A species of parasitic nematode usually found in domestic pigs and a few other animals. Human infection can also occur, presumably as result of handling pig manure, and can lead to intestinal obstruction.
A genus of nematodes of the superfamily ASCARIDOIDEA whose species usually inhabit the intestine.
Infection by nematodes of the genus ASCARIS. Ingestion of infective eggs causes diarrhea and pneumonitis. Its distribution is more prevalent in areas of poor sanitation and where human feces are used for fertilizer.
A species of parasitic nematode that is the largest found in the human intestine. Its distribution is worldwide, but it is more prevalent in areas of poor sanitation. Human infection with A. lumbricoides is acquired by swallowing fully embryonated eggs from contaminated soil.
Proteins found in any species of helminth.
Analogs or derivatives of bephenium (N,N-dimethyl-N-(2-phenoxyethyl)benzenemethanaminium).
Any part or derivative of a helminth that elicits an immune reaction. The most commonly seen helminth antigens are those of the schistosomes.
Used formerly as antimicrobial food additive. It causes mutations in many cell cultures and may be carcinogenic.
Agents destructive to parasitic worms. They are used therapeutically in the treatment of HELMINTHIASIS in man and animal.
Deoxyribonucleic acid that makes up the genetic material of helminths.
Substances used in the treatment or control of nematode infestations. They are used also in veterinary practice.
A condition produced in man by the prolonged migration of animal nematode larvae in extraintestinal tissues other than skin; characterized by persistent hypereosinophilia, hepatomegaly, and frequently pneumonitis, commonly caused by Toxocara canis and Toxocara cati.
An antihelminthic drug that has been tried experimentally in rheumatic disorders where it apparently restores the immune response by increasing macrophage chemotaxis and T-lymphocyte function. Paradoxically, this immune enhancement appears to be beneficial in rheumatoid arthritis where dermatitis, leukopenia, and thrombocytopenia, and nausea and vomiting have been reported as side effects. (From Smith and Reynard, Textbook of Pharmacology, 1991, p435-6)
Immunoglobulins produced in a response to HELMINTH ANTIGENS.
A species of parasitic nematode found in the intestine of dogs. Lesions in the brain, liver, eye, kidney, and lung are caused by migrating larvae. In humans, these larvae do not follow normal patterns and may produce visceral larva migrans (LARVA MIGRANS, VISCERAL).
Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.

Nematode pyruvate dehydrogenase kinases: role of the C-terminus in binding to the dihydrolipoyl transacetylase core of the pyruvate dehydrogenase complex. (1/169)

Pyruvate dehydrogenase kinases (PDKs) from the anaerobic parasitic nematode Ascaris suum and the free-living nematode Caenorhabditis elegans were functionally expressed with hexahistidine tags at their N-termini and purified to apparent homogeneity. Both recombinant PDKs (rPDKs) were dimers, were not autophosphorylated and exhibited similar specific activities with the A. suum pyruvate dehydrogenase (E1) as substrate. In addition, the activities of both PDKs were activated by incubation with PDK-depleted A. suum muscle pyruvate dehydrogenase complex (PDC) and were stimulated by NADH and acetyl-CoA. However, the recombinant A. suum PDK (rAPDK) required higher NADH/NAD+ ratios for half-maximal stimulation than the recombinant C. elegans PDK (rCPDK) or values reported for mammalian PDKs, as might be predicted by the more reduced microaerobic mitochondrial environment of the APDK. Limited tryptic digestion of both rPDKs yielded stable fragments truncated at the C-termini (trPDKs). The trPDKs retained their dimeric structure and exhibited substantial PDK activity with the A. suum E1 as substrate, but PDK activity was not activated by incubation with PDK-depleted A. suum PDC or stimulated by elevated NADH/NAD+ or acetyl-CoA/CoA ratios. Direct-binding assays demonstrated that increasing amounts of rCPDK bound to the A. suum PDK-depleted PDC. No additional rCPDK binding was observed at ratios greater than 20 mol of rCPDK/mol of PDC. In contrast, the truncated rCPDK (trCPDK) did not exhibit significant binding to the PDC. Similarly, a truncated form of rCPDK, rCPDK1-334, generated by mutagenesis, exhibited properties similar to those observed for trCPDK. These results suggest that the C-terminus of the PDK is not required for subunit association of the homodimer or catalysis, but instead seems to be involved in the binding of the PDKs to the dihydrolipoyl transacetylase core of the complex.  (+info)

Developmentally regulated telomerase activity is correlated with chromosomal healing during chromatin diminution in Ascaris suum. (2/169)

Telomerase is the ribonucleoprotein complex responsible for the maintenance of the physical ends, or telomeres, of most eukaryotic chromosomes. In this study, telomerase activity has been identified in cell extracts from the nematode Ascaris suum. This parasitic nematode is particularly suited as a model system for the study of telomerase, because it shows the phenomenon of chromatin diminution, consisting of developmentally programmed chromosomal breakage, DNA elimination, and new telomere formation. In vitro, the A. suum telomerase is capable of efficiently recognizing and elongating nontelomeric primers with nematode-specific telomere repeats by using limited homology at the 3' end of the DNA to anneal with the putative telomerase RNA template. The activity of this enzyme is developmentally regulated, and it correlates temporally with the phenomenon of chromatin diminution. It is up-regulated during the first two rounds of embryonic cell divisions, to reach a peak in 4-cell-stage embryos, when three presomatic blastomeres prepare for chromatin diminution. The activity remains high until the beginning of gastrulation, when the last of the presomatic cells undergoes chromatin diminution, and then constantly decreases during further development. In summary, our data strongly argue for a role of this enzyme in chromosome healing during the process of chromatin diminution.  (+info)

Sequence-divergent units of the ABA-1 polyprotein array of the nematode Ascaris suum have similar fatty-acid- and retinol-binding properties but different binding-site environments. (3/169)

Polyproteins comprise long polypeptides that are post-translationally cleaved into proteins of different function, or tandemly repetitive polypeptides which are processed into multiple versions of proteins which are presumed to have the same function. In the latter case the individual units of the polyprotein can differ substantially in sequence. Identity of function between the different units therefore cannot be assumed. Here we have examined the ABA-1 polyprotein allergen of the parasitic nematode Ascaris suum and found it to contain units which show a 50% difference in amino acid sequence. The parasite therefore produces at least two radically different forms of the allergen encoded within the polyprotein array. In fluorescence-based ligand-binding assays, recombinant polypeptides representing the two forms (designated ABA-1A1 and ABA-1B1) showed similar binding affinities for a range of fluorescent active-site probes [retinol, dansylundecanoic acid, dansyl-DL-alpha-amino-octanoic acid, cis-parinaric acid (cPnA)] and for the non-specific hydrophobic surface probe 8-anilinonaphthalene-1-sulphonic acid. However, the molecular environments in the active sites are markedly different, as indicated by disparate fluorescence emission peaks and intensities of bound probes. CD showed that the proteins have similar secondary structures but differ in susceptibility to chemical denaturation/unfolding by guanidinium chloride. Both retain a single conserved tryptophan residue in a characteristic non-polar environment, as revealed by extreme fluorescence blue shift. Thus the gross differences in sequence of the two proteins are not reflected in their ligand-binding specificities but in their binding-site environments.  (+info)

Effect of an orally active Th1/Th2 balance modulator, M50367, on IgE production, eosinophilia, and airway hyperresponsiveness in mice. (4/169)

We have found a novel anti-allergic agent, M50367, which suppresses IgE biosynthesis and eosinophil accumulation in vivo. In this study, we evaluated the ability of M50367 to modulate Th1/Th2 balance in Th2-background BALB/c mice and to inhibit airway hyperresponsiveness in a murine model of atopic asthma. Oral M50367 at 3-30 mg/kg/day exhibited 51 to 73% reduction of IL-4/IL-5 production and 2- to 5-fold augmentation of IFN-gamma production by Ag-stimulated cultured splenocytes of the mice sensitized with DNP-Ascaris. These alterations in Th1/Th2 cytokine production were accompanied by 55-85% suppression of plasma IgE level. Oral M50367 at a dose of 10 mg/kg/day significantly inhibited Ig-independent peritoneal eosinophilia by 54%, which was induced by repeated i.p. injections of Ascaris suum extract. To develop airway hyperresponsiveness caused by allergic airway inflammation, BALB/c mice were sensitized with i.p. OVA injections, followed three times by OVA inhalation. Oral M50367 significantly inhibited the increase in airway reactivity to acetylcholine, together with the elevation of plasma IgE level and pulmonary eosinophilia, which were observed in vehicle-treated mice 1 day after the last inhalation. Moreover, M50367 treatment reduced IL-4 and IL-5 production and tended to enhance IFN-gamma production, not only by cultured splenocytes, but also in bronchoalveolar lavage fluid. These results suggest that M50367 has a modulating ability of Th1/Th2 balance to down-regulate Th2 response in the circulating system as well as at the sites of inflammation, and may be beneficial for the treatment of allergic disorders such as atopic asthma.  (+info)

Localized depolymerization of the major sperm protein cytoskeleton correlates with the forward movement of the cell body in the amoeboid movement of nematode sperm. (5/169)

The major sperm protein (MSP)-based amoeboid motility of Ascaris suum sperm requires coordinated lamellipodial protrusion and cell body retraction. In these cells, protrusion and retraction are tightly coupled to the assembly and disassembly of the cytoskeleton at opposite ends of the lamellipodium. Although polymerization along the leading edge appears to drive protrusion, the behavior of sperm tethered to the substrate showed that an additional force is required to pull the cell body forward. To examine the mechanism of cell body movement, we used pH to uncouple cytoskeletal polymerization and depolymerization. In sperm treated with pH 6.75 buffer, protrusion of the leading edge slowed dramatically while both cytoskeletal disassembly at the base of the lamellipodium and cell body retraction continued. At pH 6.35, the cytoskeleton pulled away from the leading edge and receded through the lamellipodium as its disassembly at the cell body continued. The cytoskeleton disassembled rapidly and completely in cells treated at pH 5.5, but reformed when the cells were washed with physiological buffer. Cytoskeletal reassembly occurred at the lamellipodial margin and caused membrane protrusion, but the cell body did not move until the cytoskeleton was rebuilt and depolymerization resumed. These results indicate that cell body retraction is mediated by tension in the cytoskeleton, correlated with MSP depolymerization at the base of the lamellipodium.  (+info)

1H NMR investigation of the distal hydrogen bonding network and ligand tilt in the cyanomet complex of oxygen-avid Ascaris suum hemoglobin. (6/169)

The O(2)-avid hemoglobin from the parasitic nematode Ascaris suum exhibits one of the slowest known O(2) off rates. Solution (1)H NMR has been used to investigate the electronic and molecular structural properties of the active site for the cyano-met derivative of the recombinant first domain of this protein. Assignment of the heme, axial His, and majority of the residues in contact with the heme reveals a molecular structure that is the same as reported in the A. suum HbO(2) crystal structure (Yang, J., Kloek, A., Goldberg, D. E., and Mathews, F. S. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 4224-4228) with the exception that the heme in solution is rotated by 180 degrees about the alpha,gamma-meso axis relative to that in the crystal. The observed dipolar shifts, together with the crystal coordinates of HbO(2), provide the orientation of the magnetic axes in the molecular framework. The major magnetic axis, which correlates with the Fe-CN vector, is found oriented approximately 30 degrees away from the heme normal and indicates significant steric tilt because of interaction with Tyr(30)(B10). The three side chain labile protons for the distal residues Tyr(30)(B10) and Gln(64)(E7) were identified, and their relaxation, dipolar shifts, and nuclear Overhauser effects to adjacent residues used to place them in the distal pocket. It is shown that these two distal residues exhibit the same orientations ideal for H bonding to the ligand and to each other, as found in the A. suum HbO(2) crystal. It is concluded that the ligated cyanide participates in the same distal H bonding network as ligated O(2). The combination of the strong steric tilt of the bound cyanide and slow ring reorientation of the Tyr(30)(B10) side chain supports a crowded and constrained distal pocket.  (+info)

Effect of the injection of an extract of Ascaris suum on macrophage activation during the early phase of Mycobacterium bovis BCG infection in C57Bl/6 mice. (7/169)

Injection of an Ascaris suum extract (Asc) affects both the humoral and cellular immune responses to unrelated antigens when it is co-administered with these antigens. In the present study we evaluated the effect of Asc on macrophage activation in the early phase of Mycobacterium bovis BCG (Pasteur strain TMCC 1173) infection in C57Bl/6 mice. C57Bl/6 mice were injected intraperitoneally (ip) with 0.1 mg BCG (BCG group) or BCG plus 1 mg Asc (BCG + Asc group). The peritoneal exudates were obtained at 2, 7 and 14 days after infection. The numbers of IFN-gamma-secreting cells were assessed by the ELISPOT assay. Nitric oxide (NO) production was measured by the Griess method and by the evaluation of NADPH diaphorase activity in the peritoneal exudates. The administration of Asc extract increased NADPH diaphorase activity (2 days: control = 0, BCG = 7%, BCG + Asc = 13%, and Asc = 4%; 7 days: control = 4, BCG = 13%, BCG + Asc = 21%, and Asc = 4.5%) and TNF-alpha levels (mean +/- SD; 2 days: control = 0, BCG = 169 +/- 13, BCG + Asc = 202 +/- 37, and Asc = 0; 7 days: control = 0, BCG = 545 +/- 15.5, BCG + Asc = 2206 +/- 160.6, and Asc = 126 +/- 26; 14 days: control = 10 +/- 1.45, BCG = 9 +/- 1.15, BCG + Asc = 126 +/- 18, and Asc = 880 +/- 47.67 pg/ml) in the early phase of BCG infection. Low levels of NO production were detected at 2 and 7 days after BCG infection, increasing at 14 days (mean +/- SD; 2 days: control = 0, BCG = 3.7 +/- 1.59, BCG + Asc = 0.82 +/- 0.005, Asc = 0.48 +/- 0.33; 7 days: control = 0, BCG = 2.78 +/- 1.54, BCG + Asc = 3.07 +/- 1.05, Asc = 0; 14 days: control = 0, BCG = 9.05 +/- 0.53, BCG + Asc = 9.61 +/- 0.81, Asc = 10.5 +/- 0.2 (2 x 10(6)) cells/ml). Furthermore, we also observed that Asc co-injection induced a decrease of BCG-colony-forming units (CFU) in the spleens of BCG-infected mice during the first week of infection (mean +/- SD; 2 days: BCG = 1.13 +/- 0.07 and BCG + Asc = 0.798 +/- 0.305; 7 days: BCG = 1.375 +/- 0. 194 and BCG + Asc = 0.548 +/- 0.0226; 14 days: BCG = 0.473 +/- 0.184 and BCG + Asc = 0.675 +/- 0.065 (x 10(2)) CFU). The present data suggest that Asc induces the enhancement of the immune response in the early phase of BCG infection.  (+info)

Phosphocholine-containing, zwitterionic glycosphingolipids of adult Onchocerca volvulus as highly conserved antigenic structures of parasitic nematodes. (8/169)

Human Onchocerca volvulus infection sera were found to recognize zwitterionic glycolipids of O. volvulus and to cross-react with those of other parasitic nematodes (Ascaris suum, Setaria digitata and Litomosoides sigmodontis). By the use of an epitope-specific monoclonal antibody, zwitterionic glycolipids of all these nematode species were observed to contain the antigenic determinant phosphocholine. A hyperimmune serum specific for arthro-series glycolipid structures reacted with the various neutral glycolipids of all these nematodes, which demonstrated that their oligosaccharide moieties belonged to the arthro-series of protostomial glycolipids. These results indicated that arthro-series glycosphingolipids carrying, in part, phosphocholine substituents, represent highly conserved, antigenic glycolipid markers of parasitic nematodes. Three glycolipid components of the O. volvulus zwitterionic fraction were structurally characterized by matrix-assisted laser-desorption/ionization time-of-flight MS, methylation analysis and exoglycosidase treatment. Their chemical structures were elucidated to be phosphocholine-6GlcNAc(beta1-3)Man(beta1-4)Glc(1-1)ceramide, GalNAc(beta1-4)[phosphocholine-6]GlcNAc(beta1-3)Man(beta1-4)Glc(1-1) ceramide and Gal(alpha1-3)GalNAc(beta1-4)[phosphocholine-6]GlcNAc(beta1-3)Man(beta 1-4)Glc(1-1)ceramide for the zwitterionic ceramide tri-, tetra- and penta-hexosides respectively. The ceramide composition was found to be dominated by 2-hydroxylated docosanoic (C(22h:0)), tricosanoic (C(23h:0)) and tetracosanoic (C(24h:0)) acids, and C(17) sphingosine (C(d17:1)) (where (h) is hydroxylated and (d) is dihydroxylated).  (+info)

'Ascaris suum' is a species of roundworm that primarily infects pigs, although it can also rarely infect humans. It is a type of parasitic nematode that lives in the intestines of its host and obtains nutrients from ingested food. The adult female worm can grow up to 40 cm in length and produces thousands of eggs every day. These eggs are passed in the feces of infected animals and can survive in the environment for years, making them a significant source of infection for other pigs or humans who come into contact with them.

In pigs, 'Ascaris suum' infection can cause a range of symptoms, including diarrhea, vomiting, and stunted growth. In severe cases, it can lead to intestinal blockages or pneumonia. Humans who become infected with 'Ascaris suum' typically experience milder symptoms, such as abdominal pain, coughing, and wheezing. However, in rare cases, the infection can cause more serious complications, particularly if the worms migrate to other parts of the body.

Preventing 'Ascaris suum' infection involves good hygiene practices, such as washing hands thoroughly after handling animals or coming into contact with soil that may contain infected feces. It is also important to properly cook pork before eating it and to avoid consuming raw or undercooked meat. In areas where 'Ascaris suum' is common, deworming programs for pigs can help reduce the risk of infection for both animals and humans.

'Ascaris' is a genus of parasitic roundworms that are known to infect the human gastrointestinal tract. The two species that commonly infect humans are Ascaris lumbricoides (also known as the "large roundworm") and Ascaris suum (the "pig roundworm").

Human infection with Ascaris lumbricoides typically occurs through the ingestion of contaminated food or water containing the worm's eggs. Once inside the human body, these eggs hatch into larvae, which migrate through various tissues before reaching the small intestine, where they mature into adult worms. Adult female worms can grow up to 20-35 cm in length and produce thousands of eggs per day, which are then excreted in feces and can contaminate the environment, perpetuating the transmission cycle.

Symptoms of ascariasis (the infection caused by Ascaris) can range from mild to severe, depending on the number of worms present and the individual's overall health status. Light infections may not cause any symptoms, while heavy infections can lead to abdominal pain, nausea, vomiting, diarrhea, and intestinal obstruction. In some cases, Ascaris worms may migrate to unusual locations such as the lungs or bile ducts, causing additional complications.

Preventive measures include improving sanitation and hygiene practices, such as handwashing with soap and water, proper disposal of human feces, and cooking food thoroughly before consumption. Treatment typically involves administration of anthelmintic medications that kill the worms, followed by appropriate follow-up care to ensure complete eradication of the infection.

Ascariasis is a medical condition caused by infection with the parasitic roundworm Ascaris lumbricoides. This type of worm infection, also known as intestinal ascariasis, occurs when people ingest contaminated soil, food, or water that contains Ascaris eggs. Once inside the body, these eggs hatch into larvae, which then migrate through the tissues and eventually reach the small intestine, where they mature into adult worms.

The adult worms can grow to be several inches long and live in the small intestine, where they feed on partially digested food. Female worms can produce thousands of eggs per day, which are then passed out of the body in feces. If these eggs hatch and infect other people, the cycle of infection continues.

Symptoms of ascariasis can vary depending on the severity of the infection. Mild infections may not cause any symptoms, while more severe infections can lead to abdominal pain, nausea, vomiting, diarrhea, and weight loss. In some cases, the worms can cause intestinal blockages or migrate to other parts of the body, leading to potentially serious complications.

Treatment for ascariasis typically involves medication to kill the adult worms and prevent them from producing more eggs. Preventive measures include good hygiene practices, such as washing hands thoroughly after using the bathroom and before eating, and avoiding contact with contaminated soil or water.

'Ascaris lumbricoides' is the medical term for a type of intestinal roundworm that can infect humans. This parasitic worm is one of the largest that can infest humans, and it is particularly prevalent in areas with poor sanitation and hygiene.

The life cycle of Ascaris lumbricoides begins when an infected person passes eggs in their feces. These eggs can then be ingested through contaminated food or water, or by accidentally ingesting soil that contains the eggs. Once inside the body, the larvae hatch from the eggs and migrate through the tissues to the lungs, where they mature further. They are then coughed up and swallowed, entering the digestive system again, where they mature into adult worms.

Adult female Ascaris lumbricoides worms can grow up to 20-35 cm in length, while males are smaller, typically around 15-30 cm. They live in the small intestine and feed on partially digested food. Females can lay tens of thousands of eggs per day, which are passed in the feces and can infect other people if they come into contact with them.

Symptoms of ascariasis (the infection caused by Ascaris lumbricoides) can vary depending on the number of worms present and the severity of the infestation. Mild infections may cause no symptoms at all, while more severe infections can lead to abdominal pain, nausea, vomiting, diarrhea, and weight loss. In rare cases, the worms can cause intestinal obstruction or migrate to other parts of the body, leading to serious complications.

Treatment for ascariasis typically involves medication to kill the worms, such as albendazole or mebendazole. Preventing infection requires good hygiene practices, including washing hands thoroughly with soap and water after using the toilet and before eating, and avoiding contact with contaminated soil or water.

Helminth proteins refer to the proteins that are produced and expressed by helminths, which are parasitic worms that cause diseases in humans and animals. These proteins can be found on the surface or inside the helminths and play various roles in their biology, such as in development, reproduction, and immune evasion. Some helminth proteins have been identified as potential targets for vaccines or drug development, as blocking their function may help to control or eliminate helminth infections. Examples of helminth proteins that have been studied include the antigen Bm86 from the cattle tick Boophilus microplus, and the tetraspanin protein Sm22.6 from the blood fluke Schistosoma mansoni.

Bephenium compounds are a type of anti-parasitic drug that is primarily used to treat intestinal infections caused by parasites such as worms. The most common bephenium compound is bephenium hydroxynaphthoate, which works by paralyzing and eliminating the parasites from the body. These compounds were widely used in the past, but their use has decreased with the development of more modern anti-parasitic drugs. They are still available in some parts of the world as an over-the-counter or prescription medication. As with any medication, bephenium compounds should only be used under the guidance of a healthcare professional, and it's important to follow the recommended dosage and duration of treatment.

Helminth antigens refer to the proteins or other molecules found on the surface or within helminth parasites that can stimulate an immune response in a host organism. Helminths are large, multicellular parasitic worms that can infect various tissues and organs in humans and animals, causing diseases such as schistosomiasis, lymphatic filariasis, and soil-transmitted helminthiases.

Helminth antigens can be recognized by the host's immune system as foreign invaders, leading to the activation of various immune cells and the production of antibodies. However, many helminths have evolved mechanisms to evade or suppress the host's immune response, allowing them to establish long-term infections.

Studying helminth antigens is important for understanding the immunology of helminth infections and developing new strategies for diagnosis, treatment, and prevention. Some researchers have also explored the potential therapeutic use of helminth antigens or whole helminths as a way to modulate the immune system and treat autoimmune diseases or allergies. However, more research is needed to determine the safety and efficacy of these approaches.

Furylfuramide is not typically considered a medical term, but it is a chemical compound that has been used in research and industry. It's a type of antimicrobial agent known as an nitrofuran derivative. However, it is not commonly used in clinical medicine due to concerns about its potential toxicity and the development of resistance in bacteria.

In a medical context, Furylfuramide might be mentioned in relation to laboratory research or in discussions of historical uses of antimicrobial agents. It's important to note that the use of this compound in medicine is not widespread and has largely been replaced by other more effective and safer treatments.

Anthelmintics are a type of medication used to treat infections caused by parasitic worms, also known as helminths. These medications work by either stunting the growth of the worms, paralyzing them, or killing them outright, allowing the body to expel the worms through normal bodily functions. Anthelmintics are commonly used to treat infections caused by roundworms, tapeworms, flukeworms, and hookworms. Examples of anthelmintic drugs include albendazole, mebendazole, praziquantel, and ivermectin.

Helminth DNA refers to the genetic material found in parasitic worms that belong to the phylum Platyhelminthes (flatworms) and Nematoda (roundworms). These parasites can infect various organs and tissues of humans and animals, causing a range of diseases.

Helminths have complex life cycles involving multiple developmental stages and hosts. The study of their DNA has provided valuable insights into their evolutionary history, genetic diversity, and mechanisms of pathogenesis. It has also facilitated the development of molecular diagnostic tools for identifying and monitoring helminth infections.

Understanding the genetic makeup of these parasites is crucial for developing effective control strategies, including drug discovery, vaccine development, and disease management.

Antinematodal agents are a type of medication used to treat infections caused by nematodes, which are also known as roundworms. These agents work by either killing the parasitic worms or preventing them from reproducing. Some examples of antinematodal agents include albendazole, ivermectin, and mebendazole. These medications are used to treat a variety of nematode infections, such as ascariasis, hookworm infection, and strongyloidiasis. It is important to note that the use of antinematodal agents should be under the guidance of a healthcare professional, as they can have side effects and may interact with other medications.

Visceral Larva Migrans is a parasitic infection caused by the migration of the larval stage of certain nematode roundworms, such as Toxocara spp. (most commonly Toxocara canis or Toxocara cati), through the tissues of the host. The larvae are ingested, usually through the consumption of contaminated soil, water, or undercooked meat, and then penetrate the intestinal wall, entering the bloodstream and migrating to various organs, including the liver, lungs, central nervous system, and eyes. This condition is more commonly seen in children due to their higher likelihood of engaging in pica (the consumption of soil or other non-food items) and having close contact with pets that may carry these parasites. Symptoms can vary widely depending on the organs involved but often include fever, coughing, wheezing, abdominal pain, and skin rashes. In severe cases, it can lead to potentially life-threatening complications such as blindness or neurological damage. Diagnosis typically involves a combination of clinical presentation, imaging studies, and laboratory tests, such as serology or stool examination for parasite eggs. Treatment usually consists of anthelmintic medications to eliminate the parasites and supportive care to manage symptoms.

Levamisole is an anthelmintic medication used to treat parasitic worm infections. It works by paralyzing the worms, allowing the body to remove them from the system. In addition, levamisole has been used in veterinary medicine as an immunomodulator, a substance that affects the immune system.

In human medicine, levamisole was previously used in the treatment of colon cancer and autoimmune disorders such as rheumatoid arthritis. However, its use in these areas has largely been discontinued due to side effects and the availability of more effective treatments.

It is important to note that levamisole has also been identified as a common adulterant in cocaine, which can lead to various health issues, including agranulocytosis (a severe decrease in white blood cells), skin lesions, and neurological symptoms.

Antibodies are proteins produced by the immune system in response to the presence of a foreign substance, known as an antigen. They are capable of recognizing and binding to specific antigens, neutralizing or marking them for destruction by other immune cells.

Helminths are parasitic worms that can infect humans and animals. They include roundworms, tapeworms, and flukes, among others. Helminth infections can cause a range of symptoms, depending on the type of worm and the location of the infection.

Antibodies to helminths are produced by the immune system in response to an infection with one of these parasitic worms. These antibodies can be detected in the blood and serve as evidence of a current or past infection. They may also play a role in protecting against future infections with the same type of worm.

There are several different classes of antibodies, including IgA, IgD, IgE, IgG, and IgM. Antibodies to helminths are typically of the IgE class, which are associated with allergic reactions and the defense against parasites. IgE antibodies can bind to mast cells and basophils, triggering the release of histamine and other inflammatory mediators that help to protect against the worm.

In addition to IgE, other classes of antibodies may also be produced in response to a helminth infection. For example, IgG antibodies may be produced later in the course of the infection and can provide long-term immunity to reinfection. IgA antibodies may also be produced and can help to prevent the attachment and entry of the worm into the body.

Overall, the production of antibodies to helminths is an important part of the immune response to these parasitic worms. However, in some cases, the presence of these antibodies may also be associated with allergic reactions or other immunological disorders.

"Toxocara canis" is a species of roundworm that primarily infects canids, such as dogs and foxes. The adult worms live in the intestines of the host animal, where they lay eggs that are passed in the feces. These eggs can then mature and become infective to other animals, including humans, if they ingest them.

In humans, infection with "Toxocara canis" can cause a range of symptoms known as toxocariasis, which can include fever, coughing, wheezing, rash, and abdominal pain. In severe cases, the larvae of the worm can migrate to various organs in the body, including the eyes, leading to potentially serious complications.

Preventive measures for "Toxocara canis" infection include good hygiene practices, such as washing hands after handling pets or coming into contact with soil that may contain infected feces, and regular deworming of pets.

RNA (Ribonucleic acid) is a single-stranded molecule that plays a crucial role in the process of gene expression. It acts as a messenger carrying genetic information copied from DNA to the ribosomes, where proteins are synthesized. RNA is also involved in catalyzing chemical reactions and regulating gene expression.

Helminths, on the other hand, refer to parasitic worms that infect humans and animals. They belong to various phyla, including Nematoda (roundworms), Platyhelminthes (flatworms), and Acanthocephala (spiny-headed worms). Helminth infections can cause a range of diseases and conditions, such as intestinal inflammation, anemia, stunted growth, and cognitive impairment.

There is no medical definition for "RNA, Helminth" since RNA is a type of molecule found in all living organisms, including helminths. However, researchers have studied the genetic material of various helminth species to better understand their biology, evolution, and pathogenesis. This includes sequencing and analyzing the RNA transcriptome of these parasites, which can provide insights into their gene expression patterns and help identify potential drug targets for developing new treatments.

"Are Ascaris lumbricoides and Ascaris suum a single species?". Parasites & Vectors. 5: 42. doi:10.1186/1756-3305-5-42. PMC ... A. suum is distributed worldwide and grows up to 40 cm (16 in) in length. Ascaris infections are treated with ascaricides. A. ... Ascaris suum, also known as the large roundworm of pig, is a parasitic nematode that causes ascariasis in pigs. While ... Pigs get infected with A. suum by ingesting infectious parasite eggs that are present in the environment. The larvae of Ascaris ...
Ascaris suum, pig-infecting giant roundworm, closely related to human-infecting giant roundworm Ascaris lumbricoides (2011) ... October 2011). "Ascaris suum draft genome". Nature. 479 (7374): 529-33. Bibcode:2011Natur.479..529J. doi:10.1038/nature10553. ...
The morphologically similar Ascaris suum was described from pigs by Johann August Ephraim Goeze in 1782. Male Ascaris cross ... One species, Ascaris lumbricoides, affects humans and causes the disease ascariasis. Another species, Ascaris suum, typically ... Leles D, Gardner SL, Reinhard K, Iniguez A, Araujo A (2012). "Are Ascaris lumbricoides and Ascaris suum a single species?". ... section 200x Esophagus of an Ascaris worm Ascaris cross section 40× Ascaris cross section 40× Ascaris cross section 400× List ...
In pigs, the infection is caused by Ascaris suum. It is characterized by poor weight gain, leading to financial losses for the ... Ascaris lumbricoides adult worms Ascaris egg, incubation process: The Ascaris egg incubation process consists of placing the ... Prophylactic activity in a mouse-ascaris suum test model". The Journal of Parasitology. 57 (3): 487-93. doi:10.2307/3277899. ... The larva of Ascaris lumbricoides developing in the egg Ascaris lumbricoides adult worms (with measuring tape for scale) ...
Müller S, Walter RD (April 1992). "Purification and characterization of polyamine oxidase from Ascaris suum". The Biochemical ...
It has been proposed that Ascaris lumbricoides and Ascaris suum (pig roundworm) are the same species. Ascaris lumbricoides, a ... ISBN 0-85198-689-7. Ascaris lumbricoides Video - DAVE Project Ascaris lumbricoides Poll - Research Ascaris lumbricoides image ... "Are Ascaris lumbricoides and Ascaris suum a single species?". Parasites & Vectors. 5: 42. doi:10.1186/1756-3305-5-42. ISSN 1756 ... Ascaris lumbricoides is a large parasitic worm that causes ascariasis in humans. A roundworm of genus Ascaris, it is the most ...
"Crystal structure of mitochondrial quinol-fumarate reductase from the parasitic nematode Ascaris suum". Journal of Biochemistry ...
Morphine increases the latency of this defensive response in the parasitic Ascaris suum. In a study on the effects of opiates ... "The effect of opiates and opiate antagonists on heat latency response in the parasitic nematode Ascaris suum". Life Sciences. ...
Ascaris suum) infections; aid in the prevention of establishment of nodular worm (Oesophagostomum) infections. In animal models ...
In Ascaris suum, two MSP-fiber proteins (MFP), MFP1 and 2, with opposite effect on polymerization have been identified. MFP1 ... Molecular structures of MSP from Ascaris suum and Caenorhabditis elegans have been determined by X-ray crystallography and NMR ... of Ascaris suum". J. Mol. Biol. 263 (2): 284-96. doi:10.1006/jmbi.1996.0575. PMID 8913307. Haaf A, LeClaire L, Roberts G, Kent ... of Ascaris suum - evidence for two manganese binding sites and the possible role of divalent cations in filament formation". J ...
Ligocka, A.; Paluszak, Z. (2009). "Effectiveness of different sanitisation technologies on the inactivation of Ascaris suum ... There is also evidence that mesophilic (ambient temperature) fermentation kills eggs of the Ascaris worm - a parasite of humans ...
This infection established a baseline case or index case for Ascaris suum infection in humans. Doctors had originally consulted ... and eosinophilia due to Ascaris suum infestation in man, The New England Journal of Medicine, 286, 965-970 The Illicit Use of ... There was expert evidence before the court consistent with the presence of ascaris larvae in the bodies of two of the ...
Nematodes causing such zoonotic infections are Baylisascaris procyonis, Toxocara canis, Toxocara cati, and Ascaris suum. These ... "Pulmonary Lesions Associated with Visceral Larva Migrans Due to Ascaris suum or Toxocara canis: Imaging of Six Cases". American ...
Roepstorff A, Murrell KD (May 1997). "Transmission dynamics of helminth parasites of pigs on continuous pasture: Ascaris suum ...
A possible mechanism for the action of the novel anthelmintic emodepside, using Ascaris suum body wall muscle preparations - ... "The effect of the anthelmintic emodepside at the neuromuscular junction of the parasitic nematode Ascaris suum". Parasitology. ... inhibiting muscle in the parasitic nematode Ascaris sum, and inhibiting locomotive and pharyngeal movement in Caenorhabditis ...
In its native habitat, this species preys on eggs of the parasite Ascaris suum, which survive and develop after passage through ... The role of mollusks as benthos components in purification of water bodies from Ascaris suum eggs. Paraziologiya 9(5):432-433. ...
"N-Glycans of the porcine nematode parasite Ascaris suum are modified with phosphorylcholine and core fucose residues". FEBS ... have been reports documenting the expression of paucimannosidic glycans by others parasitic nematodes such as Ascaris suum, ...
"The effect of opiates and opiate antagonists on heat latency response in the parasitic nematode Ascaris suum". Life Sciences. ...
In some eukaryotes, such as the parasitic worm Ascaris suum, an enzyme similar to complex II, fumarate reductase (menaquinol: ... "Role of complex II in anaerobic respiration of the parasite mitochondria from Ascaris suum and Plasmodium falciparum". Biochim ...
"Crystal Structure of the Malic Enzyme from Ascaris suum Complexed with Nicotinamide Adenine Dinucleotide at 2.3 Å Resolution". ...
Ascaris suum). PI-3 occupies the active site of pepsin using its N-terminal residues and thereby blocks substrate binding. ... August 2000). "Structural basis for the inhibition of porcine pepsin by Ascaris pepsin inhibitor-3". Nature Structural Biology ...
... identification of extracts with potent activity against Ascaris suum in vitro". Parasite. 23: 24. doi:10.1051/parasite/2016024 ... showed than ethanolic extracts of Clausena anisata have in vitro anthelmintic properties against the nematode Ascaris suum, a ...
An antibacterial peptide from Ascaris suum, a parasitic nematode that resides in the pig intestine, also belongs to this family ...
... zanthoxyloides have in vitro anthelmintic properties against the nematode Ascaris suum, a swine parasite that is closely ... identification of extracts with potent activity against Ascaris suum in vitro". Parasite. 23: 24. doi:10.1051/parasite/2016024 ...
Komuniecki R, McCrury J, Thissen J, Rubin N (1989). "Electron-transfer flavoprotein from anaerobic Ascaris suum mitochondria ...
... found in some copepods and roundworms such as Ascaris suum, portions of the chromosomes are cast away in particular cells. This ... In A. suum, all the somatic cell precursors undergo chromatin diminution. X-inactivation. The inactivation of one X chromosome ...
... and initiation factors to nematode translation in an Ascaris suum embryo cell-free system". J. Biol. Chem. 279 (44): 45573-85. ...
... of the genus Ascaris (giant intestinal roundworms). The large roundworm of pigs (Ascaris suum) typically infects pigs while ... a flaccid paralyzing agent that causes a blocking response of ascaris muscle to acetylcholine. The narcotizing effect ... Ascaris lumbricoides affects human populations, typically in sub-tropical and tropical areas with poor sanitation. Ascaricides ...
... these isoforms are also found in Ascaris suum and Caenorhabditis elegans. The subunits form a membrane-bound cytochrome b ...
Ascaris suum". J Biol Chem. 260 (8): 4770-4777. doi:10.1016/S0021-9258(18)89138-4. PMID 3988734. Kionka, C.; Kunau, W.H. (1985 ...
"Are Ascaris lumbricoides and Ascaris suum a single species?". Parasites & Vectors. 5: 42. doi:10.1186/1756-3305-5-42. PMC ... A. suum is distributed worldwide and grows up to 40 cm (16 in) in length. Ascaris infections are treated with ascaricides. A. ... Ascaris suum, also known as the large roundworm of pig, is a parasitic nematode that causes ascariasis in pigs. While ... Pigs get infected with A. suum by ingesting infectious parasite eggs that are present in the environment. The larvae of Ascaris ...
Aberrant Ascaris suum Nematode Infection in Cattle, Missouri, USA Holly L. Taylor, Sean T. Spagnoli, Michael J. Calcutt, and ... Multiple cross-section of Ascaris suum nematode larvae in the lung of cattle. Larvae have prominent lateral alae and lateral ... Aberrant Ascaris suum Nematode Infection in Cattle, Missouri, USA. ...
Studies on chloride in the muscle bag cells of Ascaris suum. The resting membrane potential of Ascaris muscle bag cells is ... Parri, Harri Rheinallt (1991) Studies on chloride in the muscle bag cells of Ascaris suum. University of Southampton, Doctoral ... Studies on chloride in the muscle bag cells of Ascaris suum. ... Incubation of Ascaris sections with the anthelmintic ivermectin ... Incubation of Ascaris sections with the anthelmintic ivermectin (IVM, 10μM) elicited an approximate 2.9mM (15%) increase in ...
... suum found in pigs with A. suum then existing as a persistent ancestor after formation of A. lumbricoides, or 3) Ascaris suum ... Finally, we conclude that Ascaris lumbricoides and A. suum are a single species and that the name A. lumbricoides Linnaeus 1758 ... and Ascaris suum (recorded mostly from pigs) are both valid species, with the two species originating via a speciation event ... Ascaris lumbricoides and A. suum are the same species, this hypothesis being supported by studies showing both low ...
ISSN: 0028-0836 Year of publication: 1965 Volume: 205 Issue: 4975 Pages: 983-985 Type: Article ...
Maintenance of Dispersed Reproductive Cells from Male and Female Ascaris suum Authors. * Michael W. Fleming ... Tissues from the germinative-growth zones of adult Ascaris suum gonads were excised and minced, and then enzymatically ...
After ingestion of Ascaris lumbricoides eggs, larvae hatch in the intestine and penetrate the mesenteric lymphatics and venules ... The original description of Löffler syndrome listed parasitic infection with Ascaris lumbricoides as its most common cause; ... Additionally, eosinophilic pulmonary infiltrates have appeared in mice challenged with a transnasal Ascaris extract. In these ... have a similar cycle to Ascaris, with passage of larval forms through the alveolar walls. These parasites are not orally ...
Ascaris suum, Ascaris spp., Trichostrongylus columbiformis, Globocephalus urosubulatus, Paramphistomum spp., Oesophagostomum ... 117] on collared peccaries with signs of respiratory distress and coughing, Ascaris suum was found in the bile duct and the ... Action of proteases of the namatophagous fungi Pochonia chlamydosporia on Ascaris suum eggs of collared peccary (Pecari tajacu ... Ascaris suum (Goeze, 1782). Proc. Helminthol. Soc. Wash. 1984, 51, 160-161. [Google Scholar] ...
keywords = "Ascaris suum, mitochondrion, tRNA, translation",. author = "Watanabe, {Yoh Ich} and Hiromichi Tsurui and Takuya ... Mitochondrial tRNA(Arg) from a nematode, Ascaris suum, was purified and sequenced at the RNA level. An unmodified adenosine was ... Dive into the research topics of Primary sequence of mitochondrial tRNA(Arg) of a nematode Ascaris suum: Occurrence of ... abstract = "Mitochondrial tRNA(Arg) from a nematode, Ascaris suum, was purified and sequenced at the RNA level. An unmodified ...
Ascaris suum-Derived Products Induce Human Neutrophil Activation via a G Protein-Coupled Receptor That Interacts with the ... Ascaris suum-Derived Products Induce Human Neutrophil Activation via a G Protein-Coupled Receptor That Interacts with the ... The effect of products from the nematodes Ascaris suum, Toxocara canis, and Anisakis simplex on human neutrophils were studied ... Body fluids of A. suum (ABF) and T. canis (TcBF) induced strong directional migration, shape change, and intracellular Ca21 ...
People who raise pigs or use raw pig manure as fertilizer may be at risk for infection with Ascaris suum. Many infected pigs do ... Ascariasis caused by Ascaris suum is found in association with pigs. ...
Humans can also be infected by pig roundworm (Ascaris suum). Ascaris lumbricoides (human roundworm) and Ascaris suum (pig ... Ascaris parasites live in the intestine. Ascaris eggs are passed in the feces (poop) of infected people. If an infected person ... It is unknown how many people worldwide are infected with Ascaris suum. ... An estimated 807 million-1.2 billion people in the world are infected with Ascaris lumbricoides (sometimes called just Ascaris ...
LOCALIZED IMMUNITY TO THE LARGE ROUNDWORM ASCARIS SUUM IN SWINE (Proceedings) (20-Aug-01) ...
Effect of Intravenous Histamine, Allergen <i>(Ascaris suum</i> Extract) and Compound 48/80 and Inhaled Allergen- ...
Molecular identification of Ascaris lumbricoides and Ascaris suum recovered from humans and pigs in Thailand, Lao PDR, and ... Comparative analysis of microRNA profiles between adult Ascaris lumbricoides and Ascaris suum. BMC Vet Res. 2014 Apr 27. doi: ... Ascariasis may exist as a zoonotic infection associated with pigs and use of hog manure and is caused by Ascaris suum, [6, 7] ... Ascaris suum: a revision of its early migratory path and implications for human ascariasis. The Journal of Parasitology. 1997 ...
Ascaris suum ; red stomach worm, Hyostrongylus rubidus ; nodular worm, Oesophagostomum spp.; threadworm, Strongyloides ransomi ...
Animal Parasitic Nematodes Ancylostoma caninum Ascaris suum Cooperia oncophora Dictyocaulus viviparus Dirofilaria immitis ... Human Parasitic Nematodes Ancylostoma ceylanicum Ancylostoma duodenale Ascaris lumbricoides Brugia malayi Loa loa Necator ...
The effect of Ascaris suum trickle infections on Oesophagostomum dentatum challenge infection in pigs. Helwigh, B., Christensen ... Possible effects of a primary Schistosoma japonicum infection on a superimposed Ascaris suum infection in pigs. Helwigh, B., ... Possible effects of a primary Schistosoma japonicum infection on a superimposed Ascaris suum infection in pigs. Helwigh, B. & ...
Large Roundworms: (Ascaris suum) Nodular Worms: (Oesophagostomum spp.) Lungworms: (Metastrongylus spp.) Intestinal Threadworms ... Large Roundworms: (Ascaris suum) Nodular Worms: (Oesophago ...
Ascaris suum asu-miR-36d-5p mature miRNA Sequence. 12 - CAGGGAUUCCGCUUUUGGUGACG - 34. ... Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental ...
Quantifying metabolic activity of Ascaris suum L3 using resazurin reduction A. Kundik, Z. D. Musimbi, J. Krücken, T. ...
Immune serum-activated human macrophages coordinate with eosinophils to immobilize Ascaris suum larvae. Parasite Immunology ... Live ascaris in urinary bladder: a case report. Journal of Medical Case Reports 2021; 15(1) doi: 10.1186/s13256-021-03045-4 ... Ascaris Lumbricoides Infestation as an Unexpected Cause of Acute Pancreatitis. Cureus 2020; doi: 10.7759/cureus.12103 ... Identification of Ascaris lumbricoides Eggs within the Pancreas Using Endoscopic Ultrasound. The American Journal of Tropical ...
... identification of extracts with potent activity against Ascaris suum in vitro. Publikation: Bidrag til tidsskrift › ... for in vitro anthelmintic properties against Ascaris suum, a swine parasite that is very closely related to the human A. ... Current treatments for Ascaris infection are based on mass drug administration (MDA) with synthetic anthelmintic drugs such as ...
78] tested the effects of different concentrations of carvacrol on isolated tissues of the large pig nematode Ascaris suum. The ... Interaction of carvacrol with the Ascaris suum nicotinic acetylcholine receptors and gamma-aminobutyric acid receptors, ...
But Ascaris suum (roundworm) continues to persevere on some conventional farms and frequently on farms for niche markets. ...
ovary muscle tissue (human) infected by worm parasites (Ascaris suum). This is disgusting: heart infested by round worms ... Intestinal worms such as intestinal flukes, liver flukes, ascaris and many others invade our bodies and take residence in ...
A novel UV-damaged DNA binding protein emerges during the chromatin-eliminating cleavage period in Ascaris suum. Nucl. Acids ...
Scanning electron microscopy of the eggs of Ascaris lumbricoides, A. suum, Toxocara canis and T. mystax. Journal of ...
Even small numbers of the large roundworm Ascaris suum can depress feed intake and daily gain and cause a depression in gain: ... Most hogs have Ascaris infections during their lifetimes. These roundworms are usually found in greatest numbers in pigs up to ...
Humans can also become infected with Ascaris suum, a roundworm known to infect pigs. However, as the Centers for Disease ... Life cycle of Ascaris: eggs are swallowed and worm larvae hatch in the intestine. They then travel via the blood to the lungs ... The unwelcome worm was found to belong to the Ascaris genus, a group of roundworms. These slimy freeloaders are the most common ... The biggest to infect humans is Ascaris lumbricoides, sometimes called the "giant roundworm", which grows up to 35 centimeters ...
  • Are Ascaris lumbricoides and Ascaris suum a single species? (wikipedia.org)
  • Since the original description and naming of Ascaris lumbricoides from humans by Linnaeus in 1758 and later of Ascaris suum from pigs by Goeze 1782, these species have been considered to be valid. (biomedcentral.com)
  • therefore A. suum Goeze 1782 should be considered a synonym of A. lumbricoides . (biomedcentral.com)
  • Ascaris lumbricoides Linnaeus 1758 is a parasite of Homo sapiens , and Ascaris suum Goeze 1782 occurs in pigs ( Sus scrofa Linnaeus 1758). (biomedcentral.com)
  • Ascaris lumbricoides (usually infecting humans) and Ascaris suum (recorded mostly from pigs) are both valid species. (biomedcentral.com)
  • 2) Ascaris lumbricoides in humans is derived directly from the species A. suum found in pigs with A. suum then existing as a persistent ancestor. (biomedcentral.com)
  • 3) Ascaris suum is derived directly from A. lumbricoides with the persistent ancestor being A. lumbricoides and A. suum being the more newly derived species. (biomedcentral.com)
  • Ascaris lumbricoides and A. suum are conspecific, this hypothesis has support from studies showing both low morphological and low genetic divergence (low genetic distances) in several genes. (biomedcentral.com)
  • Probably the main reason for two accepted species, A. lumbricoides and A. suum , was the finding of adult worms in the intestine of two distinct hosts, humans and pigs. (biomedcentral.com)
  • After ingestion of Ascaris lumbricoides eggs, larvae hatch in the intestine and penetrate the mesenteric lymphatics and venules to enter the pulmonary circulation. (medscape.com)
  • An estimated 807 million-1.2 billion people in the world are infected with Ascaris lumbricoides (sometimes called just Ascaris or ascariasis). (cdc.gov)
  • Ascaris lumbricoides (human roundworm) and Ascaris suum (pig roundworm) are hard to tell apart. (cdc.gov)
  • Usually A lumbricoides or A suum infection is asymptomatic. (medscape.com)
  • Adult Ascaris lumbricoides. (medscape.com)
  • Ascaris lumbricoides is the largest of the common nematodes (roundworms) that infect humans. (medscape.com)
  • Ascaris lumbricoides egg. (medscape.com)
  • Life cycle of Ascaris lumbricoides. (medscape.com)
  • Here, we screened ethanolic extracts from 29 medicinal plants used in Africa (Ghana) and the Caribbean (US Virgin Islands) for in vitro anthelmintic properties against Ascaris suum, a swine parasite that is very closely related to the human A. lumbricoides. (ku.dk)
  • Scanning electron microscopy of the eggs of Ascaris lumbricoides, A. suum, Toxocara canis and T. mystax. (who.int)
  • The biggest to infect humans is Ascaris lumbricoides , sometimes called the " giant roundworm ", which grows up to 35 centimeters (14 inches) in length. (iflscience.com)
  • Ascariasis is infection with Ascaris lumbricoides or occasionally Ascaris suum (a closely related parasite of pigs). (msdmanuals.com)
  • Whether A. suum is a distinct species from A. lumbricoides is debated. (msdmanuals.com)
  • Ascaris suum, also known as the large roundworm of pig, is a parasitic nematode that causes ascariasis in pigs. (wikipedia.org)
  • Multiple cross-section of Ascaris suum nematode larvae in the lung of cattle. (cdc.gov)
  • Mitochondrial tRNA(Arg) from a nematode, Ascaris suum, was purified and sequenced at the RNA level. (elsevierpure.com)
  • Using liquid chromatography and tandem mass spectrometry, the researchers assessed 587 lipids Ascaris suum worms originating from pig hosts, quantifying lipid levels and dynamics across developmental stages in the nasty nematode. (genomeweb.com)
  • In vitro adsorption of globulins onto the cuticle of a nematode was originally reported by Soulsby, who demonstrated this with larvae of Ascaris suum incubated in antisera from animals infected with this parasite. (ajtmh.org)
  • The sequences in this videotape illustrate the unusual crawling motility of the amoeboid sperm of the nematode parasite, Ascaris suum, an intestinal parasite of pigs. (cellimagelibrary.org)
  • Ascaris suum (adults and fourth stage larvae), Ascarops strongylina (adults), Hyostrongylus rubidus (adults and fourth stage larvae), Oesophagostomum spp. (canada.ca)
  • Pigs get infected with A. suum by ingesting infectious parasite eggs that are present in the environment. (wikipedia.org)
  • citation needed] Ascaris eggs can remain infective for years in the soil, even in a temperate climate. (wikipedia.org)
  • An accidental laboratory human infection with Ascaris eggs extracted from pigs was also reported [ 18 ]. (biomedcentral.com)
  • Ascaris eggs are passed in the feces (poop) of infected people. (cdc.gov)
  • Larvae are released from the Ascaris eggs in the small intestine within 4 days of ingestion. (medscape.com)
  • Life cycle of Ascaris: eggs are swallowed and worm larvae hatch in the intestine. (iflscience.com)
  • Humans can also be infected with ascaris ( A. suum ) from pigs when they ingest eggs from handling pigs or from consuming undercooked vegetables or fruits contaminated with pig feces. (msdmanuals.com)
  • Symptoms appear 10-16 days after ingestion of Ascaris eggs. (medscape.com)
  • Chickens were inoculated with A. suum eggs. (edu.vn)
  • Ascaris suum is the worldwide most important intestinal parasite for its great economic losses. (capcess.com)
  • The migration of A. suum larvae through the lungs may cause secondary bacterial infections and result in acute respiratory symptoms in pigs. (wikipedia.org)
  • Ascariasis caused by Ascaris suum is found in association with pigs. (cdc.gov)
  • Humans can also become infected with Ascaris suum , a roundworm known to infect pigs . (iflscience.com)
  • John H. Rockey Intravitreal injection of Toxocara canis and Ascaris suum larvae into guinea pigs is being studied as a model for human ocular toxocariasis. (karger.com)
  • Other parasites, such as Necator americanus, Ancylostoma duodenale, and Strongyloides stercoralis, have a similar cycle to Ascaris, with passage of larval forms through the alveolar walls. (medscape.com)
  • Ascaris parasites live in the intestine. (cdc.gov)
  • In the present study, we conducted a large-scale investigation of TIMP proteins of a range of neglected human parasites including the hookworm Necator americanus , the roundworm Ascaris suum , the liver flukes Clonorchis sinensis and Opisthorchis viverrini , as well as the schistosome blood flukes. (biomedcentral.com)
  • Amongst these parasites, soil-transmitted helminths (STHs), including Ancylostoma duodenale and Necator americanus (hookworms), Ascaris sp. (biomedcentral.com)
  • Therefore, there is still no consensus on infection potential in these two species of Ascaris . (biomedcentral.com)
  • Current treatments for Ascaris infection are based on mass drug administration (MDA) with synthetic anthelmintic drugs such as albendazole, however continual re-infection and the threat of drug resistance mean that complementary treatment options would be highly valuable. (ku.dk)
  • Intraocular Immunoglobulin E Induced by Intravitreal Infection with Ascaris and Toxocara spp. (karger.com)
  • Humans can also be infected by pig roundworm ( Ascaris suum ). (cdc.gov)
  • Even small numbers of the large roundworm Ascaris suum can depress feed intake and daily gain and cause a depression in gain:feed ratio. (missouri.edu)
  • Midha, A., K. Janek, A. Niewienda, P. Henklein, S. Guenther, D.O. Serra, J. Schlosser, R. Hengge, and S. Hartmann (2018) The intestinal roundworm Ascaris suum releases antimicrobial factors which interfere with bacterial growth and biofilm formation. (hu-berlin.de)
  • Large Roundworms: (Ascaris suum) Nodular Worms: (Oesophagostomum spp. (southernstates.com)
  • The unwelcome worm was found to belong to the Ascaris genus, a group of roundworms . (iflscience.com)
  • However, as the Centers for Disease Control and Prevention (CDC) note, pig roundworms are difficult to distinguish from human roundworms, so the number of people currently infected with A. suum is not known. (iflscience.com)
  • Intestinal tracts that are infected by endoparasites, such as stomach worms, roundworms, (ascaris suum, heterakis) coccidial oocysts (E. acervulina, E.maxima, E.tenella, and E. isospora suis) and Cryptosporidia can cause serious health and welfare issues, along with impaired performance by reduced growth. (agritech-is.com)
  • Ascaris , hookworm, and whipworm are parasitic worms known as soil-transmitted helminths (STH). (cdc.gov)
  • Intestinal worms such as intestinal flukes, liver flukes, ascaris and many others invade our bodies and take residence in muscle tissue, cavities, even in the brain or heart. (orgoniseafrica.com)
  • Ascaris worms infect up to 1.2 billion people worldwide. (iflscience.com)
  • The effect of products from the nematodes Ascaris suum, Toxocara canis, and Anisakis simplex on human neutrophils were studied. (ed.ac.uk)
  • Ascaris infections are treated with ascaricides. (wikipedia.org)
  • Most hogs have Ascaris infections during their lifetimes. (missouri.edu)
  • Her doctor, Dr Li Juan of the Second People's Hospital of Haining in East China, also treated her family for potential Ascaris infections. (iflscience.com)
  • Since a parasite's goal is to keep its host alive and functioning so it can siphon off its nutrients, people suffering from Ascaris infections often have no symptoms. (iflscience.com)
  • According to the CDC, more severe Ascaris infections can lead to intestinal blockages and impaired growth in children. (iflscience.com)
  • Due to the apparent importance of Cl - in the physiology of Ascaris muscle bag cells, these studies were conducted to investigate the mechanisms involved in Cl - balance, with a view to possible exploitation of these mechanisms as anthelmintic target sites. (soton.ac.uk)
  • Incubation of Ascaris sections with the anthelmintic ivermectin (IVM, 10μM) elicited an approximate 2.9mM (15%) increase in intracellular Cl^- concentration compared to control sections. (soton.ac.uk)
  • Ascaris larvae migrating through the lungs may cause cough, wheezing, and occasionally hemoptysis or other respiratory symptoms in people without prior exposure to Ascaris . (msdmanuals.com)
  • 1998. Hydrostatic pressure shows that lammelipodial motility in Ascaris sperm requires membrane-associated major sperm protein filament nucleation and elongation. (fsu.edu)
  • 1998. Solution structure of the motile major sperm protein (MSP) of Ascaris suum-- evidence for two manganese binding sites and the possible role of divalent cations in filament formation. (fsu.edu)
  • Body fluids of A. suum (ABF) and T. canis (TcBF) induced strong directional migration, shape change, and intracellular Ca21 transients. (ed.ac.uk)
  • This entailed mining available transcriptomic and/or genomic sequence datasets for the presence of homologues of known TIMPs, predicting secondary structures of defined protein sequences, systematic phylogenetic analyses and assessment of differential expression of genes encoding putative TIMPs in the developmental stages of A. suum , N. americanus and Schistosoma haematobium which infect the mammalian hosts. (biomedcentral.com)
  • The resting membrane potential of Ascaris muscle bag cells is quite low at around -30mV. (soton.ac.uk)
  • A. suum is distributed worldwide and grows up to 40 cm (16 in) in length. (wikipedia.org)
  • It is unknown how many people worldwide are infected with Ascaris suum . (cdc.gov)
  • Abstract This study aimed to evaluate the sampling method for the detection of Ascaris suum larval DNA in chicken livers using real-time PCR. (edu.vn)
  • note = "Funding Information: We thank Ms Kayako Nakamura and Dr Fumiko Saruta for preparing the body wall muscle of A. suum and Dr Gota Kawai for his valuable comments. (elsevierpure.com)
  • A. suum is in the family Ascarididae, and is one of the oldest associations to mankind. (wikipedia.org)
  • Therefore, the present study aimed to investigate parasitological and immunopathological aspects of the lung during murine experimental concomitant coinfection by Plasmodium berghei and Ascaris suum during larvae ascariasis. (biomedcentral.com)
  • The enzyme from the parasitic helminth Ascaris suum catalyzes a reductive reaction as part of a fermentation pathway, shuttling reducing power from the electron-transport chain to 2-methyl branched-chain enoyl CoA. (expasy.org)
  • How is Ascaris suum spread to humans? (cdc.gov)
  • Among the geohelminths that affect humans, Ascaris spp. (biomedcentral.com)
  • In this study, we further characterized the AsHb antigen and screened samples from a population-based study conducted in an area that is endemic for Ascaris lumbricoides in Indonesia to assess changes in AsHb antibody rates and levels in humans following mass drug administration (MDA). (ui.ac.id)
  • Nucleotide correlations that suggest tertiary interactions in the TV-replacement loop-containing mitochondrial tRNAs of the nematodes, Caenorhabditis elegans and Ascaris suum. (nih.gov)
  • The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. (nih.gov)
  • Evidence for the frequent use of TTG as the translation initiation codon of mitochondrial protein genes in the nematodes, Ascaris suum and Caenorhabditis elegans. (nih.gov)
  • Abstract This study aimed to evaluate the sampling method for the detection of Ascaris suum larval DNA in chicken livers using real-time PCR. (edu.vn)
  • 1977. The role of some vitamins in the course of larval ascaridosis (Ascaris suum). (edu.pl)
  • A 273-megabase draft genome for A. suum was published in 2011. (wikipedia.org)
  • A 23-year-old postgraduate student at Quebec's MacDonald College, Kranz specialized in Ascaris suum , a nasty worm that spends its days frolicking inside pig intestines. (listverse.com)
  • The effect of a histamine releaser (48/80), an antigen (Ascaris suum extract) and of exogenous histamine infusion on antigen aerosol-induced bronchoconstriction was investigated in 24 mongrel dogs. (karger.com)
  • Ascaris larvae migrating through the lungs may cause cough, wheezing, and occasionally hemoptysis or other respiratory symptoms in people without prior exposure to Ascaris . (msdmanuals.com)
  • Additionally, eosinophilic pulmonary infiltrates have appeared in mice challenged with a transnasal Ascaris extract. (medscape.com)
  • Whilst PAC had only minor effects on pulmonary immune responses, RNA-sequencing of intestinal tissues revealed that dietary PAC significantly enhanced transcriptional responses related to immune function and antioxidant responses in the gut of both naïve and A. suum-infected animals. (usda.gov)
  • Intestinal tracts that are infected by endoparasites, such as stomach worms, roundworms, (ascaris suum, heterakis) coccidial oocysts (E. acervulina, E.maxima, E.tenella, and E. isospora suis) and Cryptosporidia can cause serious health and welfare issues, along with impaired performance by reduced growth. (agritech-is.com)
  • In Canada in 1970, a postgraduate student tainted his roommates' food with A. suum. (wikipedia.org)
  • Are Ascaris lumbricoides and Ascaris suum a single species? (wikipedia.org)
  • Whether A. suum is a distinct species from A. lumbricoides is debated. (msdmanuals.com)
  • MIG-23 is involved in sperm migration by modulating extracellular ATP levels in Ascaris suum. (bvsalud.org)
  • On the other hand, an ELISA test measuring antibodies to Ascaris suum haemoglobin (AsHb) has been shown to be useful for estimating transmission intensity on pig farms. (ui.ac.id)
  • This study demonstrates that the Ascaris-Plasmodium interaction is harmful to the host and suggests that this coinfection may potentiate Ascaris -associated pathology by dampening the Ascaris -specific immune response, resulting in the early death of affected animals. (biomedcentral.com)
  • Transmission of Ascaris suum among zoo primates - an emerging problem? (ku.dk)
  • The antibody prevalence rate may be a useful indicator for Ascaris transmission intensity in communities that can be used to assess the impact of control measures on the force of transmission. (ui.ac.id)
  • Conclusion/Significance: IgG4 antibody levels to AsHb appear to reflect recent exposure to Ascaris. (ui.ac.id)
  • Several studies have previously aimed to correlate the effects of Ascaris-Plasmodium coinfections but have obtained contradictory and inconclusive results. (biomedcentral.com)
  • Hodges then worked as a postdoctoral fellow in the Laboratory of Allergic Diseases at NIAID, where he investigated the effects of Ascaris suum pseudocoelomic fluid in allergic asthma models. (nih.gov)