Arvicolinae: A subfamily of MURIDAE found nearly world-wide and consisting of about 20 genera. Voles, lemmings, and muskrats are members.GreeceDolphins: Mammals of the families Delphinidae (ocean dolphins), Iniidae, Lipotidae, Pontoporiidae, and Platanistidae (all river dolphins). Among the most well-known species are the BOTTLE-NOSED DOLPHIN and the KILLER WHALE (a dolphin). The common name dolphin is applied to small cetaceans having a beaklike snout and a slender, streamlined body, whereas PORPOISES are small cetaceans with a blunt snout and rather stocky body. (From Walker's Mammals of the World, 5th ed, pp978-9)Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Cetacea: An order of wholly aquatic MAMMALS occurring in all the OCEANS and adjoining seas of the world, as well as in certain river systems. They feed generally on FISHES, cephalopods, and crustaceans. Most are gregarious and most have a relatively long period of parental care and maturation. Included are DOLPHINS; PORPOISES; and WHALES. (From Walker's Mammals of the World, 5th ed, pp969-70)Porpoises: Mammals of the family Phocoenidae comprising four genera found in the North Pacific Ocean and both sides of the North Atlantic Ocean and in various other seas. They differ from DOLPHINS in that porpoises have a blunt snout and a rather stocky body while dolphins have a beak-like snout and a slender, streamlined body. They usually travel in small groups. (From Walker's Mammals of the World, 5th ed, pp1003-4)Bottle-Nosed Dolphin: The species Tursiops truncatus, in the family Delphinidae, characterized by a bottle-shaped beak and slightly hooked broad dorsal fin.Whales: Large marine mammals of the order CETACEA. In the past, they were commercially valued for whale oil, for their flesh as human food and in ANIMAL FEED and FERTILIZERS, and for baleen. Today, there is a moratorium on most commercial whaling, as all species are either listed as endangered or threatened.Hebrides: A group of islands in the Atlantic Ocean west of Scotland, comprising the Outer Hebrides and the Inner Hebrides.ExplosionsCyprinidae: A family of freshwater fish comprising the minnows or CARPS.Cowpox: A mild, eruptive skin disease of milk cows caused by COWPOX VIRUS, with lesions occurring principally on the udder and teats. Human infection may occur while milking an infected animal.GreenlandScotlandHantavirus Infections: Infections with viruses of the genus HANTAVIRUS. This is associated with at least four clinical syndromes: HEMORRHAGIC FEVER WITH RENAL SYNDROME caused by viruses of the Hantaan group; a milder form of HFRS caused by SEOUL VIRUS; nephropathia epidemica caused by PUUMALA VIRUS; and HANTAVIRUS PULMONARY SYNDROME caused by SIN NOMBRE VIRUS.Hantavirus: A genus of the family BUNYAVIRIDAE causing HANTAVIRUS INFECTIONS, first identified during the Korean war. Infection is found primarily in rodents and humans. Transmission does not appear to involve arthropods. HANTAAN VIRUS is the type species.Puumala virus: A species of HANTAVIRUS causing nephropathia epidemica, a mild form of HEMORRHAGIC FEVER WITH RENAL SYNDROME. It is found in most of Europe and especially in Finland, along with its carrier rodent, the bank vole (Clethrionomys glareolus).Hemorrhagic Fever with Renal Syndrome: An acute febrile disease occurring predominately in Asia. It is characterized by fever, prostration, vomiting, hemorrhagic phenonema, shock, and renal failure. It is caused by any one of several closely related species of the genus Hantavirus. The most severe form is caused by HANTAAN VIRUS whose natural host is the rodent Apodemus agrarius. Milder forms are caused by SEOUL VIRUS and transmitted by the rodents Rattus rattus and R. norvegicus, and the PUUMALA VIRUS with transmission by Clethrionomys galreolus.Hantavirus Pulmonary Syndrome: Acute respiratory illness in humans caused by the Muerto Canyon virus whose primary rodent reservoir is the deer mouse Peromyscus maniculatus. First identified in the southwestern United States, this syndrome is characterized most commonly by fever, myalgias, headache, cough, and rapid respiratory failure.Hantaan virus: The type species of the genus HANTAVIRUS infecting the rodent Apodemus agrarius and humans who come in contact with it. It causes syndromes of hemorrhagic fever associated with vascular and especially renal pathology.WyomingRodentia: A mammalian order which consists of 29 families and many genera.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Liliaceae: A monocot family within the order Liliales. This family is divided by some botanists into other families such as Convallariaceae, Hyacinthaceae and Amaryllidaceae. Amaryllidaceae, which have inferior ovaries, includes CRINUM; GALANTHUS; LYCORIS; and NARCISSUS and are known for AMARYLLIDACEAE ALKALOIDS.IndianaLove: Affection; in psychiatry commonly refers to pleasure, particularly as it applies to gratifying experiences between individuals.Vesicovaginal Fistula: An abnormal anatomical passage between the URINARY BLADDER and the VAGINA.OhioArchivesDesigner Drugs: Drugs designed and synthesized, often for illegal street use, by modification of existing drug structures (e.g., amphetamines). Of special interest are MPTP (a reverse ester of meperidine), MDA (3,4-methylenedioxyamphetamine), and MDMA (3,4-methylenedioxymethamphetamine). Many drugs act on the aminergic system, the physiologically active biogenic amines.Politics: Activities concerned with governmental policies, functions, etc.Planctomycetales: A order of gram-negative bacteria whose members are found in a variety of aquatic habitats as well as animal hosts.Copyright: It is a form of protection provided by law. In the United States this protection is granted to authors of original works of authorship, including literary, dramatic, musical, artistic, and certain other intellectual works. This protection is available to both published and unpublished works. (from Circular of the United States Copyright Office, 6/30/2008)MedlinePlus: NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.Consumer Health Information: Information intended for potential users of medical and healthcare services. There is an emphasis on self-care and preventive approaches as well as information for community-wide dissemination and use.Social Media: Platforms that provide the ability and tools to create and publish information accessed via the INTERNET. Generally these platforms have three characteristics with content user generated, high degree of interaction between creator and viewer, and easily integrated with other sites.Material Safety Data Sheets: Information or data used to ensure the safe handling and disposal of substances in the workplace. Such information includes physical properties (i.e. melting, boiling, flashing points), as well as data on toxicity, health effects, reactivity, storage, disposal, first-aid, protective equipment, and spill-handling procedures.Hazardous Substances: Elements, compounds, mixtures, or solutions that are considered severely harmful to human health and the environment. They include substances that are toxic, corrosive, flammable, or explosive.Occupational Exposure: The exposure to potentially harmful chemical, physical, or biological agents that occurs as a result of one's occupation.Safety: Freedom from exposure to danger and protection from the occurrence or risk of injury or loss. It suggests optimal precautions in the workplace, on the street, in the home, etc., and includes personal safety as well as the safety of property.Publications: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181)Publishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.Publication Bias: The influence of study results on the chances of publication and the tendency of investigators, reviewers, and editors to submit or accept manuscripts for publication based on the direction or strength of the study findings. Publication bias has an impact on the interpretation of clinical trials and meta-analyses. Bias can be minimized by insistence by editors on high-quality research, thorough literature reviews, acknowledgement of conflicts of interest, modification of peer review practices, etc.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.Bibliometrics: The use of statistical methods in the analysis of a body of literature to reveal the historical development of subject fields and patterns of authorship, publication, and use. Formerly called statistical bibliography. (from The ALA Glossary of Library and Information Science, 1983)Duplicate Publication as Topic: Simultaneous or successive publishing of identical or near- identical material in two or more different sources without acknowledgment. It differs from reprinted publication in that a reprint cites sources. It differs from PLAGIARISM in that duplicate publication is the product of the same authorship while plagiarism publishes a work or parts of a work of another as one's own.Research: Critical and exhaustive investigation or experimentation, having for its aim the discovery of new facts and their correct interpretation, the revision of accepted conclusions, theories, or laws in the light of newly discovered facts, or the practical application of such new or revised conclusions, theories, or laws. (Webster, 3d ed)Serbia: A republic located south of HUNGARY, west of ROMANIA and BULGARIA, and part of the former YUGOSLAVIA. The capital is Belgrade.Balkan Peninsula: A peninsula in Southeast EUROPE between the Adriatic and Ionian seas on the West and Aegean and Black Seas on the East. (from www.merriam-webster.com/dictionary/balkan%20peninsula)Yugoslavia: Created as the Kingdom of Serbs, Croats, and Slovenes in 1918. Yugoslavia became the official name in 1929. BOSNIA-HERZEGOVINA; CROATIA; and SLOVENIA formed independent countries 7 April 1992. Macedonia became independent 8 February 1994 as the Former Yugoslav Republic of Macedonia (MACEDONIA REPUBLIC).Montenegro: Montenegro was formerly part of the historic Kingdom of Yugoslavia. Following World War II, Montenegro was granted the status of a republic within YUGOSLAVIA. On May 21, 2006, the Republic of Montenegro held a successful referendum on independence and declared independence on June 3. The capital is Podgorica.

Prolonged mating in prairie voles (Microtus ochrogaster) increases likelihood of ovulation and embryo number. (1/710)

Prairie voles are induced ovulators that mate frequently in brief bouts over a period of approximately 24 h. We examined 1) impact of mating duration on ovulation and embryo number, 2) incidence of fertilization, 3) temporal pattern of embryo development, 4) embryo progression through the reproductive tract over time, and 5) embryo development in culture. Mating was videotaped to determine first copulation, and the ovaries were examined and the reproductive tracts flushed at 6, 8, 10, 12, 16, 20, and 24 h and 2, 3, and 4 days after first copulation. The number of mature follicles and fresh corpora lutea and the number and developmental stage of embryos were quantified. One, two-, and four-cell embryos were cultured in Whitten's medium. Mature follicles were present at the earliest time examined (6 h). Thirty-eight percent of females that had been paired for < 12 h after the first copulation ovulated, whereas all females paired >/= 12 h after the first copulation ovulated. Virtually all (> 99%) oocytes recovered from females paired for >/= 12 h after first copulation were fertilized. Pairing time after first copulation and mean copulation-bout duration were significant (p < 0.05) determinants of embryo number. Embryos entered the uterine horns and implanted on Days 3 and 4, respectively, after first copulation (Day 0). Embryos cultured in vitro underwent approximately one cell division per day, a rate similar to that in vivo. We conclude that prairie voles ovulate reliably after pairing for >/= 12 h, although some females showed exceptional sensitivity not predicted by the variables quantified. Prolonged mating for longer than 12 h increased the total embryos produced. This mechanism likely has adaptive significance for increasing offspring number.  (+info)

A new picornavirus isolated from bank voles (Clethrionomys glareolus). (2/710)

A previously unknown picornavirus was isolated from bank voles (Clethrionomys glareolus). Electron microscopy images and sequence data of the prototype isolate, named Ljungan virus, showed that it is a picornavirus. The amino acid sequences of predicted Ljungan virus capsid proteins VP2 and VP3 were closely related to the human pathogen echovirus 22 (approximately 70% similarity). A partial 5' noncoding region sequence of Ljungan virus showed the highest degree of relatedness to cardioviruses. Two additional isolates were serologically and molecularly related to the prototype.  (+info)

Granulated metrial gland cells and interstitial trophoblast in the uterine wall of the bank vole, Clethrionomys glareolus, in early pregnancy. (3/710)

The morphology and distribution of granulated metrial gland cells and of interstitial trophoblast cells in the uterine wall was studied in the first half of pregnancy in the bank vole, Clethrionomys glareolus. The morphology and distribution of granulated metrial gland cells was generally similar to that found in other members of the Rodentia, although they were absent from the walls of the arterial vessels passing through the decidua basalis. Interstitial trophoblast invaded the decidualising endometrium mesometrial to, and antimesometrial to, the implanted embryos. There was no apparent spatiotemporal relationship between the distribution of granulated metrial gland cells and interstitial trophoblast cells.  (+info)

Rats of the genus Rattus are reservoir hosts for pathogenic Bartonella species: an Old World origin for a New World disease? (4/710)

Bartonella species were isolated from the blood of 63 of 325 Rattus norvegicus and 11 of 92 Rattus rattus from 13 sites in the United States and Portugal. Infection in both Rattus species ranged from 0% (e.g., 0/87) to approximately 60% (e.g., 35/62). A 337-bp fragment of the citrate synthase (gltA) gene amplified by polymerase chain reaction was sequenced from all 74 isolates. Isolates from R. norvegicus were most similar to Bartonella elizabethae, isolated previously from a patient with endocarditis (93%-100% sequence similarity), followed by Bartonella grahamii and other Bartonella species isolated from Old World rodents (Clethrionomys species, Mus musculus, and Rattus species). These data suggest that Rattus species are a reservoir host for pathogenic Bartonella species and are consistent with a hypothesized Old World origin for Bartonella species recovered from Rattus species introduced into the Americas.  (+info)

Isolation and characterization of a hantavirus from Lemmus sibiricus: evidence for host switch during hantavirus evolution. (5/710)

A novel hantavirus, first detected in Siberian lemmings (Lemmus sibiricus) collected near the Topografov River in the Taymyr Peninsula, Siberia (A. Plyusnin et al., Lancet 347:1835-1836, 1996), was isolated in Vero E6 cells and in laboratory-bred Norwegian lemmings (Lemmus lemmus). The virus, named Topografov virus (TOP), was most closely related to Khabarovsk virus (KBR) and Puumala viruses (PUU). In a cross focus reduction neutralization test, anti-TOP Lemmus antisera showed titers at least fourfold higher with TOP than with other hantaviruses; however, a rabbit anti-KBR antiserum neutralized TOP and KBR at the same titer. The TOP M segment showed 77% nucleotide and 88% amino acid identity with KBR and 76% nucleotide and 82% amino acid identity with PUU. However, the homology between TOP and the KBR S segment was disproportionately higher: 88% at the nucleotide level and 96% at the amino acid level. The 3' noncoding regions of KBR and the TOP S and M segments were alignable except for 113- and 58-nucleotide deletions in KBR. The phylogenetic relationships of TOP, KBR, and PUU and their respective rodent carriers suggest that an exceptional host switch took place during the evolution of these viruses; while TOP and KBR are monophyletic, the respective rodent host species are only distantly related.  (+info)

Maternal effort and male quality in the bank vole, Clethrionomys glareolus. (6/710)

Parental investment in reproduction is adjusted according to potential benefits in terms of offspring survival and/or mating success. If male quality affects the reproductive success of a female, then females mating with high-quality males should invest more in reproduction. Although the subject has been of general interest, further experimental verification of the hypothesis is needed. We studied whether female bank voles (Clethrionomys glareolus) adjusted their maternal effort according to male quality, measured as mating success. To enable the measurement of maternal effort during nursing separately from male genetic effects the litters were cross-fostered. Further, the genetic background of male quality was examined. Male quality did not correlate with litter size or offspring size at birth. Offspring growth was positively related to food consumption and milk production of mothers. However, these direct measurements of maternal effort were independent of male quality. Male mating success appeared to be significantly heritable indicating that there are genetic benefits. Still, females did not adjust maternal effort according to the genetic quality of their offspring. We suggest that female bank voles gain significant genetic benefits from mating with high-quality males whereas they cannot improve their reproductive success by increasing maternal effort.  (+info)

Cowpox: reservoir hosts and geographic range. (7/710)

It is generally accepted that the reservoir hosts of cowpox virus are wild rodents, although direct evidence for this is lacking for much of the virus's geographic range. Here, through a combination of serology and PCR, we demonstrate conclusively that the main hosts in Great Britain are bank voles, wood mice and short-tailed field voles. However, we also suggest that wood mice may not be able to maintain infection alone, explaining the absence of cowpox from Ireland where voles are generally not found. Infection in wild rodents varies seasonally, and this variation probably underlies the marked seasonal incidence of infection in accidental hosts such as humans and domestic cats.  (+info)

Potentiation of carbachol-induced amylase release by propionate in guinea pig and vole pancreatic acini. (8/710)

The action of propionate, one of the major end products of microbial fermentation in herbivores was investigated in isolated, perifused pancreatic acini of guinea pigs, voles, and mice. With the use of guinea pig acini, 100 microM propionate had no effect, whereas 300 and 600 microM increased amylase release by six- and ninefold, respectively. Simultaneous perifusion of carbachol (CCh) 10 microM plus propionate 100 microM in guinea pig acini produced a potentiated secretory response that was 130% higher than the summated value obtained with CCh and propionate alone. The potentiation by propionate (100 microM) of CCh (10 microM)-induced amylase release was also obtained in vole pancreatic acini, but the mouse pancreatic preparation did not exhibit a similar potentiation. In contrast to CCh, propionate (100-600 microM) alone had no significant effect on intracellular Ca2+ concentration ([Ca2+]i) and did not alter [Ca2+]i elicited by CCh. Ca ionophore A23187 (5 microM)-induced amylase release in guinea pig acini was enhanced twofold by the addition of propionate. Cellular cAMP content was increased slightly by propionate, but did not alter dose dependently. The cAMP level with combinations of CCh and propionate was almost same as that with CCh alone and propionate alone. Staurosporine did not modify amylase secretion induced by a combination of CCh and propionate. These results suggest that propionate, in addition to a direct action on amylase release, potentiates CCh-induced amylase release in guinea pig and vole acini via a secretory pathway not associated with an increase in [Ca2+]i and cellular cAMP.  (+info)

The authors investigated the effects of postnatal manipulations of oxytocin (OT) on the subsequent tendency to form a partner preference in male prairie voles (Microtus ochrogaster). Neonatally, males received either an injection of OT, an oxytocin antagonist (OTA), 0.9% saline vehicle, or handling without injection. As adults, males were tested for partner preference
This study compared the effects of centrally administered oxytocin (OT) and arginine vasopressin (AVP) on partner preference formation and social contact in male and female prairie votes (Microtus ochrogaster). After 1 hr of cohabitation and pretreatment with either AVP or OT, both males and females exhibited increased social contact and significant preference for the familiar partner. After pretreatment with either an OT receptor antagonist (OTA) or an AVP (V1a) receptor antagonist (AVPA), neither OT nor AVP induced a partner preference.
Many female terrestrial mammals undergo postpartum estrus (PPE), a state of heightened sexual attractiveness to male conspecifics relative to females not in PPE (REF females). PPE and REF females of several species may use over-marks to maintain territories and attract and indicate interest in males as potential mates. In our first two experiments, we determined if the response of male meadow voles, Microtus pennsylvanicus, to the top- and bottom-scent donors of a same-sex over-mark was affected by the reproductive state of the scent donors. We found that after exposure to a same-sex over-mark in which the female scent donors were in the same reproductive state, males spent more time investigating the mark of the top-scent female. Males, however, spent more time investigating the mark of the PPE female to that of a female not in PPE, independent of the position of either females scent mark in the over-mark. The third and fourth experiments determined if the response of males to the female scent donor
1.1 The monogamous prairie vole. Monogamous (prairie vole) versus Polygynous (all others -- ex. meadow vole) WHY?. 1.2 The brain of the prairie vole is a complex, highly organized machine. Vasopressin - large number of receptors (V1a) in Ventral pallium - (emotion and memory)...
Differential predation on certain classes of individuals within prey populations might make owls strong selective agents on their prey. We investigated selective predation of tawny owls (Strix aluco) on yellow-necked mice (Apodemus flavicollis, A.f.) and bank voles (Myodes glareolus, M.g.) for two years by comparing prey from owl nests with live-trapped individuals. The owls killed significantly more male M.g. (73%) than females, but not more than expected from traps (57%). For A.f., owls selected adults in favour of subadults, and for adults, individuals with longer femurs. Adult males of A.f. killed by owls had significantly heavier testes in relation their size than the trapped males. Prey selection did not correlate with size-adjusted body or spleen mass. Owl-killed A.f. had higher prevalences of the intestinal helminth Heligmosomoides sp. than trapped individuals, but hosted similar numbers of parasite species. Differential predation of tawny owls on yellow-necked mice and bank voles seems ...
Two strains of Gram-positive cocci were isolated from viscera of common voles (Microtus arvalis Pallas) with generalized Brucella microti infection in the Czech Republic. Biochemical features and phylogenetic analysis based on 16S rRNA gene sequences showed that the strains are representatives of the genus Staphylococcus and assigned Staphylococcus muscae as the nearest relative. A detailed characterization done by ribotyping, rpoB and hsp60 gene sequencing, whole-cell protein analysis and rep-PCR using the (GTG)5 primer differentiated the two strains from all described staphylococci. DNA-DNA hybridization with the type strain of S. muscae demonstrated that the two strains should be considered as members of a novel species (26.8 % reassociation). The two analysed strains were found to be coagulase-negative, novobiocin-susceptible, oxidase-negative cultures, phenotypically close to one another, but showing differences in ribotype profiles. The major fatty acids were iso-C15 : 0, iso-C17 : 0, anteiso-C15
I have, in this thesis, studied the interactions between gray-sided voles (Clethrionomys rufocanus) and tundra vegetation, on islands in, and mainland sites close to the lake Iešjávri, in northern Norway. As isolated islands are virtually free of predation, I have been able to compare plant-herbivore interactions in the presence and absence of predators. I transplanted vegetation from an island with predators and voles, to predator-free islands with and with out voles. The results reveal the existence of a terrestrial trophic cascade as voles had a severe impact on the transplanted vegetation on the predator-free islands, but only minor effects on the mainland where predators are present. Moreover, this study shows that plant defence was only a successful strategy when predators were present. Voles reduced the abundance of all available plants during winter on the predator-free islands. The results imply that cascading effects of predation are most important for well-defended plants with ...
Much interest has centred recently on the role of adaptive trade-offs between the immune system and other components of life history in determining resistance and parasite intensities among hosts. Steroid hormones, particularly glucocorticoids and sex steroids, provide a plausible mechanism for mediating such trade-offs. A basic assumption behind the hypothesis, however, is that steroid activity will generally correlate with reduced resistance and thus greater parasite intensities. Here, we present some findings from a field study of bank voles (Clethrionomys glareolus ) in which we have looked at associations between parasite intensities, anatomical and morphometric measures relating to endocrine function and life history variation in three local populations inhabiting similar but mutually isolated woodland habitats. In general, sites with greater parasite intensities were those in which male C. glareolus had significantly larger adrenal glands, testes and seminal vesicles for their age and ...
Grasslands are among the most imperiled of the North American ecosystems, with ≤ 1% of tallgrass prairie remaining. The State Acres for Wildlife Enhancement (SAFE) is a national conservation program that converts agricultural fields into grasslands with the primary focus on improving habitat for high priority wildlife species. Because small mammals can be important indicators of ecosystem function, I sampled small mammal communities to evaluate restoration efforts under the SAFE program in Illinois. I livetrapped small mammals during 3 summers (2009-2011) on plots that were recently seeded, seeded 1-4 years prior to sampling, or established references (>10 yrs old). Overall, the dominant species were the deer mouse (Peromyscus maniculatus), prairie vole (Microtus ochrogaster), and meadow vole (Microtus pennsylvanicus); which combined represented 92-97% of total captures each year. Typical restoration trajectories for small mammal communities included a shift over time from dominance by ...
Cervidae: Alces americanus (American Moose) [feeds on the foliage of these grasses from Maine to Michigan during the summer] MZN1951, Cervus canadensis (Elk) [foliage provides 1% of the diet] SMA2006; Cricetidae: Microtus ochrogaster (Prairie Vole) [feeds on these grasses] MZN1951, Microtus pennsylvanicus (Meadow Vole) [feeds on these grasses] MZN1951; Leporidae: Sylvilagus floridanus (Eastern Cottontail) [foliage comprises 5-10% of the diet in Connecticut throughout the year, foliage comprises 0.5-2% of the diet in Ohio] MZN1951 ...
Synaptic pruning within neurons in the brain during development allows for maintenance of proper neuronal connections and the elimination of aberrant ones. Rapid eye movement (REM) sleep is critical for pruning and maintaining new synapses formed during both development and learning. We hypothesize that disrupting REM sleep early in life will result in long lasting changes in synaptic density in cortical brain regions. The prefrontal cortex (PFC) is a late-maturing region that modulates higher order social and cognitive functions. Abnormally high dendritic spine density in the PFC is implicated in neurodevelopmental disorders such as autism spectrum disorder (ASD). Emerging research in our lab suggests that selectively suppressing REM sleep early in life in the socially monogamous prairie vole (Microtus ochrogaster) impairs social development and increases inhibitory interneurons in the PFC, consistent with ASD pathology. Using Golgi-Cox staining in adult prairie vole post-mortem tissue, we quantified
Boletus pinetorum is similar to B. edulis, but it has a greyish brown pileus with a wrinkled edge, and grows with Pinus. The caulocystidia of B. pinetorum are lageniform vs. the cylindrical caulocystidia in B. edulis. Boletus pinophilus is also associated with pines but it usually has vinaceous red tinted pileus and mostly cylindrical caulocystidia.. Habitat. Dry sandy pine heaths and dry coniferous forests, mycorrhizal with pines (Pinus).. Distribution. Not yet understood and so far known only in Norway, Finland and Estonia.. Photographs. I am not currently having photographs of this species. Colour photographs and line drawings of the microscopic features are found in Korhonen & al. (2009).. Important literature. Korhonen, M., Liimatainen, K. & Niskanen, T. 2009. A new boletoid fungus, Boletus pinetorum, in the Boletus section Boletus from Fennoscandia (Basidiomycota, Boletales). - Karstenia 49: 41-60.. ...
To get a deeper insight into the function of estrogen-related receptors (ERRs) and dissect underlying mechanism in Leydig cells, ERRs (type α, β and γ) were blocked or activated in testes of adult bank voles (Myodes glareolus) which show seasonal changes in the intratesticular sex hormones level. Both actively reproducing animals (long day conditions; LD) and those with regression of the reproductive system (short day conditions; SD) received intraperitoneal injections of selective ERRα antagonist 3-[4-(2,4-Bis-trifluoromethylbenzyloxy)-3-methoxyphenyl]-2-cyano-N-(5-trifluoromethyl-1,3,4-thiadiazol-2-yl)acrylamide (XCT 790) or selective ERRβ/ERRγ agonist N-(4-(Diethylaminobenzylidenyl)-N-(4-hydroxybenzoyl)-hydrazine (DY131) (50 μ/kg bw; six doses every other day ...
The sibling vole is an accidentally introduced species in Svalbard and is the only small mammal species on the archipelago. They were first discovered in 1960 and misidentified as the common vole Microtus arvalis.
Not all of the experiences in nature and moments spent with animals can be labelled with name „expedition". I decided to post the one most interesting photo every month to describe a particular moment. The May will be represented by the close observation of the bank vole (Myodes glareolus) in the Beskydy mountains near Nový Hrozenkov. This young animal behaved very friendly and had no problem with photographing from a very small distance. What a nice encounter! ...
The water vole (Arvicola amphibius) in the forest-steppe of West Siberia is known to have wide fluctuations in abundance. These fluctuations are accompanied by changes in birth and death rates, sex-age structure of the population, and individual morphophysiological and behavioral characteristics of the animals. Survival of the animals depends on season, phase of population cycle, and sex. Based on the data of long-term captive breeding of water voles, the maximal lifespan of males was found to be 1188 days and that of females, 1108 days. There were no differences between the sexes in mean lifespan. The probability of living 2 years or longer was 0.21. Individuals who began breeding at an older age had a significantly longer lifespan and produced more offspring. The survival curves of the spring-born animals were steeper than of those summer/autumn-born. Maternal factors had differential effect on males and females with respect to lifespan. Male lifespan correlated negatively with maternal age, parity,
We were able to show that bank vole females gained long-term fitness benefits from multiple mating with different males. Offspring of polyandrous females performed significantly better at reproduction than those of monandrous females, caused mainly by sons of polyandrous females producing more offspring than those of monandrous females. Offspring body mass and survival were not affected by mating treatment. To our knowledge, this is the first experimental study on mammals measuring offspring reproductive performance as fitness component potentially affected by polyandry.. Recent studies have demonstrated an increase in female fitness due to polyandry that can be attributed to genetic effects (Neff & Pitcher 2005; Simmons 2005). Most of these studies, including two on mammals, have focused on early offspring survival as a component of fitness. For example, a field study on the brown antechinus Antechinus stuartii showed that polyandry significantly increased offspring survival until weaning ...
The purpose of this study was to determine whether pretreatment with oxytocin could mimic the effects of social contact and enhance sexual receptivity in female prairie voles. Female prairie voles req...
Florida Salt Marsh Vole Microtus pennsylvanicus dukecampbelli Status Endangered Listed January 14, 1991 Family Muridae (Mouse and Rat) Description Short-tailed rodent with a blunt head and short ears.
The best distribution models provided good predictions of the present-day Siberian ranges of the study species. Their LGM projections showed that areas with a suitable LGM climate for the three temperate species (Apodemus flavicollis, Apodemus sylvaticus and Microtus arvalis) were largely restricted to the traditionally recognized southern refuge areas, i.e. mainly in the Mediterranean region, but also southernmost France and southern parts of the Russian Plain. In contrast, suitable climatic conditions for the two boreal species (Clethrionomys glareous and Microtus agrestis) were predicted as far north as southern England and across southern parts of central and eastern Europe eastwards into the Russian Plain. For the two arctic species (Lemmus lemmus and Microtus oeconomus), suitable climate was predicted from the Atlantic coast eastward across central Europe and into Russia. Main conclusions ...
The crash phase of vole populations with cyclic dynamics regularly leads to vast areas of uninhabited habitats. Yet although the capacity for cyclic voles to re-colonize such empty space is likely to be large and predicted to have become evolved as a distinct life history trait, the processes of colonization and its effect on the spatio-temporal dynamics have been little studied. Here we report from an experiment with root voles (Microtus oeconomus) specifically targeted at quantifying the process of colonization of empty patches from distant source patches and its resultant effect on local vole deme size variation in a patchy landscape. Three experimental factors: habitat quality (1), predation risk (2) and inter-patch distance (3) were employed among 24 habitat patches in a 100x300 m experimental area. The first born cohort in the spring efficiently colonized almost all empty patches irrespective of the degree of patch isolation and predation risk, but dependent on habitat quality. Just after ...
Variation at 21 allozyme loci and 10 restriction enzymes within the mitochondrial DNA control region was assessed among 3 allopatric populations of montane vole (Microtus montanus) in the American Southwest. Among populations of M. montanus, the population from the White Mountains, Arizona, was most genetically divergent. Genetic and biogeographic evidence supported recognition of the White Mountains population as a distinct subspecies, M. m. arizonensis. Results also supported recognition of the Mogollon vole (Microtus mogollonensis) as distinct from the Mexican vole (Microtus mexicanus).
Merryl is a zoologist and professional ecologist who has worked on a wide range of British mammals over the past 20 years. As well as being Honorary Secretary for the Mammal Society, Merryl founded the Oxfordshire Mammal Group and is Director and Principal Ecologist at Spires Ecology. Recently, much of her work focuses on protected species, with an emphasis on water voles, and in bridging the gap between research and the practical application of results in real-life situations. Merryl has significant experience in the provision of training in live-capture techniques for a variety of species and now runs the Mammal Society water voles live-capture and mitigation course aimed at professional ecologists. Merryl completed her doctorate at the Wildlife Conservation Research Unit (WildCRU, Oxford University) on health and welfare in reintroductions, using water voles as a model species, and has numerous publications on the topic, as well as co-authoring the latest version of the Water Vole ...
I am not an adept when it comes to identifying skulls and bones that were festering in owl pellets, but I know the parts in Carma Jos pellet were from small rodents. The primary victim was probably the hapless beast hanging here, the Meadow Vole, Microtus pennsylvanicus. Do yourself a favor: never come back as a vole. Everyone wants to eat you, and the end will not be pretty. Very few voles, I suspect, die of old age. The animal in this photo was harvested by a Northern Shrike, which unceremoniously hung it in this autumn-olive bush. We saw almost the whole thing go down, and it was cool! The shrike, or butcherbird, came lumbering in toting the vole, disappeared into the shrubs, and as soon as the bird left we dashed in to inspect the kill. Later, the shrike, which is essentially a feathered Vlad the Impaler, would have returned and torn the cute little critter apart, gobbling down the chunks ...
The name vole is short for the archaic word volemouse, which may come from Norwegian vollmus, from the Old Norse völlr, field and Old Norse mūs, mouse. Voles are rodents, in the same family (Crecetidae) as lemmings, and like lemmings they sometimes have population explosions. The field vole, Arvicola agrestis, was so plentiful in Scotland, causing so much damage in 1890-1 that the Government appointed a Committee to examine the question. The committee wondered whether the destruction of predators by gamekeepers was responsible, but in true Darwinian fashion, the Scottish outbreak was dealt with by a rapid natural increase in the population of birds of prey.[1] A more recent vole explosion permitted snowy owls to colonise and breed in the Shetland Islands for a number of years. Voles range in color from gray to brown and in size from three to nine inches long. They have rounded bodies and blunt snouts, small ears and short tails without much hair. Their main food is grasses, but they also eat ...
Elucidating the colonization processes associated with Quaternary climatic cycles is important in order to understand the distribution of biodiversity and the evolutionary potential of temperate plant and animal species. In Europe, general evolutionary scenarios have been defined from genetic evidence. Recently, these scenarios have been challenged with genetic as well as fossil data. The origins of the modern distributions of most temperate plant and animal species could predate the Last Glacial Maximum. The glacial survival of such populations may have occurred in either southern (Mediterranean regions) and/or northern (Carpathians) refugia. Here, a phylogeographic analysis of a widespread European small mammal (Microtus arvalis) is conducted with a multidisciplinary approach. Genetic, fossil and ecological traits are used to assess the evolutionary history of this vole. Regardless of whether the European distribution of the five previously identified evolutionary lineages is corroborated, this
This thesis deals with the dynamics of tundra living voles with emphasis on the most common one, the grey-sided vole (Clethrionomys rufocanus). The tundra area chosen for the study was Finnmarksvidda, a vast flatland in northernmost Norway. All small mammal herbivores in the area showed dramatic fluctuations, and field experiment were conducted in order to elucidate these density fluctuations. The specific subjects addressed included: 1/ Temporal and spatial appearance of density fluctuations of voles and lemmings in the area, 2/ The generality of the density patterns observed, 3/ The impact of predation by vole predators during summertime, 4/ The impact of grey-sided vole grazing on food plants of different preference in a predator free environment, in the presence and absence of extra food, and 5/ The impact of food availability on density and demography of grey-sided voles in a predator free environment.. The results achieved showed that voles in the slope and lowland had cyclic density ...
Background Chemical communication in mammals involves globular lipocalins that protect and transport pheromones during their passage out of the body. Efficient communication via this protein -...
1. Mathematical models for infectious diseases typically use contact rates (e.g. the number of other people a person encounters per day) as one of their main elements in predicting the outcomes of an epidemic. The aim of my project is to investigate the importance of spatial constraints and individual heterogeneity on the rate of contact of wildlife using field voles (Microtus agrestis) as a case study. By spatial constraints, I mean the importance that spatial distance plays in the rate of contact. Furthermore by individual heterogeneity, I mean the importance of characteristics such as mass and sex in determining the rate of contact.. We intuitively know that the further apart two individuals/voles are from each other, the harder it would be for a pathogen to spread. But how far is far? Incorporating these spatial constraints into the rate of contact models would help us investigate this. Studying characteristics such as mass and sex would help us investigate the features of dominant hubs in ...
I feel the problems and damage from these Meadow Voles is one of the least understood or reported problems in the Willamette Valley of Oregon - at least for the Home Orchardist. Out of sight - out of mind is likely the reaction of most. I may have mentioned in this thread walking an orchard last year and listening to the owners describe how poorly their 8 to 10 year old fruit trees were doing. They were stunned as I pointed out the vole hole-riddled ground around their most sickly ...
I feel the problems and damage from these Meadow Voles is one of the least understood or reported problems in the Willamette Valley of Oregon - at least for the Home Orchardist. Out of sight - out of mind is likely the reaction of most. I may have mentioned in this thread walking an orchard last year and listening to the owners describe how poorly their 8 to 10 year old fruit trees were doing. They were stunned as I pointed out the vole hole-riddled ground around their most sickly ...
The ovarian steroids, 17-beta estradiol (E2) and progesterone (P4), are critical for normal uterine function, establishment and maintenance of pregnancy, and mammary gland development. Furthermore, the local effects that are essential for normal ovarian physiology are dependent on the endocrine, paracrine, and autocrine actions of E2, P4, and androgens. In most mammals (including humans and mice), ovarian steroidogenesis occurs according to the two-cell/two-gonadotropin theory. This theory describes how granulosa and theca cells work together to make the ovarian steroids. Theca cells respond to LH signaling by increasing the expression of enzymes necessary for the conversion of cholesterol to androgens, such as androstenedione (A) and testosterone (T). Granulosa cells respond to FSH signaling by increasing the expression of enzymes necessary for the conversion of theca-derived androgens into estrogens (E2 and estrone ...
ananyo writes Researchers have shown for the first time that the act of mating induces permanent chemical modifications in the chromosomes (epigenetic changes), affecting the expression of genes that regulate sexual and monogamous behavior in prairie voles. Prairie voles have long been of interest ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Dr Young has found that one difference between monogamous prairie voles and promiscuous montane voles is in the distribution of vasopressin and oxytocin receptors in the brain. His hypothesis is that if the receptors are not expressed in certain areas, then smell and sex will no longer coordinate to form social memory. Hence, when a montane vole mates, it does not form a lasting bond with its partner and is therefore unrestrained when encountering a different potential mate. (This hypothesis is strongly supported by a wealth of pharmacological and genetic data, which I wont go into-unless asked ...
Musser, G. G. and M. D. Carleton. 2005. Superfamily Muroidea. pp. 894-1531 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore ...
With the onset of fall?s cool weather, animals are making plans to overwinter in your yard. Voles are one of the main rodents that love to hang around and feed. There are many species. Some will tunnel underground to feed on plant roots and bulbs. Others will stay near the surface to feed on shrub and tree bark and grass roots. Whatever the type, voles can wreak havoc on your plants. There is a new product that will bait and trap them to reduce their numbers while being safe for other animals. The Vole Control Bait Station contains a fruit-based poison bait that the voles love to eat. It can be set up as a ?tent? station among your plants to control aboveground voles, or as a ?mulch? station, buried under mulch to control belowground voles. The station is designed to attract only voles, and the poison bait is kept hidden and dry so children and other animals can?t reach it. Simply set up the station in an area where voles are active and check every few days to see if the bait has been taken or ...
The prairie vole is one of the few species in nature that is monogamous and that creates deep social bonds while mating. The basic mechanisms of voles and humans social learning are similar enough that the learning that occurs during voles pair bonding can model complex human social interactions. Young and his colleagues have used voles to show the importance for social interactions of hormones such as oxytocin, which has also been proposed as a treatment for autism spectrum disorders ...
Co-evolutionary changes in species may reverse traditional predator-prey population cycles, creating the appearance that prey are eating the predators, according to a study to be published in the journal Proceedings of the National Academy of Sciences
Bajer, Anna and Bednarska, M. and Pawelczyk, A. and Behnke, Jerzy M. and Gilbert, Francis S. and Sinski, Edward (2002) Prevalence and abundance of Cryptosporidium parvum and Giardia spp. in wild rural rodents from the Mazury Lake District region of Poland. Parasitology, 125 (1). pp. 21-34. ISSN 0031-1820 Barnard, C.J. and Behnke, J.M. and Bajer, A. and Bray, D. and Race, T. and Frake, K. and Osmond, J. and Dinmore, J. and Sinski, E. (2002) Local variation in endoparasite intensities of bank voles (Clethrionomys glareolus )from ecologically similar sites: morphometric and endocrine correlates. Journal of Helminthology, 76 (2). pp. 103-112. ISSN 0022-149X Barrett, John W. (2002) Geometrical measurements in three-dimensional quantum gravity. Bayraktutan, Ulvi (2002) Free radicals, diabetes and endothelial dysfunction. Diabetes Obesity and Metabolism, 4 . pp. 224-238. Blake, Holly and McKinney, Michelle and Treece, Karen and Lee, Elizabeth and Lincoln, Nadina (2002) An evaluation of screening ...
Daily News Thousands of Mutations Accumulate in the Human Brain Over a Lifetime Single-cell genome analyses reveal the amount of mutations a human brain cell will collect from its fetal beginnings until death.. ...
ive been reading a bit on rabbits and am interested in the population cycles - does anyone know more about this. Does diffrent stretches of habitat have diffrent cycles? Or does an entire area / the whole state go through a high low cycle at the same time? And if so does anyone know where we are at this year --- I have seen lots of rabbits this year! Thanks - t
Species differences in ligand binding to Avpr1a have been associated with variation in a polymorphic microsatellite in the non-coding 5′-flanking region of the vole Avpr1a locus (Hammock et al., 2005; Hammock and Young, 2004; Hammock and Young, 2005). Furthermore, differences in microsatellite structure within the prairie vole species have been associated with variation in pair-bonding behavior between individual animals (Hammock and Young, 2002; Hammock and Young, 2004). The proximal 5′-flanking region of the Avpr1a gene is not the only factor to direct species-typical expression profiles as transgenic mice in which homologous recombination was used to replace 3.5 kb of the murine Avpr1a proximal 5′-flanking region with the homologous prairie vole sequence expressed Avpr1a largely in a mouse pattern, indicating that more distal chromosomal elements are necessary to confer species-specific expression patterns (Donaldson and Young, 2013).. As in rodents, analogous polymorphic regions ...
Kalscheuer, V.; Singh, A. P.; Nanda, I.; Sperling, K.; Neitzel, H.: Evolution of the gonosomal heterochromatin of Microtus agrestis: rapid amplification of a large, multimeric, repeat unit containing a 3.0-kb (GATA)11-positive, middle repetitive element. Cytogenet Cell Genet 73 (3), pp. 171 - 8 (1996 ...
Slightly larger than M. mystacinus, it has a wingspan of 190 - 240 mm with relatively long ears and a long, light brown fur. For this species, mixed/broadleaf forests and water sources of high importance. Compared to other species, it is not so often found near human settlements. During summer it roosts in tree holes and trunk cracks, while in winter it chooses to hibernate in caves and mines. Tree lines and hedges are part of the species hunting grounds. In these locations, and similarly to M. mystacinus, it uses aerial hawking to catch its prey. This species is an occasional migrant but the distances covered are usually no higher than 40 km.. ...
SummaryThree non-continuous skeletal variants were studied in skulls from a captive colony of the California vole. Such variation is heritable in at least one of these traits and may be in the others. Skeletal variants can therefore be used as a measure of genetical differences between local populations. This conclusion supports previous work on inbred lines of house mice which has demonstrated that both developmental and genetic factors affect skeletal variation.
Muskrat Musk (Imitation) is an excellent substitute for real muskrat glands. It works fine with any lure formulation calling for the real thing. Thick and syrupy like real, ground rat glands. - WCS Muskrat Musk (Imitation) (EO0078)
Andrés et al. (2013) were most interested in identifying fixed differences between species that might contribute to reproductive isolation. "Fixed differences" refers to sites in the genome at which all G. firmus individuals have one nucleotide and all G. pennsylvanicus individuals have another. The authors began by identifying all sites that showed differences in the frequency of alternative alleles between species. To avoid interpreting sequencing errors as polymorphisms, they considered only sites that (1) were classified as high quality by the sequence analysis software, (2) were present in at least 20 sequencing reads per species, and (3) showed the rare allele in at least 1.0% of all reads. After compiling this list of variable sites, they calculated a statistic called "D" that captures the divergence in allele frequency between G. firmus and G. pennsylvanicus; the more divergent the two species are at a site, the larger the value of D at that site. For each contig, the average value of D ...
Adam Brandt is part of Stanford Profiles, official site for faculty, postdocs, students and staff information (Expertise, Bio, Research, Publications, and more). The site facilitates research and collaboration in academic endeavors.
Facts about Lemmings talk about a small rodent, which live in tundra or Arctic. They are included in the subfamily Arvicolinae along with muskrats and voles.
Newly constructed ramps will expand the habitat available to a colony of water voles in London, and similar ramps elsewhere could encourage isolated populations to mix. 0 Comments. ...
History of Grande Prairie - Comprehensive information about ancient Grande Prairie history and historical places of Grande Prairie. Book your tour to historical places Grande Prairie at MakeMyTrip.com.
These three brothers had decided to start a Permaculture project on one of the islands off the coast of northwestern Washington state. They had worked for a few years to restore the flora at the waters edge including planting some "wild" foods that they also enjoyed eating, like cattails. They had a good harvest for a year, and then they noticed that most of their cattails were being raided. They eventually realized it was muskrats. As they had started to restore the land, the animals were coming back, and they were eating some of the brothers harvest. Instead of trapping them or killing them, they decided to let nature be. For a few years, they continued to lose their cattail harvest. Then one year it seemed that the muskrats were gone. It turned out that now, thanks to a healthy muskrat population, the otters and eagles had moved back to the area, and they were feeding on the muskrats. The brothers were able to harvest some cattails again, but they shared some with the muskrats as well, and ...
AC seq_length taxid rank species species_name ## 1 NC_013146 16960 100858 species 100858 Threskiornis aethiopicus ## 2 NC_016427 16379 82464 species 82464 Myodes regulus ## genus genus_name family family_name superkingdom ## 1 100857 Threskiornis 33574 Threskiornithidae 2759 ## 2 447134 Myodes 337677 Cricetidae 2759 ## superkingdom_name strand forward_match forward_mismatch forward_tm ## 1 Eukaryota D ATACCGCCCGTCACCCTC 2 45.64 ## 2 Eukaryota D ACACCGCCCGTCACCCTC 1 53.84 ## reverse_match reverse_mismatch reverse_tm amplicon_length ## 1 CTAAGTGCACATTCCGGT 2 45.55 74 ## 2 CCAAGCACACTTTCCAGT 4 16.28 79 ## sequence ## 1 CTCATAAGCTACTGACTCCCATAACTAATACCCTAATTAGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGT ## 2 CTCAAACTAAATAAATGAGATCTATACATAATTACATCAAACTTTTACGAGAGGAGATAAGTCGTAACAAGGTAAGCAT ## definition ## 1 Threskiornis aethiopicus mitochondrion, complete genome ## 2 Myodes regulus mitochondrion, complete ...
How to breed multiple dog stud matings. Your stud male need to service 2 or more bitches at the same time? Heres how to handle it.
Nal-cor an-nounced it has reached a new con-tract with Astaldi, one of the big-gest con-trac-tors in the Muskrat Falls pro-ject.. Nal-cor CEO Stan Mar-shall told re-porters that the draft agree-ment for the new con-tract to com-plete the pow-er-house and in-take civil works was fi-nal-ized Fri-day night. Dec. 16.. This agree-ment in-creases the price tag for the pro-ject by about $270 mil-lion. Nal-cor has yet to re-base-line the costs, so that num-ber could change. This in-creases Astaldis con-tract to just over $1.8 bil-lion, up sig-nif-i-cantly from the orig-i-nal con-tract they signed of $1.26 bil-lion.. Cost over-runs and de-layed time-lines have con-trib-uted to the ever- in-creas-ing bot-tom line for the hy-dro-elec-tric de-vel-op-ment, with Astaldi be-ing blamed by many for both. The over-all cost of the pro-ject is rapidly ap-proach-ing $12 bil-lion.. "This agree-ment al-lows for com-ple-tion of the pow-er-house and in-take struc-ture at a cost which is sub-stan-tially less than any of ...
five structurally related heptadecapeptides rich in hydrophobic amino acids have been discovered in the venom of the bumblebee megabombus pennsylvanicus. we have named them bombolitin i (ile-lys-ile-thr-thr-met-leu-ala-lys-leu-gly-lys-val-leu-ala-his-val-nh2 ), bombolitin ii (ser-lys-ile-thr-asp-ile-leu-ala-lys-leu-gly-lys-val-leu-ala-his-val-nh2 ), bombolitin iii (ile-lys-ile-met-asp-ile-leu-ala-lys-leu-gly-lys-val-leu-ala-his-val-nh2 ), bombolitin iv (ile-asn-ile-lys-asp-ile-leu-ala-lys-leu-va ...
The Rules for the ER. Greetings to all new ER interns. Your residency program signed you up for a free monthly magazine you lucky dogs. Now that you are committed to ER I figured I should bestow some grandfatherly advice which I learned from reading House of God. If you have never read House of God by Samuel Shem, go read it right now. Youre back? That was quick. Well done.. In House of God the Fat Man outlines the rules to his naïve and eager protégé, who quickly learns the wisdom of knowing when to do nothing and when to act (in that order).. In the complex and constantly changing environment of the ER, you must have a method to maintain your sanity. Personally I have done this by storing all of my feces in an enormous bin. You laugh, but some day a bus full of resistant C. diff patients will come in. Where would you be then? Ill be ready, shoveling dose after dose of Dr. Brandts Steamy Colon Magic through NG tubes. You, however, need some tips.. Thus, with my apologies to Dr. Bergman ...
Grand Prairie Childrens Dentistry provides quality pediatric dental care and Invisalign Teen® to children and teens in Grand Prairie, Dallas, and Fort Worth, TX. Call today to schedule your appointment with Dr. Yoon Tak!
AgriTag Extra Male Studs - Antibacterial Infection Protection coating on each stud minimizes site infection. Blue, purple and red studs available by special order only; will be drop-shipped from the manufacturer. Please allow up to 4 weeks for delivery. All drop-shipped special order require
Get an in-depth review and ask questions about Prairie View A & M University including academics, college rankings, and more. See what people are saying about Prairie View A & M University.
Free shipping & free returns on La Prairie face care products at Neiman Marcus. Shop for La Prairie skin caviar luxe & night creams at neimanmarcus.com.
Wanna see the best Gay Vintage Bb Studs sex videos in the net? Then watch the best of the best free Gay Vintage Bb Studs right now on Redtube.
15mm x 3/8 inch BSPT Male Stud Coupling Tapered (Male Stud Coupling - Tapered) at BearingBoys - 22.20 exc VAT. Thread Size (inches): 3/8, Tube Size (mm): 15,
Very fast gay tube. Watch Gay muscle studs high quality videos that has been collected from thousands sites. New Gay muscle studs films are added every hour.
These vibrant 8-9mm peach freshwater cultured pearl stud earrings are a lovely every day look! These stud earrings are set on sterling silver posts.
Reviews, photos, and costs for Prairie Estates. Compare with nearby communities. No registration needed. #1 reviews site for Nursing Home.
Reviews, photos, and costs for Grande Prairie Hlth Rehab Center. Compare with nearby communities. No registration needed. #1 reviews site for Nursing Home.
Shop La Prairie skin care and makeup at Bergdorf Goodman. Experience a unique luxury with these expertly created skin caviar lift creams.
Gardening expert Val Bourne explains how to make a wild flower meadow meadow in your garden - a great alternative to a lawn that attracts wildlife.
Summer is here, and we hope youre enjoying your wildflowers. If youre new to wildflower meadow gardening, you may be wondering what to expect from your wildflower meadow. Here are answers to some frequently asked questions.
Find a Dead Meadow - Shivering King And Others first pressing or reissue. Complete your Dead Meadow collection. Shop Vinyl and CDs.
Product Details These fascinating teardrop and sparkling square stud earrings are a perfect addition to any ensemble. The brilliant clear prong set gems are enc
I Københavns Lufthavns webshop finder du et stort udvalg af accessories fra en lang række forskellige designere. Du kan for eksempel finde smukke smykker, cool solbriller eller stilrene læsebriller til gode priser.
You missed a cute little video. (link is in good order) So as I see you favor guns to keep off the bad man ( whoever they are) and to bring to everyone the wonderful permission to disagree with their betters ( whoever they may be ...
You missed a cute little video. (link is in good order) So as I see you favor guns to keep off the bad man ( whoever they are) and to bring to everyone the wonderful permission to disagree with their betters ( whoever they may be ...
Les RMLL 2010, cest fini ! Merci à toutes et tous, aux organisateurs, aux bénévoles, aux participant(e)s. Les vidéos des conférences des RMLL (...)
quote=Pioneering-the knowledge of ropes, knots, and splices along with the ability to build rustic structures by lashing together poles and spars-is among the oldest of Scoutings skills. Practicing rope use and completing projects with lashings also allow Scouts to connect with past generations, ancestors who used many of these skills as they sailed the open seas and lived in Americas forests and prairies ...
Forest habitats after harvesting or wildfire disturbance are usually dominated by early successional vegetation for up to 5-10 years, as well as downed wood or coarse woody debris (CWD). Abundance of Microtus voles is often highest in these sites with sufficient plant cover being crucial for population increases. The role of CWD for voles is less clear. We tested the hypotheses (H) that (H1) abundance and reproduction of meadow vole (Microtus pennsylvanicus) and long-tailed vole (Microtus longicaudus) populations would be higher on sites with greater amounts of downed wood and that (H2) this relationship would be stronger on sites with sparse vegetation cover. There were two study areas: a dry Douglas-fir (Pseudotsuga menziesii)-lodgepole pine (Pinus contorta) forest and a high-elevation Engelmann spruce (Picea engelmannii)-subalpine fir (Abies lasiocarpa) forest in southern British Columbia, Canada. We monitored the responses of meadow voles and long-tailed voles to three levels of downed wood ...
Drug addiction has devastating consequences on social behaviors and can lead to the impairment of social bonding. Accumulating evidence indicates that alterations in oxytocin (OT) and dopamine (DA) neurotransmission within brain reward circuitry may be involved. We investigated this possibility, as well as the therapeutic potential of OT for drug-induced social deficits, using the prairie vole (Microtus ochrogaster)-a socially monogamous rodent that forms enduring pair bonds between adult mates. We demonstrate that repeated exposure to the commonly abused psychostimulant amphetamine (AMPH) inhibits the formation of partner preferences (an index of pair bonding) in female prairie voles. AMPH exposure also altered OT and DA neurotransmission in regions that mediate partner preference formation: it decreased OT and DA D2 receptor immunoreactivity in the medial prefrontal cortex (mPFC) and nucleus accumbens (NAcc), respectively, and increased NAcc DA levels. Administration of OT directly into the ...
References. 1. Yu-Shan C. Histological observation on musk-secreting scented gland in muskrat. Chin J Zool. 2007;42:91-5. [ Links ] 2. Lu L, Liu S, Li Q, Huang S, Bao L, Sheng X, Han Y, Watanabe G, Taya K, Weng Q. Seasonal expression of androgen receptor in scented gland of muskrat (Ondatra zibethicus). Gen Comp Endocrinol. 2014;204:1-7. [ Links ] 3. Lu L, Zhang HL, Lv N, Ma XT, Tian L, Hu X, Liu SQ, Xu MY, Weng Q, Watanabe G, Taya K. Immunolocalization of androgen receptor, aromatase cytochrome P450, Estrogen receptor alpha and estrogen receptor beta proteins during the breeding season in scent glands of muskrats (Ondatra zibethicus). Zool Sci. 2011;28:727-32. [ Links ] 4. Dubey AK, Plant TM. A suppression of gonadotropin secretion by cortisol in castrated male rhesus monkeys (Macaca mulatta) mediated by the interruption of hypothalamic gonadotropin-releasing hormone release. Biol Reprod. 1985;33:423-31. [ Links ] 5. Knol BW. Stress and the endocrine hypothalamus-pituitary-testis system: a ...
SUMMARY The known range of the zoonotic fox tapeworm Echinococcus multilocularis has expanded since the 1990s, and today this parasite is recorded in higher abundances throughout large parts of Europe. This phenomenon is mostly attributed to the increasing European fox populations and their invasion of urban habitats. However, these factors alone are insufficient to explain the heterogeneous distribution of the parasite in Europe. Here, we analysed the spatial interrelationship of E. multilocularis with the known distribution of seven vole species in Ticino, southern Switzerland. Among 404 necropsied foxes (1990-2006) and 79 fox faecal samples (2010-2012), E. multilocularis was consistently found in the north of the investigated area. No expansion of this endemic focus was recorded during the 22 years of the study period. This stable endemic focus is coincident with the known distribution of the vole species Microtus arvalis but not, or only partly, with the distribution of the other ...
Poster (2010, November 18). Gammaherpesviruses are the archetypes of persistent viruses that have been identified in a range of animals from mice to man. They are host-range specific and establish persistent, productive infections ... [more ▼]. Gammaherpesviruses are the archetypes of persistent viruses that have been identified in a range of animals from mice to man. They are host-range specific and establish persistent, productive infections of immunocompetent hosts. Thus, infected individuals simultaneously both elicit antiviral protective immune response and secrete infectious virions. The best studied gammaherpesviruses are Human herpesvirus 4 and Human herpesvirus 8. As these viruses have no well-established in vivo infection model, related animal gammaherpesviruses are an important source of information. We are studying Murid herpesvirus 4 (MuHV-4), a virus that has originally been isolated from bank voles (Myodes glareolus). Although MuHV-4 has not been isolated from house mice (Mus ...
ABSTRACT. Cucumis melo subsp. agrestis var. agrestis Naudin; belonging to Cucurbitaceae family is commonly known as Wild Melon (English), Kachari (Hindi), is an annual climber, probably indigenous to North India. In present study standardization of C. melo subsp. agrestis was performed as per WHO guidelines including macroscopy and microscopy, ash values, extractive values, loss on drying, fluorescence analysis, swelling index, foaming index, determination of volatile oil content. To complete the study methanol and water extract of powdered seeds was screened for various phytoconstituents. The qualitative chemical analysis of extracts was found positive for alkaloids, proteins, carbohydrates, flavonoids and sterols. These studies provide valuable information for the identification and standardization of this plant material. ...
The genetic diversity of Puumala hantavirus (PUUV) was studied in a local population of its natural host, the bank vole (Myodes glareolus). The trapping area (2.5x2.5 km) at Konnevesi, Central Finland, included 14 trapping sites, at least 500 m apart; altogether, 147 voles were captured during May and October 2005. Partial sequences of the S, M and L viral genome segments were recovered from 40 animals. Seven, 12 and 17 variants were detected for the S, M and L sequences, respectively; these represent new wild-type PUUV strains that belong to the Finnish genetic lineage. The genetic diversity of PUUV strains from Konnevesi was 0.2-4.9% for the S segment, 0.2-4.8% for the M segment and 0.2-9.7% for the L segment. Most nucleotide substitutions were synonymous and most deduced amino acid substitutions were conservative, probably due to strong stabilizing selection operating at the protein level. Based on both sequence markers and phylogenetic clustering, the S, M and L sequences could be assigned ...
Glucagon is conventionally regarded as a counterregulatory hormone for insulin and plays a critical anti-hypoglycemic role by maintaining glucose homeostasis in both animals and humans. To increase blood glucose, glucagon promotes hepatic glucose output by increasing glycogenolysis and gluconeogenesis and by decreasing glycogenesis and glycolysis in a concerted fashion via multiple mechanisms. Glucagon also stimulates hepatic mitochondrial beta-oxidation to supply energy for glucose production. Glucagon performs its main effect via activation of adenylate cyclase. The adenylate-cyclase-derived cAMP activates protein kinase A (PKA), which then phosphorylates downstream targets, such as cAMP response element binding protein (CREB) and the bifunctional enzyme 6-phosphofructo-2-kinase/ fructose-2,6-bisphosphatase (one of the isoforms being PFK/FBPase 1, encoded by PFKFB1 ...
K03857 PIGA; phosphatidylinositol N-acetylglucosaminyltransferase subunit A [EC:2.4.1.198] K03859 PIGC; phosphatidylinositol N-acetylglucosaminyltransferase subunit C K03858 PIGH; phosphatidylinositol N-acetylglucosaminyltransferase subunit H K03858 PIGH; phosphatidylinositol N-acetylglucosaminyltransferase subunit H K03861 PIGP; phosphatidylinositol N-acetylglucosaminyltransferase subunit P K03860 PIGQ; phosphatidylinositol N-acetylglucosaminyltransferase subunit Q K11001 PIGY; phosphatidylinositol N-acetylglucosaminyltransferase subunit Y K11001 PIGY; phosphatidylinositol N-acetylglucosaminyltransferase subunit Y K09658 DPM2; dolichol phosphate-mannose biosynthesis regulatory protein K09658 DPM2; dolichol phosphate-mannose biosynthesis regulatory protein K03434 PIGL; N-acetylglucosaminylphosphatidylinositol deacetylase [EC:3.5.1.89] K05283 PIGW; glucosaminylphosphatidylinositol acyltransferase [EC:2.3.-.-] K01127 GPLD1; glycosylphosphatidylinositol phospholipase D [EC:3.1.4.50] K05284 PIGM; ...
By creating artificial selection lines divergent for male T and measuring subsequent reproductive fitness of F1 full siblings, we demonstrated several important elements of intralocus sexual conflict in the small mammal M. glareolus. First, we show that inheritance patterns of paternal T reveal a negative correlation on the fitness of opposite-sex progeny (father-daughter, mother-son; table 1 and figure 1). Second, we show a selection line by sex interaction between reproductive fitness estimates in male and female bank voles (figure 2). Third, the fitness of full siblings is negatively correlated (figure 3). Accordingly, our study indicates that sexually antagonistic selection is probably acting on the steroid hormone T, which has importance implications for sexual selection.. Could the negative correlation in fitness between F1 full siblings be owing to mechanisms other than intralocus conflict? Differential non-genetic investment by mothers may produce such a result. However, bank vole ...
I am broadly interested in evolutionary and ecological research, but have a particular interest in understanding the ecological significance of adaptive genetic diversity. How does variation at adaptive genes influence individual fitness and adaptive potential and hence population viability? My research spans molecular ecology, conservation genetics, spatial dynamics and wildlife management. To date my work has focussed on investigating the processes underlying variation at MHC genes in the water vole (Arvicola terrestris), and using large scale approaches and genetic tools to explore community dynamics and dispersal, and thereby inform management strategies for the control of the invasive American mink (Neovison vison). My current work will combine stable isotope, genetic, and disease data, to characterise how natural selection acts upon American mink as they make the transition across the invasion gradient from farm to breeding in the wild ...
Why do humans (and animals?) feel this emotion of love? What purpose does that serve? Literally, what is love? I read this one article in Science Magazine the other day that basically says that "love" is just a bunch of hormones and chemicals running through the brain. It said that oxytocin is released in the brain, which (for example) causes a human mother to take care of her baby instead of leaving it since it cant take care of itself. The oxytocin receptors happened to overlap with dopamine receptors in the part of the brain called the nucleus accumbens (generally regarded as one of the brains essential pleasure centers) (at least, this last statement is true in the case of the monogamous prairie voles). So I think that means that basically, every time a human being engages in an act of love, their brains reward them by feeling good, which encourages love. Is that right? If so, why is that so? I mean, why love when we could have instead just been able to survive independantly at birth? What ...
Doctoral thesis (2012). Gammaherpesviruses are the archetype of persistent viruses that have been identified in a series of animals ranging from mice to man. To date the study of transmission of these viruses in natural ... [more ▼]. Gammaherpesviruses are the archetype of persistent viruses that have been identified in a series of animals ranging from mice to man. To date the study of transmission of these viruses in natural condition has been limited by the fact that no experimental transmission model exists. Establishment and characterization of a model of transmission are therefore critical points to evaluate strategies of interference with the epidemiological cycle of gammaherpesviruses. We are studying Murid herpesvirus 4 (MuHV-4) which has originally been isolated from naturally infected bank voles (Myodes glareolus). Although serological data indicate that closely related strains are present in wood mice (Apodemus sylvaticus) and domestic mice (Mus musculus), no experimental ...
So why are pair-bonding mammals more susceptible to substance abuse? Because the same neural circuitry that governs pair-bonding also governs susceptibility to substance abuse, and pair-bonders seem to have a more sensitive version of it than most mammals. When pair-bonding mammals are longing for a mate (whether or not they correctly analyze the roots of that longing), they are vulnerable to any neurochemical buzz that signals "relief.". Scientists saw this recently when they compared the effects of amphetamine on two types of voles: pair-bonding prairie voles, and promiscuous montane voles. Dopamine rose significantly more in response to the drug use in the pair-bonding voles than in the voles who were not wired to seek long-term mates. The monogamous voles were inclined to find certain dopamine-based rewards more rewarding than their promiscuous vole cousins. In short, a lonely pair-bonder would have a greater risk of becoming an addict than would a mammal with no built-in urge to form a ...
This week I have decided to write about weasels. They are our smallest carnivore and widespread throughout Britain, but absent from most off-shore islands and Ireland. Being so widespread, it is perhaps unsurprising that they are found in a wide range of habitats. These range from urban areas, marshes, woodland, lowland pasture and moors. Prey for weasels are less numerous in areas such as high altitudes and very dense woodlands and as a result weasels are far less common in these areas. A weasels prey are small rodents such as voles and mice. If rodents are scarce then birds, eggs and even rabbits will be eaten. It is very common for dens made by prey species to be taken over.. In colder climates in Europe these dens are sometimes lined with the fur of lemming prey. During the breeding season it is usual for one litter of 4-6 young to be born, but this will often increase to two litters if field voles are abundant. ...
Thats the Golden Guide to Mammals by Herbert S. Zim and Donald F. Hoffmeister, copyright 1955. It features "218 ANIMALS IN FULL COLOR", with maps of their distribution and short descriptions of their habitat and life histories. I remember reading that from cover to cover, practically memorizing it, and going on long walks out into the fields and forests around my home, looking for the elusive Boreal Red-Backed Vole or the dens of the Hoary Bat, or using it to try to identify the shredded carcasses of road kill.. Now with hindsight I realize its a rather awful little book, simultaneously too thin on information for each species to be really useful, and far too limited in breadth to be helpful in actually appreciating diversity, but I have to appreciate it for being an early provocateur, telling me that there was more to the life around me than people, my dog, and the lettuces and corn growing in the nearby fields. So thank you Drs Zim and Hoffmeister! I had to buy the rather ragged copy on sale ...
Observation - Bank Vole Molar Teeth - UK and Ireland. Description: Seen indoors in the sense that they were extracted from a barn owl pellet which was found indoors.
2003 (English)In: International journal of experimental diabetes research, Vol. 4, p. 35-44Article in journal (Refereed) Published ...
The present genetic analysis revealed that the mouthbrooding adults of X. rotundiventralis were most likely the genetic mothers and fathers of the young in their mouths. This result suggests that each female broods offspring that she has laid and each male receives the young that he has fertilized from his mate. This finding strongly suggests that the female-to-male shift of young takes place between mating partners. Therefore, the mating pairs most likely maintain the pair bonds at least until the female-to-male shift of young occurs. There are two possible explanations of why these pair bonds are not recognized by eye: one explanation is that the pairs maintain physical proximity, but mingle with other conspecific individuals in schools, and the other explanation is that the pairs do not maintain physical proximity most of the time. At present, there is no information regarding which explanation is more likely. One adult male (M38) was most likely the genetic father of the two young brooded by ...
We determined the prevalence of infection with lymphocytic choriomeningitis virus (LCMV) among small mammals in northern Italy and analyzed long-term dynamics of LCMV in a rodent population in the province of Trento. LCMV is circulating among the most widespread and common wild rodent species in this area (Apodemus flavicollis, Myodes glareolus, and Microtus arvalis); overall prevalence is 6.8%. During 2000-2006, intensive monitoring of LCMV in a population of yellow-necked mice (A. flavicollis) showed a positive correlation between prevalence of infection and rodent density. At the individual level, weight and sex appeared to correlate with antibody prevalence, which suggests that horizontal transmission of LCMV occurs principally among heavier, older males and occurs during fighting. Isolation and genetic characterization of this virus will be the crucial next steps for a better understanding of its ecology.
Populations of bank voles (Clethrionomys glareolus) were monitored during a 4-year study in southern Belgium to assess the influence of agonistic behavior, reproductive status, mobility, and distribution of the rodents on the dynamics of Puumala virus (abbreviation: PUUV; genus: Hantavirus) infection. Concordance was high between data from serologic testing and results of viral RNA detection. Wounds resulting from biting or scratching were observed mainly in adult rodents. Hantavirus infection in adults was associated with wounds in the fall, i.e., at the end of the breeding season, but not in spring. In addition, sexually active animals were significantly more often wounded and positive for infection. Hantavirus infection was associated with higher mobility in juvenile and subadult males. Seroconversions observed 6 months apart also occurred more frequently in animals that had moved longer distances from their original capture point. During nonepidemic years, the distribution of infection was patchy,
Lyme borreliosis (LB) and nephropathia epidemica (NE) are zoonoses resulting from two different transmission mechanisms and the action of two different pathogens: the bacterium Borrelia burgdorferi and the Puumala virus, respectively. The landscape configuration is known to influence the spatial spread of both diseases by affecting vector demography and human exposure to infection. Yet, the connections between landscape and disease have rarely been quantified, thereby hampering the exploitation of land cover data sources to segment areas in function of risk. This study implemented a data-driven approach to relate land cover metrics and an indicator of NE/LB risk at different scales of observation of the landscape. Our results showed the suitability of the modeling approach (r² | 0.75, ? | 0.001) and highlighted the relevance of the scale of observation in the set of landscape attributes found to influence disease risk as well as common and specific risk factors of NE and LB.
Dioxin-like chemicals and brominated flame retardants are ubiquitous in the environment, despite the introduction of international prohibitions and restrictions. These chemicals do not remain in the vicinity of their source, instead they can be transported over long distances, in fact even to pristine areas in the northern latitudes. However, there have been rather few time series experiments monitoring the trends in the levels of chlorinated and brominated forms of these chemicals in the environment. In this study, the concentrations of polychlorinated dibenzo-p-dioxins and -furans (PCDDs/Fs), polychlorinated biphenyls (PCBs) and polybrominated diethyl ethers (PBDEs) were measured in the liver and muscle of bank voles (Myodes glareolus) caught in a remote area in Finnish Lapland during 1986-2007. Five time points were selected: years 1986, 1992, 1998, 2003 and 2007. The levels of PCDDs/Fs and PCBs declined from 1986 until 2003 in both females and males, but tended to increase again in 2007. The peak
Caption Credit: NASA. The artistic impression shows NASAs planet-hunting Kepler spacecraft operating in a new mission profile called K2. In May the spacecraft began its new mission observing in the ecliptic plane, the orbital path of Earth around the sun, depicted by the grey-blue line marked by opaque cross-like shapes. Each shape represents the field-of-view of an observing campaign. The K2 mission observes a specific portion of the distant sky for approximately 80 days, until it is necessary to rotate the spacecraft to prevent sunlight from entering the telescope. The spacecraft orbits the sun every 372 days as it trails Earth, allowing for four full campaigns per orbit or year. The arching band of stars is the plane of the Milky Way Galaxy. Using publicly available data collected by the spacecraft in February 2014 during the performance concept test to prove K2 would work, astronomers have confirmed the first exoplanet detected by the K2 mission. The newly confirmed planet, HIP 116454b, is ...
The four viruses that are associated with HFRS are named for the region from which they were first isolated. These viruses have different primary hosts: Apodemus agrarius (striped field mouse) for Hantaan virus, Rattus norvegicus (Norway rat) and Rattus rattus (black rat) for Seoul virus, Clethrionomys glareolus (bank vole) for Puumala virus, and Apodemus flavicollis (yellow-necked field mouse) for Dobrava virus. Hantaan virus and Dobrava virus are associated with a severe form of HFRS with an estimated mortality rate of 5% to 15%. Seoul virus causes a more moderate form of HFRS, but has a much wider world distribution than the other viruses in this group. Serologic evidence for infection with Seoul hantavirus has been found in rodents in major cities of the United States, and this virus was recently implicated in human cases of HFRS in Baltimore, Wisconsin and Illinois, and possibly other US states as well ...
Parmenter, R.R., J.W. Brunt, D.I. Moore, and S. Ernest. 1993. The Hantavirus epidemic in the southwest: Rodent population dynamics and the implications for transmission of Hantavirus-associated Adult Respiratory Distress Syndrome (HARDS) in the four corners region. A report submitted to the F. ...
Dobrava-Belgrade virus (DOBV), also known as Dobrava virus, is an enveloped, single-stranded, negative-sense RNA virus species of Old World Orthohantavirus. It is one of several species of Hantavirus that is the causative agent of severe Hantavirus hemorrhagic fever with renal syndrome. It was first isolated from yellow-necked mice (Apodemus flavicollis) found in Dobrava Village, Slovenia, Yugoslavia. It was subsequently isolated in striped field mice in Russia and other parts of Eastern Europe. It has also been found in Germany but the reservoir host there is unknown. Dobrava virus and the variants of Dobrava-Belgrade virus have been found in the Yellow-necked mouse [(Apodemus flavicollis) virus genotype Dobrava], the Striped field mouse [(Apodemus agrarius) virus genotype Kurkino] and Black Sea field mouse [(Apodemus ponticus) virus genotype Sochi]. The fatality rate is 12%, making Dobrava virus the most life-threatening hantavirus disease in Europe. Variant DOBV genotypes have different ...
Arvicolinae Genus:. Myodes Species: M. rufocanus Binomial name Myodes rufocanus. (Sundevall, 1846) ...
Subfamily: Arvicolinae *Genus: Arvicola *Water vole Arvicola terrestris LR/lc. *Genus: Chionomys *Snow vole Chionomys nivalis ...
Arvicolinae Genus:. Microtus Subgenus:. Terricola Species: M. bavaricus Binomial name Microtus bavaricus. (König, 1962) ...
Wen-Yu Wu; Lawrence J. Flynn (2017). "Yushe Basin Prometheomyini (Arvicolinae, Rodentia)". In Lawrence J. Flynn; Wen-Yu Wu. ...
Musser, G. G. and M. D. Carleton. 2005. Superfamily Muroidea. pp. 894-1531 in Mammal Species of the World a Taxonomic and Geographic Reference. D. E. Wilson and D. M. Reeder eds. Johns Hopkins University Press, Baltimore ...
Arvicolinae) from Armenia" (PDF). Russian Journal of Theriology. 15 (2): 151-158. Thomas S. Kelly; Paul C. Murphey (2016). " ...
... is a tribe of lemmings in the subfamily Arvicolinae. It contains only one extant genus, as well as one extinct ...
A vole is a small rodent in the subfamily Arvicolinae. Vole may also refer to: Vole (magazine), a UK environmental magazine ...
... is a tribe of voles in the subfamily Arvicolinae. Tribe Arvicolini Genus Arvicola - water voles European (or ...
... species form the subfamily Arvicolinae with the lemmings and the muskrats. They are small rodents that grow to 3-9 in (7.6 ... Order Rodentia Superfamily Muroidea Family Cricetidae Subfamily Arvicolinae (in part) Tribe Arvicolini Genus Arvicola - water ...
The Myodini are a tribe of forest voles in the subfamily Arvicolinae. Species in this tribe are: Tribe Myodini Genus Alticola ...
Subfamilia Arvicolinae. *Subfamilia Cricetinae. *Subfamilia Lophiomyinae. *Subfamilia Neotominae. *Subfamilia Sigmodontinae. * ...
Norris, R. W.; Zhou, K. Y.; Zhou, C. Q.; Yang, G.; Kilpatrick, C. W.; Honeycutt, R. L. (2004), "The phylogenetic position of the zokors (Myospalacinae) and comments on the families of muroids (Rodentia)", 》Molecular Phylogenetics and Evolution》 31 (3): 972-978, PMID 15120394, doi:10.1016/j.ympev.2003.10.020 ...
Lagurus is a genus in the subfamily Arvicolinae (voles, lemmings, and related species). Lagurus includes a single living ...
Karraskarien barruko Arvicolinae azpifamilia eta Cricetidae familian sailkatuta dago.. Erreferentziak[aldatu , aldatu iturburu ...
Karraskarien barruko Arvicolinae azpifamilia eta Cricetidae familian sailkatuta dago.. Erreferentziak[aldatu , aldatu iturburu ...
Karraskarien barruko Arvicolinae azpifamilia eta Cricetidae familian sailkatuta dago. Egun Errusian eta Kanadan baino ez da ...
Arvicolinae) from the eastern and south-central United States". Journal of Vertebrate Paleontology. 10 (4): 484-490. doi: ...
It is part of the tribe Arvicolini within the subfamily Arvicolinae, which contains the voles, lemmings, and relatives. It ... A new vole (Cricetidae: Arvicolinae: Proedromys) from the Liangshan Mountains of Sichuan Province, China. Journal of Mammalogy ...
Family: Cricetidae Subfamily: Arvicolinae Genus: Myodes Bank vole Myodes glareolus not assessed - a recent introduction. Family ...
The subfamily Arvicolinae, the voles and lemmings, has the zygomatic plate tilted upwards very strongly. In the subfamily ... The Philippine Batomys, Carpomys, and Crateromys have well-developed zygomatic plates, reminiscent of those in Arvicolinae. ...
The viruses carried by the Arvicolinae and Murinae subfamilies originated in Asia 500-700 years ago. These subsequently spread ...
... is an extinct genus of forest voles, subfamily Arvicolinae, tribe Pliomyini (Musser and Carleton, 2005). One member is ...
Bell, J.; Bever, J.S. (2006). "Description and significance of the Microtus (Rodentia: Arvicolinae) from the type Irvington ...
Hypsodont molars can continue to grow throughout life, for example in some species of Arvicolinae (herbivorous rodents). ...
"The evolutionary radiation of Arvicolinae rodents (voles and lemmings): relative contribution of nuclear and mitochondrial DNA ...
Subfamily Arvicolinae - voles, lemmings, muskrats The subfamily Arvicolinae contains ten tribes, seven of which are classified ... Arvicolinae are Holarctic in distribution and represent one of only a few major muroid radiations to reach the New World via ... The Arvicolinae are a subfamily of rodents that includes the voles, lemmings, and muskrats. They are most closely related to ... The Arvicolinae are the most populous group of Rodentia in the Northern Hemisphere. They often are found in fossil occlusions ...
... Dataset homepage ... Murphy R W (2011). A new vole from Xizang, China and the molecular phylogeny of the genus Neodon (Cricetidae: Arvicolinae). ... Arvicolinae). Zootaxa 3235: 1-22, DOI: 10.5281/zenodo.280393 Taxonomic Coverages. Geographic Coverages. Bibliographic Citations ...
Subfamily Arvicolinae lemmings and voles Arvicolinae: information (1) Arvicolinae: pictures (51) Arvicolinae: specimens (27) ... Arvicolinae is a large subfamily of cricetid rodents that are fairly uniform in appearance but diverse in their habits. There ... In the subfamily Arvicolinae, the IUCN lists 23 lower risk species, 1 near threatened species (wood lemming, Myopus ... The subfamily Arvicolinae has a Holarctic distribution. Arvicolines are found throughout North America from Guatemala northward ...
Arvicolinae Genus:. Myodes Species: M. rufocanus Binomial name Myodes rufocanus. (Sundevall, 1846) ...
Subfamily: Arvicolinae *Genus: Arvicola *Water vole Arvicola terrestris LR/lc. *Genus: Chionomys *Snow vole Chionomys nivalis ...
Arvicolinae • Genus: Arborimus Taylor, 1915 ...
Arvicolinae • Genus: Microtus • Species: Microtus duodecimcostatus ...
Arvicolinae, Rodentia) inferred from mitochondrial DNA sequences. Mol Phylogenet Evol 33:647-663. https://doi.org/10.1016/j. ...
Arvicolinae Population statistics The name vole is short for the archaic word volemouse, which may come from Norwegian vollmus ...
5.0 5.1 5.2 5.3 5.4 5.5 5.6 5.7 5.8 5.9 M. J. R. Jordan, "Rats, mice, and relatives I: Voles and lemmings (Arvicolinae)," pages ... other authorities place the subfamily Arvicolinae in the family Muridae.[5][6][7]. Arvicolinae also is also sometimes referred ... Subfamily Arvicolinae (in part) *Tribe Arvicolini *Genus Arvicola - water voles. *Genus Blanfordimys - Afghan vole and ... Some authorities place Arvicolinae in the family Cricetidae[1][2][3] As such, the voles closest relatives, besides the lemmings ...
Subfamilia: Arvicolinae Genus: Microtus Species: Microtus pinetorum Name[edit]. Microtus pinetorum (LeConte, 1830) ...
Subfamilia: Arvicolinae Genus: Ellobius. Species: Ellobius tancrei Name[edit]. Ellobius tancrei Blasius, 1884 ...
Wen-Yu Wu; Lawrence J. Flynn (2017). "Yushe Basin Prometheomyini (Arvicolinae, Rodentia)". In Lawrence J. Flynn; Wen-Yu Wu. ...
Subfamilia Arvicolinae. *Subfamilia Cricetinae. *Subfamilia Lophiomyinae. *Subfamilia Neotominae. *Subfamilia Sigmodontinae. * ...
Arvicolinae / virology*. Disease Reservoirs*. Hemorrhagic Fever with Renal Syndrome / epidemiology*, virology. Humans. ...
Norris, R. W.; Zhou, K. Y.; Zhou, C. Q.; Yang, G.; Kilpatrick, C. W.; Honeycutt, R. L. (2004), "The phylogenetic position of the zokors (Myospalacinae) and comments on the families of muroids (Rodentia)", 》Molecular Phylogenetics and Evolution》 31 (3): 972-978, PMID 15120394, doi:10.1016/j.ympev.2003.10.020 ...
Vole species form the subfamily Arvicolinae with the lemmings and the muskrats. ...
Karraskarien barruko Arvicolinae azpifamilia eta Cricetidae familian sailkatuta dago.. Erreferentziak[aldatu , aldatu iturburu ...
Karraskarien barruko Arvicolinae azpifamilia eta Cricetidae familian sailkatuta dago.. Erreferentziak[aldatu , aldatu iturburu ...
During the past two decades population cycles in voles, grouse and insects have been fading out in Europe. Here, we discuss the cause and implication of these changes. Several lines of evidence now point to climate forcing as the general underlying cause. However, how climate interacts with demograp …
The Smithsonian Institution Archives is using Constant Contact, a third-party contact management software vendor, to manage contacts and send eNewsletters. Please be advised that Constant Contacts Privacy Statement and Terms and Conditions apply to your use of these services. The Smithsonian Institution Archives has access to your name and email address which is subject to our privacy statement. ...
Small rodent of the Arvicolinae subfamily. ☢ Unit of electric potential ☢. To periodically shed fur or skin. ...
Arvicolinae-, Sigmodontinae-associated viruses) and showed equal relatedness to all 3 groups. This exceptional position of the ...
  • We investigated the level of intrachromosomal rearrangement in the Arvicolinae subfamily, a species-rich taxon characterized by very high rate of karyotype evolution. (mdpi.com)
  • Los muroideos clasificar en 6 families , 19 subfamilies , cerca de 280 xéneros y siquier 1300 especies . (wikipedia.org)
  • Haukisalmi V., Henttonen H. 2001: Biogeography of helminth parasitism in Lemmus Link (Arvicolinae), with the description of Paranoplocephala fellmani n. sp. (cas.cz)
  • Biogeography of helminth parasitism in Lemmus Link (Arvicolinae), with the description of Paranoplocephala fellmani n. sp. (semanticscholar.org)
  • Duplication, balancing selection and trans-species evolution explain the high levels of polymorphism of the DQA MHC class II gene in voles (Arvicolinae). (ivb.cz)
  • Pp. 501-755 en Mammal Species of the World a Taxonomic and Geographic Reference . (wikipedia.org)
  • Pp. 894-1531 en Mammal Species of the World a Taxonomic and Geographic Reference . (wikipedia.org)