poles: These are organized structures composed of microtubules and associated proteins that serve as the anchoring points for the spindle fibers. In animal cells, these poles are typically formed by centrosomes, while in plant cells, they form around nucleation sites called microtubule-organizing centers (MTOCs).
2. The spindle fibers: These are dynamic arrays of microtubules that extend between the two spindle poles. They can be categorized into three types: kinetochore fibers, which connect to the kinetochores on chromosomes; astral fibers, which radiate from the spindle poles and help position the spindle within the cell; and interpolar fibers, which lie between the two spindle poles and contribute to their separation during anaphase.
3. Regulatory proteins: Various motor proteins, such as dynein and kinesin, as well as non-motor proteins like tubulin and septins, are involved in the assembly, maintenance, and dynamics of the spindle apparatus. These proteins help to generate forces that move chromosomes, position the spindle, and ultimately segregate genetic material between two daughter cells during cell division.

The spindle apparatus is essential for ensuring accurate chromosome separation and maintaining genomic stability during cell division. Dysfunction of the spindle apparatus can lead to various abnormalities, including aneuploidy (abnormal number of chromosomes) and chromosomal instability, which have been implicated in several diseases, such as cancer and developmental disorders.

Chromosome segregation is the process that occurs during cell division (mitosis or meiosis) where replicated chromosomes are separated and distributed equally into two daughter cells. Each chromosome consists of two sister chromatids, which are identical copies of genetic material. During chromosome segregation, these sister chromatids are pulled apart by a structure called the mitotic spindle and moved to opposite poles of the cell. This ensures that each new cell receives one copy of each chromosome, preserving the correct number and composition of chromosomes in the organism.

Phosphorylation is the process of adding a phosphate group (a molecule consisting of one phosphorus atom and four oxygen atoms) to a protein or other organic molecule, which is usually done by enzymes called kinases. This post-translational modification can change the function, localization, or activity of the target molecule, playing a crucial role in various cellular processes such as signal transduction, metabolism, and regulation of gene expression. Phosphorylation is reversible, and the removal of the phosphate group is facilitated by enzymes called phosphatases.

Calcium-calmodulin-dependent protein kinases (CAMKs) are a family of enzymes that play a crucial role in intracellular signaling pathways. They are activated by the binding of calcium ions and calmodulin, a ubiquitous calcium-binding protein, to their regulatory domain.

Once activated, CAMKs phosphorylate specific serine or threonine residues on target proteins, thereby modulating their activity, localization, or stability. This post-translational modification is essential for various cellular processes, including synaptic plasticity, gene expression, metabolism, and cell cycle regulation.

There are several subfamilies of CAMKs, including CaMKI, CaMKII, CaMKIII (also known as CaMKIV), and CaMK kinase (CaMKK). Each subfamily has distinct structural features, substrate specificity, and regulatory mechanisms. Dysregulation of CAMK signaling has been implicated in various pathological conditions, such as neurodegenerative diseases, cancer, and cardiovascular disorders.

Piperazines are a class of heterocyclic organic compounds that contain a seven-membered ring with two nitrogen atoms at positions 1 and 4. They have the molecular formula N-NRR' where R and R' can be alkyl or aryl groups. Piperazines have a wide range of uses in pharmaceuticals, agrochemicals, and as building blocks in organic synthesis.

In a medical context, piperazines are used in the manufacture of various drugs, including some antipsychotics, antidepressants, antihistamines, and anti-worm medications. For example, the antipsychotic drug trifluoperazine and the antidepressant drug nefazodone both contain a piperazine ring in their chemical structure.

However, it's important to note that some piperazines are also used as recreational drugs due to their stimulant and euphoric effects. These include compounds such as BZP (benzylpiperazine) and TFMPP (trifluoromethylphenylpiperazine), which have been linked to serious health risks, including addiction, seizures, and death. Therefore, the use of these substances should be avoided.

A cell line that is derived from tumor cells and has been adapted to grow in culture. These cell lines are often used in research to study the characteristics of cancer cells, including their growth patterns, genetic changes, and responses to various treatments. They can be established from many different types of tumors, such as carcinomas, sarcomas, and leukemias. Once established, these cell lines can be grown and maintained indefinitely in the laboratory, allowing researchers to conduct experiments and studies that would not be feasible using primary tumor cells. It is important to note that tumor cell lines may not always accurately represent the behavior of the original tumor, as they can undergo genetic changes during their time in culture.

Kinetochores are specialized protein structures that form on the centromere region of a chromosome. They play a crucial role in the process of cell division, specifically during mitosis and meiosis. The primary function of kinetochores is to connect the chromosomes to the microtubules of the spindle apparatus, which is responsible for separating the sister chromatids during cell division. Through this connection, kinetochores facilitate the movement of chromosomes towards opposite poles of the cell during anaphase, ensuring equal distribution of genetic material to each resulting daughter cell.

Azepines are heterocyclic chemical compounds that contain a seven-membered ring with one nitrogen atom and six carbon atoms. The term "azepine" refers to the basic structure, and various substituted azepines exist with different functional groups attached to the carbon and nitrogen atoms.

Azepines are not typically used in medical contexts as a therapeutic agent or a target for drug design. However, some azepine derivatives have been investigated for their potential biological activities, such as anti-inflammatory, antiviral, and anticancer properties. These compounds may be the subject of ongoing research, but they are not yet established as medical treatments.

It's worth noting that while azepines themselves are not a medical term, some of their derivatives or analogs may have medical relevance. Therefore, it is essential to consult medical literature and databases for accurate and up-to-date information on the medical use of specific azepine compounds.

SRC-family kinases (SFKs) are a group of non-receptor tyrosine kinases that play important roles in various cellular processes, including cell proliferation, differentiation, survival, and migration. They are named after the founding member, SRC, which was first identified as an oncogene in Rous sarcoma virus.

SFKs share a common structure, consisting of an N-terminal unique domain, a SH3 domain, a SH2 domain, a catalytic kinase domain, and a C-terminal regulatory tail with a negative regulatory tyrosine residue (Y527 in human SRC). In their inactive state, SFKs are maintained in a closed conformation through intramolecular interactions between the SH3 domain, SH2 domain, and the phosphorylated C-terminal tyrosine.

Upon activation by various signals, such as growth factors, cytokines, or integrin engagement, SFKs are activated through a series of events that involve dephosphorylation of the regulatory tyrosine residue, recruitment to membrane receptors via their SH2 and SH3 domains, and trans-autophosphorylation of the activation loop in the kinase domain.

Once activated, SFKs can phosphorylate a wide range of downstream substrates, including other protein kinases, adaptor proteins, and cytoskeletal components, thereby regulating various signaling pathways that control cell behavior. Dysregulation of SFK activity has been implicated in various diseases, including cancer, inflammation, and neurological disorders.

Organophosphates are a group of chemicals that include insecticides, herbicides, and nerve gases. They work by inhibiting an enzyme called acetylcholinesterase, which normally breaks down the neurotransmitter acetylcholine in the synapse between nerves. This leads to an overaccumulation of acetylcholine, causing overstimulation of the nervous system and resulting in a wide range of symptoms such as muscle twitching, nausea, vomiting, diarrhea, sweating, confusion, and potentially death due to respiratory failure. Organophosphates are highly toxic and their use is regulated due to the risks they pose to human health and the environment.

Benzamides are a class of organic compounds that consist of a benzene ring (a aromatic hydrocarbon) attached to an amide functional group. The amide group can be bound to various substituents, leading to a variety of benzamide derivatives with different biological activities.

In a medical context, some benzamides have been developed as drugs for the treatment of various conditions. For example, danzol (a benzamide derivative) is used as a hormonal therapy for endometriosis and breast cancer. Additionally, other benzamides such as sulpiride and amisulpride are used as antipsychotic medications for the treatment of schizophrenia and related disorders.

It's important to note that while some benzamides have therapeutic uses, others may be toxic or have adverse effects, so they should only be used under the supervision of a medical professional.

Cell cycle proteins are a group of regulatory proteins that control the progression of the cell cycle, which is the series of events that take place in a eukaryotic cell leading to its division and duplication. These proteins can be classified into several categories based on their functions during different stages of the cell cycle.

The major groups of cell cycle proteins include:

1. Cyclin-dependent kinases (CDKs): CDKs are serine/threonine protein kinases that regulate key transitions in the cell cycle. They require binding to a regulatory subunit called cyclin to become active. Different CDK-cyclin complexes are activated at different stages of the cell cycle.
2. Cyclins: Cyclins are a family of regulatory proteins that bind and activate CDKs. Their levels fluctuate throughout the cell cycle, with specific cyclins expressed during particular phases. For example, cyclin D is important for the G1 to S phase transition, while cyclin B is required for the G2 to M phase transition.
3. CDK inhibitors (CKIs): CKIs are regulatory proteins that bind to and inhibit CDKs, thereby preventing their activation. CKIs can be divided into two main families: the INK4 family and the Cip/Kip family. INK4 family members specifically inhibit CDK4 and CDK6, while Cip/Kip family members inhibit a broader range of CDKs.
4. Anaphase-promoting complex/cyclosome (APC/C): APC/C is an E3 ubiquitin ligase that targets specific proteins for degradation by the 26S proteasome. During the cell cycle, APC/C regulates the metaphase to anaphase transition and the exit from mitosis by targeting securin and cyclin B for degradation.
5. Other regulatory proteins: Several other proteins play crucial roles in regulating the cell cycle, such as p53, a transcription factor that responds to DNA damage and arrests the cell cycle, and the polo-like kinases (PLKs), which are involved in various aspects of mitosis.

Overall, cell cycle proteins work together to ensure the proper progression of the cell cycle, maintain genomic stability, and prevent uncontrolled cell growth, which can lead to cancer.

M Phase cell cycle checkpoints are control mechanisms that ensure the proper completion of the M phase (mitosis or meiosis) of the cell cycle. These checkpoints verify that certain conditions are met before the cell proceeds to the next phase of the cell cycle, thus helping to maintain genomic stability and prevent errors such as chromosomal mutations or aneuploidy.

There are two main M Phase cell cycle checkpoints:

1. The G2/M Checkpoint: This checkpoint is activated at the end of the G2 phase and verifies that all DNA has been replicated accurately, and that there are no DNA damages or other issues that could interfere with mitosis. If any problems are detected, the cell cycle is halted until they can be resolved.
2. The Mitotic Spindle Checkpoint: This checkpoint ensures that all chromosomes have attached properly to the spindle apparatus and that they will be equally distributed to the two resulting daughter cells during mitosis. If any chromosomes are not properly attached or if there is an issue with the spindle apparatus, the cell cycle is paused until these problems are corrected.

These checkpoints play a crucial role in maintaining genomic stability and preventing the development of cancer and other diseases.

Protein Kinase C (PKC) is a family of serine-threonine kinases that play crucial roles in various cellular signaling pathways. These enzymes are activated by second messengers such as diacylglycerol (DAG) and calcium ions (Ca2+), which result from the activation of cell surface receptors like G protein-coupled receptors (GPCRs) and receptor tyrosine kinases (RTKs).

Once activated, PKC proteins phosphorylate downstream target proteins, thereby modulating their activities. This regulation is involved in numerous cellular processes, including cell growth, differentiation, apoptosis, and membrane trafficking. There are at least 10 isoforms of PKC, classified into three subfamilies based on their second messenger requirements and structural features: conventional (cPKC; α, βI, βII, and γ), novel (nPKC; δ, ε, η, and θ), and atypical (aPKC; ζ and ι/λ). Dysregulation of PKC signaling has been implicated in several diseases, such as cancer, diabetes, and neurological disorders.

A centrosome is a microtubule-organizing center found in animal cells. It consists of two barrel-shaped structures called centrioles, which are surrounded by a protein matrix called the pericentriolar material. The centrosome plays a crucial role in organizing the microtubules that form the cell's cytoskeleton and help to shape the cell, as well as in separating the chromosomes during cell division.

During mitosis, the two centrioles of the centrosome separate and move to opposite poles of the cell, where they nucleate the formation of the spindle fibers that pull the chromosomes apart. The centrosome also helps to ensure that the genetic material is equally distributed between the two resulting daughter cells.

It's worth noting that while centrioles are present in many animal cells, they are not always present in all types of cells. For example, plant cells do not have centrioles or centrosomes, and instead rely on other mechanisms to organize their microtubules.

Cytokinesis is the part of the cell division process (mitosis or meiosis) in which the cytoplasm of a single eukaryotic cell divides into two daughter cells. It usually begins after telophase, and it involves the constriction of a contractile ring composed of actin filaments and myosin motor proteins that forms at the equatorial plane of the cell. This results in the formation of a cleavage furrow, which deepens and eventually leads to the physical separation of the two daughter cells. Cytokinesis is essential for cell reproduction and growth in multicellular organisms, and its failure can lead to various developmental abnormalities or diseases.

p38 Mitogen-Activated Protein Kinases (p38 MAPKs) are a family of conserved serine-threonine protein kinases that play crucial roles in various cellular processes, including inflammation, immune response, differentiation, apoptosis, and stress responses. They are activated by diverse stimuli such as cytokines, ultraviolet radiation, heat shock, osmotic stress, and lipopolysaccharides (LPS).

Once activated, p38 MAPKs phosphorylate and regulate several downstream targets, including transcription factors and other protein kinases. This regulation leads to the expression of genes involved in inflammation, cell cycle arrest, and apoptosis. Dysregulation of p38 MAPK signaling has been implicated in various diseases, such as cancer, neurodegenerative disorders, and autoimmune diseases. Therefore, p38 MAPKs are considered promising targets for developing new therapeutic strategies to treat these conditions.

Polyploidy is a condition in which a cell or an organism has more than two sets of chromosomes, unlike the typical diploid state where there are only two sets (one from each parent). Polyploidy can occur through various mechanisms such as errors during cell division, fusion of egg and sperm cells that have an abnormal number of chromosomes, or through the reproduction process in plants.

Polyploidy is common in the plant kingdom, where it often leads to larger size, increased biomass, and sometimes hybrid vigor. However, in animals, polyploidy is less common and usually occurs in only certain types of cells or tissues, as most animals require a specific number of chromosomes for normal development and reproduction. In humans, polyploidy is typically not compatible with life and can lead to developmental abnormalities and miscarriage.

Cyclic AMP (cAMP)-dependent protein kinases, also known as protein kinase A (PKA), are a family of enzymes that play a crucial role in intracellular signaling pathways. These enzymes are responsible for the regulation of various cellular processes, including metabolism, gene expression, and cell growth and differentiation.

PKA is composed of two regulatory subunits and two catalytic subunits. When cAMP binds to the regulatory subunits, it causes a conformational change that leads to the dissociation of the catalytic subunits. The freed catalytic subunits then phosphorylate specific serine and threonine residues on target proteins, thereby modulating their activity.

The cAMP-dependent protein kinases are activated in response to a variety of extracellular signals, such as hormones and neurotransmitters, that bind to G protein-coupled receptors (GPCRs) or receptor tyrosine kinases (RTKs). These signals lead to the activation of adenylyl cyclase, which catalyzes the conversion of ATP to cAMP. The resulting increase in intracellular cAMP levels triggers the activation of PKA and the downstream phosphorylation of target proteins.

Overall, cAMP-dependent protein kinases are essential regulators of many fundamental cellular processes and play a critical role in maintaining normal physiology and homeostasis. Dysregulation of these enzymes has been implicated in various diseases, including cancer, diabetes, and neurological disorders.

Mitogen-Activated Protein Kinase 1 (MAPK1), also known as Extracellular Signal-Regulated Kinase 2 (ERK2), is a protein kinase that plays a crucial role in intracellular signal transduction pathways. It is a member of the MAPK family, which regulates various cellular processes such as proliferation, differentiation, apoptosis, and stress response.

MAPK1 is activated by a cascade of phosphorylation events initiated by upstream activators like MAPKK (Mitogen-Activated Protein Kinase Kinase) in response to various extracellular signals such as growth factors, hormones, and mitogens. Once activated, MAPK1 phosphorylates downstream targets, including transcription factors and other protein kinases, thereby modulating their activities and ultimately influencing gene expression and cellular responses.

MAPK1 is widely expressed in various tissues and cells, and its dysregulation has been implicated in several pathological conditions, including cancer, inflammation, and neurodegenerative diseases. Therefore, understanding the regulation and function of MAPK1 signaling pathways has important implications for developing therapeutic strategies to treat these disorders.

A chondroma is a benign, slow-growing tumor that develops in the cartilage. Cartilage is a type of connective tissue found in various parts of the body, including the joints, ribcage, and nose. Chondromas are most commonly found in the hands and feet.

Chondromas are typically small, measuring less than 2 centimeters in diameter, and they usually do not cause any symptoms. However, if a chondroma grows large enough to press on nearby nerves or blood vessels, it may cause pain, numbness, or weakness in the affected area.

Chondromas are usually diagnosed through imaging tests such as X-rays, CT scans, or MRI scans. If a chondroma is suspected based on these tests, a biopsy may be performed to confirm the diagnosis and rule out other types of tumors.

Treatment for chondromas typically involves surgical removal of the tumor. In most cases, this can be done using minimally invasive techniques that allow for quicker recovery times. After surgery, patients will need to follow up with their healthcare provider to ensure that the tumor has been completely removed and to monitor for any signs of recurrence.

HeLa cells are a type of immortalized cell line used in scientific research. They are derived from a cancer that developed in the cervical tissue of Henrietta Lacks, an African-American woman, in 1951. After her death, cells taken from her tumor were found to be capable of continuous division and growth in a laboratory setting, making them an invaluable resource for medical research.

HeLa cells have been used in a wide range of scientific studies, including research on cancer, viruses, genetics, and drug development. They were the first human cell line to be successfully cloned and are able to grow rapidly in culture, doubling their population every 20-24 hours. This has made them an essential tool for many areas of biomedical research.

It is important to note that while HeLa cells have been instrumental in numerous scientific breakthroughs, the story of their origin raises ethical questions about informed consent and the use of human tissue in research.

Aneugens are chemical or physical agents that can cause aneuploidy, which is a condition characterized by an abnormal number of chromosomes in the cells of an organism. Aneuploidy can result from errors in cell division, such as nondisjunction, during which chromosome pairs fail to separate properly during mitosis or meiosis.

Exposure to aneugens can increase the risk of aneuploidy by interfering with the normal functioning of the mitotic spindle, the cellular structure responsible for separating chromosomes during cell division. Aneugens can cause errors in chromosome segregation by disrupting the attachment of chromosomes to the spindle or by affecting the dynamics of spindle microtubules.

Examples of aneugens include certain chemotherapeutic drugs, such as colchicine and vincristine, which are used in cancer treatment but can also cause fetal abnormalities if taken during pregnancy. Other aneugens include environmental toxins, such as pesticides and industrial chemicals, which have been linked to increased risks of birth defects and reproductive problems.

Medical Definition:
Microtubule-associated proteins (MAPs) are a diverse group of proteins that bind to microtubules, which are key components of the cytoskeleton in eukaryotic cells. MAPs play crucial roles in regulating microtubule dynamics and stability, as well as in mediating interactions between microtubules and other cellular structures. They can be classified into several categories based on their functions, including:

1. Microtubule stabilizers: These MAPs promote the assembly of microtubules and protect them from disassembly by enhancing their stability. Examples include tau proteins and MAP2.
2. Microtubule dynamics regulators: These MAPs modulate the rate of microtubule polymerization and depolymerization, allowing for dynamic reorganization of the cytoskeleton during cell division and other processes. Examples include stathmin and XMAP215.
3. Microtubule motor proteins: These MAPs use energy from ATP hydrolysis to move along microtubules, transporting various cargoes within the cell. Examples include kinesin and dynein.
4. Adapter proteins: These MAPs facilitate interactions between microtubules and other cellular structures, such as membranes, organelles, or signaling molecules. Examples include MAP4 and CLASPs.

Dysregulation of MAPs has been implicated in several diseases, including neurodegenerative disorders like Alzheimer's disease (where tau proteins form abnormal aggregates called neurofibrillary tangles) and cancer (where altered microtubule dynamics can contribute to uncontrolled cell division).

Apoptosis is a programmed and controlled cell death process that occurs in multicellular organisms. It is a natural process that helps maintain tissue homeostasis by eliminating damaged, infected, or unwanted cells. During apoptosis, the cell undergoes a series of morphological changes, including cell shrinkage, chromatin condensation, and fragmentation into membrane-bound vesicles called apoptotic bodies. These bodies are then recognized and engulfed by neighboring cells or phagocytic cells, preventing an inflammatory response. Apoptosis is regulated by a complex network of intracellular signaling pathways that involve proteins such as caspases, Bcl-2 family members, and inhibitors of apoptosis (IAPs).

Pyrimidines are heterocyclic aromatic organic compounds similar to benzene and pyridine, containing two nitrogen atoms at positions 1 and 3 of the six-member ring. They are one of the two types of nucleobases found in nucleic acids, the other being purines. The pyrimidine bases include cytosine (C) and thymine (T) in DNA, and uracil (U) in RNA, which pair with guanine (G) and adenine (A), respectively, through hydrogen bonding to form the double helix structure of nucleic acids. Pyrimidines are also found in many other biomolecules and have various roles in cellular metabolism and genetic regulation.

The cell cycle is a series of events that take place in a cell leading to its division and duplication. It consists of four main phases: G1 phase, S phase, G2 phase, and M phase.

During the G1 phase, the cell grows in size and synthesizes mRNA and proteins in preparation for DNA replication. In the S phase, the cell's DNA is copied, resulting in two complete sets of chromosomes. During the G2 phase, the cell continues to grow and produces more proteins and organelles necessary for cell division.

The M phase is the final stage of the cell cycle and consists of mitosis (nuclear division) and cytokinesis (cytoplasmic division). Mitosis results in two genetically identical daughter nuclei, while cytokinesis divides the cytoplasm and creates two separate daughter cells.

The cell cycle is regulated by various checkpoints that ensure the proper completion of each phase before progressing to the next. These checkpoints help prevent errors in DNA replication and division, which can lead to mutations and cancer.

Histones are highly alkaline proteins found in the chromatin of eukaryotic cells. They are rich in basic amino acid residues, such as arginine and lysine, which give them their positive charge. Histones play a crucial role in packaging DNA into a more compact structure within the nucleus by forming a complex with it called a nucleosome. Each nucleosome contains about 146 base pairs of DNA wrapped around an octamer of eight histone proteins (two each of H2A, H2B, H3, and H4). The N-terminal tails of these histones are subject to various post-translational modifications, such as methylation, acetylation, and phosphorylation, which can influence chromatin structure and gene expression. Histone variants also exist, which can contribute to the regulation of specific genes and other nuclear processes.

P21-activated kinases (PAKs) are a family of serine/threonine protein kinases that play crucial roles in various cellular processes, including cytoskeletal reorganization, cell motility, and gene transcription. They are activated by binding to small GTPases of the Rho family, such as Cdc42 and Rac, which become active upon stimulation of various extracellular signals. Once activated, PAKs phosphorylate a range of downstream targets, leading to changes in cell behavior and function. Aberrant regulation of PAKs has been implicated in several human diseases, including cancer and neurological disorders.

Cell proliferation is the process by which cells increase in number, typically through the process of cell division. In the context of biology and medicine, it refers to the reproduction of cells that makes up living tissue, allowing growth, maintenance, and repair. It involves several stages including the transition from a phase of quiescence (G0 phase) to an active phase (G1 phase), DNA replication in the S phase, and mitosis or M phase, where the cell divides into two daughter cells.

Abnormal or uncontrolled cell proliferation is a characteristic feature of many diseases, including cancer, where deregulated cell cycle control leads to excessive and unregulated growth of cells, forming tumors that can invade surrounding tissues and metastasize to distant sites in the body.

CDC2 protein kinase, also known as cell division cycle 2 or CDK1, is a type of enzyme that plays a crucial role in the regulation of the cell cycle. The cell cycle is the series of events that cells undergo as they grow, replicate their DNA, and divide into two daughter cells.

CDC2 protein kinase is a member of the cyclin-dependent kinase (CDK) family, which are serine/threonine protein kinases that are activated by binding to regulatory subunits called cyclins. CDC2 protein kinase is primarily associated with the regulation of the G2 phase and the entry into mitosis, the stage of the cell cycle where nuclear and cytoplasmic division occur.

CDC2 protein kinase functions by phosphorylating various target proteins, which alters their activity and contributes to the coordination of the different events that occur during the cell cycle. The activity of CDC2 protein kinase is tightly regulated through a variety of mechanisms, including phosphorylation and dephosphorylation, as well as the binding and destruction of cyclin subunits.

Dysregulation of CDC2 protein kinase has been implicated in various human diseases, including cancer, where uncontrolled cell division can lead to the formation of tumors. Therefore, understanding the regulation and function of CDC2 protein kinase is an important area of research in molecular biology and medicine.

Mitogen-Activated Protein Kinase Kinases (MAP2K or MEK) are a group of protein kinases that play a crucial role in intracellular signal transduction pathways. They are so named because they are activated by mitogens, which are substances that stimulate cell division, and other extracellular signals.

MAP2Ks are positioned upstream of the Mitogen-Activated Protein Kinases (MAPK) in a three-tiered kinase cascade. Once activated, MAP2Ks phosphorylate and activate MAPKs, which then go on to regulate various cellular processes such as proliferation, differentiation, survival, and apoptosis.

There are several subfamilies of MAP2Ks, including MEK1/2, MEK3/6 (also known as MKK3/6), MEK4/7 (also known as MKK4/7), and MEK5. Each MAP2K is specific to activating a particular MAPK, and they are activated by different MAP3Ks (MAP kinase kinase kinases) in response to various extracellular signals.

Dysregulation of the MAPK/MAP2K signaling pathways has been implicated in numerous diseases, including cancer, cardiovascular disease, and neurological disorders. Therefore, targeting these pathways with therapeutic agents has emerged as a promising strategy for treating various diseases.

JNK (c-Jun N-terminal kinase) Mitogen-Activated Protein Kinases are a subgroup of the Ser/Thr protein kinases that are activated by stress stimuli and play important roles in various cellular processes, including inflammation, apoptosis, and differentiation. They are involved in the regulation of gene expression through phosphorylation of transcription factors such as c-Jun. JNKs are activated by a variety of upstream kinases, including MAP2Ks (MKK4/SEK1 and MKK7), which are in turn activated by MAP3Ks (such as ASK1, MEKK1, MLKs, and TAK1). JNK signaling pathways have been implicated in various diseases, including cancer, neurodegenerative disorders, and inflammatory diseases.

Cell cycle checkpoints are control mechanisms that regulate the cell cycle and ensure the accurate and timely progression through different phases of the cell cycle. These checkpoints monitor specific cellular events, such as DNA replication and damage, chromosome separation, and proper attachment of the mitotic spindle to the chromosomes. If any of these events fail to occur properly or are delayed, the cell cycle checkpoints trigger a response that can halt the cell cycle until the problem is resolved. This helps to prevent cells with damaged or incomplete genomes from dividing and potentially becoming cancerous.

There are three main types of cell cycle checkpoints:

1. G1 Checkpoint: Also known as the restriction point, this checkpoint controls the transition from the G1 phase to the S phase of the cell cycle. It monitors the availability of nutrients, growth factors, and the integrity of the genome before allowing the cell to proceed into DNA replication.
2. G2 Checkpoint: This checkpoint regulates the transition from the G2 phase to the M phase of the cell cycle. It checks for completion of DNA replication and absence of DNA damage before allowing the cell to enter mitosis.
3. Mitotic (M) Checkpoint: Also known as the spindle assembly checkpoint, this checkpoint ensures that all chromosomes are properly attached to the mitotic spindle before anaphase begins. It prevents the separation of sister chromatids until all kinetochores are correctly attached and tension is established between them.

Cell cycle checkpoints play a crucial role in maintaining genomic stability, preventing tumorigenesis, and ensuring proper cell division. Dysregulation of these checkpoints can lead to various diseases, including cancer.

Mitogen-Activated Protein Kinase 3 (MAPK3), also known as extracellular signal-regulated kinase 1 (ERK1), is a serine/threonine protein kinase that plays a crucial role in intracellular signal transduction pathways. It is involved in the regulation of various cellular processes, including proliferation, differentiation, and survival, in response to extracellular stimuli such as growth factors, hormones, and stress.

MAPK3 is activated through a phosphorylation cascade that involves the activation of upstream MAPK kinases (MKK or MEK). Once activated, MAPK3 can phosphorylate and activate various downstream targets, including transcription factors, to regulate gene expression. Dysregulation of MAPK3 signaling has been implicated in several diseases, including cancer and neurological disorders.

Antineoplastic agents are a class of drugs used to treat malignant neoplasms or cancer. These agents work by inhibiting the growth and proliferation of cancer cells, either by killing them or preventing their division and replication. Antineoplastic agents can be classified based on their mechanism of action, such as alkylating agents, antimetabolites, topoisomerase inhibitors, mitotic inhibitors, and targeted therapy agents.

Alkylating agents work by adding alkyl groups to DNA, which can cause cross-linking of DNA strands and ultimately lead to cell death. Antimetabolites interfere with the metabolic processes necessary for DNA synthesis and replication, while topoisomerase inhibitors prevent the relaxation of supercoiled DNA during replication. Mitotic inhibitors disrupt the normal functioning of the mitotic spindle, which is essential for cell division. Targeted therapy agents are designed to target specific molecular abnormalities in cancer cells, such as mutated oncogenes or dysregulated signaling pathways.

It's important to note that antineoplastic agents can also affect normal cells and tissues, leading to various side effects such as nausea, vomiting, hair loss, and myelosuppression (suppression of bone marrow function). Therefore, the use of these drugs requires careful monitoring and management of their potential adverse effects.

Pyrazoles are heterocyclic aromatic organic compounds that contain a six-membered ring with two nitrogen atoms at positions 1 and 2. The chemical structure of pyrazoles consists of a pair of nitrogen atoms adjacent to each other in the ring, which makes them unique from other azole heterocycles such as imidazoles or triazoles.

Pyrazoles have significant biological activities and are found in various pharmaceuticals, agrochemicals, and natural products. Some pyrazole derivatives exhibit anti-inflammatory, analgesic, antipyretic, antimicrobial, antiviral, antifungal, and anticancer properties.

In the medical field, pyrazoles are used in various drugs to treat different conditions. For example, celecoxib (Celebrex) is a selective COX-2 inhibitor used for pain relief and inflammation reduction in arthritis patients. It contains a pyrazole ring as its core structure. Similarly, febuxostat (Uloric) is a medication used to treat gout, which also has a pyrazole moiety.

Overall, pyrazoles are essential compounds with significant medical applications and potential for further development in drug discovery and design.

Anaphase is a stage in the cell division process called mitosis, where sister chromatids (the two copies of each chromosome formed during DNA replication) separate at the centromeres and move toward opposite poles of the cell. This separation is facilitated by the attachment of microtubules from the spindle apparatus to the kinetochores, protein structures located on the centromeres of each sister chromatid. Anaphase is followed by telophase, during which the nuclear membrane reforms around each set of separated chromosomes, and cytokinesis, the division of the cytoplasm to form two separate daughter cells.

A mutation is a permanent change in the DNA sequence of an organism's genome. Mutations can occur spontaneously or be caused by environmental factors such as exposure to radiation, chemicals, or viruses. They may have various effects on the organism, ranging from benign to harmful, depending on where they occur and whether they alter the function of essential proteins. In some cases, mutations can increase an individual's susceptibility to certain diseases or disorders, while in others, they may confer a survival advantage. Mutations are the driving force behind evolution, as they introduce new genetic variability into populations, which can then be acted upon by natural selection.

Protein-Tyrosine Kinases (PTKs) are a type of enzyme that plays a crucial role in various cellular functions, including signal transduction, cell growth, differentiation, and metabolism. They catalyze the transfer of a phosphate group from ATP to the tyrosine residues of proteins, thereby modifying their activity, localization, or interaction with other molecules.

PTKs can be divided into two main categories: receptor tyrosine kinases (RTKs) and non-receptor tyrosine kinases (NRTKs). RTKs are transmembrane proteins that become activated upon binding to specific ligands, such as growth factors or hormones. NRTKs, on the other hand, are intracellular enzymes that can be activated by various signals, including receptor-mediated signaling and intracellular messengers.

Dysregulation of PTK activity has been implicated in several diseases, such as cancer, diabetes, and inflammatory disorders. Therefore, PTKs are important targets for drug development and therapy.

Microtubules are hollow, cylindrical structures composed of tubulin proteins in the cytoskeleton of eukaryotic cells. They play crucial roles in various cellular processes such as maintaining cell shape, intracellular transport, and cell division (mitosis and meiosis). Microtubules are dynamic, undergoing continuous assembly and disassembly, which allows them to rapidly reorganize in response to cellular needs. They also form part of important cellular structures like centrioles, basal bodies, and cilia/flagella.

Collagen type XI is a fibrillar collagen that is found in the extracellular matrix of various tissues, including cartilage and the eye. It is a homotrimer made up of three identical alpha 1(XI) chains or a heterotrimer composed of two alpha 1(XI) chains and one alpha 2(XI) chain. Collagen type XI is closely associated with collagen type II fibrils and plays a role in regulating the diameter and organization of these fibrils. Mutations in the genes encoding collagen type XI can lead to skeletal disorders such as stiff skin syndrome and fibrodysplasia ossificans progressiva.

Chromosomal proteins, non-histone, are a diverse group of proteins that are associated with chromatin, the complex of DNA and histone proteins, but do not have the characteristic structure of histones. These proteins play important roles in various nuclear processes such as DNA replication, transcription, repair, recombination, and chromosome condensation and segregation during cell division. They can be broadly classified into several categories based on their functions, including architectural proteins, enzymes, transcription factors, and structural proteins. Examples of non-histone chromosomal proteins include high mobility group (HMG) proteins, poly(ADP-ribose) polymerases (PARPs), and condensins.

Cyclin-dependent kinases (CDKs) are a family of serine/threonine protein kinases that play crucial roles in regulating the cell cycle, transcription, and other cellular processes. They are activated by binding to cyclin proteins, which accumulate and degrade at specific stages of the cell cycle. The activation of CDKs leads to phosphorylation of various downstream target proteins, resulting in the promotion or inhibition of different cell cycle events. Dysregulation of CDKs has been implicated in several human diseases, including cancer, and they are considered important targets for drug development.

A blastodisc is a term used in embryology, specifically in describing the development of birds and reptiles. It refers to a flattened disc of cells that forms on the upper surface of the yolk during early embryonic development. This disc contains the cells that will give rise to the embryo itself, as well as the extra-embryonic membranes that support its development.

The blastodisc is formed when the sperm fertilizes the egg, triggering a series of cell divisions and rearrangements. The cells in the blastodisc are initially equivalent, but they soon become organized into distinct regions with different fates. The outermost layer of the blastodisc will give rise to the extra-embryonic membranes, while the inner cells will form the embryo proper.

It's worth noting that the term "blastodisc" is not used in mammalian development, where a similar structure is called the "blastocyst."

Creatine kinase (CK) is a muscle enzyme that is normally present in small amounts in the blood. It is primarily found in tissues that require a lot of energy, such as the heart, brain, and skeletal muscles. When these tissues are damaged or injured, CK is released into the bloodstream, causing the levels to rise.

Creatine kinase exists in several forms, known as isoenzymes, which can be measured in the blood to help identify the location of tissue damage. The three main isoenzymes are:

1. CK-MM: Found primarily in skeletal muscle
2. CK-MB: Found primarily in heart muscle
3. CK-BB: Found primarily in the brain

Elevated levels of creatine kinase, particularly CK-MB, can indicate damage to the heart muscle, such as occurs with a heart attack. Similarly, elevated levels of CK-BB may suggest brain injury or disease. Overall, measuring creatine kinase levels is a useful diagnostic tool for assessing tissue damage and determining the severity of injuries or illnesses.

Quinazolines are not a medical term per se, but they are a class of organic compounds that have been widely used in the development of various pharmaceutical drugs. Therefore, I will provide you with a chemical definition of quinazolines:

Quinazolines are heterocyclic aromatic organic compounds consisting of a benzene ring fused to a pyrazine ring. The structure can be represented as follows:

Quinazoline

They are often used as building blocks in the synthesis of various drugs, including those used for treating cancer, cardiovascular diseases, and microbial infections. Some examples of FDA-approved drugs containing a quinazoline core include the tyrosine kinase inhibitors gefitinib (Iressa) and erlotinib (Tarceva), which are used to treat non-small cell lung cancer, and the calcium channel blocker verapamil (Calan, Isoptin), which is used to treat hypertension and angina.

MAP (Mitogen-Activated Protein) Kinase Kinase Kinases (MAP3K or MAPKKK) are a group of protein kinases that play a crucial role in intracellular signal transduction pathways, which regulate various cellular processes such as proliferation, differentiation, survival, and apoptosis. They are called "kinases" because they catalyze the transfer of a phosphate group from ATP to specific serine or threonine residues on their target proteins.

MAP3Ks function upstream of MAP Kinase Kinases (MKKs or MAP2K) and MAP Kinases (MPKs or MAPK) in the MAP kinase cascade. Upon activation by various extracellular signals, such as growth factors, cytokines, stress, and hormones, MAP3Ks phosphorylate and activate MKKs, which subsequently phosphorylate and activate MPKs. Activated MPKs then regulate the activity of downstream transcription factors and other target proteins to elicit appropriate cellular responses.

There are several subfamilies of MAP3Ks, including ASK, DLK, TAK, MEKK, MLK, and ZAK, among others. Each subfamily has distinct structural features and functions in different signaling pathways. Dysregulation of MAP kinase cascades, including MAP3Ks, has been implicated in various human diseases, such as cancer, inflammation, and neurodegenerative disorders.

Enzyme inhibitors are substances that bind to an enzyme and decrease its activity, preventing it from catalyzing a chemical reaction in the body. They can work by several mechanisms, including blocking the active site where the substrate binds, or binding to another site on the enzyme to change its shape and prevent substrate binding. Enzyme inhibitors are often used as drugs to treat various medical conditions, such as high blood pressure, abnormal heart rhythms, and bacterial infections. They can also be found naturally in some foods and plants, and can be used in research to understand enzyme function and regulation.

I'm sorry for any confusion, but "Potoroidae" is not a medical term. It is a taxonomic family within the order Diprotodontia, which includes several species of rat-kangaroos that are native to Australia. These small marsupials are known for their hopping locomotion and nocturnal behavior. If you have any questions about veterinary or medical terminology, I would be happy to help with those!

Small interfering RNA (siRNA) is a type of short, double-stranded RNA molecule that plays a role in the RNA interference (RNAi) pathway. The RNAi pathway is a natural cellular process that regulates gene expression by targeting and destroying specific messenger RNA (mRNA) molecules, thereby preventing the translation of those mRNAs into proteins.

SiRNAs are typically 20-25 base pairs in length and are generated from longer double-stranded RNA precursors called hairpin RNAs or dsRNAs by an enzyme called Dicer. Once generated, siRNAs associate with a protein complex called the RNA-induced silencing complex (RISC), which uses one strand of the siRNA (the guide strand) to recognize and bind to complementary sequences in the target mRNA. The RISC then cleaves the target mRNA, leading to its degradation and the inhibition of protein synthesis.

SiRNAs have emerged as a powerful tool for studying gene function and have shown promise as therapeutic agents for a variety of diseases, including viral infections, cancer, and genetic disorders. However, their use as therapeutics is still in the early stages of development, and there are challenges associated with delivering siRNAs to specific cells and tissues in the body.

eIF-2 kinase is a type of protein kinase that phosphorylates the alpha subunit of eukaryotic initiation factor-2 (eIF-2) at serine 51. This phosphorylation event inhibits the guanine nucleotide exchange factor eIF-2B, thereby preventing the recycling of eIF-2 and reducing global protein synthesis.

There are four main subtypes of eIF-2 kinases:

1. HRI (heme-regulated inhibitor) - responds to heme deficiency and oxidative stress
2. PERK (PKR-like endoplasmic reticulum kinase) - activated by ER stress and misfolded proteins in the ER
3. GCN2 (general control non-derepressible 2) - responds to amino acid starvation
4. PKR (double-stranded RNA-activated protein kinase) - activated by double-stranded RNA during viral infections

These eIF-2 kinases play crucial roles in regulating cellular responses to various stress conditions, such as the integrated stress response (ISR), which helps maintain cellular homeostasis and promote survival under adverse conditions.

Casein Kinase II (CK2) is a serine/threonine protein kinase that is widely expressed in eukaryotic cells and is involved in the regulation of various cellular processes. It is a heterotetrameric enzyme, consisting of two catalytic subunits (alpha and alpha') and two regulatory subunits (beta).

CK2 phosphorylates a wide range of substrates, including transcription factors, signaling proteins, and other kinases. It is known to play roles in cell cycle regulation, apoptosis, DNA damage response, and protein stability, among others. CK2 activity is often found to be elevated in various types of cancer, making it a potential target for cancer therapy.

Casein kinases are a family of protein kinases that play important roles in various cellular processes, including signal transduction, cell cycle regulation, and DNA damage repair. These enzymes phosphorylate serine and threonine residues on their target proteins by transferring a phosphate group from ATP to the hydroxyl side chain of these amino acids.

There are several isoforms of casein kinases, including Casein Kinase 1 (CK1) and Casein Kinase 2 (CK2), which differ in their structure, substrate specificity, and cellular functions. CK1 is involved in various signaling pathways, such as the Wnt signaling pathway, and regulates processes such as gene transcription, DNA repair, and circadian rhythm. CK2, on the other hand, is a highly conserved serine/threonine protein kinase that plays a role in many cellular processes, including cell division, apoptosis, and transcriptional regulation.

Dysregulation of casein kinases has been implicated in various diseases, including cancer, neurodegenerative disorders, and cardiovascular disease. Therefore, these enzymes are considered important targets for the development of new therapeutic strategies.

Protein binding, in the context of medical and biological sciences, refers to the interaction between a protein and another molecule (known as the ligand) that results in a stable complex. This process is often reversible and can be influenced by various factors such as pH, temperature, and concentration of the involved molecules.

In clinical chemistry, protein binding is particularly important when it comes to drugs, as many of them bind to proteins (especially albumin) in the bloodstream. The degree of protein binding can affect a drug's distribution, metabolism, and excretion, which in turn influence its therapeutic effectiveness and potential side effects.

Protein-bound drugs may be less available for interaction with their target tissues, as only the unbound or "free" fraction of the drug is active. Therefore, understanding protein binding can help optimize dosing regimens and minimize adverse reactions.

Western blotting is a laboratory technique used in molecular biology to detect and quantify specific proteins in a mixture of many different proteins. This technique is commonly used to confirm the expression of a protein of interest, determine its size, and investigate its post-translational modifications. The name "Western" blotting distinguishes this technique from Southern blotting (for DNA) and Northern blotting (for RNA).

The Western blotting procedure involves several steps:

1. Protein extraction: The sample containing the proteins of interest is first extracted, often by breaking open cells or tissues and using a buffer to extract the proteins.
2. Separation of proteins by electrophoresis: The extracted proteins are then separated based on their size by loading them onto a polyacrylamide gel and running an electric current through the gel (a process called sodium dodecyl sulfate-polyacrylamide gel electrophoresis or SDS-PAGE). This separates the proteins according to their molecular weight, with smaller proteins migrating faster than larger ones.
3. Transfer of proteins to a membrane: After separation, the proteins are transferred from the gel onto a nitrocellulose or polyvinylidene fluoride (PVDF) membrane using an electric current in a process called blotting. This creates a replica of the protein pattern on the gel but now immobilized on the membrane for further analysis.
4. Blocking: The membrane is then blocked with a blocking agent, such as non-fat dry milk or bovine serum albumin (BSA), to prevent non-specific binding of antibodies in subsequent steps.
5. Primary antibody incubation: A primary antibody that specifically recognizes the protein of interest is added and allowed to bind to its target protein on the membrane. This step may be performed at room temperature or 4°C overnight, depending on the antibody's properties.
6. Washing: The membrane is washed with a buffer to remove unbound primary antibodies.
7. Secondary antibody incubation: A secondary antibody that recognizes the primary antibody (often coupled to an enzyme or fluorophore) is added and allowed to bind to the primary antibody. This step may involve using a horseradish peroxidase (HRP)-conjugated or alkaline phosphatase (AP)-conjugated secondary antibody, depending on the detection method used later.
8. Washing: The membrane is washed again to remove unbound secondary antibodies.
9. Detection: A detection reagent is added to visualize the protein of interest by detecting the signal generated from the enzyme-conjugated or fluorophore-conjugated secondary antibody. This can be done using chemiluminescent, colorimetric, or fluorescent methods.
10. Analysis: The resulting image is analyzed to determine the presence and quantity of the protein of interest in the sample.

Western blotting is a powerful technique for identifying and quantifying specific proteins within complex mixtures. It can be used to study protein expression, post-translational modifications, protein-protein interactions, and more. However, it requires careful optimization and validation to ensure accurate and reproducible results.

Cell physiological processes refer to the functional activities and biochemical reactions that occur within a cell to maintain its survival, growth, and reproduction. These processes are essential for the overall functioning of an organism and can be categorized into several key areas:

1. Metabolism: This is the sum total of all chemical reactions that occur within a cell, including catabolic reactions (breaking down molecules to release energy) and anabolic reactions (building up molecules for growth and repair).
2. Homeostasis: Cells maintain a stable internal environment by regulating various factors such as pH, temperature, and ion balance through processes like osmoregulation, buffering systems, and active transport.
3. Signal Transduction: Cells communicate with each other and respond to external stimuli through signal transduction pathways that involve the binding of signaling molecules to receptors, activation of intracellular signaling cascades, and regulation of gene expression.
4. Cell Cycle and Division: Cells grow and divide through a series of coordinated events known as the cell cycle, which includes DNA replication, chromosome segregation, and cytokinesis.
5. Apoptosis: This is a programmed cell death process that eliminates damaged or unnecessary cells to maintain tissue homeostasis and prevent the development of cancer.
6. Motility and Chemotaxis: Some cells have the ability to move and migrate in response to chemical gradients, which is important for processes such as embryonic development, wound healing, and immune responses.
7. Autophagy: This is a process by which cells recycle their own damaged or dysfunctional organelles and proteins through lysosomal degradation.

Overall, cell physiological processes are highly regulated and interconnected, allowing cells to adapt to changing environmental conditions and maintain the health and function of an organism.

Pyruvate kinase is an enzyme that plays a crucial role in the final step of glycolysis, a process by which glucose is broken down to produce energy in the form of ATP (adenosine triphosphate). Specifically, pyruvate kinase catalyzes the transfer of a phosphate group from phosphoenolpyruvate (PEP) to adenosine diphosphate (ADP), resulting in the formation of pyruvate and ATP.

There are several isoforms of pyruvate kinase found in different tissues, including the liver, muscle, and brain. The type found in red blood cells is known as PK-RBC or PK-M2. Deficiencies in pyruvate kinase can lead to a genetic disorder called pyruvate kinase deficiency, which can result in hemolytic anemia due to the premature destruction of red blood cells.

Ribosomal Protein S6 Kinases (RSKs) are a family of serine/threonine protein kinases that play a crucial role in the regulation of cell growth, proliferation, and survival. They are so named because they phosphorylate and regulate the function of the ribosomal protein S6, which is a component of the 40S ribosomal subunit involved in protein synthesis.

RSKs are activated by various signals, including growth factors, hormones, and mitogens, through a cascade of phosphorylation events involving several upstream kinases such as MAPK/ERK kinase (MEK) and extracellular signal-regulated kinase (ERK). Once activated, RSKs phosphorylate a wide range of downstream targets, including transcription factors, regulators of translation, and cytoskeletal proteins, thereby modulating their activities and functions.

There are four isoforms of RSKs in humans, namely RSK1, RSK2, RSK3, and RSK4, which share a common structural organization and functional domains, including an N-terminal kinase domain, a C-terminal kinase domain, and a linker region that contains several regulatory motifs. Dysregulation of RSKs has been implicated in various pathological conditions, including cancer, cardiovascular diseases, neurological disorders, and diabetes, making them attractive targets for therapeutic intervention.

Molecular sequence data refers to the specific arrangement of molecules, most commonly nucleotides in DNA or RNA, or amino acids in proteins, that make up a biological macromolecule. This data is generated through laboratory techniques such as sequencing, and provides information about the exact order of the constituent molecules. This data is crucial in various fields of biology, including genetics, evolution, and molecular biology, allowing for comparisons between different organisms, identification of genetic variations, and studies of gene function and regulation.

Signal transduction is the process by which a cell converts an extracellular signal, such as a hormone or neurotransmitter, into an intracellular response. This involves a series of molecular events that transmit the signal from the cell surface to the interior of the cell, ultimately resulting in changes in gene expression, protein activity, or metabolism.

The process typically begins with the binding of the extracellular signal to a receptor located on the cell membrane. This binding event activates the receptor, which then triggers a cascade of intracellular signaling molecules, such as second messengers, protein kinases, and ion channels. These molecules amplify and propagate the signal, ultimately leading to the activation or inhibition of specific cellular responses.

Signal transduction pathways are highly regulated and can be modulated by various factors, including other signaling molecules, post-translational modifications, and feedback mechanisms. Dysregulation of these pathways has been implicated in a variety of diseases, including cancer, diabetes, and neurological disorders.

An amino acid sequence is the specific order of amino acids in a protein or peptide molecule, formed by the linking of the amino group (-NH2) of one amino acid to the carboxyl group (-COOH) of another amino acid through a peptide bond. The sequence is determined by the genetic code and is unique to each type of protein or peptide. It plays a crucial role in determining the three-dimensional structure and function of proteins.

MAPKKK1 or Mitogen-Activated Protein Kinase Kinase Kinase 1 is a serine/threonine protein kinase that belongs to the MAP3K family. It plays a crucial role in intracellular signal transduction pathways, particularly in the MAPK/ERK cascade, which is involved in various cellular processes such as proliferation, differentiation, and survival.

MAPKKK1 activates MAPKKs (Mitogen-Activated Protein Kinase Kinases) through phosphorylation of specific serine and threonine residues. In turn, activated MAPKKs phosphorylate and activate MAPKs (Mitogen-Activated Protein Kinases), which then regulate the activity of various transcription factors and other downstream targets to elicit appropriate cellular responses.

Mutations in MAPKKK1 have been implicated in several human diseases, including cancer and developmental disorders. Therefore, understanding its function and regulation is essential for developing novel therapeutic strategies to treat these conditions.

A centromere is a specialized region found on chromosomes that plays a crucial role in the separation of replicated chromosomes during cell division. It is the point where the sister chromatids (the two copies of a chromosome formed during DNA replication) are joined together. The centromere contains highly repeated DNA sequences and proteins that form a complex structure known as the kinetochore, which serves as an attachment site for microtubules of the mitotic spindle during cell division.

During mitosis or meiosis, the kinetochore facilitates the movement of chromosomes by interacting with the microtubules, allowing for the accurate distribution of genetic material to the daughter cells. Centromeres can vary in their position and structure among different species, ranging from being located near the middle of the chromosome (metacentric) to being positioned closer to one end (acrocentric). The precise location and characteristics of centromeres are essential for proper chromosome segregation and maintenance of genomic stability.

Receptor Protein-Tyrosine Kinases (RTKs) are a type of transmembrane receptors found on the cell surface that play a crucial role in signal transduction and regulation of various cellular processes, including cell growth, differentiation, metabolism, and survival. They are called "tyrosine kinases" because they possess an intrinsic enzymatic activity that catalyzes the transfer of a phosphate group from ATP to tyrosine residues on target proteins, thereby modulating their function.

RTKs are composed of three main domains: an extracellular domain that binds to specific ligands (growth factors, hormones, or cytokines), a transmembrane domain that spans the cell membrane, and an intracellular domain with tyrosine kinase activity. Upon ligand binding, RTKs undergo conformational changes that lead to their dimerization or oligomerization, which in turn activates their tyrosine kinase activity. Activated RTKs then phosphorylate specific tyrosine residues on downstream signaling proteins, initiating a cascade of intracellular signaling events that ultimately result in the appropriate cellular response.

Dysregulation of RTK signaling has been implicated in various human diseases, including cancer, diabetes, and developmental disorders. As such, RTKs are important targets for therapeutic intervention in these conditions.

Thymidine kinase (TK) is an enzyme that plays a crucial role in the synthesis of thymidine triphosphate (dTMP), a nucleotide required for DNA replication and repair. It catalyzes the phosphorylation of thymidine to thymidine monophosphate (dTMP) by transferring a phosphate group from adenosine triphosphate (ATP).

There are two major isoforms of thymidine kinase in humans: TK1 and TK2. TK1 is primarily found in the cytoplasm of proliferating cells, such as those involved in the cell cycle, while TK2 is located mainly in the mitochondria and is responsible for maintaining the dNTP pool required for mtDNA replication and repair.

Thymidine kinase activity has been used as a marker for cell proliferation, particularly in cancer cells, which often exhibit elevated levels of TK1 due to their high turnover rates. Additionally, measuring TK1 levels can help monitor the effectiveness of certain anticancer therapies that target DNA replication.

Extracellular signal-regulated mitogen-activated protein kinases (ERKs or Extracellular signal-regulated kinases) are a subfamily of the MAPK (mitogen-activated protein kinase) family, which are serine/threonine protein kinases that regulate various cellular processes such as proliferation, differentiation, migration, and survival in response to extracellular signals.

ERKs are activated by a cascade of phosphorylation events initiated by the binding of growth factors, hormones, or other extracellular molecules to their respective receptors. This activation results in the formation of a complex signaling pathway that involves the sequential activation of several protein kinases, including Ras, Raf, MEK (MAPK/ERK kinase), and ERK.

Once activated, ERKs translocate to the nucleus where they phosphorylate and activate various transcription factors, leading to changes in gene expression that ultimately result in the appropriate cellular response. Dysregulation of the ERK signaling pathway has been implicated in a variety of diseases, including cancer, diabetes, and neurological disorders.

MAP Kinase Kinase 4 (MAP2K4 or MKK4) is a serine/threonine protein kinase that plays a crucial role in intracellular signal transduction pathways, particularly the mitogen-activated protein kinase (MAPK) cascades. These cascades are involved in various cellular processes such as proliferation, differentiation, survival, and apoptosis in response to extracellular stimuli like cytokines, growth factors, and stress signals.

MAP2K4 specifically activates the c-Jun N-terminal kinase (JNK) pathway by phosphorylating and activating JNK proteins. The activation of JNK leads to the phosphorylation and regulation of various transcription factors, ultimately influencing gene expression and cellular responses. Dysregulation of MAP2K4 has been implicated in several diseases, including cancer and inflammatory disorders.

A Microtubule-Organizing Center (MTOC) is a cellular structure that organizes and nucleates microtubules, which are important components of the cytoskeleton. MTOCs are involved in various cellular processes such as cell division, intracellular transport, and maintenance of cell shape. The largest and most well-known MTOC is the centrosome, which is typically located near the nucleus of animal cells. However, there are other types of MTOCs, including the basal bodies of cilia and flagella, and the microtubule-organizing centers found in plant cells called plastids. Overall, MTOCs play a crucial role in maintaining the structural integrity and organization of the cell.

Ploidy is a term used in genetics to describe the number of sets of chromosomes in a cell or an organism. The ploidy level can have important implications for genetic inheritance and expression, as well as for evolutionary processes such as speciation and hybridization.

In most animals, including humans, the normal ploidy level is diploid, meaning that each cell contains two sets of chromosomes - one set inherited from each parent. However, there are also many examples of polyploidy, in which an organism has more than two sets of chromosomes.

Polyploidy can arise through various mechanisms, such as genome duplication or hybridization between different species. In some cases, polyploidy may confer evolutionary advantages, such as increased genetic diversity and adaptability to new environments. However, it can also lead to reproductive isolation and the formation of new species.

In plants, polyploidy is relatively common and has played a significant role in their evolution and diversification. Many crop plants are polyploids, including wheat, cotton, and tobacco. In some cases, artificial induction of polyploidy has been used to create new varieties with desirable traits for agriculture and horticulture.

Overall, ploidy is an important concept in genetics and evolution, with implications for a wide range of biological processes and phenomena.

Gene expression regulation, enzymologic refers to the biochemical processes and mechanisms that control the transcription and translation of specific genes into functional proteins or enzymes. This regulation is achieved through various enzymatic activities that can either activate or repress gene expression at different levels, such as chromatin remodeling, transcription factor activation, mRNA processing, and protein degradation.

Enzymologic regulation of gene expression involves the action of specific enzymes that catalyze chemical reactions involved in these processes. For example, histone-modifying enzymes can alter the structure of chromatin to make genes more or less accessible for transcription, while RNA polymerase and its associated factors are responsible for transcribing DNA into mRNA. Additionally, various enzymes are involved in post-transcriptional modifications of mRNA, such as splicing, capping, and tailing, which can affect the stability and translation of the transcript.

Overall, the enzymologic regulation of gene expression is a complex and dynamic process that allows cells to respond to changes in their environment and maintain proper physiological function.

Enzyme activation refers to the process by which an enzyme becomes biologically active and capable of carrying out its specific chemical or biological reaction. This is often achieved through various post-translational modifications, such as proteolytic cleavage, phosphorylation, or addition of cofactors or prosthetic groups to the enzyme molecule. These modifications can change the conformation or structure of the enzyme, exposing or creating a binding site for the substrate and allowing the enzymatic reaction to occur.

For example, in the case of proteolytic cleavage, an inactive precursor enzyme, known as a zymogen, is cleaved into its active form by a specific protease. This is seen in enzymes such as trypsin and chymotrypsin, which are initially produced in the pancreas as inactive precursors called trypsinogen and chymotrypsinogen, respectively. Once they reach the small intestine, they are activated by enteropeptidase, a protease that cleaves a specific peptide bond, releasing the active enzyme.

Phosphorylation is another common mechanism of enzyme activation, where a phosphate group is added to a specific serine, threonine, or tyrosine residue on the enzyme by a protein kinase. This modification can alter the conformation of the enzyme and create a binding site for the substrate, allowing the enzymatic reaction to occur.

Enzyme activation is a crucial process in many biological pathways, as it allows for precise control over when and where specific reactions take place. It also provides a mechanism for regulating enzyme activity in response to various signals and stimuli, such as hormones, neurotransmitters, or changes in the intracellular environment.

RNA interference (RNAi) is a biological process in which RNA molecules inhibit the expression of specific genes. This process is mediated by small RNA molecules, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), that bind to complementary sequences on messenger RNA (mRNA) molecules, leading to their degradation or translation inhibition.

RNAi plays a crucial role in regulating gene expression and defending against foreign genetic elements, such as viruses and transposons. It has also emerged as an important tool for studying gene function and developing therapeutic strategies for various diseases, including cancer and viral infections.

Nuclear proteins are a category of proteins that are primarily found in the nucleus of a eukaryotic cell. They play crucial roles in various nuclear functions, such as DNA replication, transcription, repair, and RNA processing. This group includes structural proteins like lamins, which form the nuclear lamina, and regulatory proteins, such as histones and transcription factors, that are involved in gene expression. Nuclear localization signals (NLS) often help target these proteins to the nucleus by interacting with importin proteins during active transport across the nuclear membrane.

1-Phosphatidylinositol 4-Kinase (PI4K) is a type of enzyme that belongs to the family of kinases, which are enzymes that transfer phosphate groups from high-energy donor molecules to specific target proteins or lipids in the cell. PI4K specifically phosphorylates the 4th position on the inositol ring of phosphatidylinositol (PI), a type of phospholipid found in the cell membrane, converting it to phosphatidylinositol 4-phosphate (PI4P).

PI4K has several isoforms, including PI4K alpha, beta, gamma, and delta, which are located in different cellular compartments and play distinct roles. For example, PI4K alpha and beta are primarily involved in vesicle trafficking and Golgi function, while PI4K gamma and delta are associated with the plasma membrane and regulate ion channels and other signaling pathways.

PI4P, the product of PI4K activity, is an important signaling molecule that regulates various cellular processes, including membrane trafficking, cytoskeleton organization, and protein sorting. Dysregulation of PI4K and its downstream pathways has been implicated in several human diseases, such as cancer, neurodegeneration, and viral infection.

Neoplasms are abnormal growths of cells or tissues in the body that serve no physiological function. They can be benign (non-cancerous) or malignant (cancerous). Benign neoplasms are typically slow growing and do not spread to other parts of the body, while malignant neoplasms are aggressive, invasive, and can metastasize to distant sites.

Neoplasms occur when there is a dysregulation in the normal process of cell division and differentiation, leading to uncontrolled growth and accumulation of cells. This can result from genetic mutations or other factors such as viral infections, environmental exposures, or hormonal imbalances.

Neoplasms can develop in any organ or tissue of the body and can cause various symptoms depending on their size, location, and type. Treatment options for neoplasms include surgery, radiation therapy, chemotherapy, immunotherapy, and targeted therapy, among others.

Glycogen Synthase Kinase 3 (GSK-3) is a serine/threonine protein kinase that plays a crucial role in the regulation of several cellular processes, including glycogen metabolism, cell signaling, gene transcription, and apoptosis. It was initially discovered as a key enzyme involved in glycogen metabolism due to its ability to phosphorylate and inhibit glycogen synthase, an enzyme responsible for the synthesis of glycogen from glucose.

GSK-3 exists in two isoforms, GSK-3α and GSK-3β, which share a high degree of sequence similarity and are widely expressed in various tissues. Both isoforms are constitutively active under normal conditions and are regulated through inhibitory phosphorylation by several upstream signaling pathways, such as insulin, Wnt, and Hedgehog signaling.

Dysregulation of GSK-3 has been implicated in the pathogenesis of various diseases, including diabetes, neurodegenerative disorders, and cancer. In recent years, GSK-3 has emerged as an attractive therapeutic target for the development of novel drugs to treat these conditions.

Mitogen-Activated Protein Kinases (MAPKs) are a family of serine/threonine protein kinases that play crucial roles in various cellular processes, including proliferation, differentiation, transformation, and apoptosis, in response to diverse stimuli such as mitogens, growth factors, hormones, cytokines, and environmental stresses. They are highly conserved across eukaryotes and consist of a three-tiered kinase module composed of MAPK kinase kinases (MAP3Ks), MAPK kinases (MKKs or MAP2Ks), and MAPKs.

Activation of MAPKs occurs through a sequential phosphorylation and activation cascade, where MAP3Ks phosphorylate and activate MKKs, which in turn phosphorylate and activate MAPKs at specific residues (Thr-X-Tyr or Ser-Pro motifs). Once activated, MAPKs can further phosphorylate and regulate various downstream targets, including transcription factors and other protein kinases.

There are four major groups of MAPKs in mammals: extracellular signal-regulated kinases (ERK1/2), c-Jun N-terminal kinases (JNK1/2/3), p38 MAPKs (p38α/β/γ/δ), and ERK5/BMK1. Each group of MAPKs has distinct upstream activators, downstream targets, and cellular functions, allowing for a high degree of specificity in signal transduction and cellular responses. Dysregulation of MAPK signaling pathways has been implicated in various human diseases, including cancer, diabetes, neurodegenerative disorders, and inflammatory diseases.

CDC2 and CDC28 are members of the Serine/Threonine protein kinase family, which play crucial roles in the regulation of the cell cycle. These kinases were originally identified in yeast (CDC28) and humans (CDC2), but they are highly conserved across eukaryotes.

CDC2-CDC28 Kinases function as a part of larger complexes, often associated with cyclins, to control different phases of the cell cycle by phosphorylating specific substrates at key regulatory points. The activity of CDC2-CDC28 Kinases is tightly regulated through various mechanisms, including phosphorylation, dephosphorylation, and protein binding interactions.

During the G2 phase of the cell cycle, CDC2-CDC28 Kinases are inactivated by phosphorylation at specific residues (Tyr15 and Thr14). As the cell approaches mitosis, a family of phosphatases called Cdc25 removes these inhibitory phosphates, leading to activation of the kinase. Activated CDC2-CDC28 Kinases then initiate mitotic processes such as chromosome condensation and nuclear envelope breakdown.

In summary, CDC2-CDC28 Kinases are essential regulators of the eukaryotic cell cycle, controlling various aspects of cell division through phosphorylation of specific substrates. Their activity is tightly regulated to ensure proper progression through the cell cycle and prevent uncontrolled cell growth, which can lead to diseases such as cancer.

Proto-oncogene proteins are normal cellular proteins that play crucial roles in various cellular processes, such as signal transduction, cell cycle regulation, and apoptosis (programmed cell death). They are involved in the regulation of cell growth, differentiation, and survival under physiological conditions.

When proto-oncogene proteins undergo mutations or aberrations in their expression levels, they can transform into oncogenic forms, leading to uncontrolled cell growth and division. These altered proteins are then referred to as oncogene products or oncoproteins. Oncogenic mutations can occur due to various factors, including genetic predisposition, environmental exposures, and aging.

Examples of proto-oncogene proteins include:

1. Ras proteins: Involved in signal transduction pathways that regulate cell growth and differentiation. Activating mutations in Ras genes are found in various human cancers.
2. Myc proteins: Regulate gene expression related to cell cycle progression, apoptosis, and metabolism. Overexpression of Myc proteins is associated with several types of cancer.
3. EGFR (Epidermal Growth Factor Receptor): A transmembrane receptor tyrosine kinase that regulates cell proliferation, survival, and differentiation. Mutations or overexpression of EGFR are linked to various malignancies, such as lung cancer and glioblastoma.
4. Src family kinases: Intracellular tyrosine kinases that regulate signal transduction pathways involved in cell proliferation, survival, and migration. Dysregulation of Src family kinases is implicated in several types of cancer.
5. Abl kinases: Cytoplasmic tyrosine kinases that regulate various cellular processes, including cell growth, differentiation, and stress responses. Aberrant activation of Abl kinases, as seen in chronic myelogenous leukemia (CML), leads to uncontrolled cell proliferation.

Understanding the roles of proto-oncogene proteins and their dysregulation in cancer development is essential for developing targeted cancer therapies that aim to inhibit or modulate these aberrant signaling pathways.

Meiosis is a type of cell division that results in the formation of four daughter cells, each with half the number of chromosomes as the parent cell. It is a key process in sexual reproduction, where it generates gametes or sex cells (sperm and eggs).

The process of meiosis involves one round of DNA replication followed by two successive nuclear divisions, meiosis I and meiosis II. In meiosis I, homologous chromosomes pair, form chiasma and exchange genetic material through crossing over, then separate from each other. In meiosis II, sister chromatids separate, leading to the formation of four haploid cells. This process ensures genetic diversity in offspring by shuffling and recombining genetic information during the formation of gametes.

A xenograft model antitumor assay is a type of preclinical cancer research study that involves transplanting human tumor cells or tissues into an immunodeficient mouse. This model allows researchers to study the effects of various treatments, such as drugs or immune therapies, on human tumors in a living organism.

In this assay, human tumor cells or tissues are implanted into the mouse, typically under the skin or in another organ, where they grow and form a tumor. Once the tumor has established, the mouse is treated with the experimental therapy, and the tumor's growth is monitored over time. The response of the tumor to the treatment is then assessed by measuring changes in tumor size or weight, as well as other parameters such as survival rate and metastasis.

Xenograft model antitumor assays are useful for evaluating the efficacy and safety of new cancer therapies before they are tested in human clinical trials. They provide valuable information on how the tumors respond to treatment, drug pharmacokinetics, and toxicity, which can help researchers optimize dosing regimens and identify potential side effects. However, it is important to note that xenograft models have limitations, such as differences in tumor biology between mice and humans, and may not always predict how well a therapy will work in human patients.

Isoenzymes, also known as isoforms, are multiple forms of an enzyme that catalyze the same chemical reaction but differ in their amino acid sequence, structure, and/or kinetic properties. They are encoded by different genes or alternative splicing of the same gene. Isoenzymes can be found in various tissues and organs, and they play a crucial role in biological processes such as metabolism, detoxification, and cell signaling. Measurement of isoenzyme levels in body fluids (such as blood) can provide valuable diagnostic information for certain medical conditions, including tissue damage, inflammation, and various diseases.

I-kappa B kinase (IKK) is a protein complex that plays a crucial role in the activation of NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells), a transcription factor involved in the regulation of immune response, inflammation, cell survival, and proliferation.

The IKK complex is composed of two catalytic subunits, IKKα and IKKβ, and a regulatory subunit, IKKγ (also known as NEMO). Upon stimulation by various signals such as cytokines, pathogens, or stress, the IKK complex becomes activated and phosphorylates I-kappa B (IkB), an inhibitor protein that keeps NF-kB in an inactive state in the cytoplasm.

Once IkB is phosphorylated by the IKK complex, it undergoes ubiquitination and degradation, leading to the release and nuclear translocation of NF-kB, where it can bind to specific DNA sequences and regulate gene expression. Dysregulation of IKK activity has been implicated in various pathological conditions, including chronic inflammation, autoimmune diseases, and cancer.

Rho-associated kinases (ROCKs) are serine/threonine kinases that are involved in the regulation of various cellular processes, including actin cytoskeleton organization, cell migration, and gene expression. They are named after their association with the small GTPase RhoA, which activates them upon binding.

ROCKs exist as two isoforms, ROCK1 and ROCK2, which share a high degree of sequence homology and have similar functions. They contain several functional domains, including a kinase domain, a coiled-coil region that mediates protein-protein interactions, and a Rho-binding domain (RBD) that binds to active RhoA.

Once activated by RhoA, ROCKs phosphorylate a variety of downstream targets, including myosin light chain (MLC), LIM kinase (LIMK), and moesin, leading to the regulation of actomyosin contractility, stress fiber formation, and focal adhesion turnover. Dysregulation of ROCK signaling has been implicated in various pathological conditions, such as cancer, cardiovascular diseases, neurological disorders, and fibrosis. Therefore, ROCKs have emerged as promising therapeutic targets for the treatment of these diseases.

Drug synergism is a pharmacological concept that refers to the interaction between two or more drugs, where the combined effect of the drugs is greater than the sum of their individual effects. This means that when these drugs are administered together, they produce an enhanced therapeutic response compared to when they are given separately.

Drug synergism can occur through various mechanisms, such as:

1. Pharmacodynamic synergism - When two or more drugs interact with the same target site in the body and enhance each other's effects.
2. Pharmacokinetic synergism - When one drug affects the metabolism, absorption, distribution, or excretion of another drug, leading to an increased concentration of the second drug in the body and enhanced therapeutic effect.
3. Physiochemical synergism - When two drugs interact physically, such as when one drug enhances the solubility or permeability of another drug, leading to improved absorption and bioavailability.

It is important to note that while drug synergism can result in enhanced therapeutic effects, it can also increase the risk of adverse reactions and toxicity. Therefore, healthcare providers must carefully consider the potential benefits and risks when prescribing combinations of drugs with known or potential synergistic effects.

Aneuploidy is a medical term that refers to an abnormal number of chromosomes in a cell. Chromosomes are thread-like structures located inside the nucleus of cells that contain genetic information in the form of genes.

In humans, the normal number of chromosomes in a cell is 46, arranged in 23 pairs. Aneuploidy occurs when there is an extra or missing chromosome in one or more of these pairs. For example, Down syndrome is a condition that results from an extra copy of chromosome 21, also known as trisomy 21.

Aneuploidy can arise during the formation of gametes (sperm or egg cells) due to errors in the process of cell division called meiosis. These errors can result in eggs or sperm with an abnormal number of chromosomes, which can then lead to aneuploidy in the resulting embryo.

Aneuploidy is a significant cause of birth defects and miscarriages. The severity of the condition depends on which chromosomes are affected and the extent of the abnormality. In some cases, aneuploidy may have no noticeable effects, while in others it can lead to serious health problems or developmental delays.

Chromosomes are thread-like structures that exist in the nucleus of cells, carrying genetic information in the form of genes. They are composed of DNA and proteins, and are typically present in pairs in the nucleus, with one set inherited from each parent. In humans, there are 23 pairs of chromosomes for a total of 46 chromosomes. Chromosomes come in different shapes and forms, including sex chromosomes (X and Y) that determine the biological sex of an individual. Changes or abnormalities in the number or structure of chromosomes can lead to genetic disorders and diseases.

Protein Kinase C-delta (PKC-δ) is a specific isoform of the Protein Kinase C (PKC) family, which are serine/threonine protein kinases that play crucial roles in various cellular signaling pathways. PKC-δ is involved in several cellular processes such as proliferation, differentiation, apoptosis, and motility. It is activated by second messengers like diacylglycerol (DAG) and calcium ions (Ca2+), and its activation leads to the phosphorylation of specific target proteins, thereby modulating their functions. Aberrant regulation of PKC-δ has been implicated in various diseases, including cancer and neurodegenerative disorders.

A cell line is a culture of cells that are grown in a laboratory for use in research. These cells are usually taken from a single cell or group of cells, and they are able to divide and grow continuously in the lab. Cell lines can come from many different sources, including animals, plants, and humans. They are often used in scientific research to study cellular processes, disease mechanisms, and to test new drugs or treatments. Some common types of human cell lines include HeLa cells (which come from a cancer patient named Henrietta Lacks), HEK293 cells (which come from embryonic kidney cells), and HUVEC cells (which come from umbilical vein endothelial cells). It is important to note that cell lines are not the same as primary cells, which are cells that are taken directly from a living organism and have not been grown in the lab.

Cell division is the process by which a single eukaryotic cell (a cell with a true nucleus) divides into two identical daughter cells. This complex process involves several stages, including replication of DNA, separation of chromosomes, and division of the cytoplasm. There are two main types of cell division: mitosis and meiosis.

Mitosis is the type of cell division that results in two genetically identical daughter cells. It is a fundamental process for growth, development, and tissue repair in multicellular organisms. The stages of mitosis include prophase, prometaphase, metaphase, anaphase, and telophase, followed by cytokinesis, which divides the cytoplasm.

Meiosis, on the other hand, is a type of cell division that occurs in the gonads (ovaries and testes) during the production of gametes (sex cells). Meiosis results in four genetically unique daughter cells, each with half the number of chromosomes as the parent cell. This process is essential for sexual reproduction and genetic diversity. The stages of meiosis include meiosis I and meiosis II, which are further divided into prophase, prometaphase, metaphase, anaphase, and telophase.

In summary, cell division is the process by which a single cell divides into two daughter cells, either through mitosis or meiosis. This process is critical for growth, development, tissue repair, and sexual reproduction in multicellular organisms.

Protein Kinase C-alpha (PKC-α) is a specific isoform of the Protein Kinase C (PKC) family, which are serine/threonine protein kinases that play crucial roles in various cellular processes such as proliferation, differentiation, and apoptosis. PKC-α is activated by diacylglycerol (DAG) and calcium ions (Ca2+). It is involved in signal transduction pathways related to cell growth, differentiation, and oncogenic transformation. Mutations or dysregulation of PKC-alpha have been implicated in several diseases including cancer, diabetes, and neurological disorders.

Transfection is a term used in molecular biology that refers to the process of deliberately introducing foreign genetic material (DNA, RNA or artificial gene constructs) into cells. This is typically done using chemical or physical methods, such as lipofection or electroporation. Transfection is widely used in research and medical settings for various purposes, including studying gene function, producing proteins, developing gene therapies, and creating genetically modified organisms. It's important to note that transfection is different from transduction, which is the process of introducing genetic material into cells using viruses as vectors.

Intracellular signaling peptides and proteins are molecules that play a crucial role in transmitting signals within cells, which ultimately lead to changes in cell behavior or function. These signals can originate from outside the cell (extracellular) or within the cell itself. Intracellular signaling molecules include various types of peptides and proteins, such as:

1. G-protein coupled receptors (GPCRs): These are seven-transmembrane domain receptors that bind to extracellular signaling molecules like hormones, neurotransmitters, or chemokines. Upon activation, they initiate a cascade of intracellular signals through G proteins and secondary messengers.
2. Receptor tyrosine kinases (RTKs): These are transmembrane receptors that bind to growth factors, cytokines, or hormones. Activation of RTKs leads to autophosphorylation of specific tyrosine residues, creating binding sites for intracellular signaling proteins such as adapter proteins, phosphatases, and enzymes like Ras, PI3K, and Src family kinases.
3. Second messenger systems: Intracellular second messengers are small molecules that amplify and propagate signals within the cell. Examples include cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), diacylglycerol (DAG), inositol triphosphate (IP3), calcium ions (Ca2+), and nitric oxide (NO). These second messengers activate or inhibit various downstream effectors, leading to changes in cellular responses.
4. Signal transduction cascades: Intracellular signaling proteins often form complex networks of interacting molecules that relay signals from the plasma membrane to the nucleus. These cascades involve kinases (protein kinases A, B, C, etc.), phosphatases, and adapter proteins, which ultimately regulate gene expression, cell cycle progression, metabolism, and other cellular processes.
5. Ubiquitination and proteasome degradation: Intracellular signaling pathways can also control protein stability by modulating ubiquitin-proteasome degradation. E3 ubiquitin ligases recognize specific substrates and conjugate them with ubiquitin molecules, targeting them for proteasomal degradation. This process regulates the abundance of key signaling proteins and contributes to signal termination or amplification.

In summary, intracellular signaling pathways involve a complex network of interacting proteins that relay signals from the plasma membrane to various cellular compartments, ultimately regulating gene expression, metabolism, and other cellular processes. Dysregulation of these pathways can contribute to disease development and progression, making them attractive targets for therapeutic intervention.

Drug resistance in neoplasms (also known as cancer drug resistance) refers to the ability of cancer cells to withstand the effects of chemotherapeutic agents or medications designed to kill or inhibit the growth of cancer cells. This can occur due to various mechanisms, including changes in the cancer cell's genetic makeup, alterations in drug targets, increased activity of drug efflux pumps, and activation of survival pathways.

Drug resistance can be intrinsic (present at the beginning of treatment) or acquired (developed during the course of treatment). It is a significant challenge in cancer therapy as it often leads to reduced treatment effectiveness, disease progression, and poor patient outcomes. Strategies to overcome drug resistance include the use of combination therapies, development of new drugs that target different mechanisms, and personalized medicine approaches that consider individual patient and tumor characteristics.

Biological models, also known as physiological models or organismal models, are simplified representations of biological systems, processes, or mechanisms that are used to understand and explain the underlying principles and relationships. These models can be theoretical (conceptual or mathematical) or physical (such as anatomical models, cell cultures, or animal models). They are widely used in biomedical research to study various phenomena, including disease pathophysiology, drug action, and therapeutic interventions.

Examples of biological models include:

1. Mathematical models: These use mathematical equations and formulas to describe complex biological systems or processes, such as population dynamics, metabolic pathways, or gene regulation networks. They can help predict the behavior of these systems under different conditions and test hypotheses about their underlying mechanisms.
2. Cell cultures: These are collections of cells grown in a controlled environment, typically in a laboratory dish or flask. They can be used to study cellular processes, such as signal transduction, gene expression, or metabolism, and to test the effects of drugs or other treatments on these processes.
3. Animal models: These are living organisms, usually vertebrates like mice, rats, or non-human primates, that are used to study various aspects of human biology and disease. They can provide valuable insights into the pathophysiology of diseases, the mechanisms of drug action, and the safety and efficacy of new therapies.
4. Anatomical models: These are physical representations of biological structures or systems, such as plastic models of organs or tissues, that can be used for educational purposes or to plan surgical procedures. They can also serve as a basis for developing more sophisticated models, such as computer simulations or 3D-printed replicas.

Overall, biological models play a crucial role in advancing our understanding of biology and medicine, helping to identify new targets for therapeutic intervention, develop novel drugs and treatments, and improve human health.

Neoplastic gene expression regulation refers to the processes that control the production of proteins and other molecules from genes in neoplastic cells, or cells that are part of a tumor or cancer. In a normal cell, gene expression is tightly regulated to ensure that the right genes are turned on or off at the right time. However, in cancer cells, this regulation can be disrupted, leading to the overexpression or underexpression of certain genes.

Neoplastic gene expression regulation can be affected by a variety of factors, including genetic mutations, epigenetic changes, and signals from the tumor microenvironment. These changes can lead to the activation of oncogenes (genes that promote cancer growth and development) or the inactivation of tumor suppressor genes (genes that prevent cancer).

Understanding neoplastic gene expression regulation is important for developing new therapies for cancer, as targeting specific genes or pathways involved in this process can help to inhibit cancer growth and progression.

Molecular targeted therapy is a type of treatment that targets specific molecules involved in the growth, progression, and spread of cancer. These molecules can be proteins, genes, or other molecules that contribute to the development of cancer. By targeting these specific molecules, molecular targeted therapy aims to block the abnormal signals that promote cancer growth and progression, thereby inhibiting or slowing down the growth of cancer cells while minimizing harm to normal cells.

Examples of molecular targeted therapies include monoclonal antibodies, tyrosine kinase inhibitors, angiogenesis inhibitors, and immunotherapies that target specific immune checkpoints. These therapies can be used alone or in combination with other cancer treatments such as chemotherapy, radiation therapy, or surgery. The goal of molecular targeted therapy is to improve the effectiveness of cancer treatment while reducing side effects and improving quality of life for patients.

The G2 phase, also known as the "gap 2 phase," is a stage in the cell cycle that occurs after DNA replication (S phase) and before cell division (mitosis). During this phase, the cell prepares for mitosis by completing the synthesis of proteins and organelles needed for chromosome separation. The cell also checks for any errors or damage to the DNA before entering mitosis. This phase is a critical point in the cell cycle where proper regulation ensures the faithful transmission of genetic information from one generation of cells to the next. If significant DNA damage is detected during G2, the cell may undergo programmed cell death (apoptosis) instead of dividing.

Cyclin B1 is a type of cyclin protein that regulates the cell cycle, specifically the transition from G2 phase to mitosis (M phase) in eukaryotic cells. It forms a complex with and acts as a regulatory subunit of cyclin-dependent kinase 1 (CDK1), also known as CDC2. During the G2 phase, Cyclin B1 levels accumulate and upon reaching a certain threshold, it binds to CDK1 to form the maturation promoting factor (MPF). The activation of MPF triggers the onset of mitosis by promoting nuclear envelope breakdown, chromosome condensation, and other events required for cell division. After the completion of mitosis, Cyclin B1 is degraded by the ubiquitin-proteasome system, allowing the cell cycle to progress back into G1 phase.

Cell survival refers to the ability of a cell to continue living and functioning normally, despite being exposed to potentially harmful conditions or treatments. This can include exposure to toxins, radiation, chemotherapeutic drugs, or other stressors that can damage cells or interfere with their normal processes.

In scientific research, measures of cell survival are often used to evaluate the effectiveness of various therapies or treatments. For example, researchers may expose cells to a particular drug or treatment and then measure the percentage of cells that survive to assess its potential therapeutic value. Similarly, in toxicology studies, measures of cell survival can help to determine the safety of various chemicals or substances.

It's important to note that cell survival is not the same as cell proliferation, which refers to the ability of cells to divide and multiply. While some treatments may promote cell survival, they may also inhibit cell proliferation, making them useful for treating diseases such as cancer. Conversely, other treatments may be designed to specifically target and kill cancer cells, even if it means sacrificing some healthy cells in the process.

Diacylglycerol kinase (DGK) is an enzyme that plays a role in regulating cell signaling pathways. It catalyzes the conversion of diacylglycerol (DAG), a lipid second messenger, to phosphatidic acid (PA). This reaction helps to terminate DAG-mediated signals and initiate PA-mediated signals, which are involved in various cellular processes such as proliferation, differentiation, and survival. There are several isoforms of DGK that differ in their regulation, subcellular localization, and substrate specificity. Inhibition or genetic deletion of DGK has been shown to affect a variety of physiological and pathological processes, including inflammation, immunity, cancer, and neurological disorders.

Drug screening assays for antitumor agents are laboratory tests used to identify and evaluate the effectiveness of potential drugs or compounds that can inhibit the growth of tumor cells or induce their death. These assays are typically performed in vitro (in a test tube or petri dish) using cell cultures of various types of cancer cells.

The assays measure different parameters such as cell viability, proliferation, apoptosis (programmed cell death), and cytotoxicity to determine the ability of the drug to kill or inhibit the growth of tumor cells. The results of these assays can help researchers identify promising antitumor agents that can be further developed for clinical use in cancer treatment.

There are different types of drug screening assays for antitumor agents, including high-throughput screening (HTS) assays, which allow for the rapid and automated testing of a large number of compounds against various cancer cell lines. Other types of assays include phenotypic screening assays, target-based screening assays, and functional screening assays, each with its own advantages and limitations.

Overall, drug screening assays for antitumor agents play a critical role in the development of new cancer therapies by providing valuable information on the activity and safety of potential drugs, helping to identify effective treatments and reduce the time and cost associated with bringing new drugs to market.

In the context of medical and biological sciences, a "binding site" refers to a specific location on a protein, molecule, or cell where another molecule can attach or bind. This binding interaction can lead to various functional changes in the original protein or molecule. The other molecule that binds to the binding site is often referred to as a ligand, which can be a small molecule, ion, or even another protein.

The binding between a ligand and its target binding site can be specific and selective, meaning that only certain ligands can bind to particular binding sites with high affinity. This specificity plays a crucial role in various biological processes, such as signal transduction, enzyme catalysis, or drug action.

In the case of drug development, understanding the location and properties of binding sites on target proteins is essential for designing drugs that can selectively bind to these sites and modulate protein function. This knowledge can help create more effective and safer therapeutic options for various diseases.

AMP-activated protein kinases (AMPK) are a group of heterotrimeric enzymes that play a crucial role in cellular energy homeostasis. They are composed of a catalytic subunit (α) and two regulatory subunits (β and γ). AMPK is activated under conditions of low energy charge, such as ATP depletion, hypoxia, or exercise, through an increase in the AMP:ATP ratio.

Once activated, AMPK phosphorylates and regulates various downstream targets involved in metabolic pathways, including glycolysis, fatty acid oxidation, and protein synthesis. This results in the inhibition of energy-consuming processes and the promotion of energy-producing processes, ultimately helping to restore cellular energy balance.

AMPK has been implicated in a variety of physiological processes, including glucose and lipid metabolism, autophagy, mitochondrial biogenesis, and inflammation. Dysregulation of AMPK activity has been linked to several diseases, such as diabetes, obesity, cancer, and neurodegenerative disorders. Therefore, AMPK is an attractive target for therapeutic interventions in these conditions.

A dose-response relationship in the context of drugs refers to the changes in the effects or symptoms that occur as the dose of a drug is increased or decreased. Generally, as the dose of a drug is increased, the severity or intensity of its effects also increases. Conversely, as the dose is decreased, the effects of the drug become less severe or may disappear altogether.

The dose-response relationship is an important concept in pharmacology and toxicology because it helps to establish the safe and effective dosage range for a drug. By understanding how changes in the dose of a drug affect its therapeutic and adverse effects, healthcare providers can optimize treatment plans for their patients while minimizing the risk of harm.

The dose-response relationship is typically depicted as a curve that shows the relationship between the dose of a drug and its effect. The shape of the curve may vary depending on the drug and the specific effect being measured. Some drugs may have a steep dose-response curve, meaning that small changes in the dose can result in large differences in the effect. Other drugs may have a more gradual dose-response curve, where larger changes in the dose are needed to produce significant effects.

In addition to helping establish safe and effective dosages, the dose-response relationship is also used to evaluate the potential therapeutic benefits and risks of new drugs during clinical trials. By systematically testing different doses of a drug in controlled studies, researchers can identify the optimal dosage range for the drug and assess its safety and efficacy.

"Nude mice" is a term used in the field of laboratory research to describe a strain of mice that have been genetically engineered to lack a functional immune system. Specifically, nude mice lack a thymus gland and have a mutation in the FOXN1 gene, which results in a failure to develop a mature T-cell population. This means that they are unable to mount an effective immune response against foreign substances or organisms.

The name "nude" refers to the fact that these mice also have a lack of functional hair follicles, resulting in a hairless or partially hairless phenotype. This feature is actually a secondary consequence of the same genetic mutation that causes their immune deficiency.

Nude mice are commonly used in research because their weakened immune system makes them an ideal host for transplanted tumors, tissues, and cells from other species, including humans. This allows researchers to study the behavior of these foreign substances in a living organism without the complication of an immune response. However, it's important to note that because nude mice lack a functional immune system, they must be kept in sterile conditions and are more susceptible to infection than normal mice.

Chordata is a phylum in the animal kingdom that contains animals with notochords, dorsal hollow nerve cords, pharyngeal gill slits, and post-anal tails at some point during their development. This phylum includes organisms that are bilaterally symmetrical, have a coelom (a body cavity), and are triploblastic (having three germ layers: ectoderm, mesoderm, and endoderm).

The Chordata phylum is divided into three subphyla: Urochordata (tunicates or sea squirts), Cephalochordata (lancelets or amphioxi), and Vertebrata (animals with backbones, including fish, amphibians, reptiles, birds, and mammals). The presence of the notochord, a flexible, rod-like structure that runs along the length of the body, is a key characteristic that unites these diverse groups.

In vertebrates, the notochord is replaced during development by the spinal column or backbone, which provides support and protection for the central nervous system. The dorsal hollow nerve cord develops into the brain and spinal cord in vertebrates, while pharyngeal gill slits are modified into various structures such as the tonsils, thymus, and middle ear bones in different vertebrate groups.

Overall, Chordata represents a diverse group of organisms with shared developmental features that have evolved to adapt to various ecological niches throughout history.

In the context of medicine and pharmacology, "kinetics" refers to the study of how a drug moves throughout the body, including its absorption, distribution, metabolism, and excretion (often abbreviated as ADME). This field is called "pharmacokinetics."

1. Absorption: This is the process of a drug moving from its site of administration into the bloodstream. Factors such as the route of administration (e.g., oral, intravenous, etc.), formulation, and individual physiological differences can affect absorption.

2. Distribution: Once a drug is in the bloodstream, it gets distributed throughout the body to various tissues and organs. This process is influenced by factors like blood flow, protein binding, and lipid solubility of the drug.

3. Metabolism: Drugs are often chemically modified in the body, typically in the liver, through processes known as metabolism. These changes can lead to the formation of active or inactive metabolites, which may then be further distributed, excreted, or undergo additional metabolic transformations.

4. Excretion: This is the process by which drugs and their metabolites are eliminated from the body, primarily through the kidneys (urine) and the liver (bile).

Understanding the kinetics of a drug is crucial for determining its optimal dosing regimen, potential interactions with other medications or foods, and any necessary adjustments for special populations like pediatric or geriatric patients, or those with impaired renal or hepatic function.

'Tumor cells, cultured' refers to the process of removing cancerous cells from a tumor and growing them in controlled laboratory conditions. This is typically done by isolating the tumor cells from a patient's tissue sample, then placing them in a nutrient-rich environment that promotes their growth and multiplication.

The resulting cultured tumor cells can be used for various research purposes, including the study of cancer biology, drug development, and toxicity testing. They provide a valuable tool for researchers to better understand the behavior and characteristics of cancer cells outside of the human body, which can lead to the development of more effective cancer treatments.

It is important to note that cultured tumor cells may not always behave exactly the same way as they do in the human body, so findings from cell culture studies must be validated through further research, such as animal models or clinical trials.

Messenger RNA (mRNA) is a type of RNA (ribonucleic acid) that carries genetic information copied from DNA in the form of a series of three-base code "words," each of which specifies a particular amino acid. This information is used by the cell's machinery to construct proteins, a process known as translation. After being transcribed from DNA, mRNA travels out of the nucleus to the ribosomes in the cytoplasm where protein synthesis occurs. Once the protein has been synthesized, the mRNA may be degraded and recycled. Post-transcriptional modifications can also occur to mRNA, such as alternative splicing and addition of a 5' cap and a poly(A) tail, which can affect its stability, localization, and translation efficiency.

Phosphoproteins are proteins that have been post-translationally modified by the addition of a phosphate group (-PO3H2) onto specific amino acid residues, most commonly serine, threonine, or tyrosine. This process is known as phosphorylation and is mediated by enzymes called kinases. Phosphoproteins play crucial roles in various cellular processes such as signal transduction, cell cycle regulation, metabolism, and gene expression. The addition or removal of a phosphate group can activate or inhibit the function of a protein, thereby serving as a switch to control its activity. Phosphoproteins can be detected and quantified using techniques such as Western blotting, mass spectrometry, and immunofluorescence.

Imidazoles are a class of heterocyclic organic compounds that contain a double-bonded nitrogen atom and two additional nitrogen atoms in the ring. They have the chemical formula C3H4N2. In a medical context, imidazoles are commonly used as antifungal agents. Some examples of imidazole-derived antifungals include clotrimazole, miconazole, and ketoconazole. These medications work by inhibiting the synthesis of ergosterol, a key component of fungal cell membranes, leading to increased permeability and death of the fungal cells. Imidazoles may also have anti-inflammatory, antibacterial, and anticancer properties.

Substrate specificity in the context of medical biochemistry and enzymology refers to the ability of an enzyme to selectively bind and catalyze a chemical reaction with a particular substrate (or a group of similar substrates) while discriminating against other molecules that are not substrates. This specificity arises from the three-dimensional structure of the enzyme, which has evolved to match the shape, charge distribution, and functional groups of its physiological substrate(s).

Substrate specificity is a fundamental property of enzymes that enables them to carry out highly selective chemical transformations in the complex cellular environment. The active site of an enzyme, where the catalysis takes place, has a unique conformation that complements the shape and charge distribution of its substrate(s). This ensures efficient recognition, binding, and conversion of the substrate into the desired product while minimizing unwanted side reactions with other molecules.

Substrate specificity can be categorized as:

1. Absolute specificity: An enzyme that can only act on a single substrate or a very narrow group of structurally related substrates, showing no activity towards any other molecule.
2. Group specificity: An enzyme that prefers to act on a particular functional group or class of compounds but can still accommodate minor structural variations within the substrate.
3. Broad or promiscuous specificity: An enzyme that can act on a wide range of structurally diverse substrates, albeit with varying catalytic efficiencies.

Understanding substrate specificity is crucial for elucidating enzymatic mechanisms, designing drugs that target specific enzymes or pathways, and developing biotechnological applications that rely on the controlled manipulation of enzyme activities.

Protein-kinase B, also known as AKT, is a group of intracellular proteins that play a crucial role in various cellular processes such as glucose metabolism, apoptosis, cell proliferation, transcription, and cell migration. The AKT family includes three isoforms: AKT1, AKT2, and AKT3, which are encoded by the genes PKBalpha, PKBbeta, and PKBgamma, respectively.

Proto-oncogene proteins c-AKT refer to the normal, non-mutated forms of these proteins that are involved in the regulation of cell growth and survival under physiological conditions. However, when these genes are mutated or overexpressed, they can become oncogenes, leading to uncontrolled cell growth and cancer development.

Activation of c-AKT occurs through a signaling cascade that begins with the binding of extracellular ligands such as insulin-like growth factor 1 (IGF-1) or epidermal growth factor (EGF) to their respective receptors on the cell surface. This triggers a series of phosphorylation events that ultimately lead to the activation of c-AKT, which then phosphorylates downstream targets involved in various cellular processes.

In summary, proto-oncogene proteins c-AKT are normal intracellular proteins that play essential roles in regulating cell growth and survival under physiological conditions. However, their dysregulation can contribute to cancer development and progression.

Saccharomycetales is an order of fungi that are commonly known as "true yeasts." They are characterized by their single-celled growth and ability to reproduce through budding or fission. These organisms are widely distributed in nature and can be found in a variety of environments, including soil, water, and on the surfaces of plants and animals.

Many species of Saccharomycetales are used in industrial processes, such as the production of bread, beer, and wine. They are also used in biotechnology to produce various enzymes, vaccines, and other products. Some species of Saccharomycetales can cause diseases in humans and animals, particularly in individuals with weakened immune systems. These infections, known as candidiasis or thrush, can affect various parts of the body, including the skin, mouth, and genital area.

Serine is an amino acid, which is a building block of proteins. More specifically, it is a non-essential amino acid, meaning that the body can produce it from other compounds, and it does not need to be obtained through diet. Serine plays important roles in the body, such as contributing to the formation of the protective covering of nerve fibers (myelin sheath), helping to synthesize another amino acid called tryptophan, and taking part in the metabolism of fatty acids. It is also involved in the production of muscle tissues, the immune system, and the forming of cell structures. Serine can be found in various foods such as soy, eggs, cheese, meat, peanuts, lentils, and many others.

Focal Adhesion Kinase 1 (FAK1), also known as Protein Tyrosine Kinase 2 (PTK2), is a cytoplasmic tyrosine kinase that plays a crucial role in cellular processes such as cell adhesion, migration, and survival. It is recruited to focal adhesions, which are specialized structures that form at the sites of integrin-mediated attachment of the cell to the extracellular matrix (ECM).

FAK1 becomes activated through autophosphorylation upon integrin clustering and ECM binding. Once activated, FAK1 can phosphorylate various downstream substrates, leading to the activation of several signaling pathways that regulate cell behavior. These pathways include the Ras/MAPK, PI3K/AKT, and JNK signaling cascades, which are involved in cell proliferation, survival, and motility.

FAK1 has been implicated in various physiological and pathological processes, including embryonic development, wound healing, angiogenesis, and tumorigenesis. Dysregulation of FAK1 signaling has been associated with several diseases, such as cancer, fibrosis, and neurological disorders. Therefore, FAK1 is considered a potential therapeutic target for the treatment of these conditions.

Down-regulation is a process that occurs in response to various stimuli, where the number or sensitivity of cell surface receptors or the expression of specific genes is decreased. This process helps maintain homeostasis within cells and tissues by reducing the ability of cells to respond to certain signals or molecules.

In the context of cell surface receptors, down-regulation can occur through several mechanisms:

1. Receptor internalization: After binding to their ligands, receptors can be internalized into the cell through endocytosis. Once inside the cell, these receptors may be degraded or recycled back to the cell surface in smaller numbers.
2. Reduced receptor synthesis: Down-regulation can also occur at the transcriptional level, where the expression of genes encoding for specific receptors is decreased, leading to fewer receptors being produced.
3. Receptor desensitization: Prolonged exposure to a ligand can lead to a decrease in receptor sensitivity or affinity, making it more difficult for the cell to respond to the signal.

In the context of gene expression, down-regulation refers to the decreased transcription and/or stability of specific mRNAs, leading to reduced protein levels. This process can be induced by various factors, including microRNA (miRNA)-mediated regulation, histone modification, or DNA methylation.

Down-regulation is an essential mechanism in many physiological processes and can also contribute to the development of several diseases, such as cancer and neurodegenerative disorders.

I'm sorry for any confusion, but "Pyridines" is not a medical term. It is a chemical term that refers to a class of organic compounds with the chemical structure of a six-membered ring containing one nitrogen atom and five carbon atoms (heterocyclic aromatic compound).

In a biological or medical context, pyridine derivatives can be found in various natural and synthetic substances. For example, some medications contain pyridine rings as part of their chemical structure. However, "Pyridines" itself is not a medical term or condition.

Neoplastic cell transformation is a process in which a normal cell undergoes genetic alterations that cause it to become cancerous or malignant. This process involves changes in the cell's DNA that result in uncontrolled cell growth and division, loss of contact inhibition, and the ability to invade surrounding tissues and metastasize (spread) to other parts of the body.

Neoplastic transformation can occur as a result of various factors, including genetic mutations, exposure to carcinogens, viral infections, chronic inflammation, and aging. These changes can lead to the activation of oncogenes or the inactivation of tumor suppressor genes, which regulate cell growth and division.

The transformation of normal cells into cancerous cells is a complex and multi-step process that involves multiple genetic and epigenetic alterations. It is characterized by several hallmarks, including sustained proliferative signaling, evasion of growth suppressors, resistance to cell death, enabling replicative immortality, induction of angiogenesis, activation of invasion and metastasis, reprogramming of energy metabolism, and evading immune destruction.

Neoplastic cell transformation is a fundamental concept in cancer biology and is critical for understanding the molecular mechanisms underlying cancer development and progression. It also has important implications for cancer diagnosis, prognosis, and treatment, as identifying the specific genetic alterations that underlie neoplastic transformation can help guide targeted therapies and personalized medicine approaches.

Tertiary protein structure refers to the three-dimensional arrangement of all the elements (polypeptide chains) of a single protein molecule. It is the highest level of structural organization and results from interactions between various side chains (R groups) of the amino acids that make up the protein. These interactions, which include hydrogen bonds, ionic bonds, van der Waals forces, and disulfide bridges, give the protein its unique shape and stability, which in turn determines its function. The tertiary structure of a protein can be stabilized by various factors such as temperature, pH, and the presence of certain ions. Any changes in these factors can lead to denaturation, where the protein loses its tertiary structure and thus its function.

Myosin-Light-Chain Kinase (MLCK) is an enzyme that plays a crucial role in muscle contraction. It phosphorylates the regulatory light chains of myosin, a protein involved in muscle contraction, leading to the activation of myosin and the initiation of the contractile process. MLCK is activated by calcium ions and calmodulin, and its activity is essential for various cellular processes, including cytokinesis, cell motility, and maintenance of cell shape. In addition to its role in muscle contraction, MLCK has been implicated in several pathological conditions, such as hypertension, atherosclerosis, and cancer.

Thiazoles are organic compounds that contain a heterocyclic ring consisting of a nitrogen atom and a sulfur atom, along with two carbon atoms and two hydrogen atoms. They have the chemical formula C3H4NS. Thiazoles are present in various natural and synthetic substances, including some vitamins, drugs, and dyes. In the context of medicine, thiazole derivatives have been developed as pharmaceuticals for their diverse biological activities, such as anti-inflammatory, antifungal, antibacterial, and antihypertensive properties. Some well-known examples include thiazide diuretics (e.g., hydrochlorothiazide) used to treat high blood pressure and edema, and the antidiabetic drug pioglitazone.

Janus Kinase 2 (JAK2) is a tyrosine kinase enzyme that plays a crucial role in intracellular signal transduction. It is named after the Roman god Janus, who is depicted with two faces, as JAK2 has two similar phosphate-transferring domains. JAK2 is involved in various cytokine receptor-mediated signaling pathways and contributes to hematopoiesis, immune function, and cell growth.

Mutations in the JAK2 gene have been associated with several myeloproliferative neoplasms (MPNs), including polycythemia vera, essential thrombocythemia, and primary myelofibrosis. The most common mutation is JAK2 V617F, which results in a constitutively active enzyme that promotes uncontrolled cell proliferation and survival, contributing to the development of these MPNs.

An oocyte, also known as an egg cell or female gamete, is a large specialized cell found in the ovary of female organisms. It contains half the number of chromosomes as a normal diploid cell, as it is the product of meiotic division. Oocytes are surrounded by follicle cells and are responsible for the production of female offspring upon fertilization with sperm. The term "oocyte" specifically refers to the immature egg cell before it reaches full maturity and is ready for fertilization, at which point it is referred to as an ovum or egg.

Recombinant fusion proteins are artificially created biomolecules that combine the functional domains or properties of two or more different proteins into a single protein entity. They are generated through recombinant DNA technology, where the genes encoding the desired protein domains are linked together and expressed as a single, chimeric gene in a host organism, such as bacteria, yeast, or mammalian cells.

The resulting fusion protein retains the functional properties of its individual constituent proteins, allowing for novel applications in research, diagnostics, and therapeutics. For instance, recombinant fusion proteins can be designed to enhance protein stability, solubility, or immunogenicity, making them valuable tools for studying protein-protein interactions, developing targeted therapies, or generating vaccines against infectious diseases or cancer.

Examples of recombinant fusion proteins include:

1. Etaglunatide (ABT-523): A soluble Fc fusion protein that combines the heavy chain fragment crystallizable region (Fc) of an immunoglobulin with the extracellular domain of the human interleukin-6 receptor (IL-6R). This fusion protein functions as a decoy receptor, neutralizing IL-6 and its downstream signaling pathways in rheumatoid arthritis.
2. Etanercept (Enbrel): A soluble TNF receptor p75 Fc fusion protein that binds to tumor necrosis factor-alpha (TNF-α) and inhibits its proinflammatory activity, making it a valuable therapeutic option for treating autoimmune diseases like rheumatoid arthritis, ankylosing spondylitis, and psoriasis.
3. Abatacept (Orencia): A fusion protein consisting of the extracellular domain of cytotoxic T-lymphocyte antigen 4 (CTLA-4) linked to the Fc region of an immunoglobulin, which downregulates T-cell activation and proliferation in autoimmune diseases like rheumatoid arthritis.
4. Belimumab (Benlysta): A monoclonal antibody that targets B-lymphocyte stimulator (BLyS) protein, preventing its interaction with the B-cell surface receptor and inhibiting B-cell activation in systemic lupus erythematosus (SLE).
5. Romiplostim (Nplate): A fusion protein consisting of a thrombopoietin receptor agonist peptide linked to an immunoglobulin Fc region, which stimulates platelet production in patients with chronic immune thrombocytopenia (ITP).
6. Darbepoetin alfa (Aranesp): A hyperglycosylated erythropoiesis-stimulating protein that functions as a longer-acting form of recombinant human erythropoietin, used to treat anemia in patients with chronic kidney disease or cancer.
7. Palivizumab (Synagis): A monoclonal antibody directed against the F protein of respiratory syncytial virus (RSV), which prevents RSV infection and is administered prophylactically to high-risk infants during the RSV season.
8. Ranibizumab (Lucentis): A recombinant humanized monoclonal antibody fragment that binds and inhibits vascular endothelial growth factor A (VEGF-A), used in the treatment of age-related macular degeneration, diabetic retinopathy, and other ocular disorders.
9. Cetuximab (Erbitux): A chimeric monoclonal antibody that binds to epidermal growth factor receptor (EGFR), used in the treatment of colorectal cancer and head and neck squamous cell carcinoma.
10. Adalimumab (Humira): A fully humanized monoclonal antibody that targets tumor necrosis factor-alpha (TNF-α), used in the treatment of various inflammatory diseases, including rheumatoid arthritis, psoriasis, and Crohn's disease.
11. Bevacizumab (Avastin): A recombinant humanized monoclonal antibody that binds to VEGF-A, used in the treatment of various cancers, including colorectal, lung, breast, and kidney cancer.
12. Trastuzumab (Herceptin): A humanized monoclonal antibody that targets HER2/neu receptor, used in the treatment of breast cancer.
13. Rituximab (Rituxan): A chimeric monoclonal antibody that binds to CD20 antigen on B cells, used in the treatment of non-Hodgkin's lymphoma and rheumatoid arthritis.
14. Palivizumab (Synagis): A humanized monoclonal antibody that binds to the F protein of respiratory syncytial virus, used in the prevention of respiratory syncytial virus infection in high-risk infants.
15. Infliximab (Remicade): A chimeric monoclonal antibody that targets TNF-α, used in the treatment of various inflammatory diseases, including Crohn's disease, ulcerative colitis, rheumatoid arthritis, and ankylosing spondylitis.
16. Natalizumab (Tysabri): A humanized monoclonal antibody that binds to α4β1 integrin, used in the treatment of multiple sclerosis and Crohn's disease.
17. Adalimumab (Humira): A fully human monoclonal antibody that targets TNF-α, used in the treatment of various inflammatory diseases, including rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, Crohn's disease, and ulcerative colitis.
18. Golimumab (Simponi): A fully human monoclonal antibody that targets TNF-α, used in the treatment of rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, and ulcerative colitis.
19. Certolizumab pegol (Cimzia): A PEGylated Fab' fragment of a humanized monoclonal antibody that targets TNF-α, used in the treatment of rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, and Crohn's disease.
20. Ustekinumab (Stelara): A fully human monoclonal antibody that targets IL-12 and IL-23, used in the treatment of psoriasis, psoriatic arthritis, and Crohn's disease.
21. Secukinumab (Cosentyx): A fully human monoclonal antibody that targets IL-17A, used in the treatment of psoriasis, psoriatic arthritis, and ankylosing spondylitis.
22. Ixekizumab (Taltz): A fully human monoclonal antibody that targets IL-17A, used in the treatment of psoriasis and psoriatic arthritis.
23. Brodalumab (Siliq): A fully human monoclonal antibody that targets IL-17 receptor A, used in the treatment of psoriasis.
24. Sarilumab (Kevzara): A fully human monoclonal antibody that targets the IL-6 receptor, used in the treatment of rheumatoid arthritis.
25. Tocilizumab (Actemra): A humanized monoclonal antibody that targets the IL-6 receptor, used in the treatment of rheumatoid arthritis, systemic juvenile idiopathic arthritis, polyarticular juvenile idiopathic arthritis, giant cell arteritis, and chimeric antigen receptor T-cell-induced cytokine release syndrome.
26. Siltuximab (Sylvant): A chimeric monoclonal antibody that targets IL-6, used in the treatment of multicentric Castleman disease.
27. Satralizumab (Enspryng): A humanized monoclonal antibody that targets IL-6 receptor alpha, used in the treatment of neuromyelitis optica spectrum disorder.
28. Sirukumab (Plivensia): A human monoclonal antibody that targets IL-6, used in the treatment

Focal adhesion protein-tyrosine kinases (FAKs) are a group of non-receptor tyrosine kinases that play crucial roles in the regulation of various cellular processes, including cell adhesion, migration, proliferation, and survival. They are primarily localized at focal adhesions, which are specialized structures formed at the sites of integrin-mediated attachment of cells to the extracellular matrix (ECM).

FAKs consist of two major domains: an N-terminal FERM (4.1 protein, ezrin, radixin, moesin) domain and a C-terminal kinase domain. The FERM domain is responsible for the interaction with various proteins, including integrins, growth factor receptors, and cytoskeletal components, while the kinase domain possesses enzymatic activity that phosphorylates tyrosine residues on target proteins.

FAKs are activated in response to various extracellular signals, such as ECM stiffness, growth factors, and integrin engagement. Once activated, FAKs initiate a cascade of intracellular signaling events that ultimately regulate cell behavior. Dysregulation of FAK signaling has been implicated in several pathological conditions, including cancer, fibrosis, and cardiovascular diseases.

In summary, focal adhesion protein-tyrosine kinases are essential regulators of cellular processes that localize to focal adhesions and modulate intracellular signaling pathways in response to extracellular cues.

Fluorescence microscopy is a type of microscopy that uses fluorescent dyes or proteins to highlight and visualize specific components within a sample. In this technique, the sample is illuminated with high-energy light, typically ultraviolet (UV) or blue light, which excites the fluorescent molecules causing them to emit lower-energy, longer-wavelength light, usually visible light in the form of various colors. This emitted light is then collected by the microscope and detected to produce an image.

Fluorescence microscopy has several advantages over traditional brightfield microscopy, including the ability to visualize specific structures or molecules within a complex sample, increased sensitivity, and the potential for quantitative analysis. It is widely used in various fields of biology and medicine, such as cell biology, neuroscience, and pathology, to study the structure, function, and interactions of cells and proteins.

There are several types of fluorescence microscopy techniques, including widefield fluorescence microscopy, confocal microscopy, two-photon microscopy, and total internal reflection fluorescence (TIRF) microscopy, each with its own strengths and limitations. These techniques can provide valuable insights into the behavior of cells and proteins in health and disease.

Ribosomal Protein S6 Kinases, 90-kDa (RSKs) are a group of serine/threonine protein kinases that play a crucial role in signal transduction pathways linked to cell growth, proliferation, and survival. They are so named because they were initially discovered as protein kinases that phosphorylate the 40S ribosomal protein S6, a component of the ribosome involved in translation regulation.

RSKs consist of four isoforms (RSK1-4) encoded by separate genes but sharing similar structures and functions. They have an N-terminal kinase domain, a C-terminal kinase domain, and a linker region containing several regulatory phosphorylation sites. RSKs are activated through the Ras/MAPK (Mitogen-Activated Protein Kinase) signaling cascade, where Ras activates Raf, which in turn activates MEK, ultimately leading to the activation of ERK. Activated ERK then phosphorylates and activates RSKs by promoting a conformational change that allows for autophosphorylation and full kinase activity.

Once activated, RSKs can phosphorylate various substrates involved in transcriptional regulation, cytoskeletal reorganization, protein synthesis, and cell cycle progression. Dysregulation of RSK signaling has been implicated in several diseases, including cancer, where they contribute to tumor growth, metastasis, and drug resistance. Therefore, RSKs are considered potential therapeutic targets for cancer treatment.

Tyrosine is an non-essential amino acid, which means that it can be synthesized by the human body from another amino acid called phenylalanine. Its name is derived from the Greek word "tyros," which means cheese, as it was first isolated from casein, a protein found in cheese.

Tyrosine plays a crucial role in the production of several important substances in the body, including neurotransmitters such as dopamine, norepinephrine, and epinephrine, which are involved in various physiological processes, including mood regulation, stress response, and cognitive functions. It also serves as a precursor to melanin, the pigment responsible for skin, hair, and eye color.

In addition, tyrosine is involved in the structure of proteins and is essential for normal growth and development. Some individuals may require tyrosine supplementation if they have a genetic disorder that affects tyrosine metabolism or if they are phenylketonurics (PKU), who cannot metabolize phenylalanine, which can lead to elevated tyrosine levels in the blood. However, it is important to consult with a healthcare professional before starting any supplementation regimen.

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) is a laboratory technique used in molecular biology to amplify and detect specific DNA sequences. This technique is particularly useful for the detection and quantification of RNA viruses, as well as for the analysis of gene expression.

The process involves two main steps: reverse transcription and polymerase chain reaction (PCR). In the first step, reverse transcriptase enzyme is used to convert RNA into complementary DNA (cDNA) by reading the template provided by the RNA molecule. This cDNA then serves as a template for the PCR amplification step.

In the second step, the PCR reaction uses two primers that flank the target DNA sequence and a thermostable polymerase enzyme to repeatedly copy the targeted cDNA sequence. The reaction mixture is heated and cooled in cycles, allowing the primers to anneal to the template, and the polymerase to extend the new strand. This results in exponential amplification of the target DNA sequence, making it possible to detect even small amounts of RNA or cDNA.

RT-PCR is a sensitive and specific technique that has many applications in medical research and diagnostics, including the detection of viruses such as HIV, hepatitis C virus, and SARS-CoV-2 (the virus that causes COVID-19). It can also be used to study gene expression, identify genetic mutations, and diagnose genetic disorders.

Protein Kinase C-epsilon (PKCε) is a serine-threonine protein kinase that belongs to the family of Protein Kinase C (PKC) enzymes. These enzymes play crucial roles in various cellular processes, including signal transduction, cell survival, differentiation, and apoptosis.

PKCε is specifically involved in regulating several signaling pathways related to inflammation, proliferation, and carcinogenesis. It can be activated by different stimuli such as diacylglycerol (DAG) and phorbol esters, which lead to its translocation from the cytosol to the plasma membrane, where it phosphorylates and modulates the activity of various target proteins.

Abnormal regulation or expression of PKCε has been implicated in several diseases, including cancer, cardiovascular diseases, and neurodegenerative disorders. Therefore, PKCε is considered a potential therapeutic target for these conditions, and inhibitors of this enzyme are being developed and tested in preclinical and clinical studies.

In genetics, sequence alignment is the process of arranging two or more DNA, RNA, or protein sequences to identify regions of similarity or homology between them. This is often done using computational methods to compare the nucleotide or amino acid sequences and identify matching patterns, which can provide insight into evolutionary relationships, functional domains, or potential genetic disorders. The alignment process typically involves adjusting gaps and mismatches in the sequences to maximize the similarity between them, resulting in an aligned sequence that can be visually represented and analyzed.

Recombinant proteins are artificially created proteins produced through the use of recombinant DNA technology. This process involves combining DNA molecules from different sources to create a new set of genes that encode for a specific protein. The resulting recombinant protein can then be expressed, purified, and used for various applications in research, medicine, and industry.

Recombinant proteins are widely used in biomedical research to study protein function, structure, and interactions. They are also used in the development of diagnostic tests, vaccines, and therapeutic drugs. For example, recombinant insulin is a common treatment for diabetes, while recombinant human growth hormone is used to treat growth disorders.

The production of recombinant proteins typically involves the use of host cells, such as bacteria, yeast, or mammalian cells, which are engineered to express the desired protein. The host cells are transformed with a plasmid vector containing the gene of interest, along with regulatory elements that control its expression. Once the host cells are cultured and the protein is expressed, it can be purified using various chromatography techniques.

Overall, recombinant proteins have revolutionized many areas of biology and medicine, enabling researchers to study and manipulate proteins in ways that were previously impossible.

Chromosomal instability is a term used in genetics to describe a type of genetic alteration where there are abnormalities in the number or structure of chromosomes within cells. Chromosomes are thread-like structures that contain our genetic material, and they usually exist in pairs in the nucleus of a cell.

Chromosomal instability can arise due to various factors, including errors in DNA replication or repair, problems during cell division, or exposure to environmental mutagens. This instability can lead to an increased frequency of chromosomal abnormalities, such as deletions, duplications, translocations, or changes in the number of chromosomes.

Chromosomal instability is associated with several human diseases, including cancer. In cancer cells, chromosomal instability can contribute to tumor heterogeneity, drug resistance, and disease progression. It is also observed in certain genetic disorders, such as Down syndrome, where an extra copy of chromosome 21 is present, and in some rare inherited syndromes, such as Bloom syndrome and Fanconi anemia, which are characterized by a high risk of cancer and other health problems.

A base sequence in the context of molecular biology refers to the specific order of nucleotides in a DNA or RNA molecule. In DNA, these nucleotides are adenine (A), guanine (G), cytosine (C), and thymine (T). In RNA, uracil (U) takes the place of thymine. The base sequence contains genetic information that is transcribed into RNA and ultimately translated into proteins. It is the exact order of these bases that determines the genetic code and thus the function of the DNA or RNA molecule.

MAP Kinase Kinase Kinase 1 (MAP3K1) is a serine/threonine protein kinase that belongs to the MAPKKK family. It plays a crucial role in intracellular signaling pathways, particularly the mitogen-activated protein kinase (MAPK) cascades. These cascades are involved in various cellular processes such as proliferation, differentiation, and apoptosis.

MAP3K1 activates MAPKKs (MAP Kinase Kinases) by phosphorylating them on specific serine and threonine residues. In turn, activated MAPKKs phosphorylate and activate MAPKs, which then regulate the activity of various transcription factors and other downstream targets.

Mutations in MAP3K1 have been implicated in several human diseases, including cancer and developmental disorders. For example, gain-of-function mutations in MAP3K1 can lead to aberrant activation of MAPK signaling pathways, promoting tumor growth and progression. On the other hand, loss-of-function mutations in MAP3K1 have been associated with developmental defects such as craniofacial anomalies and skeletal malformations.

Calcium-calmodulin-dependent protein kinase type 2 (CAMK2) is a type of serine/threonine protein kinase that plays a crucial role in signal transduction pathways related to synaptic plasticity, learning, and memory. It is composed of four subunits, each with a catalytic domain and a regulatory domain that contains an autoinhibitory region and a calmodulin-binding site.

The activation of CAMK2 requires the binding of calcium ions (Ca^2+^) to calmodulin, which then binds to the regulatory domain of CAMK2, relieving the autoinhibition and allowing the kinase to phosphorylate its substrates. Once activated, CAMK2 can also undergo a process called autophosphorylation, which results in a persistent activation state that can last for hours or even days.

CAMK2 has many downstream targets, including ion channels, transcription factors, and other protein kinases. Dysregulation of CAMK2 signaling has been implicated in various neurological disorders, such as Alzheimer's disease, Parkinson's disease, and epilepsy.

Saccharomyces cerevisiae proteins are the proteins that are produced by the budding yeast, Saccharomyces cerevisiae. This organism is a single-celled eukaryote that has been widely used as a model organism in scientific research for many years due to its relatively simple genetic makeup and its similarity to higher eukaryotic cells.

The genome of Saccharomyces cerevisiae has been fully sequenced, and it is estimated to contain approximately 6,000 genes that encode proteins. These proteins play a wide variety of roles in the cell, including catalyzing metabolic reactions, regulating gene expression, maintaining the structure of the cell, and responding to environmental stimuli.

Many Saccharomyces cerevisiae proteins have human homologs and are involved in similar biological processes, making this organism a valuable tool for studying human disease. For example, many of the proteins involved in DNA replication, repair, and recombination in yeast have human counterparts that are associated with cancer and other diseases. By studying these proteins in yeast, researchers can gain insights into their function and regulation in humans, which may lead to new treatments for disease.

Tumor suppressor protein p53, also known as p53 or tumor protein p53, is a nuclear phosphoprotein that plays a crucial role in preventing cancer development and maintaining genomic stability. It does so by regulating the cell cycle and acting as a transcription factor for various genes involved in apoptosis (programmed cell death), DNA repair, and cell senescence (permanent cell growth arrest).

In response to cellular stress, such as DNA damage or oncogene activation, p53 becomes activated and accumulates in the nucleus. Activated p53 can then bind to specific DNA sequences and promote the transcription of target genes that help prevent the proliferation of potentially cancerous cells. These targets include genes involved in cell cycle arrest (e.g., CDKN1A/p21), apoptosis (e.g., BAX, PUMA), and DNA repair (e.g., GADD45).

Mutations in the TP53 gene, which encodes p53, are among the most common genetic alterations found in human cancers. These mutations often lead to a loss or reduction of p53's tumor suppressive functions, allowing cancer cells to proliferate uncontrollably and evade apoptosis. As a result, p53 has been referred to as "the guardian of the genome" due to its essential role in preventing tumorigenesis.

In the field of medicine, "time factors" refer to the duration of symptoms or time elapsed since the onset of a medical condition, which can have significant implications for diagnosis and treatment. Understanding time factors is crucial in determining the progression of a disease, evaluating the effectiveness of treatments, and making critical decisions regarding patient care.

For example, in stroke management, "time is brain," meaning that rapid intervention within a specific time frame (usually within 4.5 hours) is essential to administering tissue plasminogen activator (tPA), a clot-busting drug that can minimize brain damage and improve patient outcomes. Similarly, in trauma care, the "golden hour" concept emphasizes the importance of providing definitive care within the first 60 minutes after injury to increase survival rates and reduce morbidity.

Time factors also play a role in monitoring the progression of chronic conditions like diabetes or heart disease, where regular follow-ups and assessments help determine appropriate treatment adjustments and prevent complications. In infectious diseases, time factors are crucial for initiating antibiotic therapy and identifying potential outbreaks to control their spread.

Overall, "time factors" encompass the significance of recognizing and acting promptly in various medical scenarios to optimize patient outcomes and provide effective care.

A catalytic domain is a portion or region within a protein that contains the active site, where the chemical reactions necessary for the protein's function are carried out. This domain is responsible for the catalysis of biological reactions, hence the name "catalytic domain." The catalytic domain is often composed of specific amino acid residues that come together to form the active site, creating a unique three-dimensional structure that enables the protein to perform its specific function.

In enzymes, for example, the catalytic domain contains the residues that bind and convert substrates into products through chemical reactions. In receptors, the catalytic domain may be involved in signal transduction or other regulatory functions. Understanding the structure and function of catalytic domains is crucial to understanding the mechanisms of protein function and can provide valuable insights for drug design and therapeutic interventions.

Protein Kinase C beta (PKCβ) is a serine-threonine protein kinase that belongs to the family of Protein Kinase C (PKC) enzymes. It plays a crucial role in various cellular processes, including signal transduction, cell survival, differentiation, and apoptosis. PKCβ is activated by diacylglycerol (DAG) and calcium ions (Ca2+), which results in its translocation from the cytosol to the plasma membrane, where it phosphorylates downstream target proteins.

There are two isoforms of PKCβ, PKCβI and PKCβII, which differ in their regulatory domains but have similar catalytic domains. PKCβ has been implicated in several diseases, including cancer, diabetes, and inflammatory disorders, making it a potential therapeutic target for drug development.

... there are three classes of aurora kinases in multicellular organisms, including humans: Aurora A (a.k.a. Aurora 2) functions ... Aurora kinases are serine/threonine kinases that are essential for cell proliferation. They are phosphotransferase enzymes that ... Aurora inhibitor Bolanos-Garcia V M. Aurora kinases. The International Journal of Biochemistry & Cell Biology 37 (2005) 1572- ... Giet R, Prigent C. Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine-threonine kinases. Journal of Cell ...
Aurora kinase Aurora A kinase Aurora C kinase INCENP Spindle assembly checkpoint GRCh38: Ensembl release 89: ENSG00000178999 - ... Phosphorylation of CENP-A at serine 7 by Aurora A kinase recruits Aurora B to the centromere. Aurora B, itself, can also ... The Aurora kinases associate with microtubules during chromosome movement and segregation. Aurora kinase B localizes to ... Aurora B kinase has been shown to interact with: BARD1, BIRC5, and CDCA8 TACC1. FBXL2. Abnormally elevated levels of Aurora B ...
Although yeast contain only one Aurora kinase and C. elegans and Drosophila contain only two, mammals have three Aurora kinases ... "Aurora-C kinase is a novel chromosomal passenger protein that can complement Aurora-B kinase function in mitotic cells". Cell ... "Aurora-C kinase is a novel chromosomal passenger protein that can complement Aurora-B kinase function in mitotic cells". Cell ... Aurora kinase C, also Serine/threonine-protein kinase 13 is an enzyme that in humans is encoded by the AURKC gene. This gene ...
The human genome contains three members of the aurora kinase family: Aurora kinase A, Aurora kinase B and Aurora C kinase. The ... Aurora A and Aurora B kinases play important roles in mitosis. The Aurora kinase A is associated with centrosome maturation and ... Aurora A phosphorylation directs the cytoplasmic polyadenylation translation of mRNA's, like the MAP kinase kinase kinase ... contain orthologues only to Aurora A and Aurora B. In all studied species, the three Aurora mitotic kinases localize to the ...
... strong interest has shifted towards the aurora kinase proteins. The kinase gene Aurora A when amplified acts as an oncogene ... The localization of MAD2 and BubR1 to the kinetochore may also be dependent on the Aurora B kinase. Cells lacking Aurora B fail ... Aurora-B/Ipl1 kinase of the chromosomal passenger complex functions as the tensions sensor in improper kinetochore attachments ... The Aurora-B/Ipl1 kinase is also critical in correcting merotelic attachments, where one kinetochore is simultaneously attached ...
Aurora kinase inhibitors are a putative drug class for treating cancer. The Aurora kinase enzymes could be potential targets ... There are three mammalian aurora kinase genes, encoding aurora A, B and C. Intense investigation has focused on aurora A and B ... Aurora-B (Serine/threonine-protein kinase 12, AIK2, AIM1, ARK2, STK12) Aurora-C (Serine/threonine-protein kinase 13, AIE2, AIK3 ... Aurora kinases, so named because the scattered mitotic spindles generated by mutant forms resemble the Aurora Borealis, have ...
Aurora kinase has two forms which are designated Aurora kinase A and Aurora kinase B. These proteins play a key role in mitosis ... In some human cancers, the expression and kinase activity of Aurora kinases have been up-regulated and has been looked into as ... A possible causes of multipolar spindle formation involve regulation of protein kinase family known as Aurora kinase. ... Jingyan Fu, Fu (26 January 2007). "Roles of Aurora Kinases in Mitosis and Tumorigenesis". Molecular Cancer Research. 5 (1): 1- ...
"Cyclin Dependent Kinase (CDK) and Aurora Kinase (AK) inhibitors , Cyclacel R&D for anticancer drugs acting on cell cycle". www. ...
... works as an inhibitor, attaching to the active sites of Aurora A and Aurora B kinases. Hauf, Silke; Cole, Richard W ... Hesperadin is an aurora kinase inhibitor. The small molecule inhibits chromosome alignment and segregation by limiting the ... function of mitotic kinases Aurora B and Aurora A. Hesperadin causes cells to enter anaphase much faster, sometimes before the ... Hesperadin inhibits Aurora kinase-1 and blocks mitotic progression in bloodstream forms". Molecular Microbiology. 72 (2): 442- ...
Aurora kinases are required for proper spindle assembly and separation. Aurora A associates with centrosomes and is believed to ... Spindle assembly is largely regulated by phosphorylation events catalyzed by mitotic kinases. Cyclin dependent kinase complexes ... with many of these proteins serving as Aurora and Polo-like kinase substrates. In a properly formed mitotic spindle, bi- ... Polo-like kinase, also known as PLK, especially PLK1 has important roles in the spindle maintenance by regulating microtubule ...
MKLP1 TEX14 CEP55 Aurora Kinase B Paweletz N (January 2001). "Walther Flemming: pioneer of mitosis research". Nature Reviews. ...
Other kinases that have interested Sebti include Rho-associated kinase and Aurora kinase. STAT3. In 2003 the Sebti lab ... May 30, 2014). "Dual Aurora A and JAK2 kinase blockade effectively suppresses malignant transformation". Oncotarget. 5 (10): ... Kinases. Sebti's work on the kinase Akt led to his interest in Triciribine. ... October 1, 2012). "RKI-1447 is a potent inhibitor of the Rho-associated ROCK kinases with anti-invasive and antitumor ...
2011-11-01). "Arabidopsis α Aurora Kinases Function in Formative Cell Division Plane Orientation". The Plant Cell. 23 (11): ... Another midline-localized protein, "two-in-on" (TIO), is a putative kinase and is also required for cytokinesis as shown by ... October 1998). "A cell cycle regulated MAP kinase with a possible role in cytokinesis in tobacco cells". Journal of Cell ... 2011-10-25). "Phosphorylation of a mitotic kinesin-like protein and a MAPKKK by cyclin-dependent kinases (CDKs) is involved in ...
Bell, G.P.; Fletcher, G.C.; Brain, R.; Thompson, B.J (2015). "Aurora kinases phosphorylate Lgl to induce mitotic spindle ... columnar pseudostratified epithelial cells must round up at mitosis in a process that involves the Aurora A and B kinases, ... Aguilar-Aragon, M.; Elbediwy, A.; Foglizzo, V.; Fletcher, G.C.; Li, V.S.W; Thompson, B.J. (2018). "Pak1 Kinase Maintains Apical ... but Cdc42 appears to act primarily via activating the kinases aPKC and Pak1 in Drosophila follicle cells. His laboratory also ...
"Expression of Aurora-B kinase and phosphorylated histone H3 in hepatocellular carcinoma". Anticancer Research. 26 (5A): 3585-93 ...
This process is associated with Aurora B Protein Kinase. When Aurora B's function is disrupted, MCAK ability to locate ... Andrews PD, Ovechkina Y, Morrice N, Wagenbach M, Duncan K, Wordeman L, Swedlow JR (February 2004). "Aurora B regulates MCAK at ... There are other environments in which MCAK's function is impaired, absent impact on its associated kinase. For example, alpha- ...
2005). "The centrosomal protein Lats2 is a phosphorylation target of Aurora-A kinase". Genes Cells. 9 (5): 383-97. doi:10.1111/ ... 2005). "The Ste20-like kinase Mst2 activates the human large tumor suppressor kinase Lats1". Oncogene. 24 (12): 2076-86. doi: ... Large tumor suppressor kinase 2 (LATS2) is an enzyme that in humans is encoded by the LATS2 gene. This gene encodes a serine/ ... It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle ...
2006). "Analysis of Aurora-A and hMPS1 mitotic kinases in mantle cell lymphoma". Int. J. Cancer. 118 (2): 357-63. doi:10.1002/ ... "Entrez Gene: TTK TTK protein kinase". Hanks SK, Quinn AM (1991). "Protein kinase catalytic domain sequence database: ... Dual specificity protein kinase TTK also known as Mps1 is an enzyme that in humans is encoded by the TTK gene. GRCh38: Ensembl ... 2003). "Human MPS1 Kinase Is Required for Mitotic Arrest Induced by the Loss of CENP-E from Kinetochores". Mol. Biol. Cell. 14 ...
"126 Development of a new series of tricyclic pyrimido-indole inhibitors targeting Aurora kinases". European Journal of Cancer ...
... (MLN8237) is an orally available selective aurora A kinase inhibitor developed by Takeda. It was investigated as a ... a selective Aurora A kinase inhibitor, in relapsed and refractory aggressive B- and T-cell non-Hodgkin lymphomas". Journal of ... Protein kinase inhibitors, Benzoic acids, Fluoroarenes, Abandoned drugs, Takeda Pharmaceutical Company brands, Chloroarenes, ...
The problem with K562 cells, and many other cancer cell types, is an overabundance of Aurora kinases. These kinases play a role ... However, the overabundance of Aurora kinases allows for uncontrolled cellular division, resulting in cancer. Inhibiting these ... This gene targets the cyclin-dependent kinase inhibitor, p21, and causes cell differentiation, cell cycle arrest in G1, and ...
"NEDD9 depletion destabilizes Aurora A kinase and heightens the efficacy of Aurora A inhibitors: implications for treatment of ... Interaction of NEDD9 with Aurora A kinase may also play a role in tumor invasion. NEDD9 binds to and regulates acetylation of ... NEDD9 binds directly to the Aurora-A mitotic kinase at the centrosome, and promotes its activity, allowing cells to enter ... Other phosphorylation events in this region are imposed by the kinase Aurora-A, which phosphorylates residue S296, for ...
... phosphorylation and compartmentalization is regulated by Aurora A and Aurora B pathways. Other kinases have been reported ... Inhibition of Aurora B kinase by specific small molecule drugs resulted in the release of JADE1S-mediated cytokinetic delay and ... Six amino acid residues were identified to be phosphorylated in cell cycle-dependent manner via Aurora A kinase pathway. JADE1 ... Since Aurora B is a key regulator of the NoCut, JADE1S is likely to regulate cytokinesis at the abscission checkpoint control. ...
Aurora B kinase is produced in all dividing cells in normal tissue however; the levels of Aurora B kinase are abnormally raised ... The Aurora B kinase protein (also known as STK12) is one of a family of proteins that plays an essential role in the alignment ... BI 811283 may be active in a range of malignancies that are known to have raised levels of Aurora B kinase including; non-small ... BI 811283 is a small molecule inhibitor of the Aurora B kinase protein being developed by Boehringer Ingelheim for use as an ...
The CAS family member NEDD9 has also been shown to interact directly with AURKA (encoding Aurora-A kinase) to regulate cell ... it is possible that CASS4 may similarly interact with aurora-A kinase. CASS4 signaling may contribute to platelet activation ... "The focal adhesion scaffolding protein HEF1 regulates activation of the Aurora-A and Nek2 kinases at the centrosome". Nature ... These include association with FAK and Src family kinases at focal adhesions to transmit integrin-initiated signals to ...
"Drugging MYCN through an Allosteric Transition in Aurora Kinase A." Cancer Cell. 26 (3): 414-27. doi:10.1016/j.ccr.2014.07.015 ... N-Myc is also stabilized by aurora A which protects it from degradation. Drugs that target this interaction are under ... development, and are designed to change the conformation of aurora A. Conformational change in Aurora A leads to release of N- ... "Stabilization of N-Myc is a critical function of Aurora A in human neuroblastoma". Cancer Cell. 15 (1): 67-78. doi:10.1016/j. ...
Aurora B is a kinase active in late metaphase, and has been shown to function as a checkpoint for the proper attachments of ... Cimini, Daniela; Wan, Xiaohu; Hirel, Christophe B.; Salmon, E.D. (2006-09-05). "Aurora Kinase Promotes Turnover of Kinetochore ... When Aurora B was partially inhibited by a small molecule drug, Cimini et al. observed lagging chromatids at increasing ... "The Ska complex promotes Aurora B activity to ensure chromosome biorientation". The Journal of Cell Biology. 215 (1): 77-93. ...
... is also important in activating and recruiting Aurora A kinase, a kinase responsible for phosphorylating TPX2 and ... In the presence of nuclear import factor importin α, TPX2 is bound and prevented from binding Aurora A kinase, though it is ... TPX2 recruits and activates Aurora A kinase by utilizing its short 43 amino acid long amino-terminal sequence to bind the ... Notably, this recognition between TPX2 and Aurora A is analogous to that between the cAMP-dependent protein kinase (cAPK) ...
"Identification of the substrates and interaction proteins of aurora kinases from a protein-protein interaction model". ... "Phosphorylation of the mitotic regulator protein Hec1 by Nek2 kinase is essential for faithful chromosome segregation". The ... "Phosphorylation of the mitotic regulator protein Hec1 by Nek2 kinase is essential for faithful chromosome segregation". The ... and drug sensitivity are preferentially regulated by anti-HER2 antibody through phosphatidylinositol 3-kinase-AKT signaling". ...
BI811283 is a small molecule inhibitor of the aurora B kinase protein being developed by Boehringer Ingelheim for use as an ... a novel inhibitor of Aurora B kinase, on tumor senescence and apoptosis". J. Clin. Oncol. 28 (15 Suppl e13632): e13632. doi: ... studies with introducing thymidine kinase in gliomas, making them susceptible to aciclovir, are in their experimental stage. ...
... there are three classes of aurora kinases in multicellular organisms, including humans: Aurora A (a.k.a. Aurora 2) functions ... Aurora kinases are serine/threonine kinases that are essential for cell proliferation. They are phosphotransferase enzymes that ... Aurora inhibitor Bolanos-Garcia V M. Aurora kinases. The International Journal of Biochemistry & Cell Biology 37 (2005) 1572- ... Giet R, Prigent C. Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine-threonine kinases. Journal of Cell ...
Background: The Aurora kinases are a family of serine/threonine kinases comprised of Aurora A, B, and C which execute critical ... Antitumor activity of the aurora a selective kinase inhibitor, alisertib, against preclinical models of colorectal cancer ... Alisertib (MLN8237) is an investigational Aurora A selective inhibitor that has demonstrated activity against a wide variety of ... 1 Division of Medical Oncology, School of Medicine, University of Colorado, Anschutz Medical Campus, Aurora, CO, USA. ...
This strategy revealed that the anti-viral drug rilpivirine is an Aurora A kinase inhibitor. In view of previous findings ... Herein, we detail the identification of rilpivirine as an Aurora A kinase inhibitor, its molecular basis of inhibitory activity ... Protein kinases are highly sought-after anticancer drug targets since dysregulation of kinases is the hallmark of cancer. To ... implicating Aurora A kinase in abnormal cell cycle regulation, we also examined the influence of rilpivirine on the growth of ...
... but instead switches the kinase on by tuning the structure and dynamics of a dynamically sampled subpopulation. ... Phosphorylation of Aurora A does not trigger a population shift to the active state as previously thought, ... 2008) Bora and the kinase Aurora a cooperatively activate the kinase Plk1 and control mitotic entry Science 320:1655-1658. ... Kinase assays. Request a detailed protocol Kinase activity was measured using the ADP Quest coupled kinase assay (DiscoverX) in ...
Aurora kinases are a family of serine-threonine kinases that regulate multiple phases of the mitotic signaling cascade.11 ... Aurora kinases are essential regulators of chromosomal alignment and separation during mitosis. Each of the enzymes, aurora A, ... The Aurora kinase family in cell division and cancer. Biochim Biophys Acta. 2008; 1786(1):60-72. PubMedGoogle Scholar ... Marumoto T, Honda S, Hara T. Aurora-A kinase maintains the fidelity of early and late mitotic events in HeLa cells. J Biol Chem ...
Home » Reed-sternberg cells form by abscission failure in the presence of functional aurora B kinase ... Reed-sternberg cells form by abscission failure in the presence of functional aurora B kinase ... Reed-sternberg cells form by abscission failure in the presence of functional aurora B kinase. ...
These kinases play important role in centrosome maturation, chromosome separ ... Aurora kinases represent one of the emerging targets in oncology drug discovery. ... Aurora kinases represent one of the emerging targets in oncology drug discovery. These kinases play important role in ... Small Molecule Aurora Kinases Inhibitors [ Vol. 16 , Issue. 16 ] Author(s):. Laura Garuti, Marinella Roberti and Giovanni ...
Tuberculosis from the spine is one of the most common spine pathology in India. It is a challenge to treat MDR-TB Spine with late onset paraplegia and progressive deformity. Physicians must treat tuberculosis of spine on the basis of Culture and sensitivity. is considered to be pathogenic. is a slow-growing aerobic organism with a growth-doubling… Continue reading Tuberculosis from the spine is one of the most common spine. ...
... causes increased DC proliferation.24 The serine/threonine kinase proteins kinase B (PKB, also called AKT) regulates multiple ... with purified CK2 cannot present an involvement of the kinase in E1B-55K phosphorylation efficiently. Hence, we attempt to ... Furthermore, in phosphorylation assays, wild-type E1B-55K glutathione kinase research performed by Teodoro et al. ... a serine/threonine kinase) complicated 1 by binding towards the immunophilin FK506 binding proteins-12 (FKBP-12).1 Thereby, ...
2024 - The Role of Aurora Kinase Inhibitors in hematologic disorders , All rights reserved ...
... were also identified with the hinge region of Aurora kinase A. Thus, LEU139, GLU211, and ALA213 were identified as the crucial ... Aurora kinase A (AURKA) is a normal cell proliferation-inducing enzyme encoded by AURKA gene, with over-expression observed in ... Aurora kinase A (AURKA) is a normal cell proliferation-inducing enzyme encoded by AURKA gene, with over-expression observed in ... Identification of Potent Inhibitors against Aurora Kinase A Using Molecular Docking and Molecular Dynamics Simulation Studies. ...
Dendritic spine reduction is observed in many psychiatric disorders including schizophrenia and likely contributes to the altered sense of reality disruption of working memory and attention deficits that characterize these disorders. of mature spines and an overall reduction in dendritic spine density in the prefrontal cortex of weanling (P21) mice that persists at 2 months of age. These results suggest that ErbB4 signaling in excitatory pyramidal cells is critical intended for the proper formation and maintenance of dendritic spines in excitatory pyramidal cells. allele were obtained from Yohimbine HCl (Antagonil) the Mutant Mouse Regional Resource Center (MMRRC) at UC Davis (Golub et al. 2004 These embryos were implanted in pseudopregnant foster mothers by the Yale Pet Genomics Services and the resulting pups were genotyped with the following primers as per the MMRRC instructions: Primer 1 - 5′ CAAATGCTCTCTCTGTTCTTTGTGTCTG 1837-91-8 IC50 Primer 2 - 5′ TTTTGCCAAGTT CTAATTCCATCAGAAGC Rabbit ...
Cdc7 kinase stimulates Aurora B kinase in M-phase. Scientific Reports. 2019, 9(1), 18622, ISSN: 2045-2322, PMID: 31819079, ...
My research aimed to identify novel therapeutic strategies combining current drugs with aurora kinase inhibitors (AKI) in pre- ... Particular interest was stimulated by the correlation between over-expression of aurora kinases (AKs) with aggressive clinical ... Aurora Kinase inhibitors (AKI). , paclitaxel. , combination therapies. , pre-clinical models. , clinical trial design. , Aurora ... Novel combination strategies with Aurora Kinase Inhibitors: using pre-clinical data to guide clinical trial design. ...
AURKC: aurora kinase C. *AVP: arginine vasopressin. *AVPR2: arginine vasopressin receptor 2 ...
Roches novel Aurora kinase inhibitor shows promising preclinical profile. July 21, 2008 ...
Aurora kinase A (AURKA) has been implicated in the legislation of. Aurora kinase A (AURKA) has been implicated in the ... Human being Aurora kinase A (AURKA) can be important for centrosome copying, separation and maturation.6 AURKA is a potent ... 4 Aurora kinases had been identified in as crucial players in chromosomal segregation first.5 Consequently, orthologues had ... Moreover, the AURKA depletion or kinase inhibition-induced apoptotic cell death could become reversed by Survivin ectopic ...
We describe here that catalytically active Aurora-B kinase is expressed in the nuclei of many endopolyploid cells in interphase ... because Aurora-B kinase is responsible for coordination and completion of mitosis. We observed that endopolyploid giant cells ... persistence of cell division activity in giant cells expressing Aurora-B kinase. 2008, 32 (9):1044-56 Cell Biol. Int. ... persistence of cell division activity in giant cells expressing Aurora-B kinase.. ...
Aurora Kinase B); EC 2.7.11.1 (Aurora Kinases); EC 2.7.11.1 (Protein-Serine-Threonine Kinases); ppublish ... Aurora Kinase B, Aurora Kinases, Computer Simulation, Drug Design, Drug Evaluation, Preclinical/methods, Humans, Inhibitory ... A specific pharmacophore model of Aurora B kinase inhibitors and virtual screening studies based on it 2009 State Key ... In this study, 3D-pharmacophore models of Aurora B kinase inhibitors have been developed by using HipHop and HypoGen modules in ...
Regulation of Embryonic and Induced Pluripotency by Aurora Kinase-p53 Signaling. Cell Stem Cell, 2012; 11 (2): 179 DOI: 10.1016 ... applied a functional genomics strategy and identified the protein kinase Aurora A (Aurka) as an essential component of ESC ...
... is a serine-threonine kinase and scaffold protein with well defined roles in focal adhesions in integrin-mediated cell adhesio ... Phospho-Aurora A/B/C staining is presumably phospho-Aurora A rather than Aurora B or C, as it colocalizes with total Aurora A; ... Phospho-Aurora A/B/C staining is presumably phospho-Aurora A rather than Aurora B or C, as it colocalizes with total Aurora A; ... Aurora A kinase was immunoprecipitated from cytoskeletal extracts with a monoclonal anti-Aurora A antibody and then Western ...
Preclinical validation of Aurora kinases-targeting drugs in osteosarcoma. Br J Cancer. 2013 Nov 12;109(10):2607-18. [PMC free ... Inhibitors of aurora kinases and DNA methyltransferases have also shown some promise as potential treatment options.[15] ... While Chimeric antigen receptor T cells Insulin-like growth factor 1 receptor and tyrosine kinase-like orphan receptor one have ... While multiple studies are in the process of evaluating the role of receptor tyrosine kinase inhibitors, their role in ...
This plasmid is part of a kinase library, and the gene has been verified, but has not been fully sequenced for minor mutations ... pHR_dSV40-Aurora A-GFP * pWZL Neo Myr Flag PLK1 * pDONR223-AURKB ... Kinase Library Clones). Boehm JS, Zhao JJ, Yao J, Kim SY, ... Please see the following link for plasmids from this article that are not part of the kinase library http://www.addgene.org/ ...
Characterization of plant Aurora kinases during mitosis. A Kawabe, S Matsunaga, K Nakagawa, D Kurihara, A Yoneda, ... ...
Aurora kinase A (AURA) , Aurora kinase A (AURKA) , Aurora kinase A (Aurora A) , Aurora kinase A (Aurora-2) , Aurora-related ... Serine/threonine kinase 15 , Serine/threonine-protein kinase 6 , Serine/threonine-protein kinase aurora A , aurora-2 , hARK1 ... kinase 1 , Aurora/IPL1-related kinase 1 , BTAK , Breast tumor-amplified kinase , Breast-tumor-amplified kinase , IAK1 , STK15 ... E A novel mechanism by which small molecule inhibitors induce the DFG flip in Aurora A. ACS Chem Biol 7:698-706 (2012) [PubMed] ...
The structural basis of the multi-step allosteric activation of Aurora B kinase. eLife, 12:e85328. (2022). ... Dutta, A., Batish, M. & Parashar, V. Structural basis of KdpD histidine kinase binding to the second messenger c-di-AMP. ... ROR and RYK extracellular region structures suggest that receptor tyrosine kinases have distinct WNT-recognition modes. Cell ... Structure and noncanonical Cdk8 activation mechanism within an Argonaute-containing Mediator kinase module. Sci Adv. Jan 15;7(3 ...
Aurora kinase A and JAK2 also significantly reduced GVHD in mice and allowed for the development of anti-cancer immune cells. ... We hypothesized that co-treatment with drugs that target both Aurora kinase A and JAK2 could prevent GVHD better than either ... It is known that Aurora kinase A and JAK2 pathway activation contributes to GVHD. However, drugs that inhibit either protein ... This was best demonstrated by a drug developed at Moffitt that inhibits both Aurora kinase A and JAK2 simultaneously, ...
Potent pan-Aurora kinase inhibitor. Sign-up for new product e-alerts ...
  • Our study focuses on resistance to Aurora kinase inhibitors tested as anti-cancer drugs in clinical trials. (nih.gov)
  • To realize this goal we need to better understand how a kinase switching between active and inactive states affects the ability of inhibitors to interact with it. (elifesciences.org)
  • A range of potent small molecule inhibitors of Aurora kinases have been identified and found to have antitumor activity. (currentmedicinalchemistry.com)
  • Most synthetic Aurora kinase inhibitors are ATP-competitive, which makes selectivity a potential problem. (currentmedicinalchemistry.com)
  • A common structural feature of the inhibitors is a planar heterocyclic ring system able to occupy the adenino-binding region and to mimic the adenine-kinase interactions, by making backbone hydrogen bond interactions, but also by extensive hydrophobic contacts within this part of the pocket. (currentmedicinalchemistry.com)
  • Moreover, the combination of Aurora inhibitors with other chemotherapeutic agents may open new opportunities in cancer chemotherapy. (currentmedicinalchemistry.com)
  • Leucettines, a family of pharmacological inhibitors of dual-specificity tyrosine phosphorylation regulated kinases and cdc-like kinases (CLKs), are under analysis because of their potential therapeutic program to Straight down Alzheimers and symptoms disease. (biomasswars.com)
  • In patients with non-small cell lung cancer, TAMs or M2-like TAMs dampen the responsiveness to targeted therapy with EGF receptorCtyrosine kinase inhibitors (42, 43). (aurora-kinase.com)
  • My research aimed to identify novel therapeutic strategies combining current drugs with aurora kinase inhibitors (AKI) in pre-clinical models and then to design a clinical trial to assess these in patients with bladder cancer. (cam.ac.uk)
  • [14] Inhibitors of aurora kinases and DNA methyltransferases have also shown some promise as potential treatment options. (nih.gov)
  • Indeed, we observed partial restoration of dexamethasone sensitivity with a combination of dexamethasone and inhibitors targeting either these kinases or β-catenin. (lu.se)
  • Aurora inhibitor Bolanos-Garcia V M. Aurora kinases. (wikipedia.org)
  • Participants must not have had prior aurora kinase inhibitor exposure. (dana-farber.org)
  • The discovery that activated forms of Aurora A can have different dynamic properties raises the possibility that inhibitor molecules could be designed to exploit these differences and block specific activities of Aurora A in cancer cells. (elifesciences.org)
  • Alisertib, an aurora A kinase inhibitor, has demonstrated efficacy as monotherapy in trials of myeloid malignancy, and this efficacy appears enhanced in combination with conventional chemotherapies. (haematologica.org)
  • Alert FDA Approves Bosutinib for Children With CML The agency approved the tyrosine kinase inhibitor for pediatric patients with chronic phase Ph+ chronic myelogenous leukemia that is newly diagnosed or resistant or intolerant to prior therapy. (medscape.com)
  • Aurora kinase A (AURKA) is a normal cell proliferation-inducing enzyme encoded by AURKA gene, with over-expression observed in different types of malignancies. (preprints.org)
  • The results show that, these four molecules have high binding affinity to the AURKA and significant interactions (LEU139, GLU211and ALA213) were also identified with the hinge region of Aurora kinase A. Thus, LEU139, GLU211, and ALA213 were identified as the crucial protein mechanisms. (preprints.org)
  • Aurora kinase A (AURKA) has been implicated in the legislation of cell cycle progression, mitosis and a key quantity of oncogenic signaling pathways in various malignancies. (research-in-field.com)
  • Moreover, the AURKA depletion or kinase inhibition-induced apoptotic cell death could become reversed by Survivin ectopic overexpression, assisting that AURKA controlled Survivin to enhance medication level of resistance even more. (research-in-field.com)
  • Human being Aurora kinase A (AURKA) can be important for centrosome copying, separation and maturation.6 AURKA is a potent oncogene that has the capability to transform certain cell lines when overexpressed.7 Latest proof demonstrated that AURKA could regulate c-Myc phrase through cooperating with hnRNP K.8 AURKA overexpression is also a characteristic of many cancers and can improve chromosomal instability through centrosome amplification. (research-in-field.com)
  • The researchers, a team at Mount Sinai School of Medicine led by Ihor Lemischka, PhD, Director of the Black Family Stem Cell Institute, in collaboration with groups at the University of Manchester and the MD Anderson Cancer Center, applied a functional genomics strategy and identified the protein kinase Aurora A (Aurka) as an essential component of ESC function. (sciencedaily.com)
  • Mitotic kinase Aurora A (AURKA) diverges from other kinases in its multiple active conformations that may explain its interphase roles and the limited efficacy of drugs targeting the kinase pocket. (bvsalud.org)
  • Aurora 2) functions during prophase of mitosis and is required for correct duplication and separation of the centrosomes (the microtubule organising centres in eukaryotic cells). (wikipedia.org)
  • Roles of Aurora Kinases in Mitosis and Tumorigenesis" (PDF). (wikipedia.org)
  • Aurora kinases regulate mitosis and are commonly overexpressed in leukemia. (prinsesmaximacentrum.nl)
  • Here we investigate the mitotic activities and the role of Aurora-B, in view of potential depolyploidisation of these cells, because Aurora-B kinase is responsible for coordination and completion of mitosis. (openrepository.com)
  • The totally micronucleated giant cells (containing sub-genomic fragments in multiple micronuclei) represented only the minor fraction which failed to undergo mitosis, and Aurora-B was absent from it. (openrepository.com)
  • The active form of the metabolic sensor: AMP-activated protein kinase (AMPK) directly binds the mitotic apparatus and travels from centrosomes to the spindle midzone during mitosis and cytokinesis. (openrepository.com)
  • Additionally, depletion of ILK expression or inhibition of its activity inhibits Aurora A-TACC3/ch-TOG interactions, which are essential for spindle pole organization and mitosis. (rupress.org)
  • The human Aurora kinases present a similar domain organization, with a N-terminal domain of 39-129 residues in length, a related Ser/Thr protein kinase domain and a short C-terminal domain containing 15-20 residues. (wikipedia.org)
  • Aurora A activity is positively-regulated by the spindle protein TPX2, and has recently been shown to be a target for thiol-containing molecules, such as Coenzyme A. Aurora B (a.k.a. (wikipedia.org)
  • A novel mechanism for activation of the protein kinase Aurora A". Current Biology. (wikipedia.org)
  • Many eukaryotic protein kinases are activated by phosphorylation on a specific conserved residue in the regulatory activation loop, a post-translational modification thought to stabilize the active DFG-In state of the catalytic domain. (elifesciences.org)
  • This mechanism raises new questions about the functional role of the DFG-Out state in protein kinases. (elifesciences.org)
  • The enzymes that catalyze this process, called protein kinases, are themselves controlled by the phosphorylation of a flexible region called the activation loop. (elifesciences.org)
  • This assumption was based on static pictures of protein kinases obtained by X-ray crystallography, in which individual states are trapped and visualized in a crystal lattice. (elifesciences.org)
  • show that the static model is incorrect in a protein kinase called Aurora A. In this enzyme, the phosphorylated activation loop continues to switch back and forth between active and inactive states. (elifesciences.org)
  • Stringent regulatory control of protein kinases is critically important for the integrity of cellular signal transduction. (elifesciences.org)
  • The catalytic activity of protein kinases is regulated by finely-tuned allosteric mechanisms that reversibly switch the kinase domain between active and inactive conformational states ( Huse and Kuriyan, 2002 ). (elifesciences.org)
  • Integrin-linked kinase (ILK) is a serine-threonine kinase and scaffold protein with well defined roles in focal adhesions in integrin-mediated cell adhesion, spreading, migration, and signaling. (rupress.org)
  • Mitogen-activated protein kinase kinase kinases (MAPKKKs) are serine-threonine protein kinases that initiate protein kinase signaling cascades. (bvsalud.org)
  • The first aurora kinases were identified in Drosophila melanogaster, where mutations led to failure of centrosome separation with the monopolar spindles reminiscent of the North Pole, suggesting the name aurora. (wikipedia.org)
  • These kinases play important role in centrosome maturation, chromosome separation and cytokinesis. (currentmedicinalchemistry.com)
  • The absence of p53 aggravates polyploidy and centrosome number abnormality induced by Aurora-C overexpression. (openrepository.com)
  • Aberrant expression of aurora kinase A is implicated in the genesis of various neoplasms, including acute myeloid leukemia. (haematologica.org)
  • Aurora A regulates several important steps in cell division, and plays important roles in several kinds of cancer. (elifesciences.org)
  • Covalent Aurora A regulation by the metabolic integrator coenzyme A". Redox Biology. (wikipedia.org)
  • Besides being implicated as mitotic regulators, these three kinases have generated significant interest in the cancer research field due to their elevated expression profiles in many human cancers. (wikipedia.org)
  • Our findings create VprBP as a significant kinase in charge of H2AT120p in cancers cells and claim that VprBP inhibition is actually a new technique for the introduction of anticancer therapeutics. (biomasswars.com)
  • Particular interest was stimulated by the correlation between over-expression of aurora kinases (AKs) with aggressive clinical behaviour in many cancers and the network of interactions which AKs have with other key proteins. (cam.ac.uk)
  • More specifically, Aurora kinases play a crucial role in cellular division by controlling chromatid segregation. (wikipedia.org)
  • Aurora 1) functions in the attachment of the mitotic spindle to the centromere. (wikipedia.org)
  • We describe here that catalytically active Aurora-B kinase is expressed in the nuclei of many endopolyploid cells in interphase, as well as being present at the centromeres, mitotic spindle and cleavage furrow during their attempted mitotes. (openrepository.com)
  • Endopolyploidy in irradiated p53-deficient tumour cell lines: persistence of cell division activity in giant cells expressing Aurora-B kinase. (openrepository.com)
  • The specific targeting of these kinases could result in highly active drugs with minimal collateral host toxicity. (currentmedicinalchemistry.com)
  • Here we use a battery of spectroscopic methods that track different catalytic elements of the kinase domain to show that the ~100 fold activation of the mitotic kinase Aurora A (AurA) by phosphorylation occurs without a population shift from the DFG-Out to the DFG-In state, and that the activation loop of the activated kinase remains highly dynamic. (elifesciences.org)
  • For many years it had been thought that the purpose of activation loop phosphorylation was to clamp the otherwise flexible activation loop in an active state that allows molecules that need to be phosphorylated to bind to the kinase. (elifesciences.org)
  • Aurora kinases are serine/threonine kinases that are essential for cell proliferation. (wikipedia.org)
  • These kinases lead to β-catenin stabilization through phosphorylation-dependent inactivation of GSK-3β either directly or indirectly. (lu.se)
  • Alert FDA Okays First Extravascular ICD System Medtronic's Aurora extravascular implantable cardioverter-defibrillator system uses a single lead implanted substernally to allow anti-tachycardia pacing and low-energy defibrillation. (medscape.com)
  • Three Aurora kinases have been identified in mammalian cells to date. (wikipedia.org)
  • Aurora C (AURKC) works in germ-line cells and little is known about its function. (wikipedia.org)
  • These observations suggest that most endopolyploid tumour cells are not reproductively inert and that Aurora-B may contribute to the establishment of resistant tumours post-irradiation. (openrepository.com)
  • Aurora-B dysfunction of multinucleated giant cells in glioma detected by site-specific phosphorylated antibodies. (openrepository.com)
  • Giet R, Prigent C. Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic serine-threonine kinases. (wikipedia.org)
  • 13. Targeting tyrosine-kinases in ovarian cancer. (nih.gov)
  • The Aurora kinases, which include Aurora A (AURKA), Aurora B (AURKB) and Aurora C (AURKC), are serine/threonine kinases required for the control of mitosis (AURKA and AURKB) and meiosis (AURKC). (nih.gov)
  • Familia de serina-treonina cinasas implicadas en la regulación de la MITOSIS. (bvsalud.org)
  • A family of highly conserved serine-threonine kinases that are involved in the regulation of MITOSIS . (bvsalud.org)
  • The three Aurora mitotic kinases localize to the centrosome during different phases of mitosis. (aurorapathway.com)
  • Are single nucleotide variants (SNVs) in Aurora kinases B and C (AURKB, AURKC) associated with risk of aneuploid conception? (nih.gov)
  • Function of aurora kinase C (AURKC) in human reproduction]. (cdc.gov)
  • Aurora kinase A (Aurora-A), a serine / threonine kinase , plays a pivotal role in various cellular processes, including mitotic entry, centrosome maturation and spindle formation. (bvsalud.org)
  • Some patients had apparent myelosuppression, which the researchers say is an expected mechanism-based side effect of aurora kinase inhibition. (medscape.com)
  • In MYC-amplified SCLC cells Aurora kinase inhibition associates with G2/M-arrest, inactivation of PI3-kinase (PI3K) signaling, and induction of apoptosis. (uni-koeln.de)
  • Our study suggests that a fraction of SCLC patients may benefit from therapeutic inhibition of Aurora B. Thus, thorough chemical and genomic exploration of SCLC cell lines may provide starting points for further development of rational targeted therapeutic intervention in this deadly tumor type. (uni-koeln.de)
  • Both Aurora-A and Aurora-B proteins physically interact with the H3 tail and efficiently phosphorylate Ser10 both in vitro and in vivo, even if Aurora-A appears to be a better H3 kinase than Aurora-B. Since Aurora-A and Aurora-B are known to be overexpressed in a variety of human cancers, our findings provide an attractive link between cell transformation, chromatin modifications and a specific kinase system. (nih.gov)
  • Mutations of the aurora kinase C gene causing macrozoospermia are the most frequent genetic cause of male infertility in Algerian men. (cdc.gov)
  • Two frequent loss-of-function mutations in Aurora Kinase C gene in Algerian infertile men with macrozoospermia. (cdc.gov)
  • The new product is said to address this problem by targeting aurora kinases and BCR-ABL , a gene that when altered promotes uncontrolled cell growth and disease progression in leukemia. (medscape.com)
  • Overexpression or gene -amplification/ mutation of Aurora-A kinase occurs in different types of cancer , including lung cancer , colorectal cancer , and breast cancer . (bvsalud.org)
  • Alteration of Aurora-A impacts multiple cancer hallmarks, especially, immortalization, energy metabolism , immune escape and cell death resistance which are involved in cancer progression and resistance. (bvsalud.org)
  • Emerging roles of Aurora-A kinase in cancer therapy resistance. (bvsalud.org)
  • Mitotic phosphorylation of histone H3: spatio-temporal regulation by mammalian Aurora kinases. (nih.gov)
  • Here we show that the expression of Aurora-A and Aurora-B, two kinases of the Aurora/AIK family, is tightly coordinated with H3 phosphorylation during the G(2)/M transition. (nih.gov)
  • At prophase and metaphase, Aurora-A is highly localized in the centrosomic region and in the spindle poles while Aurora-B is present in the centromeric region concurrent with H3 phosphorylation, to then translocate by cytokinesis to the midbody region. (nih.gov)
  • Since their discovery nearly 20 years ago, Aurora kinases have been studied extensively in cell and cancer biology. (nih.gov)
  • This review highlights the most recent advances in the oncogenic roles and related multiple cancer hallmarks of Aurora-A kinase -driving cancer therapy resistance, including chemoresistance ( taxanes , cisplatin , cyclophosphamide ), targeted therapy resistance (osimertinib, imatinib , sorafenib , etc.), endocrine therapy resistance ( tamoxifen , fulvestrant ) and radioresistance. (bvsalud.org)
  • 7. Targeting Aurora kinases in ovarian cancer. (nih.gov)
  • Similar to alectinib, hepatotoxicity is an important side effect to monitor closely as is elevated creatine kinase. (medscape.com)
  • The kinetoplastid parasite Trypanosoma brucei employs a unique mechanism to target the conserved Aurora B kinase to kinetochores and the central spindle. (elifesciences.org)
  • The Aurora kinases N-terminal and C-terminal domains contain D-box and KEN regulatory motifs while the central kinase domain contributes the catalytic activity. (nih.gov)
  • Specifically, the mechanisms of Aurora-A kinase promote acquired resistance through modulating DNA damage repair, feedback activation bypass pathways, resistance to apoptosis , necroptosis and autophagy , metastasis , and stemness. (bvsalud.org)
  • Intervienen en muchos aspectos de la división celular como la duplicación del centrosoma, la formación del HUSO ACROMÁTICO, el alineamiento de los cromosomas, su unión al huso, la activación regulada ("checkpoint activation") y la CITOCINESIS. (bvsalud.org)
  • The Aurora Kinase C c.144delC mutation causes meiosis I arrest in men and is frequent in the North African population. (cdc.gov)
  • For the present review, the following electronic databases were used: Medline ( https://www.ebsco.com/products/research-databases/medline ), Scopus ( https://www.elsevier.com/products/scopus ) and Web of Science ( https://webofscience.help.clarivate.com/en-us/Content/home.htm/ ). (spandidos-publications.com)
  • During the G(2) phase, the Aurora-A kinase is coexpressed while the Aurora-B kinase colocalizes with phosphorylated histone H3. (nih.gov)