Major structural proteins of triacylglycerol-rich LIPOPROTEINS. There are two forms, apolipoprotein B-100 and apolipoprotein B-48, both derived from a single gene. ApoB-100 expressed in the liver is found in low-density lipoproteins (LIPOPROTEINS, LDL; LIPOPROTEINS, VLDL). ApoB-48 expressed in the intestine is found in CHYLOMICRONS. They are important in the biosynthesis, transport, and metabolism of triacylglycerol-rich lipoproteins. Plasma Apo-B levels are high in atherosclerotic patients but non-detectable in ABETALIPOPROTEINEMIA.
Protein components on the surface of LIPOPROTEINS. They form a layer surrounding the hydrophobic lipid core. There are several classes of apolipoproteins with each playing a different role in lipid transport and LIPID METABOLISM. These proteins are synthesized mainly in the LIVER and the INTESTINES.
Structural proteins of the alpha-lipoproteins (HIGH DENSITY LIPOPROTEINS), including APOLIPOPROTEIN A-I and APOLIPOPROTEIN A-II. They can modulate the activity of LECITHIN CHOLESTEROL ACYLTRANSFERASE. These apolipoproteins are low in atherosclerotic patients. They are either absent or present in extremely low plasma concentration in TANGIER DISEASE.
A group of apolipoproteins that can readily exchange among the various classes of lipoproteins (HDL; VLDL; CHYLOMICRONS). After lipolysis of TRIGLYCERIDES on VLDL and chylomicrons, Apo-C proteins are normally transferred to HDL. The subtypes can modulate remnant binding to receptors, LECITHIN CHOLESTEROL ACYLTRANSFERASE, or LIPOPROTEIN LIPASE.
A 9-kDa protein component of VERY-LOW-DENSITY LIPOPROTEINS and CHYLOMICRON REMNANTS. Apo C-III, synthesized in the liver, is an inhibitor of LIPOPROTEIN LIPASE. Apo C-III modulates the binding of chylomicron remnants and VLDL to receptors (RECEPTORS, LDL) thus decreases the uptake of triglyceride-rich particles by the liver cells and subsequent degradation. The normal Apo C-III is glycosylated. There are several polymorphic forms with varying amounts of SIALIC ACID (Apo C-III-0, Apo C-III-1, and Apo C-III-2).
The most abundant protein component of HIGH DENSITY LIPOPROTEINS or HDL. This protein serves as an acceptor for CHOLESTEROL released from cells thus promoting efflux of cholesterol to HDL then to the LIVER for excretion from the body (reverse cholesterol transport). It also acts as a cofactor for LECITHIN CHOLESTEROL ACYLTRANSFERASE that forms CHOLESTEROL ESTERS on the HDL particles. Mutations of this gene APOA1 cause HDL deficiency, such as in FAMILIAL ALPHA LIPOPROTEIN DEFICIENCY DISEASE and in some patients with TANGIER DISEASE.
A class of protein components which can be found in several lipoproteins including HIGH-DENSITY LIPOPROTEINS; VERY-LOW-DENSITY LIPOPROTEINS; and CHYLOMICRONS. Synthesized in most organs, Apo E is important in the global transport of lipids and cholesterol throughout the body. Apo E is also a ligand for LDL receptors (RECEPTORS, LDL) that mediates the binding, internalization, and catabolism of lipoprotein particles in cells. There are several allelic isoforms (such as E2, E3, and E4). Deficiency or defects in Apo E are causes of HYPERLIPOPROTEINEMIA TYPE III.
Lipid-protein complexes involved in the transportation and metabolism of lipids in the body. They are spherical particles consisting of a hydrophobic core of TRIGLYCERIDES and CHOLESTEROL ESTERS surrounded by a layer of hydrophilic free CHOLESTEROL; PHOSPHOLIPIDS; and APOLIPOPROTEINS. Lipoproteins are classified by their varying buoyant density and sizes.
The second most abundant protein component of HIGH DENSITY LIPOPROTEINS or HDL. It has a high lipid affinity and is known to displace APOLIPOPROTEIN A-I from HDL particles and generates a stable HDL complex. ApoA-II can modulate the activation of LECITHIN CHOLESTEROL ACYLTRANSFERASE in the presence of APOLIPOPROTEIN A-I, thus affecting HDL metabolism.
The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.
A 9-kDa protein component of VERY-LOW-DENSITY LIPOPROTEINS. It contains a cofactor for LIPOPROTEIN LIPASE and activates several triacylglycerol lipases. The association of Apo C-II with plasma CHYLOMICRONS; VLDL, and HIGH-DENSITY LIPOPROTEINS is reversible and changes rapidly as a function of triglyceride metabolism. Clinically, Apo C-II deficiency is similar to lipoprotein lipase deficiency (HYPERLIPOPROTEINEMIA TYPE I) and is therefore called hyperlipoproteinemia type IB.
A class of lipoproteins of small size (4-13 nm) and dense (greater than 1.063 g/ml) particles. HDL lipoproteins, synthesized in the liver without a lipid core, accumulate cholesterol esters from peripheral tissues and transport them to the liver for re-utilization or elimination from the body (the reverse cholesterol transport). Their major protein component is APOLIPOPROTEIN A-I. HDL also shuttle APOLIPOPROTEINS C and APOLIPOPROTEINS E to and from triglyceride-rich lipoproteins during their catabolism. HDL plasma level has been inversely correlated with the risk of cardiovascular diseases.
A glycoprotein component of HIGH-DENSITY LIPOPROTEINS that transports small hydrophobic ligands including CHOLESTEROL and STEROLS. It occurs in the macromolecular complex with LECITHIN CHOLESTEROL ACYLTRANSFERASE. Apo D is expressed in and secreted from a variety of tissues such as liver, placenta, brain tissue and others.
A 6.6-kDa protein component of VERY-LOW-DENSITY LIPOPROTEINS; INTERMEDIATE-DENSITY LIPOPROTEINS; and HIGH-DENSITY LIPOPROTEINS. Apo C-I displaces APO E from lipoproteins, modulate their binding to receptors (RECEPTORS, LDL), and thereby decrease their clearance from plasma. Elevated Apo C-I levels are associated with HYPERLIPOPROTEINEMIA and ATHEROSCLEROSIS.
A class of lipoproteins of very light (0.93-1.006 g/ml) large size (30-80 nm) particles with a core composed mainly of TRIGLYCERIDES and a surface monolayer of PHOSPHOLIPIDS and CHOLESTEROL into which are imbedded the apolipoproteins B, E, and C. VLDL facilitates the transport of endogenously made triglycerides to extrahepatic tissues. As triglycerides and Apo C are removed, VLDL is converted to INTERMEDIATE-DENSITY LIPOPROTEINS, then to LOW-DENSITY LIPOPROTEINS from which cholesterol is delivered to the extrahepatic tissues.
A generic term for fats and lipoids, the alcohol-ether-soluble constituents of protoplasm, which are insoluble in water. They comprise the fats, fatty oils, essential oils, waxes, phospholipids, glycolipids, sulfolipids, aminolipids, chromolipids (lipochromes), and fatty acids. (Grant & Hackh's Chemical Dictionary, 5th ed)
A 513-kDa protein synthesized in the LIVER. It serves as the major structural protein of low-density lipoproteins (LIPOPROTEINS, LDL; LIPOPROTEINS, VLDL). It is the ligand for the LDL receptor (RECEPTORS, LDL) that promotes cellular binding and internalization of LDL particles.
A 241-kDa protein synthesized only in the INTESTINES. It serves as a structural protein of CHYLOMICRONS. Its exclusive association with chylomicron particles provides an indicator of intestinally derived lipoproteins in circulation. Apo B-48 is a shortened form of apo B-100 and lacks the LDL-receptor region.
Cholesterol which is contained in or bound to high-density lipoproteins (HDL), including CHOLESTEROL ESTERS and free cholesterol.
Intermediate-density subclass of the high-density lipoproteins, with particle sizes between 7 to 8 nm. As the larger lighter HDL2 lipoprotein, HDL3 lipoprotein is lipid-rich.
An autosomal recessively inherited disorder caused by mutation of ATP-BINDING CASSETTE TRANSPORTERS involved in cellular cholesterol removal (reverse-cholesterol transport). It is characterized by near absence of ALPHA-LIPOPROTEINS (high-density lipoproteins) in blood. The massive tissue deposition of cholesterol esters results in HEPATOMEGALY; SPLENOMEGALY; RETINITIS PIGMENTOSA; large orange tonsils; and often sensory POLYNEUROPATHY. The disorder was first found among inhabitants of Tangier Island in the Chesapeake Bay, MD.
An enzyme secreted from the liver into the plasma of many mammalian species. It catalyzes the esterification of the hydroxyl group of lipoprotein cholesterol by the transfer of a fatty acid from the C-2 position of lecithin. In familial lecithin:cholesterol acyltransferase deficiency disease, the absence of the enzyme results in an excess of unesterified cholesterol in plasma. EC 2.3.1.43.
A class of lipoproteins of small size (18-25 nm) and light (1.019-1.063 g/ml) particles with a core composed mainly of CHOLESTEROL ESTERS and smaller amounts of TRIGLYCERIDES. The surface monolayer consists mostly of PHOSPHOLIPIDS, a single copy of APOLIPOPROTEIN B-100, and free cholesterol molecules. The main LDL function is to transport cholesterol and cholesterol esters to extrahepatic tissues.
Chemical analysis based on the phenomenon whereby light, passing through a medium with dispersed particles of a different refractive index from that of the medium, is attenuated in intensity by scattering. In turbidimetry, the intensity of light transmitted through the medium, the unscattered light, is measured. In nephelometry, the intensity of the scattered light is measured, usually, but not necessarily, at right angles to the incident light beam.
A superfamily of large integral ATP-binding cassette membrane proteins whose expression pattern is consistent with a role in lipid (cholesterol) efflux. It is implicated in TANGIER DISEASE characterized by accumulation of cholesteryl ester in various tissues.
Fatty acid esters of cholesterol which constitute about two-thirds of the cholesterol in the plasma. The accumulation of cholesterol esters in the arterial intima is a characteristic feature of atherosclerosis.
Electrophoresis in which a pH gradient is established in a gel medium and proteins migrate until they reach the site (or focus) at which the pH is equal to their isoelectric point.
Cell surface proteins that bind lipoproteins with high affinity. Lipoprotein receptors in the liver and peripheral tissues mediate the regulation of plasma and cellular cholesterol metabolism and concentration. The receptors generally recognize the apolipoproteins of the lipoprotein complex, and binding is often a trigger for endocytosis.
Physiological processes in biosynthesis (anabolism) and degradation (catabolism) of LIPIDS.
A class of lipoproteins that carry dietary CHOLESTEROL and TRIGLYCERIDES from the SMALL INTESTINE to the tissues. Their density (0.93-1.006 g/ml) is the same as that of VERY-LOW-DENSITY LIPOPROTEINS.
Cholesterol which is contained in or bound to low density lipoproteins (LDL), including CHOLESTEROL ESTERS and free cholesterol.
Lipids containing one or more phosphate groups, particularly those derived from either glycerol (phosphoglycerides see GLYCEROPHOSPHOLIPIDS) or sphingosine (SPHINGOLIPIDS). They are polar lipids that are of great importance for the structure and function of cell membranes and are the most abundant of membrane lipids, although not stored in large amounts in the system.
Centrifugation with a centrifuge that develops centrifugal fields of more than 100,000 times gravity. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Conditions with abnormally low levels of LIPOPROTEINS in the blood. This may involve any of the lipoprotein subclasses, including ALPHA-LIPOPROTEINS (high-density lipoproteins); BETA-LIPOPROTEINS (low-density lipoproteins); and PREBETA-LIPOPROTEINS (very-low-density lipoproteins).
Low-density subclass of the high-density lipoproteins, with particle sizes between 8 to 13 nm.
A lipoprotein that resembles the LOW-DENSITY LIPOPROTEINS but with an extra protein moiety, APOPROTEIN (A) also known as APOLIPOPROTEIN (A), linked to APOLIPOPROTEIN B-100 on the LDL by one or two disulfide bonds. High plasma level of lipoprotein (a) is associated with increased risk of atherosclerotic cardiovascular disease.
The interstitial fluid that is in the LYMPHATIC SYSTEM.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The protein components of a number of complexes, such as enzymes (APOENZYMES), ferritin (APOFERRITINS), or lipoproteins (APOLIPOPROTEINS).
Conditions with excess LIPIDS in the blood.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
Technique involving the diffusion of antigen or antibody through a semisolid medium, usually agar or agarose gel, with the result being a precipitin reaction.
An enzyme of the hydrolase class that catalyzes the reaction of triacylglycerol and water to yield diacylglycerol and a fatty acid anion. The enzyme hydrolyzes triacylglycerols in chylomicrons, very-low-density lipoproteins, low-density lipoproteins, and diacylglycerols. It occurs on capillary endothelial surfaces, especially in mammary, muscle, and adipose tissue. Genetic deficiency of the enzyme causes familial hyperlipoproteinemia Type I. (Dorland, 27th ed) EC 3.1.1.34.
(Z)-9-Octadecenoic acid 1,2,3-propanetriyl ester.
A hypertriglyceridemia disorder, often with autosomal dominant inheritance. It is characterized by the persistent elevations of plasma TRIGLYCERIDES, endogenously synthesized and contained predominantly in VERY-LOW-DENSITY LIPOPROTEINS (pre-beta lipoproteins). In contrast, the plasma CHOLESTEROL and PHOSPHOLIPIDS usually remain within normal limits.
Derivatives of phosphatidic acids in which the phosphoric acid is bound in ester linkage to a choline moiety. Complete hydrolysis yields 1 mole of glycerol, phosphoric acid and choline and 2 moles of fatty acids.
The rate dynamics in chemical or physical systems.
A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.
Conditions with abnormally elevated levels of LIPOPROTEINS in the blood. They may be inherited, acquired, primary, or secondary. Hyperlipoproteinemias are classified according to the pattern of lipoproteins on electrophoresis or ultracentrifugation.
A 34-kDa glycosylated protein. A major and most common isoform of apolipoprotein E. Therefore, it is also known as apolipoprotein E (ApoE). In human, Apo E3 is a 299-amino acid protein with a cysteine at the 112 and an arginine at the 158 position. It is involved with the transport of TRIGLYCERIDES; PHOSPHOLIPIDS; CHOLESTEROL; and CHOLESTERYL ESTERS in and out of the cells.
The specialty of ANALYTIC CHEMISTRY applied to assays of physiologically important substances found in blood, urine, tissues, and other biological fluids for the purpose of aiding the physician in making a diagnosis or following therapy.
Cholesterol which is contained in or bound to very low density lipoproteins (VLDL). High circulating levels of VLDL cholesterol are found in HYPERLIPOPROTEINEMIA TYPE IIB. The cholesterol on the VLDL is eventually delivered by LOW-DENSITY LIPOPROTEINS to the tissues after the catabolism of VLDL to INTERMEDIATE-DENSITY LIPOPROTEINS, then to LDL.
A condition of elevated levels of TRIGLYCERIDES in the blood.
Proteins that bind to and transfer CHOLESTEROL ESTERS between LIPOPROTEINS such as LOW-DENSITY LIPOPROTEINS and HIGH-DENSITY LIPOPROTEINS.
A mixture of very-low-density lipoproteins (VLDL), particularly the triglyceride-poor VLDL, with slow diffuse electrophoretic mobilities in the beta and alpha2 regions which are similar to that of beta-lipoproteins (LDL) or alpha-lipoproteins (HDL). They can be intermediate (remnant) lipoproteins in the de-lipidation process, or remnants of mutant CHYLOMICRONS and VERY-LOW-DENSITY LIPOPROTEINS which cannot be metabolized completely as seen in FAMILIAL DYSBETALIPOPROTEINEMIA.
The range or frequency distribution of a measurement in a population (of organisms, organs or things) that has not been selected for the presence of disease or abnormality.
A family of scavenger receptors that are predominately localized to CAVEOLAE of the PLASMA MEMBRANE and bind HIGH DENSITY LIPOPROTEINS.
Method of tissue preparation in which the tissue specimen is frozen and then dehydrated at low temperature in a high vacuum. This method is also used for dehydrating pharmaceutical and food products.
A semisynthetic alkylated ESTRADIOL with a 17-alpha-ethinyl substitution. It has high estrogenic potency when administered orally, and is often used as the estrogenic component in ORAL CONTRACEPTIVES.
Relating to the size of solids.
A technique using antibodies for identifying or quantifying a substance. Usually the substance being studied serves as antigen both in antibody production and in measurement of antibody by the test substance.
An ACUTE PHASE REACTION protein present in low concentrations in normal sera, but found at higher concentrations in sera of older persons and in patients with AMYLOIDOSIS. It is the circulating precusor of amyloid A protein, which is found deposited in AA type AMYLOID FIBRILS.
Fats present in food, especially in animal products such as meat, meat products, butter, ghee. They are present in lower amounts in nuts, seeds, and avocados.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
A technique that combines protein electrophoresis and double immunodiffusion. In this procedure proteins are first separated by gel electrophoresis (usually agarose), then made visible by immunodiffusion of specific antibodies. A distinct elliptical precipitin arc results for each protein detectable by the antisera.
A severe type of hyperlipidemia, sometimes familial, that is characterized by the elevation of both plasma CHYLOMICRONS and TRIGLYCERIDES contained in VERY-LOW-DENSITY LIPOPROTEINS. Type V hyperlipoproteinemia is often associated with DIABETES MELLITUS and is not caused by reduced LIPOPROTEIN LIPASE activity as in HYPERLIPOPROTEINEMIA TYPE I .
An autosomal recessive disorder of lipid metabolism. It is caused by mutation of the microsomal triglyceride transfer protein that catalyzes the transport of lipids (TRIGLYCERIDES; CHOLESTEROL ESTERS; PHOSPHOLIPIDS) and is required in the secretion of BETA-LIPOPROTEINS (low density lipoproteins or LDL). Features include defective intestinal lipid absorption, very low serum cholesterol level, and near absent LDL.
A synthetic phospholipid used in liposomes and lipid bilayers for the study of biological membranes.
A large group of structurally diverse cell surface receptors that mediate endocytic uptake of modified LIPOPROTEINS. Scavenger receptors are expressed by MYELOID CELLS and some ENDOTHELIAL CELLS, and were originally characterized based on their ability to bind acetylated LOW-DENSITY LIPOPROTEINS. They can also bind a variety of other polyanionic ligand. Certain scavenger receptors can internalize micro-organisms as well as apoptotic cells.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
An unsaturated fatty acid that is the most widely distributed and abundant fatty acid in nature. It is used commercially in the preparation of oleates and lotions, and as a pharmaceutical solvent. (Stedman, 26th ed)
Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.
The sum of the weight of all the atoms in a molecule.
Thickening and loss of elasticity of the walls of ARTERIES of all sizes. There are many forms classified by the types of lesions and arteries involved, such as ATHEROSCLEROSIS with fatty lesions in the ARTERIAL INTIMA of medium and large muscular arteries.
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
The metabolic process of breaking down LIPIDS to release FREE FATTY ACIDS, the major oxidative fuel for the body. Lipolysis may involve dietary lipids in the DIGESTIVE TRACT, circulating lipids in the BLOOD, and stored lipids in the ADIPOSE TISSUE or the LIVER. A number of enzymes are involved in such lipid hydrolysis, such as LIPASE and LIPOPROTEIN LIPASE from various tissues.
An enzyme that catalyzes the formation of cholesterol esters by the direct transfer of the fatty acid group from a fatty acyl CoA derivative. This enzyme has been found in the adrenal gland, gonads, liver, intestinal mucosa, and aorta of many mammalian species. EC 2.3.1.26.
Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.
A subfamily in the family CEBIDAE that consists of four genera: CALLITHRIX (marmosets), CALLIMICO (Goeldi's monkey), LEONTOPITHECUS (lion tamarins), and SAGUINUS (long-tusked tamarins). The members of this family inhabit the tropical forests of South and Central America.
A highly dense subclass of the high-density lipoproteins, with particle sizes below 7 nm. They are also known as nascent HDL, composed of a few APOLIPOPROTEIN A-I molecules which are complexed with PHOSPHOLIPIDS. The lipid-poor pre-beta-HDL particles serve as progenitors of HDL3 and then HDL2 after absorption of free cholesterol from cell membranes, cholesterol esterification, and acquisition of apolipoproteins A-II, Cs, and E. Pre-beta-HDL initiate the reverse cholesterol transport process from cells to liver.
An enzyme of the hydrolase class that catalyzes the reaction of triacylglycerol and water to yield diacylglycerol and a fatty acid anion. It is produced by glands on the tongue and by the pancreas and initiates the digestion of dietary fats. (From Dorland, 27th ed) EC 3.1.1.3.
Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.
Receptors on the plasma membrane of nonhepatic cells that specifically bind LDL. The receptors are localized in specialized regions called coated pits. Hypercholesteremia is caused by an allelic genetic defect of three types: 1, receptors do not bind to LDL; 2, there is reduced binding of LDL; and 3, there is normal binding but no internalization of LDL. In consequence, entry of cholesterol esters into the cell is impaired and the intracellular feedback by cholesterol on 3-hydroxy-3-methylglutaryl CoA reductase is lacking.
A group of fatty acids that contain 18 carbon atoms and a double bond at the omega 9 carbon.

Serum triglyceride: a possible risk factor for ruptured abdominal aortic aneurysm. (1/2985)

BACKGROUND: We aimed to determine the relationship between ruptured abdominal aortic aneurysm (AAA) and serum concentrations of lipids and apolipoproteins. METHODS: A cohort of 21 520 men, aged 35-64 years, was recruited from men attending the British United Provident Association (BUPA) clinic in London for a routine medical examination in 1975-1982. Smoking habits, weight, height and blood pressure were recorded at entry. Lipids and apolipoproteins were measured in stored serum samples from the 30 men who subsequently died of ruptured AAA and 150 matched controls. RESULTS: Triglyceride was strongly related to risk of ruptured AAA. In univariate analyses the risk in men on the 90th centile of the distribution relative to the risk in men on the 10th (RO10-90) was 12 (95% confidence interval [CI] : 3.8-37) for triglyceride, 5.5 (95% CI: 1.8-17) for apolipoprotein B (apoB) (the protein component of low density lipoprotein [LDL]), 0.15 (95% CI : 0.04-0.56) for apo A1 (the protein component of high density lipoprotein [HDL]), 3.7 (95% CI: 1.4-9.4) for body mass index and 3.0 (95% CI: 1.1-8.5) for systolic blood pressure. Lipoprotein (a) (Lp(a)) was not a significant risk factor (RO10-90 = 1.6, 95% CI: 0.6-3.0). In multivariate analysis triglyceride retained its strong association. CONCLUSION: Triglyceride appears to be a strong risk factor for ruptured AAA, although further studies are required to clarify this. If this and other associations are cause and effect, then changing the distribution of risk factors in the population (by many people stopping smoking and adopting a lower saturated fat diet and by lowering blood pressure) could achieve an important reduction in mortality from ruptured AAA.  (+info)

Association of the inflammatory state in active juvenile rheumatoid arthritis with hypo-high-density lipoproteinemia and reduced lipoprotein-associated platelet-activating factor acetylhydrolase activity. (2/2985)

OBJECTIVE: To investigate the relationship between the quantitative and qualitative abnormalities of apolipoprotein B (Apo B)- and Apo A-I-containing lipoproteins and between lipoprotein-associated platelet-activating factor acetylhydrolase (PAF-AH) activity in patients with juvenile rheumatoid arthritis (JRA) as a function of the inflammatory state. METHODS: Twenty-six JRA patients and 22 age- and sex-matched control subjects with normal lipid levels participated in the study. Fourteen patients had active disease, and 12 had inactive disease. Plasma lipoproteins were fractionated by gradient ultracentrifugation into 9 subfractions, and their chemical composition and mass were determined. The PAF-AH activity associated with lipoprotein subfractions and the activity in plasma were also measured. RESULTS: Patients with active JRA had significantly lower plasma total cholesterol and high-density lipoprotein (HDL) cholesterol levels as compared with controls, due to the decrease in the mass of both the HDL2 and HDL3 subfractions. Patients with active JRA also had higher plasma triglyceride levels, mainly due to the higher triglyceride content of the very low-density lipoprotein plus the intermediate-density lipoprotein subfraction. The plasma PAF-AH activity in patients with active JRA was lower than that in controls, mainly due to the decrease in PAF-AH activity associated with the intermediate and dense low-density lipoprotein subclasses. The lipid abnormalities and the reduction in plasma PAF-AH activity were significantly correlated with plasma C-reactive protein levels and were not observed in patients with inactive JRA. CONCLUSION: This is the first study to show that patients with active JRA exhibit low levels of HDL2 and HDL3 and are deficient in plasma PAF-AH activity. These alterations suggest that active JRA is associated with partial loss of the antiinflammatory activity of plasma Apo B- and Apo A-I-containing lipoproteins.  (+info)

Liver-specific inactivation of the abetalipoproteinemia gene completely abrogates very low density lipoprotein/low density lipoprotein production in a viable conditional knockout mouse. (3/2985)

Conventional knockout of the microsomal triglyceride transfer protein large subunit (lMTP) gene is embryonic lethal in the homozygous state in mice. We have produced a conditional lMTP knockout mouse by inserting loxP sequences flanking exons 5 and 6 by gene targeting. Homozygous floxed mice were born live with normal plasma lipids. Intravenous injection of an adenovirus harboring Cre recombinase (AdCre1) produced deletion of exons 5 and 6 and disappearance of lMTP mRNA and immunoreactive protein in a liver-specific manner. There was also disappearance of plasma apolipoprotein (apo) B-100 and marked reduction in apoB-48 levels. Wild-type mice showed no response, and heterozygous mice, an intermediate response, to AdCre1. Wild-type mice doubled their plasma cholesterol level following a high cholesterol diet. This hypercholesterolemia was abolished in AdCre1-treated lMTP-/- mice, the result of a complete absence of very low/intermediate/low density lipoproteins and a slight reduction in high density lipoprotein. Heterozygous mice showed an intermediate lipoprotein phenotype. The rate of accumulation of plasma triglyceride following Triton WR1339 treatment in lMTP-/- mice was <10% that in wild-type animals, indicating a failure of triglyceride-rich lipoprotein production. Pulse-chase experiments using hepatocytes isolated from wild-type and lMTP-/- mice revealed a failure of apoB secretion in lMTP-/- animals. Therefore, the liver-specific inactivation of the lMTP gene completely abrogates apoB-100 and very low/intermediate/low density lipoprotein production. These conditional knockout mice are a useful in vivo model for studying the role of MTP in apoB biosynthesis and the biogenesis of apoB-containing lipoproteins.  (+info)

Insights into apolipoprotein B biology from transgenic and gene-targeted mice. (4/2985)

Over the past five years, several laboratories have used transgenic and gene-targeted mice to study apolipoprotein (apo) B biology. Genetically modified mice have proven useful for investigating the genetic and environmental factors affecting atherogenesis, for defining apoB structure/function relationships, for understanding the regulation of the apoB gene expression in the intestine, for defining the "physiologic rationale" for the existence of the two different forms of apoB (apoB48 and apoB100) in mammalian metabolism and for providing mechanistic insights into the human apoB deficiency syndrome, familial hypobetalipoproteinemia. This review will provide several examples of how genetically modified mice have contributed to our understanding of apoB biology, including our new discovery that human heart myocytes secrete nascent apoB-containing lipoproteins.  (+info)

Apolipoprotein B in the rough endoplasmic reticulum: translation, translocation and the initiation of lipoprotein assembly. (5/2985)

Apolipoprotein (apo) B and the microsomal triglyceride transfer protein are essential for the hepatic assembly and secretion of triglyceride-rich VLDL. To understand how apoB initiates the process of lipoprotein formation, interest has focused on the biogenesis of its amino terminal globular domain (alpha1 domain). When only this domain is expressed in hepatoma cells, no lipoprotein particle will form. However, proper folding of the alpha1 domain is essential for the internal lipophilic regions of apoB to engage in cotranslational lipid recruitment. The essential function of this domain may be related to its capacity to promote a specific physical interaction with the microsomal triglyceride transfer protein, necessary for apoB's proper folding and lipidation. Alternatively, this domain may promote an autonomous lipid recruitment step that nucleates microsomal triglyceride transfer protein-dependent lipid sequestration by apoB. Forms of apoB that fail to initiate particle assembly or forms associated with aberrant underlipidated particles are targeted for intracellular turnover. Two sites of apoB degradation have been identified. In hepatocarcinoma-derived cells, misassembled apoB may undergo progressive reverse translocation from the endoplasmic reticulum lumen to the cytosol, a process that is mechanistically coupled to polyubiquitination and proteasome-mediated degradation on the cytosolic side of the membrane. Alternatively, studies in primary hepatocytes reveal that apoB may undergo sorting to a post-endoplasmic reticulum compartment for presecretory degradation. In either case, the balance between assembly and presecretory degradation of apoB may represent a control point for the production of hepatic VLDL.  (+info)

Assembly of very low density lipoprotein: a two-step process of apolipoprotein B core lipidation. (6/2985)

The liver plays a primary role in lipid metabolism. Important functions include the synthesis and incorporation of hydrophobic lipids, triacylglycerols and cholesteryl esters into the core of water-miscible particles called lipoproteins and the secretion of these particles into the circulation for transport to distant tissues. In this article, we present a brief overview of one aspect of the assembly process of very low density lipoproteins, namely, possible mechanisms for combining core lipids with apolipoprotein B. This is a complex process in which apolipoprotein B interacts with core lipids to form very low density lipoproteins by a two-step process that can be dissociated biochemically.  (+info)

The LDL receptor gene family, apolipoprotein B and cholesterol in embryonic development. (7/2985)

In recent years, a number of genes that are involved in cholesterol synthesis, its systemic or intercellular transport or lipid metabolism in general have been found to play important roles during embryonic development. In this article, we present a brief overview of these genes, their molecular functions as we understand them to date and our current interpretation of possible mechanisms by which genetic deficiency states might affect the development of the embryo, in particular the formation of the central nervous system.  (+info)

Dietary fish oils inhibit early events in the assembly of very low density lipoproteins and target apoB for degradation within the rough endoplasmic reticulum of hamster hepatocytes. (8/2985)

Dietary fish oils inhibited secretion and stimulated intracellular degradation of apolipoprotein (apo)B in hamster hepatocytes, while dietary sunflower oils stimulated secretion and had no effect on degradation of apoB. To investigate the intracellular site at which fish oils act, we have made use of our previous observations that inhibition of degradation by N-acetyl-leucyl-leucyl-norleucinal (ALLN) results in accumulation of apoB in the trans -Golgi membrane and does not stimulate secretion, while inhibition of degradation by o-phenanthroline results in accumulation of apoB in the rough endoplasmic reticulum membrane and stimulates secretion. Thus, ALLN protects apoB which has been diverted from secretion and o -phenanthroline protects apoB which is targetted for secretion. Addition of o -phenantholine to the incubation medium of hepatocytes from fish oil-fed hamsters inhibited degradation of apoB and stimulated its secretion in particles of the density of VLDL, while addition of ALLN had no effect. These observations suggest that dietary fish oils reversibly inhibit early steps in the assembly of very low density lipoprotein precursors and target apoB for degradation in the rough endoplasmic reticulum.  (+info)

TY - JOUR. T1 - The effect of a six-month exercise program on very low density lipoprotein apolipoprotein B secretion in type 2 diabetes. AU - Alam, S.. AU - Stolinski, M.. AU - Pentecost, C.. AU - Boroujerdi, Massoud. AU - Jones, R. H.. AU - Sonksen, P. H.. AU - Umpleby, A. M.. PY - 2004. Y1 - 2004. N2 - The dyslipidemia and insulin resistance of type 2 diabetes can be improved by aerobic exercise. The effect of 6 months supervised exercise on very low-density lipoprotein (VLDL) apolipoprotein B metabolism was investigated in patients with type 2 diabetes. Moderately obese patients (n = 18) were randomized into supervised (n = 9) and unsupervised (n = 9) exercise groups. All patients were given a training session and a personal exercise program and asked to exercise four times per week at 70% maximal oxygen uptake for 6 months. Patients in the supervised group had a weekly session with an exercise trainer. VLDL apolipoprotein (apo) B metabolism was measured with an infusion of 1-C-13 leucine ...
Microsomal triglyceride transfer protein (MTP) is required for the assembly and cellular secretion of apolipoprotein B (apoB) -containing lipoproteins from the liver and intestine. The secretion pattern of apoB-containing lipoproteins is likely to influence the VLDL and LDL levels in plasma. By initial opportunistic screening for polymorphic sites in the regulatory region of the MTP gene by gene sequencing in 20 healthy male subjects, a common functional G/T polymorphism was detected 493 bp upstream from the transcriptional start point. There was differential binding of unique nuclear proteins at this site, as shown by electrophoretic mobility shift assay. The G variant seemed to bind two or three nuclear proteins that do not bind to the T variant. Expression studies with minimal promoter constructs linked to the chloramphenicol acetyltransferase reporter and transfected into HepG2 cells revealed marked enhancement of transcriptional activity with the T variant. The prevalence of the MTP promoter
TY - JOUR. T1 - An intrinsic gut leptin-melanocortin pathway modulates intestinal microsomal triglyceride transfer protein and lipid absorption. AU - Iqbal, Jahangir. AU - Li, Xiaosong. AU - Chang, Benny Hung Junn. AU - Chan, Lawrence. AU - Schwartz, Gary J.. AU - Chua, Streamson C.. AU - Hussain, M. Mahmood. PY - 2010/7/1. Y1 - 2010/7/1. N2 - Fat is delivered to tissues by apoB-containing lipoproteins synthesized in the liver and intestine with the help of an intracellular chaperone, microsomal triglyceride transfer protein (MTP). Leptin, a hormone secreted by adipose tissue, acts in the brain and on peripheral tissues to regulate fat storage and metabolism. Our aim was to identify the role of leptin signaling in MTP regulation and lipid absorption using several mouse models deficient in leptin receptor (LEPR) signaling and downstream effectors. Mice with spontaneous LEPR B mutations or targeted ablation of LEPR B in proopiomelanocortin (POMC) or agouti gene related peptide (AGRP) expressing ...
PubMed journal article: Influence of atorvastatin and simvastatin on apolipoprotein B metabolism in moderate combined hyperlipidemic subjects with low VLDL and LDL fractional clearance rates. Download Prime PubMed App to iPhone, iPad, or Android
The apolipoprotein (apo) B-100-specific monoclonal antibody MB47 has been widely used in lipoprotein metabolism and atherosclerosis research. When bound to apoB-100 on low density lipoproteins (LDL), antibody MB47 completely blocks the binding of LDL to the LDL receptor. The epitope for antibody MB47 has previously been mapped to the vicinity of apoB-100 amino acid (aa) residue 3500. To map the epitope for antibody MB47 more precisely, we used recombinant bacterial fusion proteins. Antibody MB47 bound strongly to a fusion protein containing apoB-100 aa 3214-3728, but no specific binding was observed to fusion proteins containing aa 3214-3351, 3214-3506, 3351-3506, or a fusion protein containing aa 3214-3351 and 3506-3728. Although antibody MB47 did not bind to aa 3214-3506, it did bind to aa 3214-3510. Further fusion protein studies revealed that antibody MB47 bound to aa 3429-3510, but bound only very weakly to aa 3453-3510, indicating that aa 3429-3453 constitute an important part of the MB47 ...
An elevated plasma level of apolipoprotein B (apoB), the major protein of low density lipoproteins, is a risk factor for coronary artery disease. This study tested the hypothesis, suggested by previous studies, that the apoB level is strongly influenced by a major gene. The study population included 832 family members of 116 subjects who had undergone elective coronary arteriography at an early age. The apoB level was adjusted for age, gender, body mass index, alcohol consumption, and cigarette smoking (R2 = 20 %). ApoB levels revealed strong familial aggregation with correlations among spouses of 0.23, parent-offspring of 0.16, and siblings of 0.21. Regressive models were used to examine inter-individual variation in adjusted apoB levels. In the total sample, familial aggregation of the apoB level was consistent with two models: (1) a major gene model and (2) a polygenic model with a mixture of non-transmitted types. Comparison of these two models in each family showed that 57 families ...
Gentaur molecular products has all kinds of products like :search , AbD \ MOUSE ANTI HUMAN APOLIPOPROTEIN B, Product Type Monoclonal Antibody, Specificity APOLIPOPROTEIN B, Target Species Human, Host Mouse, Format Purified, Isotypes IgG1, Applications E, R, Clone F< \ 0650-0954 for more molecular products just contact us
The sine qua non of atherosclerosis is the presence of sterols in arterial wall macrophages. Sterols are delivered to the arterial wall by the penetration of the endothelium by an apoB-containing lipoprotein, which transport the sterols. In other words, unless an apoB-containing lipoprotein particle violates the border created by an endothelium cell and the layer it protects, the media layer, there is no way atherogenesis occurs. For now, lets focus only on the most ubiquitous apoB-containing lipoprotein, the LDL particle. Yes, other lipoproteins also contain apoB (e.g., chylomicrons, remnant lipoproteins such as VLDL remnants, IDL and Lp(a)), but they are few in number relative to LDL particles. I will address them later.. The endothelium is the one-cell-thick-layer which lines the lumen (i.e., the tube) of a vessel, in this case, the artery. Since blood is in direct contact with this cell all the time, all lipoproteins - including LDL particles - come in constant contact with such ...
TG and apoB secretion was elevated in hPten-ko mice. When hepatic TG was reduced by inhibition of diacylglycerol acyltransferase 1/diacylglycerol acyltransferase 2 or sterol regulatory element-binding protein-1c, both TG secretion and apoB secretion fell without changes in hepatic insulin signaling. Acute reconstitution of hPten reduced hepatic TG content, and both TG and apoB secretion fell within 4 days despite decreased hepatic insulin signaling. Acute depletion of hepatic Pten by adenoviral introduction of Cre into Pten floxed mice caused steatosis within 4 days, and secretion of both TG and apoB increased despite increased hepatic insulin signaling. Even when steatosis after acute Pten depletion was prevented by pretreatment with SREBP-1c antisense oligonucleotides, apoB secretion was not reduced after 4 days. Ex vivo results were in primary hepatocytes were similar.. ...
The relationship between antiretroviral treatment of HIV infection, body fat distribution, insulin resistance (HOMA), adipocytokine and apolipoprotein-B (apoB) kinetics was investigated in 12 HIV negative controls and 55 HIV-infected patients including antiretroviral treatment-naïve patients (n=15) and patients taking two nucleoside analogues plus either a protease inhibitor (PI, n=15) or non-nucleoside reverse transcriptase inhibitor (NNRTI, n = 25). The HIV positive treatment groups had mild dyslipidaemia. The apo-B fractional clearance rate (FCR) was reduced in the HIV positive groups. Peripheral fat was lower in treated patients and correlated with duration of therapy. There was a positive correlation between peripheral fat and apo-B clearance rate and a negative correlation with apo-B pool size. Adiponectin was reduced in all HIV positive groups and correlated positively with HDL-cholesterol, apo-B FCR and limb fat and correlated negatively with plasma triglycerides and HOMA. In a linear ...
In this report, the authors used nuclear magnetic resonance (NMR) spectroscopy to measure different apoB-containing lipoprotein particle concentrations in 11,984 subjects from the JUPITER study population. The variables of interest were LDL (large, small), intermediate-density lipoproteins (IDL), and very low-density lipoproteins (VLDL, large, medium and small) particle subclasses, VLDL-cholesterol and VLDL/chylomicron triglycerides. In the statin-treated group, in which median LDL-C was 55 mg/dl (1.4 mmol/L), there was no association between LDL or IDL particle concentration and risk for major adverse cardiovascular events (MACE). There was, however, an association for VLDL particle concentration, specifically driven by small VLDL particles. Indeed, each increase by one standard deviation in small VLDL particle concentration was associated with 68% increase in the residual risk of MACE. This finding is consistent with mechanistic studies of lipoprotein/arterial wall interactions, which show ...
In patients with HoFH, lomitapide led to a significant reduction of LDL-c levels and to achievement of EAS targets in many patients, while CV event rates correlated with LDL-c levels.
1. Vrablík M, Češka R. Novinky v oblasti hypolipidemické léčby. Vnitř Lék 2014; 60: 924- 932. 2. Cuchel M, Bloedon LT, Szapary PO et al. Inhibition of microsomal triglyceride transfer protein in familial hypercholesterolemia. N Engl J Med 2007; 356: 148- 156. 3. Kastelein JJ, Wedel MK, Baker BF et al. Potent reduction of apolipoprotein B and low‑ density lipoprotein cholesterol by short‑term administration of an antisense inhibitor of apolipoprotein B. Circulation 2006; 114: 1729- 1735. 4. Sacks FM, Stanesa M, Hegele RA. Severe hypertriglyceridemia with pancreatitis: thirteen years treat-ment with lomitapide. JAMA Intern Med 2014; 174: 443- 447. doi: 10.1001/ jamainternmed.2013.13309. 5. Seidah NG. PCSK9 as a therapeutic target of dyslipidemia. Expert Opin Ther Targets 2009; 13: 19- 28. doi: 10.1517/ 14728220802600715. 6. Catapano AL, Papadopoulos N. The safety of therapeutic monoclonal antibodies: implications for cardiovascular disease and targeting the PCSK9 pathway. ...
The findings presented at EAS highlight mipomersens potential to treat the unique needs of patients with severe forms of FH, said Vice President and General Manager of Genzymes Cardiovascular Business, Paula Soteropoulos. Other than apheresis, there is no approved treatment that addresses the specific challenges faced by severe FH patients, which include elevated Lp(a) in addition to LDL-C. We believe mipomersen could play an important role as a targeted treatment for these patients. In a presentation entitled Mipomersen, an ApoB Synthesis Inhibitor, Might Reduce Necessity for Lipid Apheresis in CAD, K.G. Parhofer, M.D., of Ludwig-Maximilians University, Munich, Germany, focused on mipomersens potential to reduce the necessity for lipid-apheresis by lowering LDL-C values below thresholds for apheresis eligibility. Patients with severe forms of FH may be eligible for this treatment, a dialysis-like procedure where blood is filtered through a machine to remove excess cholesterol. ...
As we discovered pB1 by using an anti-ApoB100 antibody, it was natural to ask whether the BVFs (B4T in most experiments) exerted their anti-obesity effect through antibodies that modulate the functions of ApoB100. Indeed, when we injected the BVFs in a typical immunization schedule, they induced antibodies that specifically recognized ApoB100 in Western blots and reacted with native ApoB100 in ELISAs; importantly, the antibody titres correlated with the weight decrements in HFD-fed/immunized mice. As discussed in the following paragraphs, our in vitro data suggest that, at least in part, the antibodies cause their effects on lipid metabolism by blocking the interaction between ApoB100 and LDLRs, and by acting as opsonins for the ApoB100-containing lipoproteins.. The antibodies induced by B4T or B4-OVA, as well as a C-terminally acting commercial anti-ApoB antibody, but not an N-terminally acting antibody, blunted the uptake of LDL-associated lipids by cultured 3T3L1 adipocytes. Furthermore, in ...
Folding of the amino-terminal domain of apolipoprotein B initiates microsomal triglyceride transfer protein-dependent lipid transfer to nascent very low density
Definition : Immunoassay reagents intended to perform qualitative and/or quantitative analyses on a body fluid sample (typically serum) to determine apolipoprotein B, the major protein in low-density lipids (LDLs) and present in large amounts (approximately 4%) in both very-low-density lipids (VLDLs) and chylomicrons. Apolipoprotein B is found in at least two forms: B-100 (Apo B-100) synthesized in the liver, and B-48 (Apo B-48), probably synthesized in the intestines. Levels of apolipoproteins in plasma are associated with the risk of atherosclerosis and coronary artery diseases.. Entry Terms : Apolipoprotein B Determination Reagents , Reagents, Immunoassay, Lipoprotein, Apolipoprotein B. UMDC code : 19817 ...
LDL and its major protein, apolipoprotein B, play an essential role in lipid transport and metabolism. Apo B may regulate cholesterol synthesis through its interaction with specific cell membrane receptors and by inhibition of HMG Co A reductase. This enzyme has been identified as the rate controlling enzyme in cholest
Nachschlagewerk für Laborärzte, Medizinisch-technische Assistenten, Einkäufer in Krankenhäusern, Medizinstudenten und angehende MTAs. Die Website bietet einen unabhängigen Marktüberblick über Produkte vom Blutzuckermessgerät bis zum Großanalyser, vom Autoklaven bis zur Zentrifuge. Seite: Apolipoprotein B
3B Metabolism Microscopic Slides Available From Lab World Online Store. Now With Free UK Delivery On All Orders Over 50. Ideal For Students & Biology Lessons.
Spise Plan for type B Metabolism Noen mennesker tror en individuell diett plan tilpasset deres unike metabolske behov fungerer bedre enn en tradisjonell diett plan. Blodet-type diett er oppfinner sier det kan fremme vekttap og redusere risikoen for kroniske sykdommer ved å instruere
The lack of a decrease in circulating lipids indicates that stored lipids are to be mobilized from peripheral storage sites at a rate similar to their use, whether for tissue β-oxidation or ovarian lipid uptake and storage. While the mechanisms behind this mobilization are beyond the scope of this study, the mobilized lipids must be packaged to be efficiently transported and taken up by tissues, such as the ovary. This packaging undoubtedly occurs in the liver as reflected by several changes, both morphological and molecular [e.g., larger hepatocytes (personal observation), increased HSI and increased relative transcript copy numbers of hepatic packagers (apob and mttp) in early vitellogenic females]. However, evidence of changes in hepatic lipid packaging during fasting is controversial in mammals. Windmueller and Wu (83) found an increase in relative transcript copy numbers of hepatic apob during fasting in rats, yet Lopez-Miranda et al. (45) found no differences in human apob transcript ...
mutant L343V and R463W altered folding of the alpha-helical domain within the N terminus of apoB (proper folding of the -helical domain within the N terminus of apoB is important for efficient secretion of apoB-containing lipoproteins ...
APOLB : Collection Container/Tube: Preferred: Serum gel Acceptable: Red top Submission Container/Tube: Plastic vial Specimen Volume: 1 mL Collection Instructions: Centrifuge and aliquot 1 mL of serum.
pep:known chromosome:VEGA66:12:7977648:8016835:1 gene:OTTMUSG00000035465 transcript:OTTMUST00000090769 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Apob description:apolipoprotein B ...
The courses are ideal for the more unusual aspects of Southern Africa. Learn about the folklore, and geology of the region. Discuss the processes of evolution and find out what could be in store for the planet. Become an expert birder and learn about Southern African birdlife, or discover the perfect formula to running a successful game lodge. Fancy yourself as a bit of a shutterbug? Take the photography courses and learn all about the art of photography, especially how to take that perfect wildlife photograph.. ...
Abetalipoproteinemia (ABL) is an extremely rare autosomal recessive disorder, which is characterized by defective assembly and secretion of plasma apolipoprotein (apo) B-containing lipoproteins. ABL results from mutations in the gene encoding the microsomal triglyceride transfer protein (MTP). We se …
Microsomal triglyceride transfer protein large subunit is a protein that in humans is encoded by the MTTP gene. MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triaglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. Apolipoprotein B48 on chylomicra and Apolipoprotein B100 on LDL, IDL, and VLDL are important for MTP binding. Click on genes, proteins and metabolites below to link to respective articles. [[File: [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] ,px,alt=Statin Pathway edit]] The interactive pathway map can be edited at ...
Microsomal triglyceride transfer protein large subunit is a protein that in humans is encoded by the MTTP gene.[1][2] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triaglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia.[2] Apolipoprotein B48 on chylomicra and Apolipoprotein B100 on LDL, IDL, and VLDL are important for MTP binding. ...
We have previously reported a positive correlation between the expression of BHMT (betaine-homocysteine S-methyltransferase) and ApoB (apolipoprotein B) in rat hepatoma McA (McArdle RH-7777) cells [Sowden, Collins, Smith, Garrow, Sparks and Sparks (1999) Biochem. J. 341, 639-645]. To examine whether a similar relationship occurs in vivo, hepatic BHMT expression was induced by feeding rats a Met (L-methionine)-restricted betaine-containing diet, and parameters of ApoB metabolism were evaluated. There were no generalized metabolic abnormalities associated with Met restriction for 7 days, as evidenced by control levels of serum glucose, ketones, alanine aminotransferase and L-homocysteine levels. Betaine plus the Met restriction resulted in lower serum insulin and non-esterified fatty acid levels. Betaine plus Met restriction induced hepatic BHMT 4-fold and ApoB mRNA 3-fold compared with Met restriction alone. No changes in percentage of edited ApoB mRNA were observed on the test diets. An increase ...
Low-density lipoprotein is recognized as a primary vascular risk factor. However, recent data favor apolipoprotein (apo)B and apoA-I as risk factors with higher predictive values than conventional lipids. We investigated how leisure-time physical activity relates to the serum apoB/apoA-I ratio in...
Background: We previously demonstrated the presence and localization of hepatic apoB100 and intestinal apoB48 in human carotid atherosclerotic plaques by immunoperoxidase, immunofluorescence (IF), immunoelectron microscopy, and western blot; however, co-localization of apoB48 and apoB100 with macrophages has not been shown.. Methods: In 3 patients undergoing carotid endarterectomy (CEA), plaques were stained for apoB100/CD68 and apoB48/CD68 dual stain (DS)-IF. CD68 was used to localize macrophages. Slides were processed for antigen retrieval and incubated with primary antibodies(ApoB100: ab50069-100 rabbit polyclonal antibody recognizing the C-terminal; apoB48:Shibayagi AKHB48E goat monoclonal antibody recognizing the C-terminal; CD68: Santa Cruz Biotechnologies SC-20060 mouse monoclonal antibody) and species-specific secondary antibodies (Invitrogen;A21447,A21235,A21244, or A11010).Confocal microscopy was used to visualize DS-IF.. Results: There is intense CD68 staining throughout the plaques, ...
Apolipoprotein B-100 (apoB) is the central protein component of very low density lipoproteins (VLDL) and is subject to endoplasmic reticulum-associated degradation (ERAD). Hepatic assembly of VLDL particles is monitored by the cellular quality control machinery, which determines whether a properly formed lipoprotein is secreted or the inadequately lipidated apoB protein is degraded. Changes in lipid supply, ER folding capacity or ERAD pathway function can alter VLDL output from HepG2 cells. Bag6 is a cytosolic protein that has a role in the bilayer integration of proteins and is also implicated in maintaining the solubility of proteasome substrates that contain exposed hydrophobic regions. Notably, Bag6 has been observed to interact with the ERAD components gp78 and p97, which are known to facilitate apoB degradation. The goal of this study was to evaluate the role of cytosolic Bag6 in apoB metabolism in HepG2 cells. When MG132 was used to inhibit proteasomal degradation of apoB, Bag6 was ...
Buy anti-APOB antibody, Mouse anti-Human Apolipoprotein B (APOB) Monoclonal Antibody (Clone C2)-NP_000375.2 (MBS2090601) product datasheet at MyBioSource, Primary Antibodies. Application: Western Blot (WB), Immunohistochemistry (IHC), Immunocytochemistry (ICC), Immunoprecipitation (IP)
Background. Dirlotapide causes body weight reduction in obese dogs primarily due to reductions in food intake.. Aims. To investigate the efficacy and safety of dirlotapide in overweight Labradors in two masked, parallel-design studies. Methods. Study A: 42 dogs randomised to 0.0, 0.025, 0.05, 0.1, 0.2 or 0.4 mg dirlotapide/kg/day orally for 4 weeks. Study B: 72 dogs randomised to nine treatments: placebo (24 weeks); dirlotapide (24 weeks) followed by placebo (28 weeks); or dirlotapide (52 weeks); on diets containing 5%, 10% or 15% fat, offered in excess of maintenance requirements. Dogs were weighed and dirlotapide dose (initially 0.1 mg/kg) was adjusted monthly. After 24 weeks, dosages were reduced to stabilise body weight. Body composition (body fat, lean tissue and bone mineral content) was monitored using dual-energy x-ray absorptiometry. Multiple blood samples were collected for haematology and biochemistry.. Results. Study A: body weight and food intake decreased asymptotically with dose, ...
Apolipoproteins are carrier proteins that bind lipids to form water-soluble lipoprotein particles that can be carried through blood and lymph. Several different classes and subclasses of apolipoproteins are known. Apolipoprotein B (ApoB) is the primary apolipoprotein in chylomicrons (lipoprotein particles that contain triglycerides, phospholipids, cholesterol, and proteins) and low-density lipoprotein (LDL). It is also known as FLDB and LDLCQ4. High levels of ApoB can lead to plaques that cause atherosclerosis, and ApoB levels can be a better indicator of heart disease risk than total cholesterol or LDL. The APOB transcript is subject to tissue-specific RNA editing, resulting in two major isoforms, ApoB-100 and ApoB-48.. ...
Apolipoproteins are carrier proteins that bind lipids to form water-soluble lipoprotein particles that can be carried through blood and lymph. Several different classes and subclasses of apolipoproteins are known. Apolipoprotein B (ApoB) is the primary apolipoprotein in chylomicrons (lipoprotein particles that contain triglycerides, phospholipids, cholesterol, and proteins) and low-density lipoprotein (LDL). It is also known as FLDB and LDLCQ4. High levels of ApoB can lead to plaques that cause atherosclerosis, and ApoB levels can be a better indicator of heart disease risk than total cholesterol or LDL. The APOB transcript is subject to tissue-specific RNA editing, resulting in two major isoforms, ApoB-100 and ApoB-48.. ...
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100: the former is synthesized exclusively in the gut and the latter in the liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2180 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. Mutations in this gene or its regulatory region cause hypobetalipoproteinemia, normotriglyceridemic hypobetalipoproteinemia, and hypercholesterolemia due to ligand-defective apoB, diseases affecting plasma cholesterol and apoB levels. [provided by RefSeq, Jul 2008 ...
The study performed by Tamer et al [12] estimated the frequency of APoB point mutations in 179 atherosclerotic, 145 hyperlipidaemic Individuals and 272 healthy individuals in the east Mediterranean region of Turkey. Lipid and lipoprotein level were measured with routine biochemical analysis and APoB mutation was detected using realtime PCR. In this region, APoB mutation was observed as rare causes of hyperlipidaemia and atherosclerosis may therefore be unrelated to them. Dekha et al [13] reported the allele frequency distribution at the hypervariable locus 3′ to the apolipoprotein B gene (ApoB 3′ VNTR) in five well-defined human populations by using the PCR technique. A total of 12 segregating alleles were detected in the pooled sample of 319 individuals. A fairly consistent pattern of allele frequency distribution was found apparent in most of these geographically and genetically diverse populations, suggesting that the ApoB 3′ VNTR polymorphism predates the geographic dispersal of ...
Apolipoprotein B is a major protein constituent of chylomicrons (apo B-48), LDL (apo B-100) and VLDL (apo B-100). Apo B-100 functions as a recognition signal for the cellular binding and internalization of LDL particles by the apoB/E receptor.
Antibodies. Rabbit anti-sortilin (ab16640), rabbit anti-APOB (ab20737), and mouse anti-actin (ab8226) were purchased from Abcam. Mouse anti-sortilin (612101) was purchased from BD Biosciences.. Creation of adenoassociated viruses for gene overexpression studies in mouse liver. The murine Sort1 cDNA (MR210834; Origene) was subcloned into a specialized AAV8 vector provided by the University of Pennsylvania Vector Core. Site-directed mutagenesis was performed using the Stratagene kit to generate both trafficking mutants. To make the truncated mutant, the following primers were used: GCAACTTCTTGAACCCCACAAAGTAGAATTCCAAGTCAAATTCTG (forward); CAGAATTTGACTTGGAATTCTACTTTGTGGGGTTCAAGAAGTTGC (reverse). This created a C2251T transition mutation, which created a Q751X nonsense mutation. To make the double-sortilin trafficking mutant, 2 sequential PCR reactions were performed. The first reaction converted the dileucine sorting motif to a dialanine (L826A/L827A) by introducing the following base pair changes: ...
Human genetic research can pinpoint drug targets by identifying complete loss-of-function mutations affecting a human gene product that, in turn, underlie a favorable phenotype.1 Most small-molecule oral drugs, monoclonal antibodies, or RNA-based strategies act by inhibiting a selected molecular target, thereby pharmacologically mimicking the naturally advantageous genetic deficiency. The fields of atherosclerosis and lipoprotein biology have several examples of drugs whose raison dêtre is to impersonate a naturally occurring, genetically determined beneficial phenotype.. Article see p 677. For instance, 3 new classes of agents approved in the United States reduce low-density lipoprotein (LDL)-cholesterol levels through nonstatin mechanisms.2,3 These include (1) an oral inhibitor of microsomal triglyceride transfer protein (MTP), namely lomitapide (Juxtapid; Aegerion); (2) an injectable antisense oligonucleotide against apolipoprotein (apo) B, namely mipomersen (Kynamro; ISIS-Genzyme); and (3) ...
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
Naganawa S, Kodama T, Aburatani H, Matsumoto A, Itakura H, Takashima Y, Kawamura M, Muto Y. Genetic analysis of a Japanese family with normotriglyceridemic abetalipoproteinemia indicates a lack of linkage to the apolipoprotein B gene. Biochem Biophys Res Commun. 1992 Jan 15;182(1):99-104. ...
Italian researchers have found that a genetic variation that can save individuals in their 40s and 50s also may reduce their chances of living into old age. These findings appear to come from the genes influence on levels of low-density lipoprotein (LDL; bad) cholesterol.Writing in BMC Medical Genetics (February 2004), the researchers reported that individuals with a particular form of the gene had dramatically lower levels of LDL. Earlier research showed that the gene form linked to low LDL cholesterol usually occurs among adults; however, it is rarely present in healthy elderly adults. This example suggests that the low-cholesterol gene can protect the heart in middle age, but that it also may interfere with reaching old age. ...
All reagents should be stored refrigerated (2-8°C). Return all reagents to 2-8°C promptly after use. Unopened reagents can be used for one year from the date of manufacture, as indicated by the expiration date on the package and bottle labels. Opened reagents can be used for one month if stored at 2-8°C ...
Patton, J G.; Alley, M C.; and Mao, S J., Evaluation of monoclonal antibodies to human plasma low density lipoproteins. A requirement for lipids to maintain antigenic structure. (1982). Subject Strain Bibliography 1982. 75 ...
Man 55 years or older OR woman 65 years or older; Man younger than 55 years OR woman younger than 65 years; Apolipoprotein B:A1 ratio: Q1 (less than 0.633); Apolipoprotein B:A1 ratio: Q2 (0.633-0.792); Apolipoprotein B:A1 ratio: Q3 (0.792-0.983); Apolipoprotein B:A1 ratio: Q4 (>=0.984); Never smoked; Former smoker (last smoked more than 12 months ago); Current or former smoker
New variation on the translocation of proteins during early biogenesis of apolipoprotein B. A translocation signal for delivery of oomycete effector proteins into host plant cells
Catalytic component of the apolipoprotein B mRNA editing enzyme complex which is responsible for the postranscriptional editing of a CAA codon for Gln to a UAA codon for stop in the APOB mRNA. May also play a role in the epigenetic regulation of gene expression by participating in DNA demethylation.
CONTENT: To assess the comparability of apo B and LDL-P, we reviewed 25 clinical studies containing 85 outcomes for which both biomarkers were determined. In 21 of 25 (84.0%) studies, both apo B and LDL-P were significant for at least 1 outcome. Neither was significant for any outcome in only 1 study (4.0%). In 50 of 85 comparisons (58.8%), both apo B and LDL-P had statistically significant associations with the clinical outcome, whereas in 17 comparisons (20.0%) neither was significantly associated with the outcome. In 18 comparisons (21.1%) there was discordance between apo B and LDL-P ...
Complete information for APOBEC3B gene (Protein Coding), Apolipoprotein B MRNA Editing Enzyme Catalytic Subunit 3B, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative) (APOBEC3D), mRNA. (H00140564-R01) - Products - Abnova
significant risk factors for all stroke were: history of hypertension (OR 2·64, 99% CI 2·26-3·08; PAR 34·6%, 99% CI 30·4-39·1); current smoking (2·09, 1·75-2·51; 18·9%, 15·3-23·1); waist-to-hip ratio (1·65, 1·36-1·99 for highest vs lowest tertile; 26·5%, 18·8-36·0); diet risk score (1·35, 1·11-1·64 for highest vs lowest tertile; 18·8%, 11·2-29·7); regular physical activity (0·69, 0·53-0·90; 28·5%, 14·5-48·5); diabetes mellitus (1·36, 1·10-1·68; 5·0%, 2·6-9·5); alcohol intake (1·51, 1·18-1·92 for more than 30 drinks per month or binge drinking; 3·8%, 0·9-14·4); psychosocial stress (1·30, 1·06-1·60; 4·6%, 2·1-9·6) and depression (1·35, 1·10-1·66; 5·2%, 2·7-9·8); cardiac causes (2·38, 1·77-3·20; 6·7%, 4·8-9·1); and ratio of apolipoproteins B to A1 (1·89, 1·49-2·40 for highest vs lowest tertile; 24·9%, 15·7-37·1). Collectively, these risk factors accounted for 88·1% (99% CI 82·3-92·2) of the PAR for all stroke. When an alternate ...
Representative light micrographs of H&E- (A-D), PAM- (E-H), and Oil RedO-stained (I, J) kidney sections from 36-week-old human apoB Tg.SHR-cp/cp (A, E, I),
Leica의 매크로현미경(Macroscope)는 시판되는 제품 중 최고 수준의 정밀도를 가지며 산업, 의학, 연구 분야에서 다채로운 목적으로 사용됩니다. 편리한 매크로스코프 Leica Macroscope는 APO 16:1 줌이 주는 탁월한 광학 특성과 함께 작업 편리성에 있어 최고의
Apolipoprotein A-1 Milano (also ETC-216, now MDCO-216) is a naturally occurring mutated variant of the apolipoprotein A1 ... Weisgraber KH, Rall SC, Bersot TP, Mahley RW, Franceschini G, Sirtori CR (25 February 1983). "Apolipoprotein A-IMilano. ...
... or apolipoprotein C-II is a protein that in humans is encoded by the APOC2 gene. secreted in plasma where it ... "A nonsense mutation in the apolipoprotein C-IIPadova gene in a patient with apolipoprotein C-II deficiency". J. Clin. Invest. ... Familial apolipoprotein CII deficiency associated with premature vascular disease". J. Clin. Invest. 80 (6): 1597-606. doi: ... "Structure of apolipoprotein C-IIToronto, a nonfunctional human apolipoprotein". Proc. Natl. Acad. Sci. U.S.A. 84 (1): 270-3. ...
"Genetic studies of human apolipoproteins. XVIII. apolipoprotein polymorphisms in Australian Aborigines", Human Biology, 63 (2 ...
Apolipoprotein L3 is a protein that in humans is encoded by the APOL3 gene. This gene is a member of the apolipoprotein L gene ... "Entrez Gene: APOL3 apolipoprotein L, 3". Human APOL3 genome location and APOL3 gene details page in the UCSC Genome Browser. ... 2001). "Apolipoprotein L gene family: tissue-specific expression, splicing, promoter regions; discovery of a new gene". J. ... Monajemi H, Fontijn RD, Pannekoek H, Horrevoets AJ (2002). "The apolipoprotein L gene cluster has emerged recently in evolution ...
Apolipoprotein L6 is a protein that in humans is encoded by the APOL6 gene. This gene is a member of the apolipoprotein L gene ... "Entrez Gene: APOL6 apolipoprotein L, 6". Human APOL6 genome location and APOL6 gene details page in the UCSC Genome Browser. ... Liu Z, Lu H, Jiang Z, Pastuszyn A, Hu CA (Jan 2005). "Apolipoprotein l6, a novel proapoptotic Bcl-2 homology 3-only protein, ... Page NM, Butlin DJ, Lomthaisong K, Lowry PJ (May 2001). "The human apolipoprotein L gene cluster: identification, ...
Its most abundant apolipoproteins are apo A-I and apo A-II.[citation needed] A rare genetic variant, ApoA-1 Milano, has been ... In the stress response, serum amyloid A, which is one of the acute-phase proteins and an apolipoprotein, is under the ... Sacks FM, Zheng C, Cohn JS (2011). "Complexities of plasma apolipoprotein C-III metabolism". Journal of Lipid Research. 52 (6 ... HDL lipoprotein particles that bear apolipoprotein C3 are associated with increased, rather than decreased, risk for coronary ...
Hauser, Paul S.; Ryan, Robert O. (October 2013). "Impact of Apolipoprotein E on Alzheimer's Disease". Current Alzheimer ...
"Entrez Gene: apolipoprotein B mRNA editing enzyme". Marino D, Perković M, Hain A, Jaguva Vasudevan AA, Hofmann H, Hanschmann KM ... C->U-editing enzyme APOBEC-4, also known as Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 4, is a protein ...
The presence of the Apolipoprotein c4 allele. ARD is treated with abstinence from further alcohol consumption. Multiple ...
These molecules contain apolipoprotein B100 and apolipoprotein E in their shells, and can be degraded by lipoprotein lipase on ... Chylomicrons, the least dense cholesterol transport molecules, contain apolipoprotein B-48, apolipoprotein C, and ... adjusted for apolipoprotein A-I and apolipoprotein B) and increased risk of cardiovascular disease, casting doubt on the ... Upon binding of apolipoprotein B100, many LDL receptors concentrate in clathrin-coated pits. Both LDL and its receptor form ...
1995). cDNA-Klonierung und Charakterisierung des humanen Apolipoprotein B mRNA Editingenzyms (PhD). University of Vienna. - ( ... Hammerschmid, Sonja (1991). Transkriptionsmodulationssystem am Beispiel des Apolipoprotein Al Gens (MSc). University of Vienna ...
BP Nathan, S Bellosta, DA Sanan, KH Weisgraber, RW Mahley, RE Pitas (6 May 1994). "Differential effects of apolipoproteins E3 ... The differential effects of apolipoproteins E3 and E4 were also examined on neuronal growth in vitro. Randomization Causality ...
... sensitive and accurate screening of apolipoproteins and mutations of them. Apolipoproteins represent a groups of proteins with ... Nelson and colleagues did a study using MSIA to characterize and isolate apolipoproteins species.[citation needed] There are ... "Novel mass spectrometric immunoassays for the rapid structural characterization of plasma apolipoproteins". Journal of Lipid ...
When exposed to high hyppo levels, cells with apolipoproteins did not initiate immune responses evidencing their role as a ... In studying nuclear factor-κB dependent gene expression Seong found strong evidence that apolipoproteins function as a hyppo- ... Cho, Nam-Hyuk; Seong, Seung-Yong (2009-09-01). "Apolipoproteins inhibit the innate immunity activated by necrotic cells or ...
October 2010). "Membrane curvature induction and tubulation are common features of synucleins and apolipoproteins". The Journal ... alpha-synuclein can also form lipoprotein nanoparticles similar to apolipoproteins. The most common form of cell death in ...
Peng J, Li XP (November 2018). "Apolipoprotein A-IV: A potential therapeutic target for atherosclerosis". Prostaglandins & ...
August 1992). "Apolipoprotein AI mutation Arg-60 causes autosomal dominant amyloidosis". Proc. Natl. Acad. Sci. U.S.A. 89 (16 ... with congenital mutations in apolipoprotein A1 and lysozyme. It is also known as "Ostertag" type, after B. Ostertag, who ...
Apolipoprotein E4 allele in a population based study of early onset Alzheimer's disease. Nat Genet. 1994;7:74-9. Hendriks L, et ... Atherosclerosis, apolipoprotein and prevalence of dementia and Alzheimer's disease. The Rotterdam Study. Lancet. 1997;349:151-4 ...
In animals, when there is an oversupply of dietary carbohydrate, the excess carbohydrate is converted to triglycerides. This involves the synthesis of fatty acids from acetyl-CoA and the esterification of fatty acids in the production of triglycerides, a process called lipogenesis.[87] Fatty acids are made by fatty acid synthases that polymerize and then reduce acetyl-CoA units. The acyl chains in the fatty acids are extended by a cycle of reactions that add the acetyl group, reduce it to an alcohol, dehydrate it to an alkene group and then reduce it again to an alkane group. The enzymes of fatty acid biosynthesis are divided into two groups, in animals and fungi all these fatty acid synthase reactions are carried out by a single multifunctional protein,[88] while in plant plastids and bacteria separate enzymes perform each step in the pathway.[89][90] The fatty acids may be subsequently converted to triglycerides that are packaged in lipoproteins and secreted from the liver. The synthesis of ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. Genet. 85 (5 ...
November 2009). "Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. Genet. 85 (5 ...
November 2009). "Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". American Journal of ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". American Journal of ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. Genet. 85 (5 ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. Genet. 85 (5 ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. Genet. 85 (5 ...
"Antisense Inhibition of Apolipoprotein C-III in Patients with Hypertriglyceridemia". The New England Journal of Medicine. 373 ( ...
The lipoprotein density and type of apolipoproteins it contains determines the fate of the particle and its influence on ... Online Mendelian Inheritance in Man (OMIM): Apolipoprotein C-II Deficency - 207750 Yamamura T, Sudo H, Ishikawa K, Yamamoto A ( ... or altered apolipoprotein C2, resulting in elevated chylomicrons, the particles that transfer fatty acids from the digestive ... September 1979). "Familial type I hyperlipoproteinemia caused by apolipoprotein C-II deficiency". Atherosclerosis. 34 (1): 53- ...
... and ProteinsProteinsApoproteinsApolipoproteinsApolipoproteins CApolipoprotein C-IApolipoprotein C-IIApolipoprotein C-III ... and ProteinsProteinsLipoproteinsApolipoproteinsApolipoproteins CApolipoprotein C-IApolipoprotein C-IIApolipoprotein C-III ... and Drugs CategoryLipidsLipoproteinsApolipoproteinsApolipoproteins CApolipoprotein C-IApolipoprotein C-IIApolipoprotein C-III ... Apolipoproteins C. A group of apolipoproteins that can readily exchange among the various classes of lipoproteins (HDL; VLDL; ...
Apolipoprotein C-IV, also known as apolipoprotein C4, is a protein that in humans is encoded by the APOC4 gene.[5][6] ... Apolipoprotein (apo)C4 gene is a member of the apolipoprotein C gene family. It is expressed in the liver and has a predicted ... "Entrez Gene: apolipoprotein C-IV".. *^ Allan CM, Walker D, Segrest JP, Taylor JM (July 1995). "Identification and ... 2002). "Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical ...
Apolipoprotein C2 or apolipoprotein C-II is a protein that in humans is encoded by the APOC2 gene. secreted in plasma where it ... "A nonsense mutation in the apolipoprotein C-IIPadova gene in a patient with apolipoprotein C-II deficiency". J. Clin. Invest. ... Familial apolipoprotein CII deficiency associated with premature vascular disease". J. Clin. Invest. 80 (6): 1597-606. doi: ... "Structure of apolipoprotein C-IIToronto, a nonfunctional human apolipoprotein". Proc. Natl. Acad. Sci. U.S.A. 84 (1): 270-3. ...
Alzheimers Is Genetic Protect Your Future www.alzheimer-herbs.com/ Apolipoprotein alzhei… ... Apolipoprotein alzheimers disease connection * 1. Anti Alzheimers Herbs. Alzheimers Is Genetic Protect Your Future www. ... The fourth and perhaps the most important recently discovered gene linked to AAlzheimers disease is the Apolipoprotein E (ApoE ... alzheimer-herbs.com/ Apolipoprotein alzheimers disease connection The scientific enthusiasm about the possible role of amyloid ...
Apolipoprotein B100 (apoB100) is a protein that plays a role in moving cholesterol around your body. It is a form of low ... Apolipoprotein B100 (apoB100) is a protein that plays a role in moving cholesterol around your body. It is a form of low ... Apolipoprotein measurements may provide more detail about your risk for heart disease, but the added value of this test beyond ... Lipids, lipoproteins, apolipoproteins, and other cardiovascular risk factors. In: Rifai N, ed. Tietz Textbook of Clinical ...
Apolipoprotein CII (apoCII) is a protein found in large fat particles that the gastrointestinal tract absorbs. It is also found ... ApoCII; Apoprotein CII; ApoC2; Lipoprotein lipase deficiency - apolipoprotein CII; Chylomicronemia syndrome - apolipoprotein ... Apolipoprotein measurements may provide more detail about your risk for heart disease, but the added value of this test beyond ... Apolipoprotein CII (apoCII) is a protein found in large fat particles that the gastrointestinal tract absorbs. It is also found ...
Apolipoprotein AI amyloidosis (apoAI) is an autosomal dominant amyloidosis caused by point mutations in the apoAI gene. Usually ... encoded search term (What is apolipoprotein AI amyloidosis (apoAI)?) and What is apolipoprotein AI amyloidosis (apoAI)? What to ... What is apolipoprotein AI amyloidosis (apoAI)?. Updated: May 09, 2019 * Author: Robert O Holmes, Jr, DO; Chief Editor: Herbert ... Apolipoprotein AI amyloidosis (apoAI) is an autosomal dominant amyloidosis caused by point mutations in the apoAI gene. Usually ...
The apolipoprotein B (Apo B) is a protein involved in the metabolism of lipids. The apo B test may be used, along with other ... Apolipoprotein B-100 (also called apolipoprotein B or apo B) is a protein that is involved in the metabolism of lipids and is ... Apolipoproteins combine with lipids to transport them throughout the bloodstream. Apolipoproteins provide structural integrity ... The apolipoprotein B (apo B) test is used, along with other lipid tests, to help determine an individuals risk of developing ...
... (apoB100) is a protein that plays a role in moving cholesterol around your body. It is a form of low ... Apolipoprotein B100 (apoB100) is a protein that plays a role in moving cholesterol around your body. It is a form of low ... Apolipoprotein measurements may provide more detail about your risk for heart disease, but the added value of this test beyond ... Regulation and clearance of apolipoprotein B-containing lipoproteins. In: Ballantyne CM, ed. Clinical Lipidology: A Companion ...
... a series of Sicilian neonates was studied in order to investigate about the distribution of serum lipid and apolipoprotein at ... 1990) Lipid and apolipoprotein in cord blood. In: Descovich G., Gaddi A., Magri G., Lenzi S. (eds) Atherosclerosis and ... McConathy, W.J., Lane, D.M., (1980) "Studies on the apolipoproteins and lipoproteins of cord serum", Pediatr. Res., 14, 757-61. ... In conclusion lipid and apolipoprotein distributions in Sicilian newborns are not different from that of other population and ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Exchangeable apolipoproteins (apoA, apoC and apoE) have the same genomic structure and are members of a multi-gene family that ... ApoA1, ApoA4 and Apo5 are part of the APOA1/C3/A4/A5 gene cluster on chromosome 11 [PMID: 15108119]. Apolipoproteins function ... Three-dimensional structure of the LDL receptor-binding domain of human apolipoprotein E.. Science 252 1817-22 1991 ... Contributions of domain structure and lipid interaction to the functionality of exchangeable human apolipoproteins.. Prog. ...
Human apolipoprotein E has three isoforms: APOE2, APOE3 and APOE41. APOE4 is a major genetic risk factor for Alzheimers ... Human apolipoprotein E has three isoforms: APOE2, APOE3 and APOE41. APOE4 is a major genetic risk factor for Alzheimers ... Apolipoprotein E controls cerebrovascular integrity via cyclophilin A. *Robert D. Bell1,2. , ... Bell, R., Winkler, E., Singh, I. et al. Apolipoprotein E controls cerebrovascular integrity via cyclophilin A. Nature 485, 512- ...
APOA1 apolipoprotein A1 [Homo sapiens] APOA1 apolipoprotein A1 [Homo sapiens]. Gene ID:335 ... Title: Apolipoprotein B/apolipoprotein A1 ratio and mortality among incident peritoneal dialysis patients. ... apolipoprotein A1provided by HGNC. Primary source. HGNC:HGNC:600 See related. Ensembl:ENSG00000118137 MIM:107680; Vega: ... Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins. Pourmousa M, et al. Proc Natl Acad Sci U S A, ...
... apolipoprotein D apolipoprotein E apolipoprotein F apolipoprotein H apolipoprotein L apolipoprotein M apolipoprotein(a) ... apolipoprotein A (apoA1, apoA2, apoA4, and apolipoprotein A-V (apoA5)) apolipoprotein B (apo B48 and apo B100) apolipoprotein C ... Apolipoprotein F (apoF) is one of the minor apolipoprotein in blood plasma and it is a lipid transfer inhibit protein to ... Apolipoprotein synthesis in the intestine is regulated principally by the fat content of the diet. Apolipoprotein synthesis in ...
APOLIPOPROTEIN E. A. 165. Homo sapiens. Mutation(s): 1 Gene Names: APOE. ... Crystal Structure of the 22K Domain of Human Apolipoprotein E4. Verderame, J.R., Kantardjieff, K., Segelke, B., Weisgraber, K. ...
Apolipoprotein L1 is a protein that in humans is encoded by the APOL1 gene. Two transcript variants encoding two different ... APOL1 is a member of a family of apolipoproteins which also includes six other proteins and it is a member of bcl2 genes which ... Apolipoprotein L1 (apoL1) is a minor apoprotein component of HDL (High-density lipoprotein) or good cholesterol which is ... particles that also contain apolipoprotein A1 (APOA1) and the hemoglobin-binding, haptoglobin-related protein (HPR). The APOL1 ...
Apolipoproteins regulate lipid metabolism, adipose tissue, and energy production and serve major... ... Apolipoproteins have important structural and functional roles in several lipoprotein particles. ... Horejsi B, Ceska R (2000) Apolipoproteins and atherosclerosis. Apolipoprotein E and apolipoprotein(a) as candidate genes of ... Apolipoproteins have important structural and functional roles in several lipoprotein particles. Apolipoproteins regulate lipid ...
LBXAPB - Apolipoprotein (B) (mg/dL). Variable Name: LBXAPB. SAS Label: Apolipoprotein (B) (mg/dL). English Text: Apolipoprotein ... LBDAPBSI - Apolipoprotein (B) (g/L). Variable Name: LBDAPBSI. SAS Label: Apolipoprotein (B) (g/L). English Text: Apolipoprotein ... Apolipoprotein B (ApoB_G) Data File: ApoB_G.xpt First Published: January 2014. Last Revised: NA ... Apolipoprotein B is the main protein component of LDL and accounts for approximately 95% of the total protein content of LDL. ...
LBXAPB - Apolipoprotein (B) (mg/dL). Variable Name: LBXAPB. SAS Label: Apolipoprotein (B) (mg/dL). English Text: Apolipoprotein ... LBDAPBSI - Apolipoprotein (B) (g/L). Variable Name: LBDAPBSI. SAS Label: Apolipoprotein (B) (g/L). English Text: Apolipoprotein ... A crossover study was performed to compare the 2007-2008 Apolipoprotein B data to the 2005-2006 Apolipoprotein B data. The Dade ... Apolipoprotein B (ApoB_E) Data File: ApoB_E.xpt First Published: July 2010. Last Revised: NA Note: See Analytic Note on ...
HDL3species containing both apolipoprotein A-I and apolipoprotein A-II, and HDL3(AI w/o AII), HDL3species containing ... initially with three apolipoprotein A-I, to larger particles with four apolipoprotein A-I per particle. © 1989. ... Conversion of apolipoprotein-specific high-density lipoprotein populations during incubation of human plasma. *Nichols A ... Nichols, A. V., Blanche, P. J., Shore, V. G., & Gong, E. L. (1989). Conversion of apolipoprotein-specific high-density ...
First, plasma apolipoprotein E maintains overall plasma cholesterol homeostasis by facilitating efficient hepatic uptake of ... Apolipoprotein E plays a key protective role in atherosclerosis. Its capacity to safeguard against this disease can be ... Second, lesion apolipoprotein E in concert with apolipoprotein A-I facilitates cellular cholesterol efflux from macrophage foam ... Apolipoprotein E and atherosclerosis Curr Opin Lipidol. 2000 Jun;11(3):243-51. doi: 10.1097/00041433-200006000-00004. ...
Apolipoprotein-D Human Recombinant, Human Apolipoprotein-J, Apolipoprotein-J Canine Recombinant ... ProSpecs Apolipoproteins include: Clusterin Human Recombinant, Clusterin Rat Recombinant, ... About Apolipoprotein:. The binding of lipids (soluble oil molecules) and cholesterol to Apoliproteins result in the formation ... 6 main classes of apolipoproteins are APOA, APOB, APOC, APOD, APOE and APOH. APOA1 takes an important role in the return of ...
Human apolipoprotein E (apoE) consists of a single polypeptide chain with 299 amino acids and is best known for its role in the ... Keywords: ATP binding cassette transporter 1 (ABC1); ApoE; Apolipoprotein; Atherosclerosis; Cell-based Gene Therapy; ...
Structural changes induced by acidic pH in human apolipoprotein B-100. *José A. Fernández-Higuero1,2. na1, ... Structural changes induced by acidic pH in human Apolipoprotein B-100. Sci. Rep. 6, 36324; doi: 10.1038/srep36324 (2016). ... Law, A. & Scott, J. A cross-species comparison of the apolipoprotein B domain that binds to the LDL receptor. Journal of lipid ... Segrest, J. P., Jones, M. K., De Loof, H. & Dashti, N. Structure of apolipoprotein B-100 in low density lipoproteins. Journal ...
Effective immediately, SpectraCell Laboratories now offers apolipoprotein E genotyping. This test determines a persons genetic ... SpectraCell Laboratories Offers Apolipoprotein E Genetic Testing. Thursday, April 22, 2010 General News ... HOUSTON, April 21 /PRNewswire/ -- Effective immediately, SpectraCell Laboratories now offers apolipoprotein E genotyping. ...
Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins. Mohsen Pourmousa, Hyun D. Song, Yi He, Jay W. ... Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins. Mohsen Pourmousa, Hyun D. Song, Yi He, Jay W. ... Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins. Mohsen Pourmousa, Hyun D. Song, Yi He, Jay W. ... Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins Message Subject (Your Name) has sent you a ...
... of this unique and specialized field but also updates on the current state of research and development of apolipoprotein ... Using the models of two long anti-atherogenic and anti-inflammatory proteins (apolipoprotein A-I and apolipoprotein E with 243 ... Apolipoprotein Mimetics in the Management of Human Disease. Editors: Anantharamaiah, G M, Goldberg, Dennis (Eds.) ... Apolipoprotein Mimetics in the Management of Human Disease. Editors. * G M Anantharamaiah ...
The present invention relates to methods of use of phosphonate-phosphates and diphosphonates to modulate apolipoprotein E ... Rubinsztein, "Apolipoprotein E-a review of its roles in lipoprotein metabolism, neuronal growth and repair and as a risk factor ... Poirier, "Apolipoprotein E in animal models of CNS injury and in Alzheimers disease," Trends in Neurosciences 17:525-530, 1994 ... Apolipoprotein E was expressed as % change from mean control value. Cholesterol was measured with a commercially available ...
We have generated transgenic mice over-expressing human apolipoprotein CI (apo CI) using the native gene joined to the ...
  • Apolipoproteins are proteins that bind lipids (oil-soluble substances such as fat and cholesterol) to form lipoproteins. (wikipedia.org)
  • Different lipoproteins contain different classes of apolipoproteins, which influence their function. (wikipedia.org)
  • Apolipoprotein A-I (apoA1) is the major structural protein component of high-density lipoproteins (HDL), although it is present in other lipoproteins in smaller amounts. (wikipedia.org)
  • Apolipoprotein A-IV (apoA4) is present in chylomicrons, very-low-density lipoproteins (VLDL), and HDL. (wikipedia.org)
  • Apolipoprotein B plays a particularly important role in lipoprotein transport being the primary organizing protein of many lipoproteins. (wikipedia.org)
  • Apolipoprotein C-III (apoC3) plays an important role in lipid metabolism specific in regulating the metabolism of triglyceride-rich lipoproteins (TRLs). (wikipedia.org)
  • Regulation and clearance of apolipoprotein B-containing lipoproteins. (medlineplus.gov)
  • Apolipoproteins provide structural integrity to lipoproteins and shield the water-repellent (hydrophobic) lipids at their center. (labtestsonline.org)
  • Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins. (nih.gov)
  • McQueen MJ, Hawken S, Wang X, Ounpuu S, Sniderman A, Probstfield J et al (2008) Lipids, lipoproteins, and apolipoproteins as risk markers of myocardial infarction in 52 countries (the INTERHEART study): a case-control study. (springer.com)
  • Apolipoproteins are composed from various lipoproteins such as exchangeable Apolipoprtoeins and non-exchangeable. (prospecbio.com)
  • Apolipoprotein C-II (apoCII) is in found in chylomicrons (large lipoprotein particles absorbed from the gastrointestinal tract) and VLDL (large lipoproteins that are broken down to eventually form LDL). (abcam.com)
  • Cinnamon extract inhibits the postprandial overproduction of apolipoprotein B48-containing lipoproteins in fructose-fed animals. (greenmedinfo.com)
  • While LDL, HDL, and (sometimes) VLDL (very low-density lipoprotein) are the only classes mentioned in regards to diagnostic tests, there are four other classes of lipoproteins that differ in size, lipid composition, and apolipoproteins. (taconic.com)
  • The Apolipoproteins are the main form of protein found in High Density Lipoproteins (HDL). (randox.com)
  • Apolipoprotein E (apoE), a component of plasma lipoproteins, has been suggested to bind and traffic Ags for NKT cell activation. (jimmunol.org)
  • Apolipoprotein E (apoE) 3 is a multifunctional component of plasma lipoproteins that is found on very low density lipoprotein, low density lipoprotein (LDL), high density lipoprotein, and chylomicron remnant lipoprotein complexes. (jimmunol.org)
  • Apolipoprotein B100 (apoB) is the structural protein of the atherogenic lipoproteins. (thefreedictionary.com)
  • In particular, increased apolipoprotein B levels, both in whole plasma and in specific lipoprotein fractions, e.g. low density lipoproteins (LDL) [3], seem to be associated to a raised risk, the opposite being the case for apo AI [4]. (springer.com)
  • Swaney JB, Braithwaite F, Eder HA (1977) Characterization of the apolipoproteins of rat plasma lipoproteins. (springer.com)
  • Brewer HB, Fairwell T, La Rue A, Rorian R, Hauser A, Bronzert TJ (1978) The amino acid sequence of human apo AI, an apolipoprotein isolated from high density lipoproteins. (springer.com)
  • Apolipoprotein (Apo) C-III (ApoCIII) resides on the surface of plasma chylomicron (CM), very low density lipoprotein (VLDL) and high density lipoproteins (HDL). (jove.com)
  • Apolipoprotein E or apo E is the most important protein found in chylomicrons and very low density lipoproteins, or VLDL cholesterol. (medicalhealthtests.com)
  • Apolipoprotein E (apoE) plays an important role in the transport and uptake of cholesterol by way of its high affinity interaction with lipoprotein receptors, including the low-density lipoprotein (LDL) receptor. (wikipedia.org)
  • Recent findings with apoA1 and apoE suggest that the tertiary structures of these two members of the human exchangeable apolipoprotein gene family are related. (wikipedia.org)
  • Exchangeable apolipoproteins (apoA, apoC and apoE) have the same genomic structure and are members of a multi-gene family that probably evolved from a common ancestral gene. (ebi.ac.uk)
  • APOE is primarily located in HDL and VLDL Apolipoproteins act as lipid transfer carrier enzymes, cofactors and receptor ligands which control lipoprotein metabolism. (prospecbio.com)
  • Human apolipoprotein E (apoE) consists of a single polypeptide chain with 299 amino acids and is best known for its role in the transport of cholesterol and other lipids between peripheral tissues and the liver. (ingentaconnect.com)
  • Apolipoprotein E (ApoE) is a protein associated with cardiovascular disease (CVD) and Alzheimer's disease. (genomebc.ca)
  • Apolipoprotein E ( ApoE ) is a class of proteins involved in the metabolism of fats in the body. (wikidoc.org)
  • The gene, APOE , is mapped to chromosome 19 in a cluster with apolipoprotein C1 (APOC-I) and the apolipoprotein C2 . (wikidoc.org)
  • The lipid transport protein, apolipoprotein E (apoE), is expressed in many peripheral tissues in vivo including the adrenal gland and testes. (pnas.org)
  • Several studies in mice indicate a role for apolipoprotein E (APOE) in lipid accumulation and adipogenic differentiation in adipose tissue. (osti.gov)
  • Inheritance of the three different alleles of the human apolipoprotein (apo) E gene (APOE) are associated with varying risk or clinical outcome from a variety of neurologic diseases. (nih.gov)
  • They examined the correlation of high-density lipoprotein cholesterol (HDL-C), apoA1, apoCIII, apoD, and apoE and the ratios of apolipoproteins with apoA1 with T2D risk. (medicalxpress.com)
  • The apolipoprotein (APOE) epsilon4 allele is a genetic risk factor for the development of Alzheimer's disease (AD). (unboundmedicine.com)
  • VL - 483 IS - 1 N2 - The apolipoprotein (APOE) epsilon4 allele is a genetic risk factor for the development of Alzheimer's disease (AD). (unboundmedicine.com)
  • Objectives: To evaluate the frequency of apolipoprotein (APOE) alleles and determine whether APOE type 4 allele (e4) was associated with edentulousness even when certain factors were controlled.Background: The APOE are important in lipid homeostasis, and APOE e4 has been found in many diseases and to have a negative impact on longevity. (diva-portal.org)
  • METHODS AND RESULTS: Apolipoprotein E (Apoe) null mice that had knockout of a single allele of the insulin receptor (Insr) gene were compared with littermate Apoe null mice with intact insulin receptors. (biomedsearch.com)
  • Apolipoprotein C-IV , also known as apolipoprotein C4 , is a protein that in humans is encoded by the APOC4 gene . (wikipedia.org)
  • Apolipoprotein (apo)C4 gene is a member of the apolipoprotein C gene family. (wikipedia.org)
  • 2002). "Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. (wikipedia.org)
  • 2009). "Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip" . (wikipedia.org)
  • Apolipoprotein C2 or apolipoprotein C-II is a protein that in humans is encoded by the APOC2 gene . (wikipedia.org)
  • 1986). "The structure of the human apolipoprotein C-II gene. (wikipedia.org)
  • 1989). "A nonsense mutation in the apolipoprotein C-IIPadova gene in a patient with apolipoprotein C-II deficiency" . (wikipedia.org)
  • 1988). "Donor splice site mutation in the apolipoprotein (Apo) C-II gene (Apo C-IIHamburg) of a patient with Apo C-II deficiency" . (wikipedia.org)
  • Apolipoprotein L1 is a protein that in humans is encoded by the APOL1 gene. (wikipedia.org)
  • Apolipoprotein AI amyloidosis (apoAI) is an autosomal dominant amyloidosis caused by point mutations in the apoAI gene. (medscape.com)
  • This gene encodes apolipoprotein A-I, which is the major protein component of high density lipoprotein (HDL) in plasma. (nih.gov)
  • This gene is closely linked with two other apolipoprotein genes on chromosome 11. (nih.gov)
  • Two novel APOA1 gene mutations in a Japanese renal transplant recipient with recurrent apolipoprotein A-I related amyloidosis. (nih.gov)
  • The objective of this study was to evaluate whether apolipoprotein gene polymorphisms confer susceptibility to osteonecrosis of the femoral head. (nih.gov)
  • We have generated transgenic mice over-expressing human apolipoprotein CI (apo CI) using the native gene joined to the downstream 154-bp liver-specific enhancer that we defined for apo E. Human apo CI (HuCI)-transgenic mice showed elevation of plasma triglycerides (mg/dl) compared to controls in both the fasted (211 +/- 81 vs 123 +/- 52, P = 0.0001) and fed (265 +/- 105 vs 146 +/- 68, P (jci.org)
  • Apolipoprotein E genotype and the association between C-reactive protein and postoperative delirium: Importance of gene-protein interactions. (harvard.edu)
  • There are two forms, apolipoprotein B-100 and apolipoprotein B-48, both derived from a single gene. (harvard.edu)
  • Apolipoprotein All (ApoAII) amyloidosis, first reported in 2001 in a family with renal amyloidosis, is associated with mutations in the stop codon of the apolipoprotein AII gene resulting in a carboxyl terminal peptide extension of 21 amino acid residues in the protein. (highbeam.com)
  • Apolipoprotein D is a protein that in humans is encoded by the APOD gene . (wikidoc.org)
  • Expression of the human apolipoprotein E gene suppresses steroidogenesis in mouse Y1 adrenal cells. (pnas.org)
  • The data show that a single dose of the gene therapy carrying a short hairpin RNA to silence Apolipoprotein B100 (ApoB100) resulted in a reduction of serum cholesterol of approximately 80% without any signs of toxicity. (thefreedictionary.com)
  • Mammalian apolipoprotein B (apo B) exists in two forms, each the product of a single gene. (sciencemag.org)
  • The apolipoprotein E gene ε4 all. (bio-medicine.org)
  • The apolipoprotein E gene ε4 allele is considered a negative fact. (bio-medicine.org)
  • The apolipoprotein E gene ε4 allele is considered a negative factor for neural regeneration in late-onset Alzheimer's disease cases. (bio-medicine.org)
  • A research team from Department of Neurology, Peking University Shenzhen Hospital in China pointed out a non-invasive and fast method to genotype large samples to help to elucidate the role of apolipoprotein E gene ε4 allele in neural regeneration in the cases with late-onset Alzheimer's disease. (bio-medicine.org)
  • APOC2 encodes a lipid-binding protein belonging to the apolipoprotein gene family. (antibodies-online.com)
  • The apolipoprotein E gene increases the risk of developing late-onset of Alzheimer's disease. (medicalhealthtests.com)
  • In addition to stabilizing lipoprotein structure and solubilizing the lipid component, apolipoproteins interact with lipoprotein receptors and lipid transport proteins, thereby participating in lipoprotein uptake and clearance. (wikipedia.org)
  • In lipid transport, apolipoproteins function as structural components of lipoprotein particles, ligands for cell-surface receptors and lipid transport proteins, and cofactors for enzymes (e.g. apolipoprotein C-II for lipoprotein lipase and apolipoprotein A-I (apoA1) for lecithin-cholesterol acyltransferase). (wikipedia.org)
  • APOL1 is a member of a family of apolipoproteins which also includes six other proteins and it is a member of bcl2 genes which are involved in autophagic cell death. (wikipedia.org)
  • Using the models of two long anti-atherogenic and anti-inflammatory proteins (apolipoprotein A-I and apolipoprotein E with 243 and 299 amino acids, respectively) short mimetic peptides of 18 to 28 amino acid residues in length, which can be produced either synthetically or genetically in edible fruits and vegetables, have been shown to exert profound biological effects in a large number of animal models of diseases. (springer.com)
  • 1995). "Site-specific detection and structural characterization of the glycosylation of human plasma proteins lecithin:cholesterol acyltransferase and apolipoprotein D using HPLC/electrospray mass spectrometry and sequential glycosidase digestion" . (wikidoc.org)
  • Additionally we are shipping Apolipoprotein D Kits (32) and Apolipoprotein D Proteins (24) and many more products for this protein. (antibodies-online.com)
  • Apolipoprotein J Antibody functions as a secreted chaperone that prevents aggregation of nonnative proteins. (rockland-inc.com)
  • Apolipoprotein J does not require ATP or refold proteins by itself. (rockland-inc.com)
  • This product has been prepared by immunoaffinity chromatography using immobilized antigens followed by extensive cross-adsorption against other apoLipoproteins and human serum proteins to remove any unwanted specificities. (rockland-inc.com)
  • Non-specific cross reaction of anti-apoLipoprotein antibodies with other human serum proteins is negligible. (rockland-inc.com)
  • These proteins, known as apolipoproteins, are the major identifying characteristics of a lipoprotein. (labce.com)
  • One role is to increase the overall solubility of the lipid particle, helping it to dissolve in the aqueous environment of the blood (apolipoproteins are amphipathic, or detergent-like proteins). (labce.com)
  • Additionally we are shipping Apolipoprotein C-II Kits (51) and Apolipoprotein C-II Proteins (28) and many more products for this protein. (antibodies-online.com)
  • It forms a complex, known as a trypanosome lytic factor (TLF), with high-density lipoprotein 3 (HDL3) particles that also contain apolipoprotein A1 (APOA1) and the hemoglobin-binding, haptoglobin-related protein (HPR). (wikipedia.org)
  • Case Report: recurrence of non-familial hereditary apolipoprotein A-I amyloidosis in Japanese transplant recipient with two novel APOA1 mutations. (nih.gov)
  • An example of non-exchangeable apolipoprotein is APOAB which is attached to the lipoprotein particle while examples of Lipoprotein exchangeable are APOM, APOD, APOJ, APOH and APOA1 which are transported between different lipoprotein molecules. (prospecbio.com)
  • HDL begins to develop when two copies of the protein apolipoprotein A-I (APOA1) mediate the removal of excess lipids from peripheral cells and form a nanodisc. (pnas.org)
  • Understanding the function of high-density lipoprotein (HDL) requires detailed knowledge of the structure of its primary protein, apolipoprotein A-I (APOA1). (pnas.org)
  • AIM: To determine the association between apolipoprotein A1 ( APOA1 ) (−75 guanine [G] to adenine [A] and +83/84 M2 +/− , MspI ) and apolipoprotein C3 ( APOC3 ) ( SstI ) polymorphisms with gallstone disease. (hindawi.com)
  • HealthDay)-Apolipoprotein (apo) CIII and apoCIII-to-apoA1 ratio are correlated with incident type 2 diabetes (T2D), according to a study published online Dec. 28 in Diabetes Care . (medicalxpress.com)
  • Apolipoprotein A I (APOA1) - Pipeline Review, H2 2016', provides in depth analysis on Apolipoprotein A I (APOA1) targeted pipeline therapeutics. (researchandmarkets.com)
  • The report provides comprehensive information on the Apolipoprotein A I (APOA1) , targeted therapeutics, complete with analysis by indications, stage of development, mechanism of action (MoA), route of administration (RoA) and molecule type. (researchandmarkets.com)
  • Additionally, the report provides an overview of key players involved in Apolipoprotein A I (APOA1) targeted therapeutics development and features dormant and discontinued projects. (researchandmarkets.com)
  • Apolipoprotein A-I/ApoA1 Polyclonal antibody specifically detects Apolipoprotein A-I/ApoA1 in Human, Mouse samples. (fishersci.com)
  • Noma A Yokosuka T, Kitamura K (1983) Plasma lipids and apolipoproteins as discriminators for presence and severity of angiographically defined coronary artery disease. (springer.com)
  • Associations of major lipids and apolipoproteins with the risk of vascular disease have not been reliably quantified. (pubmedcentralcanada.ca)
  • To assess major lipids and apolipoproteins in vascular risk. (pubmedcentralcanada.ca)
  • Reliable assessment of the separate and joint associations of major blood lipids and apolipoproteins with the risk of vascular disease is important for the development of screening and therapeutic strategies. (pubmedcentralcanada.ca)
  • Chen CH, Albers JJ (1985) Activation of lecithin:cholesterol acyltransferase by apolipoproteins E-2, E-3, and AIV isolated from human plasma. (springer.com)
  • LDL-cholesterol (LDL- C), apolipoproteins (apo) B, CIII, and E, and by decreased levels of HDL-cholesterol (HDL-C), apoA-I, and lecithin:cholesterol acyltransferase (LCAT) activity. (tudelft.nl)
  • The analyst should use the special sampling weights in this file to analyze Apolipoprotein B (ApoB). (cdc.gov)
  • Here we show that increased hepatic sortilin not only reduced hepatic apolipoprotein B (APOB) secretion, but also increased LDL catabolism, and that both effects were dependent on intact lysosomal targeting. (jci.org)
  • Birmingham, AL), developer of the VAP Cholesterol Test, announced it has received a patent on its method to derive and report apolipoprotein B100 (apoB) using the Vertical Auto Profile (VAP) technology. (thefreedictionary.com)
  • Recently, we have reported that serum apolipoprotein (apo)AI and apoB levels were strongly associated with the presence and severity of diabetic retinopathy ( 1 ), and these associations were more prominent than those of traditional lipids (e.g., total cholesterol). (diabetesjournals.org)
  • However, Cox proportional hazards models with quartiles of each variable adjusted for confounders and hs-CRP or IL-6 identified apolipoprotein (apo)B-to-apoA-I ratio (apoB/apoA-I) and oxidized HDL, but not apoA-I or apoA-II, as independent risk factors for composite CVD events. (unboundmedicine.com)
  • Aldehyde-modified peptide sequences in apolipoprotein B-100 (apoB-100) are major targets for these immune responses. (ahajournals.org)
  • 2,3 The LDL protein apolipoprotein B-100 (apoB-100) is degraded, and aldehydes bind to free amino groups on the peptide fragments. (ahajournals.org)
  • Apolipoprotein M (apoM) participates in the lipid metabolism and exhibit anti‑atherosclerotic functions and it is presented in high-density lipoprotein (HDL), low-density lipoprotein (LDL) and very low-density lipoprotein (VLDL). (wikipedia.org)
  • Apolipoproteins regulate lipid metabolism, adipose tissue, and energy production and serve major regulatory roles in both pre- and pro-atherosclerotic mechanisms. (springer.com)
  • Lipoprotein (a) and Low-density lipoprotein apolipoprotein B metabolism following apheresis in patients with elevated lipoprotein(a) and coronary artery disease. (harvard.edu)
  • Kei AA, Filippatos TD, Tsimihodimos V, Elisaf MS. A review of the role of apolipoprotein C-II in lipoprotein metabolism and cardiovascular disease. (randox.com)
  • Apolipoprotein B100 metabolism in autosomal-dominant hypercholesterolemia related to mutations in PCSK9. (thefreedictionary.com)
  • Fidge NH (1980) The redistribution and metabolism of iodinated apolipoprotein AIV in rats. (springer.com)
  • The apolipoproteins dictate where the particles will dock and where they can bind, and in so doing the apolipoproteins regulate lipid metabolism in the body. (labce.com)
  • Ajeganova S, Ehrnfelt C, Alizadeh R, Rohani M, Jogestrand T, Hafström I et al (2011) Longitudinal levels of apolipoproteins and antibodies against phosphorylcholine are independently associated with carotid artery atherosclerosis 5 years after rheumatoid arthritis onset-a prospective cohort study. (springer.com)
  • Eo HS, Lee KB, Kim AK, Kim MH, Kim DH, Kim DI (2011) Association with inflammatory cells and apolipoproteins to the progression of atherosclerosis. (springer.com)
  • Garber DW, Handattu SP, Datta G, Mishra VK, Gupta H, White CR et al (2006) Atherosclerosis and vascular disease: effects of peptide mimetics of apolipoproteins. (springer.com)
  • Horejsi B, Ceska R (2000) Apolipoproteins and atherosclerosis. (springer.com)
  • Apolipoprotein E and apolipoprotein(a) as candidate genes of premature development of atherosclerosis. (springer.com)
  • Seishima M (2016) Physiological function of apolipoproteins and atherosclerosis. (springer.com)
  • Zivanovic Z, Divjak I, Jovicevic M, Rabi-Zikic T, Radovanovic B, Ruzicka-Kaloci S et al (2018) Association between apolipoproteins AI and B and ultrasound indicators of carotid atherosclerosis. (springer.com)
  • Avogaro P, Bittolo-Bon G, Cazzolato G, Quinci GB (1979) Are apolipoproteins better discriminators than lipids for atherosclerosis? (springer.com)
  • Human apolipoprotein A-I-derived amyloid: its association with atherosclerosis. (sigmaaldrich.com)
  • Apolipoprotein E polymorphism and atherosclerosis. (ahajournals.org)
  • Hyperinsulinemia does not change atherosclerosis development in apolipoprotein E null mice. (biomedsearch.com)
  • Apolipoprotein B100 (apoB100) is a protein that plays a role in moving cholesterol around your body. (medlineplus.gov)
  • Serum apolipoprotein A1 (APO-A1), apolipoprotein B100 (APO-B100) and lipoprotein-(a) (LPA) were measured in the Pathology Laboratories of Postgraduate Lady Reading Hospital, Peshawar using turbiditrimetric kits of Roche Diagnostics, on chemistry auto analyzer, modular P-800 by Roche, Cobas (Japan). (thefreedictionary.com)
  • This could explain reduced capacity of the liver to synthesize apolipoprotein B100 (ApoB100). (thefreedictionary.com)
  • Apolipoprotein B100 (Apo B) molecule is present in all major atherogenic particles (VLDL, IDL, LDL). (thefreedictionary.com)
  • At the end of 12 weeks, total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), very-low-density lipoprotein cholesterol (VLDL-C), and apolipoprotein B100 (Apo B100) were significantly lower in the soy nut group compared with the control group. (thefreedictionary.com)
  • Association of high-density lipoprotein cholesterol with incident cardiovascular events in women, by low-density lipoprotein cholesterol and apolipoprotein B100 Levels: a cohort study. (thefreedictionary.com)
  • Is vitellogenin an ancestor of apolipoprotein B100 of human low-density lipoprotein and human lipoprotein lipase? (thefreedictionary.com)
  • Although apolipoprotein B100 (ApoB100) plays a key role in peripheral fat deposition, it is not considered a suitable therapeutic target in obesity. (portlandpress.com)
  • Apolipoprotein L1 (apoL1) is a minor apoprotein component of HDL (High-density lipoprotein) or 'good cholesterol' which is synthesized in the liver and also in many other tissues, including pancreas, kidney, and brain. (wikipedia.org)
  • The Ratio of High-Density Lipoprotein Cholesterol to Apolipoprotein A-I Predicts Myocardial Injury Following Elective Percutaneous Coronary Intervention. (medscape.com)
  • Apolipoprotein D (Apo-D) is a component of high-density lipoprotein that has no marked similarity to other apolipoprotein sequences. (wikidoc.org)
  • In the presence of monensin (an inhibitor of protein secretion), the cells secrete cholesterol, but little apolipoprotein E. After secretion, apolipoprotein E and cholesterol associate with high-density lipoprotein to form a particle that can deliver cholesterol to the liver by receptor-mediated endocytosis. (sciencemag.org)
  • Hazard ratios (HRs), adjusted for several conventional factors, were calculated for 1-SD higher values: 0.52 loge triglyceride, 15 mg/dL high-density lipoprotein cholesterol (HDL-C), 43 mg/dL non-HDL-C, 29 mg/dL apolipoprotein AI, 29 mg/dL apolipoprotein B, and 33 mg/dL directly measured low-density lipoprotein cholesterol (LDL-C). Within-study regression analyses were adjusted for within-person variation and combined using meta-analysis. (pubmedcentralcanada.ca)
  • 1 , 2 Expert opinion is divided about whether assessment of apolipoprotein AI (apo AI) and apolipoprotein B (apo B) should replace assessment of high-density lipoprotein cholesterol (HDL-C) and total cholesterol levels in assessment of vascular risk. (pubmedcentralcanada.ca)
  • Apolipoproteins are associated with survival among patients on hemodialysis (HD), but these associations might be influenced by dysfunctional (oxidized) high-density lipoprotein (HDL). (unboundmedicine.com)
  • Apolipoprotein levels and ratios are more significant than LDL cholesterol levels in the prediction of fatal myocardial infarction. (greenmedinfo.com)
  • The proband, a 65-year-old woman, had greatly diminished concentrations of serum HDL cholesterol (0.19 mmol/L) and apolipoprotein (apo) A-I (21.9 mg/dL). (ahajournals.org)
  • Plasma apolipoprotein E phenotypes modulate lipoprotein concentrations, particularly that of low density lipoprotein cholesterol. (bmj.com)
  • These complex molecules have a "shell" composed of cholesterol, phospholipids, and apolipoproteins, and a core with the transport material: cholesterol esters and triglycerides (see Figure 1). (taconic.com)
  • Apolipoproteins are protein-lipid complexes that bind oil-soluble substances such as fat and cholesterol. (taconic.com)
  • Apolipoprotein A is a protein carried in HDL ("good") cholesterol. (ahealthyme.com)
  • Although apolipoprotein A levels can be measured, it's more common to measure the HDL and LDL ("bad") cholesterol when looking at cardiovascular risk. (ahealthyme.com)
  • Cholesterol-loaded macrophages secrete cholesterol and apolipoprotein E. The current studies show that this secretion occurs by two independent pathways. (sciencemag.org)
  • In the absence of serum, the cells secrete apolipoprotein E, but not cholesterol. (sciencemag.org)
  • We conclude that apolipoprotein E does not function to remove cholesterol from macrophages but rather to participate in "reverse cholesterol transport. (sciencemag.org)
  • Lipid assessment in vascular disease can be simplified by measurement of either total and HDL cholesterol levels or apolipoproteins without the need to fast and without regard to triglyceride. (pubmedcentralcanada.ca)
  • Xu, Nilsson-Ehle, Ahrén: Correlation of apolipoprotein M with leptin and cholesterol in normal and obese subjects. (antikoerper-online.de)
  • Despite the hyperinsulinemia, atherosclerotic lesion size was not different between the 2 groups at time points up to 52 weeks of age when measured as en face lesion area in the aorta, cross-sectional plaque area in the aortic sinus, and cholesterol abundance in the brachiocephalic artery. (biomedsearch.com)
  • Apolipoprotein D (apoD) is a soluble carrier protein of lipophilic molecules in neurons and glial cells within the central and peripheral nervous system and apoD can also modulate the stability and oxidation status of these molecules. (wikipedia.org)
  • On www.antibodies-online.com are 116 Apolipoprotein D (APOD) Antibodies from 22 different suppliers available. (antibodies-online.com)
  • Apolipoprotein CII (apoCII) is a protein found in large fat particles that the gastrointestinal tract absorbs. (medlineplus.gov)
  • Apolipoproteins function in lipid transport as structural components of lipoprotein particles, cofactors for enzymes and ligands for cell-surface receptors. (ebi.ac.uk)
  • Apolipoproteins have important structural and functional roles in several lipoprotein particles. (springer.com)
  • The apolipoproteins act as stabilizers of the intact lipoprotein particles. (abcam.com)
  • In addition, quantitative immunological measurements of certain apolipoproteins (especially A-1 and B) have been suggested to be more accurate estimators of coronary heart disease than measurements of lipoprotein particles (especially HDL and LDL). (abcam.com)
  • It does not interchange between lipoprotein particles, as do the other apolipoproteins, and it is found in IDL and LDL after the removal of the Apo-A, E, and C. Apo-B48 is present in chylomicrons and their remnants. (sigmaaldrich.com)
  • Antibodies directed against murine Apolipoprotein AI and human low-density lipoprotein (LDL) particles specifically immunoprecipitated metabolically labelled radioactive apolipoproteins from the culture supernatant of 10.5 days post coitum (days p.c.) yolk sac visceral endoderm cultured in vitro. (nih.gov)
  • Verghese, P. B., Castellano, J. M. & Holtzman, D. M. Apolipoprotein E in Alzheimer's disease and other neurological disorders. (nature.com)
  • Elevated IgM against Nε-(Carboxyethyl)lysine-modified Apolipoprotein A1 peptide 141-147 in Taiwanese with Alzheimer's disease. (nih.gov)
  • To determine the association between the e4 allele of apolipoprotein E and Alzheimer's disease in a randomly selected population sample. (bmj.com)
  • The prevalence of Alzheimer's disease was 2.9% in subjects with no e4 alleles, 7.6% in subjects with one e4 allele, and 21.4% in subjects with two e4 alleles of apolipoprotein E. (bmj.com)
  • Allele e4 of apolipoprotein is associated with Alzheimer's disease in a dose-response fashion in a randomly selected elderly population. (bmj.com)
  • RF 1-2* Evidence is accumulating that apolipoprotein E is important in late onset Alzheimer's disease. (bmj.com)
  • The first evidence that e4 allele of apolipoprotein E could be associated with Alzheimer's disease was published by Pericak-Vance et al. (bmj.com)
  • All the studies that have investigated the relation between apolipoprotein E polymorphism and Alzheimer's disease have included highly selected patients and corresponding controls. (bmj.com)
  • TY - JOUR T1 - Apolipoprotein epsilon4 and neuropsychological performance in Alzheimer's disease and vascular dementia. (unboundmedicine.com)
  • The method developed for apolipoprotein E genotyping is accurate and reliable, and also suitable for genotyping large samples, which may help determine the role of the apolipoprotein E ε4 allele in neural regeneration in late-onset Alzheimer's disease cases. (bio-medicine.org)
  • Increased level of MSU crystal-bound protein apolipoprotein A-I in acute gouty arthritis. (medscape.com)
  • Apolipoprotein E is a fat-binding protein ( apolipoprotein ) that is part of the chylomicron and intermediate-density lipoprotein (IDLs) . (wikidoc.org)
  • Familial apolipoprotein CII deficiency is a very rare (rarer than LPL deficiency) autosomal recessive disorder in which apolipoprotein CII (apoC-II), a cofactor for LPL, is absent, the clearance of chylomicrons from the blood is greatly impaired and triglycerides (TG) accumulate in the plasma. (renalandurologynews.com)
  • In an immunochemical reaction, Apolipoprotein B in the human serum sample form immune complexes with specific antibodies. (cdc.gov)
  • Immunohistochemical staining at sectioned 10.5 days p.c. embryos with anti-Apolipoprotein AI antibodies revealed specific localization of immunoreactive material in the yolk sac visceral endoderm. (nih.gov)
  • Anti-apolipoprotein antibodies have been used for indirect trapping ELISA for quantitation of antigen in serum using a standard curve, for immunoprecipitation and for western blotting for highly sensitive qualitative analysis. (rockland-inc.com)
  • Specific cross reaction of anti-apoLipoprotein antibodies with antigens from other species has not been determined. (rockland-inc.com)
  • Primary structure of the bovine analogues to human apolipoproteins CII and CIII. (wikipedia.org)
  • Apolipoprotein E genotyping is crucial to apolipoprotein E polymorphism analysis. (bio-medicine.org)
  • Peripheral venous blood is the conventional tissue source for apolipoprotein E genotyping polymorphism analysis. (bio-medicine.org)
  • Apolipoprotein F (apoF) is one of the minor apolipoprotein in blood plasma and it is a lipid transfer inhibit protein to inhibit cholesteryl ester transfer protein-mediated transfers of cholesteryl esters and triglycerides. (wikipedia.org)
  • The present invention relates to methods of use of phosphonate-phosphates and diphosphonates to modulate apolipoprotein E levels and the use of such compounds in therapy, including cardiovascular and neurological disease states. (freepatentsonline.com)
  • Global Structure and Dynamics of Human Apolipoprotein CII in Complex with Micelles: Evidence for Increased Mobility of the Helix Involved in the Activation of Lipoprotein Lipase. (randox.com)
  • Title: The relationship between apolipoprotein genes polymorphisms and susceptibility to osteonecrosis of the femoral head: a meta-analysis. (nih.gov)
  • INTRODUCTION: Genetic polymorphisms in apolipoprotein genes may be associated with alteration in lipid profile and susceptibility to gallstone disease. (hindawi.com)
  • Herein, we describe a highly robust and quantitative method using liquid chromatography coupled to tandem mass spectrometry to quantify apolipoproteins in plasma. (springer.com)
  • This methodology may add clinical value for profiling cardiovascular risk in vulnerable individuals and enable monitoring of apolipoprotein levels in plasma following intervention strategies. (springer.com)
  • OBJECTIVE To determine plasma apolipoprotein A-IV (apoA-IV) levels and phenotype distribution in non-insulin-dependent diabetes mellitus (NIDDM) patients and to analyze the influence of apoA-IV phenotype on lipid profiles in NIDDM. (diabetesjournals.org)
  • The determination of the circulating levels of apolipoproteins has become common practice in clinical laboratories, in view of the apparent correlation between levels of specific apolipoproteins and increased or decreased cardiovascular risk [1, 2]. (springer.com)
  • Hundreds of genetic polymorphisms of the apolipoproteins have been described, and many of them alter their structure and function. (wikipedia.org)
  • However, most apolipoproteins cannot be detected using standard clinical immunoassays, and multiplexing is not available for some species of apolipoproteins. (springer.com)
  • Our Apolipoprotein L2 Lysates can be used in a variety of model species. (novusbio.com)
  • Our Apolipoprotein C1 ELISA Kits can be used in a variety of model species: Human. (novusbio.com)
  • Contributions of domain structure and lipid interaction to the functionality of exchangeable human apolipoproteins. (ebi.ac.uk)
  • Deficiency of apoC-II can also be verified by gel electrophoresis of the apolipoproteins contained in VLDL and chylomicrons on 2D gels. (renalandurologynews.com)
  • Large deletion in APOC2 caused by Alu-Alu homologous recombination is associated with with apolipoprotein C-II deficiency. (antibodies-online.com)
  • Structure of a biologically active fragment of human serum apolipoprotein C-II in the presence of sodium dodecyl sulfate and dodecylphosphocholine. (randox.com)
  • Kukita M, Hiwada K, Kokubu T (1984) Serum apolipoprotein A-I, A-II and B levels and their discriminative values in relatives of patients with coronary artery disease. (springer.com)
  • Serum apolipoprotein (apo)AI and -B have been shown to be associated with diabetic retinopathy, but the underlying mechanisms are unclear. (diabetesjournals.org)
  • Apply their overview of the roles of specific apolipoproteins in the brain to physiological and pathophysiological processes. (cyberounds.com)
  • Vlad C, Burlacu A, Florea L, Artene B, Badarau S, Covic A et al (2019) A comprehensive review on apolipoproteins as nontraditional cardiovascular risk factors in end-stage renal disease: current evidence and perspectives. (springer.com)
  • Apolipoprotein A-I Increases Insulin Secretion and Production From Pancreatic ß-Cells via a G-Protein-cAMP-PKA-FoxO1-Dependent Mechanism. (medscape.com)
  • Nonhereditary apolipoprotein A-I (apoA-I) amyloid is characterized by deposits of nonvariant protein in atherosclerotic arteries. (sigmaaldrich.com)
  • However, because of their detergent-like (amphipathic) properties, apolipoproteins and other amphipathic molecules (such as phospholipids) can surround the lipids, creating a lipoprotein particle that is itself water-soluble, and can thus be carried through water-based circulation (i.e., blood, lymph). (wikipedia.org)
  • Nevertheless, due to of their amphipathic/detergent like characteristics, Apolipoproteins fence in the lipids, forming a lipoprotein particle which is soluble in water, hence travel in blood. (prospecbio.com)
  • Anti-Apolipoprotein J Antibody is useful for researchers interested in the immune system, Ubiquitin pathways, and cardiovascular research. (rockland-inc.com)
  • 1990) Lipid and apolipoprotein in cord blood. (springer.com)
  • 1990). "Apolipoprotein D is the major protein component in cyst fluid from women with human breast gross cystic disease" . (wikidoc.org)
  • We have discovered that natural variant versions of Apolipoprotein L1 (APOL1) that protect humans against infection by the parasite Trypanosoma rhodesiense (responsible for sleeping sickness) also cause kidney disease. (europa.eu)
  • The protein encoded by APOM is an apolipoprotein and member of the lipocalin protein family. (antikoerper-online.de)
  • Duan, Dahlbäck, Villoutreix: Proposed lipocalin fold for apolipoprotein M based on bioinformatics and site-directed mutagenesis. (antikoerper-online.de)
  • Pechlaner R, Tsimikas S, Yin X, Willeit P, Baig F, Santer P et al (2017) Very-low-density lipoprotein-associated apolipoproteins predict cardiovascular events and are lowered by inhibition of APOC-III. (springer.com)
  • Association Between ApoA-I (Apolipoprotein A-I) Immune Complexes and Adverse Cardiovascular Events. (medscape.com)
  • encoded search term (How are specimens collected and prepared for apolipoprotein A-I (Apo-A1) testing? (medscape.com)
  • Your search returned 60 Apolipoprotein A-IV ELISA ELISA Kit across 1 supplier. (biocompare.com)
  • Your search returned 1 apolipoprotein B mRNA editing enzyme catalytic subunit 2 ELISA ELISA Kit across 1 supplier. (biocompare.com)
  • Minor apolipoprotein mainly associated with HDL and to a lesser extent with VLDL. (abcam.com)
  • Apolipoprotein E2 (apoE2)-associated hyperlipidemia is characterized by a disturbed clearance of apoE2-enriched VLDL remnants. (tudelft.nl)
  • The agent blocks the function of the mRNA of apolipoprotein C3 and successfully treats severe hypertriglyceridaemia in phase 3 trials (Ionis Pharmaceuticals). (ovid.com)
  • Fibrinogen alpha chain precursor and apolipoprotein a-I in urine as biomarkers for noninvasive diagnosis of calcium oxalate nephrolithiasis: a proteomics study. (medscape.com)
  • Selenium has a positive effect on apolipoprotein B expression in hypercholesterolemia. (greenmedinfo.com)