Apolipoproteins B: Major structural proteins of triacylglycerol-rich LIPOPROTEINS. There are two forms, apolipoprotein B-100 and apolipoprotein B-48, both derived from a single gene. ApoB-100 expressed in the liver is found in low-density lipoproteins (LIPOPROTEINS, LDL; LIPOPROTEINS, VLDL). ApoB-48 expressed in the intestine is found in CHYLOMICRONS. They are important in the biosynthesis, transport, and metabolism of triacylglycerol-rich lipoproteins. Plasma Apo-B levels are high in atherosclerotic patients but non-detectable in ABETALIPOPROTEINEMIA.Apolipoproteins: Protein components on the surface of LIPOPROTEINS. They form a layer surrounding the hydrophobic lipid core. There are several classes of apolipoproteins with each playing a different role in lipid transport and LIPID METABOLISM. These proteins are synthesized mainly in the LIVER and the INTESTINES.Apolipoproteins A: Structural proteins of the alpha-lipoproteins (HIGH DENSITY LIPOPROTEINS), including APOLIPOPROTEIN A-I and APOLIPOPROTEIN A-II. They can modulate the activity of LECITHIN CHOLESTEROL ACYLTRANSFERASE. These apolipoproteins are low in atherosclerotic patients. They are either absent or present in extremely low plasma concentration in TANGIER DISEASE.Apolipoproteins C: A group of apolipoproteins that can readily exchange among the various classes of lipoproteins (HDL; VLDL; CHYLOMICRONS). After lipolysis of TRIGLYCERIDES on VLDL and chylomicrons, Apo-C proteins are normally transferred to HDL. The subtypes can modulate remnant binding to receptors, LECITHIN CHOLESTEROL ACYLTRANSFERASE, or LIPOPROTEIN LIPASE.Apolipoprotein C-III: A 9-kDa protein component of VERY-LOW-DENSITY LIPOPROTEINS and CHYLOMICRON REMNANTS. Apo C-III, synthesized in the liver, is an inhibitor of LIPOPROTEIN LIPASE. Apo C-III modulates the binding of chylomicron remnants and VLDL to receptors (RECEPTORS, LDL) thus decreases the uptake of triglyceride-rich particles by the liver cells and subsequent degradation. The normal Apo C-III is glycosylated. There are several polymorphic forms with varying amounts of SIALIC ACID (Apo C-III-0, Apo C-III-1, and Apo C-III-2).Apolipoprotein A-I: The most abundant protein component of HIGH DENSITY LIPOPROTEINS or HDL. This protein serves as an acceptor for CHOLESTEROL released from cells thus promoting efflux of cholesterol to HDL then to the LIVER for excretion from the body (reverse cholesterol transport). It also acts as a cofactor for LECITHIN CHOLESTEROL ACYLTRANSFERASE that forms CHOLESTEROL ESTERS on the HDL particles. Mutations of this gene APOA1 cause HDL deficiency, such as in FAMILIAL ALPHA LIPOPROTEIN DEFICIENCY DISEASE and in some patients with TANGIER DISEASE.Apolipoproteins E: A class of protein components which can be found in several lipoproteins including HIGH-DENSITY LIPOPROTEINS; VERY-LOW-DENSITY LIPOPROTEINS; and CHYLOMICRONS. Synthesized in most organs, Apo E is important in the global transport of lipids and cholesterol throughout the body. Apo E is also a ligand for LDL receptors (RECEPTORS, LDL) that mediates the binding, internalization, and catabolism of lipoprotein particles in cells. There are several allelic isoforms (such as E2, E3, and E4). Deficiency or defects in Apo E are causes of HYPERLIPOPROTEINEMIA TYPE III.Lipoproteins: Lipid-protein complexes involved in the transportation and metabolism of lipids in the body. They are spherical particles consisting of a hydrophobic core of TRIGLYCERIDES and CHOLESTEROL ESTERS surrounded by a layer of hydrophilic free CHOLESTEROL; PHOSPHOLIPIDS; and APOLIPOPROTEINS. Lipoproteins are classified by their varying buoyant density and sizes.Apolipoprotein A-II: The second most abundant protein component of HIGH DENSITY LIPOPROTEINS or HDL. It has a high lipid affinity and is known to displace APOLIPOPROTEIN A-I from HDL particles and generates a stable HDL complex. ApoA-II can modulate the activation of LECITHIN CHOLESTEROL ACYLTRANSFERASE in the presence of APOLIPOPROTEIN A-I, thus affecting HDL metabolism.Cholesterol: The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.TriglyceridesApolipoprotein C-II: A 9-kDa protein component of VERY-LOW-DENSITY LIPOPROTEINS. It contains a cofactor for LIPOPROTEIN LIPASE and activates several triacylglycerol lipases. The association of Apo C-II with plasma CHYLOMICRONS; VLDL, and HIGH-DENSITY LIPOPROTEINS is reversible and changes rapidly as a function of triglyceride metabolism. Clinically, Apo C-II deficiency is similar to lipoprotein lipase deficiency (HYPERLIPOPROTEINEMIA TYPE I) and is therefore called hyperlipoproteinemia type IB.Lipoproteins, HDL: A class of lipoproteins of small size (4-13 nm) and dense (greater than 1.063 g/ml) particles. HDL lipoproteins, synthesized in the liver without a lipid core, accumulate cholesterol esters from peripheral tissues and transport them to the liver for re-utilization or elimination from the body (the reverse cholesterol transport). Their major protein component is APOLIPOPROTEIN A-I. HDL also shuttle APOLIPOPROTEINS C and APOLIPOPROTEINS E to and from triglyceride-rich lipoproteins during their catabolism. HDL plasma level has been inversely correlated with the risk of cardiovascular diseases.Apolipoproteins D: A glycoprotein component of HIGH-DENSITY LIPOPROTEINS that transports small hydrophobic ligands including CHOLESTEROL and STEROLS. It occurs in the macromolecular complex with LECITHIN CHOLESTEROL ACYLTRANSFERASE. Apo D is expressed in and secreted from a variety of tissues such as liver, placenta, brain tissue and others.Apolipoprotein C-I: A 6.6-kDa protein component of VERY-LOW-DENSITY LIPOPROTEINS; INTERMEDIATE-DENSITY LIPOPROTEINS; and HIGH-DENSITY LIPOPROTEINS. Apo C-I displaces APO E from lipoproteins, modulate their binding to receptors (RECEPTORS, LDL), and thereby decrease their clearance from plasma. Elevated Apo C-I levels are associated with HYPERLIPOPROTEINEMIA and ATHEROSCLEROSIS.Lipoproteins, VLDL: A class of lipoproteins of very light (0.93-1.006 g/ml) large size (30-80 nm) particles with a core composed mainly of TRIGLYCERIDES and a surface monolayer of PHOSPHOLIPIDS and CHOLESTEROL into which are imbedded the apolipoproteins B, E, and C. VLDL facilitates the transport of endogenously made triglycerides to extrahepatic tissues. As triglycerides and Apo C are removed, VLDL is converted to INTERMEDIATE-DENSITY LIPOPROTEINS, then to LOW-DENSITY LIPOPROTEINS from which cholesterol is delivered to the extrahepatic tissues.Lipids: A generic term for fats and lipoids, the alcohol-ether-soluble constituents of protoplasm, which are insoluble in water. They comprise the fats, fatty oils, essential oils, waxes, phospholipids, glycolipids, sulfolipids, aminolipids, chromolipids (lipochromes), and fatty acids. (Grant & Hackh's Chemical Dictionary, 5th ed)Apolipoprotein B-100: A 513-kDa protein synthesized in the LIVER. It serves as the major structural protein of low-density lipoproteins (LIPOPROTEINS, LDL; LIPOPROTEINS, VLDL). It is the ligand for the LDL receptor (RECEPTORS, LDL) that promotes cellular binding and internalization of LDL particles.Apolipoprotein B-48: A 241-kDa protein synthesized only in the INTESTINES. It serves as a structural protein of CHYLOMICRONS. Its exclusive association with chylomicron particles provides an indicator of intestinally derived lipoproteins in circulation. Apo B-48 is a shortened form of apo B-100 and lacks the LDL-receptor region.Cholesterol, HDL: Cholesterol which is contained in or bound to high-density lipoproteins (HDL), including CHOLESTEROL ESTERS and free cholesterol.Lipoproteins, HDL3: Intermediate-density subclass of the high-density lipoproteins, with particle sizes between 7 to 8 nm. As the larger lighter HDL2 lipoprotein, HDL3 lipoprotein is lipid-rich.Tangier Disease: An autosomal recessively inherited disorder caused by mutation of ATP-BINDING CASSETTE TRANSPORTERS involved in cellular cholesterol removal (reverse-cholesterol transport). It is characterized by near absence of ALPHA-LIPOPROTEINS (high-density lipoproteins) in blood. The massive tissue deposition of cholesterol esters results in HEPATOMEGALY; SPLENOMEGALY; RETINITIS PIGMENTOSA; large orange tonsils; and often sensory POLYNEUROPATHY. The disorder was first found among inhabitants of Tangier Island in the Chesapeake Bay, MD.Phosphatidylcholine-Sterol O-Acyltransferase: An enzyme secreted from the liver into the plasma of many mammalian species. It catalyzes the esterification of the hydroxyl group of lipoprotein cholesterol by the transfer of a fatty acid from the C-2 position of lecithin. In familial lecithin:cholesterol acyltransferase deficiency disease, the absence of the enzyme results in an excess of unesterified cholesterol in plasma. EC 2.3.1.43.Lipoproteins, LDL: A class of lipoproteins of small size (18-25 nm) and light (1.019-1.063 g/ml) particles with a core composed mainly of CHOLESTEROL ESTERS and smaller amounts of TRIGLYCERIDES. The surface monolayer consists mostly of PHOSPHOLIPIDS, a single copy of APOLIPOPROTEIN B-100, and free cholesterol molecules. The main LDL function is to transport cholesterol and cholesterol esters to extrahepatic tissues.Nephelometry and Turbidimetry: Chemical analysis based on the phenomenon whereby light, passing through a medium with dispersed particles of a different refractive index from that of the medium, is attenuated in intensity by scattering. In turbidimetry, the intensity of light transmitted through the medium, the unscattered light, is measured. In nephelometry, the intensity of the scattered light is measured, usually, but not necessarily, at right angles to the incident light beam.ATP Binding Cassette Transporter 1: A superfamily of large integral ATP-binding cassette membrane proteins whose expression pattern is consistent with a role in lipid (cholesterol) efflux. It is implicated in TANGIER DISEASE characterized by accumulation of cholesteryl ester in various tissues.Cholesterol Esters: Fatty acid esters of cholesterol which constitute about two-thirds of the cholesterol in the plasma. The accumulation of cholesterol esters in the arterial intima is a characteristic feature of atherosclerosis.Isoelectric Focusing: Electrophoresis in which a pH gradient is established in a gel medium and proteins migrate until they reach the site (or focus) at which the pH is equal to their isoelectric point.Receptors, Lipoprotein: Cell surface proteins that bind lipoproteins with high affinity. Lipoprotein receptors in the liver and peripheral tissues mediate the regulation of plasma and cellular cholesterol metabolism and concentration. The receptors generally recognize the apolipoproteins of the lipoprotein complex, and binding is often a trigger for endocytosis.Lipid Metabolism: Physiological processes in biosynthesis (anabolism) and degradation (catabolism) of LIPIDS.Chylomicrons: A class of lipoproteins that carry dietary CHOLESTEROL and TRIGLYCERIDES from the SMALL INTESTINE to the tissues. Their density (0.93-1.006 g/ml) is the same as that of VERY-LOW-DENSITY LIPOPROTEINS.Cholesterol, LDL: Cholesterol which is contained in or bound to low density lipoproteins (LDL), including CHOLESTEROL ESTERS and free cholesterol.Phospholipids: Lipids containing one or more phosphate groups, particularly those derived from either glycerol (phosphoglycerides see GLYCEROPHOSPHOLIPIDS) or sphingosine (SPHINGOLIPIDS). They are polar lipids that are of great importance for the structure and function of cell membranes and are the most abundant of membrane lipids, although not stored in large amounts in the system.Ultracentrifugation: Centrifugation with a centrifuge that develops centrifugal fields of more than 100,000 times gravity. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Hypolipoproteinemias: Conditions with abnormally low levels of LIPOPROTEINS in the blood. This may involve any of the lipoprotein subclasses, including ALPHA-LIPOPROTEINS (high-density lipoproteins); BETA-LIPOPROTEINS (low-density lipoproteins); and PREBETA-LIPOPROTEINS (very-low-density lipoproteins).Lipoproteins, HDL2: Low-density subclass of the high-density lipoproteins, with particle sizes between 8 to 13 nm.Lipoprotein(a): A lipoprotein that resembles the LOW-DENSITY LIPOPROTEINS but with an extra protein moiety, APOPROTEIN (A) also known as APOLIPOPROTEIN (A), linked to APOLIPOPROTEIN B-100 on the LDL by one or two disulfide bonds. High plasma level of lipoprotein (a) is associated with increased risk of atherosclerotic cardiovascular disease.Lymph: The interstitial fluid that is in the LYMPHATIC SYSTEM.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Apoproteins: The protein components of a number of complexes, such as enzymes (APOENZYMES), ferritin (APOFERRITINS), or lipoproteins (APOLIPOPROTEINS).Hyperlipidemias: Conditions with excess LIPIDS in the blood.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Immunodiffusion: Technique involving the diffusion of antigen or antibody through a semisolid medium, usually agar or agarose gel, with the result being a precipitin reaction.Lipoprotein Lipase: An enzyme of the hydrolase class that catalyzes the reaction of triacylglycerol and water to yield diacylglycerol and a fatty acid anion. The enzyme hydrolyzes triacylglycerols in chylomicrons, very-low-density lipoproteins, low-density lipoproteins, and diacylglycerols. It occurs on capillary endothelial surfaces, especially in mammary, muscle, and adipose tissue. Genetic deficiency of the enzyme causes familial hyperlipoproteinemia Type I. (Dorland, 27th ed) EC 3.1.1.34.Triolein: (Z)-9-Octadecenoic acid 1,2,3-propanetriyl ester.Hyperlipoproteinemia Type IV: A hypertriglyceridemia disorder, often with autosomal dominant inheritance. It is characterized by the persistent elevations of plasma TRIGLYCERIDES, endogenously synthesized and contained predominantly in VERY-LOW-DENSITY LIPOPROTEINS (pre-beta lipoproteins). In contrast, the plasma CHOLESTEROL and PHOSPHOLIPIDS usually remain within normal limits.Phosphatidylcholines: Derivatives of phosphatidic acids in which the phosphoric acid is bound in ester linkage to a choline moiety. Complete hydrolysis yields 1 mole of glycerol, phosphoric acid and choline and 2 moles of fatty acids.Kinetics: The rate dynamics in chemical or physical systems.ATP-Binding Cassette Transporters: A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.Hyperlipoproteinemias: Conditions with abnormally elevated levels of LIPOPROTEINS in the blood. They may be inherited, acquired, primary, or secondary. Hyperlipoproteinemias are classified according to the pattern of lipoproteins on electrophoresis or ultracentrifugation.Apolipoprotein E3: A 34-kDa glycosylated protein. A major and most common isoform of apolipoprotein E. Therefore, it is also known as apolipoprotein E (ApoE). In human, Apo E3 is a 299-amino acid protein with a cysteine at the 112 and an arginine at the 158 position. It is involved with the transport of TRIGLYCERIDES; PHOSPHOLIPIDS; CHOLESTEROL; and CHOLESTERYL ESTERS in and out of the cells.Chemistry, Clinical: The specialty of ANALYTIC CHEMISTRY applied to assays of physiologically important substances found in blood, urine, tissues, and other biological fluids for the purpose of aiding the physician in making a diagnosis or following therapy.Cholesterol, VLDL: Cholesterol which is contained in or bound to very low density lipoproteins (VLDL). High circulating levels of VLDL cholesterol are found in HYPERLIPOPROTEINEMIA TYPE IIB. The cholesterol on the VLDL is eventually delivered by LOW-DENSITY LIPOPROTEINS to the tissues after the catabolism of VLDL to INTERMEDIATE-DENSITY LIPOPROTEINS, then to LDL.Hypertriglyceridemia: A condition of elevated levels of TRIGLYCERIDES in the blood.Cholesterol Ester Transfer Proteins: Proteins that bind to and transfer CHOLESTEROL ESTERS between LIPOPROTEINS such as LOW-DENSITY LIPOPROTEINS and HIGH-DENSITY LIPOPROTEINS.Lipoproteins, IDL: A mixture of very-low-density lipoproteins (VLDL), particularly the triglyceride-poor VLDL, with slow diffuse electrophoretic mobilities in the beta and alpha2 regions which are similar to that of beta-lipoproteins (LDL) or alpha-lipoproteins (HDL). They can be intermediate (remnant) lipoproteins in the de-lipidation process, or remnants of mutant CHYLOMICRONS and VERY-LOW-DENSITY LIPOPROTEINS which cannot be metabolized completely as seen in FAMILIAL DYSBETALIPOPROTEINEMIA.Reference Values: The range or frequency distribution of a measurement in a population (of organisms, organs or things) that has not been selected for the presence of disease or abnormality.Scavenger Receptors, Class B: A family of scavenger receptors that are predominately localized to CAVEOLAE of the PLASMA MEMBRANE and bind HIGH DENSITY LIPOPROTEINS.Freeze Drying: Method of tissue preparation in which the tissue specimen is frozen and then dehydrated at low temperature in a high vacuum. This method is also used for dehydrating pharmaceutical and food products.Ethinyl Estradiol: A semisynthetic alkylated ESTRADIOL with a 17-alpha-ethinyl substitution. It has high estrogenic potency when administered orally, and is often used as the estrogenic component in ORAL CONTRACEPTIVES.Particle Size: Relating to the size of solids.Immunoassay: A technique using antibodies for identifying or quantifying a substance. Usually the substance being studied serves as antigen both in antibody production and in measurement of antibody by the test substance.Serum Amyloid A Protein: An ACUTE PHASE REACTION protein present in low concentrations in normal sera, but found at higher concentrations in sera of older persons and in patients with AMYLOIDOSIS. It is the circulating precusor of amyloid A protein, which is found deposited in AA type AMYLOID FIBRILS.Dietary Fats: Fats present in food, especially in animal products such as meat, meat products, butter, ghee. They are present in lower amounts in nuts, seeds, and avocados.Microscopy, Electron: Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.Immunoelectrophoresis: A technique that combines protein electrophoresis and double immunodiffusion. In this procedure proteins are first separated by gel electrophoresis (usually agarose), then made visible by immunodiffusion of specific antibodies. A distinct elliptical precipitin arc results for each protein detectable by the antisera.Hyperlipoproteinemia Type V: A severe type of hyperlipidemia, sometimes familial, that is characterized by the elevation of both plasma CHYLOMICRONS and TRIGLYCERIDES contained in VERY-LOW-DENSITY LIPOPROTEINS. Type V hyperlipoproteinemia is often associated with DIABETES MELLITUS and is not caused by reduced LIPOPROTEIN LIPASE activity as in HYPERLIPOPROTEINEMIA TYPE I .Abetalipoproteinemia: An autosomal recessive disorder of lipid metabolism. It is caused by mutation of the microsomal triglyceride transfer protein that catalyzes the transport of lipids (TRIGLYCERIDES; CHOLESTEROL ESTERS; PHOSPHOLIPIDS) and is required in the secretion of BETA-LIPOPROTEINS (low density lipoproteins or LDL). Features include defective intestinal lipid absorption, very low serum cholesterol level, and near absent LDL.Dimyristoylphosphatidylcholine: A synthetic phospholipid used in liposomes and lipid bilayers for the study of biological membranes.Receptors, Scavenger: A large group of structurally diverse cell surface receptors that mediate endocytic uptake of modified LIPOPROTEINS. Scavenger receptors are expressed by MYELOID CELLS and some ENDOTHELIAL CELLS, and were originally characterized based on their ability to bind acetylated LOW-DENSITY LIPOPROTEINS. They can also bind a variety of other polyanionic ligand. Certain scavenger receptors can internalize micro-organisms as well as apoptotic cells.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Oleic Acid: An unsaturated fatty acid that is the most widely distributed and abundant fatty acid in nature. It is used commercially in the preparation of oleates and lotions, and as a pharmaceutical solvent. (Stedman, 26th ed)Chromatography, Gel: Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.Molecular Weight: The sum of the weight of all the atoms in a molecule.Arteriosclerosis: Thickening and loss of elasticity of the walls of ARTERIES of all sizes. There are many forms classified by the types of lesions and arteries involved, such as ATHEROSCLEROSIS with fatty lesions in the ARTERIAL INTIMA of medium and large muscular arteries.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Lipolysis: The metabolic process of breaking down LIPIDS to release FREE FATTY ACIDS, the major oxidative fuel for the body. Lipolysis may involve dietary lipids in the DIGESTIVE TRACT, circulating lipids in the BLOOD, and stored lipids in the ADIPOSE TISSUE or the LIVER. A number of enzymes are involved in such lipid hydrolysis, such as LIPASE and LIPOPROTEIN LIPASE from various tissues.Sterol O-Acyltransferase: An enzyme that catalyzes the formation of cholesterol esters by the direct transfer of the fatty acid group from a fatty acyl CoA derivative. This enzyme has been found in the adrenal gland, gonads, liver, intestinal mucosa, and aorta of many mammalian species. EC 2.3.1.26.Rats, Inbred Strains: Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.Callitrichinae: A subfamily in the family CEBIDAE that consists of four genera: CALLITHRIX (marmosets), CALLIMICO (Goeldi's monkey), LEONTOPITHECUS (lion tamarins), and SAGUINUS (long-tusked tamarins). The members of this family inhabit the tropical forests of South and Central America.High-Density Lipoproteins, Pre-beta: A highly dense subclass of the high-density lipoproteins, with particle sizes below 7 nm. They are also known as nascent HDL, composed of a few APOLIPOPROTEIN A-I molecules which are complexed with PHOSPHOLIPIDS. The lipid-poor pre-beta-HDL particles serve as progenitors of HDL3 and then HDL2 after absorption of free cholesterol from cell membranes, cholesterol esterification, and acquisition of apolipoproteins A-II, Cs, and E. Pre-beta-HDL initiate the reverse cholesterol transport process from cells to liver.Lipase: An enzyme of the hydrolase class that catalyzes the reaction of triacylglycerol and water to yield diacylglycerol and a fatty acid anion. It is produced by glands on the tongue and by the pancreas and initiates the digestion of dietary fats. (From Dorland, 27th ed) EC 3.1.1.3.Liposomes: Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.Receptors, LDL: Receptors on the plasma membrane of nonhepatic cells that specifically bind LDL. The receptors are localized in specialized regions called coated pits. Hypercholesteremia is caused by an allelic genetic defect of three types: 1, receptors do not bind to LDL; 2, there is reduced binding of LDL; and 3, there is normal binding but no internalization of LDL. In consequence, entry of cholesterol esters into the cell is impaired and the intracellular feedback by cholesterol on 3-hydroxy-3-methylglutaryl CoA reductase is lacking.Oleic Acids: A group of fatty acids that contain 18 carbon atoms and a double bond at the omega 9 carbon.

Serum triglyceride: a possible risk factor for ruptured abdominal aortic aneurysm. (1/2985)

BACKGROUND: We aimed to determine the relationship between ruptured abdominal aortic aneurysm (AAA) and serum concentrations of lipids and apolipoproteins. METHODS: A cohort of 21 520 men, aged 35-64 years, was recruited from men attending the British United Provident Association (BUPA) clinic in London for a routine medical examination in 1975-1982. Smoking habits, weight, height and blood pressure were recorded at entry. Lipids and apolipoproteins were measured in stored serum samples from the 30 men who subsequently died of ruptured AAA and 150 matched controls. RESULTS: Triglyceride was strongly related to risk of ruptured AAA. In univariate analyses the risk in men on the 90th centile of the distribution relative to the risk in men on the 10th (RO10-90) was 12 (95% confidence interval [CI] : 3.8-37) for triglyceride, 5.5 (95% CI: 1.8-17) for apolipoprotein B (apoB) (the protein component of low density lipoprotein [LDL]), 0.15 (95% CI : 0.04-0.56) for apo A1 (the protein component of high density lipoprotein [HDL]), 3.7 (95% CI: 1.4-9.4) for body mass index and 3.0 (95% CI: 1.1-8.5) for systolic blood pressure. Lipoprotein (a) (Lp(a)) was not a significant risk factor (RO10-90 = 1.6, 95% CI: 0.6-3.0). In multivariate analysis triglyceride retained its strong association. CONCLUSION: Triglyceride appears to be a strong risk factor for ruptured AAA, although further studies are required to clarify this. If this and other associations are cause and effect, then changing the distribution of risk factors in the population (by many people stopping smoking and adopting a lower saturated fat diet and by lowering blood pressure) could achieve an important reduction in mortality from ruptured AAA.  (+info)

Association of the inflammatory state in active juvenile rheumatoid arthritis with hypo-high-density lipoproteinemia and reduced lipoprotein-associated platelet-activating factor acetylhydrolase activity. (2/2985)

OBJECTIVE: To investigate the relationship between the quantitative and qualitative abnormalities of apolipoprotein B (Apo B)- and Apo A-I-containing lipoproteins and between lipoprotein-associated platelet-activating factor acetylhydrolase (PAF-AH) activity in patients with juvenile rheumatoid arthritis (JRA) as a function of the inflammatory state. METHODS: Twenty-six JRA patients and 22 age- and sex-matched control subjects with normal lipid levels participated in the study. Fourteen patients had active disease, and 12 had inactive disease. Plasma lipoproteins were fractionated by gradient ultracentrifugation into 9 subfractions, and their chemical composition and mass were determined. The PAF-AH activity associated with lipoprotein subfractions and the activity in plasma were also measured. RESULTS: Patients with active JRA had significantly lower plasma total cholesterol and high-density lipoprotein (HDL) cholesterol levels as compared with controls, due to the decrease in the mass of both the HDL2 and HDL3 subfractions. Patients with active JRA also had higher plasma triglyceride levels, mainly due to the higher triglyceride content of the very low-density lipoprotein plus the intermediate-density lipoprotein subfraction. The plasma PAF-AH activity in patients with active JRA was lower than that in controls, mainly due to the decrease in PAF-AH activity associated with the intermediate and dense low-density lipoprotein subclasses. The lipid abnormalities and the reduction in plasma PAF-AH activity were significantly correlated with plasma C-reactive protein levels and were not observed in patients with inactive JRA. CONCLUSION: This is the first study to show that patients with active JRA exhibit low levels of HDL2 and HDL3 and are deficient in plasma PAF-AH activity. These alterations suggest that active JRA is associated with partial loss of the antiinflammatory activity of plasma Apo B- and Apo A-I-containing lipoproteins.  (+info)

Liver-specific inactivation of the abetalipoproteinemia gene completely abrogates very low density lipoprotein/low density lipoprotein production in a viable conditional knockout mouse. (3/2985)

Conventional knockout of the microsomal triglyceride transfer protein large subunit (lMTP) gene is embryonic lethal in the homozygous state in mice. We have produced a conditional lMTP knockout mouse by inserting loxP sequences flanking exons 5 and 6 by gene targeting. Homozygous floxed mice were born live with normal plasma lipids. Intravenous injection of an adenovirus harboring Cre recombinase (AdCre1) produced deletion of exons 5 and 6 and disappearance of lMTP mRNA and immunoreactive protein in a liver-specific manner. There was also disappearance of plasma apolipoprotein (apo) B-100 and marked reduction in apoB-48 levels. Wild-type mice showed no response, and heterozygous mice, an intermediate response, to AdCre1. Wild-type mice doubled their plasma cholesterol level following a high cholesterol diet. This hypercholesterolemia was abolished in AdCre1-treated lMTP-/- mice, the result of a complete absence of very low/intermediate/low density lipoproteins and a slight reduction in high density lipoprotein. Heterozygous mice showed an intermediate lipoprotein phenotype. The rate of accumulation of plasma triglyceride following Triton WR1339 treatment in lMTP-/- mice was <10% that in wild-type animals, indicating a failure of triglyceride-rich lipoprotein production. Pulse-chase experiments using hepatocytes isolated from wild-type and lMTP-/- mice revealed a failure of apoB secretion in lMTP-/- animals. Therefore, the liver-specific inactivation of the lMTP gene completely abrogates apoB-100 and very low/intermediate/low density lipoprotein production. These conditional knockout mice are a useful in vivo model for studying the role of MTP in apoB biosynthesis and the biogenesis of apoB-containing lipoproteins.  (+info)

Insights into apolipoprotein B biology from transgenic and gene-targeted mice. (4/2985)

Over the past five years, several laboratories have used transgenic and gene-targeted mice to study apolipoprotein (apo) B biology. Genetically modified mice have proven useful for investigating the genetic and environmental factors affecting atherogenesis, for defining apoB structure/function relationships, for understanding the regulation of the apoB gene expression in the intestine, for defining the "physiologic rationale" for the existence of the two different forms of apoB (apoB48 and apoB100) in mammalian metabolism and for providing mechanistic insights into the human apoB deficiency syndrome, familial hypobetalipoproteinemia. This review will provide several examples of how genetically modified mice have contributed to our understanding of apoB biology, including our new discovery that human heart myocytes secrete nascent apoB-containing lipoproteins.  (+info)

Apolipoprotein B in the rough endoplasmic reticulum: translation, translocation and the initiation of lipoprotein assembly. (5/2985)

Apolipoprotein (apo) B and the microsomal triglyceride transfer protein are essential for the hepatic assembly and secretion of triglyceride-rich VLDL. To understand how apoB initiates the process of lipoprotein formation, interest has focused on the biogenesis of its amino terminal globular domain (alpha1 domain). When only this domain is expressed in hepatoma cells, no lipoprotein particle will form. However, proper folding of the alpha1 domain is essential for the internal lipophilic regions of apoB to engage in cotranslational lipid recruitment. The essential function of this domain may be related to its capacity to promote a specific physical interaction with the microsomal triglyceride transfer protein, necessary for apoB's proper folding and lipidation. Alternatively, this domain may promote an autonomous lipid recruitment step that nucleates microsomal triglyceride transfer protein-dependent lipid sequestration by apoB. Forms of apoB that fail to initiate particle assembly or forms associated with aberrant underlipidated particles are targeted for intracellular turnover. Two sites of apoB degradation have been identified. In hepatocarcinoma-derived cells, misassembled apoB may undergo progressive reverse translocation from the endoplasmic reticulum lumen to the cytosol, a process that is mechanistically coupled to polyubiquitination and proteasome-mediated degradation on the cytosolic side of the membrane. Alternatively, studies in primary hepatocytes reveal that apoB may undergo sorting to a post-endoplasmic reticulum compartment for presecretory degradation. In either case, the balance between assembly and presecretory degradation of apoB may represent a control point for the production of hepatic VLDL.  (+info)

Assembly of very low density lipoprotein: a two-step process of apolipoprotein B core lipidation. (6/2985)

The liver plays a primary role in lipid metabolism. Important functions include the synthesis and incorporation of hydrophobic lipids, triacylglycerols and cholesteryl esters into the core of water-miscible particles called lipoproteins and the secretion of these particles into the circulation for transport to distant tissues. In this article, we present a brief overview of one aspect of the assembly process of very low density lipoproteins, namely, possible mechanisms for combining core lipids with apolipoprotein B. This is a complex process in which apolipoprotein B interacts with core lipids to form very low density lipoproteins by a two-step process that can be dissociated biochemically.  (+info)

The LDL receptor gene family, apolipoprotein B and cholesterol in embryonic development. (7/2985)

In recent years, a number of genes that are involved in cholesterol synthesis, its systemic or intercellular transport or lipid metabolism in general have been found to play important roles during embryonic development. In this article, we present a brief overview of these genes, their molecular functions as we understand them to date and our current interpretation of possible mechanisms by which genetic deficiency states might affect the development of the embryo, in particular the formation of the central nervous system.  (+info)

Dietary fish oils inhibit early events in the assembly of very low density lipoproteins and target apoB for degradation within the rough endoplasmic reticulum of hamster hepatocytes. (8/2985)

Dietary fish oils inhibited secretion and stimulated intracellular degradation of apolipoprotein (apo)B in hamster hepatocytes, while dietary sunflower oils stimulated secretion and had no effect on degradation of apoB. To investigate the intracellular site at which fish oils act, we have made use of our previous observations that inhibition of degradation by N-acetyl-leucyl-leucyl-norleucinal (ALLN) results in accumulation of apoB in the trans -Golgi membrane and does not stimulate secretion, while inhibition of degradation by o-phenanthroline results in accumulation of apoB in the rough endoplasmic reticulum membrane and stimulates secretion. Thus, ALLN protects apoB which has been diverted from secretion and o -phenanthroline protects apoB which is targetted for secretion. Addition of o -phenantholine to the incubation medium of hepatocytes from fish oil-fed hamsters inhibited degradation of apoB and stimulated its secretion in particles of the density of VLDL, while addition of ALLN had no effect. These observations suggest that dietary fish oils reversibly inhibit early steps in the assembly of very low density lipoprotein precursors and target apoB for degradation in the rough endoplasmic reticulum.  (+info)

TY - JOUR. T1 - The effect of a six-month exercise program on very low density lipoprotein apolipoprotein B secretion in type 2 diabetes. AU - Alam, S.. AU - Stolinski, M.. AU - Pentecost, C.. AU - Boroujerdi, Massoud. AU - Jones, R. H.. AU - Sonksen, P. H.. AU - Umpleby, A. M.. PY - 2004. Y1 - 2004. N2 - The dyslipidemia and insulin resistance of type 2 diabetes can be improved by aerobic exercise. The effect of 6 months supervised exercise on very low-density lipoprotein (VLDL) apolipoprotein B metabolism was investigated in patients with type 2 diabetes. Moderately obese patients (n = 18) were randomized into supervised (n = 9) and unsupervised (n = 9) exercise groups. All patients were given a training session and a personal exercise program and asked to exercise four times per week at 70% maximal oxygen uptake for 6 months. Patients in the supervised group had a weekly session with an exercise trainer. VLDL apolipoprotein (apo) B metabolism was measured with an infusion of 1-C-13 leucine ...
Microsomal triglyceride transfer protein (MTP) is required for the assembly and cellular secretion of apolipoprotein B (apoB) -containing lipoproteins from the liver and intestine. The secretion pattern of apoB-containing lipoproteins is likely to influence the VLDL and LDL levels in plasma. By initial opportunistic screening for polymorphic sites in the regulatory region of the MTP gene by gene sequencing in 20 healthy male subjects, a common functional G/T polymorphism was detected 493 bp upstream from the transcriptional start point. There was differential binding of unique nuclear proteins at this site, as shown by electrophoretic mobility shift assay. The G variant seemed to bind two or three nuclear proteins that do not bind to the T variant. Expression studies with minimal promoter constructs linked to the chloramphenicol acetyltransferase reporter and transfected into HepG2 cells revealed marked enhancement of transcriptional activity with the T variant. The prevalence of the MTP promoter
TY - JOUR. T1 - An intrinsic gut leptin-melanocortin pathway modulates intestinal microsomal triglyceride transfer protein and lipid absorption. AU - Iqbal, Jahangir. AU - Li, Xiaosong. AU - Chang, Benny Hung Junn. AU - Chan, Lawrence. AU - Schwartz, Gary J.. AU - Chua, Streamson C.. AU - Hussain, M. Mahmood. PY - 2010/7/1. Y1 - 2010/7/1. N2 - Fat is delivered to tissues by apoB-containing lipoproteins synthesized in the liver and intestine with the help of an intracellular chaperone, microsomal triglyceride transfer protein (MTP). Leptin, a hormone secreted by adipose tissue, acts in the brain and on peripheral tissues to regulate fat storage and metabolism. Our aim was to identify the role of leptin signaling in MTP regulation and lipid absorption using several mouse models deficient in leptin receptor (LEPR) signaling and downstream effectors. Mice with spontaneous LEPR B mutations or targeted ablation of LEPR B in proopiomelanocortin (POMC) or agouti gene related peptide (AGRP) expressing ...
An elevated plasma level of apolipoprotein B (apoB), the major protein of low density lipoproteins, is a risk factor for coronary artery disease. This study tested the hypothesis, suggested by previous studies, that the apoB level is strongly influenced by a major gene. The study population included 832 family members of 116 subjects who had undergone elective coronary arteriography at an early age. The apoB level was adjusted for age, gender, body mass index, alcohol consumption, and cigarette smoking (R2 = 20 %). ApoB levels revealed strong familial aggregation with correlations among spouses of 0.23, parent-offspring of 0.16, and siblings of 0.21. Regressive models were used to examine inter-individual variation in adjusted apoB levels. In the total sample, familial aggregation of the apoB level was consistent with two models: (1) a major gene model and (2) a polygenic model with a mixture of non-transmitted "types." Comparison of these two models in each family showed that 57 families ...
Gentaur molecular products has all kinds of products like :search , AbD \ MOUSE ANTI HUMAN APOLIPOPROTEIN B, Product Type Monoclonal Antibody, Specificity APOLIPOPROTEIN B, Target Species Human, Host Mouse, Format Purified, Isotypes IgG1, Applications E, R, Clone F< \ 0650-0954 for more molecular products just contact us
The sine qua non of atherosclerosis is the presence of sterols in arterial wall macrophages. Sterols are delivered to the arterial wall by the penetration of the endothelium by an apoB-containing lipoprotein, which transport the sterols. In other words, unless an apoB-containing lipoprotein particle violates the border created by an endothelium cell and the layer it protects, the media layer, there is no way atherogenesis occurs. For now, lets focus only on the most ubiquitous apoB-containing lipoprotein, the LDL particle. Yes, other lipoproteins also contain apoB (e.g., chylomicrons, remnant lipoproteins such as VLDL remnants, IDL and Lp(a)), but they are few in number relative to LDL particles. I will address them later.. The endothelium is the one-cell-thick-layer which lines the lumen (i.e., the "tube") of a vessel, in this case, the artery. Since blood is in direct contact with this cell all the time, all lipoproteins - including LDL particles - come in constant contact with such ...
The relationship between antiretroviral treatment of HIV infection, body fat distribution, insulin resistance (HOMA), adipocytokine and apolipoprotein-B (apoB) kinetics was investigated in 12 HIV negative controls and 55 HIV-infected patients including antiretroviral treatment-naïve patients (n=15) and patients taking two nucleoside analogues plus either a protease inhibitor (PI, n=15) or non-nucleoside reverse transcriptase inhibitor (NNRTI, n = 25). The HIV positive treatment groups had mild dyslipidaemia. The apo-B fractional clearance rate (FCR) was reduced in the HIV positive groups. Peripheral fat was lower in treated patients and correlated with duration of therapy. There was a positive correlation between peripheral fat and apo-B clearance rate and a negative correlation with apo-B pool size. Adiponectin was reduced in all HIV positive groups and correlated positively with HDL-cholesterol, apo-B FCR and limb fat and correlated negatively with plasma triglycerides and HOMA. In a linear ...
In this report, the authors used nuclear magnetic resonance (NMR) spectroscopy to measure different apoB-containing lipoprotein particle concentrations in 11,984 subjects from the JUPITER study population. The variables of interest were LDL (large, small), intermediate-density lipoproteins (IDL), and very low-density lipoproteins (VLDL, large, medium and small) particle subclasses, VLDL-cholesterol and VLDL/chylomicron triglycerides. In the statin-treated group, in which median LDL-C was 55 mg/dl (1.4 mmol/L), there was no association between LDL or IDL particle concentration and risk for major adverse cardiovascular events (MACE). There was, however, an association for VLDL particle concentration, specifically driven by small VLDL particles. Indeed, each increase by one standard deviation in small VLDL particle concentration was associated with 68% increase in the residual risk of MACE. This finding is consistent with mechanistic studies of lipoprotein/arterial wall interactions, which show ...
In patients with HoFH, lomitapide led to a significant reduction of LDL-c levels and to achievement of EAS targets in many patients, while CV event rates correlated with LDL-c levels.
1. Vrablík M, Češka R. Novinky v oblasti hypolipidemické léčby. Vnitř Lék 2014; 60: 924- 932. 2. Cuchel M, Bloedon LT, Szapary PO et al. Inhibition of microsomal triglyceride transfer protein in familial hypercholesterolemia. N Engl J Med 2007; 356: 148- 156. 3. Kastelein JJ, Wedel MK, Baker BF et al. Potent reduction of apolipoprotein B and low‑ density lipoprotein cholesterol by short‑term administration of an antisense inhibitor of apolipoprotein B. Circulation 2006; 114: 1729- 1735. 4. Sacks FM, Stanesa M, Hegele RA. Severe hypertriglyceridemia with pancreatitis: thirteen years treat-ment with lomitapide. JAMA Intern Med 2014; 174: 443- 447. doi: 10.1001/ jamainternmed.2013.13309. 5. Seidah NG. PCSK9 as a therapeutic target of dyslipidemia. Expert Opin Ther Targets 2009; 13: 19- 28. doi: 10.1517/ 14728220802600715. 6. Catapano AL, Papadopoulos N. The safety of therapeutic monoclonal antibodies: implications for cardiovascular disease and targeting the PCSK9 pathway. ...
The findings presented at EAS highlight mipomersens potential to treat the unique needs of patients with severe forms of FH," said Vice President and General Manager of Genzymes Cardiovascular Business, Paula Soteropoulos. "Other than apheresis, there is no approved treatment that addresses the specific challenges faced by severe FH patients, which include elevated Lp(a) in addition to LDL-C. We believe mipomersen could play an important role as a targeted treatment for these patients." In a presentation entitled "Mipomersen, an ApoB Synthesis Inhibitor, Might Reduce Necessity for Lipid Apheresis in CAD," K.G. Parhofer, M.D., of Ludwig-Maximilians University, Munich, Germany, focused on mipomersens potential to reduce the necessity for lipid-apheresis by lowering LDL-C values below thresholds for apheresis eligibility. Patients with severe forms of FH may be eligible for this treatment, a dialysis-like procedure where blood is filtered through a machine to remove excess cholesterol. ...
As we discovered pB1 by using an anti-ApoB100 antibody, it was natural to ask whether the BVFs (B4T in most experiments) exerted their anti-obesity effect through antibodies that modulate the functions of ApoB100. Indeed, when we injected the BVFs in a typical immunization schedule, they induced antibodies that specifically recognized ApoB100 in Western blots and reacted with native ApoB100 in ELISAs; importantly, the antibody titres correlated with the weight decrements in HFD-fed/immunized mice. As discussed in the following paragraphs, our in vitro data suggest that, at least in part, the antibodies cause their effects on lipid metabolism by blocking the interaction between ApoB100 and LDLRs, and by acting as opsonins for the ApoB100-containing lipoproteins.. The antibodies induced by B4T or B4-OVA, as well as a C-terminally acting commercial anti-ApoB antibody, but not an N-terminally acting antibody, blunted the uptake of LDL-associated lipids by cultured 3T3L1 adipocytes. Furthermore, in ...
Definition : Immunoassay reagents intended to perform qualitative and/or quantitative analyses on a body fluid sample (typically serum) to determine apolipoprotein B, the major protein in low-density lipids (LDLs) and present in large amounts (approximately 4%) in both very-low-density lipids (VLDLs) and chylomicrons. Apolipoprotein B is found in at least two forms: B-100 (Apo B-100) synthesized in the liver, and B-48 (Apo B-48), probably synthesized in the intestines. Levels of apolipoproteins in plasma are associated with the risk of atherosclerosis and coronary artery diseases.. Entry Terms : "Apolipoprotein B Determination Reagents" , "Reagents, Immunoassay, Lipoprotein, Apolipoprotein B". UMDC code : 19817 ...
LDL and its major protein, apolipoprotein B, play an essential role in lipid transport and metabolism. Apo B may regulate cholesterol synthesis through its interaction with specific cell membrane receptors and by inhibition of HMG Co A reductase. This enzyme has been identified as the rate controlling enzyme in cholest
Nachschlagewerk für Laborärzte, Medizinisch-technische Assistenten, Einkäufer in Krankenhäusern, Medizinstudenten und angehende MTAs. Die Website bietet einen unabhängigen Marktüberblick über Produkte vom Blutzuckermessgerät bis zum Großanalyser, vom Autoklaven bis zur Zentrifuge. Seite: Apolipoprotein B
3B Metabolism Microscopic Slides Available From Lab World Online Store. Now With Free UK Delivery On All Orders Over 50. Ideal For Students & Biology Lessons.
Spise Plan for type B Metabolism Noen mennesker tror en individuell diett plan tilpasset deres unike metabolske behov fungerer bedre enn en tradisjonell diett plan. Blodet-type diett er oppfinner sier det kan fremme vekttap og redusere risikoen for kroniske sykdommer ved å instruere
The lack of a decrease in circulating lipids indicates that stored lipids are to be mobilized from peripheral storage sites at a rate similar to their use, whether for tissue β-oxidation or ovarian lipid uptake and storage. While the mechanisms behind this mobilization are beyond the scope of this study, the mobilized lipids must be packaged to be efficiently transported and taken up by tissues, such as the ovary. This packaging undoubtedly occurs in the liver as reflected by several changes, both morphological and molecular [e.g., larger hepatocytes (personal observation), increased HSI and increased relative transcript copy numbers of hepatic packagers (apob and mttp) in early vitellogenic females]. However, evidence of changes in hepatic lipid packaging during fasting is controversial in mammals. Windmueller and Wu (83) found an increase in relative transcript copy numbers of hepatic apob during fasting in rats, yet Lopez-Miranda et al. (45) found no differences in human apob transcript ...
mutant L343V and R463W altered folding of the alpha-helical domain within the N terminus of apoB (proper folding of the -helical domain within the N terminus of apoB is important for efficient secretion of apoB-containing lipoproteins ...
pep:known chromosome:VEGA66:12:7977648:8016835:1 gene:OTTMUSG00000035465 transcript:OTTMUST00000090769 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Apob description:apolipoprotein B ...
The courses are ideal for the more unusual aspects of Southern Africa. Learn about the folklore, and geology of the region. Discuss the processes of evolution and find out what could be in store for the planet. Become an expert birder and learn about Southern African birdlife, or discover the perfect formula to running a successful game lodge. Fancy yourself as a bit of a shutterbug? Take the photography courses and learn all about the art of photography, especially how to take that perfect wildlife photograph.. ...
Microsomal triglyceride transfer protein large subunit is a protein that in humans is encoded by the MTTP gene. MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triaglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. Apolipoprotein B48 on chylomicra and Apolipoprotein B100 on LDL, IDL, and VLDL are important for MTP binding. Click on genes, proteins and metabolites below to link to respective articles. [[File: [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] [[ ]] ,px,alt=Statin Pathway edit]] The interactive pathway map can be edited at ...
Microsomal triglyceride transfer protein large subunit is a protein that in humans is encoded by the MTTP gene.[1][2] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triaglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia.[2] Apolipoprotein B48 on chylomicra and Apolipoprotein B100 on LDL, IDL, and VLDL are important for MTP binding. ...
We have previously reported a positive correlation between the expression of BHMT (betaine-homocysteine S-methyltransferase) and ApoB (apolipoprotein B) in rat hepatoma McA (McArdle RH-7777) cells [Sowden, Collins, Smith, Garrow, Sparks and Sparks (1999) Biochem. J. 341, 639-645]. To examine whether a similar relationship occurs in vivo, hepatic BHMT expression was induced by feeding rats a Met (L-methionine)-restricted betaine-containing diet, and parameters of ApoB metabolism were evaluated. There were no generalized metabolic abnormalities associated with Met restriction for 7 days, as evidenced by control levels of serum glucose, ketones, alanine aminotransferase and L-homocysteine levels. Betaine plus the Met restriction resulted in lower serum insulin and non-esterified fatty acid levels. Betaine plus Met restriction induced hepatic BHMT 4-fold and ApoB mRNA 3-fold compared with Met restriction alone. No changes in percentage of edited ApoB mRNA were observed on the test diets. An increase ...
Low-density lipoprotein is recognized as a primary vascular risk factor. However, recent data favor apolipoprotein (apo)B and apoA-I as risk factors with higher predictive values than conventional lipids. We investigated how leisure-time physical activity relates to the serum apoB/apoA-I ratio in...
Background: We previously demonstrated the presence and localization of hepatic apoB100 and intestinal apoB48 in human carotid atherosclerotic plaques by immunoperoxidase, immunofluorescence (IF), immunoelectron microscopy, and western blot; however, co-localization of apoB48 and apoB100 with macrophages has not been shown.. Methods: In 3 patients undergoing carotid endarterectomy (CEA), plaques were stained for apoB100/CD68 and apoB48/CD68 dual stain (DS)-IF. CD68 was used to localize macrophages. Slides were processed for antigen retrieval and incubated with primary antibodies(ApoB100: ab50069-100 rabbit polyclonal antibody recognizing the C-terminal; apoB48:Shibayagi AKHB48E goat monoclonal antibody recognizing the C-terminal; CD68: Santa Cruz Biotechnologies SC-20060 mouse monoclonal antibody) and species-specific secondary antibodies (Invitrogen;A21447,A21235,A21244, or A11010).Confocal microscopy was used to visualize DS-IF.. Results: There is intense CD68 staining throughout the plaques, ...
Apolipoprotein B-100 (apoB) is the central protein component of very low density lipoproteins (VLDL) and is subject to endoplasmic reticulum-associated degradation (ERAD). Hepatic assembly of VLDL particles is monitored by the cellular quality control machinery, which determines whether a properly formed lipoprotein is secreted or the inadequately lipidated apoB protein is degraded. Changes in lipid supply, ER folding capacity or ERAD pathway function can alter VLDL output from HepG2 cells. Bag6 is a cytosolic protein that has a role in the bilayer integration of proteins and is also implicated in maintaining the solubility of proteasome substrates that contain exposed hydrophobic regions. Notably, Bag6 has been observed to interact with the ERAD components gp78 and p97, which are known to facilitate apoB degradation. The goal of this study was to evaluate the role of cytosolic Bag6 in apoB metabolism in HepG2 cells. When MG132 was used to inhibit proteasomal degradation of apoB, Bag6 was ...
Buy anti-APOB antibody, Mouse anti-Human Apolipoprotein B (APOB) Monoclonal Antibody (Clone C2)-NP_000375.2 (MBS2090601) product datasheet at MyBioSource, Primary Antibodies. Application: Western Blot (WB), Immunohistochemistry (IHC), Immunocytochemistry (ICC), Immunoprecipitation (IP)
Background. Dirlotapide causes body weight reduction in obese dogs primarily due to reductions in food intake.. Aims. To investigate the efficacy and safety of dirlotapide in overweight Labradors in two masked, parallel-design studies. Methods. Study A: 42 dogs randomised to 0.0, 0.025, 0.05, 0.1, 0.2 or 0.4 mg dirlotapide/kg/day orally for 4 weeks. Study B: 72 dogs randomised to nine treatments: placebo (24 weeks); dirlotapide (24 weeks) followed by placebo (28 weeks); or dirlotapide (52 weeks); on diets containing 5%, 10% or 15% fat, offered in excess of maintenance requirements. Dogs were weighed and dirlotapide dose (initially 0.1 mg/kg) was adjusted monthly. After 24 weeks, dosages were reduced to stabilise body weight. Body composition (body fat, lean tissue and bone mineral content) was monitored using dual-energy x-ray absorptiometry. Multiple blood samples were collected for haematology and biochemistry.. Results. Study A: body weight and food intake decreased asymptotically with dose, ...
Apolipoproteins are carrier proteins that bind lipids to form water-soluble lipoprotein particles that can be carried through blood and lymph. Several different classes and subclasses of apolipoproteins are known. Apolipoprotein B (ApoB) is the primary apolipoprotein in chylomicrons (lipoprotein particles that contain triglycerides, phospholipids, cholesterol, and proteins) and low-density lipoprotein (LDL). It is also known as FLDB and LDLCQ4. High levels of ApoB can lead to plaques that cause atherosclerosis, and ApoB levels can be a better indicator of heart disease risk than total cholesterol or LDL. The APOB transcript is subject to tissue-specific RNA editing, resulting in two major isoforms, ApoB-100 and ApoB-48.. ...
Apolipoproteins are carrier proteins that bind lipids to form water-soluble lipoprotein particles that can be carried through blood and lymph. Several different classes and subclasses of apolipoproteins are known. Apolipoprotein B (ApoB) is the primary apolipoprotein in chylomicrons (lipoprotein particles that contain triglycerides, phospholipids, cholesterol, and proteins) and low-density lipoprotein (LDL). It is also known as FLDB and LDLCQ4. High levels of ApoB can lead to plaques that cause atherosclerosis, and ApoB levels can be a better indicator of heart disease risk than total cholesterol or LDL. The APOB transcript is subject to tissue-specific RNA editing, resulting in two major isoforms, ApoB-100 and ApoB-48.. ...
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
This gene product is the main apolipoprotein of chylomicrons and low density lipoproteins. It occurs in plasma as two main isoforms, apoB-48 and apoB-100: the former is synthesized exclusively in the gut and the latter in the liver. The intestinal and the hepatic forms of apoB are encoded by a single gene from a single, very long mRNA. The two isoforms share a common N-terminal sequence. The shorter apoB-48 protein is produced after RNA editing of the apoB-100 transcript at residue 2180 (CAA->UAA), resulting in the creation of a stop codon, and early translation termination. Mutations in this gene or its regulatory region cause hypobetalipoproteinemia, normotriglyceridemic hypobetalipoproteinemia, and hypercholesterolemia due to ligand-defective apoB, diseases affecting plasma cholesterol and apoB levels. [provided by RefSeq, Jul 2008 ...
The study performed by Tamer et al [12] estimated the frequency of APoB point mutations in 179 atherosclerotic, 145 hyperlipidaemic Individuals and 272 healthy individuals in the east Mediterranean region of Turkey. Lipid and lipoprotein level were measured with routine biochemical analysis and APoB mutation was detected using realtime PCR. In this region, APoB mutation was observed as rare causes of hyperlipidaemia and atherosclerosis may therefore be unrelated to them. Dekha et al [13] reported the allele frequency distribution at the hypervariable locus 3′ to the apolipoprotein B gene (ApoB 3′ VNTR) in five well-defined human populations by using the PCR technique. A total of 12 segregating alleles were detected in the pooled sample of 319 individuals. A fairly consistent pattern of allele frequency distribution was found apparent in most of these geographically and genetically diverse populations, suggesting that the ApoB 3′ VNTR polymorphism predates the geographic dispersal of ...
Apolipoprotein B is a major protein constituent of chylomicrons (apo B-48), LDL (apo B-100) and VLDL (apo B-100). Apo B-100 functions as a recognition signal for the cellular binding and internalization of LDL particles by the apoB/E receptor.
Antibodies. Rabbit anti-sortilin (ab16640), rabbit anti-APOB (ab20737), and mouse anti-actin (ab8226) were purchased from Abcam. Mouse anti-sortilin (612101) was purchased from BD Biosciences.. Creation of adenoassociated viruses for gene overexpression studies in mouse liver. The murine Sort1 cDNA (MR210834; Origene) was subcloned into a specialized AAV8 vector provided by the University of Pennsylvania Vector Core. Site-directed mutagenesis was performed using the Stratagene kit to generate both trafficking mutants. To make the truncated mutant, the following primers were used: GCAACTTCTTGAACCCCACAAAGTAGAATTCCAAGTCAAATTCTG (forward); CAGAATTTGACTTGGAATTCTACTTTGTGGGGTTCAAGAAGTTGC (reverse). This created a C2251T transition mutation, which created a Q751X nonsense mutation. To make the double-sortilin trafficking mutant, 2 sequential PCR reactions were performed. The first reaction converted the dileucine sorting motif to a dialanine (L826A/L827A) by introducing the following base pair changes: ...
Human genetic research can pinpoint drug targets by identifying complete loss-of-function mutations affecting a human gene product that, in turn, underlie a favorable phenotype.1 Most small-molecule oral drugs, monoclonal antibodies, or RNA-based strategies act by inhibiting a selected molecular target, thereby pharmacologically mimicking the naturally advantageous genetic deficiency. The fields of atherosclerosis and lipoprotein biology have several examples of drugs whose raison dêtre is to impersonate a naturally occurring, genetically determined beneficial phenotype.. Article see p 677. For instance, 3 new classes of agents approved in the United States reduce low-density lipoprotein (LDL)-cholesterol levels through nonstatin mechanisms.2,3 These include (1) an oral inhibitor of microsomal triglyceride transfer protein (MTP), namely lomitapide (Juxtapid; Aegerion); (2) an injectable antisense oligonucleotide against apolipoprotein (apo) B, namely mipomersen (Kynamro; ISIS-Genzyme); and (3) ...
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
Naganawa S, Kodama T, Aburatani H, Matsumoto A, Itakura H, Takashima Y, Kawamura M, Muto Y. Genetic analysis of a Japanese family with normotriglyceridemic abetalipoproteinemia indicates a lack of linkage to the apolipoprotein B gene. Biochem Biophys Res Commun. 1992 Jan 15;182(1):99-104. ...
Italian researchers have found that a genetic variation that can save individuals in their 40s and 50s also may reduce their chances of living into old age. These findings appear to come from the genes influence on levels of low-density lipoprotein (LDL; "bad") cholesterol.Writing in BMC Medical Genetics (February 2004), the researchers reported that individuals with a particular form of the gene had dramatically lower levels of LDL. Earlier research showed that the gene form linked to low LDL cholesterol usually occurs among adults; however, it is rarely present in healthy elderly adults. This example suggests that the low-cholesterol gene can protect the heart in middle age, but that it also may interfere with reaching old age. ...
All reagents should be stored refrigerated (2-8°C). Return all reagents to 2-8°C promptly after use. Unopened reagents can be used for one year from the date of manufacture, as indicated by the expiration date on the package and bottle labels. Opened reagents can be used for one month if stored at 2-8°C ...
Patton, J G.; Alley, M C.; and Mao, S J., "Evaluation of monoclonal antibodies to human plasma low density lipoproteins. A requirement for lipids to maintain antigenic structure." (1982). Subject Strain Bibliography 1982. 75 ...
CONTENT: To assess the comparability of apo B and LDL-P, we reviewed 25 clinical studies containing 85 outcomes for which both biomarkers were determined. In 21 of 25 (84.0%) studies, both apo B and LDL-P were significant for at least 1 outcome. Neither was significant for any outcome in only 1 study (4.0%). In 50 of 85 comparisons (58.8%), both apo B and LDL-P had statistically significant associations with the clinical outcome, whereas in 17 comparisons (20.0%) neither was significantly associated with the outcome. In 18 comparisons (21.1%) there was discordance between apo B and LDL-P ...
Complete information for APOBEC3B gene (Protein Coding), Apolipoprotein B MRNA Editing Enzyme Catalytic Subunit 3B, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Homo sapiens apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D (putative) (APOBEC3D), mRNA. (H00140564-R01) - Products - Abnova
significant risk factors for all stroke were: history of hypertension (OR 2·64, 99% CI 2·26-3·08; PAR 34·6%, 99% CI 30·4-39·1); current smoking (2·09, 1·75-2·51; 18·9%, 15·3-23·1); waist-to-hip ratio (1·65, 1·36-1·99 for highest vs lowest tertile; 26·5%, 18·8-36·0); diet risk score (1·35, 1·11-1·64 for highest vs lowest tertile; 18·8%, 11·2-29·7); regular physical activity (0·69, 0·53-0·90; 28·5%, 14·5-48·5); diabetes mellitus (1·36, 1·10-1·68; 5·0%, 2·6-9·5); alcohol intake (1·51, 1·18-1·92 for more than 30 drinks per month or binge drinking; 3·8%, 0·9-14·4); psychosocial stress (1·30, 1·06-1·60; 4·6%, 2·1-9·6) and depression (1·35, 1·10-1·66; 5·2%, 2·7-9·8); cardiac causes (2·38, 1·77-3·20; 6·7%, 4·8-9·1); and ratio of apolipoproteins B to A1 (1·89, 1·49-2·40 for highest vs lowest tertile; 24·9%, 15·7-37·1). Collectively, these risk factors accounted for 88·1% (99% CI 82·3-92·2) of the PAR for all stroke. When an alternate ...
Representative light micrographs of H&E- (A-D), PAM- (E-H), and Oil RedO-stained (I, J) kidney sections from 36-week-old human apoB Tg.SHR-cp/cp (A, E, I),
Leica의 매크로현미경(Macroscope)는 시판되는 제품 중 최고 수준의 정밀도를 가지며 산업, 의학, 연구 분야에서 다채로운 목적으로 사용됩니다. 편리한 매크로스코프 Leica Macroscope는 APO 16:1 줌이 주는 탁월한 광학 특성과 함께 작업 편리성에 있어 최고의
Different dietary fatty acids exert specific effects on plasma lipids but the mechanism by which this occurs is unknown. Hamsters were fed on low-cholesterol diets containing triacylglycerols enriched in specific saturated fatty acids, and effects on plasma lipids and the expression of genes involved in hepatic lipoprotein metabolism were measured. Trimyristin and tripalmitin caused significant rises in low-density lipoprotein (LDL) cholesterol which were accompanied by significant reductions in hepatic LDL receptor mRNA levels. Tripalmitin also increased hepatic expression of the apolipoprotein B gene, implying an increased production of LDL via very-low-density lipoprotein (VLDL) and decreased removal of LDL in animals fed this fat. Hepatic levels of 3-hydroxy-3-methylglutaryl-CoA reductase mRNA did not vary significantly between the groups. Compared with triolein, tristearin had little effect on hepatic gene expression or total plasma cholesterol. However, it caused a marked decrease in VLDL ...
Supply of lipids from the mother is essential for fetal growth and development. In mice, disruption of yolk sac cell secretion of apolipoprotein (apo) B-containing lipoproteins results in embryonic lethality. In humans, the yolk sac is vestigial. Nutritional functions are instead established very early during pregnancy in the placenta. To examine whether the human placenta produces lipoproteins, we examined apoB and microsomal triglyceride transfer protein (MTP) mRNA expression in placental biopsies. ApoB and MTP are mandatory for assembly and secretion of apoB-containing lipoproteins. Both genes were expressed in placenta and microsomal extracts from human placenta contained triglyceride transfer activity, indicating expression of bioactive MTP. To detect lipoprotein secretion, biopsies from term placentas were placed in medium with [(35)S]methionine and [(35)S]cysteine for 3-24 h. Upon sucrose gradient ultracentrifugation of the labeled medium, fractions were analyzed by ...
Science 1988;241:591-593. 41. Linton MF, Pierotti V, Young SG: Reading-frame restoration with an apolipoprotein B gene frameshift mutation. Proc Natl Acad Sci USA 1992;89:11431-11435. 42. Wetterau JR, Aggerbeck LP, Bouma M-E, et al: Absence of microsomal triglyceride transfer protein in individuals with abetalipoproteinemia. Science 1992;258:999-1001. 43. Ross RS, Gregg RE, Law SW, et al: Homozygous hypobetalipoproteinemia: a disease distinct from abetalipoproteinemia at the molecular level. J Clin Invest 1988;81:590-595. Am J Physiol Gastrointest Liver Physiol 2007;292:G53-65. Farese RV, Veniant MM, Cham CM, et al: Phenotypic analysis of mice expressing exclusively apolipoprotein B48 or apolipoprotein B100. Proc Natl Acad Sci USA 1996;93:6393-6398. Veniant MM, Pierotti V, Newland D, et al: Susceptibility to atherosclerosis in mice expressing exclusively apolipoprotein B48 or apolipoprotein B100. J Clin Invest 1997;100:180-188. Yu Q, Chen D, Konig R, et al: APOBEC3B and APOBEC3C are potent ...
Context The associations of low-density lipoprotein cholesterol (LDL-C), non-high-density lipoprotein cholesterol (non-HDL-C), and apolipoprotein B (apoB) levels with the risk of cardiovascular events among patients treated with statin therapy have not been reliably documented.. Objective To evaluate the relative strength of the associations of LDL-C, non-HDL-C, and apoB with cardiovascular risk among patients treated with statin therapy.. Design Meta-analysis of individual patient data from randomized controlled statin trials in which conventional lipids and apolipoproteins were determined in all study participants at baseline and at 1-year follow-up.. Data Sources Relevant trials were identified by a literature search updated through December 31, 2011. Investigators were contacted and individual patient data were requested and obtained for 62154 patients enrolled in 8 trials published between 1994 and 2008.. Data Extraction Hazard ratios (HRs) and corresponding 95% CIs for risk of major ...
We have reported studies characterizing small-molecule inhibitors that selectively inhibit PLTP activity and concomitantly reduce apoB secretion. In the present study, we identified small molecules that inhibit both PLTP and MTP activities, which are known to regulate apoB secretion. This is the first report to identify dual inhibitors for PLTP and MTP activities. The discovery was not expected based on the lack of homology of PLTP and MTP at protein sequence levels. Although CETP and PLTP have 40% homology and belong to the family of lipid transfer/lipopolysaccharide-binding proteins (Tollefson et al., 1988; Day et al., 1994), none of these compounds inhibit CETP activity (Luo et al., 2010). MTP and apoB belong to the vitellogenin family of lipid transfer proteins. Read et al. (2000) predicted the three-dimensional structure of the C-terminal lipid binding cavity of MTP based on the crystal structure of lipoviellin. The lipid cavity in MTP bears a resemblance to the lipid binding domain of ...
To evaluate possible mechanisms by which insulin inhibits hepatic apolipoprotein B (apoB) secretion, we incubated primary cultures of rat hepatocytes with sodium ort ho vanadate, a phosphotyrosine phosphatase inhibitor and insulin-mimetic agent. Vanadate (10 μM) and insulin (10 nM) inhibited the medium accumulation of apoB (secretion) by 21 and 37%, respectively, without increasing intracellular apoB. The effects of insulin and vanadate together were not additive. Both insulin and vanadate enhanced intracellular glycogen accumulation by 82 and 37%, respectively. Unlike insulin, vanadate, at a concentration that inhibited apoB secretion (10 μM), had no effect on intracellular lipogenesis, inhibited the secretion of newly synthesized hepatic proteins, and had a delayed onset and termination of action on inhibition of apoB secretion. At higher concentrations (40 and 80 μM), vanadate stimulated intracellular lipogenesis. In conclusion, our data indicate that vanadate mimics insulin action in ...
In individuals with low Lp[a] levels, there is a corresponding low level of OxPL/apoB, suggesting that in the absence of Lp[a], these OxPLs do not accumulate on plasma apoB-containing lipoproteins other than to a minor degree. A similar situation exists with most animals that we have studied (32, 33). For example, in mice with marked hypercholesterolemia, a situation in which OxPLs recognized by E06 are abundant in the arterial tissues (and probably elsewhere as well), the levels of OxPL/apoB in plasma are very low, and often just at the level of detection of our assay (33). In contrast, Lp[a]-transgenic mice have very high OxPL/apoB levels, even in a C57BL/6 background without obvious atherosclerosis (34). Presumably, this reflects the generation of such OxPLs as a component of normal physiological processes. Lp[a]-transgenic mice express both human apoB-100 and apo[a] and thus can form a true covalent Lp[a] similar to that found in humans (34). Mice expressing high levels of human apoB-100 ...
Rehberg EF et al. (1996) A novel abetalipoproteinemia genotype. Identification of a missense mutation in the 97-kDa subunit of the microsomal triglyceride transfer protein that prevents complex formation with protein disulfide isomerase.. [^] ...
Considerable attention has focused on the development of new therapeutic agents that substantially elevate levels of HDL-C. However, development of pharmacological therapies that raise HDL-C levels has been challenging, in part because the underlying biology is substantially more complex than other lipoprotein-directed therapies. HDL circulates in many forms, including both lipid-rich and lipid-poor subfractions (12). It appears that lipid-poor preβ1-HDL fractions acquire cholesterol from macrophages in atherosclerotic plaques. These particles increase in size as they accumulate cholesterol. Cholesterol is ultimately taken up by the liver from these larger, lipid-rich α1-HDL particles or transferred to apoB-containing particles, a process known as RCT (13). Preβ1-HDL represents the most efficient substrate for enhancing RCT, which is considered a pivotal mechanism underlying the potential benefits of HDL-C-raising therapies (14). Because apoA-I has the capacity to generate more lipid-poor ...
Order an Apolipoprotein B Blood Test to evaluate the risk of developing cardiovascular disease and monitor treatment for high cholesterol.
Our results demonstrated the efficiency of EP in MS.The presence of MS was the main grouping criteria (Table 1). According to Table 2, half of the initial subjects were selected as having MS, probably in an incipient stage. Our criteria of selection were the presence of three conditions (2-4, 7): increased BMI and TG and the presence of cardiovascular disorder or type 2 diabetes. Anyway, total cholesterol was increased in all subjects, as a consequence of aging. In the same way, other modifications might be explained, such as increased LDL, TG, as well as some independent parameters, such as cortisol, CRP, IGF-1. Secondly, as we mentioned, in all subjects, the levels of HDL cholesterol and insulin were within the physiological range, possibly compensatory. In this way, the factors of cardiac risk (recommended by AETHNA 2000 Program), such as TC/HDL and Apolipoproteins B/A ratio remained to a moderate level (6). Based on these observations, the difference between the groups with MS versus those ...
Some people believe an individualized diet plan tailored to their unique metabolic needs works better than a traditional diet plan. The blood-type...
Methods. int :: Int -, repr h IntSource. add :: repr h Int -, repr h Int -, repr h IntSource. z :: repr (a, h) aSource. s :: repr h a -, repr (any, h) aSource. lam :: repr (a, h) b -, repr h (a -, b)Source. app :: repr h (a -, b) -, repr h a -, repr h bSource ...
Schnellstartanleitung IDL 400s Quick Installation Guide IDL 400s Deutsch English 2 22 Schnellstartanleitung IDL 400s Advanced SAT>IP Multiscreen Server De Inhaltsverzeichnis Wichtige Informationen 4 Kurzbeschreibung
Hypobetalipoproteinemia is a disorder consisting of low levels of LDL cholesterol or apolipoprotein B, below the 5th percentile. The patient can have hypobetalipoproteinemia and simultaneously have high levels of HDL cholesterol. Notably, in people who do not have the genetic disorder hypobetalipoproteinemia, a low cholesterol level may be a marker for poor nutrition, wasting disease, cancer, hyperthyroidism, and liver disease. One form is thought to be caused by mutated apolipoprotein B. Another form is associated with microsomal triglyceride transfer protein which causes abetalipoproteinemia. A third form, chylomicron retention disease (CRD), is associated with SARA2. Typically in hypobetalipoproteinemia, plasma cholesterol levels will be around 80-120 mg/dL, LDL cholesterol will be around 50-80 mg/dL.[citation needed] Early high doses of vitamin E in infants and children has shown to be effective. Schonfeld G, Lin X, Yue P (June 2005). "Familial hypobetalipoproteinemia: genetics and ...
Background: Type 2 diabetes is a common disease with increased mortality and morbidity due to cardiovascular disease (CVD). This thesis is based on three studies that evaluated traditionally used and emerging risk markers to identify individuals with high-risk of developing CVD in middle-aged men and women with type 2 diabetes. One study was conducted to compare the equivalence between two different ultrasound techniques to measure intima-media thickness since IMT was used to evaluate subclinical atherosclerosis as a surrogate endpoint.. Methods: Data from the cohort study, cardiovascular risk in type 2 diabetes - a prospective study in primary care (CARDIPP) was used in paper I, III and IV. In paper I, baseline data from the first 247 subjects was analysed. Associations between traditionally measured lipids, apolipoproteins, glycaemic control and low-grade inflammation and IMT were analysed.. In paper III, the full baseline cohort, with data from 761 subjects from the CARDIPP study was ...
TY - JOUR. T1 - Plasma apolipoprotein B-48 transport in obese men: A new tracer kinetic study in the postprandial state. AU - Wong, A.T.Y.. AU - Chan, Dick. AU - Pang, Jing. AU - Watts, Gerald. AU - Barrett, Hugh. PY - 2014/1. Y1 - 2014/1. N2 - Context: The mechanisms responsible for impaired chylomicron metabolism have not been adequately investigated in obese subjects. Objective: We aimed to compare apolipoprotein (apo) B-48 kinetics in obese and lean men by developing a new model to describe the kinetics of apoB-48 particles in the postprandial state. Design, Setting, and Patients: Seven obese and 13 age-matched lean men were given an oral fat load. apoB-48 tracer to tracee ratios were measured after intravenous d3-leucine administration using gas chromatography-mass spectrometry. Kinetic parameters were derived using a multicompartmental model. Outcomes Measures: Plasma total and incremental apoB-48 0-10 hour areas under the curve as well as apoB-48 secretion and fractional catabolic rate. ...
BACKGROUND Dyslipidemia increases the risk of atherosclerotic cardiovascular disease and is incompletely reversed by statin therapy alone in many patients. Thyroid hormone lowers levels of serum low-density lipoprotein (LDL) cholesterol and has other potentially favorable actions on lipoprotein metabolism. Consequently, thyromimetic drugs hold promise as lipid-lowering agents if adverse effects can be avoided. METHODS We performed a randomized, placebo-controlled, double-blind, multicenter trial to assess the safety and efficacy of the thyromimetic compound eprotirome (KB2115) in lowering the level of serum LDL cholesterol in patients with hypercholesterolemia who were already receiving simvastatin or atorvastatin. In addition to statin treatment, patients received either eprotirome (at a dose of 25, 50, or 100 mu g per day) or placebo. Secondary outcomes were changes in levels of serum apolipoprotein B, triglycerides, and Lp(a) lipoprotein. Patients were monitored for potential adverse ...
Macrophage receptor that binds to the apolipoprotein B48 (APOB) of dietary triglyceride (TG)-rich lipoproteins (TRL) or to a like domain of APOB in hypertriglyceridemic very low density lipoprotein (HTG-VLDL). Binds and internalizes TRL when out of the context of the macrophage. May provide essential lipids to reticuloendothelial cells. Could also be involved in foam cell formation with elevated TRL and remnant lipoprotein (RLP). Mediates the rapid high-affinity uptake of chylomicrons (CM), HTG-VLDL, and trypsinized (tryp) VLDL devoid of APOE in vitro in macrophages.
Apolipoproteins have multiple roles. One role is to increase the overall solubility of the lipid particle, helping it to dissolve in the aqueous environment of the blood (apolipoproteins are amphipathic, or detergent-like proteins). Apolipoproteins can also function as enzyme co-factors (receptor ligands), facilitating the transfer of their lipid cargo to specific cells. Thus, the apoliproteins are the "smart" or working-end of the lipoprotein particle. The apolipoproteins dictate where the particles will dock and where they can bind, and in so doing the apolipoproteins regulate lipid metabolism in the body. So although the particles are composed of phospholipids and have lipid cargo, the few proteins on their surface are what give them their collective name of lipoproteins ...
Ocean Acoustic Tomography requires deep-ocean moorings whose horizontal excursions are either small or accurately measured. The present study rigorously investigates the former case: the design of stiff moorings to meet any particular horizontal excursion goal (e.g., 25 meters) under two typical ocean current-versus-depth profiles. Moorings are considered for tomographic transmitters and receivers at depths ranging from one thousand to four thousand meters. Mooring components considered include steel sphere, glass ball, and syntactic foam buoyancy; jacketed 3 x 19 wire and electromagnetic cable; and a realistic (large) battery pack for the acoustic transmitter. Kevlar mooring line was considered and rejected. The basic tool of this study is a well-verified computer program that simulates mooring motion. Many runs of this program have yielded enough data to make plots showing mooring cost as a function of excursion, depth, and mooring type. It has been found that cost and excursion are very sensitive to
Rapid responses are electronic letters to the editor. They enable our users to debate issues raised in articles published on thebmj.com. Although a selection of rapid responses will be included online and in print as readers letters, their first appearance online means that they are published articles. If you need the url (web address) of an individual response, perhaps for citation purposes, simply click on the response headline and copy the url from the browser window. Letters are indexed in PubMed ...
NASH is a clinico-pathological entity characterized by the development of histological changes of inflammation and fibrosis in the liver that are nearly identical to those induced by excessive alcohol intake, but in the absence of alcohol abuse. Nonalcoholic steatohepatitis occurs commonly children with additional comorbidities such as obesity and diabetes mellitus. Paralleling the increasing prevalence of obesity and type 2 diabetes in the pediatric population, nonalcoholic fatty liver disease (NAFLD) and especially its more severe histological form NASH, is expected to become one of the most common causes of end-stage liver disease in both children and young adults.. Although no genome wide association studies have been conducted in association with NASH to date, individual candidate gene investigations have identified several genes associated with increase susceptibility to NASH in adults including the microsomal triglyceride transfer protein (MTP) which regulates the incorporation of ...
There is delayed but increased FA oxidation in 6-week apoB ASO-treated livers. Lipolysis of lipids within autolysosomes, with delivery of their FAs to mitochondria, could lead to oxidation that would compensate for the lack of secretion of VLDL, but our studies of FA oxidation in primary hepatocytes had not demonstrated differences between cells from control ASO- and apoB ASO-treated mice (Figure 2G). We considered the possibility that the 2-hour labeling-collection protocol used for those studies was too short to observe the oxidation of 14C OA which, after incorporation into lipids in the ER membrane, would have to move to the lumen, then be incorporated into autophagosomes that would have to fuse to lysosomes before the lipids could be hydrolyzed to allow released 14C OA to finally be oxidized by mitochondria. This schema is supported by published data demonstrating that the peak fusion of autophagosomes with lysosomes can occur as late as 16 hours after stimulation of autophagy (23, ...
Apolipoproteins have important structural and functional roles in several lipoprotein particles. Apolipoproteins regulate lipid metabolism, adipose tissue, and energy production and serve major...
In the ICSI treatment group, significantly higher levels of triglycerides and apolipoprotein-B were observed in cord blood compared with controls. Meanwhile, in ICSI-conceived fetuses, the expression of INSIG1 was significantly higher, and methylation rates were lower, than in the IVF and control groups. Furthermore, in the placenta, the INSIG1 and SREBF1 transcripts were also significantly higher with lower methylation rates in the ICSI group than in the IVF and control groups.. Conclusion(s): ...
Bio-Rad Antibodies (formerly AbD Serotec) is the research antibody division of Bio-Rad, the worlds leading life science company.
Apolipoprotein (apolipoprotein) je bílkovinná složka lipoproteinů. Apolipoproteinů existuje více druhů a jednotlivé typy se vyskytují v konkrétních lipoproteinech. Apolipoproteiny mají více funkcí, jsou strukturálně důležité, pomáhají transportu lipoproteinových částic, a dokonce mohou fungovat jako koenzymy některých enzymů ...
Restricted Access Oops, it looks like you dont have a valid subscription to this content. To gain full access to the content and functionality of the AdisInsight database try one of the following. ...
I have been trying for over 6 months to purchase 5 mooring bits as pictured, to replace my 3 rather small mooring cleats on my CM32 CC Aft Cabin Ketch. First I
This information is intended for physicians and related personnel, who understand that medical information is often imperfect, and must be interpreted in the context of a patients clinical data using reasonable medical judgment. This website should not be used as a substitute for the advice of a licensed physician ...
Tekmira today reported very encouraging results from their first clinical study with SNALP siRNA delivery targeting apolipoprotein B for the treatment of hypercholesterolemia (PRO-040201, aka SNALP-ApoB). While the ~20% ApoB/LDL-c knockdown following single dose administration and evidence for flu-like toxicities at the highest tested dose level indicate that the present formulation is not suitable as a therapeutic, the company is rightly optimistic that based on these results, follow-up formulations that it intends to enter into the clinic later this year will be able to provide significant improvements in the absolute dose and therapeutic index. This is because the new knowledge can now be applied to the rapid progress that has been made in finding much more potent SNALP/LNP formulations (see recent PNAS paper and ILS2009 presentation) since the present formulation was locked down 2 years ago. In addition, much has been learned since on how to predict and mitigate SNALP siRNA-triggered ...
Human plasmas, at a defined DDimer concentration (about 0.6 microgram/ml), as measured with commercially available methods and eespecially the VIDAS-DDimer (Biom�rieux) and the ZYMUTEST DDimer assays, for the quality control of DDimer ELISA assay. Reactive with most of the DDimer assays.
Background: Whole exome sequencing (WES) has shown ~30% success in the diagnosis of Mendelian disorders. Few data exists regarding clinical application of WES for the molecular diagnosis of familial hypobetalipoproteinemia (FHBL), which is characterized as extremely low LDL cholesterol level.. Methods: WES was performed on 36 individuals including 32 patients exhibiting low LDL-C (less than 70 mg/dl) primarily, and 4 unaffected family members from 23 families. We filtered out the following variants: 1) Benign variants predicted by SnpEff; 2) Minor allele frequency (MAF) , 1%; 3) Segregation unmatched for the autosomal codominant pattern; 4) C-score , 10 calculated using in silico prediction software named Combined Annotation Dependent Depletion.. Results: Among 181,404 variants found in those individuals, we found 48,786 nonsense, missense, or splice site variants, of which 14,415 were rare (MAF ≤ 1% or not reported). Filtering assuming autosomal codominant pattern of inheritance combined with ...
Both apoB and non-HDL-C have been proposed as markers to reflect the risk conferred by proatherogenic TG-rich VLDL in addition to LDL-C.1,7 We found that non-HDL-C was more strongly correlated with CHD than LDL-C; however, apoB showed the strongest association with risk of CHD. Interestingly, apoB was associated with increased risk of CHD even after adjustment for LDL-C or non-HDL-C, despite the high degree of correlation between these variables. Furthermore, TG levels provided additional information on CHD risk beyond LDL-C and non-HDL-C but not apoB levels. Because TC and HDL-C measurements are currently standard clinical practice, non-HDL-C is an easily obtainable CHD risk factor. However, our data suggest that apoB-as a single well quantified lipoprotein measurement-is more strongly linked to the incidence of CHD than non-HDL-C and LDL-C. Thus, plasma concentration of atherogenic lipoproteins may be more critical to the development of atherosclerosis than the amount of cholesterol that the ...
To our knowledge, our study represents the first time that NMR lipoprotein variables have been assessed longitudinally in adults with SLE in relation to SLE disease activity and treatment. Each unit increase in the SLEDAI resulted in an increase in apoB-containing lipoproteins (total and small LDL-P) and a decline in apoB-containing HDL-P, which remained significant in multivariate analysis. Thus, more pathogenic lipoprotein variables occurred with SLE disease activity. In the general population, the atherogenic lipoprotein phenotype is often characterized by elevations in apoB-containing lipoproteins, including VLDL and small LDL-P concentrations, and lower levels of apoA-containing lipoproteins (HDL)27.. Prednisone use is often cited as a key factor in the development of atherosclerosis in SLE and is predictive of damage accrual and CV events2. In univariate and multivariate analyses, increases were demonstrated in VLDL variables and TGC with increases in the dose of prednisone. HDL was also ...
Primary objective:. Determine whether mipomersen (ISIS 301012) significantly reduces atherogenic lipid levels in patients with severe heterozygous familial hypercholesterolemia (severe HeFH), defined as low-density lipoprotein cholesterol (LDL-C) levels ≥200 mg/dL plus the presence of coronary heart disease (CHD)/risk equivalents or LDL-C levels ≥300 mg/dL regardless of the presence of CHD/risk equivalents (referred to as Cohort 1) compared to placebo. Two different mipomersen dosing regimens will be studied: subcutaneous (SC) mipomersen 200 mg once weekly versus placebo, and SC mipomersen 70 mg thrice weekly versus placebo.. Secondary Objectives:. ...
Treatment for Abetalipoproteinemia in Fortis Hospital Kalyan West, Mumbai. Find Doctors Near You, Book Appointment, Consult Online, View Doctor Fees, Address, Phone Numbers and Reviews. Doctors for Abetalipoproteinemia in Fortis Hospital Kalyan West, Mumbai | Lybrate
Treatment for abetalipoproteinemia in Yio Chu Kang, Singapore, find doctors near you. Book Appointment Online, View Fees, Reviews Doctors for Abetalipoproteinemia Treatment in Yio Chu Kang, Singapore | Practo
Treatment for abetalipoproteinemia in Anson, Singapore, find doctors near you. Book Appointment Online, View Fees, Reviews Doctors for Abetalipoproteinemia Treatment in Anson, Singapore | Practo
Background: Insulin resistance is linked to dyslipidemia, characterized by a decrease in high density lipo-proteins and an increase in low density lipoproteins. Thiazolidinediones (TZDs) are insulin-sensitizing agents used to improve glycemic control in patients with type 2 diabetes. Recently, the safety of certain TZD regimens has been questioned because of associated adverse effects on the plasma lipid profile. We examined the effect of a TZD, Ciglitazone, on apolipoprotein synthesis and secretion in human liver HepG2 cells. Methods and Results: The effect of Ciglitazone treatment on apolipoprotein synthesis was addressed at the level of transcription, translation and secretion. RT-PCR showed that Ciglitazone increased the transcription of apoE and apoAI but reduced the levels of apoCI and apoB mRNA. Western blot analysis showed an increase in apoAI and apoE secreted in the cell culture media, whereas the amounts of apoB100 and apoCI were reduced. To confirm that Ciglitazone regulates apolipoprotein
analyzed within 24 h of collection. A 2-ml aliquot of plasma Calculation of VLDL apoB secretion and clearance rates. was overlaid with 3 ml of sodium chloride density solution VLDL apoB enrichment with [13C]leucine and [13C]KIC en- (1.006 kg/l) and ultracentrifuged for 16 h at 147,000 g (Cen- richment (precursor pool) was calculated using the following trikon T-2070 ultracentrifuge; Kontron Instruments, Zurich, formula (12): Et ϭ [Rt Ϫ R0/(1 ϩ Rt Ϫ R0)] ϫ 100, where Rt is Switzerland). The supernatant containing VLDL was iso- the 13C-to-12C ratio at time t and R0 is the 13C-to-12C ratio at lated by aspiration. ApoB was precipitated by the tetra- baseline before tracer infusion. Fractional catabolic rate methylurea method, which is highly specific (specificity 97%) (FCR) and fractional secretion rate (FSR) of VLDL were for apoB (15). The precipitate was delipidated by incubation estimated by a multicompartmental model with an intrahe- with 3 ml ether-ethanol solution (1:3, vol/vol) at ...
Much more attention in type 2 diabetes has been paid to VLDL and HDL particles than to LDL particles. The major findings of this study oppose such a view. Forty percent of our subjects had elevated apoB and therefore elevated LDL particle number (2). Most of these subjects also had small dense LDL particles. By contrast, the conventional LDL cholesterol-based approach identified only 23% of the cohort as having abnormal LDL particles, a major difference in diagnostic outcome. In this regard, the present study supports the recent report of Wagner et al. (3), who were the first to examine dyslipidemic phenotypes in type 2 diabetes while incorporating apoB.. Our data extend their results in two regards. First, in our study, LDL particle size was directly measured, and the data indicate that small dense LDL particles were present in both hypertriglyceridemic groups. Second, we analyzed phenotypes based on triglycerides and apoB as well as on the conventional approach to further characterize the ...
Atherogenesis is initiated by subendothelial accumulation (i.e. retention) of apolipoprotein B (apoB)-containing lipoproteins. Lipoprotein retention only occurs in specific vascular areas and is mediated by artery wall proteoglycans in the innermost layer of the artery (the arterial intima). In particular, proteoglycans with elongated glycosaminoglycan chains seem to play a crucial role in this process. The retained lipoproteins subsequently provoke an inflammatory response that ultimately leads to atherosclerosis. Atherogenic lipoproteins specifically locate in areas of intimal hyperplasia, characterised by accumulation of vascular smooth muscle cells and extracellular matrix. This thickened intima appears to act as a depot for extracellular lipids in the earliest initial stages of atherosclerosis. Furthermore, accumulation of apoB-containing triglyceride-rich lipoproteins in the postprandial state promotes the retention of remnant particles in the artery wall, in turn leading to accelerated ...
Atherogenesis is initiated by subendothelial accumulation (i.e. retention) of apolipoprotein B (apoB)-containing lipoproteins. Lipoprotein retention only occurs in specific vascular areas and is mediated by artery wall proteoglycans in the innermost layer of the artery (the arterial intima). In particular, proteoglycans with elongated glycosaminoglycan chains seem to play a crucial role in this process. The retained lipoproteins subsequently provoke an inflammatory response that ultimately leads to atherosclerosis. Atherogenic lipoproteins specifically locate in areas of intimal hyperplasia, characterised by accumulation of vascular smooth muscle cells and extracellular matrix. This thickened intima appears to act as a depot for extracellular lipids in the earliest initial stages of atherosclerosis. Furthermore, accumulation of apoB-containing triglyceride-rich lipoproteins in the postprandial state promotes the retention of remnant particles in the artery wall, in turn leading to accelerated ...
TY - JOUR. T1 - Hyperglycemia, asymmetric dimethylarginine, and patient survival. T2 - Dysregulation of complex networks and the metabolic basis of disease. AU - Castillo, Leticia. AU - Al-Khadra, Eman. PY - 2005/3/1. Y1 - 2005/3/1. KW - Amino acid pool. KW - Asymmetric dimethylarginine. KW - Nutrients. KW - Peroxisome proliferator-activated receptor-γ. UR - http://www.scopus.com/inward/record.url?scp=14944354288&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=14944354288&partnerID=8YFLogxK. U2 - 10.1097/01.CCM.0000155775.30228.33. DO - 10.1097/01.CCM.0000155775.30228.33. M3 - Editorial. C2 - 15753766. AN - SCOPUS:14944354288. VL - 33. SP - 674. EP - 676. JO - Critical Care Medicine. JF - Critical Care Medicine. SN - 0090-3493. IS - 3. ER - ...
PURPOSE: To test the hypothesis that the accumulation of oxidized phospholipids (OxPL) in the macula is toxic to the retina unless neutralized by a variety of mechanisms, including binding by lipoprotein(a) [Lp(a)], which is composed of apolipoprotein(a) [apo(a)] and apolipoprotein B-100 (apoB). METHODS: Human maculas and eyes from two Lp(a) transgenic murine models were subjected to morphologic, ultrastructural, and immunohistochemical analysis. "Wild-type Lp(a)" mice, which express human apoB-100 and apo(a) that contains oxidized phospholipid, and "mutant LBS(-) Lp(a)" mice with a defective apo(a) lysine binding site (LBS) for oxidized phospholipid binding, were fed a chow or high-fat diet for 2 to 12 months ...
Low-density lipoprotein (LDL) plays a key role in the development and progression of atherosclerosis and cardiovascular disease. LDL consists of several subclasses of particles with different sizes and densities, including large buoyant (lb) and intermediate and small dense (sd) LDLs. It has been we …
PCR is usually performed on purified DNA. However, the extraction of DNA from whole blood is time consuming and involves the risk of contamination at every step. Hence, it is desirable to amplify DNA directly from whole blood. Earlier, investigators tried to achieve this target by either pretreatment of whole blood samples with different agents or by altering the conventional thermal cyclic conditions. This would make the technique cumbersome and time consuming. Here, we describe a simple protocol to amplify DNA directly from whole blood without the need of pretreatment. PCR buffer system was optimized in the laboratory and Apolipoprotein B gene was used as a model for this experiment. 480 bp was the target site for amplification. Fresh whole blood samples were used both from healthy and diseased individuals (coronary artery disease patients). Successful amplification was achieved with 1 μl volume of whole blood and it was comparable to that of genomic DNA. No pretreatment of whole blood samples was
The liver secretes triglyceride-rich VLDLs, and the triglycerides in these particles are taken up by peripheral tissues, mainly heart, skeletal muscle, and adipose tissue. Blocking hepatic VLDL secretion interferes with the delivery of liver-derived triglycerides to peripheral tissues and results in an accumulation of triglycerides in the liver. However, it is unclear how interfering with hepatic triglyceride secretion affects adiposity, muscle triglyceride stores, and insulin sensitivity. To explore these issues, we examined mice that cannot secrete VLDL [due to the absence of microsomal triglyceride transfer protein (Mttp) in the liver]. These mice exhibit markedly reduced levels of apolipoprotein B-100 in the plasma, along with reduced levels of triglycerides in the plasma. Despite the low plasma triglyceride levels, triglyceride levels in skeletal muscle were unaffected. Adiposity and adipose tissue triglyceride synthesis rates were also normal, and body weight curves were unaffected. Even ...
TY - JOUR. T1 - Adrenal function in heterozygous and homozygous hypobetalipoproteinemia. AU - Illingworth, D. Roger. AU - Kenny, Terry A.. AU - Orwoll, Eric. PY - 1982. Y1 - 1982. N2 - Corticosteroid synthesis in the human adrenal cortex requires a supply of cholesterol which can be derived from both local synthesis and the uptake of plasma lipoproteins. Studies with cultured adrenal cells have shown that such uptake i s mediated through the interaction of plasma low density lipo-proteins (LDL) and a specific cellular receptor (the LDL receptor). In the present study we have examined parameters of adrenal corticosteroid production in a patient with phenotypic abetalipoproteinemia (on the basis of homozygous hypobetalip-oproteinemia) and in three of her relatives with inherently low levels of LDL (heterozygous hypobetalipoproteinemia). These studies sought to determine whether the absence of LDL or an inherent reduction in their plasma concentration results in alterations in corticosteroid ...
In this paper, 37 patients (23 males-14 females) undergoing aortocoronary bypass surgery and 20 cases (10 males-10 females) as a control group, were studied for their total plasma cholesterol, triglyceride, high density lipoprotein (HDL), low density lipoprotein (LDL), apolipoprotein A1(Apo A1) and apolipoprotein B (Apo B) levels. The predictive value of these levels in coronary artery disease were assessed angiographically and peroperatively in the number of stennosed wessels, extent of atherosclerosis (coronary score) and internal diameters of the bypassed coronary arteries.. In both sexes, no correlation was found between coronary artery disease and the levels of triglycerides and LDL.. Cholesterol and Apo 1 levels in men, were significantly lower than that of control group, Also, the levels of Apo 1 and the internal diameter of the bypassed coronary arteries, were correlated in men.. There was a significant correlation between the levels of Apo 1 and B, and the extent of coronary artery ...
The effects of hemostatic substances on the vascular tone in porcine coronary arteries and the influence of low density lipoprotein on tension were investigated. Thrombin induced a marked concentration-dependent relaxation in prostaglandin F2 alpha-precontracted strips with intact endothelium, whereas it produced a modest constriction in endothelium-denuded arteries. Methylene blue abolished the relaxation, but indomethacin did not affect it significantly. An exposure of the intact strips to low density lipoprotein resulted in a marked inhibition of the relaxation to thrombin but did not interfere with vasodilation by sodium nitroprusside. The inhibition by low density lipoprotein was reversed completely by washing. In contrast, high density lipoprotein lacked such inhibitory effects. Adenosine diphosphate, calcium ionophore A23187, and platelet-activating factor also produced relaxation in the intact strips. An exposure of the strips to low density lipoprotein almost abolished relaxation to ...
Cholesterol is minimally soluble in water; it cannot dissolve and travel in the water-based bloodstream. Instead, it is transported in the bloodstream by lipoproteins that are water-soluble and carry cholesterol and triglycerides internally. The apolipoproteins forming the surface of the given lipoprotein particle determine from what cells cholesterol will be removed and to where it will be supplied.. The largest lipoproteins, which primarily transport fats from the intestinal mucosa to the liver, are called chylomicrons. They carry mostly fats in the form of triglycerides. In the liver, chylomicron particles release triglycerides and some cholesterol. The liver converts unburned food metabolites into very low density lipoproteins (VLDL) and secretes them into plasma where they are converted to intermediate density lipoproteins(IDL), which thereafter are converted to low-density lipoprotein (LDL) particles and non-esterified fatty acids, which can affect other body cells. In healthy individuals, ...
... or apolipoprotein C-II is a protein that in humans is encoded by the APOC2 gene. secreted in plasma where it ... "A nonsense mutation in the apolipoprotein C-IIPadova gene in a patient with apolipoprotein C-II deficiency". J. Clin. Invest. ... Familial apolipoprotein CII deficiency associated with premature vascular disease". J. Clin. Invest. 80 (6): 1597-606. doi: ... "Structure of apolipoprotein C-IIToronto, a nonfunctional human apolipoprotein". Proc. Natl. Acad. Sci. U.S.A. 84 (1): 270-3. ...
In animals, when there is an oversupply of dietary carbohydrate, the excess carbohydrate is converted to triglycerides. This involves the synthesis of fatty acids from acetyl-CoA and the esterification of fatty acids in the production of triglycerides, a process called lipogenesis.[87] Fatty acids are made by fatty acid synthases that polymerize and then reduce acetyl-CoA units. The acyl chains in the fatty acids are extended by a cycle of reactions that add the acetyl group, reduce it to an alcohol, dehydrate it to an alkene group and then reduce it again to an alkane group. The enzymes of fatty acid biosynthesis are divided into two groups, in animals and fungi all these fatty acid synthase reactions are carried out by a single multifunctional protein,[88] while in plant plastids and bacteria separate enzymes perform each step in the pathway.[89][90] The fatty acids may be subsequently converted to triglycerides that are packaged in lipoproteins and secreted from the liver. The synthesis of ...
Text is available under the Creative Commons Attribution-ShareAlike License; additional terms may apply. By using this site, you agree to the Terms of Use and Privacy Policy. Wikipedia® is a registered trademark of the Wikimedia Foundation, Inc., a non-profit organization ...
Apolipoprotein E-associated. Elevation of both serum cholesterol and triglycerides; accelerated atherosclerosis, coronary heart ...
Apolipoprotein BEdit. Apolipoprotein B, in its ApoB100 form, is the main apolipoprotein, or protein part of the lipoprotein ... Class III: LDLR does not properly bind LDL on the cell surface because of a defect in either apolipoprotein B100 (R3500Q) or in ... LDL cholesterol normally circulates in the body for 2.5 days, and subsequently the apolipoprotein B portion of LDL cholesterol ... or apolipoprotein B (ApoB), which is the part of LDL that binds with the receptor; mutations in other genes are rare.[1] People ...
"Farnesoid X receptor agonists suppress hepatic apolipoprotein CIII expression". Gastroenterology. 125 (2): 544-55. doi:10.1016/ ...
A recent study found that a lncRNA in the antisense direction of the Apolipoprotein A1 (APOA1) regulates the transcription of ... Halley, Paul; Kadakkuzha, Beena (2014). "Regulation of the apolipoprotein gene cluster by a long noncoding RNA". Cell Reports. ...
Apolipoprotein E, dementia, and cortical deposition of beta-amyloid protein. „N Engl J Med". 333 (19), s. 1242-47, 11 1995. DOI ... Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial ... a b Mahley RW, Weisgraber KH, Huang Y. Apolipoprotein E4: A causative factor and therapeutic target in neuropathology, ...
... alpha-synuclein can also form lipoprotein nanoparticles similar to apolipoproteins. ... "Membrane curvature induction and tubulation are common features of synucleins and apolipoproteins". The Journal of Biological ...
Apolipoprotein E)會導致類澱粉蛋白質斑塊在大腦中累積[83],因此推測Aβ是導致阿茲海默症的原因,進一步的證據則是來自於轉殖基因老鼠實驗,研究人員在實驗老鼠身上表現突變型人類APP基因,結果發現實驗老鼠的大腦會產生纖維狀的類澱粉蛋白質斑塊 ... Apolipoprotein E, dementia, and cortical deposition of beta-amyloid protein. N Engl J Med. November 1995,
... apolipoprotein D; beta-lactoglobulin; complement component C8 gamma chain; crustacyanin; epididymal-retinoic acid binding ...
2009). "Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. ...
"Gene-centric association signals for lipids and apolipoproteins identified via the HumanCVD BeadChip". Am. J. Hum. Genet. 85 ...
Specifically too, the apolipoprotein *e4 allele is linked to Alzheimer's disease as well. Also, there is increased coronary ... research has been put on concerning apolipoprotein E genotypes; this polymorphism has three alleles (*e2, *e3, and *e4)and was ...
Apolipoprotein A-1 Milano (also ETC-216, now MDCO-216) is a naturally occurring mutated variant of the apolipoprotein A1 ... Weisgraber KH, Rall SC, Bersot TP, Mahley RW, Franceschini G, Sirtori CR (25 February 1983). "Apolipoprotein A-IMilano. ...
structures of apolipoprotein a-ii and a lipid surrogate complex provide insights into apolipoprotein-lipid interactions ... "Entrez Gene: APOA2 apolipoprotein A-II".. *^ Pussinen PJ, Jauhiainen M, Metso J, Pyle LE, Marcel YL, Fidge NH, Ehnholm C (Jan ... Apolipoprotein A-II is a protein that in humans is encoded by the APOA2 gene.[5] ... apolipoprotein receptor binding. • high-density lipoprotein particle receptor binding. • cholesterol binding. • protein binding ...
Apolipoprotein A-II is a protein that in humans is encoded by the APOA2 gene. This gene encodes apolipoprotein (apo-) A-II, ... "Entrez Gene: APOA2 apolipoprotein A-II". Pussinen PJ, Jauhiainen M, Metso J, Pyle LE, Marcel YL, Fidge NH, Ehnholm C (Jan 1998 ... Brewer HB, Lux SE, Ronan R, John KM (May 1972). "Amino acid sequence of human apoLp-Gln-II (apoA-II), an apolipoprotein ... The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result ...
"Lack of macrophage fatty-acid-binding protein aP2 protects mice deficient in apolipoprotein E against atherosclerosis". Nature ...
"Entrez Gene: APOE apolipoprotein E".. *↑ Liu CC, Liu CC, Kanekiyo T, Xu H, Bu G (Feb 2013). "Apolipoprotein E and Alzheimer ... "Alzheimer Research Forum: Meta-Analyses of apolipoprotein E AD Association Studies".. *↑ Weisgraber KH, Innerarity TL, Mahley ... Mahley RW, Rall SC (2002). "Apolipoprotein E: far more than a lipid transport protein". Annual Review of Genomics and Human ... Apolipoproteins E Medical Subject Headings (MeSH) na Biblioteca Nacional de Medicina dos EUA. ...
Apolipoprotein E (ApoE) plays an important role in phospholipid and cholesterol homeostasis. After binding ApoER2, ApoE is ... Riddell DR, Sun XM, Stannard AK, Soutar AK, Owen JS (2001). "Localization of apolipoprotein E receptor 2 to caveolae in the ... Herz J (June 2009). "Apolipoprotein E receptors in the nervous system". Curr. Opin. Lipidol. 20 (3): 190-6. doi:10.1097/MOL. ... Low-density lipoprotein receptor-related protein 8 (LRP8), also known as apolipoprotein E receptor 2 (ApoER2), is a protein ...
Apolipoprotein M is a protein that in humans is encoded by the APOM gene. The protein encoded by this gene is an apolipoprotein ... "Entrez Gene: APOM apolipoprotein M". Albertella MR, Jones H, Thomson W, et al. (1997). "Localization of eight additional genes ... 2004). "Regulation of apolipoprotein M gene expression by MODY3 gene hepatocyte nuclear factor-1alpha: haploinsufficiency is ... 2005). "Leptin inhibits apolipoprotein M transcription and secretion in human hepatoma cell line, HepG2 cells". Biochim. ...
Gatto LM, Sullivan DR, Samman S (May 2003). "Postprandial effects of dietary trans fatty acids on apolipoprotein(a) and ... because palm oil results in adverse changes in the blood concentrations of LDL and apolipoprotein B just as trans fat does.[191 ... higher after the trans meal than after the cis meal and that lipoprotein concentrations were enriched in apolipoprotein(a) ... of dietary fatty acids and carbohydrates on the ratio of serum total to HDL cholesterol and on serum lipids and apolipoproteins ...
Apolipoprotein L3 is a protein that in humans is encoded by the APOL3 gene. This gene is a member of the apolipoprotein L gene ... "Entrez Gene: APOL3 apolipoprotein L, 3". Human APOL3 genome location and APOL3 gene details page in the UCSC Genome Browser. ... 2001). "Apolipoprotein L gene family: tissue-specific expression, splicing, promoter regions; discovery of a new gene". J. ... Monajemi H, Fontijn RD, Pannekoek H, Horrevoets AJ (2002). "The apolipoprotein L gene cluster has emerged recently in evolution ...
Alzheimer's disease and apolipoprotein E (apoE). Uncovered the molecular pathways that link apoE and Alzheimer's disease, and ...
Apolipoprotein L2 is a protein that in humans is encoded by the APOL2 gene. This gene is a member of the apolipoprotein L gene ... "Entrez Gene: APOL2 apolipoprotein L, 2". Human APOL2 genome location and APOL2 gene details page in the UCSC Genome Browser. ... McGhee KA, Morris DW, Schwaiger S (2005). "Investigation of the apolipoprotein-L (APOL) gene family and schizophrenia using a ... Monajemi H, Fontijn RD, Pannekoek H, Horrevoets AJ (2002). "The apolipoprotein L gene cluster has emerged recently in evolution ...
Apolipoprotein L6 is a protein that in humans is encoded by the APOL6 gene. This gene is a member of the apolipoprotein L gene ... "Entrez Gene: APOL6 apolipoprotein L, 6". Human APOL6 genome location and APOL6 gene details page in the UCSC Genome Browser. ... Liu Z, Lu H, Jiang Z, Pastuszyn A, Hu CA (Jan 2005). "Apolipoprotein l6, a novel proapoptotic Bcl-2 homology 3-only protein, ... "The human apolipoprotein L gene cluster: identification, classification, and sites of distribution". Genomics. 74 (1): 71-8. ...
Apolipoprotein D (ApoD) is a lipocalin involved in several processes including lipid transport, but its modulation during human ... From: Modulation of Apolipoprotein D levels in human pregnancy and association with gestational weight gain ...
... analysis of a Japanese family with normotriglyceridemic abetalipoproteinemia indicates a lack of linkage to the apolipoprotein ... analysis of a Japanese family with normotriglyceridemic abetalipoproteinemia indicates a lack of linkage to the apolipoprotein ...
Lipid-free human apolipoprotein C-II (apoC-II) forms characteristic amyloid fibrils and is one of several apolipoproteins that ... A structural model for apolipoprotein C-II amyloid fibrils : experimental characterization and molecular dynamics simulations ... A structural model for apolipoprotein C-II amyloid fibrils : experimental characterization and molecular dynamics simulations. ...
Influence of Glycaemic Balance on the Ability of Apolipoprotein C1 to Inhibit Cholesteryl Ester Transfer Protein in Type-1 ...
It is believed that the apolipoprotein E, which is present in higher quantities in VLDL-subfraction 2 plays an important role ...
Apolipoprotein C-IV, also known as apolipoprotein C4, is a protein that in humans is encoded by the APOC4 gene.[5][6] ... Apolipoprotein (apo)C4 gene is a member of the apolipoprotein C gene family. It is expressed in the liver and has a predicted ... "Entrez Gene: apolipoprotein C-IV".. *^ Allan CM, Walker D, Segrest JP, Taylor JM (July 1995). "Identification and ... 2002). "Regulated expression of the apolipoprotein E/C-I/C-IV/C-II gene cluster in murine and human macrophages. A critical ...
Apolipoprotein C2 or apolipoprotein C-II is a protein that in humans is encoded by the APOC2 gene. secreted in plasma where it ... "A nonsense mutation in the apolipoprotein C-IIPadova gene in a patient with apolipoprotein C-II deficiency". J. Clin. Invest. ... Familial apolipoprotein CII deficiency associated with premature vascular disease". J. Clin. Invest. 80 (6): 1597-606. doi: ... "Structure of apolipoprotein C-IIToronto, a nonfunctional human apolipoprotein". Proc. Natl. Acad. Sci. U.S.A. 84 (1): 270-3. ...
Apolipoprotein B100 (apoB100) is a protein that plays a role in moving cholesterol around your body. It is a form of low ... Apolipoprotein B100 (apoB100) is a protein that plays a role in moving cholesterol around your body. It is a form of low ... Apolipoprotein measurements may provide more detail about your risk for heart disease, but the added value of this test beyond ... Regulation and clearance of apolipoprotein B-containing lipoproteins. In: Ballantyne CM, ed. Clinical Lipidology: A Companion ...
Apolipoprotein CII (apoCII) is a protein found in large fat particles that the gastrointestinal tract absorbs. It is also found ... ApoCII; Apoprotein CII; ApoC2; Lipoprotein lipase deficiency - apolipoprotein CII; Chylomicronemia syndrome - apolipoprotein ... Apolipoprotein measurements may provide more detail about your risk for heart disease, but the added value of this test beyond ... Apolipoprotein CII (apoCII) is a protein found in large fat particles that the gastrointestinal tract absorbs. It is also found ...
The key is a naturally occurring protein called apolipoprotein A-I binding protein (AIBP). AIBP binds to toll-like receptor 4 ( ...
Apolipoprotein AI amyloidosis (apoAI) is an autosomal dominant amyloidosis caused by point mutations in the apoAI gene. Usually ... encoded search term (What is apolipoprotein AI amyloidosis (apoAI)?) and What is apolipoprotein AI amyloidosis (apoAI)? What to ... What is apolipoprotein AI amyloidosis (apoAI)?. Updated: May 09, 2019 * Author: Robert O Holmes, Jr, DO; Chief Editor: Herbert ... Apolipoprotein AI amyloidosis (apoAI) is an autosomal dominant amyloidosis caused by point mutations in the apoAI gene. Usually ...
The apolipoprotein B (Apo B) is a protein involved in the metabolism of lipids. The apo B test may be used, along with other ... Apolipoprotein B-100 (also called apolipoprotein B or apo B) is a protein that is involved in the metabolism of lipids and is ... Apolipoproteins combine with lipids to transport them throughout the bloodstream. Apolipoproteins provide structural integrity ... The apolipoprotein B (apo B) test is used, along with other lipid tests, to help determine an individuals risk of developing ...
... a series of Sicilian neonates was studied in order to investigate about the distribution of serum lipid and apolipoprotein at ... 1990) Lipid and apolipoprotein in cord blood. In: Descovich G., Gaddi A., Magri G., Lenzi S. (eds) Atherosclerosis and ... McConathy, W.J., Lane, D.M., (1980) "Studies on the apolipoproteins and lipoproteins of cord serum", Pediatr. Res., 14, 757-61. ... In conclusion lipid and apolipoprotein distributions in Sicilian newborns are not different from that of other population and ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Exchangeable apolipoproteins (apoA, apoC and apoE) have the same genomic structure and are members of a multi-gene family that ... ApoA1, ApoA4 and Apo5 are part of the APOA1/C3/A4/A5 gene cluster on chromosome 11 [PMID: 15108119]. Apolipoproteins function ... Three-dimensional structure of the LDL receptor-binding domain of human apolipoprotein E.. Science 252 1817-22 1991 ... Contributions of domain structure and lipid interaction to the functionality of exchangeable human apolipoproteins.. Prog. ...
APOA1 apolipoprotein A1 [Homo sapiens] APOA1 apolipoprotein A1 [Homo sapiens]. Gene ID:335 ... Title: Apolipoprotein B/apolipoprotein A1 ratio and mortality among incident peritoneal dialysis patients. ... apolipoprotein A1provided by HGNC. Primary source. HGNC:HGNC:600 See related. Ensembl:ENSG00000118137 MIM:107680; Vega: ... Tertiary structure of apolipoprotein A-I in nascent high-density lipoproteins. Pourmousa M, et al. Proc Natl Acad Sci U S A, ...
Apolipoprotein synthesis in the intestine is regulated principally by the fat content of the diet. Apolipoprotein synthesis in ... There are also intermediate-density lipoproteins formed by Apolipoprotein E. There are six classes of apolipoproteins and ... There are two major types of apolipoproteins. Apolipoproteins B form low-density lipoprotein (sometimes referred to as "bad ... Apolipoprotein L Saito H, Lund-Katz S, Phillips MC (July 2004). "Contributions of domain structure and lipid interaction to the ...
Apolipoprotein E in Alzheimers disease: an update.. Yu JT1, Tan L, Hardy J. ... Apolipoprotein E (APOE) has been irrefutably recognized as the major genetic risk factor, with semidominant inheritance, for ...
Apolipoproteins regulate lipid metabolism, adipose tissue, and energy production and serve major... ... Apolipoproteins have important structural and functional roles in several lipoprotein particles. ... Horejsi B, Ceska R (2000) Apolipoproteins and atherosclerosis. Apolipoprotein E and apolipoprotein(a) as candidate genes of ... Apolipoproteins have important structural and functional roles in several lipoprotein particles. Apolipoproteins regulate lipid ...
LBXAPB - Apolipoprotein (B) (mg/dL). Variable Name: LBXAPB. SAS Label: Apolipoprotein (B) (mg/dL). English Text: Apolipoprotein ... LBDAPBSI - Apolipoprotein (B) (g/L). Variable Name: LBDAPBSI. SAS Label: Apolipoprotein (B) (g/L). English Text: Apolipoprotein ... Apolipoprotein B (ApoB_G) Data File: ApoB_G.xpt First Published: January 2014. Last Revised: NA ... Apolipoprotein B is the main protein component of LDL and accounts for approximately 95% of the total protein content of LDL. ...
LBXAPB - Apolipoprotein (B) (mg/dL). Variable Name: LBXAPB. SAS Label: Apolipoprotein (B) (mg/dL). English Text: Apolipoprotein ... LBDAPBSI - Apolipoprotein (B) (g/L). Variable Name: LBDAPBSI. SAS Label: Apolipoprotein (B) (g/L). English Text: Apolipoprotein ... A crossover study was performed to compare the 2007-2008 Apolipoprotein B data to the 2005-2006 Apolipoprotein B data. The Dade ... Apolipoprotein B (ApoB_E) Data File: ApoB_E.xpt First Published: July 2010. Last Revised: NA Note: See Analytic Note on ...
HDL3species containing both apolipoprotein A-I and apolipoprotein A-II, and HDL3(AI w/o AII), HDL3species containing ... initially with three apolipoprotein A-I, to larger particles with four apolipoprotein A-I per particle. © 1989. ... Conversion of apolipoprotein-specific high-density lipoprotein populations during incubation of human plasma. *Nichols A ... Nichols, A. V., Blanche, P. J., Shore, V. G., & Gong, E. L. (1989). Conversion of apolipoprotein-specific high-density ...
Apolipoprotein-D Human Recombinant, Human Apolipoprotein-J, Apolipoprotein-J Canine Recombinant ... ProSpecs Apolipoproteins include: Clusterin Human Recombinant, Clusterin Rat Recombinant, ... About Apolipoprotein:. The binding of lipids (soluble oil molecules) and cholesterol to Apoliproteins result in the formation ... 6 main classes of apolipoproteins are APOA, APOB, APOC, APOD, APOE and APOH. APOA1 takes an important role in the return of ...
Human apolipoprotein E (apoE) consists of a single polypeptide chain with 299 amino acids and is best known for its role in the ... Keywords: ATP binding cassette transporter 1 (ABC1); ApoE; Apolipoprotein; Atherosclerosis; Cell-based Gene Therapy; ...
Effective immediately, SpectraCell Laboratories now offers apolipoprotein E genotyping. This test determines a persons genetic ... SpectraCell Laboratories Offers Apolipoprotein E Genetic Testing. Thursday, April 22, 2010 General News ... HOUSTON, April 21 /PRNewswire/ -- Effective immediately, SpectraCell Laboratories now offers apolipoprotein E genotyping. ...
  • It is believed that the apolipoprotein E, which is present in higher quantities in VLDL-subfraction 2 plays an important role for clearing VLDL triacylglycerol into adipose tissue. (ajas.info)
  • In addition, quantitative immunological measurements of certain apolipoproteins (especially A-1 and B) have been suggested to be more accurate estimators of coronary heart disease than measurements of lipoprotein particles (especially HDL and LDL). (abcam.com)
  • Apolipoproteins A and B are risk indicators of coronary heart disease and targets for lipid-modifying therapy, such as statins. (thefreedictionary.com)
  • Hundreds of genetic polymorphisms of the apolipoproteins have been described, and many of them alter their structure and function. (wikipedia.org)
  • INTRODUCTION: Genetic polymorphisms in apolipoprotein genes may be associated with alteration in lipid profile and susceptibility to gallstone disease. (hindawi.com)
  • Trp99His, Cys116Ser, Ile118Ser, Leu120Ser amino acids exchanges were introduced at the surface of Apolipoprotein-D to enhance the protein's solubility and another three Leu23Pro, Pro133Val, Asn134Ala amino acids exchanges which facilitate its genetic manipulation. (prospecbio.com)
  • Title: The relationship between apolipoprotein genes polymorphisms and susceptibility to osteonecrosis of the femoral head: a meta-analysis. (nih.gov)
  • Smoking cigarettes, taking diuretics, or taking medicines that contain androgens can also cause lower levels of apolipoprotein A. (ahealthyme.com)
  • OBJECTIVE To determine plasma apolipoprotein A-IV (apoA-IV) levels and phenotype distribution in non-insulin-dependent diabetes mellitus (NIDDM) patients and to analyze the influence of apoA-IV phenotype on lipid profiles in NIDDM. (diabetesjournals.org)
  • This comprehensive book provides not only the stages in the development of this unique and specialized field but also updates on the current state of research and development of apolipoprotein mimetics as therapeutic modalities for various lipid-mediated disorders. (springer.com)
  • Over the years Dr. Ananth has been an author in more than 200 original publications and more than 30 patents, most of which are related to the studies of apolipoprotein mimetics. (springer.com)
  • Apolipoprotein A-I mimetics and high-density lipoprotein function. (thefreedictionary.com)
  • The present invention relates to methods of use of phosphonate-phosphates and diphosphonates to modulate apolipoprotein E levels and the use of such compounds in therapy, including cardiovascular and neurological disease states. (freepatentsonline.com)
  • The agent blocks the function of the mRNA of apolipoprotein C3 and successfully treats severe hypertriglyceridaemia in phase 3 trials (Ionis Pharmaceuticals). (ovid.com)
  • Your search returned 5 apolipoprotein B mRNA editing enzyme catalytic subunit 1 ELISA ELISA Kit across 2 suppliers. (biocompare.com)
  • Vlad C, Burlacu A, Florea L, Artene B, Badarau S, Covic A et al (2019) A comprehensive review on apolipoproteins as nontraditional cardiovascular risk factors in end-stage renal disease: current evidence and perspectives. (springer.com)
  • However, because of their detergent-like (amphipathic) properties, apolipoproteins and other amphipathic molecules (such as phospholipids) can surround the lipids, creating the lipoprotein particle that is itself water-soluble, and can thus be carried through water-based circulation (i.e., blood, lymph). (wikipedia.org)
  • Nevertheless, due to of their amphipathic/detergent like characteristics, Apolipoproteins fence in the lipids, forming a lipoprotein particle which is soluble in water, hence travel in blood. (prospecbio.com)
  • One role is to increase the overall solubility of the lipid particle, helping it to dissolve in the aqueous environment of the blood (apolipoproteins are amphipathic, or detergent-like proteins). (labce.com)
  • Using the models of two long anti-atherogenic and anti-inflammatory proteins (apolipoprotein A-I and apolipoprotein E with 243 and 299 amino acids, respectively) short mimetic peptides of 18 to 28 amino acid residues in length, which can be produced either synthetically or genetically in edible fruits and vegetables, have been shown to exert profound biological effects in a large number of animal models of diseases. (springer.com)
  • Fibrinogen alpha chain precursor and apolipoprotein a-I in urine as biomarkers for noninvasive diagnosis of calcium oxalate nephrolithiasis: a proteomics study. (medscape.com)
  • Apolipoproteins can also function as enzyme co-factors (receptor ligands), facilitating the transfer of their lipid cargo to specific cells. (labce.com)