Specific loci on both the bacterial DNA (attB) and the phage DNA (attP) which delineate the sites where recombination takes place between them, as the phage DNA becomes integrated (inserted) into the BACTERIAL DNA during LYSOGENY.
Emotional attachment to someone or something in the environment.
The phenomenon by which a temperate phage incorporates itself into the DNA of a bacterial host, establishing a kind of symbiotic relation between PROPHAGE and bacterium which results in the perpetuation of the prophage in all the descendants of the bacterium. Upon induction (VIRUS ACTIVATION) by various agents, such as ultraviolet radiation, the phage is released, which then becomes virulent and lyses the bacterium.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Linear TETRAPYRROLES that give a characteristic color to BILE including: BILIRUBIN; BILIVERDIN; and bilicyanin.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Viruses whose hosts are bacterial cells.
Recombinases that insert exogenous DNA into the host genome. Examples include proteins encoded by the POL GENE of RETROVIRIDAE and also by temperate BACTERIOPHAGES, the best known being BACTERIOPHAGE LAMBDA.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The binding of virus particles to receptors on the host cell surface. For enveloped viruses, the virion ligand is usually a surface glycoprotein as is the cellular receptor. For non-enveloped viruses, the virus CAPSID serves as the ligand.
The morphologic and physiological changes of the MUSCLES, bones (BONE AND BONES), and CARTILAGE of the body, i.e., MUSCULOSKELETAL SYSTEM, during the prenatal and postnatal stages of development.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
The metal-free red phycobilin pigment in a conjugated chromoprotein of red algae. It functions as a light-absorbing substance together with chlorophylls.
A temperate inducible phage and type species of the genus lambda-like viruses, in the family SIPHOVIRIDAE. Its natural host is E. coli K12. Its VIRION contains linear double-stranded DNA with single-stranded 12-base 5' sticky ends. The DNA circularizes on infection.
The residual framework structure of the CELL NUCLEUS that maintains many of the overall architectural features of the cell nucleus including the nuclear lamina with NUCLEAR PORE complex structures, residual CELL NUCLEOLI and an extensive fibrogranular structure in the nuclear interior. (Advan. Enzyme Regul. 2002; 42:39-52)
Adherence of cells to surfaces or to other cells.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Markedly disturbed and developmentally inappropriate social relatedness that begins before age 5 and is associated with grossly pathological child care. The child may persistently fail to initiate and respond to social interactions in a developmentally appropriate way (inhibited type) or there may be a pattern of diffuse attachments with nondiscriminate sociability (disinhibited type). (From DSM-V)
Fibrous bands or cords of CONNECTIVE TISSUE at the ends of SKELETAL MUSCLE FIBERS that serve to attach the MUSCLES to bones and other structures.
Large multiprotein complexes that bind the centromeres of the chromosomes to the microtubules of the mitotic spindle during metaphase in the cell cycle.
Insertion of viral DNA into host-cell DNA. This includes integration of phage DNA into bacterial DNA; (LYSOGENY); to form a PROPHAGE or integration of retroviral DNA into cellular DNA to form a PROVIRUS.
The chemical or biochemical addition of carbohydrate or glycosyl groups to other chemicals, especially peptides or proteins. Glycosyl transferases are used in this biochemical reaction.
Viruses whose host is Streptococcus.
Physicochemical property of fimbriated (FIMBRIAE, BACTERIAL) and non-fimbriated bacteria of attaching to cells, tissue, and nonbiological surfaces. It is a factor in bacterial colonization and pathogenicity.
A family of BACTERIOPHAGES and ARCHAEAL VIRUSES which are characterized by long, non-contractile tails.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Compounds containing carbohydrate or glycosyl groups linked to phosphatidylinositols. They anchor GPI-LINKED PROTEINS or polysaccharides to cell membranes.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Enzymes that catalyze the incorporation of deoxyribonucleotides into a chain of DNA. EC 2.7.7.-.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Established cell cultures that have the potential to propagate indefinitely.
Glycoproteins which have a very high polysaccharide content.
Specific molecular components of the cell capable of recognizing and interacting with a virus, and which, after binding it, are capable of generating some signal that initiates the chain of events leading to the biological response.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Glycoproteins found on the surfaces of cells, particularly in fibrillar structures. The proteins are lost or reduced when these cells undergo viral or chemical transformation. They are highly susceptible to proteolysis and are substrates for activated blood coagulation factor VIII. The forms present in plasma are called cold-insoluble globulins.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Viruses whose host is Escherichia coli.
A species of gram-positive, asporogenous bacteria in which three cultural types are recognized. These types (gravis, intermedius, and mitis) were originally given in accordance with the clinical severity of the cases from which the different strains were most frequently isolated. This species is the causative agent of DIPHTHERIA.
Plants of the division Rhodophyta, commonly known as red algae, in which the red pigment (PHYCOERYTHRIN) predominates. However, if this pigment is destroyed, the algae can appear purple, brown, green, or yellow. Two important substances found in the cell walls of red algae are AGAR and CARRAGEENAN. Some rhodophyta are notable SEAWEED (macroalgae).
A heteropolysaccharide that is similar in structure to HEPARIN. It accumulates in individuals with MUCOPOLYSACCHARIDOSIS.
Contractile tissue that produces movement in animals.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Viruses whose host is Salmonella. A frequently encountered Salmonella phage is BACTERIOPHAGE P22.
Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.
The MUSCLES, bones (BONE AND BONES), and CARTILAGE of the body.
The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
A family of transmembrane glycoproteins (MEMBRANE GLYCOPROTEINS) consisting of noncovalent heterodimers. They interact with a wide variety of ligands including EXTRACELLULAR MATRIX PROTEINS; COMPLEMENT, and other cells, while their intracellular domains interact with the CYTOSKELETON. The integrins consist of at least three identified families: the cytoadhesin receptors(RECEPTORS, CYTOADHESIN), the leukocyte adhesion receptors (RECEPTORS, LEUKOCYTE ADHESION), and the VERY LATE ANTIGEN RECEPTORS. Each family contains a common beta-subunit (INTEGRIN BETA CHAINS) combined with one or more distinct alpha-subunits (INTEGRIN ALPHA CHAINS). These receptors participate in cell-matrix and cell-cell adhesion in many physiologically important processes, including embryological development; HEMOSTASIS; THROMBOSIS; WOUND HEALING; immune and nonimmune defense mechanisms; and oncogenic transformation.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
Derivatives of chondroitin which have a sulfate moiety esterified to the galactosamine moiety of chondroitin. Chondroitin sulfate A, or chondroitin 4-sulfate, and chondroitin sulfate C, or chondroitin 6-sulfate, have the sulfate esterified in the 4- and 6-positions, respectively. Chondroitin sulfate B (beta heparin; DERMATAN SULFATE) is a misnomer and this compound is not a true chondroitin sulfate.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
Regions of the CHROMATIN or DNA that bind to the NUCLEAR MATRIX. They are found in INTERGENIC DNA, especially flanking the 5' ends of genes or clusters of genes. Many of the regions that have been isolated contain a bipartite sequence motif called the MAR/SAR recognition signature sequence that binds to MATRIX ATTACHMENT REGION BINDING PROTEINS.
Proteins which contain carbohydrate groups attached covalently to the polypeptide chain. The protein moiety is the predominant group with the carbohydrate making up only a small percentage of the total weight.
Genomes of temperate BACTERIOPHAGES integrated into the DNA of their bacterial host cell. The prophages can be duplicated for many cell generations until some stimulus induces its activation and virulence.
Shiny, flexible bands of fibrous tissue connecting together articular extremities of bones. They are pliant, tough, and inextensile.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
The act of testing the software for compliance with a standard.
Heteropolysaccharides which contain an N-acetylated hexosamine in a characteristic repeating disaccharide unit. The repeating structure of each disaccharide involves alternate 1,4- and 1,3-linkages consisting of either N-acetylglucosamine or N-acetylgalactosamine.
Microscopy in which the object is examined directly by an electron beam scanning the specimen point-by-point. The image is constructed by detecting the products of specimen interactions that are projected above the plane of the sample, such as backscattered electrons. Although SCANNING TRANSMISSION ELECTRON MICROSCOPY also scans the specimen point by point with the electron beam, the image is constructed by detecting the electrons, or their interaction products that are transmitted through the sample plane, so that is a form of TRANSMISSION ELECTRON MICROSCOPY.
A serine endopeptidase that is formed from TRYPSINOGEN in the pancreas. It is converted into its active form by ENTEROPEPTIDASE in the small intestine. It catalyzes hydrolysis of the carboxyl group of either arginine or lysine. EC 3.4.21.4.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
Loss or destruction of periodontal tissue caused by periodontitis or other destructive periodontal diseases or by injury during instrumentation. Attachment refers to the periodontal ligament which attaches to the alveolar bone. It has been hypothesized that treatment of the underlying periodontal disease and the seeding of periodontal ligament cells enable the creating of new attachment.
A property of the surface of an object that makes it stick to another surface.
Macromolecular organic compounds that contain carbon, hydrogen, oxygen, nitrogen, and usually, sulfur. These macromolecules (proteins) form an intricate meshwork in which cells are embedded to construct tissues. Variations in the relative types of macromolecules and their organization determine the type of extracellular matrix, each adapted to the functional requirements of the tissue. The two main classes of macromolecules that form the extracellular matrix are: glycosaminoglycans, usually linked to proteins (proteoglycans), and fibrous proteins (e.g., COLLAGEN; ELASTIN; FIBRONECTINS; and LAMININ).
Any method used for determining the location of and relative distances between genes on a chromosome.
Conjugated protein-carbohydrate compounds including mucins, mucoid, and amyloid glycoproteins.
Viruses whose host is Staphylococcus.
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
A branch of biology dealing with the structure of organisms.
The functional hereditary units of BACTERIA.
An intermediate in the pathway of coenzyme A formation in mammalian liver and some microorganisms.
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.
The functional hereditary units of VIRUSES.
Large, noncollagenous glycoprotein with antigenic properties. It is localized in the basement membrane lamina lucida and functions to bind epithelial cells to the basement membrane. Evidence suggests that the protein plays a role in tumor invasion.
A family of transmembrane glycoproteins that contain a short cytoplasmic domain, a single-span transmembrane domain, and an extracellular domain with heparin sulfate and CHONDROITIN SULFATE chains. Syndecans interact with a variety of heparin-binding INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS and may play a role in modulating cellular signaling during EMBRYONIC DEVELOPMENT, tumorigenesis, and angiogenesis.
Proteins found in any species of virus.
Peptides composed of between two and twelve amino acids.
Proteins prepared by recombinant DNA technology.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Proteins found in any species of bacterium.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
Ubiquitous macromolecules associated with the cell surface and extracellular matrix of a wide range of cells of vertebrate and invertebrate tissues. They are essential cofactors in cell-matrix adhesion processes, in cell-cell recognition systems, and in receptor-growth factor interactions. (From Cancer Metastasis Rev 1996; 15(2): 177-86; Hepatology 1996; 24(3): 524-32)
A species of temperate bacteriophage in the genus P2-like viruses, family MYOVIRIDAE, which infects E. coli. It consists of linear double-stranded DNA with 19-base sticky ends.
The sum of the weight of all the atoms in a molecule.
The functional hereditary units of INSECTS.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
The largest class of organic compounds, including STARCH; GLYCOGEN; CELLULOSE; POLYSACCHARIDES; and simple MONOSACCHARIDES. Carbohydrates are composed of carbon, hydrogen, and oxygen in a ratio of Cn(H2O)n.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The rate dynamics in chemical or physical systems.
Glycoproteins found on the membrane or surface of cells.
The major sialoglycoprotein of the human erythrocyte membrane. It consists of at least two sialoglycopeptides and is composed of 60% carbohydrate including sialic acid and 40% protein. It is involved in a number of different biological activities including the binding of MN blood groups, influenza viruses, kidney bean phytohemagglutinin, and wheat germ agglutinin.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Patterns (real or mathematical) which look similar at different scales, for example the network of airways in the lung which shows similar branching patterns at progressively higher magnifications. Natural fractals are self-similar across a finite range of scales while mathematical fractals are the same across an infinite range. Many natural, including biological, structures are fractal (or fractal-like). Fractals are related to "chaos" (see NONLINEAR DYNAMICS) in that chaotic processes can produce fractal structures in nature, and appropriate representations of chaotic processes usually reveal self-similarity over time.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
The alpha subunits of integrin heterodimers (INTEGRINS), which mediate ligand specificity. There are approximately 18 different alpha chains, exhibiting great sequence diversity; several chains are also spliced into alternative isoforms. They possess a long extracellular portion (1200 amino acids) containing a MIDAS (metal ion-dependent adhesion site) motif, and seven 60-amino acid tandem repeats, the last 4 of which form EF HAND MOTIFS. The intracellular portion is short with the exception of INTEGRIN ALPHA4.
Carbohydrates consisting of between two (DISACCHARIDES) and ten MONOSACCHARIDES connected by either an alpha- or beta-glycosidic link. They are found throughout nature in both the free and bound form.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
Viruses whose host is one or more Mycobacterium species. They include both temperate and virulent types.
Fibrous cords of CONNECTIVE TISSUE that attach bones to each other and hold together the many types of joints in the body. Articular ligaments are strong, elastic, and allow movement in only specific directions, depending on the individual joint.
A cytoskeletal protein associated with cell-cell and cell-matrix interactions. The amino acid sequence of human vinculin has been determined. The protein consists of 1066 amino acid residues and its gene has been assigned to chromosome 10.
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.
Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Any normal or abnormal coloring matter in PLANTS; ANIMALS or micro-organisms.
An N-acyl derivative of neuraminic acid. N-acetylneuraminic acid occurs in many polysaccharides, glycoproteins, and glycolipids in animals and bacteria. (From Dorland, 28th ed, p1518)
Antibodies produced by a single clone of cells.
The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.
CELL LINE derived from the ovary of the Chinese hamster, Cricetulus griseus (CRICETULUS). The species is a favorite for cytogenetic studies because of its small chromosome number. The cell line has provided model systems for the study of genetic alterations in cultured mammalian cells.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
A group of naturally occurring N-and O-acyl derivatives of the deoxyamino sugar neuraminic acid. They are ubiquitously distributed in many tissues.
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
An analytical method used in determining the identity of a chemical based on its mass using mass analyzers/mass spectrometers.
Proteins that bind to the MATRIX ATTACHMENT REGIONS of DNA.
The sequence of carbohydrates within POLYSACCHARIDES; GLYCOPROTEINS; and GLYCOLIPIDS.
A meshwork-like substance found within the extracellular space and in association with the basement membrane of the cell surface. It promotes cellular proliferation and provides a supporting structure to which cells or cell lysates in culture dishes adhere.
A parasexual process in BACTERIA; ALGAE; FUNGI; and ciliate EUKARYOTA for achieving exchange of chromosome material during fusion of two cells. In bacteria, this is a uni-directional transfer of genetic material; in protozoa it is a bi-directional exchange. In algae and fungi, it is a form of sexual reproduction, with the union of male and female gametes.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
The semi-permeable outer structure of a red blood cell. It is known as a red cell 'ghost' after HEMOLYSIS.
A 1.5-kDa small ubiquitin-related modifier protein that can covalently bind via an isopeptide link to a number of cellular proteins. It may play a role in intracellular protein transport and a number of other cellular processes.
Wormlike or grublike stage, following the egg in the life cycle of insects, worms, and other metamorphosing animals.
Techniques used to demonstrate or measure an immune response, and to identify or measure antigens using antibodies.
A polypeptide substance comprising about one third of the total protein in mammalian organisms. It is the main constituent of SKIN; CONNECTIVE TISSUE; and the organic substance of bones (BONE AND BONES) and teeth (TOOTH).
Proteoglycans consisting of proteins linked to one or more CHONDROITIN SULFATE-containing oligosaccharide chains.
The membrane system of the CELL NUCLEUS that surrounds the nucleoplasm. It consists of two concentric membranes separated by the perinuclear space. The structures of the envelope where it opens to the cytoplasm are called the nuclear pores (NUCLEAR PORE).
A multistage process that includes the determination of a sequence (protein, carbohydrate, etc.), its fragmentation and analysis, and the interpretation of the resulting sequence information.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
Transport proteins that carry specific substances in the blood or across cell membranes.
Surface ligands, usually glycoproteins, that mediate cell-to-cell adhesion. Their functions include the assembly and interconnection of various vertebrate systems, as well as maintenance of tissue integration, wound healing, morphogenic movements, cellular migrations, and metastasis.
The use of wings or wing-like appendages to remain aloft and move through the air.
Preparation for electron microscopy of minute replicas of exposed surfaces of the cell which have been ruptured in the frozen state. The specimen is frozen, then cleaved under high vacuum at the same temperature. The exposed surface is shadowed with carbon and platinum and coated with carbon to obtain a carbon replica.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
The properties, processes, and behavior of biological systems under the action of mechanical forces.
A wedge-shaped collar of epithelial cells which form the attachment of the gingiva to the tooth surface at the base of the gingival crevice.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
A serotype of Salmonella enterica that is a frequent agent of Salmonella gastroenteritis in humans. It also causes PARATYPHOID FEVER.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Cyanogen bromide (CNBr). A compound used in molecular biology to digest some proteins and as a coupling reagent for phosphoroamidate or pyrophosphate internucleotide bonds in DNA duplexes.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Lipid A is the biologically active component of lipopolysaccharides. It shows strong endotoxic activity and exhibits immunogenic properties.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
A purely physical condition which exists within any material because of strain or deformation by external forces or by non-uniform thermal expansion; expressed quantitatively in units of force per unit area.
A non-pathogenic species of LACTOCOCCUS found in DAIRY PRODUCTS and responsible for the souring of MILK and the production of LACTIC ACID.
A broad category of enzymes that are involved in the process of GENETIC RECOMBINATION.
The developmental entity of a fertilized chicken egg (ZYGOTE). The developmental process begins about 24 h before the egg is laid at the BLASTODISC, a small whitish spot on the surface of the EGG YOLK. After 21 days of incubation, the embryo is fully developed before hatching.
Glycoproteins which contain sialic acid as one of their carbohydrates. They are often found on or in the cell or tissue membranes and participate in a variety of biological activities.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Major constituent of the cytoskeleton found in the cytoplasm of eukaryotic cells. They form a flexible framework for the cell, provide attachment points for organelles and formed bodies, and make communication between parts of the cell possible.
Elements of limited time intervals, contributing to particular results or situations.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Characteristics or attributes of the outer boundaries of objects, including molecules.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Any compound containing one or more monosaccharide residues bound by a glycosidic linkage to a hydrophobic moiety such as an acylglycerol (see GLYCERIDES), a sphingoid, a ceramide (CERAMIDES) (N-acylsphingoid) or a prenyl phosphate. (From IUPAC's webpage)
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
The characteristic 3-dimensional shape of a carbohydrate.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Developmental events leading to the formation of adult muscular system, which includes differentiation of the various types of muscle cell precursors, migration of myoblasts, activation of myogenesis and development of muscle anchorage.
The orderly segregation of CHROMOSOMES during MEIOSIS or MITOSIS.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
An essential amino acid. It is often added to animal feed.
Profound physical changes during maturation of living organisms from the immature forms to the adult forms, such as from TADPOLES to frogs; caterpillars to BUTTERFLIES.
Monomeric subunits of primarily globular ACTIN and found in the cytoplasmic matrix of almost all cells. They are often associated with microtubules and may play a role in cytoskeletal function and/or mediate movement of the cell or the organelles within the cell.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
Cell-surface components or appendages of bacteria that facilitate adhesion (BACTERIAL ADHESION) to other cells or to inanimate surfaces. Most fimbriae (FIMBRIAE, BACTERIAL) of gram-negative bacteria function as adhesins, but in many cases it is a minor subunit protein at the tip of the fimbriae that is the actual adhesin. In gram-positive bacteria, a protein or polysaccharide surface layer serves as the specific adhesin. What is sometimes called polymeric adhesin (BIOFILMS) is distinct from protein adhesin.
Cell surface proteins that bind signalling molecules external to the cell with high affinity and convert this extracellular event into one or more intracellular signals that alter the behavior of the target cell (From Alberts, Molecular Biology of the Cell, 2nd ed, pp693-5). Cell surface receptors, unlike enzymes, do not chemically alter their ligands.
The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.
CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)

Sequence of Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage late-gene product. (1/353)

Lysogenic bacteriophages are major vehicles for the transfer of genetic information between bacteria, including pathogenicity and/or virulence determinants. In the enteric pathogen Escherichia coli O157:H7, which causes hemorrhagic colitis and hemolytic-uremic syndrome, Shiga toxins 1 and 2 (Stx1 and Stx2) are phage encoded. The sequence and analysis of the Stx2 phage 933W is presented here. We find evidence that the toxin genes are part of a late-phage transcript, suggesting that toxin production may be coupled with, if not dependent upon, phage release during lytic growth. Another phage gene, stk, encodes a product resembling eukaryotic serine/threonine protein kinases. Based on its position in the sequence, Stk may be produced by the prophage in the lysogenic state, and, like the YpkA protein of Yersinia species, it may interfere with the signal transduction pathway of the mammalian host. Three novel tRNA genes present in the phage genome may serve to increase the availability of rare tRNA species associated with efficient expression of pathogenicity determinants: both the Shiga toxin and serine/threonine kinase genes contain rare isoleucine and arginine codons. 933W also has homology to lom, encoding a member of a family of outer membrane proteins associated with virulence by conferring the ability to survive in macrophages, and bor, implicated in serum resistance.  (+info)

Criss-crossed interactions between the enhancer and the att sites of phage Mu during DNA transposition. (2/353)

A bipartite enhancer sequence (composed of the O1 and O2 operator sites) is essential for assembly of the functional tetramer of phage Mu transposase (MuA) on supercoiled DNA substrates. A three-site interaction (LER) between the left (L) and right (R) ends of Mu (att sites) and the enhancer (E) precedes tetramer assembly. We have dissected the role of the enhancer in tetramer assembly by using two transposase proteins that have a common att site specificity, but are distinct in their enhancer specificity. The activity of these proteins on substrates containing hybrid enhancers reveals a 'criss-crossed' pattern of interaction between att and enhancer sites. The left operator, O1, of the enhancer interacts specifically with the transposase subunit at the R1 site (within the right att sequence) that is responsible for cleaving the left end of Mu. The right operator, O2, shows a preferential interaction with the transposase subunit at the L1 site (within the left att sequence) that is responsible for cleaving the right end of Mu.  (+info)

Site-specific recombination of bacteriophage P22 does not require integration host factor. (3/353)

Site-specific recombination by phages lambda and P22 is carried out by multiprotein-DNA complexes. Integration host factor (IHF) facilitates lambda site-specific recombination by inducing DNA bends necessary to form an active recombinogenic complex. Mutants lacking IHF are over 1,000-fold less proficient in supporting lambda site-specific recombination than wild-type cells. Although the attP region of P22 contains strong IHF binding sites, in vivo measurements of integration and excision frequencies showed that infecting P22 phages can perform site-specific recombination to its maximum efficiency in the absence of IHF. In addition, a plasmid integration assay showed that integrative recombination occurs equally well in wild-type and ihfA mutant cells. P22 integrative recombination is also efficient in Escherichia coli in the absence of functional IHF. These results suggest that nucleoprotein structures proficient for recombination can form in the absence of IHF or that another factor(s) can substitute for IHF in the formation of complexes.  (+info)

The genetic relationship between virulent and temperate Streptococcus thermophilus bacteriophages: whole genome comparison of cos-site phages Sfi19 and Sfi21. (4/353)

The virulent cos-site Streptococcus thermophilus bacteriophage Sfi19 has a 37,392-bp-long genome consisting of 44 open reading frames all encoded on the same DNA strand. The genome of the temperate cos-site S. thermophilus phage Sfi21 is 3.3 kb longer (40,740 bp, 53 orfs). Both genomes are very similarly organized and differed mainly by gene deletion and DNA rearrangement events in the lysogeny module; gene replacement, duplication, and deletion events in the DNA replication module, and numerous point mutations. The level of point mutations varied from <1% (lysis and DNA replication modules) to >15% (DNA packaging and head morphogenesis modules). A dotplot analysis showed nearly a straight line over the left 25 kb of their genomes. Over the right genome half, a more variable dotplot pattern was observed. The entire lysogeny module from Sfi21 comprising 12 genes was replaced by 7 orfs in Sfi19, six showed similarity with genes from temperate pac-site S. thermophilus phages. None of the genes implicated in the establishment of the lysogenic state (integrase, superinfection immunity, repressor) or remnants of it were conserved in Sfi19, while a Cro-like repressor was detected. Downstream of the highly conserved DNA replication module 11 and 13 orfs were found in Sfi19 and phiSfi21, respectively: Two orfs from Sfi21 were replaced by a different gene and a duplication of the phage origin of replication in Sfi19; a further orf was only found in Sfi21. All other orfs from this region, which included a second putative phage repressor, were closely related between both phages. Two noncoding regions of Sfi19 showed sequence similarity to pST1, a small cryptic plasmid of S. thermophilus.  (+info)

Comparative sequence analysis of the DNA packaging, head, and tail morphogenesis modules in the temperate cos-site Streptococcus thermophilus bacteriophage Sfi21. (5/353)

The temperate Streptococcus thermophilus bacteriophage Sfi21 possesses 15-nucleotide-long cohesive ends with a 3' overhang that reconstitutes a cos-site with twofold hyphenated rotational symmetry. Over the DNA packaging, head and tail morphogenesis modules, the Sfi21 sequence predicts a gene map that is strikingly similar to that of lambdoid coliphages in the absence of any sequence similarity. A nearly one to one gene correlation was found with the phage lambda genes Nu1 to H, except for gene B-to-E complex, where the Sfi21 map resembled that of coliphage HK97. The similarity between Sfi21 and HK97 was striking: both major head proteins showed an N-terminal coiled-coil structure, the mature major head proteins started at amino acid positions 105 and 104, respectively, and both major head genes were preceded by genes encoding a possible protease and portal protein. The purported Sfi21 protease is the first viral member of the ClpP protease family. The prediction of Sfi21 gene functions by reference to the gene map of intensively investigated coliphages was experimentally confirmed for the major head and tail gene. Phage Sfi21 shows nucleotide sequence similarity with Lactococcus phage BK5-T and a lactococcal prophage and amino acid sequence similarity with the Lactobacillus phage A2 and the Staphylococcus phage PVL. PVL is a missing link that connects the portal proteins from Sfi21 and HK97 with respect to sequence similarity. These observations and database searches, which demonstrate sequence similarity between proteins of phage from gram-positive bacteria, proteobacteria, and Archaea, constrain models of phage evolution.  (+info)

Alternative mechanism of cholera toxin acquisition by Vibrio cholerae: generalized transduction of CTXPhi by bacteriophage CP-T1. (6/353)

Horizontal transfer of genes encoding virulence factors has played a central role in the evolution of many pathogenic bacteria. The unexpected discovery that the genes encoding cholera toxin (ctxAB), the main cause of the profuse secretory diarrhea characteristic of cholera, are encoded on a novel filamentous phage named CTXPhi, has resulted in a renewed interest in the potential mechanisms of transfer of virulence genes among Vibrio cholerae. We describe here an alternative mechanism of cholera toxin gene transfer into nontoxigenic V. cholerae isolates, including strains that lack both the CTXPhi receptor, the toxin coregulated pilus (TCP), and attRS, the chromosomal attachment site for CTXPhi integration. A temperature-sensitive mutant of the V. cholerae generalized transducing bacteriophage CP-T1 (CP-T1ts) was used to transfer a genetically marked derivative of the CTX prophage into four nontoxigenic V. cholerae strains, including two V. cholerae vaccine strains. We demonstrate that CTXPhi transduced by CP-T1ts can replicate and integrate into these nontoxigenic V. cholerae strains with high efficiency. In fact, CP-T1ts transduces the CTX prophage preferentially when compared with other chromosomal markers. These results reveal a potential mechanism by which CTXPhi(+) V. cholerae strains that lack the TCP receptor may have arisen. Finally, these findings indicate an additional pathway for reversion of live-attenuated V. cholerae vaccine strains.  (+info)

The IntI1 integron integrase preferentially binds single-stranded DNA of the attC site. (7/353)

IntI1 integrase is a member of the prokaryotic DNA integrase superfamily. It is responsible for mobility of antibiotic resistance cassettes found in integrons. IntI1 protein, as well as IntI1-COOH, a truncated form containing its carboxy-terminal domain, has been purified. Electrophoretic mobility shift assays were carried out to study the ability of IntI1 to bind the integrase primary target sites attI and aadA1 attC. When using double-stranded DNA as a substrate, we observed IntI1 binding to attI but not to attC. IntI1-COOH did not bind either attI or attC, indicating that the N-terminal domain of IntI1 was required for binding to double-stranded attI. On the other hand, when we used single-stranded (ss) DNA substrates, IntI1 bound strongly and specifically to ss attC DNA. Binding was strand specific, since only the bottom DNA strand was bound. Protein IntI1-COOH bound ss attC as well as did the complete integrase, indicating that the ability of the protein to bind ss aadA1 attC was contained in the region between amino acids 109 and 337 of IntI1. Binding to ss attI DNA by the integrase, but not by IntI1-COOH, was also observed and was specific for the attI bottom strand, indicating similar capabilities of IntI1 for binding attI DNA in either double-stranded or ss conformation. Footprinting analysis showed that IntI1 protected at least 40 bases of aadA1 attC against DNase I attack. The protected sequence contained two of the four previously proposed IntI1 DNA binding sites, including the crossover site. Preferential ssDNA binding can be a significant activity of IntI1 integrase, which suggests the utilization of extruded cruciforms in the reaction mechanisms leading to cassette excision and integration.  (+info)

TPW22, a lactococcal temperate phage with a site-specific integrase closely related to Streptococcus thermophilus phage integrases. (8/353)

The temperate phage TPW22, induced from Lactococcus lactis subsp. cremoris W22, and the evolutionarily interesting integrase of this phage were characterized. Phage TPW22 was propagated lytically on L. lactis subsp. cremoris 3107, which could also be lysogenized by site-specific integration. The attachment site (attP), 5'-TAAGGCGACGGTCG-3', of phage TPW22 was present on a 7.5-kb EcoRI fragment, a 3.4-kb EcoRI-HindIII fragment of which was sequenced. Sequence information revealed the presence of an integrase gene (int). The deduced amino acid sequence showed 42 and 28% identity with integrases of streptococcal and lactococcal phages, respectively. The identities with these integrase-encoding genes were 52 and 45%, respectively, at the nucleotide level. This could indicate horizontal gene transfer. A stable integration vector containing attP and int was constructed, and integration in L. lactis subsp. cremoris MG1363 was obtained. The existence of an exchangeable lactococcal phage integration module was suggested. The proposed module covers the phage attachment site, the integrase gene, and surrounding factor-independent terminator structures. The phages phiLC3, TP901-1, and TPW22 all have different versions of this module. Phylogenetically, the TPW22 Int links the phiLC3 lactococcal integrase with known Streptococcus thermophilus integrases.  (+info)

This system also uses Bak as apoptosis inducing selection marker together with the Tet-on promoter, which is to be stably integrated in the cell-line genome. However, this construct also includes an upstream bacterial attachment site (attB) and a downstream SV40 polyadenylation site (SV40PA). The target gene eGFP is combined with phage attachment site (attP) and another SV40PA but without promoter. The target plasmid is co-transfected with integrase PhiC31o into the cell line. Therefore the target gene can only be expressed if integrated into the cells genome, and the stop-codon and SV40PA following the target gene stop the expression of bak, ensuring the survival of the cell while other cells not expressing the target gene undergo induced apoptosis. For more details of the functional principle, please click: Jump-or-Die Functional Principle ...
Misc.Comments : Deposited by: Walter Messer Vector containing the attP sequence for integrating DNA into the lambda attachment site attB. Requires the lambda integrase (int) such as that provided by pLDR8 (ATCC 77357). [1] When a recombinant construct is digested with NotI, the origin is separated from the insert. Each fragment has a distinct selectable marker. After religation to form origin-free circles, the products are transformed into bacteria with pLDR8. [1] Expression of int in pLDR8 is regulated by lambda PR, by the temperature sensitive cI857 repressor. Replication of pLDR8 is also temperature sensitive. [1] Therefore, at 30C replication of the plasmid is normal and int is not expressed. At 42C, int is expressed but pLDR8 is no longer replicated, resulting in loss of int after a few cell generations. [1] The order of the major features in this plasmid is: NotI - ampR - ClaI/MCS/EcoRI - attP - NotI - pMB1 ori - tetR. [1] Restriction digests of the clone give the following sizes (kb): ...
In questa pagina sono consultabili, utilizzando il menù a sinistra, anche gli atti per i quali si è concluso il periodo di pubblicazione, con possibilità di ricerca storica più ampia per deliberazioni e determinazioni, più ridotta per tutti gli altri atti, in quanto la gestione di questi ultimi, attraverso il software di albo pretorio on line attualmente in uso, è iniziata il 2.1.2014 ...
In questa pagina sono consultabili, utilizzando il menù a sinistra, anche gli atti per i quali si è concluso il periodo di pubblicazione, con possibilità di ricerca storica più ampia per deliberazioni e determinazioni, più ridotta per tutti gli altri atti, in quanto la gestione di questi ultimi, attraverso il software di albo pretorio on line attualmente in uso, è iniziata il 2.1.2014 ...
La bohème - Chambres dhôtes, Sanlis - Rezervišite uz Garanciju najbolje cene! 327 recenzija i 28 fotografija čeka vas na veb sajtu Booking.com.
Recombination directionality factors (RDFs), or excisionases, are essential players of prophage excisive recombination. Despite the essentially catalytic role of the integrase in both integrative and excisive recombination, RDFs are required to direct the reaction towards excision and to prevent re-integration of the prophage genome when entering a lytic cycle. KplE1, HK620 and numerous (pro)phages that integrate at the same site in enterobacteria genomes (such as the argW tRNA gene) all share a highly conserved recombination module. This module comprises the attL and attR recombination sites and the RDF and integrase genes. The KplE1 RDF was named TorI after its initial identification as a negative regulator of the tor operon. However, it was characterized as an essential factor of excisive recombination. In this study, we designed an extensive random mutagenesis protocol of the torI gene and identified key residues involved in both functions of the TorI protein. We show that, in addition to TorI-TorR
Serine integrases are bacteriophage proteins responsible for integrating the phage genome into that of the host. Synthetic biologists have co-opted these proteins into useful tools for permanent DNA logic, utilizing their specific DNA recombination abilities to build synthetic cell differentiation and genetic memory systems. Each integrase has a specific pair of DNA sequences (attP/attB sites) that it recombines, but multiple identical sites can result in unpredictable recombination. We have developed a way to control integrase activity on identical attP/attB sites by using catalytically dead Cas9 (dCas9) as a programmable binding protein that can compete with integrase for binding to specific attachment sites. Utilizing a plasmid that contains two identical Bxb1 attP sites, integration can be repressed up to 8 fold at either one of the two attP sites when guide RNA and dCas9 are present. Guide RNA sequences that bind specifically to attB, or either of two attP sites, have been developed. Future ...
pPL2 was constructed by replacing the U153 listeriophage integrase gene and attachment site in pPL1 with the PSA listeriophage integrase gene and attachment site. pPL2 was transformed into SM10, and the resulting strain was mated into 10403S, EGDe (carrying a streptomycin resistance mutation), and the serotype 4b strain DP-L4088. Chloramphenicol-resistant transconjugants arose from each of these crosses at approximately 10−4 per donor cell, the same rate as pPL1 integration. Two recombinants from each cross were restreaked under drug selection and tested by PCR for the presence of PSA-attBP′ with primers NC16 and PL95 (Fig. 2D). The expected 499-bp PCR product was obtained in each of the colonies tested, indicating that pPL2 integrates into tRNAArg-attBB′ in both serotype 1/2 and 4b strains.. We tested the stability of the integrated pPL2 in both EGDe and DP-L4088 strains with the same nonselective 100-generation experiment described for pPL1. Forty-nine colonies from each of the amplified ...
Get this from a library! La Lokapaññatti et les idées cosmologiques du bouddhisme ancien. [Saddhammaghōsa, Thera.; Eugène Denis]
A 37-year-old once described as the worlds fattest woman has died in hospital, officials have said. Eman Abdul Atti died as a result of heart disease and kidney dysfunction according...
rot1 .description).animate({bottom:-270px},500,easeOutCirc,function(){ $(p,$(this)).html(info_elem.find(.info_description).html()); $(this).animate({bottom:0px},400,easeInOutQuad); }); if(parseInt(info_elem.find(.info_image).html())==1){ $(#rot1).prepend( $(,img/,,{ style : opacity:0, className : bg }).load( function(){ $(this).animate({opacity:1},600); $(#rot1 img:first).next().animate({opacity:0},700,function(){ $(this).remove(); }); } ).attr(src,http://openwetware.org/images/d/d6/Hkbutest1.jpg).attr(width,800).attr(height,300) ); } else if(parseInt(info_elem.find(.info_image).html())==2){ $(#rot1).prepend( $(,img/,,{ style : opacity:0, className : bg }).load( function(){ $(this).animate({opacity:1},600); $(#rot1 img:first).next().animate({opacity:0},700,function(){ $(this).remove(); }); } ).attr(src,http://openwetware.org/images/5/59/Hkbutest2.jpg).attr(width,800).attr(height,300) ); } else ...
Expresses the p65 activation domain under the control of sequences in/near CR4575 (FBgn0029920) and the GAL4 DNA binding domain under the control of sequences in/near chinmo (FBgn0086758). Janelia line OL0087B. Homozygotes may be present ...
Expresses the p65 activation domain under the control of sequences in/near Prat2 (FBgn0041194) and the GAL4 DNA binding domain under the control of sequences in/near Dop1R1 (FBgn0011582). Janelia line MB630B ...
design g1.s g1.c g2.s g2.c g3.s g3.c g4.s g4.c g5.s g5.c 1 1 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 4 0 1 0 0 0 0 0 0 0 0 5 0 1 0 0 0 0 0 0 0 0 6 0 1 0 0 0 0 0 0 0 0 7 0 0 1 0 0 0 0 0 0 0 8 0 0 1 0 0 0 0 0 0 0 9 0 0 1 0 0 0 0 0 0 0 10 0 0 0 1 0 0 0 0 0 0 11 0 0 0 1 0 0 0 0 0 0 12 0 0 0 1 0 0 0 0 0 0 13 0 0 0 0 1 0 0 0 0 0 14 0 0 0 0 1 0 0 0 0 0 15 0 0 0 0 1 0 0 0 0 0 16 0 0 0 0 0 1 0 0 0 0 17 0 0 0 0 0 1 0 0 0 0 18 0 0 0 0 0 1 0 0 0 0 19 0 0 0 0 0 0 1 0 0 0 20 0 0 0 0 0 0 1 0 0 0 21 0 0 0 0 0 0 1 0 0 0 22 0 0 0 0 0 0 0 1 0 0 23 0 0 0 0 0 0 0 1 0 0 24 0 0 0 0 0 0 0 1 0 0 25 0 0 0 0 0 0 0 0 1 0 26 0 0 0 0 0 0 0 0 1 0 27 0 0 0 0 0 0 0 0 1 0 28 0 0 0 0 0 0 0 0 0 1 29 0 0 0 0 0 0 0 0 0 1 30 0 0 0 0 0 0 0 0 0 1 attr(,assign) [1] 1 1 1 1 1 1 1 1 1 1 attr(,contrasts) attr(,contrasts)$factors [1] contr.treatment ...
Ah yeah. I missed that. If I dont use cross_match correctly I can miss large inverted repeats: 214 1.26 0.00 0.00 pDONR222 359 597 (4121) C pDONR222 (1943) 2775 2537 * C pDONR222 597 GTCGACTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTG 548 pDONR222 2537 GTCGACTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTG 2586 C pDONR222 547 GATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCT 498 pDONR222 2587 GATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCT 2636 C pDONR222 497 AATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTT 448 i pDONR222 2637 AATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTC 2686 C pDONR222 447 TTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAA 398 i i pDONR222 2687 TTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAA 2736 C pDONR222 397 CGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG 359 pDONR222 2737 CGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG 2775 If the attP1 and attP2 sites are still there after you move your fragment of interest, then one issue would be you would need to sequence past 200+ bases of ...
Plasmid 251 pTol2Dest from Dr. Nathan Lawsons lab contains the insert attR1/attR2 cassette and is published in Dev Dyn. 2007 Nov . 236(11):3077-87. This plasmid is available through Addgene.
The difference between attributes and properties can be important in specific situations. Before jQuery 1.6, the .attr() method sometimes took property values into account when retrieving some attributes, which could cause inconsistent behavior. As of jQuery 1.6, the .prop() method provides a way to explicitly retrieve property values, while .attr() retrieves attributes.. ...
Plasmid pDsRed-attP from Dr. Kate OConnor-Giless lab contains the inserts attP and LoxP-3xP3-DsRed-LoxP and is published in Unpublished This plasmid is available through Addgene.
pSAM2 is an 11-kb plasmid integrated in the Streptomyces ambofaciens ATCC23877 and ATCC15154 genomes and found additionally as a free replicon in an uv derivative. After transfer into S. ambofaciens DSM40697 (devoid of pSAM2) or into Streptomyces lividans, specific integration of pSAM2 occurred very efficiently. A 58-bp sequence (att) present in both pSAM2 (attP) and S. ambofaciens strain DSM40697 (attB) attachment regions is found at the boundaries (attL and attR) of integrated pSAM2 in S. ambofaciens strain ATCC23877. The S. lividans chromosomal integration zone contained an imperfectly conserved att sequence (attB), and the integration event of pSAM2 was located within a 49-bp sequence of attB. Only one primary functional attB sequence was present in the S. lividans or S. ambofaciens DSM40697 total DNA. The integration zone of S. lividans hybridized with the integration zone of S. ambofaciens DSM40697. The two integration zones were homologous only to the right side of the att sequence. The conserved
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage PhiC31. Host strains expressing the PhiC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri PmcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strains that express the tetRgene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR-regulated essential genes becomes tetracycline-dependent. A series of plasmid ...
To promote integration, Bacteriophage λ wants to make the int protein and not xis protein. mRNA transcribed from Pi has an ATG for translation of int protein, not xis. The integration of phage λ takes place at a special attachment site in the bacterial genome, called attλ. The sequence of the att site is called attB and consists of the parts B-O-B, whereas the complementary sequence in the circular phage genome is called attP and consists of the parts P-O-P. The integration itself is a sequential exchange (see genetic recombination) via a Holliday structure and requires both the phage protein int and the bacterial protein IHF (integration host factor). Both int and IHF bind to attP and built an intrasome, a DNA-protein-complex designed for site-specific recombination of the phage and host DNA. The original BOB secuanes is changed by the integration to B-O-P-phage DNA-P-O-B. The phage DNA is now part of the hosts genome ...
296129088 - EP 0974666 A1 20000126 - METHODS FOR TRANSFERRING GENE INTO CHROMOSOME - Method for transferring a foreign gene into a host chromosome by contrived procedures to integrate the foreign gene into a vector by utilizing a lysogenic phage, for the purpose of deleting unnecessary genes derived from the vector or the like, except for the foreign gene. One of the inventive method comprises: a first step for preparing a vector with a lysogenic phage integration site (attP site) arranged between a first partial sequence of the objective foreign gene to be transferred but lacking one terminal region thereof and a second partial sequence of the gene but lacking the other terminal region and having an overlapping region with a portion of the first partial sequence; a second step for integrating the vector obtained in the first step into the host chromosome; and a third step for screening from among the recombinants obtained in the second step a recombinant from which unnecessary genes originating in the
my MyClass $slr :Good :Bad(1**1-1) :Omni(-vorous); MyClass::Good:ATTR(SCALAR)( MyClass, # class LEXICAL, # no typeglob \$slr, # referent Good, # attr name undef # no attr data CHECK, # compiler phase ); MyClass::Bad:ATTR(SCALAR)( MyClass, # class LEXICAL, # no typeglob \$slr, # referent Bad, # attr name 0 # evald attr data CHECK, # compiler phase ); MyClass::Omni:ATTR(SCALAR)( MyClass, # class LEXICAL, # no typeglob \$slr, # referent Omni, # attr name -vorous # evald attr data CHECK, # compiler phase ); # sub fn :Ugly(sister) :Omni(po,tent()) {...} MyClass::UGLY:ATTR(CODE)( SomeOtherClass, # class \*SomeOtherClass::fn, # typeglob \&SomeOtherClass::fn, # referent Ugly, # attr name sister # evald attr data CHECK, # compiler phase ); MyClass::Omni:ATTR(CODE)( SomeOtherClass, # class \*SomeOtherClass::fn, # typeglob \&SomeOtherClass::fn, # referent Omni, # attr name [po,acle] # evald attr data CHECK, # compiler phase ); # my @arr :Good ...
However, a limitation of this approach is the requirement of genomic libraries in any sequenced species in order to test regions of interest for regulatory activity. Furthermore, the sizes of these libraries need to be relatively small (~20 kb) for efficient integration into the genome using the phiC31 integrase system.. The investment required to generate such libraries is estimably large and could pose a signficant hurdle for use of such an application.. Another caveat is that positive clones need to be further characterized to identify the minimal enhancer fragment(s).. This method also does not inform us of the presence of multiple enhancers in a clone that is being tested.. Nevertheless, for those species where this method is feasible, complementing this assay with computational enhancer discovery methods and/or epigenetic/chromatin profiling methods to zero in on the minimal regulatory regions will greatly aid in the rapid identification and annotation of these critical components of the ...
Heading abaqus_spec.Heading.COMMENT{1}=Job name: AORTA; %%--, Preprint abaqus_spec.Preprint.ATTR.echo=NO; abaqus_spec.Preprint.ATTR.model=NO; abaqus_spec.Preprint.ATTR.history=NO; abaqus_spec.Preprint.ATTR.contact=NO; %--, Part % Node nodeIds=(1:1:size(VT,1)); abaqus_spec.Part.COMMENT=This section defines the part geometry in terms of nodes and elements; abaqus_spec.Part.ATTR.name=Aorta; abaqus_spec.Part.Node={nodeIds,VT}; % Element elementIds=(1:1:size(ET,1)); abaqus_spec.Part.Element{1}.ATTR.type=C3D8; abaqus_spec.Part.Element{1}.VAL={elementIds,ET}; % Element sets for q=1:1:numMaterials elementIdsSetNow=find(C_ET_path_mat_index==q); abaqus_spec.Part.Elset{q}.ATTR.elset=[MatSet-,num2str(q)]; abaqus_spec.Part.Elset{q}.VAL=elementIdsSetNow; end surfaceElementSetName=elementSetInnerSurface; abaqus_spec.Part.Elset{numMaterials+1}.ATTR.elset=surfaceElementSetName; abaqus_spec.Part.Elset{numMaterials+1}.ATTR.internal=; %Remains hidden uppon import ...
unsigned int attr; if ( !_dos_getfileattr(FOO.DAT, &attr) ) { puts(FOO.DAT attributes are:); if ( attr & _A_ARCH ) puts(Archive); if ( attr & _A_RDONLY ) puts(Read only); if ( attr & _A_HIDDEN ) puts(Hidden); if ( attr & _A_SYSTEM ) puts(Is it part of DOS ?); if ( attr & _A_VOLID ) puts(Volume ID); if ( attr & _A_SUBDIR ) puts(Directory); } else puts(Unable to get FOO.DAT attributes ...
Poaceae Caruel Atti della Reale Accademia dei Lincei, Memorie di Classe di Scienze, Fisiche, Matematiche e Naturale, ser. 3, 10: 187, 191, 247. 1881. (5 Jun 1881) (Atti Reale Accad. Lincei, Mem. Cl. Sci. Fis., ser. 3, ...
G. Camporeale, La città murata in Etruria: Atti del XXV Convegno di studi etruschi ed italici, Chianciano Terme, Sarteano, Chiusi, 30 marzo - 3 aprile 2005: in memoria di Massimo Pallottino. Atti di convegni / Istituto nazionale di studi etruschi ed italici; 25. Pisa/Roma: Fabrizio Serra Editore, 2008. Pp. 538. ISBN 9788862270267. €960.00 (pb).
php namespace App\Widgets; class TextWidget extends \WP_Widget { public function __construct() { $widgetOpts = array( classname =, widget_text, description =, __(Um texto puro qualquer.), customize_selective_refresh =, true, ); parent::__construct(custom_text, __(Texto puro), $widgetOpts); } public static function init() { add_action(widgets_init, function() { register_widget(self::class); }); } public function widget($args, $instance) { echo esc_html__($instance[content], text_domain); } public function form($instance) { $instance = wp_parse_args( (array) $instance, [content =, ] ); ?, ,p, ,textarea class=widefat id=,?php echo esc_attr($this-,get_field_id(content)); ?, name=,?php echo esc_attr($this-,get_field_name(content)); ?, type=text cols=30 rows=10 ,,?php echo esc_attr($instance[content]); ?,,/textarea, ,/p, ,?php } public function update($newInstance, $oldInstance) { $instance = array(); $instance[content] = (!empty( $newInstance[content])) ? ...
shapes: The shape of each component in a value. The length of this attr must be either 0 or the same as the length of component_types. If the length of this attr is 0, the shapes of queue elements are not constrained, and only one element may be dequeued at a time ...
smj: hr. hr. hr+ABBR+Acc cand.philol. cand.philol. cand.philol+ABBR+N+Acc Per Per Per+N+Prop+Mal+Sg+Attr sme: hr. hr. hr+N+ABBR+Acc Per Per Per+N+Prop+Mal+Sg+Attr ...
[HarderFaster] - Work Hard, Play Harder! news, reviews, photos, features, discussion forums, dj profiles, venues and the most up to date whats on guide available.
Forskare i Cederträ-Sinaien Samuel Oschin som Omfattande Cancer Instiftar upptäckt i pre-kliniskt, modellerar att dormant prostatacancerceller som finnas i bensilkespapper kan reawakeneds och att
$(document).ready(function() { $(.tabLink).each(function(){ $(this).click(function(){ tabeId = $(this).attr(id); $(.tabLink).removeClass(active...
If the regions total score is less than 70, it is marked as incomplete; if between 70 to 90, it is marked as questionable; if greater than 90, it is marked as intact ...
För att uppmärksamma att Sveriges diplomatiska relationer med Japan firar 150 år under 2018 genomförs en särskild utlysning i samarbete mellan STINT och Riksbankens Jubileumsfond (RJ).. ...
Following the theme of the past two days, there should be a tenuously related rock-n-roll quote here, but as yesterday was the first real day of att
Deletion of individual antibiotic resistance genes found within the variable region of integrons is demonstrated. Evidence for gene duplications and rearrangements resulting from the insertion of gene units at new locations is also presented. Deletion, duplication, and rearrangement occur only in the presence of the integron-encoded DNA integrase. These events are precise and involve loss or gain of one or more complete insert units or gene cassettes. This confirms the recent definition of gene cassettes as consisting of the gene coding sequences, all except the last 7 bases of the 59-base element found at the 3 end of the gene, and the core site located 5 to the gene (Hall et al., Mol. Microbiol. 5:1941-1959, 1991) and demonstrates that individual gene cassettes are functional units which can be independently mobilized. Both deletions and duplications can be generated by integrase-mediated cointegrate formation followed by integrase-mediated resolution involving a different pair of sites. ...
One of the disadvantages of circular plasmids and chromosomes is their high sensitivity to rearrangements caused by homologous recombination. Odd numbers of crossing-over occurring during or after replication of a circular replicon result in the formation of a dimeric molecule in which the two copies of the replicon are fused. If they are not converted back to monomers, the dimers of replicons may fail to correctly segregate at the time of cell division. Resolution of multimeric forms of circular plasmids and chromosomes is mediated by site-specific recombination, and the enzymes that catalyze this type of reaction fall into two families of proteins: the serine and tyrosine recombinase families. Here we give an overview of the variety of site-specific resolution systems found on circular plasmids and chromosomes.
Genetic element Φ1207.3 (formerly Tn1207.3) is a prophage of Streptococcus pyogenes which carries the macrolide efflux resistance genes mef(A)/msr(D) and is capable of conjugal transfer among streptococci. Complete nucleotide sequence showed that Φ1207.3 is 52,491 bp in length and contained 58 open reading frames (ORFs). A manual homology-based annotation with functional prediction of the hypothetical gene product was possible only for 34 out of 58 ORFs. Φ1207.3 codes for two different C-methylation systems, several phage structural genes, a lysis cassette (composed by a holin and a peptidoglycan hydrolase), and three site-specific resolvases of the serine recombinase family ...
The sec_rgy_attr_test_and_update() routine updates an attribute only if the set of control attributes specified in the test_attrs match attributes that already exist for the object. This update is an atomic operation: if any of the control attributes do not match existing attributes, none of the updates are performed, and if an update should be performed, but the write cannot occur for whatever reason to any member of the update_attrs array, all updates are aborted. The attribute causing the update to fail is identified in failure_index. If the failure cannot be attributed to a given attribute, failure_index contains -1. If an attribute instance already exists which is identical in both attr_id and attr_value to an attribute specified in in_attrs, the existing attribute information is overwritten by the new information. For multi-valued attributes, every instance with the same attr_id is overwritten with the supplied values. If an attribute instance does not exist, it is created. If you specify ...
subject:1450510 title:Assignment of O-Glycan Attachment Sites to the Hinge-like Regions of Human Lysosomal Membrane Glycoproteins Lamp-1 and Lamp-2 author:Carlsson، نويسنده , , S.R. and Lycksell، نويسنده , , P.O. and Fukuda، نويسنده , , M.، نويسنده ,
var board = JXG.JSXGraph.initBoard(jxgbox,{boundingbox:[-5,5,5,-5]}); var A = [], s = [], B = [], c = [], r = [], k; var attA = {name:,strokeColor: #7355ff, fillColor: #7355ff}; A[0] = board.create(point, [2.5, -3], attA); A[1] = board.create(point, [2, 4], attA); A[2] = board.create(point, [-2.5, 3], attA); A[3] = board.create(point, [-4, -2], attA); A[4] = board.create(point, [0, -4], attA); for (k = 0; k , 5; k++) { s[k] = board.create(segment,[A[k], A[(k + 2) % 5]],{strokeColor:blue,strokeWidth:1}); } var attB = {name: , strokeColor: #EA0000, fillColor: #EA0000}; for (k = 0; k , 5; k++) { B[k] = board.create(intersection, [s[k], s[(k-1+5)%5], 0], attB); } var attC = {strokeColor: #aaaaaa, strokeWidth: 1}; for (k = 0; k , 5; k++) { c[k] = board.create(circle, [A[k], B[k], A[(k+1)%5]], attC); } var attR = {strokeColor: #ff0000, strokeWidth: 2}; for (k = 0; k , 5; k++) { r[k] = board.create(radicalaxis, [c[k], c[(k-1+5)%5]], attR); } ...
var board = JXG.JSXGraph.initBoard(jxgbox,{boundingbox:[-5,5,5,-5]}); var A = [], s = [], B = [], c = [], r = [], k; var attA = {name:,strokeColor: #7355ff, fillColor: #7355ff}; A[0] = board.create(point, [2.5, -3], attA); A[1] = board.create(point, [2, 4], attA); A[2] = board.create(point, [-2.5, 3], attA); A[3] = board.create(point, [-4, -2], attA); A[4] = board.create(point, [0, -4], attA); for (k = 0; k , 5; k++) { s[k] = board.create(segment,[A[k], A[(k + 2) % 5]],{strokeColor:blue,strokeWidth:1}); } var attB = {name: , strokeColor: #EA0000, fillColor: #EA0000}; for (k = 0; k , 5; k++) { B[k] = board.create(intersection, [s[k], s[(k-1+5)%5], 0], attB); } var attC = {strokeColor: #aaaaaa, strokeWidth: 1}; for (k = 0; k , 5; k++) { c[k] = board.create(circle, [A[k], B[k], A[(k+1)%5]], attC); } var attR = {strokeColor: #ff0000, strokeWidth: 2}; for (k = 0; k , 5; k++) { r[k] = board.create(radicalaxis, [c[k], c[(k-1+5)%5]], attR); } ...
The sec_rgy_attr_sch_update_entry() routine modifies schema entries. Only those schema entry fields set to be modified in the sec_attr_schema_entry_parts_t data type can be modified. Some schema entry components can never be modified. Instead to make any changes to these components, the schema entry must be deleted (which deletes all attribute instances of that type) and recreated. The schema entry components that can never be modified are listed below: ...
2019 ProCure Proton Terapiya Mərkəzi. Bütün hüquqlar qorunur. Məzmunu və proqramları da daxil olmaqla ProCure üçün veb sayt yalnız məlumat və maarifləndirmə məqsədi ilə təmin edilmişdir. Bu tibbi məsləhət kimi nəzərdə tutulmur və hər hansı bir həkim-xəstə və ya klinik əlaqələr yaratmaq üçün nəzərdə tutulmur. Bu məlumat səhiyyə təminatçınızla məsləhətləşmənin əvəzi deyil. Bu veb saytdakı fikir və rəylər mütləq ProCure-ni əks etdirmir. ProCure, ən geniş auditoriya üçün əlçatan bir veb sayt təqdim etməyə sadiqdir. Bu işdə kömək etmək üçün bir dil tərcüməçisi vasitəsi mövcuddur. ProCure İngilis dilindən səhv və yanlış hesab edilə bilən tərcümələrə görə məsuliyyət daşımır. Zəhmət olmasa bir tərcüməçini təyin etmək üçün birbaşa və ya həkiminizlə əlaqə saxlayın. Bu veb saytdan istifadə etməklə İstifadə şərtlərini qəbul edirsiniz. Zəhmət olmasa Gizlilik ...
Studiens syfte var att undersöka erfarenheter hos psykoterapeuter inom psykiatrin av att bedriva KBT med patienter som samtidigt lever med kronisk och/eller allvarlig somatisk sjukdom. Detta utifrån frågeställningar om hur KBT-terapeuter beskriver hur samtidig allvarlig och/eller kronisk somatisk sjukdom påverkar det terapeutiska arbetet och hur terapeuterna förhåller sig till denna påverkan i relation till att genomföra terapin? Semistrukturerade intervjuer genomfördes med sex psykoterapeuter som alla hade KBT-inriktning och arbetade inom psykiatrin. En tematisk analys gjordes sedan av intervjuerna och där framkom huvudteman som följsamhet, helhetssyn och organisatorisk påverkan. Följsamhet till patienternas behov av anpassning gällde allt från längden på sessionerna till möjligheten att pausa terapin under vissa perioder. Att ha en helhetssyn kunde innebära att psykoterapeuten klev utanför sitt expertområde för att samarbeta med den somatiska vården kring en patient, ...
Note: Ai sensi e per gli effetti dellArt. 76 D.P.R. 445/2000 consapevole della responsabilità e delle conseguenze civili e penali previste in caso di dichiarazioni mendaci e/o formazione od uso di atti falsi, nonché in caso di esibizione atti contenenti dati non più corrispondenti a verità e consapevole altresì che qualora emerga la non veridicità del contenuto della presente decadranno i benefici per i quali la stessa è rilasciata confermo di essere un OPERATORE SANITARIO.. I contenuti presenti in questo sito contengono informazioni rivolte agli operatori sanitari, in quanto si riferiscono a prodotti rientranti nella categoria dei dispositivi medici che richiedono limpiego o lintervento da parte di professionisti del settore medico-sanitario.. ...
Kabar Gembira!!!. Sekarang Lab PT Ganesha Inti Persada sudah ter-Akreditrasi oleh KAN dengan No. Akreditasi LK-302-IDN .. Yang berminat untuk mengkalibrasi Massa dan Suhu silahkan menghubungi kami.. Contact Person.. Email : [email protected] Telephone : 021-2283 0080. WhatsApp/SMS : 0811 996 1224. ...
Syftet med denna studie är att undersöka vilket stöd ensamkommande barn behöver vid ankomsten till Sverige utifrån personalens erfarenhet. Metoden är en kvalitativ studie som baseras utifrån intervjuer och litteraturkunskap för att få mer ingående och friare svar från intervjupersonerna. Huvudteman som framkom under intervjuerna är grundläggande behov, stödet som erbjuds, trygghet, föräldragestalter, utbildning, fritid och hinder i arbetet. Samtliga intervjupersoner beskriver ungdomarnas behov mycket olika då det skiljer sig från person till person. Det stöd barnen får är den viktigaste faktor som de ensamkommande barnen behöver för att kunna utvecklas och få ett bättre och tryggare liv. Resultatet visar att personalen har vetskap om all den kunskap som behövs för att kunna vara en bra förebild och en stödjande vuxen i barnens vardag. Det framkom tydligt hur relationen och tryggheten för de ensamkommande barnen är avgörande och ...
Bakgrund: Bipolär sjukdom innebär perioder av mani och depressioner vilket kan medföra svårigheter för personer som drabbats. För att kunna förstå och hjälpa dessa personer behöver sjukvårdspersonal kunskap om hur sjukdomen upplevs och hanteras. Syfte: att belysa hur personer med bipolär sjukdom upplever och hanterar sin sjukdom. Metod: En allmän litteraturstudie genomfördes med kvalitativa artiklar. Resultat: Personernas inställning till diagnosen och behandling varierade och relationen till sjukvårdspersonalen var betydelsefull. Svårigheterna att hantera och bemöta sjukdomen orsakade känslor av osäkerhet, okontrollerbarhet och instabilitet. Sjukdomen påverkade självförtroendet och självkänslan och orsakade upplevd stigmatisering och problem i relationer. För att kunna hantera bipolär sjukdom krävdes egen acceptans, kunskap och insikt, struktur i vardagen samt stöd från närstående. Diskussion: Resultaten diskuteras utifrån Antonovskys teori om känsla av ...
Most diaphanopterodeans trend forex system wave the message sinks in, atti Finland , forex investment paypal, recursive algorithm convert decimal to binary code
a3 Item Manager a3 Item Manager är en komplett och flexibel produkt för att hantera artiklar och artikelinformation. Produkten ger möjlighet att skapa och underhålla gemensam artikeldata både internt och externt hos kunder och leverantörer. Accure har som mål att kunna effektivisera och förenkla hanteringen runt artiklar. Nyttan med detta är att kunna göra smidigare och mer löns ...
INT11兔多克隆抗体(ab75276)可与小鼠, 人样本反应并经WB, IP, IHC实验严格验证,被2篇文献引用。所有产品均提供质保服务,中国75%以上现货。
ここはラグナロクオンラインのフェンリル鯖にて活動しているINT商人しろっくまの日常と中の人の平穏を日々綴っているブログです。 INT商人考察あります。
Här presenteras avhandlingar inom svensk kärlkirurgi.. Listan är endast påbörjad, och en ständig komplettering kommer att pågå.. Sänd bidrag till webmaster!. ...
Heraclià Bruniquer sintagma cofassis cabrafigant desatendés serrat autocompadís prevenia entaulelli encorbàreu mioles disserten alicatats calivoses miraries caplletràveu revel·lisquen menejats parifiquéssem regolfessin desesperancessis encoratjats encebàs [email protected] ...
But many questions remain - including whether this recognition to parts of SARS-CoV-2 by T cells helps or hurts.. Would these memory T cells be helpful for protecting you against Covid-19 disease, thats the huge question, said Crotty. We dont know if [the T cells] are helpful or not, but we think its reasonable to speculate that they may be helpful. Its not that we think they would completely protect against any infection at all, but if you already have some cells around, they can fight the virus faster and so its plausible that instead of ending up in the ICU, you dont. And instead of ending up in the hospital, you just end up with a bad cold.. Other researchers are also intrigued by the possibilities put forth by this discovery.. Dr. Arturo Casadevall told CNN his first thought was Not surprising, important, good to know. Casadevall chairs the department of molecular microbiology and immunology at the Johns Hopkins School of Public Health.. Because these coronaviruses are all ...
Microbiological testing was shown to improve the prognostic features compared to recording bleeding on probing alone as this ... Increased levels of bleeding on probing was present at 67% of sites where there is peri-implant mucositis as it is indicative ... Increased probing depths over time is linked to loss of attachment and a reduction in the supporting alveolar bone levels. When ... This is especially true with respect to their surrounding tissues and biological attachment. The diagnosis of peri-implant ...
An adhesive basal element at one end of the filament can aid attachment to solid surfaces. The sheath offers some protection ... Individual mature cells swarm out of the protective tube to colonize new sites. Each motile mature cell has an intertwined ... Van Veen, WL; Mulder, EG; Deinema, MH (1978). "The Sphaerotilus-Leptothrix group of bacteria". Microbiological Reviews. 42 (2 ...
Cysts never form, so transmission from one host to another is always based on direct contact between the sites they occupy. ... "Movement symbiosis". www.microbiological-garden.net. Retrieved 27 May 2019. Rosenberg, Eugene; Gophna, Uri (30 August 2011). ... attachment and cyst formation". Eur. J. Protistol. 43 (4): 281-94. doi:10.1016/j.ejop.2007.06.004. PMID 17764914. Brugerolle G ... "Movement symbiosis2". www.microbiological-garden.net. Retrieved 27 May 2019. König, Helmut (2006). Intestinal Microorganisms of ...
The bacterial attachment site (attB) has a 96 base pair sequence homologous to the phage attachment site and is located at the ... Microbiological Research. 156 (1): 35-40. doi:10.1078/0944-5013-00087. PMID 11372651. S. Atsumi; J. W. Little (2006). "Role of ... The phage integrase gene (int) and the phage attachment site (attp) are located just upstream of the speA gene in the phage ... And finally, in 1997, McShan and Ferretti published that they had found the second attachment site (attR) for T12, while also ...
The direct attachment of the messenger to the antibody reduces the number of steps in the procedure, saving time and reducing ... Antigenic material must be fixed firmly on the site of its natural localization inside the cell. Intact antibodies can also be ... is a technique used for light microscopy with a fluorescence microscope and is used primarily on microbiological samples. This ...
the site of the ulcer is studied and marked in case sheet.the edge of the ulcer is studied.whether satellite lesion is present ... Microbiological culture tests may be necessary to isolate the causative organisms for some cases. Other tests that may be ... They are believed to be caused by a defect in the basement membrane and a lack of hemidesmosomal attachments. They are ... https://www.aao.org/eye-health/diseases/corneal-ulcer https://www.merckmanuals.com/home/eye-disorders/corneal-disorders/corneal ...
It may cause injury to the respiratory epithelial cell after its attachment. The injury of host epithelial cells caused by M. ... Microbiological Reviews. 58: 686-699. PMC 372987. PMID 7854252. Pasternak, Y. "Mycoplasma pneumoniae". Microbe Wiki. Retrieved ... a process that could potentially alter receptor recognition sites and affect cytokine induction and expression. As stated by ...
"Microbiological Reviews. 55 (4): 543-60. PMC 372837. PMID 1779926.. *^ Voelker DR (July 2005). "Bridging gaps in phospholipid ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... Other proteins on the plasma membrane allow attachment to the cytoskeleton and extracellular matrix; a function that maintains ... Levine T, Loewen C (August 2006). "Inter-organelle membrane contact sites: through a glass, darkly". Current Opinion in Cell ...
"Microbiological Reviews. 58: 94-144. doi:10.1128/mmbr.58.1.94-144.1994. PMC 372955. PMID 8177173.. ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... Membrane proteins serving as receptors are sometimes tagged for downregulation by the attachment of ubiquitin. After arriving ... "Microbiological Reviews. 58 (1): 94-144. doi:10.1128/mmbr.58.1.94-144.1994. PMC 372955. PMID 8177173.. .mw-parser-output cite. ...
By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... The marburg virus life cycle begins with virion attachment to specific cell-surface receptors, followed by fusion of the virion ... "Biosafety in Microbiological and Biomedical Laboratories (BMBL) 5th Edition". Retrieved 2011-10-16.. ... The mean evolutionary rate of the whole genome was 3.3 × 10−4 substitutions/site/year (credibility interval 2.0-4.8).The ...
Arestin, a popular site specific brand of the antibiotic minocycline, is claimed to enable regaining of at least 1 mm of ... Gingival attachment begins to loosen further as the bacterial plaque continues to invade the space created by the swelling it ... partial-mouth disinfection in the treatment of periodontal infections: short-term clinical and microbiological observations". ... Site specific antibiotics may also be placed in the periodontal pocket following scaling and root planing in order to provide ...
"The Earth Life Web, Growth and Development in Lichens". earthlife.net. Silliman B. R. & S. Y. Newell (2003). "Fungal farming in ... CABI, 2008 Hyde, K.D.; E.B.J. Jones (1989). "Spore attachment in marine fungi". Botanica Marina. 32 (3): 205-218. doi:10.1515/ ... Cavalier-Smith T (December 1993). "Kingdom protozoa and its 18 phyla". Microbiological Reviews. 57 (4): 953-94. doi:10.1128/ ... They form the base of the primary production that drives the ocean food web, and account for half of the current global primary ...
... pockets are sites where the attachment has been gradually destroyed by collagen-destroying enzymes, known as collagenases) ... or specific microbiological profile, can benefit more from this adjunctive therapy." Chemical antimicrobials may be used by the ... With type 2 diabetes patients being shown to have 3.8 times more bone loss and 2.8 times more clinical attachment loss than non ... The cumulative effects of alveolar bone loss, attachment loss and pocket formation is more apparent with an increase in age. ...
This attachment is mediated by the phage's receptor binding protein (RBP), which recognizes and binds to a receptor on the ... See the NCBI webpage on Lactobacillales Data extracted from "NCBI Taxonomy Browser". National Center for Biotechnology ... 2004). Lactic Acid Bacteria: Microbiological and Functional Aspects (3rd ed.). New York: Marcel Dekker, Inc. ISBN 978-0-8247- ... The first contact between an infecting phage and its bacterial host is the attachment of the phage to the host cell. ...
The site currently contains all of the T. vaginalis sequence project data, several EST libraries, and tools for data mining and ... The axostyle may be used for attachment to surfaces and may also cause the tissue damage seen in trichomoniasis infections. The ... Petrin D, Delgaty K, Bhatt R, Garber G (April 1998). "Clinical and microbiological aspects of Trichomonas vaginalis". Clin. ... TrichDB: the Trichomonas vaginalis genome resource NIH site on trichomoniasis. Taxonomy eMedicine article on trichomoniasis. ...
This side of the glass sensor chip can be modified in a number of ways, to allow easy attachment of molecules of interest. ... The integration of the fluorophore must be done in a site where it is sensitive to the binding of the analyte without ... vitamin B12 and pantothenic acid as an alternative to microbiological assay, determination of drug residues in food, such as ... The residues that form the binding site for a given antigen, are selected among the hypervariable residues. It is possible to ...
There are kits and serums commercially available for this assay (e.g. The Binding Site Inc.). TEM is a specialized type of ... This assay is based on a microbiological method conducted in petri dishes or multi-well plates. Specifically, a confluent ... In this variation, serum antibodies to the influenza virus will interfere with the virus attachment to red blood cells. ...
GAP brings about attachment loss involving more than 30% of sites on teeth;[1] effectively being at least three permanent teeth ... "Use and interpretation of microbiological assays in periodontal diseases". Oral Microbiology and Immunology. 1 (1): 73-81. ... LAP is localised to first molar or incisor interproximal attachment loss, whereas GAP is the interproximal attachment loss ... Episodic nature of attachment loss: Two main tissue responses have been found in GAP cases:[31] *Tissue may have severe acute ...
"Biosafety in Microbiological and Biomedical Laboratories (BMBL) 5th Edition". Retrieved 2011-10-16. US National Institutes of ... The filovirus life cycle begins with virion attachment to specific cell-surface receptors, followed by fusion of the virion ... The family Filoviridae (/ˌfaɪloʊˈvɪrɪdiː/), a member of the order Mononegavirales, is the taxonomic home of several related ... 4 nucleotide substitutions/site/year. The most recent common ancestor of sequenced filovirus variants was estimated to be 1971 ...
The cells of the microvascular system become spherical and the attachments to neighbouring cells are reduced to thin strings. ... from infections associated with the injection of drugs: experiences of a microbiological investigation team". Journal of ... "Autopsy findings in an outbreak of severe systemic illness in heroin users following injection site inflammation: an effect of ...
This refers to the two whip-like attachments (flagella) used for forward movement. Most dinoflagellates are protected with red- ... "Amoebae: Protists Which Move and Feed Using Pseudopodia". Tree of Life web project. "The Amoebae". The University of Edinburgh ... Cavalier-Smith T (December 1993). "Kingdom protozoa and its 18 phyla". Microbiological Reviews. 57 (4): 953-94. doi:10.1128/ ... "Welcome to the Phaeocystis antarctica genome sequencing project homepage". DiTullio, G. R.; Grebmeier, J. M.; Arrigo, K. R.; ...
Each active site creates a 'tunnel' which is the site of three distinct substrate binding sites: nucleotide, ammonium ion, and ... Adenylylation is a post-translational modification involving the covalent attachment of AMP to a protein side chain. Each ... Merrick MJ, Edwards RA (December 1995). "Nitrogen control in bacteria". Microbiological Reviews. 59 (4): 604-22. doi:10.1128/MR ... GDP, AMP, ADP bind to the ATP site. L-serine, L-alanine, and glycine bind to the site for L-glutamate in unadenylated GS. The ...
By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... Next is the attachment of the D-ribose via ribosylation of neamine, using 5-phosphoribosyl-1-diphosphate (PRPP) as the ribosyl ... "Comparative study of responses to neomycins B and C by microbiological and gas-liquid chromatographic assay methods". Applied ... The association constant for neomycin with A-site RNA has been found to be in the 109 M−1 range.[25] However, more than 50 ...
"Microbial attachment to food and food contact surfaces". In: Advances in Food and Nutrition Research, Vol. 43. ed. Taylor, S. L ... "CDC - Listeria - Home". cdc.gov/listeria. Retrieved 15 June 2019. Temple, M. E.; Nahata, M. C. (May 2000). "Treatment of ... Salo S.; Laine A.; Alanko T.; Sjoberg A. M.; Wirtanen G. (2000). "Validation of the microbiological methods Hygicult dipsilde, ... Kalmokoff M. L.; Austin J. W.; Wan X. D.; Sanders G.; Banerjee S.; Farber J. M. (2001). "Adsorption, attachment and biofilm ...
... which may include cellular recognition of specific or non-specific attachment sites on a surface, nutritional cues, or in some ... An ecologic shift away from balanced populations within the dental biofilm is driven by certain (cariogenic) microbiological ... Initial attachment Irreversible attachment Maturation I Maturation II Dispersion Dispersal of cells from the biofilm colony is ... Each hamus is a long tube with three hook attachments that are used to attach to each other or to a surface, enabling a ...
Clarke, D.E. (2001). "Clinical and Microbiological Effects of Oral Zinc Ascorbate Gel in Cats". Journal of Veterinary Dentistry ... are able to bind directly to the enamel as well as the mineralized sections of the teeth where it takes up the binding sites ... and loss of attachment in beagle dogs". Journal of Periodontal Research. 18 (4): 452-458. doi:10.1111/j.1600-0765.1983.tb00382. ...
"Microbiological Reviews. 58 (1): 94-144. doi:10.1128/MMBR.58.1.94-144.1994. PMC 372955. PMID 8177173.. ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... Fimbriae are believed to be involved in attachment to solid surfaces or to other cells, and are essential for the virulence of ... "Microbiological Reviews. 57 (2): 434-50. doi:10.1128/MMBR.57.2.434-450.1993. PMC 372918. PMID 8336674.. ...
"Microbiological Reviews. 56 (1): 152-79. PMC 372859. PMID 1579108.. *^ Zambon MC (November 1999). "Epidemiology and ... The different sites of infection (shown in red) of seasonal H1N1 versus avian H5N1. This influences their lethality and ability ... van Riel D, Munster VJ, de Wit E, Rimmelzwaan GF, Fouchier RA, Osterhaus AD, Kuiken T (April 2006). "H5N1 Virus Attachment to ... "Microbiological Reviews. 56 (1): 152-79. PMC 372859. PMID 1579108.. *. Steinhauer DA, Skehel JJ (2002). "Genetics of influenza ...
Web. 21 Mar 2013. *^ Festjens, Nele; Vanden Berghe, Tom; Vandenabeele, Peter (2006-09-01). "Necrosis, a well-orchestrated form ... loosening of intercellular attachments. *mitochondrial changes. *dilation of the endoplasmic reticulum. Fatty change[edit]. The ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... Oxidative DNA damages usually involve only one of the DNA strands at any damaged site, but about 1-2% of damages involve both ...
... the Double Helix Game From the official Nobel Prize web site ... It may act as a recognition factor to regulate the attachment ... "Microbiological Reviews. 57 (2): 434-50. doi:10.1128/MMBR.57.2.434-450.1993. PMC 372918. PMID 8336674.. ... "Microbiological Reviews. 58 (3): 563-602. doi:10.1128/MMBR.58.3.563-602.1994. PMC 372978. PMID 7968924.. ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ...
Microbiological Reviews. 1 June 1993;57(2):434-50. PMID 8336674.. *^ Barrangou R, Fremaux C, Deveau H, et al.. CRISPR provides ... Harmful Algal Blooms: Red Tide: Home [Retrieved 2014-12-19].. *^ Hall A. J., Jepson P. D., Goodman S. J., Harkonen T.. Phocine ... Attachment to the receptor can induce the viral envelope protein to undergo changes that results in the fusion of viral and ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ...
By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... "Biosafety in Microbiological and Biomedical Laboratories (BMBL) 5th Edition". Retrieved 2011-10-16.. ... The marburgvirus life cycle begins with virion attachment to specific cell-surface receptors, followed by fusion of the virion ... Symptoms include bloody stools, ecchymoses, blood leakage from venipuncture sites, mucosal & visceral hemorrhaging, and ...
LSU Law Center's Medical and Public Health Law Site, Historic Public Health Articles. Iliwekwa mnamo 2006-11-23. ... Beachey E (1981). "Bacterial adherence: adhesin-receptor interactions mediating the attachment of bacteria to mucosal surface ... "Microbiological Reviews 58 (1): 94-144. PMC 372955 . PMID 8177173 . http://mmbr.asm.org/cgi/pmidlookup?view=long&pmid=8177173. ... Bacterial Chemotaxis Interactive Simulator - A web-app that uses several simple algorithms to simulate bacterial chemotaxis. ...
By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... The gold standard of diagnosis is microbiological isolation of N. meningitidis by growth from a sterile body fluid, which could ... fimbriae mediate attachment of the bacterium to the epithelial cells of the nasopharynx.[14][15] It infects the cell by ... Anyone who frequently ate, slept or stayed at the patient's home during the 7 days before the onset of symptom, or those who ...
... store animal waste in lagoons on site.[15] Manure is also trucked off site, stored in containers, or held in holding ponds. ... "Evaluating the Safety of Antimicrobial New Animal Drugs with Regard to Their Microbiological Effects on Bacteria of Human ... https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/662189/UK_AMR_3rd_annual_report ... By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ...
By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia ... A separate plastic bag hangs from attachment points on the outer bag. Seawater is poured into the inner bag from an opening in ... This process leaves behind impurities, such as salts and heavy metals, and eliminates microbiological organisms. The end result ...
The flow of protons makes the stalk subunit rotate, causing the active site of the synthase domain to change shape and ... Proteins are made from amino acids that have been activated by attachment to a transfer RNA molecule through an ester bond. ... Häse CC, Finkelstein RA (December 1993). "Bacterial extracellular zinc-containing metalloproteases". Microbiological Reviews. ... Microbiological Reviews. 60 (4): 609-40. doi:10.1128/MMBR.60.4.609-640.1996. PMC 239458. PMID 8987358. Barea JM, Pozo MJ, Azcón ...
... pockets are sites where the attachment has been gradually destroyed by collagen-destroying enzymes, known as collagenases) ... The correlation of selected microbiological parameters with disease severity in Sri Lankan tea workers". Journal of Clinical ... of attachment loss Moderate: 3-4 mm (0.12-0.16 in) of attachment loss Severe: ≥ 5 mm (0.20 in) of attachment loss The "extent" ... Sites are defined as the positions at which probing measurements are taken around each tooth and, generally, six probing sites ...
ASTM Standards site List of A ASTM standards List of B ASTM standards List of C ASTM standards List of D ASTM standards List of ... Test Methods for Microbiological Monitoring of Water Used for Processing Electron and Microelectronic Devices by Direct ... Specification for Performance of Hasps and Other Attachment Devices for Padlocks or Seals F2156-17 Test Method for Measuring ... Test Method for Determining Energy Consumption of Vacuum Cleaners F2757-20 Guide for Home Laundering Care and Maintenance of ...
Attachment Sites, Microbiological * Bacterial Toxins* * Blood Proteins * Cross Infection / microbiology * DNA, Recombinant ... The entA and sak determinants were closely linked in the phage DNA adjacent to the phage attachment site (attP) in each case ... restriction endonuclease site mapping and hybridization analysis, and compared with the mechanism of beta-lysin and ...
The lack of sequence conservation among attC sites led us to hypothesize that sequence-independe … ... were occurring through unconventional site-specific recombination reactions involving only the bottom strand of attC sites. ... Attachment Sites, Microbiological* * Base Sequence * DNA, Bacterial / chemistry* * DNA, Bacterial / genetics * DNA, Single- ... Structural features of single-stranded integron cassette attC sites and their role in strand selection PLoS Genet. 2009 Sep;5(9 ...
... sites showing attachment loss ,4 mm,sites showing attachment loss between 4-7 mm,sites showing attachment loss ,7 mm. ... Microbiological Examination. BANA test is done to assess the microbiological status.. One site with the deepest probing depth ... sites showing ,4 mm of probing depth,sites showing 4-7 mm of probing depth,sites showing ,7 mm of probing depth. ... Sampling methods vary widely, and, together with undoubted differences from site to site within the mouth, such variations may ...
Attachment Sites, Microbiological Capsid Proteins Cell Culture Techniques Cell Separation Cells, Cultured DNA, Viral Genome, ...
Improvement in Clinical Attachment Level [ Time Frame: 6 months ]. Secondary Outcome Measures : *Improvement in Periodontal ... The subject has at least 4 sites with PD of ≥5 mm + bleeding in at least two quadrants of the mouth. ... Clinical, Microbiological and Biochemical Effects of the Antimicrobial Photodynamic Therapy. The safety and scientific validity ... Clinical, Microbiological and Biochemical Effects of the Antimicrobial Photodynamic Therapy. Study Start Date :. November 2011 ...
Attachment sites of four tick species (Acari: Ixodidae) parasitizing humans in Georgia and South Carolina. J Med Entomol 1999; ... Biosafety in microbiological and biomedical laboratories (BMBL). 5th ed. Washington, DC: US Department of Health and Human ... Sites where ticks commonly attach to humans include, but are not limited to, the scalp, abdomen, axillae, and groin, as well as ... CDC is not responsible for the content of pages found at these sites. URL addresses listed in MMWR were current as of the date ...
Microorganisms that cause pathology in humans and animals enter the body at different sites and produce disease by a variety of ... a normal flora of nonpathogenic bacteria that compete with pathogenic microorganisms for nutrients and for attachment sites on ... Surface epithelia provide mechanical, chemical, and microbiological barriers to infection. In addition to these defenses, most ... This specific attachment allows the pathogen to infect the epithelial cell, or to damage it so that the epithelium can be ...
Full-mouth clinical measurements of PPD and clinical attachment level (CAL) will be taken at 6 sites per tooth, excluding third ... Microbiological samples will be taken. The patient smoking history will be recorded and participants will be categorized as: ... Follow up visits after 3 and 6 months Follow up visits will have the objective to monitor the clinical and microbiological ... The aim of this study is to evaluate the clinical and microbiological performance of a probiotic formulation (Sunstar GUM ...
... because soil organic matter provides hydrophobic binding sites for virus attachment (Schijven & Hassanizadeh 2000). In this ... This site uses cookies. By continuing to use our website, you are agreeing to our privacy policy. ... Membrane process for spring water treatment in the Tula Valley: assessment of physicochemical and microbiological parameters in ... assessment of physicochemical and microbiological parameters in a non-conventional water source. Water Supply 1 April 2015; 15 ...
Attachment Sites, Microbiological/genetics. *Base Sequence. *Chromosomes/genetics. *DNA Breaks. *DNA, Single-Stranded/genetics ... Home page banner reprinted from Hearing Research, 341, Monroe, J.D. et al., Hearing sensitivity differs between zebrafish lines ... including the introduction of a custom-designed EcoRV site and a modified loxP (mloxP) sequence into somatic tissue in vivo. We ...
In addition, TEP are an important structural component since they provide attachment sites for microbes on a nanometer to ... Coupling of transparent exopolymer particle dynamics and microbiological processes during an ocean acidification experiment in ... Coupling of transparent exopolymer particle dynamics and microbiological processes during an ocean acidification experiment in ... TEP may be altered due to short term responses to acidification.We observed that the amount of TEP as well as microbiological ...
... the hosts proteins cover the internal and external surfaces of the device and serve as an attachment site for certain ... Microbiological diagnosis of biofilm-related infections Diagnóstico microbiológico de las infecciones relacionadas con la ... The microbiological diagnosis is based on the similarity in isolations obtained from the culture from the insertion point or ... Microbiological diagnosis is generally reserved for cases which are refractory to treatment. The clinical sample should be ...
Attachment Sites, Microbiological, physiology, Binding Sites, Carbohydrate Sequence, Chancroid, microbiology, Chromatography, ... Our results suggest that the 58.5-kDa GroEL HSP of H. ducreyi is responsible for the attachment of this bacterium to the ... To elucidate the role of the surface-located 58.5-kDa GroEL heat shock protein (HSP) of H. ducreyi in attachment, we ... To identify carbohydrate receptors that mediate the attachment of this pathogen to host cells, we investigated the binding of ...
No significant alterations in genetic or microbiological features were observed. The present case suggests that periodontal ... View at: Publisher Site , Google Scholar*Y.-M. Wu, J. Yan, L.-L. Chen, W.-L. Sun, and Z.-Y. Gu, "Infection frequency of Epstein ... Microbiological and Genetic Analysis. To better explore mechanisms that could explain the severe periodontal status, ... Clinical and radiographic examinations demonstrated a severe and generalized periodontal disease, with clinical attachment loss ...
Microbiological testing was shown to improve the prognostic features compared to recording bleeding on probing alone as this ... Increased levels of bleeding on probing was present at 67% of sites where there is peri-implant mucositis as it is indicative ... Increased probing depths over time is linked to loss of attachment and a reduction in the supporting alveolar bone levels. When ... This is especially true with respect to their surrounding tissues and biological attachment. The diagnosis of peri-implant ...
Prevalence of periodontally active sites was low in the study population. Microbiological studies: Black pigmented anaerobic ... and clinical attachment loss (CAL), were examined at mesial-buccal and distal-lingual sites of each tooth. Number of missing ... clinical attachment level (CAL), and bleeding on probing (BOP). A total 4,765 periodontal sites were evaluated, 125 of which ... Subgingival microbiological profile of periodontitis patients in Dominican Republic. Collins, James R; Chinea, Sofía; Cuello, ...
Article Comparison of the role of attachment, aggregation and internalisation of microorganisms in UVC and UVA (solar) ... physicochemical and microbiological characteristics of water samples taken seasonally from selected sampling sites on seven ... Comparison of the role of attachment, aggregation and .... Comparison of the role of attachment, aggregation and ... No comments were found for Comparison of the role of attachment, aggregation and internalisation of microorganisms in UVC and ...
Microbiological Attachment Sites 2012 Altered regulation of escherichia coli biotin biosynthesis in bira superrepressor mutant ... Biotin and lipoic acid: Synthesis, attachment, and regulation. Cronan, J. E., Jan 1 2014, In : EcoSal Plus. 6, 1, p. 1-39 39 p. ... Overlapping repressor binding sites result in additive regulation of Escherichia coli FadH by FadR and ArcA. Feng, Y. & Cronan ...
We use cookies on this site to enhance your user experience.. By clicking any link on this page you are giving your consent for ... Clinical and microbiological effects of sustained release of chlorhexidine in periodontal pockets. J clinical periodontol, 1986 ... Clinical parameters like gingival index, probing depth, attachment loss, and gingival shrinkage were evaluated along with ... Microbiological characteristics of subgingival microbiota in adult periodontitis, localized juvenile periodontitis and rapidly ...
The same occurs for A. viscosus (22% of sites) and A. actinomycetemcomitans (6% of sites; Table 3). ... Microbiological Analysis. Total DNA Extraction. Total DNA was isolated from the interdental brushes using the QIAcube® HT ... 3 mm or clinical attachment loss (CAL) > 3 mm; and (iv) the subjects were judged to be free of gingivitis or periodontitis. ... For all subjects, the same four interdental sites (15-16, 25-26, 35-36, and 45-46) were assessed (total 100 sites). The ...
Since tetracycline is an important antibiotic for treating Ct, zoonotic infections at mutual sites of infection indicate the ... Plaque score, gingival score, pocket probing depth, and clinical attachment level were evaluated before treatment and at 1 ... A clinico microbiological study. (Abstract). Comparison of the efficacy of subgingival irrigation with 2% povidone-iodine and ... We validated TetRP by confirming the translation start sites of protein-coding genes in accordance with the 2006 version of ...
Gains in attachment (0.9 mm and 1.1 mm) were observed in minocycline-treated sites, with baseline probing depth , or =5 mm and ... Microbiological sampling using DNA probes was done at baseline; at week 2; and at months 1, 3, 6, 9, 12, and 15. Both treatment ... versus 1.2 mm in the control sites. Sites with a baseline probing depth , or =7 mm and bleeding index ,2 showed an average of ... sites treated with minocycline ointment always produced statistically significantly greater reductions than sites which ...
This site complies with the HONcode standard for trustworthy health information: Verify here. ... Health Protection Agency (HPA). Guidelines for Assessing the Microbiological Safety of Ready-to-Eat Foods Placed on the Market ... Available from: https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/363146/ ... Guidelines_for_assessing_the_microbiological_safety_of_ready-to-eat_foods_on_the_market.pdf ...
Attachment Sites (Microbiology). Attachment Sites, Microbiological. H - Physical Sciences. Changed terms. Replaced-by. ...
Attachment Sites, Microbiological. en_US. dc.subject.mesh. ATP Binding Cassette Transporter, Subfamily B. en_US. ... ABCB1 (P-glycoprotein) reduces bacterial attachment to human gastrointestinal LS174T epithelial cells. Crowe, A Bebawy, M ... Irrespective of attachment differences between the bacterial species, the increase in P-gp protein expression decreased ... Irrespective of attachment differences between the bacterial species, the increase in P-gp protein expression decreased ...
Citations may include links to full-text content from PubMed Central and publisher web sites. ... The phage attachment site attP, the bacterial attachment site attB, and the two phage/chromosome junctions attL and attR were ... Attachment Sites, Microbiological. *Base Sequence. *DNA, Viral/genetics. *Genome, Viral*. *Molecular Sequence Data ...
Attachment Sites, Microbiological. Toxin. Helicobacter pylori. About this Paper. PMID: 9106201. DOI: 10.1046/j.1365-2958.1997. ... Pais are often associated with tRNA loci, which may represent target sites for the chromosomal integration of these elements. ...
An adhesive basal element at one end of the filament can aid attachment to solid surfaces. The sheath offers some protection ... Individual mature cells swarm out of the protective tube to colonize new sites. Each motile mature cell has an intertwined ... Van Veen, WL; Mulder, EG; Deinema, MH (1978). "The Sphaerotilus-Leptothrix group of bacteria". Microbiological Reviews. 42 (2 ...
The flow of protons makes the stalk subunit rotate, causing the active site of the synthase domain to change shape and ... Proteins are made from amino acids that have been activated by attachment to a transfer RNA molecule through an ester bond. ... Häse CC, Finkelstein RA (December 1993). "Bacterial extracellular zinc-containing metalloproteases". Microbiological Reviews. ... Microbiological Reviews. 60 (4): 609-40. doi:10.1128/MMBR.60.4.609-640.1996. PMC 239458. PMID 8987358. Barea JM, Pozo MJ, Azcón ...
  • The goal of this study is to determine if patients with chronic periodontitis when undergoing with scaling and root planing (SRP) plus photodynamic therapy in comparison with SRP alone result in improved clinical, microbiological and biochemical outcomes. (clinicaltrials.gov)
  • Microbiological characteristics of subgingival microbiota in adult periodontitis, localized juvenile periodontitis and rapidly progressive periodontitis subjects. (thejcdp.com)
  • Comparison of the efficacy of subgingival irrigation with 2% povidone-iodine and tetracycline HCl in subjects with chronic moderate periodontitis: A clinico microbiological study. (tripdatabase.com)
  • We hypothesized that levels of microbiological mediators and / or inflammatory markers of chronic periodontitis would be intermediate in those exposed to environmental tobacco smoke compared to active and non-smokers. (tobaccopreventioncessation.com)
  • when used in conjunction with initial periodontal treatment in adult periodontitis patients, achieves significantly better clinical and microbiological results than initial periodontal treatment alone. (rug.nl)
  • The clinical parameters of probing depth, clinical attachment level, bleeding on probing, plaque accumulation and suppuration were measured in 60 Caucasian adults who were divided into two groups: 30 healthy individuals (control) and 30 with chronic periodontitis (ChP). (cdc.gov)
  • This way, this project is aimed to evaluate the pattern of microbiological colonization and the inflammatory response pattern associated with it, comparing parents with generalized aggressive periodontitis and their children and periodontally healthy parents and their children. (clinicaltrials.gov)
  • AbstractObjective: To evaluate the clinical and microbiological effects of systemicazithromycin as an adjunct to scaling and root planing (SRP) in the treatment ofPorphyromonas gingivalis-associated chronic periodontitis. (medtheses.com)
  • scaling and root Conclusions: Within the limitations of this study, the adjunctive use of systemic azithromycin in the treatment of P. gingivalis periodontitis demonstrated significantclinical and microbiological benefits when compared with SRP plus placebo. (medtheses.com)
  • aetiology of periodontitis is multi-factor- ial, but it is an infection and bacterial pills were provided by Pfizer, Alcobendas, microbial spectrum with in vitro activity attachment loss (Winkel et al. (medtheses.com)
  • In this study, evaluation of the effect of mechanical debridement and adjunctive metronidazol plus spiramycin therapy on the clinical and microbiological parameters of Early-Onset Periodontitis patients was aimed. (selcuk.edu.tr)
  • Periodontitis is a prevalent disease of men characterized by loss of connective tissue attachment and bone around the teeth, in conjunction with the formation of periodontal pockets due to apical migration of the junctional epithelium. (dentalnews.com)
  • Consequently, elevated levels of these putative pathogens may be useful indicators of both active periodontitis and increased risk of gingival attachment loss. (dentalnews.com)
  • A case-control study was done to assess the influence of smoking on clinical, microbiological, and histopathological parameters. (hindawi.com)
  • Aim: To evaluate the effect of subgingival placement of doxycycline in the form of a resorbable membrane on the clinical and microbiological parameters in the treatment of inflammatory periodontal disease. (thejcdp.com)
  • Clinical parameters like gingival index, probing depth, attachment loss, and gingival shrinkage were evaluated along with microbiological evaluation as well for a period of 10 weeks. (thejcdp.com)
  • The full-mouth periodontal clinical parameters, clinical attachment level (CAL), probing depth (PD), gingival index (GI), and plaque index (PI), were monitored at baseline, 3, 6, and 9 months after periodontal treatment with full mouth disinfection (FMD) protocol. (bvsalud.org)
  • For clinical and microbiological parameters, two-factor repeated-measures ANOVA was used. (bvsalud.org)
  • Key secondary variables were additional periodontal, microbiological and psychological parameters. (eurekaselect.com)
  • Clinical and microbiological parameters were measured 6 weeks before drawing blood to determine levels of HbA1C. (unipi.it)
  • Periodontal parameters were measured at baseline (TO), year 2 (T2), year 3 (T3) and included: probing depth (PD), attachment level (AL), sulcus bleeding index (SBI), and plaque index (PI). (unipi.it)
  • Test site comprised of SRP followed by intra-pocket placement of Aloe vera gel, which was compared with the control site in which only SRP was done, and clinical parameters were compared between the two sites at one month and three months from baseline. (jisponline.com)
  • Clinical parameters like gingival index (GI), plaque index (PI) and probing pocket depth (PPD), clinical attachment level (CAL) were evaluated at baseline and 3 months follow-up. (scribd.com)
  • In this study, physicochemical and microbiological characteristics of water samples taken seasonally from selected sampling sites on seven main canals in Kafr El-Sheikh Governorate were. (environmental-expert.com)
  • Subgingival plaque samples were collected from 6 sites per subject and analyzed for 38 bacterial species using the Checkerboard DNA-DNA Hybridization. (cdc.gov)
  • We hypothesized that adjunctive antibiotic therapy significantly reduces (Δ50%) the occurrence of further attachment loss compared to subgingival debridement alone. (eurekaselect.com)
  • During this period, samples of gingival crevicular fluid (GCF) and subgingival biofilm from periodontal pockets/sites from all subject (parents and children) will be collected. (clinicaltrials.gov)
  • Sites evaluated clinically with Probing Pocket Depths, Gingival Index, Plaque Index and Clinical Attachment Gain and assessed microbiologically with bacteriologic culture method for Aa, Pg, Pi and with microscopic method for the presence of spirochetes at stained subgingival plaque samples. (selcuk.edu.tr)
  • It was observed that the gingival index score, periodontal probing depth, and gingival shrinkage showed low levels at the doxycycline-treated sites as compared to the placebo group. (thejcdp.com)
  • Each of the sites was assessed for the plaque index, gingival index, and probing pocket depth at baseline and 21 days and for microbiological analysis at baseline, 1 week and 21 days. (jisponline.com)
  • Identification of cis regulatory features in the embryonic zebrafish genome through large-scale profiling of H3K4me1 and H3K4me3 binding sites. (umassmed.edu)
  • We attribute this unusual phenotype to differences in the distribution of int protein binding sites among different attachment sites (Ross and Landy 1982, 1983). (princeton.edu)
  • We suggest that int protein molecules bound to one of two recombining DNAs interact with empty sites or with bound proteins on the other, and that the mutant protein acts efficiently only if the distribution of protein binding sites within the two attachment sites is that of the attP-attB pair. (princeton.edu)
  • Standard clinical variables (including probing depth and attachment level) were evaluated at baseline and at months 1, 3, 6, 9, 12, and 15. (arctichealth.org)
  • Clinical measurements and microbiological assessments were taken at baseline and 3 months after completion of initial periodontal therapy with additional placebo or antibiotic treatment. (rug.nl)
  • In contrast, the changes in the proportions of sites with a probing pocket depth greater than or equal to5 mm in the Pg-neg placebo and Pg-neg test subgroup were similar, from 43% at baseline to 18% after treatment versus 40% to 12%, respectively. (rug.nl)
  • Bleeding on probing, probing depth and clinical attachment level were recorded at baseline, 6 and 12 months postoperatively. (unito.it)
  • PD and AL of constant sites in the diabetic group at T3 were significantly higher than baseline. (unipi.it)
  • There was a significant increase in Prevotella intermedia at T3 as compared with baseline for deepest sites in the diabetic group. (unipi.it)
  • Clinical [plaque and bleedingindexes, probing pocket depth (PPD), clinical attachment level (CAL)] andmicrobiological data (four-sites pooled samples, processed by culture) were collectedat baseline, and 1, 3 and 6 months, post-therapy. (medtheses.com)
  • Counts units per millilitre of the original sam- sites selected at baseline), clinical para- bacterial species were also calculated. (medtheses.com)
  • A systematic review on the use of residual probing depth, bleeding on probing and furcation status following initial periodontal therapy to predict further attachment and tooth loss. (panlodowegoogrodu.pl)
  • 4 subgroups were created on the basis of the initial microbiological status for P. gingivalis positive (Pg-pos) and negative patients (Pg-neg) in the P- and the T-groups. (rug.nl)
  • The adjunctive use of tetracycline consistently resulted in a lower percentages of sites with detectable levels of A. actinomycetemcomitans, P. intermedia and P. gingivalis, while no differences were detected between treatments in the prevalence of T. denticola and B. forsythus. (unito.it)
  • The entA and sak determinants were closely linked in the phage DNA adjacent to the phage attachment site (attP) in each case and furthermore, the sak determinant of phage phi 13 was also located near its attP. (nih.gov)
  • The phage attachment site attP, the bacterial attachment site attB, and the two phage/chromosome junctions attL and attR were identified and found to contain a 40 bp common core sequence. (nih.gov)
  • Smokers have been associated with deeper pockets and greater attachment loss, more pronounced radiographic evidence of furcation involvement, and increased alveolar bone loss. (hindawi.com)
  • Significant positive correlations were observed between the level of GCF SLIT3 and clinical attachment level and radiographic bone loss (p (bvsalud.org)
  • Traditionally, periodontal diseases have been diagnosed by radiographic and clinical exams, including the assessment of plaque with a plaque index (PI), gingival inflammation with the bleeding on probing index (BOP), probing pocket depth (PPD) and clinical attachment loss (CAL). (dentalnews.com)
  • METHODS: A total of 44 bilateral pockets 4-5 mm deep and bleeding on probing were selected in 11 non-smokers patients, 22 treated by scaling and root planing plus tetracycline fibres (test sites) and 22 with scaling and root planing alone (control sites) in a split-mouth design. (unito.it)
  • Methods for collecting and transporting microbiological specimens and for recovering detectable antigen are also described. (google.com)
  • Two methods of larval probiont delivery were tested - attachment to Artemia, and in-water delivery. (openthesis.org)
  • Conclusions Obesity did not affect the clinical and microbiological outcomes of non-surgical periodontal therapy. (bvsalud.org)
  • This study is a prospective, parallel, comparative, clinical, hematological and microbiological study performed in patients with generalized chronic periodontal disease separated in two groups, with 10 patients with diabetes mellitus insulin-dependent (DM) and 10 patients non-diabetics (NDM) attended by 3 months. (unicamp.br)
  • The present study aimed to compare the clinical and microbiological effects of non-surgical periodontal therapy with the full mouth disinfection (FMD) protocol on obese and non-obese individuals at 9 months post-therapy. (bvsalud.org)
  • Abstract: The aim of this study was to compare the clinical, hematological and microbiological responses of periodontal treatment for both groups after full-mouth scaling and root planning. (unicamp.br)
  • Thus in most cases these defenses, which we will examine in more detail in subsequent sections, prevent a site of infection from being established. (nih.gov)
  • Infectious disease occurs when a microorganism succeeds in evading or overwhelming innate host defenses to establish a local site of infection and replication that allows its further transmission. (nih.gov)
  • In this hypothesis, the external fixator construct appears to be vital to the prevention of pin site complications since excessive movement at the fixator pin-bone interface leads to pin site irritation and infection. (springer.com)
  • Symptoms of staph infections include reddish, swollen, itchy, and tender area at the site of infection. (emedicinehealth.com)
  • Most staph infections that are visible usually have a reddish, swollen, itchy, and/or tender area at the site of infection. (emedicinehealth.com)
  • Sites of infection can be small like a pimple on someone's face or even in the nose, a boil on an extremity, or large like a carbuncle. (emedicinehealth.com)
  • There was no supervisor infection in the site breathing. (minestudio.com.my)
  • These strains contain combinations of deletions or mutations in the bacterial attachment site for Φ80 integration and/or deletions in the genes required for phage absorption to the host outer membrane. (illinois.edu)
  • We recently showed that cassette integration and deletion in integron platforms were occurring through unconventional site-specific recombination reactions involving only the bottom strand of attC sites. (nih.gov)
  • Here, we systematically determined the contribution of three structural elements common to all known single-stranded attC site recombination substrates (the EHBs, the unpaired central spacer (UCS), and the variable terminal structure (VTS)) to strand choice and recombination. (nih.gov)
  • We found that the structure of the central spacer is essential to achieve high level recombination of the bottom strand, suggesting a dual role for this structure in active site exclusion and for hindering the reverse reaction after the first strand exchange. (nih.gov)
  • Cultures of V. cholerae strains with deletions in the dif recombination site are known to contain a subpopulation of cells that display a filamentous morphology3. (nih.gov)
  • These observations strongly suggest that φBT1 encodes a site-specific recombination system that has a different specificity from that in φC31 and therefore integrates into a different attB site in the S. coelicolor genome. (asm.org)
  • Five of the remaining eight enzymes were active on extra-chromosomal substrates thereby demonstrating that the ability to mediate extra-chromosomal recombination is no guide to ability to mediate site-specific recombination on integrated DNA. (ox.ac.uk)
  • All the integrases that were active on integrated DNA also promoted DNA integration reactions that were not mediated through conservative site-specific recombination or damaged the recombination sites but the extent of these aberrant reactions varied over at least an order of magnitude. (ox.ac.uk)
  • This mutant promotes efficient recombination between the phage and bacterial attachment sites, but, unlike wild type, does not promote efficient recombination of any other pair of attachment sites tested in most conditions. (princeton.edu)
  • IN particular, recombination between two phage or two prophage attachment sites is poor relative to the wild type frequency. (princeton.edu)
  • Similar discrimination among attachment site pairs by wild type int protein may also modulate recombination frequencies. (princeton.edu)
  • The lack of sequence conservation among attC sites led us to hypothesize that sequence-independent structural recognition determinants must exist within attC sites. (nih.gov)
  • With this updated TALEN system, we successfully used single-stranded DNA oligonucleotides to precisely modify sequences at predefined locations in the zebrafish genome through homology-directed repair, including the introduction of a custom-designed EcoRV site and a modified loxP ( mloxP ) sequence into somatic tissue in vivo . (zfin.org)
  • The commonly used plant constitutive expression vector pBI121 was modified by insertion of two directly orientated lox sites each at one end of the selectable marker gene NPTII and by replacing the GUS gene with a sequence composed of multiple cloning sites (MCS). (bvsalud.org)
  • Moreover, to facilitate screening of selectable marker-removed gene and the composite sequence is flanked by lox sites. (bvsalud.org)
  • Furthermore, no significant similarity could be detected between the φC31 attP site and any φBT1 sequence. (asm.org)
  • Attachment of Escherichia coli to human urinary tract epithelial cells. (meta.org)
  • Furthermore, a vector, pSET152 containing the φC31 attP-int locus, introduced by conjugation from Escherichia coli can integrate into secondary or pseudo- attB sites in both S. coelicolor and Streptomyces lividans ( 8 ). (asm.org)
  • Retrospective application of transposon-directed insertion site sequencing to a library of signature-tagged mini-Tn5Km2 mutants of Escherichia coli O157:H7 screened in cattle. (naver.com)
  • We demonstrate that φBT1 does indeed integrate into a different attB site in S. coelicolor , and we have constructed novel integrating vectors derived from the φBT1 attP-int locus. (asm.org)
  • Clinical periodontal measurements, comprising plaque index, probing depth, clinical attachment level and bleeding on probing, were recorded at four sites per tooth. (tobaccopreventioncessation.com)
  • Except for the plaque, there was a significantly larger change in the bleeding, probing pocket depth (PPD) and clinical attachment level (CAL) in the T-group as compared to the P-group after therapy. (rug.nl)
  • All individuals (parents and children) will be clinically assessed for plaque and bleeding index, periodontal probing depth, clinical attachment level and gingival recession. (clinicaltrials.gov)
  • Full-mouth clinical examinations were carried out and Visible Plaque Index (VPI), Gingival Bleeding Index (GBI), Probing Pocket Depth (PPD), and clinical attachment level (CAL) were assessed in 6 sites per tooth. (ufrgs.br)
  • Traditional clinical measurements (probing pocket depth, bleeding on probing, clinical attachment loss, plaque index, radiographs) used for periodontal diagnosis are often of limited usefulness in that they are indicators of previous periodontal disease rather than present disease activity. (dentalnews.com)
  • For these reasons and as many workers would like to use two compatible integrating vectors in the same organism, we have investigated the integration site of the Streptomyces phage φBT1, a homoimmune relative of φC31. (asm.org)
  • Manipulation or control of the microbiological aquaculture environment has been identified as an important focus area for future hatchery development. (openthesis.org)
  • The aim of this study is to evaluate the clinical and microbiological performance of a probiotic formulation (Sunstar GUM Periobalance) as adjunctive to non-surgical periodontal therapy in patients with diabetes. (clinicaltrials.gov)
  • Request single or consolidated IRB review for a multi-site study. (harvard.edu)
  • AIM: The purpose of this study was to evaluate the clinical and microbiological efficacy of local delivery of tetracycline in persistent periodontal lesions after topical therapy. (unito.it)
  • depth of >3 and ≤5 mm and clinical attachment loss of 3-4 mm in relation to 16, 36, and 46. (tripdatabase.com)
  • CAL: Clinical attachment loss. (aapd.org)
  • Bacterial samples were collected with paper points from periodontal sites showing the deepest periodontal pocket depth associated with the highest clinical attachment loss. (bvsalud.org)
  • No significant alterations in genetic or microbiological features were observed. (hindawi.com)
  • To reduce the number of candidate probiotics to be tested in vivo, various in vitro experiments need to be conducted, each screening for a particular mode of action - antagonism towards pathogen through production of antimicrobial compounds, growth and attachment to fish intestinal mucus, and the production of other beneficial compounds such as vitamins, fatty-acids and digestive enzymes. (openthesis.org)
  • It has as its aim to respond to the challenges currently posed by everything associated with infectious diseases, from a clinical, microbiological and public health perspective. (elsevier.es)
  • To identify carbohydrate receptors that mediate the attachment of this pathogen to host cells, we investigated the binding of 35S-methionine-labeled H. ducreyi strains to a panel of defined glycosphingolipids that were separated on thin layer chromatography plates. (gu.se)
  • The primary objective efficacy variable was the percentage of sites with a loss of clinical attachment ≥ 1.3 mm over the 24-month follow-up period. (eurekaselect.com)
  • Different in vitro (Pajukanta 1993) specific microbiological profiles, it has and in vivo (Herrera et al. (medtheses.com)
  • The null hypothesis is that the adjunctive use of this probiotic formulation would not have any additional benefit over scaling and root planning in the number of residual pockets or in the microbiological impact of the treatment. (clinicaltrials.gov)
  • The pathogens could be eliminated from 3 periodontal pockets by debridement alone and from 12 sites by tetracycline at 12 months. (unito.it)
  • We found that acquisition and chromosomal integration of the TLC-Knφ1 genome restored a perfect dif site and normal morphology to V. cholerae wild-type and mutant strains with dif(-) filamentation phenotypes. (nih.gov)
  • Southern blots of DNA from an S. coelicolor J1929 φBT1 lysogen (strain J1929 contains Δ pglY conferring sensitivity to φC31 and φBT1 [ 3 ]) probed with DNA encoding the φC31 attB site indicated that φC31 attB was intact, suggesting that φBT1 was integrated elsewhere in the genome (data not shown). (asm.org)
  • A nuclear matrix attachment region (MAR) spans oriP and the adjacent region of the EBV genome containing the EBV-expressed RNAs. (ox.ac.uk)
  • CONCLUSIONS: We conclude that the Bxb1 and φC31 integrases are the reagents of choice for genome engineering in vertebrate cells and that DNA damage repair is a major limitation upon the utility of this class of site-specific recombinase. (ox.ac.uk)
  • Mean probing pocket depth and clinical attachment level significantly increased in the high antibody group. (bvsalud.org)
  • When differences were detected, sites treated with minocycline ointment always produced statistically significantly greater reductions than sites which received the vehicle control. (arctichealth.org)
  • The microbiological tests have the potential to support the diagnosis of various forms of periodontal disease, to serve as indicators of disease initiation and progression and to determine which periodontal sites are at higher risk for active destruction. (dentalnews.com)
  • The reduction of bleeding on probing scores was 86.4% and 40.9%, the decrease of probing depth was 2.25 mm and 1.19 mm and the gain of clinical attachment level was 2.04 mm and 0.64 mm for test and control groups, respectively, over the 12-month period. (unito.it)
  • Attachment in adolescence: A move to the level of emotion regulation. (levitra2020.site)
  • Prognosis periodontal treatment Once all of the steps of the treatment plan have been carried out, the microbiological test is then repeated to certify that the mouth has regained a healthy ecosystem, hence showing a clear prevalence of saprophytes and a level of percentage of pathogens that the immune system is able to easily manage. (panlodowegoogrodu.pl)
  • If the follow experiences directions, acne medication with accutane swelling of the level, antibiotics or voorhoofd or has lantana promiseit, contact the cjd about, as these are teeth of an microbiological broad-spectrum. (minestudio.com.my)
  • Standardised pin site protocols which encompass an understanding of external fixator biomechanics and meticulous surgical technique during pin and wire insertion, postoperative pin site care and pin removal could limit the incidence of major infections and treatment failures. (springer.com)
  • Conjugation was used to deliver the attC sites in single-stranded form. (nih.gov)
  • Candidate probiont Pseudoalteromonas AP5 reduced the attachment ability of Vibrio alginolyticus when added before the pathogen and partially out-competed the pathogen for attachment sites when added second. (openthesis.org)
  • or =5 mm, a mean reduction in probing depth of 1.9 mm was seen in the test sites, versus 1.2 mm in the control sites. (arctichealth.org)
  • To test this further and to identify the φBT1 attB site, we performed vectorette PCR (Sigma-Genosys) extending outwards from the φBT1 DNA into the host DNA in an S. coelicolor φBT1 lysogen. (asm.org)
  • Mean values were obtained and Wilcoxon and paired sample t tests were used to compare the test and control sites. (ufrgs.br)
  • Test sites received scaling and root planing along with green tea catechin strips and control sites received scaling and root planning alone. (jisponline.com)
  • Despite their wide use and clear advantages, it has been reported that integration of these vectors into the φC31 attB site can cause detrimental effects on antibiotic production in some strains ( 2 ). (asm.org)
  • The reported reductions in antibiotic synthesis could be caused by insertional mutagenesis into SCO3798 or by integration into one of the pseudo- attB sites or some other factor. (asm.org)
  • Another potential problem with integrating vectors could be the absence of an efficiently recognized attB site in some streptomycete strains. (asm.org)
  • Indeed, Saccharopolyspora erythraea appears to lack a φC31 attB site (P. Leadlay, personal communication). (asm.org)
  • Doxycycline should soon be used in doxycycline pets humans regimens or in ill vesicles where it can result in microbiological stroke staining of compositions and have fetal prescriptions on female doctor infinity. (gastro-service-info.de)
  • The difference in reduction of PPD between Pg-pos and Pg-neg patients was particularly evident with respect to the changes in % of sites with a probing pocket depth greater than or equal to5 mm. (rug.nl)
  • Two sites in each patient were selected for microbial samples: a mesio-facial aspect of the maxillary right first molar (defined as constant site, CS) and a site with the greatest probing depth (defined as deepest site, DS). (unipi.it)
  • Fourteen patients with two sites in the contralateral quadrants with probing pocket depth of 5−8mm were selected. (jisponline.com)
  • Thus, the relation between autotrophic N2-fixation and heterotrophic activity (uptake of radiolabeld Leucine) was determined and compared with TEP concentration measurements to elucidate how production and fate of TEP may be altered due to short term responses to acidification.We observed that the amount of TEP as well as microbiological activities were sensitive to changes in pCO2. (awi.de)
  • Our results suggest that the 58.5-kDa GroEL HSP of H. ducreyi is responsible for the attachment of this bacterium to the majority of the tested glycosphingolipids, and thus represents a potential bacterial adhesin. (gu.se)
  • RESULTS: The changes over the 10 years with respect to frequency of diseased sites indicated an increased frequency in continuous smokers versus decreased frequencies in former smokers and non-smokers. (arctichealth.org)
  • Pais are often associated with tRNA loci, which may represent target sites for the chromosomal integration of these elements. (meta.org)
  • Furthermore, lysogeny of a dif(-) non-toxigenic V. cholerae with TLC-Knφ1 promoted its subsequent toxigenic conversion through integration of CTXφ into the restored dif site. (nih.gov)
  • Analysis of the integrity of the yecE gene, a possible stx phage integration site in EHEC O157, in the consecutive stx(2)-positive and stx-negative isolates demonstrated that yecE was occupied in stx(2)-positive but intact in stx-negative strains. (unboundmedicine.com)
  • Here we demonstrate that φBT1 integrates into a different attachment site than φC31. (asm.org)
  • We updated the design of this site on December 18, 2017. (clinicaltrials.gov)
  • Nejsum, Lene N. 2017-08-01 00:00:00 To target bacterial pathogens that invade and proliferate inside host cells, it is necessary to design intervention strategies directed against bacterial attachment, cellular invasion and intracellular proliferation. (deepdyve.com)