Oxidoreductases that specifically reduce arsenate ion to arsenite ion. Reduction of arsenate is a critical step for its biotransformation into a form that can be transported by ARSENITE TRANSPORTING ATPASES or complexed by specific sulfhydryl-containing proteins for the purpose of detoxification (METABOLIC DETOXIFICATION, DRUG). Arsenate reductases require reducing equivalents such as GLUTAREDOXIN or AZURIN.
Inorganic or organic salts and esters of arsenic acid.
A general class of integral membrane proteins that transport ions across a membrane against an electrochemical gradient.
Efflux pumps that use the energy of ATP hydrolysis to pump arsenite across a membrane. They are primarily found in prokaryotic organisms, where they play a role in protection against excess intracellular levels of arsenite ions.
A plant genus of the family PTERIDACEAE. Members contain entkaurane DITERPENES. The name is similar to bracken fern (PTERIDIUM).
A shiny gray element with atomic symbol As, atomic number 33, and atomic weight 75. It occurs throughout the universe, mostly in the form of metallic arsenides. Most forms are toxic. According to the Fourth Annual Report on Carcinogens (NTP 85-002, 1985), arsenic and certain arsenic compounds have been listed as known carcinogens. (From Merck Index, 11th ed)
Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.
Inorganic salts or organic esters of arsenious acid.
A family of thioltransferases that contain two active site CYSTEINE residues, which either form a disulfide (oxidized form) or a dithiol (reduced form). They function as an electron carrier in the GLUTHIONE-dependent synthesis of deoxyribonucleotides by RIBONUCLEOTIDE REDUCTASES and may play a role in the deglutathionylation of protein thiols. The oxidized forms of glutaredoxins are directly reduced by the GLUTATHIONE.
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
A subclass of dual specificity phosphatases that play a role in the progression of the CELL CYCLE. They dephosphorylate and activate CYCLIN-DEPENDENT KINASES.
Hydrogen-donating proteins that participates in a variety of biochemical reactions including ribonucleotide reduction and reduction of PEROXIREDOXINS. Thioredoxin is oxidized from a dithiol to a disulfide when acting as a reducing cofactor. The disulfide form is then reduced by NADPH in a reaction catalyzed by THIOREDOXIN REDUCTASE.
Oxidoreductases that are specific for the reduction of NITRATES.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
Enzymes that catalyze the reversible reduction of alpha-carboxyl group of 3-hydroxy-3-methylglutaryl-coenzyme A to yield MEVALONIC ACID.
Ribonucleotide Reductases are enzymes that catalyze the conversion of ribonucleotides to deoxyribonucleotides, which is a crucial step in DNA synthesis and repair, utilizing a radical mechanism for this conversion.
A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A FLAVOPROTEIN oxidoreductase that occurs both as a soluble enzyme and a membrane-bound enzyme due to ALTERNATIVE SPLICING of a single mRNA. The soluble form is present mainly in ERYTHROCYTES and is involved in the reduction of METHEMOGLOBIN. The membrane-bound form of the enzyme is found primarily in the ENDOPLASMIC RETICULUM and outer mitochondrial membrane, where it participates in the desaturation of FATTY ACIDS; CHOLESTEROL biosynthesis and drug metabolism. A deficiency in the enzyme can result in METHEMOGLOBINEMIA.
A group of enzymes that oxidize diverse nitrogenous substances to yield nitrite. (Enzyme Nomenclature, 1992) EC 1.
Catalyzes the oxidation of GLUTATHIONE to GLUTATHIONE DISULFIDE in the presence of NADP+. Deficiency in the enzyme is associated with HEMOLYTIC ANEMIA. Formerly listed as EC 1.6.4.2.
An enzyme that utilizes NADH or NADPH to reduce FLAVINS. It is involved in a number of biological processes that require reduced flavin for their functions such as bacterial bioluminescence. Formerly listed as EC 1.6.8.1 and EC 1.5.1.29.
A FLAVOPROTEIN enzyme that catalyzes the oxidation of THIOREDOXINS to thioredoxin disulfide in the presence of NADP+. It was formerly listed as EC 1.6.4.5
A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.
A flavoprotein that catalyzes the reduction of heme-thiolate-dependent monooxygenases and is part of the microsomal hydroxylating system. EC 1.6.2.4.
An enzyme that catalyzes the oxidation and reduction of FERREDOXIN or ADRENODOXIN in the presence of NADP. EC 1.18.1.2 was formerly listed as EC 1.6.7.1 and EC 1.6.99.4.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Proteins found in any species of bacterium.
Cytochrome reductases are enzymes that catalyze the transfer of electrons from donor molecules to cytochromes in electron transport chains, playing a crucial role in cellular respiration and energy production within cells.

Studies on the ADP-ribose pyrophosphatase subfamily of the nudix hydrolases and tentative identification of trgB, a gene associated with tellurite resistance. (1/35)

Four Nudix hydrolase genes, ysa1 from Saccharomyces cerevisiae, orf209 from Escherichia coli, yqkg from Bacillus subtilis, and hi0398 from Hemophilus influenzae were amplified, cloned into an expression vector, and transformed into E. coli. The expressed proteins were purified and shown to belong to a subfamily of Nudix hydrolases active on ADP-ribose. Comparison with other members of the subfamily revealed a conserved proline 16 amino acid residues downstream of the Nudix box, common to all of the ADP-ribose pyrophosphatase subfamily. In this same region, a conserved tyrosine designates another subfamily, the diadenosine polyphosphate pyrophosphatases, while an array of eight conserved amino acids is indicative of the NADH pyrophosphatases. On the basis of these classifications, the trgB gene, a tellurite resistance factor from Rhodobacter sphaeroides, was predicted to designate an ADP-ribose pyrophosphatase. In support of this hypothesis, a highly specific ADP-ribose pyrophosphatase gene from the archaebacterium, Methanococcus jannaschii, introduced into E. coli, increased the transformant's tolerance to potassium tellurite.  (+info)

Purification and characterization of ACR2p, the Saccharomyces cerevisiae arsenate reductase. (2/35)

In Saccharomyces cerevisiae, expression of the ACR2 and ACR3 genes confers arsenical resistance. Acr2p is the first identified eukaryotic arsenate reductase. It reduces arsenate to arsenite, which is then extruded from cells by Acr3p. In this study, we demonstrate that ACR2 complemented the arsenate-sensitive phenotype of an arsC deletion in Escherichia coli. ACR2 was cloned into a bacterial expression vector and expressed in E. coli as a C-terminally histidine-tagged protein that was purified by sequential metal chelate affinity and gel filtration chromatography. Acr2p purified as a homodimer of 34 kDa. The purified protein was shown to catalyze the reduction of arsenate to arsenite. Enzymatic activity as a function of arsenate concentration exhibited an apparent positive cooperativity with an apparent Hill coefficient of 2.7. Activity required GSH and glutaredoxin as the source of reducing equivalents. Thioredoxin was unable to support arsenate reduction. However, glutaredoxins from both S. cerevisiae and E. coli were able to serve as reductants. Analysis of grx mutants lacking one or both cysteine residues in the Cys-Pro-Tyr-Cys active site demonstrated that only the N-terminal cysteine residue is essential for arsenate reductase activity. This suggests that during the catalytic cycle, Acr2p forms a mixed disulfide with GSH before being reduced by glutaredoxin to regenerate the active Acr2p reductase.  (+info)

The phosphatase C(X)5R motif is required for catalytic activity of the Saccharomyces cerevisiae Acr2p arsenate reductase. (3/35)

Acr2p detoxifies arsenate by reduction to arsenite in Saccharomyces cerevisiae. This reductase has been shown to require glutathione and glutaredoxin, suggesting that thiol chemistry might be involved in the reaction mechanism. Acr2p has a HC(X)(5)R motif, the signature sequence of the phosphate binding loop of the dual-specific and protein-tyrosine phosphatase family. In Acr2p these are residues His-75, Cys-76, and Arg-82, respectively. Acr2p has another sequence, (118)HCR, that is absent in phosphatases. Acr2p also has a third cysteine residue at position 106. Each of these cysteine residues was changed individually to serine residues, whereas the histidine and arginine residues were altered to alanines. Cells of Escherichia coli heterologously expressing the majority of the mutant ACR2 genes retained wild type resistance to arsenate, and the purified altered Acr2p proteins exhibited normal enzymatic properties. In contrast, cells expressing either the C76S or R82A mutations lost resistance to arsenate, and the purified proteins were inactive. These results suggest that Acr2p utilizes a phosphatase-like Cys(X)(5)Arg motif as the catalytic center to reduce arsenate to arsenite.  (+info)

Bacillus subtilis arsenate reductase is structurally and functionally similar to low molecular weight protein tyrosine phosphatases. (4/35)

Arsenate is an abundant oxyanion that, because of its ability to mimic the phosphate group, is toxic to cells. Arsenate reductase (EC; encoded by the arsC gene in bacteria) participates to achieve arsenate resistance in both prokaryotes and yeast by reducing arsenate to arsenite; the arsenite is then exported by a specific transporter. The crystal structure of Bacillus subtilis arsenate reductase in the reduced form with a bound sulfate ion in its active site is solved at 1.6-A resolution. Significant structural similarity is seen between arsenate reductase and bovine low molecular weight protein tyrosine phosphatase, despite very low sequence identity. The similarity is especially high between their active sites. It is further confirmed that this structural homology is relevant functionally by showing the phosphatase activity of the arsenate reductase in vitro. Thus, we can understand the arsenate reduction in the light of low molecular weight protein tyrosine phosphatase mechanism and also explain the catalytic roles of essential residues such as Cys-10, Cys-82, Cys-89, Arg-16, and Asp-105. A "triple cysteine redox relay" is proposed for the arsenate reduction mechanism.  (+info)

Arsenate reductases in prokaryotes and eukaryotes. (5/35)

The ubiquity of arsenic in the environment has led to the evolution of enzymes for arsenic detoxification. An initial step in arsenic metabolism is the enzymatic reduction of arsenate [As(V)] to arsenite [As(III)]. At least three families of arsenate reductase enzymes have arisen, apparently by convergent evolution. The properties of two of these are described here. The first is the prokaryotic ArsC arsenate reductase of Escherichia coli. The second, Acr2p of Saccharomyces cerevisiae, is the only identified eukaryotic arsenate reductase. Although unrelated to each other, both enzymes receive their reducing equivalents from glutaredoxin and reduced glutathione. The structure of the bacterial ArsC has been solved at 1.65 A. As predicted from its biochemical properties, ArsC structures with covalent enzyme-arsenic intermediates that include either As(V) or As(III) were observed. The yeast Acr2p has an active site motif HC(X)(5)R that is conserved in protein phosphotyrosine phosphatases and rhodanases, suggesting that these three groups of enzymes may have evolved from an ancestral oxyanion-binding protein.  (+info)

Directed evolution of a yeast arsenate reductase into a protein-tyrosine phosphatase. (6/35)

Arsenic, which is ubiquitous in the environment and comes from both geochemical and anthropogenic sources, has become a worldwide public health problem. Every organism studied has intrinsic or acquired mechanisms for arsenic detoxification. In Saccharomyces cerevisiae arsenate is detoxified by Acr2p, an arsenate reductase. Acr2p is not a phosphatase but is a homologue of CDC25 phosphatases. It has the HCX5R phosphatase motif but not the glycine-rich phosphate binding motif (GXGXXG) that is found in protein-tyrosine phosphatases. Here we show that creation of a phosphate binding motif through the introduction of glycines at positions 79, 81, and 84 in Acr2p resulted in a gain of phosphotyrosine phosphatase activity and a loss of arsenate reductase activity. Arsenate likely achieved geochemical abundance only after the atmosphere became oxidizing, creating pressure for the evolution of an arsenate reductase from a protein-tyrosine phosphatase. The ease by which an arsenate reductase can be converted into a protein-tyrosine phosphatase supports this hypothesis.  (+info)

An arsenate reductase from Synechocystis sp. strain PCC 6803 exhibits a novel combination of catalytic characteristics. (7/35)

The deduced protein product of open reading frame slr0946 from Synechocystis sp. strain PCC 6803, SynArsC, contains the conserved sequence features of the enzyme superfamily that includes the low-molecular-weight protein-tyrosine phosphatases and the Staphylococcus aureus pI258 ArsC arsenate reductase. The recombinant protein product of slr0946, rSynArsC, exhibited vigorous arsenate reductase activity (V(max) = 3.1 micro mol/min. mg), as well as weak phosphatase activity toward p-nitrophenyl phosphate (V(max) = 0.08 micro mol/min. mg) indicative of its phosphohydrolytic ancestry. pI258 ArsC from S. aureus is the prototype of one of three distinct families of detoxifying arsenate reductases. The prototypes of the others are Acr2p from Saccharomyces cerevisiae and R773 ArsC from Escherichia coli. All three have converged upon catalytic mechanisms involving an arsenocysteine intermediate. While SynArsC is homologous to pI258 ArsC, its catalytic mechanism exhibited a unique combination of features. rSynArsC employed glutathione and glutaredoxin as the source of reducing equivalents, like Acr2p and R773 ArsC, rather than thioredoxin, as does the S. aureus enzyme. As postulated for Acr2p and R773 ArsC, rSynArsC formed a covalent complex with glutathione in an arsenate-dependent manner. rSynArsC contains three essential cysteine residues like pI258 ArsC, whereas the yeast and E. coli enzymes require only one cysteine for catalysis. As in the S. aureus enzyme, these "extra" cysteines apparently shuttle a disulfide bond to the enzyme's surface to render it accessible for reduction. SynArsC and pI258 ArsC thus appear to represent alternative branches in the evolution of their shared phosphohydrolytic ancestor into an agent of arsenic detoxification.  (+info)

Transcriptional activation of metalloid tolerance genes in Saccharomyces cerevisiae requires the AP-1-like proteins Yap1p and Yap8p. (8/35)

All organisms are equipped with systems for detoxification of the metalloids arsenic and antimony. Here, we show that two parallel pathways involving the AP-1-like proteins Yap1p and Yap8p are required for acquisition of metalloid tolerance in the budding yeast S. cerevisiae. Yap8p is demonstrated to reside in the nucleus where it mediates enhanced expression of the arsenic detoxification genes ACR2 and ACR3. Using chromatin immunoprecipitation assays, we show that Yap8p is associated with the ACR3 promoter in untreated as well as arsenic-exposed cells. Like for Yap1p, specific cysteine residues are critical for Yap8p function. We further show that metalloid exposure triggers nuclear accumulation of Yap1p and stimulates expression of antioxidant genes. Yap1p mutants that are unable to accumulate in the nucleus during H(2)O(2) treatment showed nearly normal nuclear retention in response to metalloid exposure. Thus, our data are the first to demonstrate that Yap1p is being regulated by metalloid stress and to indicate that this activation of Yap1p operates in a manner distinct from stress caused by chemical oxidants. We conclude that Yap1p and Yap8p mediate tolerance by controlling separate subsets of detoxification genes and propose that the two AP-1-like proteins respond to metalloids through distinct mechanisms.  (+info)

Arsenate reductases are enzymes that catalyze the reduction of arsenate (As(V)) to arsenite (As(III)). This reaction is a critical step in the detoxification process of arsenic compounds in many organisms, including bacteria, fungi, and plants. The enzyme typically uses thioredoxin or glutaredoxin as an electron donor to reduce arsenate.

The medical significance of arsenate reductases lies in their role in arsenic detoxification and resistance. Exposure to high levels of arsenic can lead to a variety of health issues, including skin lesions, cancer, and neurological disorders. Understanding the mechanisms of arsenate reduction and detoxification may provide insights into new strategies for treating arsenic poisoning and developing environmental remediation technologies.

Arsenates are salts or esters of arsenic acid (AsO4). They contain the anion AsO4(3-), which consists of an arsenic atom bonded to four oxygen atoms in a tetrahedral arrangement. Arsenates can be found in various minerals, and they have been used in pesticides, wood preservatives, and other industrial applications. However, arsenic is highly toxic to humans and animals, so exposure to arsenates should be limited. Long-term exposure to arsenic can cause skin lesions, cancer, and damage to the nervous system, among other health problems.

Ion pumps, also known as ion transporters, are membrane-bound proteins that actively transport ions across a biological membrane against their electrochemical gradient. This process requires energy, usually in the form of ATP (adenosine triphosphate), and allows cells to maintain resting potentials, regulate intracellular ion concentrations, and facilitate various physiological processes such as nerve impulse transmission, muscle contraction, and cell volume regulation.

Ion pumps can transport one or more types of ions, including sodium (Na+), potassium (K+), chloride (Cl-), calcium (Ca2+), and protons (H+). A well-known example of an ion pump is the Na+/K+ ATPase, which transports three sodium ions out of the cell and two potassium ions into the cell for each ATP molecule hydrolyzed. This creates a concentration gradient that drives the passive transport of Na+ and K+ ions through other channels, contributing to the resting membrane potential.

Arsenite transporting ATPases are a type of membrane-bound enzyme complexes that use the energy from ATP hydrolysis to actively transport arsenic compounds across cell membranes. They are part of the P-type ATPase family and play a crucial role in detoxifying cells by removing arsenite (AsIII) ions, which are highly toxic even at low concentrations.

These enzymes consist of two main domains: a cytoplasmic domain responsible for ATP binding and hydrolysis, and a transmembrane domain that contains the ion transport pathway. The transport process involves several conformational changes in the protein structure, driven by ATP hydrolysis, which ultimately result in the movement of arsenite ions against their concentration gradient from the cytoplasm to the extracellular space or into organelles like vacuoles and endosomes.

In humans, there are two main isoforms of arsenite transporting ATPases: ACR3 (also known as ARS-A) and ACR2 (or ARS-B). Both isoforms have been identified in various tissues, including the liver, kidney, and intestine. Mutations in these genes can lead to impaired arsenic detoxification and increased susceptibility to arsenic toxicity.

Overall, arsenite transporting ATPases are essential for maintaining cellular homeostasis and protecting organisms from the harmful effects of environmental arsenic exposure.

I apologize for any confusion, but "Pteris" is not a medical term. It is the name of a genus of ferns, commonly known as brake ferns or table ferns. If you have any questions about a medical term or concept, please provide it, and I would be happy to help define it for you.

Arsenic is a naturally occurring semi-metal element that can be found in the earth's crust. It has the symbol "As" and atomic number 33 on the periodic table. Arsenic can exist in several forms, including inorganic and organic compounds. In its pure form, arsenic is a steel-gray, shiny solid that is brittle and easily pulverized.

Arsenic is well known for its toxicity to living organisms, including humans. Exposure to high levels of arsenic can cause various health problems, such as skin lesions, neurological damage, and an increased risk of cancer. Arsenic can enter the body through contaminated food, water, or air, and it can also be absorbed through the skin.

In medicine, arsenic has been used historically in the treatment of various diseases, including syphilis and parasitic infections. However, its use as a therapeutic agent is limited due to its toxicity. Today, arsenic trioxide is still used as a chemotherapeutic agent for the treatment of acute promyelocytic leukemia (APL), a type of blood cancer. The drug works by inducing differentiation and apoptosis (programmed cell death) in APL cells, which contain a specific genetic abnormality. However, its use is closely monitored due to the potential for severe side effects and toxicity.

Multienzyme complexes are specialized protein structures that consist of multiple enzymes closely associated or bound together, often with other cofactors and regulatory subunits. These complexes facilitate the sequential transfer of substrates along a series of enzymatic reactions, also known as a metabolic pathway. By keeping the enzymes in close proximity, multienzyme complexes enhance reaction efficiency, improve substrate specificity, and maintain proper stoichiometry between different enzymes involved in the pathway. Examples of multienzyme complexes include the pyruvate dehydrogenase complex, the citrate synthase complex, and the fatty acid synthetase complex.

Arsenites are inorganic compounds that contain arsenic in the trivalent state (arsenic-III). They are formed by the reaction of arsenic trioxide (As2O3) or other trivalent arsenic compounds with bases such as sodium hydroxide, potassium hydroxide, or ammonia.

The most common and well-known arsenite is sodium arsenite (NaAsO2), which has been used in the past as a wood preservative and pesticide. However, due to its high toxicity and carcinogenicity, its use has been largely discontinued. Other examples of arsenites include potassium arsenite (KAsO2) and calcium arsenite (Ca3(AsO3)2).

Arsenites are highly toxic and can cause a range of health effects, including skin irritation, nausea, vomiting, diarrhea, abdominal pain, and death in severe cases. Long-term exposure to arsenites has been linked to an increased risk of cancer, particularly lung, bladder, and skin cancer.

Glutaredoxins (Grxs) are small, ubiquitous proteins that belong to the thioredoxin superfamily. They play a crucial role in maintaining the redox balance within cells by catalyzing the reversible reduction of disulfide bonds and mixed disulfides between protein thiols and low molecular weight compounds, using glutathione (GSH) as a reducing cofactor.

Glutaredoxins are involved in various cellular processes, such as:

1. DNA synthesis and repair
2. Protein folding and degradation
3. Antioxidant defense
4. Regulation of enzyme activities
5. Iron-sulfur cluster biogenesis

There are two main classes of glutaredoxins, Grx1 and Grx2, which differ in their active site sequences and functions. In humans, Grx1 is primarily located in the cytosol, while Grx2 is found in both the cytosol and mitochondria.

The medical relevance of glutaredoxins lies in their role as antioxidant proteins that protect cells from oxidative stress and maintain cellular redox homeostasis. Dysregulation of glutaredoxin function has been implicated in several pathological conditions, including neurodegenerative diseases, cancer, and aging-related disorders.

Oxidoreductases are a class of enzymes that catalyze oxidation-reduction reactions, which involve the transfer of electrons from one molecule (the reductant) to another (the oxidant). These enzymes play a crucial role in various biological processes, including energy production, metabolism, and detoxification.

The oxidoreductase-catalyzed reaction typically involves the donation of electrons from a reducing agent (donor) to an oxidizing agent (acceptor), often through the transfer of hydrogen atoms or hydride ions. The enzyme itself does not undergo any permanent chemical change during this process, but rather acts as a catalyst to lower the activation energy required for the reaction to occur.

Oxidoreductases are classified and named based on the type of electron donor or acceptor involved in the reaction. For example, oxidoreductases that act on the CH-OH group of donors are called dehydrogenases, while those that act on the aldehyde or ketone groups are called oxidases. Other examples include reductases, peroxidases, and catalases.

Understanding the function and regulation of oxidoreductases is important for understanding various physiological processes and developing therapeutic strategies for diseases associated with impaired redox homeostasis, such as cancer, neurodegenerative disorders, and cardiovascular disease.

CDC25 phosphatases are a group of enzymes that play crucial roles in the regulation of the cell cycle, which is the series of events that cells undergo as they grow and divide. Specifically, CDC25 phosphatases function to remove inhibitory phosphates from certain cyclin-dependent kinases (CDKs), thereby activating them and allowing the cell cycle to progress.

There are three main types of CDC25 phosphatases in humans, known as CDC25A, CDC25B, and CDC25C. These enzymes are named after the original yeast homolog, called Cdc25, which was discovered to be essential for cell cycle progression.

CDC25 phosphatases are tightly regulated during the cell cycle, with their activity being controlled by various mechanisms such as phosphorylation, protein-protein interactions, and subcellular localization. Dysregulation of CDC25 phosphatases has been implicated in several human diseases, including cancer, where they can contribute to uncontrolled cell growth and division. Therefore, understanding the functions and regulation of CDC25 phosphatases is an important area of research in molecular biology and medicine.

Thioredoxins are a group of small proteins that contain a redox-active disulfide bond and play a crucial role in the redox regulation of cellular processes. They function as electron donors and help to maintain the intracellular reducing environment by reducing disulfide bonds in other proteins, thereby regulating their activity. Thioredoxins also have antioxidant properties and protect cells from oxidative stress by scavenging reactive oxygen species (ROS) and repairing oxidatively damaged proteins. They are widely distributed in various organisms, including bacteria, plants, and animals, and are involved in many physiological processes such as DNA synthesis, protein folding, and apoptosis.

Nitrate reductases are a group of enzymes that catalyze the reduction of nitrate (NO3-) to nitrite (NO2-). This process is an essential part of the nitrogen cycle, where nitrate serves as a terminal electron acceptor in anaerobic respiration for many bacteria and archaea. In plants, this enzyme plays a crucial role in nitrogen assimilation by reducing nitrate to ammonium (NH4+), which can then be incorporated into organic compounds. Nitrate reductases require various cofactors, such as molybdenum, heme, and/or FAD, for their activity. There are three main types of nitrate reductases: membrane-bound (which use menaquinol as an electron donor), cytoplasmic (which use NADH or NADPH as an electron donor), and assimilatory (which also use NADH or NADPH as an electron donor).

Oxidation-Reduction (redox) reactions are a type of chemical reaction involving a transfer of electrons between two species. The substance that loses electrons in the reaction is oxidized, and the substance that gains electrons is reduced. Oxidation and reduction always occur together in a redox reaction, hence the term "oxidation-reduction."

In biological systems, redox reactions play a crucial role in many cellular processes, including energy production, metabolism, and signaling. The transfer of electrons in these reactions is often facilitated by specialized molecules called electron carriers, such as nicotinamide adenine dinucleotide (NAD+/NADH) and flavin adenine dinucleotide (FAD/FADH2).

The oxidation state of an element in a compound is a measure of the number of electrons that have been gained or lost relative to its neutral state. In redox reactions, the oxidation state of one or more elements changes as they gain or lose electrons. The substance that is oxidized has a higher oxidation state, while the substance that is reduced has a lower oxidation state.

Overall, oxidation-reduction reactions are fundamental to the functioning of living organisms and are involved in many important biological processes.

Hydroxymethylglutaryl CoA (HMG-CoA) reductase is an enzyme that plays a crucial role in the synthesis of cholesterol in the body. It is found in the endoplasmic reticulum of cells and catalyzes the conversion of HMG-CoA to mevalonic acid, which is a key rate-limiting step in the cholesterol biosynthetic pathway.

The reaction catalyzed by HMG-CoA reductase is as follows:

HMG-CoA + 2 NADPH + 2 H+ → mevalonic acid + CoA + 2 NADP+

This enzyme is the target of statin drugs, which are commonly prescribed to lower cholesterol levels in the treatment of cardiovascular diseases. Statins work by inhibiting HMG-CoA reductase, thereby reducing the production of cholesterol in the body.

Ribonucleotide Reductases (RNRs) are enzymes that play a crucial role in DNA synthesis and repair. They catalyze the conversion of ribonucleotides to deoxyribonucleotides, which are the building blocks of DNA. This process involves the reduction of the 2'-hydroxyl group of the ribose sugar to a hydrogen, resulting in the formation of deoxyribose.

RNRs are highly regulated and exist in various forms across different species. They are divided into three classes (I, II, and III) based on their structure, mechanism, and cofactor requirements. Class I RNRs are further divided into two subclasses (Ia and Ib), which differ in their active site architecture and regulation.

Class Ia RNRs, found in eukaryotes and some bacteria, contain a stable tyrosyl radical that acts as the catalytic center for hydrogen abstraction. Class Ib RNRs, found in many bacteria, use a pair of iron centers to perform the same function. Class II RNRs are present in some bacteria and archaea and utilize adenosine triphosphate (ATP) as a cofactor for reduction. Class III RNRs, found in anaerobic bacteria and archaea, use a unique mechanism involving a radical S-adenosylmethionine (SAM) cofactor to facilitate the reduction reaction.

RNRs are essential for DNA replication and repair, and their dysregulation has been linked to various diseases, including cancer and neurodegenerative disorders. Therefore, understanding the structure, function, and regulation of RNRs is of great interest in biochemistry, molecular biology, and medicine.

Cysteine is a semi-essential amino acid, which means that it can be produced by the human body under normal circumstances, but may need to be obtained from external sources in certain conditions such as illness or stress. Its chemical formula is HO2CCH(NH2)CH2SH, and it contains a sulfhydryl group (-SH), which allows it to act as a powerful antioxidant and participate in various cellular processes.

Cysteine plays important roles in protein structure and function, detoxification, and the synthesis of other molecules such as glutathione, taurine, and coenzyme A. It is also involved in wound healing, immune response, and the maintenance of healthy skin, hair, and nails.

Cysteine can be found in a variety of foods, including meat, poultry, fish, dairy products, eggs, legumes, nuts, seeds, and some grains. It is also available as a dietary supplement and can be used in the treatment of various medical conditions such as liver disease, bronchitis, and heavy metal toxicity. However, excessive intake of cysteine may have adverse effects on health, including gastrointestinal disturbances, nausea, vomiting, and headaches.

Molecular sequence data refers to the specific arrangement of molecules, most commonly nucleotides in DNA or RNA, or amino acids in proteins, that make up a biological macromolecule. This data is generated through laboratory techniques such as sequencing, and provides information about the exact order of the constituent molecules. This data is crucial in various fields of biology, including genetics, evolution, and molecular biology, allowing for comparisons between different organisms, identification of genetic variations, and studies of gene function and regulation.

Nitrite reductases are a group of enzymes that catalyze the reduction of nitrite (NO2-) to nitric oxide (NO). This reaction is an important part of the nitrogen cycle, particularly in denitrification and dissimilatory nitrate reduction to ammonium (DNRA) processes. Nitrite reductases can be classified into two main types based on their metal co-factors: copper-containing nitrite reductases (CuNiRs) and cytochrome cd1 nitrite reductases. CuNiRs are typically found in bacteria and fungi, while cytochrome cd1 nitrite reductases are primarily found in bacteria. These enzymes play a crucial role in the global nitrogen cycle and have potential implications for environmental and medical research.

Glutathione reductase (GR) is an enzyme that plays a crucial role in maintaining the cellular redox state. The primary function of GR is to reduce oxidized glutathione (GSSG) to its reduced form (GSH), which is an essential intracellular antioxidant. This enzyme utilizes nicotinamide adenine dinucleotide phosphate (NADPH) as a reducing agent in the reaction, converting it to NADP+. The medical definition of Glutathione Reductase is:

Glutathione reductase (GSR; EC 1.8.1.7) is a homodimeric flavoprotein that catalyzes the reduction of oxidized glutathione (GSSG) to reduced glutathione (GSH) in the presence of NADPH as a cofactor. This enzyme is essential for maintaining the cellular redox balance and protecting cells from oxidative stress by regenerating the active form of glutathione, a vital antioxidant and detoxifying agent.

Flavin Mononucleotide (FMN) Reductase is an enzyme that catalyzes the reduction of FMN to FMNH2 using NADH or NADPH as an electron donor. This enzyme plays a crucial role in the electron transport chain and is involved in various redox reactions within the cell. It is found in many organisms, including bacteria, fungi, plants, and animals. In humans, FMN Reductase is encoded by the RIBFLR gene and is primarily located in the mitochondria. Defects in this enzyme can lead to various metabolic disorders.

Thioredoxin-disulfide reductase (Txnrd, TrxR) is an enzyme that belongs to the pyridine nucleotide-disulfide oxidoreductase family. It plays a crucial role in maintaining the intracellular redox balance by reducing disulfide bonds in proteins and keeping them in their reduced state. This enzyme utilizes NADPH as an electron donor to reduce thioredoxin (Trx), which then transfers its electrons to various target proteins, thereby regulating their activity, protein folding, and antioxidant defense mechanisms.

Txnrd is essential for several cellular processes, including DNA synthesis, gene expression, signal transduction, and protection against oxidative stress. Dysregulation of Txnrd has been implicated in various pathological conditions, such as cancer, neurodegenerative diseases, and inflammatory disorders. Therefore, understanding the function and regulation of this enzyme is of great interest for developing novel therapeutic strategies.

Adenosine triphosphatases (ATPases) are a group of enzymes that catalyze the conversion of adenosine triphosphate (ATP) into adenosine diphosphate (ADP) and inorganic phosphate. This reaction releases energy, which is used to drive various cellular processes such as muscle contraction, transport of ions across membranes, and synthesis of proteins and nucleic acids.

ATPases are classified into several types based on their structure, function, and mechanism of action. Some examples include:

1. P-type ATPases: These ATPases form a phosphorylated intermediate during the reaction cycle and are involved in the transport of ions across membranes, such as the sodium-potassium pump and calcium pumps.
2. F-type ATPases: These ATPases are found in mitochondria, chloroplasts, and bacteria, and are responsible for generating a proton gradient across the membrane, which is used to synthesize ATP.
3. V-type ATPases: These ATPases are found in vacuolar membranes and endomembranes, and are involved in acidification of intracellular compartments.
4. A-type ATPases: These ATPases are found in the plasma membrane and are involved in various functions such as cell signaling and ion transport.

Overall, ATPases play a crucial role in maintaining the energy balance of cells and regulating various physiological processes.

NADPH-ferrihemoprotein reductase, also known as diaphorase or NO synthase reductase, is an enzyme that catalyzes the reduction of ferrihemoproteins using NADPH as a reducing cofactor. This reaction plays a crucial role in various biological processes such as the detoxification of certain compounds and the regulation of cellular signaling pathways.

The systematic name for this enzyme is NADPH:ferrihemoprotein oxidoreductase, and it belongs to the family of oxidoreductases that use NADH or NADPH as electron donors. The reaction catalyzed by this enzyme can be represented as follows:

NADPH + H+ + ferrihemoprotein ↔ NADP+ + ferrohemoprotein

In this reaction, the ferric (FeIII) form of hemoproteins is reduced to its ferrous (FeII) form by accepting electrons from NADPH. This enzyme is widely distributed in various tissues and organisms, including bacteria, fungi, plants, and animals. It has been identified as a component of several multi-enzyme complexes involved in different metabolic pathways, such as nitric oxide synthase (NOS) and cytochrome P450 reductase.

In summary, NADPH-ferrihemoprotein reductase is an essential enzyme that catalyzes the reduction of ferrihemoproteins using NADPH as a reducing agent, playing a critical role in various biological processes and metabolic pathways.

Ferredoxin-NADP Reductase (FDNR) is an enzyme that catalyzes the electron transfer from ferredoxin to NADP+, reducing it to NADPH. This reaction plays a crucial role in several metabolic pathways, including photosynthesis and nitrogen fixation.

In photosynthesis, FDNR is located in the stroma of chloroplasts and receives electrons from ferredoxin, which is reduced by photosystem I. The enzyme then transfers these electrons to NADP+, generating NADPH, which is used in the Calvin cycle for carbon fixation.

In nitrogen fixation, FDNR is found in the nitrogen-fixing bacteria and receives electrons from ferredoxin, which is reduced by nitrogenase. The enzyme then transfers these electrons to NADP+, generating NADPH, which is used in the reduction of nitrogen gas (N2) to ammonia (NH3).

FDNR is a flavoprotein that contains a FAD cofactor and an iron-sulfur cluster. The enzyme catalyzes the electron transfer through a series of conformational changes that bring ferredoxin and NADP+ in close proximity, allowing for efficient electron transfer.

An amino acid sequence is the specific order of amino acids in a protein or peptide molecule, formed by the linking of the amino group (-NH2) of one amino acid to the carboxyl group (-COOH) of another amino acid through a peptide bond. The sequence is determined by the genetic code and is unique to each type of protein or peptide. It plays a crucial role in determining the three-dimensional structure and function of proteins.

Bacterial proteins are a type of protein that are produced by bacteria as part of their structural or functional components. These proteins can be involved in various cellular processes, such as metabolism, DNA replication, transcription, and translation. They can also play a role in bacterial pathogenesis, helping the bacteria to evade the host's immune system, acquire nutrients, and multiply within the host.

Bacterial proteins can be classified into different categories based on their function, such as:

1. Enzymes: Proteins that catalyze chemical reactions in the bacterial cell.
2. Structural proteins: Proteins that provide structural support and maintain the shape of the bacterial cell.
3. Signaling proteins: Proteins that help bacteria to communicate with each other and coordinate their behavior.
4. Transport proteins: Proteins that facilitate the movement of molecules across the bacterial cell membrane.
5. Toxins: Proteins that are produced by pathogenic bacteria to damage host cells and promote infection.
6. Surface proteins: Proteins that are located on the surface of the bacterial cell and interact with the environment or host cells.

Understanding the structure and function of bacterial proteins is important for developing new antibiotics, vaccines, and other therapeutic strategies to combat bacterial infections.

Cytochrome reductases are a group of enzymes that play a crucial role in the electron transport chain, a process that occurs in the mitochondria of cells and is responsible for generating energy in the form of ATP (adenosine triphosphate). Specifically, cytochrome reductases are responsible for transferring electrons from one component of the electron transport chain to another, specifically to cytochromes.

There are several types of cytochrome reductases, including NADH dehydrogenase (also known as Complex I), succinate dehydrogenase (also known as Complex II), and ubiquinone-cytochrome c reductase (also known as Complex III). These enzymes help to facilitate the flow of electrons through the electron transport chain, which is essential for the production of ATP and the maintenance of cellular homeostasis.

Defects in cytochrome reductases can lead to a variety of mitochondrial diseases, which can affect multiple organ systems and may be associated with symptoms such as muscle weakness, developmental delays, and cardiac dysfunction.

... may refer to: Arsenate reductase (azurin) Arsenate reductase (cytochrome c) Arsenate reductase (donor) ... Arsenate reductase (glutaredoxin) This set index page lists enzyme articles associated with the same name. If an internal link ...
... (EC 1.20.4.1) is an enzyme that catalyzes the chemical reaction arsenate + glutaredoxin ⇌ {\ ... reduction of arsenate to arsenite by human liver arsenate reductase". Chem. Res. Toxicol. 13 (1): 26-30. doi:10.1021/tx990115k ... Gladysheva T, Liu J, Rosen BP (1996). "His-8 lowers the pKa of the essential Cys-12 residue of the ArsC arsenate reductase of ... Silver S; Garber, Eric A. E.; Armes, L. Gene; Chen, Chih-Ming; Fuchs, James A.; Silver, Simon (1994). "Arsenate reductase of ...
... (EC 1.20.9.1) is an enzyme that catalyzes the chemical reaction arsenite + H2O + 2 azurinox ⇌ {\ ... displaystyle \rightleftharpoons } arsenate + 2 azurinred + 2 H+ The 3 substrates of this enzyme are arsenite, water, and ... oxidised azurin, whereas its 3 products are arsenate, reduced azurin, and hydrogen ion. This enzyme belongs to the family of ...
... arsenate + 2 reduced cytochrome c + 2 H+ Arsenate reductase is a molybdoprotein isolated from alpha-proteobacteria that ... Arsenate reductase (cytochrome c) (EC 1.20.2.1, arsenite oxidase) is an enzyme with systematic name arsenite:cytochrome c ... Arsenate+reductase+(cytochrome+c) at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology ( ...
... reduction of arsenate to arsenite by human liver arsenate reductase". Chem. Res. Toxicol. 13 (1): 26-30. doi:10.1021/tx990115k ... Arsenate reductase (donor) (EC 1.20.99.1) is an enzyme that catalyzes the chemical reaction arsenite + acceptor ⇌ {\ ... Krafft T, Macy JM (1998). "Purification and characterization of the respiratory arsenate reductase of Chrysiogenes arsenatis". ... The systematic name of this enzyme class is arsenate:acceptor oxidoreductase. This enzyme is also called arsenate:(acceptor) ...
"Respiratory arsenate reductase as a bidirectional enzyme". Biochemical and Biophysical Research Communications. 382 (2): 298- ...
ArsC is an approximately 150-residue arsenate reductase that uses reduced glutathione (GSH) to convert arsenate to arsenite ... Liu J, Rosen BP (August 1997). "Ligand interactions of the ArsC arsenate reductase". J. Biol. Chem. 272 (34): 21084-9. doi: ... and mechanism of ArsC arsenate reductase, a novel arsenic detoxification enzyme". Structure. 9 (11): 1071-81. doi:10.1016/S0969 ... Arsenate, however, must first be reduced to arsenite before it is extruded. A third gene, arsC, expands the substrate ...
"The respiratory arsenate reductase from Bacillus selenitireducensstrain MLS10". FEMS Microbiology Letters. 226 (1): 107-112. ...
The enzymes involved are known as arsenate reductases. In 2008, bacteria were discovered that employ a version of ... IUPAC have recommended that arsenite compounds are to be named as arsenate(III), for example ortho-arsenite is called ... Some species of bacteria obtain their energy by oxidizing various fuels while reducing arsenates to form arsenites. ... researchers conjectured that historically these photosynthesizing organisms produced the arsenates that allowed the arsenate- ...
... derive their energy from reducing arsenate (As(+5)) to arsenite (As(+3)) via arsenate reductase ... a membrane-bound or periplasmic respiratory arsenate reductase and a cytoplasmic arsenate reductase. The anaerobic respiratory ... It appears that arsenate reduction by the Desulfovibrio strain Ben-RA is catalyzed by an arsenate reductase that is encoded by ... Arsenate-reducing bacteria are bacteria which reduce arsenates. Arsenate-reducing bacteria are ubiquitous in arsenic- ...
Ordóñez E, Van Belle K, Roos G, De Galan S, Letek M, Gil JA, Wyns L, Mateos LM, Messens J (May 2009). "Arsenate reductase, ... mycothiol-mycoredoxin disulfide Reduction of arsenate is part of a defense mechanism of the cell against toxic arsenate. ...
Localization of the dissimilatory arsenate reductase in Sulfurospirillum Barnesi strain SeS-3. Am. J. Agric. Biol. Sci., 7: 97- ...
Localization of the dissimilatory arsenate reductase in Sulfurospirillum Barnesi strain SeS-3. Am. J. Agric. Biol. Sci., 7: 97- ...
Ordóñez E, Van Belle K, Roos G, De Galan S, Letek M, Gil JA, Wyns L, Mateos LM, Messens J (May 2009). "Arsenate reductase, ... Arsenate-mycothiol transferase (EC 2.8.4.2, ArsC1, ArsC2, mycothiol:arsenate transferase) is an enzyme with systematic name ... Wikimedia Commons has media related to Arsenate-mycothiol transferase. Arsenate-mycothiol+transferase at the U.S. National ... H2O Reduction of arsenate is part of a defence mechanism of the cell against toxic arsenate. ...
This ability is proposed to be due to gene encoding for respiratory arsenate reductase. List of bacterial orders List of ...
... and arsenate reductases, into functionally relevant clusters. Alumni Fellow, Pennsylvania State University College of Medicine ... Isofunctional Clustering and Conformational Analysis of the Arsenate Reductase Superfamily Reveals Nine Distinct Clusters. ... "Isofunctional Clustering and Conformational Analysis of the Arsenate Reductase Superfamily Reveals Nine Distinct Clusters". ...
Duan, Gui-Lan; Zhu, Yong-Guan; Tong, Yi-Ping; Cai, Chao; Kneer, Ralf (2005). "Characterization of Arsenate Reductase in the ...
Guo X, Li Y, Peng K, Hu Y, Li C, Xia B, Jin C (Nov 2005). "Solution structures and backbone dynamics of arsenate reductase from ... Bacillus subtilis: reversible conformational switch associated with arsenate reduction". The Journal of Biological Chemistry. ...
The enzymes involved are known as arsenate reductases (Arr). In 2008, bacteria were discovered that employ a version of ... Synthetic arsenates include Scheele's Green (cupric hydrogen arsenate, acidic copper arsenate), calcium arsenate, and lead ... Arsenite (AsO3−3) is more soluble than arsenate (AsO3−4) and is more toxic; however, at a lower pH, arsenate becomes more ... In the second half of the 20th century, monosodium methyl arsenate (MSMA) and disodium methyl arsenate (DSMA) - less toxic ...
... may refer to: Arsenate reductase (cytochrome c) Arsenate reductase (azurin) This disambiguation page lists ...
... sphaericus strain CBAM5 showed resistance to 200 mM of arsenic which may be explained by the presence of the arsenate reductase ...
... respiratory arsenate reductase, carbon monoxide dehydrogenase, aldehyde oxidase. Prosthetic group of: formate dehydrogenase, ... Molybdopterin is a: Cofactor of: xanthine oxidase, DMSO reductase, sulfite oxidase, nitrate reductase, ethylbenzene ... Enzymes that contain the molybdopterin cofactor include xanthine oxidase, DMSO reductase, sulfite oxidase, and nitrate ... DMSO reductase, the metal is bound to two molybdopterin cofactors. Models for the active sites of enzymes molybdopterin- ...
... significant Glutathione Reductase inhibition by sodium arsenate has only been at 10 mg/kg/day. Glutathione reductase is also ... In vitro, glutathione reductase is inhibited by low concentrations of sodium arsenite and methylated arsenate metabolites, but ... Glutathione reductase (GR) also known as glutathione-disulfide reductase (GSR) is an enzyme that in humans is encoded by the ... In particular, glutathione reductase appears to be a good target for anti-malarials, as the glutathione reductase of the ...
EC 1.20.4 Arsenate reductase (glutaredoxin) EC 1.20.4.1 Glutaredoxin Category:EC 1.20.9 Category:EC 1.20.99 Category:EC 1.21.1 ... reductase EC 1.17.4.1 Ribonucleoside-triphosphate reductase EC 1.17.4.2 Vitamin K epoxide reductase Vitamin-K-epoxide reductase ... Nitrite reductase EC 1.7.99.3 Nitrate reductase EC 1.7.99.4 Category:EC 1.8.1 (with NAD+ or NADP+ as acceptor) Glutathione ... Dihydrofolate reductase EC 1.5.1.3 Methylenetetrahydrofolate reductase EC 1.5.1.20 Category:EC 1.5.3 (with oxygen as acceptor) ...
These genes include a putative arsenite efflux pump and an arsenate reductase, as well as genes similar to those found in ...
... reductase". Chemical Research in Toxicology. 12 (12): 1278-83. doi:10.1021/tx9901231. PMID 10604879. Zakharyan RA, Ayala-Fierro ... dimethylarsinate An enzyme of the biotransformation pathway that forms dimethylarsinate from inorganic arsenite and arsenate. ...
... diphosphate-arsenate from ADP and arsenate in presence of succinate. Thus, by a variety of mechanisms arsenate leads to an ... Arsenite inhibits members of the disulfide oxidoreductase family like glutathione reductase and thioredoxin reductase. The ... Arsenate can replace phosphate in many reactions. It is able to form Glc-6-arsenate in vitro; therefore it has been argued that ... Chromated copper arsenate has been registered for use in the United States since the 1940s as a wood preservative, protecting ...
... by the enzymes nitrate reductase, nitrite reductase, nitric oxide reductase, and nitrous oxide reductase, respectively. Protons ... Arsenate (AsO3− 4) reduction to arsenite (AsO3− 3) Uranyl ion (UO2+ 2) reduction to uranium dioxide (UO 2) A number of ... The APS is then reduced by the enzyme APS reductase to form sulfite (SO2− 3) and AMP. In organisms that use carbon compounds as ... Some organisms (e.g. E. coli) only produce nitrate reductase and therefore can accomplish only the first reduction leading to ...
The replacement of phosphate by arsenate is initiated when arsenate reacts with glucose and gluconate in vitro. This reaction ... glutathione reductase, pyruvate dehydrogenase, and thioredoxin reductase. Arsenic is a cause of mortality throughout the world ... "Absence of Detectable Arsenate in DNA from Arsenate-Grown GFAJ-1 Cells". Science. 337 (6093): 470-3. arXiv:1201.6643. Bibcode: ... Although phosphate and arsenate are structurally similar, there is no evidence that arsenic replaces phosphorus in DNA or RNA. ...
In particular the presence of both a cytoplasmic and a periplasmic polysulfide reductases has been detected, in order to reduce ... They are mesophilic, exhibiting anaerobic respiration in which arsenate serves as the electron acceptor. Strictly anaerobic, ... NCB37-1 has been given the hypothesis in which a polysulfide reductase (PsrABC) is involved in its sulfur reduction. ... Further genetic analysis revealed that the polysulfide reductases from Sulfurimonas sp.NW10 share less than 40% sequence ...
Arsenate reductase may refer to: Arsenate reductase (azurin) Arsenate reductase (cytochrome c) Arsenate reductase (donor) ... Arsenate reductase (glutaredoxin) This set index page lists enzyme articles associated with the same name. If an internal link ...
... but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one ... Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the ... We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is ... homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity ...
ARSENATE REDUCTASE FROM E. COLI; X-RAY DIFFRACTION 1.65 Å SMTL ID. 1i9d.1. Ligands. SULFATE ION; SULFITE ION; CESIUM ION. ... ARSENATE REDUCTASE. Oligo-state. homo-dimer. SMTL ID. 1i9d.3. Ligands. SULFATE ION; SULFITE ION; CESIUM ION. Polypeptides. ... ARSENATE REDUCTASE. Oligo-state. homo-dimer. SMTL ID. 1i9d.4. Ligands. SULFATE ION; SULFITE ION; CESIUM ION. Polypeptides. ... ARSENATE REDUCTASE. Oligo-state. monomer. SMTL ID. 1i9d.2. Ligands. SULFATE ION; SULFITE ION; CESIUM ION. Polypeptides. ...
Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and gamma-glutamylcysteine ... 2002). Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and gamma- ... 2002). Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and gamma- ...
... arsenate reductase; ArsD, arsenical resistance operon trans-acting repressor and arsenic chaperone; ArsAB, arsenic efflux pump ... genes encoding the arsenite transporter ArsB and another arsenate reductase ArsC, were also detected elsewhere in the At. ... mercuric reductase. Arsenic resistance components: GlpF, glycerol MIP channel; PstACS, high affinity phosphate transport system ...
Wild Type pI258 S. aureus arsenate reductase. 1lju. X-RAY STRUCTURE OF C15A ARSENATE REDUCTASE FROM PI258 COMPLEXED WITH ... X-ray structure of reduced C10S, C15A arsenate reductase from pI258. 1jfv. X-Ray Structure of oxidised C10S, C15A arsenate ... pI258 arsenate reductase (ArsC) triple mutant C10S/C15A/C82S. 1u2p. Crystal structure of Mycobacterium tuberculosis Low ... Staphylococcus aureus pI258 arsenate reductase (ArsC) H62Q mutant. 2cwd. Crystal Structure of TT1001 protein from Thermus ...
A novel arsenate reductase from the arsenic hyperaccumulating fern Pteris vittata. Plant Physiology 141: 1544-1554.. CrossRef ... Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and gamma-glutamylcysteine ... Expression of mercuric ion reductase in Eastern cottonwood (Populus deltoides) confers mercuric ion reduction and resistance. ...
Arsenate reductase. GOSPT_089_00550. E. ARSB2. (NRULE_0016). Arsenite resistance protein ArsB. GOSPT_082_00120. ... Ferredoxin reductase. GOSPT_096_00080 GOSPT_025_00720. Aromatic hydrocarbon degradation (via hydroxylation by dioxygenase)( ... NADH-dependent flavin reductase. GOSPT_028_00050 GOSPT_085_00850 GOSPT_045_00360 GOSPT_004_00390. ... NADH-dependent flavin reductase. GOSPT_085_00850 GOSPT_045_00360 GOSPT_028_00050 GOSPT_004_00390. ...
Engineering tolerance and hyperaccumulation of arsenic in plants by combining arsenate reductase and y-glutamylcysteine ...
arsB and arsC are arsenic detoxification genes; arsenate is reduced to arsenite by arsenate reductase (ArsC), followed by ... Arsenate reductases in prokaryotes and eukaryotes. Environ Health Perspect. 2002;110(Suppl 5):745-8. https://doi.org/10.1289/ ... M20. As(III): arsenite; As(V): arsenate; MAs(III): methylarsenite; MAs(V): methylarsenate; AcAs(V): acetylarsenate; AST: ... In the environment, inorganic arsenic exists in various chemical forms, including arsenate [As(V)], arsenite [As(III)], ...
arsenate reductase activity + chlorate reductase activity chromate reductase activity crotonyl-CoA reductase activity ... coenzyme F420-dependent 2,4,6-trinitrophenol hydride reductase activity coenzyme F420-dependent 2,4,6-trinitrophenol reductase ...
Chen YS, Han YH, Rathinasabapathi B, Ma LQ (2015) Naming and function of ACR2, arsenate reductase, and ACR3 arsenite efflux ... Wang X, Ma L.Q., Rathinasabapathi B., Liu Y., Zeng G. (2010) Uptake and translocation of arsenite and arsenate by Pteris ... Mathew, S., Ma, L.Q., Rathinasabapathi, B. (2011) Uptake and translocation of arsenite and arsenate by Pteris vittata L: ... Lessl, J.T., Ma, L.Q., Rathinasabapathi, B, Guy C (2013) A novel phytase from Pteris vittata resistant to arsenate, high ...
arsenate reductase 3428_slr5105-sacB ATGATTATTACCGTTGCCAGTTTTA… plasmid partitioning protein 3429_ssr5106-sacB ...
Arginine 60 in the ArsC arsenate reductase of E. coli plasmid R773 determines the chemical nature of the bound As(III) product ...
arsenate reductase activity. IEP. Neighborhood. MF. GO:0030613. oxidoreductase activity, acting on phosphorus or arsenic in ...
arsenate reductase (RefSeq). 161, 249. BSU25850. yqzI. hypothetical protein; skin element (RefSeq). 31, 379. ... putative FAD-dependent oxido-reductase (RefSeq). 161, 174. BSU09640. yhdY. putative integral membrane protein; putative small ...
arsenate reductase (thioredoxin) activity GO:0030612 * methylarsonate reductase activity GO:0050610 * nitrate reductase ...
Corbin, K. D., Carnero, E. A., Dirks, B., Igudesman, D., Yi, F., Marcus, A., Davis, T. L., Pratley, R. E., Rittmann, B. E., Krajmalnik-Brown, R. & Smith, S. R., Dec 2023, In: Nature communications. 14, 1, 3161.. Research output: Contribution to journal › Article › peer-review ...
arsenate reductase and related YP_001280719 hitchhiker 0.00492435 unclonable 0.000000000467548 Psychrobacter sp. PRwf-1 ... N-ethylmaleimide reductase YP_001279246 unclonable 0.000000000113831 hitchhiker 0.00000000671042 Psychrobacter sp. PRwf-1 ... ubiquinol-cytochrome c reductase, iron-sulfur subunit YP_001279698 unclonable 0.0000000000156865 normal 1 Psychrobacter sp. ...
arsenate reductase (azurin) activity GO:0050611 * medium-chain fatty acid transport GO:0001579 ...
Arsenate reductase (EC 1.20.4.1). Export. Regulated Genes [ Tab delimited format ] DOWNLOAD ...
It contained three distinct arsenic resistance gene clusters (ars operons), while no respiratory arsenate reductase gene (arr) ... It contained three distinct arsenic resistance gene clusters (ars operons), while no respiratory arsenate reductase gene (arr) ... It contained three distinct arsenic resistance gene clusters (ars operons), while no respiratory arsenate reductase gene (arr) ... It contained three distinct arsenic resistance gene clusters (ars operons), while no respiratory arsenate reductase gene (arr) ...
F:electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide oxidoreductase activity;P:cell redox ...
Furthermore, five isolates contained the arsenate reductase gene (arsC). We conclude that P. vittata can efficiently ... Sixteen arsenate-tolerant bacterial strains were isolated from the P. vittata rhizosphere, a majority of which belong to the ...
tr,P74313,P74313_SYNY3 Arsenate reductase OS=Synechocystis sp. (strain PCC 6803 / Kazusa) GN=arsC PE=1 SV=1. ...
The respiratory arsenate reductase from Bacillus selenitireducens strain MLS10. FEMS Microbiol. Letts. 226:107-112 ... arsenate-reductase of B. selenitireducens is membrane-associated and is a heterodimer of the DMSO family of Mo-containing ... This organism was isolated from Mono Lake, California (Switzer Blum et al., 1998). It is a low G+C (49%), Gram + arsenate- ... organism that can respire toxic selenite in addition to arsenate, nitrate, nitrite, TMAO, fumarate, and has some capacity for ...
glutaredoxin, putative; FUNCTIONS IN: electron carrier activity, arsenate reductase (glutaredoxin) activity, protein disulfide ... ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; ... ubiquinol-cytochrome C reductase complex 14 kDa protein, putative; FUNCTIONS IN: ubiquinol-cytochrome-c reductase activity; ... FATTY ACID REDUCTASE 1 (FAR1); FUNCTIONS IN: oxidoreductase activity, acting on the CH-CH group of donors, fatty acyl-CoA ...
  • Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). (usgs.gov)
  • It contained three distinct arsenic resistance gene clusters (ars operons), while no respiratory arsenate reductase gene (arr) was identified. (elsevierpure.com)
  • 2004). The respiratory arsenate-reductase of B. selenitireducens is membrane-associated and is a heterodimer of the DMSO family of Mo-containing enzymes (Afkar et al, 2003). (doe.gov)
  • The respiratory arsenate reductase from Bacillus selenitireducens strain MLS10. (doe.gov)
  • Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. (usgs.gov)
  • WK6 reduces arsenate to arsenite at arsenic-polluted sites [ 10 ]. (biomedcentral.com)
  • Arsenate reductase may refer to: Arsenate reductase (azurin) Arsenate reductase (cytochrome c) Arsenate reductase (donor) Arsenate reductase (glutaredoxin) This set index page lists enzyme articles associated with the same name. (wikipedia.org)
  • Furthermore, five isolates contained the arsenate reductase gene (arsC). (bvsalud.org)
  • 2014). Genome-wide Association Mapping Identifies a New Arsenate Reductase Enzyme Critical for Limiting Arsenic Accumulation in Plants. (1001genomes.org)
  • The thermophilic bacterium Thermus thermophilus HB27 encodes chromosomal arsenate reductase (TtArsC), the enzyme responsible for resistance to the harmful effects of arsenic. (cnr.it)
  • Arsenate reductase (glutaredoxin). (edu.pl)
  • It is the only well-described organism that can respire toxic selenite in addition to arsenate, nitrate, nitrite, TMAO, fumarate, and has some capacity for microaerophilic growth. (doe.gov)
  • Chromium (VI) accumulation reduces chlorophyll biosynthesis, nitrate reductase activity and protein content in Nymphaea alba L. (google.co.ve)
  • Most of parameters involved in ROS and MG metabolisms had similar variation trends and degrees between the Mg-deficient lower leaves and roots, but several parameters (namely glutathione S-transferase, sulfite reductase, ascorbate and dehydroascorbate) displayed the opposite variation trends. (biomedcentral.com)
  • Thus Arr can function as a reductase or oxidase. (usgs.gov)
  • Sixteen arsenate-tolerant bacterial strains were isolated from the P. vittata rhizosphere, a majority of which belong to the Bacillus genus, and of this majority only two have been previously associated with As. (bvsalud.org)
  • Alkyl hydroperoxide reductase subunit C/ Thiol specific antioxidant [Interproscan]. (ntu.edu.sg)
  • This organism can reduce arsenate, selenate, and selenite, making it a potential bioremediation agent. (up.ac.za)
  • AS3MT knockout mice treated with arsenate retain a significantly greater body burden of As, and excrete less As in urine, than wild-type mice (Hughes et al. (medscape.com)
  • 14478 3-oxoacyl-[acyl-carrier protein] reductase fabG BBZA01000001 CDS ARMA_0014 complement(14430. (go.jp)
  • Arsenate is taken up by phosphate transporters. (qub.ac.uk)
  • The respiratory arsenate reductase has been purified, and is able to function at high pH and alkalinity. (up.ac.za)
  • Reduction of arsenate in the purine nucleoside arsenolysis reaction required both PNP and dihydrolipoic acid (DHLP). (nih.gov)
  • The PNP rate of reduction of arsenate with the reducing agents GSH or ascorbic acid was negligible compared to that with the naturally occurring dithiol DHLP and synthetic dithiols such as BAL (British anti-lewisite), DMPS (2,3-dimercapto-1-propanesulfonate), or DTT (alpha-dithiothreitol). (nih.gov)
  • Via a genome-wide association study, we identified a high level of mutational burden in methionine sulfoxide reductase genes relative to the most closely related Earth strains. (biomedcentral.com)
  • Among the mycorrhizal inoculum, the mixed inoculum IM/GM promoted substantially higher mycorrhizal colonization and arsenate reductase activity in P. vittata than C. dactylon, among all As levels. (edu.hk)
  • One type of arsenate reductase has been identified, but its in planta functions remain to be investigated. (qub.ac.uk)