Apoferritins: The protein components of ferritins. Apoferritins are shell-like structures containing nanocavities and ferroxidase activities. Apoferritin shells are composed of 24 subunits, heteropolymers in vertebrates and homopolymers in bacteria. In vertebrates, there are two types of subunits, light chain and heavy chain. The heavy chain contains the ferroxidase activity.Ferritins: Iron-containing proteins that are widely distributed in animals, plants, and microorganisms. Their major function is to store IRON in a nontoxic bioavailable form. Each ferritin molecule consists of ferric iron in a hollow protein shell (APOFERRITINS) made of 24 subunits of various sequences depending on the species and tissue types.Crystallization: The formation of crystalline substances from solutions or melts. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Crystallography, X-Ray: The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Ferritins: Iron-containing proteins that are widely distributed in animals, plants, and microorganisms. Their major function is to store IRON in a nontoxic bioavailable form. Each ferritin molecule consists of ferric iron in a hollow protein shell (APOFERRITINS) made of 24 subunits of various sequences depending on the species and tissue types.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Horses: Large, hoofed mammals of the family EQUIDAE. Horses are active day and night with most of the day spent seeking and consuming food. Feeding peaks occur in the early morning and late afternoon, and there are several daily periods of rest.Spleen: An encapsulated lymphatic organ through which venous blood filters.Chlorobutanol: A colorless to white crystalline compound with a camphoraceous odor and taste. It is a widely used preservative in various pharmaceutical solutions, especially injectables. Also, it is an active ingredient in certain oral sedatives and topical anesthetics.Muramic Acids: Compounds consisting of glucosamine and lactate joined by an ether linkage. They occur naturally as N-acetyl derivatives in peptidoglycan, the characteristic polysaccharide composing bacterial cell walls. (From Dorland, 28th ed)HemosiderinAlcohol Dehydrogenase: A zinc-containing enzyme which oxidizes primary and secondary alcohols or hemiacetals in the presence of NAD. In alcoholic fermentation, it catalyzes the final step of reducing an aldehyde to an alcohol in the presence of NADH and hydrogen.Furans: Compounds with a 5-membered ring of four carbons and an oxygen. They are aromatic heterocycles. The reduced form is tetrahydrofuran.Scattering, Radiation: The diversion of RADIATION (thermal, electromagnetic, or nuclear) from its original path as a result of interactions or collisions with atoms, molecules, or larger particles in the atmosphere or other media. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Light: That portion of the electromagnetic spectrum in the visible, ultraviolet, and infrared range.Particle Size: Relating to the size of solids.Scattering, Small Angle: Scattering of a beam of electromagnetic or acoustic RADIATION, or particles, at small angles by particles or cavities whose dimensions are many times as large as the wavelength of the radiation or the de Broglie wavelength of the scattered particles. Also know as low angle scattering. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed) Small angle scattering (SAS) techniques, small angle neutron (SANS), X-ray (SAXS), and light (SALS, or just LS) scattering, are used to characterize objects on a nanoscale.Laser Therapy, Low-Level: Treatment using irradiation with LASER light of low power intensity so that the effects are not due to heat, as they are in LASER THERAPY.Lasers: An optical source that emits photons in a coherent beam. Light Amplification by Stimulated Emission of Radiation (LASER) is brought about using devices that transform light of varying frequencies into a single intense, nearly nondivergent beam of monochromatic radiation. Lasers operate in the infrared, visible, ultraviolet, or X-ray regions of the spectrum.Micelles: Particles consisting of aggregates of molecules held loosely together by secondary bonds. The surface of micelles are usually comprised of amphiphatic compounds that are oriented in a way that minimizes the energy of interaction between the micelle and its environment. Liquids that contain large numbers of suspended micelles are referred to as EMULSIONS.Solutions: The homogeneous mixtures formed by the mixing of a solid, liquid, or gaseous substance (solute) with a liquid (the solvent), from which the dissolved substances can be recovered by physical processes. (From Grant & Hackh's Chemical Dictionary, 5th ed)Nanoparticles: Nanometer-sized particles that are nanoscale in three dimensions. They include nanocrystaline materials; NANOCAPSULES; METAL NANOPARTICLES; DENDRIMERS, and QUANTUM DOTS. The uses of nanoparticles include DRUG DELIVERY SYSTEMS and cancer targeting and imaging.Lasers, Semiconductor: Lasers with a semiconductor diode as the active medium. Diode lasers transform electric energy to light using the same principle as a light-emitting diode (LED), but with internal reflection capability, thus forming a resonator where a stimulated light can reflect back and forth, allowing only a certain wavelength to be emitted. The emission of a given device is determined by the active compound used (e.g., gallium arsenide crystals doped with aluminum or indium). Typical wavelengths are 810, 1,060 and 1,300 nm. (From UMDNS, 2005)Methods: A series of steps taken in order to conduct research.Algorithms: A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.Computer Simulation: Computer-based representation of physical systems and phenomena such as chemical processes.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Reproducibility of Results: The statistical reproducibility of measurements (often in a clinical context), including the testing of instrumentation or techniques to obtain reproducible results. The concept includes reproducibility of physiological measurements, which may be used to develop rules to assess probability or prognosis, or response to a stimulus; reproducibility of occurrence of a condition; and reproducibility of experimental results.Plant Leaves: Expanded structures, usually green, of vascular plants, characteristically consisting of a bladelike expansion attached to a stem, and functioning as the principal organ of photosynthesis and transpiration. (American Heritage Dictionary, 2d ed)Sensitivity and Specificity: Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)District of Columbia: A federal area located between Maryland and Virginia on the Potomac river; it is coextensive with Washington, D.C., which is the capital of the United States.Hepatolenticular Degeneration: A rare autosomal recessive disease characterized by the deposition of copper in the BRAIN; LIVER; CORNEA; and other organs. It is caused by defects in the ATP7B gene encoding copper-transporting ATPase 2 (EC 3.6.3.4), also known as the Wilson disease protein. The overload of copper inevitably leads to progressive liver and neurological dysfunction such as LIVER CIRRHOSIS; TREMOR; ATAXIA and intellectual deterioration. Hepatic dysfunction may precede neurologic dysfunction by several years.Metabolic Networks and Pathways: Complex sets of enzymatic reactions connected to each other via their product and substrate metabolites.Molecular Sequence Annotation: The addition of descriptive information about the function or structure of a molecular sequence to its MOLECULAR SEQUENCE DATA record.Anniversaries and Special Events: Occasions to commemorate an event or occasions designated for a specific purpose.Splenorenal Shunt, Surgical: Anastomosis of splenic vein to renal vein to relieve portal hypertension.Gene Ontology: Sets of structured vocabularies used for describing and categorizing genes, and gene products by their molecular function, involvement in biological processes, and cellular location. These vocabularies and their associations to genes and gene products (Gene Ontology annotations) are generated and curated by the Gene Ontology Consortium.Databases, Genetic: Databases devoted to knowledge about specific genes and gene products.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Pathology Department, Hospital: Hospital department which administers and provides pathology services.Camelids, New World: Ruminant mammals of South America. They are related to camels.Single-Domain Antibodies: An immunoglobulin fragment composed of one variable domain from an IMMUNOGLOBULIN HEAVY CHAIN or IMMUNOGLOBULIN LIGHT CHAIN.Immunoglobulin Heavy Chains: The largest of polypeptide chains comprising immunoglobulins. They contain 450 to 600 amino acid residues per chain, and have molecular weights of 51-72 kDa.Single-Chain Antibodies: A form of antibodies consisting only of the variable regions of the heavy and light chains (FV FRAGMENTS), connected by a small linker peptide. They are less immunogenic than complete immunoglobulin and thus have potential therapeutic use.Hepatopancreas: A primitive form of digestive gland found in marine ARTHROPODS, that contains cells similar to those found in the mammalian liver (HEPATOCYTES), and the PANCREAS.Antibodies: Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the ANTIGEN (or a very similar shape) that induced their synthesis in cells of the lymphoid series (especially PLASMA CELLS).Immunoglobulin Fragments: Partial immunoglobulin molecules resulting from selective cleavage by proteolytic enzymes or generated through PROTEIN ENGINEERING techniques.Antibody Specificity: The property of antibodies which enables them to react with some ANTIGENIC DETERMINANTS and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site.Tumor Necrosis Factor Ligand Superfamily Member 13: A member of tumor necrosis factor superfamily found on MACROPHAGES; DENDRITIC CELLS and T-LYMPHOCYTES. It occurs as transmembrane protein that can be cleaved to release a secreted form that specifically binds to TRANSMEMBRANE ACTIVATOR AND CAML INTERACTOR PROTEIN; and B CELL MATURATION ANTIGEN.Transmembrane Activator and CAML Interactor Protein: A tumor necrosis factor receptor superfamily member found expressed on peripheral B-LYMPHOCYTES. It has specificity for B-CELL MATURATION ANTIGEN and TUMOR NECROSIS FACTOR LIGAND SUPERFAMILY MEMBER 13.B-Cell Activating Factor: A tumor necrosis factor superfamily member that plays a role in the regulation of B-LYMPHOCYTE survival. It occurs as a membrane-bound protein that is cleaved to release an biologically active soluble form with specificity to TRANSMEMBRANE ACTIVATOR AND CAML INTERACTOR PROTEIN; B-CELL ACTIVATION FACTOR RECEPTOR; and B-CELL MATURATION ANTIGEN.B-Cell Maturation Antigen: A member of the tumor necrosis factor receptor superfamily found on mature B-LYMPHOCYTES. It has specificity for B CELL ACTIVATING FACTOR and TUMOR NECROSIS FACTOR LIGAND SUPERFAMILY MEMBER 13. Signaling of the receptor occurs through its association with TNF RECEPTOR-ASSOCIATED FACTORS.B-Cell Activation Factor Receptor: A member of the tumor necrosis factor receptor superfamily that specifically binds B-CELL ACTIVATING FACTOR. It is found on B-LYMPHOCYTES and plays a role in maturation and survival of B-cells. Signaling by the activated receptor occurs through its association with TNF RECEPTOR-ASSOCIATED FACTORS.Iron: A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.Evidence-Based Nursing: A way of providing nursing care that is guided by the integration of the best available scientific knowledge with nursing expertise. This approach requires nurses to critically assess relevant scientific data or research evidence, and to implement high-quality interventions for their nursing practice.Bibliometrics: The use of statistical methods in the analysis of a body of literature to reveal the historical development of subject fields and patterns of authorship, publication, and use. Formerly called statistical bibliography. (from The ALA Glossary of Library and Information Science, 1983)Aegle: A plant genus of the family RUTACEAE.Publications: Copies of a work or document distributed to the public by sale, rental, lease, or lending. (From ALA Glossary of Library and Information Science, 1983, p181)Periodicals as Topic: A publication issued at stated, more or less regular, intervals.Publishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.Bass: Common name for FISHES belonging to the order Perciformes and occurring in three different families.Research: Critical and exhaustive investigation or experimentation, having for its aim the discovery of new facts and their correct interpretation, the revision of accepted conclusions, theories, or laws in the light of newly discovered facts, or the practical application of such new or revised conclusions, theories, or laws. (Webster, 3d ed)Biomedical Research: Research that involves the application of the natural sciences, especially biology and physiology, to medicine.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.Academies and Institutes: Organizations representing specialized fields which are accepted as authoritative; may be non-governmental, university or an independent research organization, e.g., National Academy of Sciences, Brookings Institution, etc.

Overexpression of the hereditary hemochromatosis protein, HFE, in HeLa cells induces and iron-deficient phenotype. (1/232)

A transfectant HeLa cell clone expressing HFE under the control of a tetracycline-repressible promoter was generated. HFE expression was fully repressed by the presence of doxycycline, while it was strongly induced by growth in the absence of doxycycline. HFE accumulation was accompanied by a large (approximately 10-fold) decrease in H- and L-ferritin levels, by a approximately 3-4-fold increase in transferrin receptor, and a approximately 2-fold increase in iron regulatory protein activity. These indices of cellular iron deficiency were reversed by iron supplementation complexes. The overexpressed HFE immunoprecipitated together with transferrin receptor, indicating a physical association which is the likely cause for the observed approximately 30% decrease in 55Fe-transferrin incorporation after 18 h incubation. In the HFE-expressing cells the reduction in transferrin-mediated iron incorporation was partially compensated by a approximately 30% increase in non-transferrin iron incorporation from 55Fe-NTA, evident after prolonged, 18 h, incubations. The findings indicate that HFE binding to transferrin receptor reduces cellular iron availability and regulates the balance between transferrin-mediated and non-transferrin-mediated cellular iron incorporation.  (+info)

Iron primes hepatic macrophages for NF-kappaB activation in alcoholic liver injury. (2/232)

NF-kappaB activation induced by lipopolysaccharide (LPS) in cultured hepatic macrophages (HM) may be abrogated by pretreatment of cells with a lipophilic iron chelator, 1,2-dimethyl-3-hydroxypyrid-4-one (L1, deferiprone), suggesting a role for iron in this molecular event [M. Lin, M., R. A. Rippe, O. Niemela, G. Brittenham, and H. Tsukamoto, Am. J. Physiol. 272 (Gastrointest. Liver Physiol. 35): G1355-G1364, 1997]. To ascertain the relevance in vivo of this hypothesis, HM from an experimental model of alcoholic liver injury were examined for the relationship between nuclear factor (NF)-kappaB activation and iron storage. HM showed a significant increase in nonheme iron concentration (+70%), accompanied by enhanced generation of electron paramagnetic resonance-detected radicals (+200%), NF-kappaB activation (+100%), and tumor necrosis factor-alpha (+150%) and macrophage inflammatory protein-1 (+280%) mRNA induction. Treatment of the cells ex vivo with L1 normalized all these parameters. HM content of ferritin protein, ferritin L chain mRNA, and hemeoxygenase-1 mRNA and splenic content of nonheme iron were increased, suggesting enhanced heme turnover as a cause of the increased iron storage and NF-kappaB activation. To test this possibility, increased iron content in HM was reproduced in vitro by phagocytosis of heat-treated red blood cells. Treatment caused a 40% increase in nonheme iron concentration and accentuated LPS-induced NF-kappaB activation twofold. Both effects could be abolished by pretreatment of cells with zinc protoporphyrin, a hemeoxygenase inhibitor. To extend this observation, animals were splenectomized before 9-wk alcohol feeding. Splenectomy resulted in further increments in HM nonheme iron storage (+60%) and NF-kappaB activation (+90%) and mononuclear cell infiltration (+450%), particularly around the iron-loaded HM in alcohol-fed animals. These results support the pivotal role of heme-derived iron in priming HM for NF-kappaB activation and expression of proinflammatory genes in alcoholic liver injury.  (+info)

Interactions and aggregation of apoferritin molecules in solution: effects of added electrolytes. (3/232)

We have studied the structure of the protein species and the protein-protein interactions in solutions containing two apoferritin molecular forms, monomers and dimers, in the presence of Na(+) and Cd(2+) ions. We used chromatographic, and static and dynamic light scattering techniques, and atomic force microscopy (AFM). Size-exclusion chromatography was used to isolate these two protein fractions. The sizes and shapes of the monomers and dimers were determined by dynamic light scattering and AFM. Although the monomer is an apparent sphere with a diameter corresponding to previous x-ray crystallography determinations, the dimer shape corresponds to two, bound monomer spheres. Static light scattering was applied to characterize the interactions between solute molecules of monomers and dimers in terms of the second osmotic virial coefficients. The results for the monomers indicate that Na(+) ions cause strong intermolecular repulsion even at concentrations higher than 0.15 M, contrary to the predictions of the commonly applied Derjaguin-Landau-Verwey-Overbeek theory. We argue that the reason for such behavior is hydration force due to the formation of a water shell around the protein molecules with the help of the sodium ions. The addition of even small amounts of Cd(2+) changes the repulsive interactions to attractive but does not lead to oligomer formation, at least at the protein concentrations used. Thus, the two ions provide examples of strong specificity of their interactions with the protein molecules. In solutions of the apoferritin dimer, the molecules attract even in the presence of Na(+) only, indicating a change in the surface of the apoferritin molecule. In view of the strong repulsion between the monomers, this indicates that the dimers and higher oligomers form only after partial denaturation of some of the apoferritin monomers. These observations suggest that aggregation and self-assembly of protein molecules or molecular subunits may be driven by forces other than those responsible for crystallization and other phase transitions in the protein solution.  (+info)

The role of lactoferrin in the bactericidal function of polymorphonuclear leucocytes. (4/232)

Rabbit polymorphonuclear leucocytes contain the iron-binding protein lactoferrin, and can rapidly phagocytose and destroy Pseudomonas aeruginosa. The lactoferrin normally has a large unsaturated iron-binding capacity. If the cells are exposed to a ferritin-antibody complex, large amounts of this are phagocytosed and appear in the cytoplasmic granules and phagosomes. This leads to saturation of the cellular iron-binding protein with Fe. In these circumstances, the bactericidal power of the cells is greatly reduced with the result that some phagocytosed bacteria survive and eventually grow and destroy the cells. An apoferritin-antibody complex used as a control is also phagocytosed but has no effect on the bactericidal power of the cell. The results support the view that lactoferrin plays an essential role in the bactericidal power of the cell.  (+info)

Overexpression of wild type and mutated human ferritin H-chain in HeLa cells: in vivo role of ferritin ferroxidase activity. (5/232)

Transfectant HeLa cells were generated that expressed human ferritin H-chain wild type and an H-chain mutant with inactivated ferroxidase activity under the control of the tetracycline-responsive promoter (Tet-off). The clones accumulated exogenous ferritins up to levels 14-16-fold over background, half of which were as H-chain homopolymers. This had no evident effect in the mutant ferritin clone, whereas it induced an iron-deficient phenotype in the H-ferritin wild type clone, manifested by approximately 5-fold increase of IRPs activity, approximately 2.5-fold increase of transferrin receptor, approximately 1.8-fold increase in iron-transferrin iron uptake, and approximately 50% reduction of labile iron pool. Overexpression of the H-ferritin, but not of the mutant ferritin, strongly reduced cell growth and increased resistance to H(2)O(2) toxicity, effects that were reverted by prolonged incubation in iron-supplemented medium. The results show that in HeLa cells H-ferritin regulates the metabolic iron pool with a mechanism dependent on the functionality of the ferroxidase centers, and this affects, in opposite directions, cellular growth and resistance to oxidative damage. This, and the finding that also in vivo H-chain homopolymers are much less efficient than the H/L heteropolymers in taking up iron, indicate that functional activity of H-ferritin in HeLa cells is that predicted from the in vitro data.  (+info)

Hydrogen ion interactions of horse spleen ferritin and apoferritin. (6/232)

The interactions of horse spleen ferritin and its derivative apoferritin with H+ ions were studied by potentiometric and spectrophotometric titration; to aid in data analysis, heats of ionization over a limited pH range and amide content were also determined. Per apoferritin subunit, all tyrosine and cysteine side chains, two of the nine lysine side chains and at least three of the six histidine side chains were found not to titrate; a preliminary but self-consistent analysis of the titration data is proposed. The titration curve of ferritin was identical with that of apoferritin in the pH range 5.5 to 3. In addition, under the conditions used, the reactivities of ferritin histidines to bromoacetate and of ferritin lysines to formaldehyde were identical with those in apoferritin. Above pH 8, a time-dependent titration of the ferritin core occurs which prevents comparison of the titration curves of the two proteins in this region. However, in the pH regions 5.5 to 7.5, two extra groups per subunit titrate reversibly in ferritin relative to apoferritin. Moreover, although the isoionic points of ferritin and apoferritin are identical in water, the isoionic point of ferritin is 0.5 pH unit lower than that of apoferritin in 0.16 to 1 M KCl. The different effects of KCl and NaCl on the two proteins indicate the presence of cation binding sites in ferritin that are absent in apoferritin and possibly also the presence of anion binding sites in apoferritin that are occupied in ferritin by anions of the core. The difference between the isoionic points of the two proteins in KCl has been interpreted to indicate the presence of approximately 2 phosphate residues per ferritin subunit which serve as cation binding sites and which are negatively charged at the isoionic point in KCl. These phosphates may also represent the additional residues that titrate in ferritin between pH 5.5 and 7.5, or may interact with positively charged residues on the inner surface of the ferritin shell, or both.  (+info)

Expression and characterization of the chemokine receptors CCR2 and CCR5 in mice. (7/232)

The chemokine receptors CCR2 and CCR5 play important roles in the recruitment of monocytes/macrophages and T cells. To better understand the role of both receptors in murine models of inflammatory diseases and to recognize potential problems when correlating these data to humans, we have generated mAbs against murine CCR2 and CCR5. In mice CCR2 is homogeneously expressed on monocytes and on 2--15% of T cells, closely resembling the expression pattern in humans. In contrast to humans, murine NK cells are highly CCR5 positive. In addition, CCR5 is expressed on 3--10% of CD4 and 10--40% of CD8-positive T cells and is weakly detectable on monocytes. Using a model of immune complex nephritis, we examined the effects of inflammation on chemokine receptor expression and found a 10-fold enrichment of CCR5(+) and CCR2(+) T cells in the inflamed kidneys. The activity of various chemokines and the antagonistic properties of the mAbs were measured by ligand-induced internalization of CCR2 and CCR5 on primary leukocytes. The Ab MC-21 (anti-CCR2) reduced the activity of murine monocyte chemotactic protein 1 by 95%, whereas the Ab MC-68 (anti-CCR5) blocked over 99% of the macrophage-inflammatory protein 1alpha and RANTES activity. MC-21 and MC-68 efficiently blocked the ligand binding to CCR2 and CCR5 with an IC(50) of 0.09 and 0.6--1.0 microg/ml, respectively. In good correlation to these in vitro data, MC-21 almost completely prevented the influx of monocytes in thioglycollate-induced peritonitis. Therefore, both Abs appear as useful reagents to further study the role of CCR2 and CCR5 in murine disease models.  (+info)

Chemokine and chemokine receptor expression during initiation and resolution of immune complex glomerulonephritis. (8/232)

Chemokines participate in leukocyte infiltration, which plays a major role in glomerular injury during immune complex glomerulonephritis (IC-GN). Because target cell expression of chemokine receptors (CCR) is thought to mediate leukocyte migration, the expression pattern of chemokines and CCR in a model of IC-GN was examined. The transient course and predominant glomerular pathology of this model allows the examination of both the induction and resolution phases of IC-GN. GN was induced in mice by daily apoferritin injection for 2 wk. Urine samples and kidneys were obtained at 1, 2, and 4 wk. Albuminuria was noted at 2 wk, but resolved after 4 wk. This was associated with glomerular IC deposits and mesangial proliferation. Glomerular macrophage infiltration was prominent at 1 and 2 wk, which resolved at 4 wk. Expression of monocyte chemoattractant protein-1 (MCP-1) and RANTES mRNA was upregulated at week 1 and decreased to control levels at weeks 2 and 4. The expression was localized to glomeruli by in situ hybridization and immunohistochemistry. The mRNA of CCR1, CCR2, and CCR5 but not CCR3 or CCR4 were upregulated at week 1 and decreased at weeks 2 and 4. Expression of CCR5 was located to the glomerulus by in situ hybridization and quantitative reverse transcription-PCR of isolated glomeruli. In summary, in a model of transient IC-GN, MCP-1 and RANTES and their receptors CCR1, CCR2, and CCR5 are expressed early and are already downregulated at the peak of proteinuria and leukocyte infiltration. Resolution of glomerulonephritis is associated with a return to baseline of chemokine and CCR expression. Therefore, it is concluded that glomerular MCP-1 and RANTES production directs circulating leukocytes that express CCR1, CCR2, and CCR5 into the glomerulus. After initiating GN, MCP-1 and RANTES and their receptors are readily downregulated.  (+info)

*FTH1

Addison JM, Fitton JE, Lewis WG, May K, Harrison PM (Nov 1983). "The amino acid sequence of human liver apoferritin". FEBS ... "Cloning and sequencing of a full length cDNA coding for a human apoferritin H chain: evidence for a multigene family". The EMBO ... "Structure of gene and pseudogenes of human apoferritin H". Nucleic Acids Research. 14 (2): 721-36. doi:10.1093/nar/14.2.721. ...

*Ferritin light chain

Addison JM, Fitton JE, Lewis WG, May K, Harrison PM (November 1983). "The amino acid sequence of human liver apoferritin". FEBS ... "Cloning of the gene coding for human L apoferritin". Nucleic Acids Res. 14 (7): 2863-76. doi:10.1093/nar/14.7.2863. PMC 339708 ... "Negative and positive elements in the promoter region of the human apoferritin L gene". Biochem. Biophys. Res. Commun. 215 (1 ...

*Philip Bourne

"Helix packing and subunit conformation in horse spleen apoferritin". Nature. 288 (5788): 298-300. doi:10.1038/288298a0. PMID ...

*Ferritin

Apoferritin binds to free ferrous iron and stores it in the ferric state. As ferritin accumulates within cells of the ... Ferritin that is not combined with iron is called apoferritin. Ferritin genes are highly conserved between species. All ... "Size-Selective Olefin Hydrogenation by a Pd Nanocluster Provided in an Apo-Ferritin Cage". Angewandte Chemie. 43 (19): 2527-30 ...

*Sam Granick

A second paper, by Granick and Michaelis, showed that iron could be removed from ferritin to produce apoferritin. Granick went ... Kresge, Nicole; Robert D. Simoni; Robert L. Hill (2004-12-03). "The Characterization of Ferritin and Apoferritin by Leonor ...

*List of MeSH codes (D12.776)

... apoferritin MeSH D12.776.556.579.374.187 - hemerythrin MeSH D12.776.556.579.374.281 - inositol oxygenase MeSH D12.776.556.579. ...

*List of MeSH codes (D12.776.157)

... apoferritin MeSH D12.776.157.427.374.187 -- hemerythrin MeSH D12.776.157.427.374.375 -- iron-sulfur proteins MeSH D12.776. ...

*Human iron metabolism

... which is accomplished by Fe3+ binding to apoferritin (in which case the iron will leave the body when the cell dies and is ...
Ferritin heavy chain is a ferroxidase enzyme that in humans is encoded by the FTH1 gene. This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. FTH1 has been shown to interact with Ferritin light chain. Ferritin GRCh38: Ensembl release 89: ENSG00000167996 - Ensembl, May 2017 GRCm38: Ensembl release 89: ENSMUSG00000024661 - Ensembl, May 2017 "Human PubMed Reference:". "Mouse PubMed Reference:". Hentze MW, Keim S, ...
Mutations in the coding sequence of the ferritin light chain (FTL) gene cause a neurodegenerative disease known as neuroferritinopathy or hereditary ferritinopathy, which is characterized by the presence of intracellular inclusion bodies containing the mutant FTL polypeptide and by abnormal accumulation of iron in the brain. Here, we describe the x-ray crystallographic structure and report functional studies of ferritin homopolymers formed from the mutant FTL polypeptide p.Phe167SerfsX26, which has a C terminus that is altered in amino acid sequence and length. The structure was determined and refined to 2.85 A resolution and was very similar to the wild type between residues Ile-5 and Arg-154. However, instead of the E-helices normally present in wild type ferritin, the C-terminal sequences of all 24 mutant subunits showed substantial amounts of disorder, leading to multiple C-terminal polypeptide conformations and a large disruption of the normally tiny 4-fold axis pores. Functional studies ...
Long-lived lens proteins undergo little turnover but show a high degree of enzymatic and non-enzymatic posttranslational modification. These modifications start early in life and continue as the lens ages, resulting in the accumulation of modified proteins [11]. Changes in lens protein structure lead to formation of high molecular weight aggregates with decreased solubility, a factor that contributes to the increase in the light-scattering characteristic of older lenses [12]. Lens proteins can also be modified by partial or complete proteolytic degradation, which is particularly dramatic during the transformation of epithelial cells into fiber cells [13]. Furthermore, proteosomal and non-proteosomal degradation systems are present in lens fiber cells. The activity of both systems declines with age, but is still detectable in mature fiber cells [14]. Analysis of the distribution pattern and characteristics of ferritin chains in lens fiber cells revealed similar changes to those described for lens ...
Fig. 8. Accumulation of CD8+ T-lymphocytes in tumor regions with expression of cFTH1. A, IHC staining of FTH1, CD3, CD4 and CD8 in TNBC whole tissue sections (yellow arrows: CD4+ T-lymphocytes; red arrows: CD8+ T-lymphocytes); B, Box plots summarize the observation in (A). CD4+/CD8+ ratio was significantly increased in TNBC samples with high expression of cFTH1. Data are presented as the median ± interquartile range (Mann-Whitney U test, n = 15 per group); C, A proposed functional model of cFTH1 in the context of the antigen processing and presentation pathway: Ferritin complex captures intracellular Fe2+ ions (green dots) and converts them into Fe3+ ions (yellow dots). Accumulation of Fe3+ iron in tumor cells increases in response to inflammation, and IFN γ (red dots) can enhance the inflammatory response of tumor cells. Together, inflammatory signals can enhance processing of cytosolic antigens through the proteasome, heat shock proteins (HSP), and antigen peptide transporters (TAP), ...
Crichton R. R., Millar J. A., Cumming R. L. C., Bryce C. F. A., The organ-specificity of ferritin in human and horse liver and spleen, 10.1042/bj1310051 ...
Complete information for FTLP17 gene (Pseudogene), Ferritin Light Chain Pseudogene 17, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
SED021Mu, FTH1; FTHL6; PIG15; PLIF; Ferritin Heavy Chain; Apoferritin; Placenta Immunoregulatory Factor; Proliferation-Inducing Protein 15; Cell proliferation-inducing gene 15 protein | Products for research use only!
1DAT: X-ray structure of recombinant horse L-chain apoferritin at 2.0 angstrom resolution: Implications for stability and function.
Biochemistry CRP1.50|5.0mg/L Ferritin78.320 - 150ug/L Thyroid Function TSH1.050.27 - 4.20mIU/L T4 Total87.464.5 - 142.0nmol/L Free T415.5512 - 22pmol/L Free T34.623.1 - 6.8pmol/L Immunology Anti...
Read reviews, compare customer ratings, see screenshots and learn more about FTL: Faster Than Light. Download FTL: Faster Than Light and enjoy it on your Apple TV.
The tags customers have most frequently applied to FTL: Faster Than Light + Soundtrack have also been applied to these products ...
And so my FTL campaign, the flight of the starship Moggy, limps to the games penultimate sector. It seems impossible that were still alive at this point - let
Here I am again, THIS time I have a little more time on my hands. I was able to actually sit down, do some crafting AND make a card! WOO HOO!! YAY, me!! LOL This time, when I did the cleanandsimplestamping.blogspot.com layout for THIS week, I didnt really have a stamp set, color scheme or…
Northside Manipal Hospital in Malleshwaram, Bangalore. Book Appointment, Consult Doctors Online, View Doctor Fees, Contact Number, Address for Northside Manipal Hospital - Dr. Shraddha Bahirwani | Lybrate
The +51G,C mutation has already been described in 2 father-child pairs with moderate hyperferritinemia and clinically silent bilateral cataract.6,7 The first father-daughter pair (50 and 15 years old, respectively) were Canadians, like our proband. Both had serum ferritin levels below 1000 μg/L and only fine bilateral lenticular changes were observed by slit lamp examination.6 The second father-son pair (46 and 19 years old, respectively) was of Caucasian origin. They displayed serum ferritin levels of 1291 and 1251 μg/L, respectively. Slit-lamp and dilated funduscopic examinations revealed bilateral white breadcrumb-like nuclear and cortical lens opacity, whereas visual acuity was not affected.7 In our case, the proband displayed higher ferritin levels (roughly twice the levels observed in heterozygotes) but as for heterozygous affected patients, visual symptoms were mild and ophthalmological examination revealed bilateral cataract in the third decade only. However, it is noteworthy that ...
Ferritins (MW: ~ 450 kD) are polymeric proteins composed of 2 subunits a heavy chain and a light chain polypeptide, that reversibly bind and store iron in liver, spleen and bone marrow. The ferritin molecule consists of 24 self-assembling polypeptide subunits composed of the heavy and light chains. Ferritin light chain is the main intracellular iron storage protein. The proportion of heavy and light chain composing the ferritin molecule varies from tissue to tissue. This variation accounts for the differences in the rate of iron uptake and release in different tissues or organs. Recombinant Human Ferritin Light Chain is produced in E.coli as a single non-glycosylated polypeptide having a molecular weight of 19 kDa. Clinically, the monitoring of serum ferritin levels aides in the diagnosis and management of iron metabolic disorders. Serum levels increase in hepatic diseases, various malignancies, inflammation and late stage hemochromatosis. Ferritin levels are also indicative of the ero
When ferritin is reconstituted from Fe and apoferritin in vitro in the presence of Pi, the product obtained differs both from native ferritin and from ferritin reconstituted in the absence of Pi. When the latter is incubated with Pi the product resembles native ferritin with respect both to the pattern of Pi incorporated per molecule or per Fe atom and to the ease of release of this Pi relative to Fe release. It is concluded that much of the Pi of native ferritin is adsorbed on surfaces of ferritin iron-core crystallites. The results also suggest that Pi is not present at the intracellular site of Fe incorporation into ferritin, but is added after Fe. ...
Ferritin is the intracellular protein responsible for the sequestration, storage and release of iron. Ferritin can accumulate up to 4500 iron atoms as a ferrihydrite mineral in a protein shell and releases these iron atoms when there is an increase in the cells need for bioavailable iron. The ferritin protein shell consists of 24 protein subunits of two types, the H-subunit and the L-subunit. These ferritin subunits perform different functions in the mineralization process of iron. The ferritin protein shell can exist as various combinations of these two subunit types, giving rise to heteropolymers or isoferritins. Isoferritins are functionally distinct and characteristic populations of isoferritins are found depending on the type of cell, the proliferation status of the cell and the presence of disease. The synthesis of ferritin is regulated both transcriptionally and translationally. Translation of ferritin subunit mRNA is increased or decreased, depending on the labile iron pool and is ...
Goat anti human ferritin antibody recognizes Human Ferritin, a large globular protein found in the liver, intestines and spleen that funct
Ferritin- The ferritins are a class of iron storage proteins found widely distributed among the animal, plant and microbial kingdoms. These proteins consist of 24 subunits assembled into hollow spherical structure within which iron is stored as a hydrous ferric oxide mineral core. Our research focuses on understanding the redox and hydrolysis-mineralization mechanisms by which iron is acquired and released by ferritin. We seek to understand the structural attributes by which this unusual protein is capable of reversibly storing such large quantities of iron (4500 Fe/protein). A variety of spectroscopic, kinetic and thermochemical techniques and site-directed mutagenesis are employed in this research (see Methodologies and Major Instrumentation ...
2. As we discussed yesterday, ferritin is an iron storage protein. Basically, it functions as a giant ball that sequesters Fe3+ by polymerizing it with oxygen-rich anions (sulfate, phosphate, hydroxide). In the PDB, look at file 1AEW. If you download it directly into RasMol, you will see just one chain, but ferritin is made up of a bunch of identical chains. So, when you have pulled up 1AEW in the PDB, look to the left-hand margin. Under other resources go to the EBI MSD Macromolecule File Server, which will give you the quarternary structure version of 1AEW. Save it on the desktop, change the filename to .pdb and open it in RasMol.. ...
Several novel findings on Drosophila ferritin are described in this work. We show that the absence of either Fer1HCH or Fer2LCH results in embryonic lethality and that modified Fer1HCH subunits (mutant in the ferroxidase center or GFP tagged) cannot substitute for lack of Fer1HCH. However, if the same modified subunits are expressed in the presence of wild-type subunits, they can be integrated into ferritin holomers without inducing dominant-negative effects. Analysis of heterozygous loss-of-function ferritin fly mutants or flies overexpressing ferritin subunits revealed that a constant ratio of Fer1HCH and Fer2LCH is maintained, independent of their internal transcriptional expression levels. The structural cooperation of the two subunits that is secured via disulfide bonds (Hamburger et al. 2005) likely explains these observations. A post-transcriptional mechanism, possibly involving the degradation of subunits that are present in excess, ensures the presence of equal amounts of the two ...
Discussion:. Energetics in animals is based on the availability of reducing equivalents, specifically hydrogen (H+) which is replenished byconsumed as carbohydrates and fats, that react with oxygen to generate water and hydrogen via mitochondrial oxidative phosphorylation.. The older evolutionary pathways makes far less energy than complex animals need for chronic living. Glucose is cleaved into pyruvate via glycolysis within the cytosol, reducing cytosolic NAD+ to NADH (reduced nicotinamide adenine nucleotide). The pyruvate then enters the mitochondrion via pyruvate dehydrogenase (PDH), resulting in mitochondrial acetyl-CoA (main electron provider for ECT), NADH + H+, and CO2. The acetyl-CoA then enters the tricarboxylic acid (TCA) cycle, which strips the hydrogens from the organic acids, thereby generating NADH + H+.. The new pathways (beta oxidation) are required for complex life because they provide a lot more electrons for tunneling. The more electrons the more life you live.. Fatty acids ...
Mouse monoclonal antibody raised against a full length native FTL. Native purified human FTL. (H00002512-M04) - Products - Abnova
Mouse monoclonal antibody raised against a full length native FTL. Native purified human FTL. (H00002512-M09) - Products - Abnova
Human ferritins have been extensively studied to be used as nanocarriers for diverse applications and could represent a convenient alternative for targeted delivery of anticancer drugs and imaging agents. However, the most relevant limitation to their applications is the need for highly acidic experimental c
FTL: Faster Than Light is a tactical spaceship combat simulator, however rather than commanding a ship directly, the player manages and commands the crew of a ship in addition to several ship systems (power, weapons, shields, etc). Navigating the ship across a sector of space is turn-based, but ship...
Looking for FABORY HHCS,7/8-9x5-1/2,Black Oxide,Gr 5,PK20 (42HA89)? Graingers got your back. Price:$95.00. Easy ordering & convenient delivery. Log-in or register for your pricing.
Looking for FABORY HHCS,3/8-24x2,Black Oxide,Gr 8,PK300 (42HP52)? Graingers got your back. Price:$167.50. Easy ordering & convenient delivery. Log-in or register for your pricing.
Gentaur molecular products has all kinds of products like :search , BioBasic \ Ferritin \ FB0457 for more molecular products just contact us
Gentaur molecular products has all kinds of products like :BioBasic , BioBasic \ Ferritin \ FB0457 for more molecular products just contact us
Reactions and interactions of iron and oxygen can be both beneficial and detrimental to cells and tissues. Iron is mainly found in our blood where it functions as a mediator in the transport of oxygen to the cells and is further vital for the cellular respiration reducing the oxygen to water. The flexible redox state of iron makes it ideal to contribute in single electron transfers, but may also catalyze reactions with oxygen resulting in cell damaging reactive oxygen species (ROS). Normally the cells are protected against iron toxicity by controlling iron uptake and storage. When the intracellular demand for iron increases; the iron uptake is promoted by increasing the expression of transferrin receptor (TfR) and by decreasing the expression of the iron storage protein ferritin. Ferritin has a central role in the cellular iron detoxification by keeping it in a non reactive but still bioavailable form. However, in neurodegenerative diseases like in Alzheimers and Parkinsons disease the iron ...
Close The Infona portal uses cookies, i.e. strings of text saved by a browser on the users device. The portal can access those files and use them to remember the users data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser. ...
Recombinant ferritin is an excellent template for the synthesis of magnetic nanoparticles. This paper describes carefully performed experiments both to identify ironoxides within nanoparticles and to measure the number of iron atoms in the cores of recombinant human H-chain ferritin (HFn), based on spectroscopy techniques. Using electron energy-loss spectroscopy (EELS) analysis, magnetite (Fe3O4) has been unequivocally identified as the ironoxide formed within HFn cores under special preparation conditions. Atom counting analysis by EELS and high-angle annular dark-field imaging further allowed the correlation of the particle sizes to the real Fe atom numbers in a quantitative manner. These results help clarify some structural confusion between magnetite and maghemite (γ-Fe2O3), and also provide standard data for the number of Fe atoms within Fe3O4 particles of a given size, whose use is not limited to cases of magnetite synthesized in the cores of recombinant human ferritin.
Iron is required for normal cell growth and proliferation. However, excess iron is potentially harmful, as it can catalyse the formation of toxic reactive oxygen species (ROS) via Fenton chemistry. For this reason, cells have evolved highly regulated mechanisms for controlling intracellular iron levels. Chief among these is the sequestration of iron in ferritin. Ferritin is a 24 subunit protein composed of two subunit types, termed H and L. The ferritin H subunit has a potent ferroxidase activity that catalyses the oxidation of ferrous iron, whereas ferritin L plays a role in iron nucleation and protein stability. In the present study we report that increased synthesis of both subunits of ferritin occurs in HeLa cells exposed to oxidative stress. An increase in the activity of iron responsive element binding proteins in response to oxidative stress was also observed. However, this activation was transient, allowing ferritin protein induction to subsequently proceed. To assess whether ferritin ...
Ferritins are ubiquitous and can be found in practically all organisms that utilize Fe. They are composed of 24 subunits forming a hollow sphere with an inner cavity of ~80 A in diameter. The main function of ferritin is to oxidize the cytotoxic Fe(2+) ions and store the oxidized Fe in the inner cavity. It has been established that the initial step of rapid oxidation of Fe(2+) (ferroxidation) by H-type ferritins, found in vertebrates, occurs at a diiron binding center, termed the ferroxidase center. In bacterial ferritins, however, X-ray crystallographic evidence and amino acid sequence analysis revealed a trinuclear Fe binding center comprising a binuclear Fe binding center (sites A and B), homologous to the ferroxidase center of H-type ferritin, and an adjacent mononuclear Fe binding site (site C). In an effort to obtain further evidence supporting the presence of a trinuclear Fe binding center in bacterial ferritins and to gain information on the states of the iron bound to the trinuclear ...
Looking for online definition of H-chain in the Medical Dictionary? H-chain explanation free. What is H-chain? Meaning of H-chain medical term. What does H-chain mean?
Over time, some gene copies mutate to lose their function entirely. Such so-called pseudogenes may arise through accumulation of mutations that A gene family is descended from a common ancestral gene. prevent translation of the gene, such as an insertion or deletion that stops translation at the beginning of the gene sequence. Pseudogenes also arise from mutation in a genes promoter region. The promoter is the site at the beginning of the gene that attracts the enzyme called RNA polymerase. Without a functional promoter, the gene cannot be transcribed effectively, and so cannot lead to protein production.. Retroposition is a very common source of pseudogenes. Pseudogenes have been discovered because their sequences are similar to functional genes. In humans, pseudogenes are known to exist for topoisomerase (a gene that cuts DNA to prevent twisting), ferritin (an iron storage protein), two different forms of actin, and many other genes.. ...
Homologs from the ferric uptake regulator Hair as well as the iron storage space proteins ferritin play a central function in maintaining iron homeostasis in bacterias. out by various other metals. The gram-negative microaerophilic bacterial pathogen colonizes the mucus level of the individual tummy (12, 20). Its hostile ecological specific niche market provides necessitated the […]. ...
Nobody has yet worked out how to make a good nanobattery, so nanoscale devices are typically driven by power sources many times their own size. A key problem is how to assemble a battery on such a tiny scale and a number of research groups have been working on exploiting the way biological molecules self-assemble for this task.. NASA says one promising avenue is exploiting the ability of the protein ferritin to carry either a positive or negative charge. Ferritin also self assembles relatively easily into a uniform nanolayer. So, the agency says, it is straightforward to create a layer of ferritin and then cover it with another layer of the opposite charge. The result is a capacitor just a few nanometres thick that can store charge between its layers - in other words a battery. Adding more layers of alternately charged ferritin increases the capacitance of this bio-nanobattery. NASA reckons its battery is not only stable and robust but can be produced easily and quickly too.. Justin ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
Definition : Immunoassay reagents intended to perform qualitative and/or quantitative analyses on a body fluid sample (typically serum) to determine the level of ferritin, an iron-apoferritin complex, one of the main forms of iron storage in the body. Ferritin is present in the blood in very low concentrations, but it usually reflects the variation in the total iron body stores. Decreased levels of ferritin are found very early in the development of iron deficiency in otherwise healthy patients; increased levels of ferritin are associated with chronic infections, rheumatoid arthritis, renal diseases, a variety of malignancies , viral hepatitis, and other diseases.. Entry Terms : "Ferritin Determination Reagents" , "Reagents, Ferritin" , "Reagents, Immunoassay, Anemia Test, Ferritin". UMDC code : 17342 ...
After installation, FTL may fail to run due to a Text file busy error (characterised in Steam by your portrait border going green then blue again). The easiest way to mend this is to just reboot your system. Upon logging back in FTL should run. The Steam overlay in FTL does not function as it is not a 3D accelerated game. Because of this the desktop notifications will be visible. If playing in fullscreen, therefore, these notifications in some systems may steal focus and revert you back to windowed mode with no way of going back to fullscreen without relaunching. The binaries for FTL on Steam have no DRM and it is possible to run the game without Steam running, so in some cases that may be optimum - just ensure that you launch FTL via the launcher script in ...
Iron is a metal that is essential for all living things as it is heavily involved in cell redox reactions and the electron transport chain (a major part of aerobic respiration). However it is strongly reactive with oxygen - outside of living organisms this leads to rust, inside it can lead to the production of dangerous reactive oxygen species - and therefore needs to be controlled and contained within the cell. In order to provide this control, all living organisms (apart from yeast, weirdly enough) use a protein called ferritin. Multiple subunits of ferritin proteins (usually 24, although occasionally only 12) form an outer shell, with a central cavity that can contain around 2000-400 individual ferric ions (iron ions) keeping them safely out of harms way ...
Promotes the biosynthesis of heme and assembly and repair of iron-sulfur clusters by delivering Fe(2+) to proteins involved in these pathways. May play a role in the protection against iron-catalyzed oxidative stress through its ability to catalyze the oxidation of Fe(2+) to Fe(3+); the oligomeric form but not the monomeric form has in vitro ferroxidase activity. May be able to store large amounts of iron in the form of a ferrihydrite mineral by oligomerization; however, the physiological relevance is unsure as reports are conflicting and the function has only been shown using heterologous overexpression systems. Modulates the RNA-binding activity of ACO1 ...
First, let me say what you read here is going to be wrong in several ways. HFT covers such a wide path of trading that different parties participate or are impacted in different ways. I wanted to put this out there as a starting point . Hopefully the comments will help further educate us all. 1. Electronic trading is part of HFT, but not all electronic trading is high frequency trading.. Trading equities and other financial instruments has been around for a long time. it is Electronic Trading that has lead to far smaller spreads and lower actual trading costs from your broker. Very often HFT companies take credit for reducing spreads. They did not. Electronic trading did.. We all trade electronically now. Its no big deal. 2. Speed is not a problem. People like to look at the speed of trading as the problem. It is not. We have had a need for speed since the first stock quotes were communicated cross country via telegraph. The search for speed has been never ending. While i dont think co location ...
Bad puns and video games since 1999.. This site © 2020 Gamer Network. All Rights Reserved. No part of this site or its content may be reproduced without the permission of the copyright holder.. ...
The FTL then decides if the find is anything important. For instance, a 20 year old soda bottle with moss inside it is not a clue, nor is a deer footprint. The FTL tells the navigator to plot the exact location of the team, (which should be easy if theyve been keeping track all along) and asks the radio operator to contact base. Everybody else on the team stays put, so you know where to begin if base tells you to continue on the task. Nows a good time to have a snack or drink some water ...
In seltenen Fällen können Mutationen im FTH1-Gen, das für die schwere Kette von Ferritin kodiert, zu Hämochromatose ähnlichen Erkrankungen führen, die mit einer Hyperferritinämie einhergehen.
Ferritin is a protein in the bodys cells that is responsible for the storage of iron, according to Healthline. Cells irelease ferritin when they receive a signal that the body needs more red blood...
Ferritin is a protein found inside the body that aids in storing iron in the body. A blood test is used to measure the amount of ferritin in the body,...
Acute administration of iron to rats has been previously shown to induce liver ferritin synthesis by increasing the translation of inactive cytoplasmic ferritin mRNAs for both heavy (H) and light (L) subunits by mobilizing them onto polyribosomes. In this report rat hepatoma cells in culture are used to explore the relationship of this response to intracellular iron levels. After adding iron as ferric ammonium citrate to the medium, latent ferritin H- and L-mRNAs were extensively transferred to polyribosomes, accompanied by increased uptake of [35S]methionine into ferritin protein. Because total cellular levels of L- and H-mRNA were not significantly changed by exposure to iron, the increased ferritin mRNAs on polyribosomes most probably come from an inactive cytoplasmic pool, consistent with the inability of actinomycin-D and of cordycepin to inhibit iron-induced ferritin synthesis. When deferoxamine mesylate, an intracellular iron chelator, was added after the addition of iron to the medium, ferritin
Rabbit polyclonal Ferritin Heavy Chain antibody validated for WB, IHC, ICC/IF and tested in Human and Mouse. Referenced in 11 publications and 2 independent…
Ferritin is the principal iron storage molecule found in animal cells. It is a globular protein complex about 10 nm in diameter composed of 24 subunits arranged as a hollow shell (apoferritin) in which iron atoms can be packed. A typical ferritin molecule contains about 2000 iron atoms at its core, but potentially may hold up to 4500. Pores are present on the surface of the complex allowing iron atoms to enter and be released from the core. In this manner ferritin is able to regulate levels of intracellular iron ...
Any nutritional imbalance can result in a host of disorders and diseases in your pet. If there is excessive iron in the blood, it accumulates in the birds main organs, and is generally referred to as Iron Storage Disease.
Health,Denver Colorado (PRWEB) November 05 2013 People whose lean muscles prevent them from getting in shape and getting fit can now confidently opt for Chad Waterburys HFT program announces Daily Gossip magazine after reviewing the product. Ac,HFT,Review,Reveals,Chad,Waterburys,New,Training,Program,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
FTL: Faster Than Light is a Roguelike-like spaceship simulation game released by Subset Games. The player controls the crew of a lone spaceship affiliated …
Ferritin levels are important for everyone-whether youre male or female, an avid exerciser or a couch potato. If your ferritin levels are too low, you may feel fatigued and run down, which can be a problem for anyone, no matter their level of physical activity. To find out exactly what your ferritin levels are, sign up for an InsideTracker plan. If your levels are out-of-range, InsideTracker will give you suggestions for diet, exercise, supplement and lifestyle changes to help you optimize them.
This "spaceship simulation roguelike-like" allows you to take your ship and crew on an adventure through a randomly generated galaxy filled with glory and bitter defeat.
Ferritin is a highly specialized protein whose main function is to store excess iron intracellularly. It is widely distributed throughout the animal and plant kingdoms. I
[button size=small text=MSDS & Datasheet link=/wp-content/uploads/media/BCDatasheets_C_10.26/IXXXX/I-7201-1.pdf]Ferritin Conjugated Cancer antenn
Book Ferritin In Kolkata online from Diagno Labs. View test prices, normal range, sample results and user reviews about labs only on 1mg
Financial markets and trading an introduction to market microstructure and trading strategies #### MONEY.PL FOREX ONLINE Vp stock options #### Hft group forex trading
Presenile cataract may present in the second to fifth decades and can be associated with genetic or metabolic disorders, including myotonic dystrophy-associated cataract, hereditary hyperferritinemia cataract syndrome (HHCS), adult i blood group phenotype, female carriers of X-linked forms of cataract (eg, Nance Horan "cataract-dental" syndrome [NHS]; Lowe oculocerebrorenal syndrome [OCRL]), oil droplet cataract and diabetic cataract. Other adult-onset forms of cataract may result from local ocular disease (eg, uveitis, retinal dystrophy or degeneration, glaucoma, ocular tumors), certain drugs (eg, chronic corticosteroid regimens), radiation exposure, electrocution, metal ion deposits (eg, siderotic cataract), and trauma. ...
Although a partial ferritin subunit sequence of the seal Phoca vitulina (AF246195, unpublished data) has been determined, the entire coding sequences of ferritin subunits in marine mammals were previously unknown. The present study shows the ferritin coding sequences coding for the H and L subunits of six different dolphin species (P. crassidens, L. obliquidens, G. griseus, G. macrorhyncus, T. truncatus, and D. leucas). The predicted secondary structures using the GENETYX-MAC computer program (Robson method) of dolphin ferritin H and L subunits show A, B, C, D, and short E-helices and the L loop connecting B and C helices (data not shown) as in other mammalian species [1-3, 18]. Sequence comparisons between dolphin ferritin and that of other mammalian species strongly suggest similar functions for the H subunit unique ferroxidase [2, 3, 18], the L subunit salt bridge [2, 8, 23] and iron nucleation site [2, 8], subunit dimer formation [8, 18], and the iron channel [8, 18]. A putative ...
Play media In molecular biology, the iron response element or iron-responsive element (IRE) is a short conserved stem-loop which is bound by iron response proteins (IRPs, also named IRE-BP or IRBP). The IRE is found in UTRs (untranslated regions) of various mRNAs whose products are involved in iron metabolism. For example, the mRNA of ferritin (an iron storage protein) contains one IRE in its 5 UTR. When iron concentration is low, IRPs bind the IRE in the ferritin mRNA and cause reduced translation rates. In contrast, binding to multiple IREs in the 3 UTR of the transferrin receptor (involved in iron acquisition) leads to increased mRNA stability. The two leading theories describe how iron probably interacts to impact posttranslational control of transcription. The classical theory suggests that IRPs, in the absence of iron, bind avidly to the mRNA IRE. When Iron is present, it interacts with the protein to cause it to release the mRNA. For example, In high iron conditions in humans, IRP1 ...
Results Thirty four patients with AOSD (21 active-13 non active) (F 22, M 12, mean age 38.1 years, range 17-64), 18 patients with sepsis and 22 NHS were enrolled. Mean serum levels of sCD163 and ferritin are reported in table. In NHS mean sCD163 was 2.56 mg/l (SD ±1.16). In active AOSD mean sCD163 level was significantly higher than "non active" (p=0.02). AOSD and sepsis had mean sCD163 significantly higher than NHS (p,0.001). No difference in sCD163 levels between AOSD and sepsis was detected. sCD163 was positively correlated to ferritin (Spearmans test) (p=0.0045; r=0.4755) only in AOSD. In active AOSD mean ferritin serum level was significantly higher than in sepsis (p,0.007). By immunohistochemical analysis CD163 was detected equally distributed into the B and T area of both lymph node and tonsil. Both ferritin subunits were highly expressed only in the B cell area of the lymph node while it was possible to find them widely expressed also in the T and B cell areas of the tonsil control ...
But is it crystal clear that entanglement does not somehow permit FTL communication? My thinking is as follows:The speed of light limit on signaling times is predicted by a classical physics theory, i.e., relativity. But the apparent instantaneity (,10,000xc according to a recent experiment) of effects between entangled particles is a quantum mechanical phenomenon. At this point, the two theories are of course incompatible and thus incomplete, since no testable unified theory has yet been developed. But when experiments examined Bells inequality, and thus whether (classical) locality/separability or QM entanglement is correct, QM won out. This type of result implies to me that the current QM theory may represent a significantly more basic description of the universe than does the current relativity theory. If so, perhaps the final unified theory will in fact permit FTL signaling, utilizing some aspect of entanglement not yet envisaged ...
Ferrous Gluconate is absorbed from the stomach and small intestine and combines with apoferritin to form ferritin which is stored in the liver, spleen, red bone marrow and intestinal mucosa ...
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
Parahita Diagnostic Centre, Berpangalaman belasan tahun dengan ratusan tenaga ahli berpengalaman, siap memberikan pelayanan terbaik untuk kamu yang membutuhkan pemeriksaan Ferritin di kota surabaya,sidoarjo,gresik,jember,banyuwangi,solo,yogyakarta,bandung,bekasi,jakarta,tangerang,makassar,malang , apa itu Ferritin?, Kita ikuti penjelasannya dibawah. FERRITIN ADALAH Ferritin adalah sebuah protein yang terbisa di dalam sel pada hampir seluruh makhluk hidup. Ferritin merupakan protein penyimpan zat…. ...
Parahita Diagnostic Centre, Berpangalaman belasan tahun dengan ratusan tenaga ahli berpengalaman, siap menghasilkan pelayanan terbaik untuk kamu yang membutuhkan pemeriksaan Ferritin di kota surabaya,sidoarjo,gresik,jember,banyuwangi,solo,yogyakarta,bandung,bekasi,jakarta,tangerang,makassar,malang , apa itu Ferritin?, Kita ikuti penjelasannya dibawah. FERRITIN ADALAH Ferritin adalah sebuah protein yang terdapat di dalam sel pada hampir seluruh makhluk hidup. Ferritin merupakan protein penyimpan zat…. ...
Ferritins are metalloproteins containing in their reaction center an iron atom, which is bound to various amino acid ligands. The main function of ferritin in human body is a storage of iron. Besides, ferritin fulfills a number of other functions, the mechanisms of which are not yet known. Apart from this, ferritin significantly affects various types of malignant or other diseases. The elucidation of the structure and properties of ferritin helps to understand these functions and effects ...
Your browser does not support inline frames or is currently configured not to display inline frames. Content can be viewed at actual source page: https://atkcareers.taleo.net/careersection/0hr/joblist.ftl?lang=en ...
Iron sucrose is dissociated into iron and sucrose by the reticuloendothelial system and iron is transferred form the blood to a bone marrow. The Ferritin the iron storage protein binds and sequesters iron into a nontoxic iron that is easily available. The iron binds to plasma transferring that is carries iron to extracellular fluid to supply to tissues. The transferring receptors presented in membrane binds transferrin iron complex which is then internalized in vesicles iron is released within the cell and transferrin-receptor complex is return to the cell membrane transferrin without iron is then releases to the plasma. The intracellular iron becomes hemoglobin on circulating red blood cells. Transferrin synthesis increased Ferritin production reduced in iron deficiency. ...
Our department main research field is Nuclear magnetic resonance, a phenomenon whose principal application is Magnetic Resonance Imaging. Over the last thirty years, this method has established itself as one of the highest performance medical imaging methods. More precisely, we are studying the behaviour of nuclear magnetic relaxation of water protons in the presence of magnetic nanoparticles.. Indeed, the contrast of MRI images is strongly influenced by the presence of magnetic particles. Some particles are endogenous, i.e. naturally present in the human body, whereas others are exogenic, i.e. injected into patients to obtain a better contrast. Let us mention ferritin and hemosiderin, which are iron storage proteins, as examples of endogenous magnetic particles, whereas magnetite nanoparticles are used as exogenic contrast agents.. For more information, consult the research page. ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Ferritin cores from human spleen, limpet (Patella vulgata) haemolymph and bacterial (Pseudomonasaeruginosa) cells have been investigated using 57Fe Mössbauer spectroscopy. The Mössbauer spectra were recorded over a range of temperatures from 1.3 to 78 K. At 78 K, all the spectra are quadrupole-split doublets with similar quadrupole splittings and isomer shifts, characteristic of iron(III), while at sufficiently low temperatures the spectra of all the samples show well-resolved magnetic splitting. At intermediate temperatures, the spectra from the human ferritin exhibit typical superparamagnetic behaviour, while those from the bacterial ferritin show behaviour corresponding to a transition from a magnetically ordered to a paramagnetic state. The spectra from the limpet ferritin show a complex combination of the two effects. The results are discussed in terms of the magnetic behaviour of small particles. The data are consistent with magnetic ordering temperatures of about 3 and 30 K for the ...
Fiona Tinwei Lam. P. C.: When and where are you happiest?. Fiona Tinwei Lam: Reading aloud to my son at bedtime or having a conversation with him while we walk home after school.. Birthing the first and the final drafts of a really interesting poem or essay.. Waking after getting a really good nights sleep (rare).. Moments of real connection with another human being.. P. C.: What is a poem you might carry in your pocket?. FTL: Czeslaw Miloszs "On Angels" or maybe Tomas Transtromers "Half-Finished Heaven". P. C.: What is your favourite memory from childhood?. FTL: The two poems I wrote in elementary school.. P. C.: What is your most unappealing habit?. FTL: Too many to mention.. P. C.: What do you eat on a bad day?. FTL: Comfort foods: basmati rice with sag paneer or dal, homemade soup, warm fruit-based desserts, dark chocolate.. P. C.: What do you always carry with you?. FTL: Keys and bus tickets or change for the bus.. P. C.: Do you play a musical instrument? Have you ever?. FTL: Classical ...
Purpose: : We had previously shown that ultraviolet irradiation (UVR) significantly and maximally increases telomerase activity in canine lens epithelial cells at a dose of 600 J/m2 followed by a recovery period of 8 hours. However, we had not evaluated telomerase gene transcription. Therefore, we hypothesized that an acute dose of UVR followed by an 8 hour recovery period would up-regulate TERT, the catalytic subunit of telomerase, and possibly up-regulate TR, the RNA component of telomerase. Methods: : Six freshly harvested normal adult canine lenses per group were exposed to 0 or 600 J/m2 UVR, then allowed to recover for 8 or 24 hours prior to RNA extraction. Quantitative RT-PCR was performed using primers for canine TERT and TR, designed in our laboratory. A greater than two-fold difference was deemed physiologically relevant. Data is expressed as fold-difference and HPRT was used as the housekeeping gene. Results: : Lenses exposed to UVR, then recovered for 8 hours had a 9.88 fold ...
Hearing more and more about ferritin levels being maybe the most important thing one can do to be healthy. What levels do you guys feel are ideal Im thinking 60-120 at the most.
Dinakar Singh, founder of $4 billion hedge fund TPG-Axon Capital, spoke with Bloomberg TVs Erik Schatzker and Stephanie Ruhle on
Drive is a scifi webcomic by Dave Kellett, author of Sheldon. It takes place a few hundred years in the future, in which humanity has discovered FTL space …
List of all the English words containing letters L and T. LT, Lt., TL, alt, Alt, Alt., ATL, Atl., BLT, CLT, CTL, DLT, DTL, ELT, elt, ETL, flt., FTL, Lat., LAT, lat, lat., LCT, let, -let, LFT, LGT, lit, lit., Lit, LNT, lot, Lot, LPT, LRT, LTA, LTC, Ltd., LTD,
pFN21AB8470 7171 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Approximately 1 million children , 5 y living in sub-Saharan Africa die from severe anemia annually. This severe anemia frequently results from coexisting iron deficiency and malaria infection, but the standard of care, concurrent iron therapy and antimalarial treatment, has proven ineffective at curing the profound anemia and has promoted proliferation of the parasite in some studies. The pro-inflammatory immune response mounted against malaria down-regulates iron absorption in the gut, making provision of oral iron supplements during malarial infection of questionable utility. The present study proposes to use iron stable isotopes and a randomized design to test whether starting 4 weeks of iron therapy immediately after antimalarial treatment or 4 weeks later is associated with greater iron incorporation into red blood cells at the time of initial administration of iron therapy and improved long-term hematological recovery. One hundred severely anemic (hemoglobin 5-9.9 g/dL) Ugandan children ...
Ferritins are recognized as key players in the iron storage and detoxification processes. Iron acquisition in the case of pathogenic bacteria has long been established as an important virulence mechanism. Here, we report a 3.0 Å crystal structure of a ferritin, annotated as Bacterioferritin B (BfrB), from Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis that continues to be one of the worlds deadliest diseases. Similar to the other members of ferritin family, the Mtb BfrB subunit exhibits the characteristic fold of a four-helical bundle that possesses the ferroxidase catalytic centre. We compare the structure of Mtb BfrB with representatives of the ferritin family belonging to the archaea, eubacteria and eukarya. Unlike most other ferritins, Mtb BfrB has an extended C-terminus. To dissect the role of this extended C-terminus, truncated Mtb BfrB was purified and biochemical studies implicate this region in ferroxidase activity and iron release in addition to providing stability to
A stator for a rotary machine includes a rotor 7 and a stator 8 having a stator iron core 15 disposed oppositely around the outer circumference of the rotor 7 and a stator coil 16 fitted around the iron core 15, wherein the iron core 15 has a laminated iron core 150 with plural axially extending slots 15 a formed circumferentially at predetermined pitches, an insulating resin 100 is coated on an axial end face 15 f of the iron core 15 and an inner wall face of a slot 15 a in the laminated iron core 150 to provide insulation between the iron core 15 and the stator coil 16, and the iron core is cylindrically shaped by bringing both circumferential end portions 15 g of the laminated iron core 150 into contact to bend the laminated iron core 150 so that an opening face 15 b of the slot 15 a is directed inside.
Previous studies have shown that lenticular levels of Fe and Cu are elevated in age-related cataract. However, it is not known if these metals are present in a state that is permissive for redox reactions that may lead to the formation of free radicals. In addition, there is little data available concerning the concentration and lenticular distribution of ferritin, the major intracellular Fe-sequestering protein, in the lens. The aim of the present work was therefore to determine the distribution of ferritin and the redox-availability of Fe and Cu in healthy and cataractous lenses. Lens ferritin distribution was assessed by ELISA and immunohistochemistry. A modified ELISA detected ferritin in an insoluble lens protein fraction. Ferritin levels were not significantly different in the cortex vs nucleus of healthy lenses. In contrast, ferritin levels in the cataractous lens nuclei appeared to be 70 % lower compared to the cortex. This was at least partially due to the presence of ferritin within ...
Ischemia associated injury of the myocardium is caused by oxidative damage during reperfusion. Myocardial protection by ischemic preconditioning (IPC) was shown to be mediated by a transient iron-signal that leads to the accumulation of apoferritin and sequestration of reactive iron released during the ischemia. Here we identified the source of this iron signal and evaluated its role in the mechanisms of cardiac protection by hypoxic preconditioning. Rat hearts were retrogradely perfused and the effect of proteasomal and lysosomal protease inhibitors on ferritin levels were measured. The iron-signal was abolished, ferritin levels were not increased and cardiac protection was diminished by inhibition of the proteasome prior to IPC. Similarly, double amounts of ferritin and better recovery after ex vivo ischemia-and-reperfusion (I/R) were found in hearts from in vivo hypoxia pre-conditioned animals. IPC followed by normoxic perfusion for 30 min (delay) prior to I/R caused a reduced ferritin
TY - JOUR. T1 - Improved Doxorubicin Encapsulation and Pharmacokinetics of Ferritin-Fusion Protein Nanocarriers Bearing Proline, Serine, and Alanine Elements. AU - Falvo, Elisabetta. AU - Tremante, Elisa. AU - Arcovito, A.. AU - Papi, Massimiliano. AU - Elad, Nadav. AU - Boffi, Alberto. AU - Morea, Veronica. AU - Conti, Giamaica. AU - De Toffoli, Giuseppe Konishi. AU - Fracasso, Giulio. AU - Giacomini, Patrizio. AU - Ceci, Pierpaolo. PY - 2016/2/8. Y1 - 2016/2/8. N2 - A novel human ferritin-based nanocarrier, composed of 24 modified monomers able to auto-assemble into a modified protein cage, was produced and used as selective carrier of anti-tumor payloads. Each modified monomer derives from the genetic fusion of two distinct modules, namely the heavy chain of human ferritin (HFt) and a stabilizing/protective PAS polypeptide sequence rich in proline (P), serine (S), and alanine (A) residues. Two genetically fused protein constructs containing PAS polymers with 40- and 75-residue lengths, ...
In Arabidopsis and other species, light and photoperiod signals are integrated at the level of FT expression. Late-flowering photoperiod pathway mutants in Arabidopsis such as gi, fkf1, and cry2 have reduced FT expression under LD conditions, whereas early-flowering mutants have increased FT expression. In pea, LATE1 is clearly necessary for induction of the FT homolog FTL (Fig. 5B), demonstrating that both the GI-FT regulatory interaction and the association between photoperiod-insensitive late flowering and low expression of FT homologs are conserved in pea. Our preliminary studies of other photoperiod response mutants, such as phyA and SD-grown wild-type plants, suggest that they also show altered FTL expression (V. Hecht and C. Knowles, unpublished data), in support of a role for FTL as a target of the photoperiod pathway.. In Arabidopsis and rice, effects of GI on FT expression are mediated at least in part through changes in the expression of CO genes (Suárez-López et al., 2001; Hayama ...
A protein which binds iron atoms and acts as iron storage for the body. It is also used as a nonradioactive label to detect certain antibody - antigen complexes in places such as Western blot s ...
If an individual has a low ferritin level, the individual has an iron deficiency that can be caused by a variety of conditions, according to WebMD. The individual should consult a doctor to determine...
Reaktivität: Alle Spezies, Huhn, Rind (Kuh) and more. 90 verschiedene CP ELISA Kits vergleichen. Alle direkt auf antikoerper-online.de bestellbar!
Book Ferritin Test starting at ₹ 425 at 9 certified diagnostic lab(s) in Gurgaon including at Miracles Mediclinic, City Xray, Oncquest Laboratories. Book online or call now.
pFN21AE3002 4909 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Iron deficiency is a common problem among frequent blood donors. The Canadian Blood Services recently sought to identify donors at highest risk of iron deficiency and the feasibility of large-scale ferritin testing. Over 1.5 years, ferritin testing was performed on 12,595 blood donors (2.6% of all donors) who had passed the hemoglobin screen. Donors with low ferritin levels (,25 µg/L) were informed of their low iron stores and advised to see their health care providers to ensure iron levels returned to normal. They were also advised not to donate blood for at least 6 months. Iron deficiency (,25 µg/L ferritin) was identified in 54% of female donors and 33% of male donors. Furthermore, over 41% of repeat male donors and 65% of repeat female donors had low iron levels. Almost 60% of donors deferred for low iron returned to donate within a year, but they donated less often and had a lower return rate compared to donors with normal iron levels. Since female donors are more prone to have low iron ...
Description of Invention:. National Institutes of Health (NIH) inventors at the Vaccine Research Center have developed a novel influenza virus hemagglutinin (HA)-ferritin nanoparticle influenza vaccine that is easily manufactured, potent, and elicits broadly neutralizing influenza antibodies against multiple strains of influenza. This novel influenza nanoparticle vaccine elicited two types of broadly neutralizing, cross-protective antibodies-one directed to the highly conserved HA stem and a second proximal to the conserved receptor binding site (RBS) of the viral HA-providing a new platform for universal and seasonal influenza. In addition, HA-ferritin nanoparticles can be easily produced from simple expression vectors and without the production of infectious virus in eggs, and will facilitate influenza preparedness in the face of emerging epidemics.. This technology exploits ferritin, a ubiquitous iron storage protein, that self-assembles into spherical nanoparticles and could serve as a ...
If youre feeling tired or have iron-deficiency risk factors like being overweight or a vegetarian, ask your doctor about getting tested to see if you need to boost iron through diet or would benefit from taking iron supplements.. Both iron deficiency and anemia can result from menstrual blood loss, which is why the U.S. Centers for Disease Control and Prevention recommends yearly tests for teenage girls who experience heavy periods.. A note on testing: While a complete blood count test can detect anemia, it may not pick up an iron deficiency. That requires a separate blood test to measure the protein ferritin. If you have risk factors, having this test can catch a deficiency before it progresses to anemia.. To boost iron through diet, eat lean beef, chicken and turkey, oysters, dark leafy greens and whole grains. Besides leafy greens, the best plant-based sources of iron are legumes (beans and lentils), tofu and cashews. The body is better at using the iron from animal sources, but you can ...

Structure Cluster 









- 1DAT: CUBIC CRYSTAL STRUCTURE RECOMBINANT HORSE L APOFERRITIN 3D Similarity Report PageStructure Cluster - 1DAT: CUBIC CRYSTAL STRUCTURE RECOMBINANT HORSE L APOFERRITIN 3D Similarity Report Page

X-ray structure of recombinant horse L-chain apoferritin at 2.0 angstrom resolution: Implications for stability and function. ...
more infohttp://www.rcsb.org/pdb/explore/structureCluster.do?structureId=1DAT

Apoferritin-camouflaged Pt nanoparticles: surface effects on cellular uptake and cytotoxicity - Journal of Materials Chemistry ...Apoferritin-camouflaged Pt nanoparticles: surface effects on cellular uptake and cytotoxicity - Journal of Materials Chemistry ...

The spherical structure of apoferritin remained intact after loading Pt particles in its cavit ... were bio-mimetically prepared by an in situreduction method in the unique 8 nm spherical cage of apoferritin. The average size ... apoferritin. . The average size of AFt-Pt was 4.3 ± 0.9 nm. The spherical structure of apoferritin. remained intact after ... Apoferritin. -camouflaged Pt nanoparticles. : surface effects on cellular uptake and cytotoxicity Xiangyou Liu,abe Wei Wei,c ...
more infohttp://pubs.rsc.org/en/Content/ArticleLanding/2011/JM/C1JM10575B

apoferritin encapsulated catalytic nanoparticlesapoferritin encapsulated catalytic nanoparticles

Page contains details about apoferritin encapsulated catalytic nanoparticles . It has composition images, properties, ...
more infohttps://nano.nature.com/nano/GR-M8662350?error=cookies_not_supported&code=9487bb1b-dd0d-4990-9a7c-09be76c0bdd1

The Amino-acid-sequence of Human Spleen Apoferritin

 | DIAL.pr - BOREALThe Amino-acid-sequence of Human Spleen Apoferritin | DIAL.pr - BOREAL

The Amino-acid-sequence of Human Spleen Apoferritin. In: FEBS Letters, Vol. 150, no. 1, p. 43-48 (1982). ... The Amino-acid-sequence of Human Spleen Apoferritin Primary tabs. *Détail(active tab) ... Heusterspreute Michel, Crichton Robert R., Amino acid sequence of horse spleen apoferritin, 10.1016/0014-5793(81)80193-7 ... Fish Wayne W., Bjork Ingemar, Native and subunit molecular weights of apoferritin, 10.1021/bi00791a007 ...
more infohttps://dial.uclouvain.be/pr/boreal/object/boreal:56950

Cadmium in the structure of Mutant R59M Recombinant Horse Spleen Apoferritin Cocrystallized With Haemin in Acidic Conditions ...Cadmium in the structure of Mutant R59M Recombinant Horse Spleen Apoferritin Cocrystallized With Haemin in Acidic Conditions ...

Mutant R59M Recombinant Horse Spleen Apoferritin Cocrystallized With Haemin in Acidic Conditions ... The binding sites of Cadmium atom in the structure of Mutant R59M Recombinant Horse Spleen Apoferritin Cocrystallized With ... Cadmium in the structure of Mutant R59M Recombinant Horse Spleen Apoferritin Cocrystallized With Haemin in Acidic Conditions ( ...
more infohttp://cadmium.atomistry.com/pdb2v2n.html

FQM-368 : ProjectsFQM-368 : Projects

Iron(III) complexation of Desferrioxamine B encapsulated in apoferritin Dominguez-Vera, Jose M. Journal of Inorganic ... Apoferritin as a nanoreactor for preparing metallic nanoparticles Galvez, Natividad; Fernandez, Belen; Valero, Elsa; Sanchez, ... Apoferritin-encapsulated Ni and Co superparamagnetic nanoparticles Galvez, Natividad; Sanchez, Purificacion; Dominguez-Vera, ... Permanentmagnetism in apoferritin-encapsulated Pd nanoparticles. Clemente-Leon, Miguel; Coronado, Eugenio; Soriano-Portillo, ...
more infohttp://www.ugr.es/~josema/Publ.html

Final Flashcards by Tabatha OKeefe | BrainscapeFinal Flashcards by Tabatha O'Keefe | Brainscape

Brainscape is a web and mobile study platform that helps you learn things faster. Our mission is to create a smarter world by simplifying and accelerating the learning process. © 2018 Bold Learning Solutions ...
more infohttps://www.brainscape.com/flashcards/final-6006073/packs/8763088

Dynamic Light Scattering (DLS) | SpringerLinkDynamic Light Scattering (DLS) | SpringerLink

Examples are the pH-dependent dissociation and hydrolysis of Apoferritin (Jaenicke 1987), human prion protein (PrP) aggregation ...
more infohttps://link.springer.com/chapter/10.1007%2F978-3-030-28247-9_6

FTH1 - WikipediaFTH1 - Wikipedia

Addison JM, Fitton JE, Lewis WG, May K, Harrison PM (Nov 1983). "The amino acid sequence of human liver apoferritin". FEBS ... "Cloning and sequencing of a full length cDNA coding for a human apoferritin H chain: evidence for a multigene family". The EMBO ... "Structure of gene and pseudogenes of human apoferritin H". Nucleic Acids Research. 14 (2): 721-36. doi:10.1093/nar/14.2.721. ...
more infohttps://en.wikipedia.org/wiki/FTH1

Ferritin light chain - WikipediaFerritin light chain - Wikipedia

Addison JM, Fitton JE, Lewis WG, May K, Harrison PM (November 1983). "The amino acid sequence of human liver apoferritin". FEBS ... "Cloning of the gene coding for human L apoferritin". Nucleic Acids Res. 14 (7): 2863-76. doi:10.1093/nar/14.7.2863. PMC 339708 ... "Negative and positive elements in the promoter region of the human apoferritin L gene". Biochem. Biophys. Res. Commun. 215 (1 ...
more infohttps://en.wikipedia.org/wiki/Ferritin_light_chain

IUCr) An introduction to experimental phasing of macromolecules illustrated by SHELX; new autotracing featuresIUCr) An introduction to experimental phasing of macromolecules illustrated by SHELX; new autotracing features

Apoferritin. F432. 171. SAD, 8 Cd. 2.0. -m20 -h8 -s0.61 -a3 -q -t13 -m20 -h8 -s0.61 -a3 -q14 -t18 ... Three examples of tracing evolution: (a, b) apoferritin, (c, d) autophagy-related protein 38 and (e, f) titin A168-A169. (a), ( ... Apoferritin†. -s0.61 -h8. F432. 2.00. 29.0. 4. 77/7. 47.6. 91.2. 29.8. ... SAD data for apoferritin and titin protein A168-A169 are from Mueller-Dieckmann et al. (2007. ) and those for fibronectin are ...
more infohttp://journals.iucr.org/d/issues/2018/02/00/ba5271/index.html

KEGG PATHWAY: liv00860KEGG PATHWAY: liv00860

Deery E, Schroeder S, Lawrence AD, Taylor SL, Seyedarabi A, Waterman J, Wilson KS, Brown D, Geeves MA, Howard MJ, Pickersgill RW, Warren ...
more infohttp://www.genome.jp/dbget-bin/www_bget?pathway+liv00860

Recombinant Human Ferritin Heavy Chain protein (ab158472) | AbcamRecombinant Human Ferritin Heavy Chain protein (ab158472) | Abcam

Apoferritin. *Cell proliferation inducing gene 15 protein. *Cell proliferation-inducing gene 15 protein ...
more infohttps://www.abcam.com/recombinant-human-ferritin-heavy-chain-protein-ab158472.html

Advances in Size Exclusion Chromatography for the Analysis of Macromolecular Proteins  : WatersAdvances in Size Exclusion Chromatography for the Analysis of Macromolecular Proteins : Waters

IgM Pentamer (900 Kda), 2. Thyroglobulin (667 KDa), 3. Apoferritin (443KDa), 4. β-Amylase (200 Kda), 5. IgG (150 KDa), 6. BSA ( ... USP resolution values (half-height measurement) calculated for the separation between the apoferritin monomer (MW=443 KDa) and ... IgM Pentamer (900 Kda), 2. Thyroglobulin (667 KDa), 3. Apoferritin (443KDa), 4. β-Amylase (200 KDa), 5. IgG (150 KDa). Sample ... for the separation of apoferritin (443 KDa). Sample injection volumes and flow rate were normalized for column geometry. UV ...
more infohttps://www.waters.com/nextgen/us/en/library/application-notes/2013/advances-size-exclusion-analysis-macromolecular-proteins.html

Anti-Ferritin Heavy Chain antibody (ab65080) | AbcamAnti-Ferritin Heavy Chain antibody (ab65080) | Abcam

Apoferritin antibody. *Cell proliferation inducing gene 15 protein antibody. *Cell proliferation-inducing gene 15 protein ...
more infohttp://www.abcam.com/ferritin-heavy-chain-antibody-ab65080.html

IUCr) Acta Crystallographica Section D Volume 68, Part 5, May 2012IUCr) Acta Crystallographica Section D Volume 68, Part 5, May 2012

Beyond the detergent effect: a binding site for sodium do-decyl sulfate (SDS) in mammalian apoferritin. ... binds specifically to a pre-formed internal cavity in horse-spleen apoferritin. ...
more infohttps://journals.iucr.org/d/issues/2012/05/00/

Advanced Search Results - Public Health Image Library(PHIL)Advanced Search Results - Public Health Image Library(PHIL)

Categories: Apoferritin Image Types: Photo, Illustrations, Video, Color, Black&White, PublicDomain, CopyrightRestricted 1 ...
more infohttps://phil.cdc.gov/AdvancedSearchResults.aspx?Search=Apoferritin&parentid=10577&catid=3325

Advanced Search Results - Public Health Image Library(PHIL)Advanced Search Results - Public Health Image Library(PHIL)

Categories: Apoferritin Image Types: Photo, Illustrations, Video, Color, Black&White, PublicDomain, CopyrightRestricted 1 ...
more infohttps://phil.cdc.gov/AdvancedSearchResults.aspx?Search=Apoferritin&parentid=10576&catid=3324

Free Laboratory Science Flashcards about Hematology Tests 3-4Free Laboratory Science Flashcards about Hematology Tests 3-4

Apoferritin (the protein) + iron. Ferritin increased in . . . any condition that leads to increased protein: hepatic necrosis; ...
more infohttps://www.studystack.com/flashcard-283669

ELISA Kit for Ferritin, Heavy Polypeptide (FTH) | SED021Mu | Mus musculus (Mouse) CLOUD-CLONE CORP.(CCC)ELISA Kit for Ferritin, Heavy Polypeptide (FTH) | SED021Mu | Mus musculus (Mouse) CLOUD-CLONE CORP.(CCC)

Apoferritin; Placenta Immunoregulatory Factor; Proliferation-Inducing Protein 15; Cell proliferation-inducing gene 15 protein ... FTH1; FTHL6; PIG15; PLIF; Ferritin Heavy Chain; Apoferritin; Placenta Immunoregulatory Factor; Proliferation-Inducing Protein ...
more infohttp://www.cloud-clone.com/products/SED021Mu.html

NIOSHTIC-2 Search Results - Full ViewNIOSHTIC-2 Search Results - Full View

Different apoferritin templated metal phosphates were used as distinguishable signal reporters (apoferritin templated cadmium ... Simultaneous immunoassay of phosphorylated proteins based on apoferritin templated metallic phosphates as voltammetrically ... Apoferritin templated metallic phosphates; Phoaphorylated protein; Electrochemical detection ... phosphates (ATCP) and apoferritin templated lead phosphates (ATLP)) to enhance the detection sensitivity. Here, magnetic Fe3O4 ...
more infohttp://www2a.cdc.gov/nioshtic-2/BuildQyr.asp?s1=cadmium&f1=%2A&Adv=0&terms=1&PageNo=5&RecNo=44&View=f&
  • Thus apoferritin is obtained, a porous protein that chemists can use as a biomolecular nano-reactor in chemistry. (metode.org)
  • We also demonstrate light-fuelled macroscopic movements in native biomolecules, showing that complexes of apoferritin protein and azobenzene can effectively form light-induced surface patterns. (tut.fi)