Diseases of chimpanzees, gorillas, and orangutans.
A DNA repair enzyme that catalyses the excision of ribose residues at apurinic and apyrimidinic DNA sites that can result from the action of DNA GLYCOSYLASES. The enzyme catalyzes a beta-elimination reaction in which the C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate. This enzyme was previously listed under EC 3.1.25.2.
Family of the suborder HAPLORHINI (Anthropoidea) comprising bipedal primate MAMMALS. It includes modern man (HOMO SAPIENS) and the great apes: gorillas (GORILLA GORILLA), chimpanzees (PAN PANISCUS and PAN TROGLODYTES), and orangutans (PONGO PYGMAEUS).
This single species of Gorilla, which is a member of the HOMINIDAE family, is the largest and most powerful of the PRIMATES. It is distributed in isolated scattered populations throughout forests of equatorial Africa.
A species of orangutan, family HOMINIDAE, found in the forests on the island of Borneo.
The pygmy chimpanzee, a species of the genus Pan, family HOMINIDAE. Its common name is Bonobo, which was once considered a separate genus by some; others considered it a subspecies of PAN TROGLODYTES. Its range is confined to the forests of the central Zaire basin. Despite its name, it is often of equal size to P. troglodytes.
A genus of the family HYLOBATIDAE consisting of six species. The members of this genus inhabit rain forests in southeast Asia. They are arboreal and differ from other anthropoids in the great length of their arms and very slender bodies and limbs. Their major means of locomotion is by swinging from branch to branch by their arms. Hylobates means dweller in the trees. Some authors refer to Symphalangus and Nomascus as Hylobates. The six genera include: H. concolor (crested or black gibbon), H. hoolock (Hoolock gibbon), H. klossii (Kloss's gibbon; dwarf siamang), H. lar (common gibbon), H. pileatus (pileated gibbon), and H. syndactylus (siamang). H. lar is also known as H. agilis (lar gibbon), H. moloch (agile gibbon), and H. muelleri (silvery gibbon).
A species of GAMMARETROVIRUS causing leukemia in the gibbon ape. Natural transmission is by contact.
Any of several carnivores in the family CANIDAE, that possess erect ears and long bushy tails and are smaller than WOLVES. They are classified in several genera and found on all continents except Antarctica.
A form of CARDIAC MUSCLE disease that is characterized by ventricular dilation, VENTRICULAR DYSFUNCTION, and HEART FAILURE. Risk factors include SMOKING; ALCOHOL DRINKING; HYPERTENSION; INFECTION; PREGNANCY; and mutations in the LMNA gene encoding LAMIN TYPE A, a NUCLEAR LAMINA protein.
The hollow, muscular organ that maintains the circulation of the blood.
A heterogeneous condition in which the heart is unable to pump out sufficient blood to meet the metabolic need of the body. Heart failure can be caused by structural defects, functional abnormalities (VENTRICULAR DYSFUNCTION), or a sudden overload beyond its capacity. Chronic heart failure is more common than acute heart failure which results from sudden insult to cardiac function, such as MYOCARDIAL INFARCTION.
Pathological conditions involving any of the various HEART VALVES and the associated structures (PAPILLARY MUSCLES and CHORDAE TENDINEAE).
Individuals with a degree in veterinary medicine that provides them with training and qualifications to treat diseases and injuries of animals.
A republic in central Africa lying between GABON and DEMOCRATIC REPUBLIC OF THE CONGO and south of Cameroon. Its capital is Brazzaville.
Celestial bodies orbiting around the sun or other stars.
Planet that is the third in order from the sun. It is one of the four inner or terrestrial planets of the SOLAR SYSTEM.
A genus, Muntiacus, of the deer family (Cervidae) comprising six species living in China, Tibet, Nepal, India, the Malay Peninsula, and neighboring island countries. They are usually found in forests and areas of dense vegetation, usually not far from water. They emit a deep barklike sound which gives them the name "barking deer." If they sense a predator they will "bark" for an hour or more. They are hunted for their meat and skins; they thrive in captivity and are found in many zoos. The Indian muntjac is believed to have the lowest chromosome number in mammals and cell lines derived from them figure widely in chromosome and DNA studies. (From Walker's Mammals of the World, 5th ed., p1366)
Creation and development of bodies within solar systems, includes study of early planetary geology.
The science concerned with celestial bodies and the observation and interpretation of the radiation received in the vicinity of the earth from the component parts of the universe (McGraw Hill Dictionary of Scientific and Technical Terms, 5th ed)
Large bodies consisting of self-luminous gas held together by their own gravity. (From McGraw Hill Dictionary of Scientific and Technical Terms, 6th ed)
The interdisciplinary science that studies evolutionary biology, including the origin and evolution of the major elements required for life, their processing in the interstellar medium and in protostellar systems. This field also includes the study of chemical evolution and the subsequent interactions between evolving biota and planetary evolution as well as the field of biology that deals with the study of extraterrestrial life.
A country in northern Africa bordering the Mediterranean Sea, between MOROCCO and TUNISIA. Its capital is Algiers.
A genus of the family CEBIDAE, subfamily CEBINAE, consisting of four species which are divided into two groups, the tufted and untufted. C. apella has tufts of hair over the eyes and sides of the head. The remaining species are without tufts - C. capucinus, C. nigrivultatus, and C. albifrons. Cebus inhabits the forests of Central and South America.
A genus of oysters in the family OSTREIDAE, class BIVALVIA.
Using an INTERNET based personal journal which may consist of reflections, comments, and often hyperlinks.
A body of water covering approximately one-fifth of the total ocean area of the earth, extending amidst Africa in the west, Australia in the east, Asia in the north, and Antarctica in the south. Including the Red Sea and the Persian Gulf, it constitutes the third largest ocean after the ATLANTIC OCEAN and the PACIFIC OCEAN. (New Encyclopaedia Britannica Micropaedia, 15th ed, 1990, p289)
Modifying, carrying, or manipulating an item external to itself by an animal, before using it to effect a change on the environment or itself (from Beck, Animal Tool Behavior, 1980).
A branch of internal medicine concerned with the diagnosis and treatment of INFECTIOUS DISEASES.
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
The scientific disciplines concerned with the embryology, anatomy, physiology, biochemistry, pharmacology, etc., of the nervous system.
The non-neuronal cells of the nervous system. They not only provide physical support, but also respond to injury, regulate the ionic and chemical composition of the extracellular milieu, participate in the BLOOD-BRAIN BARRIER and BLOOD-RETINAL BARRIER, form the myelin insulation of nervous pathways, guide neuronal migration during development, and exchange metabolites with neurons. Neuroglia have high-affinity transmitter uptake systems, voltage-dependent and transmitter-gated ion channels, and can release transmitters, but their role in signaling (as in many other functions) is unclear.
A publication issued at stated, more or less regular, intervals.
The act or practice of calling public attention to a product, service, need, etc., especially by paid announcements in newspapers, magazines, on radio, or on television. (Random House Unabridged Dictionary, 2d ed)
Instruments or technological means of communication that reach large numbers of people with a common message: press, radio, television, etc.
An infectious disease caused by a spirochete, BORRELIA BURGDORFERI, which is transmitted chiefly by Ixodes dammini (see IXODES) and pacificus ticks in the United States and Ixodes ricinis (see IXODES) in Europe. It is a disease with early and late cutaneous manifestations plus involvement of the nervous system, heart, eye, and joints in variable combinations. The disease was formerly known as Lyme arthritis and first discovered at Old Lyme, Connecticut.
An order comprising three families of tailed bacteriophages: MYOVIRIDAE; PODOVIRIDAE; and SIPHOVIRIDAE.
A family of wingless, blood-sucking insects of the suborder HETEROPTERA, including the bedbugs and related forms. Cimex (BEDBUGS), Heamatosiphon, and Oeciacus are medically important genera. (From Dorland, 28th ed)
A specific species of bacteria, part of the BORRELIA BURGDORFERI GROUP, whose common name is Lyme disease spirochete.
Accountability and responsibility to another, enforceable by civil or criminal sanctions.
Failure of a professional person, a physician or lawyer, to render proper services through reprehensible ignorance or negligence or through criminal intent, especially when injury or loss follows. (Random House Unabridged Dictionary, 2d ed)
Gram-negative helical bacteria, in the genus BORRELIA, that are the etiologic agents of LYME DISEASE. The group comprises many specific species including Borrelia afzelii, Borellia garinii, and BORRELIA BURGDORFERI proper. These spirochetes are generally transmitted by several species of ixodid ticks.
A tumor derived from mesothelial tissue (peritoneum, pleura, pericardium). It appears as broad sheets of cells, with some regions containing spindle-shaped, sarcoma-like cells and other regions showing adenomatous patterns. Pleural mesotheliomas have been linked to exposure to asbestos. (Dorland, 27th ed)
Neoplasms of the thin serous membrane that envelopes the lungs and lines the thoracic cavity. Pleural neoplasms are exceedingly rare and are usually not diagnosed until they are advanced because in the early stages they produce no symptoms.
Asbestos. Fibrous incombustible mineral composed of magnesium and calcium silicates with or without other elements. It is relatively inert chemically and used in thermal insulation and fireproofing. Inhalation of dust causes asbestosis and later lung and gastrointestinal neoplasms.
A species of GAMMARETROVIRUS producing tumors in primates. Originally isolated from a fibrosarcoma in a woolly monkey, WMSV is a replication-defective v-onc virus which carries the sis oncogene. In order to propagate, WMSV requires a replication-competent helper virus.
Specific molecular components of the cell capable of recognizing and interacting with a virus, and which, after binding it, are capable of generating some signal that initiates the chain of events leading to the biological response.

A new group of hepadnaviruses naturally infecting orangutans (Pongo pygmaeus). (1/102)

A high prevalence (42.6%) of hepatitis B virus (HBV) infection was suspected in 195 formerly captive orangutans due to a large number of serum samples which cross-reacted with human HBV antigens. It was assumed that such viral infections were contracted from humans during captivity. However, two wild orangutans were identified which were HBV surface antigen positive, indicating that HBV or related viruses may be occurring naturally in the orangutan populations. Sequence analyses of seven isolates revealed that orangutans were infected with hepadnaviruses but that these were clearly divergent from the six known human HBV genotypes and those of other nonhuman hepadnaviruses reported. Phylogenetic analyses revealed geographic clustering with Southeast Asian genotype C viruses and gibbon ape HBV. This implies a common origin of infection within this geographic region, with cross-species transmission of hepadnaviruses among hominoids.  (+info)

Evaluation of accumulation of hepatitis C virus mutations in a chronically infected chimpanzee: comparison of the core, E1, HVR1, and NS5b regions. (2/102)

Four hepatitis C virus genome regions (the core, E1, HVR1, and NS5b) were amplified and sequenced from yearly samples obtained from a chronically infected chimpanzee over a 12-year span. Nucleotide substitutions were found to accumulate in the core, E1, and HVR1 regions during the course of chronic infection; substitutions within the NS5b region were not detected for the first 8 years and were found to be minimal during the last 4 years. The rate of accumulation of mutations in the core and E1 regions, based on a direct comparison between the first 1979 sequence and the last 1990 sequence, was 1.120 x 10(-3), while phylogenetic ancestral comparison using the 12 yearly sequences showed a rate of 0.816 x 10(-3) bases per site per year. Temporal evaluation of the sequences revealed that there appeared to be periods in which substitutions accumulated and became fixed, followed by periods with relative stasis or random substitutions that did not persist. Synonymous and nonsynonymous substitutions within the core, E1, and HVR1 regions were also analyzed. In the core and E1 regions, synonymous substitutions predominated and gradually increased over time. However, within the HVR1 region, nonsynonymous substitutions predominated but gradually decreased over time.  (+info)

Molecular epidemiology of simian T-lymphotropic virus (STLV) in wild-caught monkeys and apes from Cameroon: a new STLV-1, related to human T-lymphotropic virus subtype F, in a Cercocebus agilis. (3/102)

A serological survey for human T-lymphotropic virus (HTLV)/simian T-lymphotropic virus (STLV) antibodies was performed in 102 wild-caught monkeys and apes from 15 (sub)species originating from Cameroon. Two animals (a Mandrillus sphinx and a Cercocebus agilis) exhibited a complete HTLV-1 seroreactivity pattern while two others lacked either the p24 (a Mandrillus sphinx) or the MTA-1/gp46 bands (a Pan troglodytes). Sequence comparison and phylogenetic analyses, using a 522 bp env gene fragment and the complete LTR, indicated that the two mandrill STLV strains belonged to the HTLV/STLV subtype D clade while the chimpanzee strain clustered in the HTLV/STLV subtype B clade. The Cercocebus agilis STLV strain, the first one found in this species, was closely related to the two HTLV/STLV subtype F strains. Such data indicate that the African biodiversity of STLV-1 in the wild is far from being known and reinforces the hypothesis of interspecies transmission of STLV-1 from monkeys and apes to humans leading to the present day distribution of HTLV-1 in African inhabitants.  (+info)

Cryptosporidiosis in people sharing habitats with free-ranging mountain gorillas (Gorilla gorilla beringei), Uganda. (4/102)

Cryptosporidiosis, a zoonotic diarrheal disease, significantly contributes to the mortality of people with impaired immune systems worldwide. Infections with an animal-adapted genotype (Genotype 2) of Cryptosporidium parvum were found in a human population in Uganda that shares habitats with free-ranging gorillas, from which the same genotype of C. parvum had been recovered previously. A high prevalence of disease was found in park staff members (21%) who frequently contact gorillas versus 3% disease prevalence in the local community. This indicates a zoonotic transmission cycle of this pathogen against which no effective prophylaxis or therapy exists. The results of the study questionnaire demonstrated a high percentage of people not undertaking appropriate precautions to prevent fecal-oral transmission of C. parvum in the Bwindi Impenetrable National Park, Uganda. This human population will benefit from stronger compliance with park regulations regarding disposal of their fecal waste within the park boundaries.  (+info)

Identification of a hepatitis B virus genome in wild chimpanzees (Pan troglodytes schweinfurthi) from East Africa indicates a wide geographical dispersion among equatorial African primates. (5/102)

DNAs from four wild chimpanzees (Pan troglodytes schweinfurthi) from eastern Africa were screened for 14 DNA viruses and retroviruses. Between two and three viruses were found in each animal. An entire hepatitis B virus (HBV) genome was amplified and sequenced from samples taken from one animal. This indicates that HBV is distributed across the entire range of chimpanzee habitats.  (+info)

Reduced transmission and prevalence of simian T-cell lymphotropic virus in a closed breeding colony of chimpanzees (Pan troglodytes verus). (6/102)

A retrospective study spanning 20 years was undertaken to investigate the prevalence and modes of transmission of a simian T-cell lymphotropic virus (STLV) in a closed breeding colony of chimpanzees. Of the 197 animals tested, 22 had antibodies that were cross-reactive with human T-cell lymphotropic virus type-1 (HTLV-I) antigens. The specificity of the antibody response was confirmed by Western blot analysis and the presence of a persistent virus infection was established by PCR analysis of DNA from peripheral blood mononuclear cells. Sequence analysis revealed that the virus infecting these chimpanzees was not HTLV-I but STLV(cpz), a virus that naturally infects chimpanzees. The limited number of transmission events suggested that management practices of social housing of family units away from troops of mature males might have prevented the majority of cases of transmission. Evidence for transmission by blood-to-blood contact was documented clearly in at least one instance. In contrast, transmission from infected mother to child was not observed, suggesting that this is not a common route of transmission for STLV in this species, which is in contrast to HTLV-1 in humans.  (+info)

Screening for simian foamy virus infection by using a combined antigen Western blot assay: evidence for a wide distribution among Old World primates and identification of four new divergent viruses. (7/102)

Simian foamy viruses (SFVs) belong to a genetically and antigenically diverse class of retroviruses that naturally infect a wide range of nonhuman primates (NHPs) and can also be transmitted to humans occupationally exposed to NHPs. Current serologic detection of SFV infection requires separate Western blot (WB) testing by using two different SFV antigens [SFV(AGM) (African green monkey) and SFV(CPZ) (chimpanzee)]. However, this method is labor intensive and validation is limited to only small numbers of NHPs. To facilitate serologic SFV testing, we developed a WB assay that combines antigens from both SFV(AGM) and SFV(CPZ). The combined-antigen WB (CA-WB) assay was validated with 145 serum samples from 129 NHPs (32 African and Asian species) and 16 humans, all with known SFV infection status determined by PCR. Concordant CA-WB results were obtained for all 145 PCR-positive or -negative primate and human specimens, giving the assay a 100% sensitivity and specificity. In addition, no reactivity was observed in sera from persons positive for human immunodeficiency virus or human T cell lymphotropic virus (HIV/HTLV) (n = 25) or HIV/HTLV-negative U.S. blood donors (n = 100). Using the CA-WB assay, we screened 360 sera from 43 Old World primate species and found an SFV prevalence of about 68% in both African and Asian primates. We also isolated SFV from the blood of four seropositive primates (Allenopithecus nigroviridis, Trachypithecus francoisi, Hylobates pileatus, and H. leucogenys) not previously known to be infected with SFV. Phylogenetic analysis of integrase sequences from these isolates confirmed that all four SFVs represent new, distinct, and highly divergent lineages. These results demonstrate the ability of the CA-WB assay to detect infection in a large number of NHP species, including previously uncharacterized infections with divergent SFVs.  (+info)

Structural and evolutionary analysis of an orangutan foamy virus. (8/102)

The full-length proviral genome of a foamy virus infecting a Bornean orangutan was amplified, and its sequence was analyzed. Although the genome showed a clear resemblance to other published foamy virus genomes from apes and monkeys, phylogenetic analysis revealed that simian foamy virus SFVora was evolutionarily equidistant from foamy viruses from other hominoids and from those from Old World monkeys. This finding suggests an independent evolution within its host over a long period of time.  (+info)

In February, 2009, tragedy strikes, and the worlds attention turns to the issue of private ownership of chimpanzees. On a cold afternoon in Stamford Connecticut, Travis the Chimpanzee attacks a long time friend of owner Sandra Herold named Charla Nash in Herolds driveway. Travis is shot and killed by a patrol officer as the 14 year old, 200 pound male chimpanzee; tries to pry open the door of his patrol car as he responded to the tragedy. Nash is rushed to the hospital, and remains in a coma for months.. Weeks later, in early March, the US House of Representatives passes the Captive Primate Safety Act, banning sales of all primates across state lines. The bill moves on to the senate, where it still sits, not being acted on, to this day.. In late November, 2008, neighbors turned in a couple in Houston, Texas for a chimpanzee living in a garage in a suburban neighborhood. Fred Henry, now known simply as Henry, was over fifteen years old and had been living in the garage in a cage for 15 years. ...
In February, 2009, tragedy strikes, and the worlds attention turns to the issue of private ownership of chimpanzees. On a cold afternoon in Stamford Connecticut, Travis the Chimpanzee attacks a long time friend of owner Sandra Herold named Charla Nash in Herolds driveway. Travis is shot and killed by a patrol officer as the 14 year old, 200 pound male chimpanzee; tries to pry open the door of his patrol car as he responded to the tragedy. Nash is rushed to the hospital, and remains in a coma for months.. Weeks later, in early March, the US House of Representatives passes the Captive Primate Safety Act, banning sales of all primates across state lines. The bill moves on to the senate, where it still sits, not being acted on, to this day.. In late November, 2008, neighbors turned in a couple in Houston, Texas for a chimpanzee living in a garage in a suburban neighborhood. Fred Henry, now known simply as Henry, was over fifteen years old and had been living in the garage in a cage for 15 years. ...
Define Pan troglodytes troglodytes. Pan troglodytes troglodytes synonyms, Pan troglodytes troglodytes pronunciation, Pan troglodytes troglodytes translation, English dictionary definition of Pan troglodytes troglodytes. Noun 1. Pan troglodytes troglodytes - black-faced chimpanzees of central Africa; closely related to eastern chimpanzees central chimpanzee chimp,...
Doctoral thesis (2015). According to the IUCN, the western lowland gorilla (Gorilla gorilla gorilla Savage & Wyman) is a critically endangered species. This species would play an important role in tropical forest dynamics ... [more ▼]. According to the IUCN, the western lowland gorilla (Gorilla gorilla gorilla Savage & Wyman) is a critically endangered species. This species would play an important role in tropical forest dynamics. Indeed, its highly frugivorous diet and its large body mass would result in the implication of gorilla in the seed dispersal of many plant species. Moreover, by building its nest sites in open canopy forest, it would deposit the majority of seeds in habitats displaying potentially suitable light condition for their germination and for the subsequent seedling development. However, given the expansion of timber exploitation in Central Africa, ecological services dispensed by gorilla could be threatened. The objective of this thesis is to characterize the impacts of ...
Trypanosoma cruzi is an intracellular protozoan parasite that causes Chagas disease. The parasite life cycle involves hematophagous reduviid bugs as vectors. Once parasites enter the host body, they invade diverse host cells including cardiomyocytes. Establishment of infection depends on various parasite molecules such as cruzipain, oligopeptidase B, and trans-sialidase that activate Ca2+ signaling. Internalized parasites escape from the parasitophorous vacuole using secreted pore-forming TcTOX molecule and replicate in the cytosol. Multiplied parasites eventually lyse infected host cells and are released in the circulation. During these events, the parasites manipulate host innate immunity and elicit cardiomyocyte hypertrophy. T lymphocyte responses are also disturbed ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Gorillas, the largest living primates, are humans closest living relatives after chimpanzees, and are important for the study of human origins and evolution. They are found today only within several endangered populations in the equatorial forests of central Africa.. We generated a reference genome assembly for gorilla using DNA sampled from a single individual - a female western lowland gorilla (Gorilla gorilla gorilla) named Kamilah, resident at San Diego Zoo. We collected 5.4 Gbp of capillary sequence and 166.8 Gbp of Illumina read pairs, and combined both data sets in an initial hybrid de novo assembly. Improvements in long-range structure were guided by human homology, placing contigs into scaffolds wherever read pairs confirmed collinearity between gorilla and human. Base-pair contiguity was improved by local reassembly within each scaffold, merging or extending contigs using Illumina read pairs. Finally we used additional Kamilah bacterial artificial chromosome and fosmid end pair ...
Ebola outbreak is nearing possible end in Nigeria. Strong emergency operations center, polio eradication experience keys to success. The Ebola outbreak in Nigeria appears to be nearing a possible end thanks to a rapid response coordinated by Nigerias Emergency Operations Center with assistance from international partners, including the U.S. Centers for Disease Control and Prevention (CDC). The official end to an Ebola outbreak comes when two of the 21-day incubation periods for Ebola virus have elapsed without any new cases.. During the outbreak there were 19 laboratory-confirmed and one probable Ebola cases in two Nigerian states. Nearly 900 patient contacts were identified and followed; all but three have completed 21 days of follow-up without Ebola symptoms. There have been no new cases since August 31 and the last three patient contacts will exit their 21-day follow-up on October 2 - strongly suggesting the outbreak in Nigeria has been contained. A report on Nigerias response to the ...
Gorillas are great apes and one of our closest living relatives. The Smithsonian Institutions Division of Mammals ( http://vertebrates.si.edu/mammals/ ) houses many gorillas in its scientific collections. This specimen, USNM 588746 ( http://collections.mnh.si.edu/search/mammals/?irn=7585817 ), is a female western lowland gorilla ( Gorilla gorilla ).
Recent etho-archaeological studies of stone-tool use by wild chimpanzees have contributed valuable data towards elucidating the variables that influenced the emergence and development of the first lithic industries among Plio-Pleistocene hominins. Such data help to identify potential behaviours entailed in the first percussive technologies that are invisible in archaeological records. The long-term research site of Bossou in Guinea features a unique chimpanzee community whose members systematically use portable stones as hammers and anvils to crack open nuts in natural as well as in field experimental settings. Here we present the first analysis of repeated reuse of the same tool-composites in wild chimpanzees. Data collected over 5 years of experimental nut-cracking sessions at an outdoor laboratory site were assessed for the existence of systematic patterns in the selection of tool-composites, at group and at individual levels. Chimpanzees combined certain stones as hammer and anvil more often than
The FWS decision awaits a 60-day public comment period. Once finalized, captive chimpanzees new endangered status will place them alongside their free-living relatives in Africa. As such, research not benefiting the survival of the species would be prohibited, adding yet another barrier to wanton, unnecessary, and non-productive research purportedly to benefit human health. By listing all chimpanzees as endangered, the FWS findings will more consistently promote the conservation of the species as intended by the ESA. Chimpanzees in U.S. labs will be one step closer to being prohibited from indiscriminate use in human-directed research once appropriately listed as endangered, says NEAVS President Theodora Capaldo, EdD. NEAVS Project R&R: Release and Restitution for Chimpanzees in U.S. Labs campaign has focused on several routes to end the use of chimpanzees and all great apes in U.S. research. While we would like to have seen a one-punch knockout to research on chimpanzees, an institution ...
August 27 2004 (Torino Italy) Scientists fear that emerging evidenc...Congos Odzala National Park a UNESCO Biosphere Reserve contains ... We have not confirmed this as an outbreak of Ebola yet but there ...Fewer than 100000 western lowland gorillas remain on Earth. A stud...Ebola outbreaks have already occurred in this general area. In the ...,Scientists,fear,new,Ebola,outbreak,may,,explain,sudden,gorilla,disappearance,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
mdsolar (1045926) writes with news that, with the Ebola outbreak growing out of control, the WHO has declared an international health emergency. From the article: With cases rapidly mounting in four West African countries, the World Health Organization (WHO) today declared the Ebola outbreak a Publ...
Todays genuinely shocking WHO update has resonated at ScienceInsider: Nigerias Ebola outbreak spreads. Excerpt: The hopes that Nigerias Ebola outbreak could be quickly stamped out have evaporated. The World Health Organization (WHO) this afternoon issued its first detailed report of...
General Information: This strain probably caused lethal anthrax in chimpanzee Leo in the rainforest of the Tai National Park, Cote dIvoire. It belongs to a collection of genetically closely related bacteria, isolated in 2001 and 2002 from deceased wild chimpanzees living in this rain forest area. An autopsy showed symptoms typical of anthrax, but the bacterium isolated was motile, unlike B.anthracis. This organism is a soil-dwelling opportunistic pathogen that causes food poisoning in infected individuals. The rapid onset is characterized by nausea and vomiting while the late onset is characterized by diarrhea and abdominal pain. The emetic disease is caused by a small stable dodecadepsipeptide cerulide whereas the diarrheal disease is caused by a heat labile enterotoxin. Some strains produce a potent cytotoxin that forms a pore in the membrane of eukaryotic cells and causes necrotic enteritis (death of intestinal epithelial cells) while the unique tripartite membrane lytic toxin hemolysin BL ...
Gorillas are great apes and one of our closest living relatives. The Smithsonian Institutions Division of Mammals ( http://vertebrates.si.edu/mammals/ ) houses many gorillas in its scientific collections. This specimen, USNM 588746 ( http://collections.mnh.si.edu/search/mammals/?irn=7585817 ), is a female western lowland gorilla ( Gorilla gorilla ).
McGuire, M., Vonk, J., Fuller, G., & Allard, S. (2017). Using an ambiguous cue paradigm to assess cognitive bias in gorillas (Gorilla gorilla gorilla) during a browse manipulation. Animal Behavior and Cognition, 4 ...
This study demonstrates that detections on autonomous recording devices, for two types of long-distance acoustic signals produced by chimpanzees, reflected direct and indirect indices of chimpanzee presence collected by field workers. Specifically, we found that the number of hours Taï chimpanzees were observed ranging in a given grid cell strongly predicted the probability of detecting a chimpanzee drum on an ARU located up to 1 km away (Fig. 1). At a second field site in the Issa valley, we also found that ad libitum, indirect observations of chimpanzees predicted detections of pant hoots and screams on SPATUs already within a 500 m radius (Fig. 4). These results are all the more promising since both datasets suffered from technical problems during data collection (typical for innovative solutions to field challenges) that resulted in discontinuous recording effort in their respective study periods. Additionally, the latter dataset came from unhabituated chimpanzees thereby further validating ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The cognitive and social needs of chimpanzees, our closest genetic relatives, are indisputable. Chimpanzees such as Tom (pictured here / photo: M. Seres) were captured from the wild and used in research now acknowledged to have limited if any ends for human health. Tom was housed alone in a 5x5x7 cage prior to his rescue to sanctuary. His research history included being terrifyingly knocked down (shot with dart guns to be anesthetized) more than 369 times over his 30 years in several different laboratories. He endured chronic psychological and physical stress while in the labs, with multiple symptoms remaining to plague him even long after his rescue. The stress Tom and other chimpanzees endured impacted not only their well-being, but also impaired their physiological suitability for further research.. Chimpanzees endured and continue to endure enormous suffering even though their use in research was and is unnecessary, limited, or misleading. Chimpanzees even turned out to be an unsuitable ...
We describe the individual and combined use of vocalizations and gestures in wild chimpanzees. The rate of gesturing peaked in infancy and, with the exception of the alpha male, decreased again in old
How Much Should People Worry About The Unprecedented Ebola Outbreak In Guinea? Guinea is battling to contain an outbreak of Ebola, which currently includes 122 suspected cases and 78 deaths, not all of which are confirmed to be the deadly virus. [...] more cases will be confirmed as additional testing is done, W. Ian Lipkin, MD, the director of the Center for Infection and Immunity at Columbias Mailman School of Public Health, told Business Insider. Ebola is usually contained within a small, rural area, but in the Guinea outbreak, it took six weeks to identify the virus. The symptoms of Ebola often include uncontrollable bleeding, and the deadliest strains of the virus kill up to 90% of people infected. Nobody can say for sure, but people and wild animals dont respect geographic boundaries, Lipkin noted, proposing three potential explanations for the spread into Guinea: a human was infected elsewhere and traveled to Guinea, infected bushmeat was acquired elsewhere and brought into Guinea, or
How Much Should People Worry About The Unprecedented Ebola Outbreak In Guinea? Guinea is battling to contain an outbreak of Ebola, which currently includes 122 suspected cases and 78 deaths, not all of which are confirmed to be the deadly virus. [...] more cases will be confirmed as additional testing is done, W. Ian Lipkin, MD, the director of the Center for Infection and Immunity at Columbias Mailman School of Public Health, told Business Insider. Ebola is usually contained within a small, rural area, but in the Guinea outbreak, it took six weeks to identify the virus. The symptoms of Ebola often include uncontrollable bleeding, and the deadliest strains of the virus kill up to 90% of people infected. Nobody can say for sure, but people and wild animals dont respect geographic boundaries, Lipkin noted, proposing three potential explanations for the spread into Guinea: a human was infected elsewhere and traveled to Guinea, infected bushmeat was acquired elsewhere and brought into Guinea, or
Via The Daily Nation in Kenya, a good survey the situation as of Sunday: Ebola outbreak in Guinea sparks health fears in West Africa. Saturday`s confirmation of the Ebola virus as source of a mystery illness in Guinea has raised...
First and foremost, I want the American people to know that our experts, here at the CDC and across our government, agree that the chances of an Ebola outbreak here in the United States are extremely low. Weve been taking the necessary precautions, including working with countries in West Africa to increase screening at airports so that someone with the virus doesnt get on a plane for the United States. In the unlikely event that someone with Ebola does reach our shores, weve taken new measures so that were prepared here at home. Were working to help flight crews identify people who are sick, and more labs across our country now have the capacity to quickly test for the virus. Were working with hospitals to make sure that they are prepared, and to ensure that our doctors, our nurses and our medical staff are trained, are ready, and are able to deal with a possible case safely ...
An Ebola outbreak blamed for 135 deaths in West Africa in the past month was not imported from Central Africa but caused by a new strain of the disease, a study in a U.S. medical journal said, raising the spectre of further regional epidemics.
|p|dpa GENEVA - The magnitude of the Ebola outbreak in Africa has been underestimated because families hide infected relatives in their homes, the World Health Organization said Friday. Because Ebola has no cure, some people infected with the virus preferred to die at home, the WHO said in a statement. This was especially the case […]|/p|
The Committee emphasized the importance of continued support by WHO and other national and international partners towards the effective implementation and monitoring of these recommendations. Based on this advice, the reports made by affected States Parties and the currently available information, the Director-General accepted the Committees assessment and on 8 August 2014 declared the Ebola outbreak in West Africa a Public Health Emergency of International Concern (PHEIC). The Director-General endorsed the Committees advice and issued them as Temporary Recommendations under IHR (2005) to reduce the international spread of Ebola, effective 8 August 2014. The Director-General thanked the Committee Members and Advisors for their advice and requested their reassessment of this situation within 3 months.. 1 IHR Emergency Committee Members and Advisers. ...
The latest Ebola crisis is the worst ever documented in DRC-and the second-largest Ebola outbreak recorded anywhere. Learn how we are fighting this epidemic in
3.0.CO;2-8. Please enable it to take advantage of the complete set of features! The chromosome numbers of nine chimpanzees (Pani troglodytes) have been determined by the bone marrow technique. So, mom and dad each contribute 23 chromosomes-the haploid number… Protein knowledgebase. Sequence archive. Solution for Give the Haploid Number of Chromosomes for a Varietyof Organisms (see below) Common Name Scientific Name… Statistics: Number of protein genes: 21522 Number of RNA genes: 3382. Pan troglodytes (Chimpanzee) Status. The Chimpanzee Genome Project is an effort to determine the DNA sequence of the chimpanzee genome.It is expected that by comparing the genomes of humans and other apes, it will be possible to better understand what makes humans distinct from other species from a genetic perspective. 3. Sequence archive. 26. Application: Use of karyograms to deduce sex and diagnose Down syndrome in humans. The chromosome numbers of nine chimpanzees ( Pani troglodytes ) have been determined by ...
Its nine months into the biggest Ebola outbreak in history, and the situation is only going from bad to worse. The outbreak simmered slowly in West Af ...
Guinea declared a new Ebola outbreak on Sunday when tests came back positive for the virus after three people died and four fell ill in the southeast - the first resurgence of the disease there since the worlds worst outbreak in 2013-2016.
The death toll from an Ebola outbreak in West Africa has spiked to 603 since February, with at least 68 deaths reported in the last week alone, the World Health Organization said on Tuesday.
Scientists suspect the current Ebola outbreak started with bats that lived in a hollow tree in Guinea. The outbreaks first victim, a two-year-old boy, often played in the tree.
Health ministers from 11 west African nations and experts in disease control are meeting in Ghanas capital to plan drastic action to fight the deadliest Ebola outbreak in history.
At least 1,552 people have died in West Africa as the deadliest Ebola outbreak in history continues to accelerate, the World Health Organization has said.
More than 100 people have died in Guineas ebola outbreak, that includes 14 health workers. The virus has no cure and you can get infected with just one microscopic droplet of saliva or blood hitting a break in the skin.
As the Ebola outbreak in West Africa worsens, airlines around the globe are closely monitoring the situation but have yet to make any drastic changes. Below are some key questions about the disease, what airlines are doing and how safe it is to fly.
(CNN) - President Barack Obama on Tuesday announced a major increase in the U.S. response to the Ebola outbreak in West Africa. Obama said experts know how to fight this disease, but international leaders need to move fast, as the cases continue to multiply rapidly.
Dominance rank in female chimpanzees correlates positively with reproductive success. Although a high rank obviously has an advantage for females, clear (linear) hierarchies in female chimpanzees have not been detected. Following the predictions of the socio-ecological model, the type of food competition should affect the dominance relationships among females. We investigated food competition and relationships among 11 adult female chimpanzees in the Taï National Park, Côte dIvoire (West Africa). We detected a formal linear dominance hierarchy among the females based on greeting behaviour directed from the subordinate to the dominant female. Females faced contest competition over food, and it increased when either the food was monopolizable or the number of competitors increased. Winning contests over food, but not age, was related to the dominance rank. Affiliative relationships among the females did not help to explain the absence of greetings in some dyads. However comparison post hoc ...
Broadly cross-reactive neutralizing antibodies (bNabs) represent powerful tools to combat human immunodeficiency virus type 1 (HIV-1) infection. Here, we examined whether HIV-1-specific bNabs are capable of cross-neutralizing distantly related simian immunodeficiency viruses (SIVs) infecting central (Pan troglodytes troglodytes) (SIVcpzPtt) and eastern (Pan troglodytes schweinfurthii) (SIVcpzPts) chimpanzees (n = 11) as well as western gorillas (Gorilla gorilla gorilla) (SIVgor) (n = 1). We found that bNabs directed against the CD4 binding site (n = 10), peptidoglycans at the base of variable loop 3 (V3) (n = 5), and epitopes at the interface of surface (gp120) and membrane-bound (gp41) envelope glycoproteins (n = 5) failed to neutralize SIVcpz and SIVgor strains. In addition, apex V2-directed bNabs (n = 3) as well as llama-derived (heavy chain only) antibodies (n = 6) recognizing both the CD4 binding site and gp41 epitopes were either completely inactive or neutralized only a fraction of SIVcpzPtt
The eastern lowland gorilla (Gorilla beringei graueri) is a subspecies of Eastern Gorilla. It is now only found in the forests of eastern Democratic Republic of the Congo.. This subspecies is sturdier in appearance than the western lowland gorilla. It has longer teeth, a stronger jaw and a broader torso. They have black coats, which in males turns silver at the back as the animal matures.. Habitat and diet. Eastern lowland gorilla is predominantly herbivorous, eating mostly leaves. They are known to eat only a few leaves from a single plant, allowing the plant to grow. They will also eat fruit, seeds, bamboo shoots and insects.. Behavior. Eastern lowland gorilla tends to be sociable and peaceful. It lives in groups of 5 to 30. A group usually consists of one silverback and few subdominant males. Silverbacks are the strong, dominant troop leaders. They are in charge of leading the group to food and protecting the group from danger. Males will slowly begin to leave their original group when they ...
The western lowland gorilla is the most numerous and widespread of all gorilla subspecies. But their populations are being threatened by poaching and disease. Learn more about what WWF is doing to protect its future, and how you can help.
Anthony, N.M., Johnson-Bawe, M., Jeffery, K., Clifford, S.L., Abernethy, K.A., Tutin, C.E., Lahm, S.A., White, L.J.T., Utley, J.F., Wickings, E.J. and Bruford, M.W. 2007. The role of Pleistocene refugia and rivers in shaping gorilla genetic diversity in central Africa. Proceedings of the National Academy of Sciences of the United States of America 104: 20432-20436.. Arandjelovic, M., Bergl, R.A., Ikfuingei, R., Jameson, C., Parker, M. and Vigilant, L. 2015. Detection dog efficacy for collecting faecal samples from the critically endangered Cross River gorilla (Gorilla gorilla diehli) for genetic censusing. Royal Society Open Science 2: 140423.. Bennett, E.L. 2014. Legal ivory trade in a corrupt world and its impact on African elephant populations. Conservation Biology 29: 54-60.. Bergl, R.A. 2006. Conservation Biology of the Cross River Gorilla (Gorilla gorilla diehli). City University of New York.. Bergl, R.A. and Vigilant, L. 2007. Genetic analysis reveals population structure and recent ...
Proximity data were collected in a captive breeding group of gorillas (Gorilla gorilla gorilla) at the San Diego Wild Animal Park (currently called the San Diego Zoo Safari Park) twice a year (spring and fall periods) for over 12 years, by using a convenient method in which individuals less than 5 m from each animal in the group were recorded by scan sampling, approximately once per hour. Immature ...
ID G3R0Q3_GORGO Unreviewed; 856 AA. AC G3R0Q3; DT 16-NOV-2011, integrated into UniProtKB/TrEMBL. DT 16-NOV-2011, sequence version 1. DT 27-SEP-2017, entry version 34. DE RecName: Full=V-type proton ATPase subunit a {ECO:0000256,RuleBase:RU361189}; GN Name=ATP6V0A2 {ECO:0000313,Ensembl:ENSGGOP00000008746}; OS Gorilla gorilla gorilla (Western lowland gorilla). OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; OC Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; OC Catarrhini; Hominidae; Gorilla. OX NCBI_TaxID=9595 {ECO:0000313,Ensembl:ENSGGOP00000008746, ECO:0000313,Proteomes:UP000001519}; RN [1] {ECO:0000313,Ensembl:ENSGGOP00000008746, ECO:0000313,Proteomes:UP000001519} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RA Scally A.; RT Insights into the evolution of the great apes provided by the gorilla RT genome.; RL Submitted (MAY-2011) to the EMBL/GenBank/DDBJ databases. RN [2] {ECO:0000313,Ensembl:ENSGGOP00000008746} RP IDENTIFICATION. RG Ensembl; RL Submitted ...
Due to the lack of Ebola outbreak early warning alert, preparedness, surveillance and response systems, the most deadly, complex and largest ever seen Ebola war has been devastating West African communities. The unparalleled Ebola tsunami has prompted interrogations into, and uncertainties about, the effectiveness and efficiency of national, regional and international communitys illed- responses using conventional humanitarian control and containment approaches and methods. The late humanitarian and local non-government organisations emergency responses and challenges to curb transmission dynamics and stop the ongoing spread in the Ebola outbreak in West Africa have led to an unprecedented toll of 14,413 reported Ebola cases in eight countries since the outbreak began, with 5,177 reported deaths including 571 health-care workers and 325 died as 14 November 2014. These indications the need of further evaluation of monitoring as substantial proportion of infections outside the context of Ebola epicentres
Liberia has closed its borders to stop the Ebola outbreak as two infected Americans fight for their lives. Learn more about the Ebola outbreak.
The Cincinnati Zoo & Botanical Garden celebrated the coming Easter holiday by hosting a special egg hunt event just for gorillas.
Predatory behavior in wild chimpanzees and other primates has been well documented over the last 30 years. However, as it is an opportunistic behavior, conditions which may promote such behavior are left up to chance. Until now, predatory behavior among captive chimpanzees has been poorly documented. In this paper, we present five instances providing evidence of predatory behavior: four performed by isolated individuals and one carried out in cooperation. The evidence of group predation involved the chimpanzees adopting different roles as pursuers and ambushers. Prey was partially eaten in some cases, but not in the social episode. This study confirms that naturalistic environments allow chimpanzees to enhance species-typical behavioral patterns.
SPR00001222_2.0 # Promoter # Selenoprotein U2 (SelU2) # Gorilla (Gorilla gorilla) Full length # Reverse GAAAGCCAAGACGGCAGAAAGGGCAAGTTAGTAAAGCAGCACCCTCGGGCCCCGAAGGAT CCCTGTACTTCGCCGTGCGTGACGCGAGCAAAGGCGACGCCCGCGGGGCCGGGACCGNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA GAGTGAACCCCACGGGCGGTTCTGACTCCGCTCTCAGGGTAGGGGACAGAGAGAGAAAGT AAGGTCCGTCCACGGCGAGCAAGCATTATTGAGGAAGAAAGCCGCCCGCGCCCTCCATGG CCACCTGAGCGGATGTTCTCACCTATTCGAGAACTAATGGGTGTATGTGTAAAAGGTGGG ...
2014 Ebola outbreak in West Africa Graph 2: Total suspected, probable, and confirmed cases and deaths of Ebola virus disease in Guinea, March 25, 2014 - October 18, 2015, by date of WHO Situation Report, n= ...
The Ebola outbreak in West Africa has already killed 600 people. The outbreak occurred this spring, but a new study shows that the virus may have been affecting people in the region for years before the outbreak.. According to the study, there was a mysterious illness affecting people in West Africa years before the outbreak. The illness was likely the Ebola virus. Although blood samples were taken from most of the people treated for the illness, none of them were tested for Ebola.. Researchers are now testing the blood samples to see if the patients were indeed suffering from the Ebola virus. The test samples were over seven years old, but still potentially dangerous. Researchers had to heat treat them to help make them safe before they could be tested.. It had been circulating there for a long time, said Randal Schoepp of the U.S. Army Medical Research Institute of Infectious Diseases. It just hadnt gotten out of control or the right conditions werent there.. ...
KINSHASA/DAKAR/GENEVA/NEW YORK, 18 May 2018 - Scaling up in response to the Ebola outbreak in the Democratic Republic of the Congo, UNICEF, with the DRC Government and partners, is mobilizing hundreds of community workers to raise awareness among children and families of how to protect themselves against the disease. The community workers will also play a crucial role in providing communities with information on the Ebola vaccination campaign, planned to start next week. The community workers, deployed to Bikoro and Mbandaka health zones, aim to help contain the spread of the outbreak through information campaigns, social mobilization and community engagement, including disseminating information through radio, religious institutions, markets, schools and youth associations. It is crucial that communities understand how to protect themselves at home and in public places, especially in health facilities and schools, said Dr. Gianfranco Rotigliano, UNICEF Representative in the Democratic Republic ...
Fischer has been working in an isolation area in Gueckedou, Guinea, since May as part of a team from Doctors without Borders to try to reduce mortality from the Ebola virus in rural communities. His dispatches from Africa are available from the online newsroom of UNC Health Care and UNC School of Medicine, where Fischer is a pulmonologist and critical care physician.. Bhadelia, the director of infection control at Bostons National Emerging Infectious Diseases Laboratory and a hospital epidemiologist at Boston Medical Center, has expertise in controlling the spread of infectious diseases. Though she is not without concern for her safety, her desire to help stem the Ebola outbreak clearly outweighs her fears.. I think itd be cavalier not to have a healthy amount of fear, but its that fear that drives us to be careful and to follow the protocols, she told WBUR. I have extensive training and I have a background in infectious disease and particularly with these pathogens.. Im reminded of the ...
An extensive look at the genome of the Ebola virus reveals its behavior, when it arrived in West Africa and how it spread in the region to cause the largest-ever recorded Ebola outbreak.
DAKAR, Senegal (AP) - Health officials have confirmed a second Ebola outbreak in Congo, the World Health Organization said Monday, adding yet another health crisis for a country already battling COVID-19 and the worlds largest measles outbreak.Congo also has yet to declare an official end to Ebola in its troubled east, where at least 2,243 people have died since an epidemic
World Health Organization declared on Friday that the Ebola outbreak spreading across West Africa has become a public health emergency of international concern. WHO also revealed that Ebola took an additional 29 lives between Tuesday and Wednesday alone.
Congos year-long Ebola outbreak has spread to a new province, with two cases, including one death, confirmed in South Kivu, according to the government health ministry. The movement of the potentially deadly disease to a new province highlights the difficulties that health workers in Congo face
The Ebola outbreak in the Democratic Republic of the Congo (DRC) is over, according to the country s health officials and the World Health Organization. The dec
The deadliest Ebola outbreak in the Democratic Republic of Congo has been declared over by WHO. This was achieved through continuous co-operation and effort by different arms of the Government, health workers and support of people.
The disproportionate number of recent infections among children in the Democratic Republic of Congo - specifically in Beni, the outbreaks current hot spot - has come as a surprise; typically young children dont make up a big proportion of cases during an Ebola outbreak.
Neon Nettle - EBOLA OUTBREAK: Disease Spreads Beyond Infection Zone, Pandemic Warning - Almost a hundred people have died from the virus since July
The Democratic Republic of the Congo’s 11th Ebola outbreak was declared over today, marking the end of a 6-month effort in Équateur province.“This is a tremendous accomplishment, particularly in the midst of the COVID-19 pandemic,” CDC Director Robert R. Redfield, MD, said in a statement.
The Ebola outbreak in the Democratic Republic of Congo made the long-feared jump across borders with three cases confirmed Wednesday in Uganda, including the de...
The Ebola outbreak in West Africa is disrupting the regions health care system, and one consequence is a dramatic drop in measles vaccinations, leaving millions of children potentially at risk for catching the disease, a new study suggests.
Ebola Outbreak Summer 2014 - SuperTopos climbing discussion forum is the worlds most popular community discussion forum for people who actively climb outdoors.
Sixteen people have died so far from the Ebola outbreak that began earlier this month in Western Uganda. According to the World Health Organization, the first case is believed to be from the Nyanswiga village in Nyamarunda, a sub-county of the Kibaale district of Uganda.
In a paper publishing May 21 in PLOS Neglected Tropical Diseases, researchers have interviewed Sierra Leonean journalists about their experiences reporting during the 2014-2015 Ebola outbreak. The experiences of these journalists may be able to help inform current efforts to communicate about COVID-19.
Ebola outbreak data in various formats. Contribute to montanaflynn/ebola-outbreak-data development by creating an account on GitHub.
Ebola Outbreak Highlights Importance of Infection Control for Healthcare Professionals By CareerSmart Learning Contributor, October 2014 , as published by
There are two sub-species of lowland gorilla; western and eastern, both of which inhabit isolated rainforest pockets where they...
The music is not in the notes, but the silence in between. - Wolfgang Amadeus Mozart. If one were to describe the history of Ebola outbreaks, one method would be to construct a timeline, with a point on the line for each outbreak. You could create this timeline with a varying number of points, depending on your methodology, but regardless of how you built your timeline, there would be spaces between these points. This is due to the nature of Ebola; it appears, it disappears, and it appears again. To the Ebola virus, these gaps are periods of convalescence. To us, they are periods of absence and mystery, and one of these gaps stands out as the most mysterious.. The CDC lists five Ebola outbreaks in the late 1970s. The first Ebola outbreak took place in 1976, though we now recognize the event as two simultaneous and separate outbreaks. Between June and November 1976, 284 cases (151 deaths) of Ebola Sudan occurred near what is now Nzara, South Sudan[i]; between September and October 1976, 318 ...
Chimpanzees inhabit the forest that US company Herakles Farms plans to destroy to make way for a controversial palm oil plantation, according to a study carried out by Dschang University, Cameroon. This adult chimpanzee was photographed at the Pandrillus Drill Sanctuary in Nigeria.
Emerging infectious diseases are of great concern to both humans and wild ape populations in the Congo Basin. In particular, drastic declines in ape densities following repeated emergences of Ebola in Gabon and Congo have shown clearly that this virus poses a serious threat to the long-term survival of great apes in central Africa. Ebola outbreaks in humans have been associated with declines in local ape populations, and ape remains recovered near outbreak sites have tested positive for the Ebola virus. The natural host of Ebola continues to elude researchers, despite attempts to discover its identity over the past 30 years.. The Goualougo Triangle Ape Project has developed a strong relationship with the Wildlife Conservation Societys Global Health Program and is actively involved in implementing the Regional Ebola Action Plan to address the threat of Ebola in the Sangha Trinational Region. The most valuable information on the epidemiology of Ebola virus has come from timely research (direct ...
Explorer and primatologist, Mireya Mayor, journeys deep into the unforgiving jungle to uncover the secrets of the mysterious western lowland gorillas.
Wildlife Conservation Society researchers in the remote northern jungles of the Republic of Congo have made a startling discovery: approximately 125,000 western lowland gorillas - more than twice the previous worldwide estimate. Coined the Green Abyss by scientists and explorers eager to do some coining in a world running increasingly short on coinable areas, these…. ...
"Vector-borne diseases". Articles about vector-borne disease. Vaccine News Daily. Chicago. WHO page on vector-borne diseases ... 4. December 1936 Quammen, David (4 April 2013). "Planet of the Ape; 'Between Man and Beast,' by Monte Reel". The New York Times ... are causing a resurgence in zoonotic disease across the world. Examples of vector-borne zoonotic diseases include: Lyme disease ... Airborne disease Asymptomatic carrier Fomite Globalization and disease Insect vectors of human pathogens Insect vectors of ...
Cutaneous disease is most common in Afghanistan, Algeria, Brazil, Colombia, and Iran, while mucocutaneous disease is most ... González C, Wang O, Strutz SE, González-Salazar C, Sánchez-Cordero V, Sarkar S (January 2010). Galvani AP (ed.). "Climate ... It is classified as a neglected tropical disease. The disease may occur in a number of other animals, including dogs and ... Nearly 13,000 cases of the disease were recorded in all of Colombia throughout 2004, and about 360 new instances of the disease ...
On Oxidation, Fermentation, Vitamins, Health, and Disease (1940). *Bioenergetics (1957). *Introduction to a Submolecular ... The Crazy Ape (1970). *What next?! (1971). *Electronic Biology and Cancer: A New Theory of Cancer (1976) ...
Thus, Benton defines "apes" to include humans, then he repeatedly uses "ape-like" to mean "like an ape rather than a human"; ... Close interactions between humans and non-human primates (NHPs) can create pathways for the transmission of zoonotic diseases. ... "apes" to mean "hominoids". In that case, the group heretofore called "apes" must now be identified as the "non-human apes". ... "apes" as a whole, and the "great apes" in particular, are paraphyletic because they exclude humans. ...
She then wrote a column on evolution, titled Planet Of The Apes, which ran from April, 2011 to October, 2012, when she left the ... Sometimes it takes a scary sounding disease story to highlight the importance of science literate journalism. -Faye Flam, KSJ ... While writing the Planet Of The Apes blog for the Inquirer, Flam wrote an article about evolution as though the responses had ... This approach continued, with Higgs guest-authoring other posts in the Planet Of The Apes blog, and "Higgs, the Science Cat" ...
Ebola virus disease Ebola virus disease treatment research "First FDA-approved vaccine for the prevention of Ebola virus ... Fausther-Bovendo H, Mulangu S, Sullivan NJ (June 2012). "Ebolavirus vaccines for humans and apes". Current Opinion in Virology ... Center for Infectious Disease Research and Policy (CIDRAP) and Wellcome Trust. Archived (PDF) from the original on 18 January ... Congress passed a law in 2004, that funds a national stockpile of vaccines and medicine for possible outbreaks of disease. A ...
Humans, apes, pigs, and dogs serve as natural hosts. There are currently 18 species in the two genera Orthorubulavirus and ... Diseases associated with this genus include mumps. Members of the subfamily are collectively called rubulaviruses. The ... Humans, apes, pigs, and dogs serve as the natural host. Transmission routes are respiratory and saliva. "Virus Taxonomy: 2019 ...
"Human and great ape red blood cells differ in plasmalogen levels and composition". Lipids in Health and Disease. 10: 101. doi: ... Parkinson's disease, Niemann-Pick disease, type C, Down syndrome, and multiple sclerosis, it is not clear if this is causal or ... In such cases, both copies of the GNPAT or AGPS gene must be mutated in order for disease to manifest. Unlike the peroxisome ... Gene expression data from all these species caused the authors to speculate that other human and great ape cells and tissues ...
"Protecting Great Apes & Primates from Disease & Trafficking - The Jane Goodall Institute". The Jane Goodall Institute. ...
These include curing the Great Ape's disease and saving his friends from the evil poachers. These poachers want to capture the ... The player controls Tarzan (based on the famous character created by Edgar Rice Burroughs for his novel Tarzan of the Apes) in ...
The higher an African ape's population density, the better a disease fares. 55% of chimps at the Gombe reserve die of disease, ... While a disease specific to hominins must keep its human host alive long enough to transmit itself, zoonotic diseases will not ... The majority of these diseases are still restricted to hot and damp African environments. Once hominins had moved out into ... Zoonotic diseases are those that are transmitted from animals to humans. ...
... heart disease and other individual diseases. 8 October The Nobel Prize in Physics has been awarded to François Englert and ... "Evolution: Fossils Pinpoint Ape and Monkey Split". Design & Trend. 15 May 2013. Archived from the original on 10 June 2013. ... potentially helping to treat neurological diseases such as Parkinson's disease. A much-vaunted experimental vaccine for ... "Man with kidney disease first in U.S. to get bioengineered vein". CNET. 6 June 2013. Retrieved 7 June 2013. Williams, Sarah C. ...
25 people in Bakaklion, Cameroon killed due to eating of ape. *^ a b "Ebolavirus - Pathogen Safety Data Sheets". Public Health ... Ebola virus disease at Curlie. *CDC: Ebola hemorrhagic fever - Centers for Disease Control and Prevention, Special Pathogens ... Main articles: Ebola virus cases in the United States, Ebola virus disease in Spain, and Ebola virus disease in the United ... "Ebola virus disease - Democratic Republic of the Congo - Disease outbreak news: Update 6 June 2019". World Health Organization ...
Humans, apes, and birds serve as natural hosts. There are currently seven species in this family, divided among 2 genera. Its ... Although liver diseases transmissible among human populations were identified early in the history of medicine, the first known ... Diseases associated with this family include: liver infections, such as hepatitis, hepatocellular carcinomas (chronic ...
Nearly 13,000 cases of the disease were recorded in all of Colombia throughout 2004, and about 360 new instances of the disease ... González C, Wang O, Strutz SE, González-Salazar C, Sánchez-Cordero V, Sarkar S (January 2010). Galvani AP (ed.). "Climate ... "Centers for Disease Control and Prevention. January 2013.. *^ González U, Pinart M, Sinclair D, Firooz A, Enk C, Vélez ID, et ... It is classified as a neglected tropical disease.[12] The disease may occur in a number of other animals, including dogs and ...
Rayner JC, Liu W, Peeters M, Sharp PM, Hahn BH (May 2011). "A plethora of Plasmodium species in wild apes: a source of human ... Coatney, G.R.; National Institute of Allergy and Infectious Diseases (1971). The primate malarias. U.S. National Institute of ...
Mayhew suffered from cancer and Parkinson's disease in his later years. He died on 25 June 2016, aged 86, in his home in Kent ... co-founded the outdoor adventure company Go Ape.[citation needed] His son, Jerome Mayhew, is the Conservative MP for the ...
"Vector-borne diseases". Articles about vector-borne disease. Vaccine News Daily. Chicago.. ... "Planet of the Ape; 'Between Man and Beast,' by Monte Reel". The New York Times. Retrieved 7 April 2014 ... "Division of Vector-Borne Diseases (DVBD)" (Multimedia). Fort Collins, Colorado: Centers for Disease Control and Prevention (CDC ... Many factors affect the incidence of vector-borne diseases. These factors include animals hosting the disease, vectors, and ...
Buck Kartalian, 93, American actor (Planet of the Apes, Cool Hand Luke, The Rock). Malik Iqbal Mehdi Khan, 64, Pakistani ... Intikhab, 22, American racehorse, heart disease. John Lyons, 90, British trade union leader. José Luis Romo Martín, 62, Mexican ... Rudra Madhab Ray, 78, Indian politician, kidney disease. Ghislaine Roquet, 90, Canadian nun and academic. Pam Royds, 91, ... Jacky Lee, 77, American football player (Denver Broncos, Kansas City Chiefs), Alzheimer's disease. Balraj Madhok, 96, Indian ...
He had first-hand knowledge of the disease, and was present in Rome when it first struck in 166, and was also present in the ... Galen claims that the High Priest chose him over other physicians after he eviscerated an ape and challenged other physicians ... Galen was not trying to present a description of the disease so that it could be recognized in future generations; he was more ... Romans frequented the temple at Pergamon in search of medical relief from illness and disease. It was also the haunt of notable ...
Aerico (Greek) - Disease demon. Æsir (Norse) - Norse deities. Afanc (Welsh) - Lake monster (exact lake varies by story). Agni ( ... Agogwe (East Africa) - Small, ape-like humanoid. Ahkiyyini (Inuit) - Animated skeleton that causes shipwrecks. Ahuizotl (Aztec ... Ardat-Lili (Akkadian) - Disease demon. Argus Panoptes (Greek) - Hundred-eyed giant. Arikura-no-baba (Japanese) - Old woman with ... Acheri (Mitologia Hindu) - Disease-bringing ghost. Achlis (Roman) - Curious elk. Adar Llwch Gwin (Welsh) - Giant birds that ...
Roberts, Alice May (2008). Rotator cuff disease in humans and apes: a palaeopathological and evolutionary perspective on ... Roberts spent seven years working part-time on her PhD in paleopathology, the study of disease in ancient human remains, ... Writing in the i newspaper in 2016, Roberts dismissed the aquatic ape hypothesis (AAH) as a distraction "from the emerging ... aquatic apes' - here's why". The Conversation. Retrieved 16 October 2016. Roberts, Alice; McLysaght, Aoife (2018). "Who am I ...
Loomis MR (1985). 》Immunoprofylaxis in infant great apes》. Graham CE, Bowen JA. 》Clinical Management of Infant Great Apes》. ... "The Journal of Infectious Diseases》 209 (7): 982-5. doi:10.1093/infdis/jit639. PMC 3952676. PMID 24626533.. ... Harrison's Infectious Diseases》 3판. New York: McGraw-Hill Education. 502-506쪽. ISBN 9781259835971. .. ... Atkinson W (May 2012). 》Pertussis Epidemiology and Prevention of Vaccine-Preventable Diseases》 12판. Public Health Foundation. ...
Once the ape is in the care of the Dr. Galdikas and her staff, it is raised (if it is young) or treated for any diseases or ... The critics question if the behavior of the apes mirrors that of a wild orangutan or not. Other people began wondering if the ... The new insight from Galdikas' research with the Asian Ape (orangutan) drew a lot of media attention. Galdikas' found that she ... Birutė Galdikas, one of three anthropologists (The Trimates) to study great apes under the guidance of Dr. Louis Leakey, OFI ...
In infectious disease ecology and epidemiology, a natural reservoir, also known as a disease reservoir or a reservoir of ... 25 people in Bakaklion, Cameroon killed due to eating of ape Macpherson, C.N.L.; Craig, P.S. (1991). "Chapter 8: Animal ... Humans as disease reservoirs can be symptomatic (showing illness) or asymptomatic (not showing illness), act as disease ... "Modes of Disease Transmission , Microbiology". courses.lumenlearning.com. Retrieved 2017-12-05. "Modes of Disease Transmission ...
Disease Control Priorities Project. (2006). Vaccine-Preventable Diseases (Table 20.1, page 390 "Archived copy" (PDF). Archived ... Loomis MR (1985). "Immunoprofylaxis in infant great apes". In Graham CE; Bowen JA. Clinical Management of Infant Great Apes. ... Antibiotics may be used to prevent the disease in those who have been exposed and are at risk of severe disease.[15] In those ... Whooping cough (also known as pertussis or 100-day cough) is a highly contagious bacterial disease.[1][10] Initially, symptoms ...
Adult male gorillas are prone to cardiomyopathy, a degenerative heart disease. List of individual apes Cross River gorilla ... Disease has also been a factor in the survival of the western lowland gorilla. The Ebola epizootic in western and central ... The gorilla became the next-to-last great ape genus to have its genome sequenced. This was done in 2012. This has given ... Researchers later adjusted the figure to less than half because of poaching and diseases. Surveys conducted by the Wildlife ...
The disease can cause red itchy swellings below the skin called "Calabar swellings". The disease is treated with the drug ... A simian type of loiasis exists in monkeys and apes but it is transmitted by Chrysops langi. There is no crossover between the ... Loa loa filariasis is a skin and eye disease caused by the nematode worm Loa loa. Humans contract this disease through the bite ... The disease was once endemic to the western African countries of Ghana, Guinea, Guinea Bissau, Ivory Coast and Mali but has ...
"Update: Severe respiratory disease associated with a novel coronavirus" (PDF) (PDF). European Centre for Disease Prevention and ... Heilprin, John (23 May 2013). The Associated Press (AP) (ed.). "WHO: Probe into deadly coronavirus delayed by sample dispute". ... On 1 November 2013, a woman who had recently traveled to Saudi Arabia for the Hajj, contracted the disease. She was stated to ... On 2 May 2014, the United States Centers for Disease Control (CDC) confirmed the first diagnosis of MERS-CoV in the United ...
He also claimed that Negros had very similar brains to apes and that Negros have a shortened big toe which is a character which ... He also worked with tropical diseases, and was concerned with ophthalmic disorders that included trachoma and conjunctivitis. ... He claimed that the main feature of the Negros skeleton is prognathism, which he claimed was Negros relation to the ape. ... Tentamen de morborum transitionibus, Munich 1830 (dissertation) - Examination of the contagiousness of diseases. Ist denn die ...
... while imbalance results in disease. Such disease-inducing imbalances can be adjusted and balanced using traditional herbs, ... A belief that a substance that causes the symptoms of a disease in healthy people cures similar symptoms in sick people.[n 8] ... Treatments for severe diseases such as cancer and HIV infection have well-known, significant side-effects. Even low-risk ... In the absence of this bias, especially for diseases that are not expected to get better by themselves such as cancer or HIV ...
"Ebola Virus Disease". SRHD. Retrieved 15 September 2020.. *^ a b c d "Q&A on Transmission, Ebola". Centers for Disease Control ... 25 people in Bakaklion, Cameroon killed due to eating of ape. *^ a b "Ebolavirus - Pathogen Safety Data Sheets". Public Health ... "About Ebola Virus Disease". Centers for Disease Control and Prevention (CDC). Archived from the original on 16 October 2014. ... "Ebola (Ebola Virus Disease) Transmission". Centers for Disease Control and Prevention (CDC). 5 November 2014. Archived from the ...
... coronary heart disease, and cerebrovascular disease, because they ate mostly lean meats and plants and frequently engaged in ... This view is supported by studies of higher apes, particularly chimpanzees. Chimpanzees are the closest to humans genetically, ... caused by other factors such as disease and overhunting by humans.[16][17] New research suggests that the extinction of the ... It is also unlikely that Paleolithic hunter-gatherers were affected by modern diseases of affluence such as type 2 diabetes, ...
... subluxation is the sole cause of disease and manipulation is the cure for all diseases of the human race.[4][41] A 2003 ... Palmer, a magnetic healer, hypothesized that manual manipulation of the spine could cure disease.[214] The first chiropractic ... A subluxated vertebra ... is the cause of 95 percent of all diseases ... The other five percent is caused by displaced joints ... Early chiropractors believed that all disease was caused by interruptions in the flow of innate intelligence, a vitalistic ...
... "first severe new disease of the 21st century." She observed that the two new diseases WHO is dealing with in 2013 are the novel ... Heilprin, John (23 May 2013). The Associated Press (AP) (ed.). "WHO: Probe into deadly coronavirus delayed by sample dispute". ... Enhanced global actions for the prevention and control of non-communicable diseases, endorsed in 2011[8] ... combatting non-communicable diseases and female genital mutilation; campaigns to support breastfeeding and to decrease abuse of ...
Brown Hare - List of Mammals, Facts about Animals, Carnivores, Seals, Sea Lion, Whales, Dolphins, Monkeys, Apes, Elephants, ... "Life-history change in disease-ravaged Tasmanian devil populations". Proceedings of the National Academy of Sciences. 105 (29 ... The great ape Gigantopithecus, which lived in Asia between 1 million and 300,000 years ago, is the largest primate known to ... "The ape that was". Archived from the original on May 25, 2015. Retrieved 10 June 2012.. CS1 maint: Unfit url (link ...
"Threat to Great Apes Highlighted at Virunga Meeting". America.gov. Archived from the original on 28 August 2010. Retrieved 2010 ... higher resistance to pests and diseases, and increased cold-weather tolerance.[109] ...
... some anthropoid apes, especially chimpanzees. Both Roux and Metchnikoff, consequent to the discovery that this type of ape can ... This made him realise that the vector of the disease were lice that were discarded with the patient's own clothes.[3] Nicolle ... This disease used to kill thousands of children every year: an associated condition was commonly called croup, which created ... Alphonse Laveran got the 1907 Nobel Prize for his research on the role of protozoans as disease agents (notably, his discovery ...
Tu, Z; Wang, L; Xu, M; Zhou, X; Chen, T; Sun, F (21 February 2006). "Further understanding human disease genes by comparing ... Mitchell, Matthew W.; Gonder, Mary Katherine (2013). "Primate Speciation: A Case Study of African Apes". Nature Education ... "Mutagenesis strategies in zebrafish for identifying genes involved in development and disease.". Trends in genetics : TIG 22 (9 ...
Diseases and disabilities supposedly resulted from an excess or deficit of one of these four humors. Disease could also be the ... Yellow bile caused warm diseases and phlegm caused cold diseases. In On the Temperaments, Galen further emphasized the ... The imbalance of humors, or dyscrasia, was thought to be the direct cause of all diseases. Health was associated with a balance ... It also uses the term blood dyscrasia to refer to any blood disease or abnormality. ...
Various congenital and acquired tongue diseases can affect speech as can motor neuron disease. ... While animals also communicate using vocalizations, and trained apes such as Washoe and Kanzi can use simple sign language, no ... Diseases and disorders of the brain, including alogia, aphasias, dysarthria, dystonia and speech processing disorders, where ... Diseases and disorders of the lungs or the vocal cords, including paralysis, respiratory infections (bronchitis), vocal fold ...
"I think it [religion] is a contagious mental disease. . . . The brain has a need to believe it knows a reason for things.. ... "Man's evolution as a neotenous ape has put him in a similar position to the dog's. He becomes sexually mature and yet he still ... famous for describing human behaviour from a zoological perspective in his books The Naked Ape and The Human Zoo.[240][241] ...
Other diseases[edit]. Studies examining the effects of vitamin C intake on the risk of Alzheimer's disease have reached ... ability to make vitamin C may have occurred much farther back in evolutionary history than the emergence of humans or even apes ... "Journal of Alzheimer's Disease. 29 (4): 711-26. doi:10.3233/JAD-2012-111853. PMC 3727637. PMID 22366772.. ... The disease was shown to be prevented by citrus fruit in an early controlled trial by a Royal Navy surgeon, James Lind, in 1747 ...
Anti-germ theory of diseasesEdit. Virchow did not believe in the germ theory of diseases, as advocated by Louis Pasteur and ... "it is quite certain that man did not descend from the apes...not caring in the least that now almost all experts of good ... Virchow's disease, leontiasis ossea, now recognized as a symptom rather than a disease ... Murray, edited by Edward J. Huth, T. Jock (2006). Medicine in Quotations: Views of Health and Disease Through the Ages (2 ed ...
Diagnosis is most often made by the elimination of other conditions, disorders or diseases. Onset usually occurs in adulthood, ...
This is argued to explain why human brains can be much larger than other apes, since humans are the only ape to engage in food ... A culture historical hypothesis". The American Journal of Digestive Diseases. 15: 695-710. doi:10.1007/bf02235991. Cavalli- ... and has been attributed to one of the reasons why humans have such large brains compared to other great apes. This is due to ... which go some way to explain the observable difference between great ape traditions and human types of culture (see Emulation ( ...
Y-chromosome-linked diseasesEdit. Diseases linked to the Y chromosome typically involve an aneuploidy, an atypical number of ... June 2003). "Abundant gene conversion between arms of palindromes in human and ape Y chromosomes". Nature. 423 (6942): 873-6. ... The following Y-chromosome-linked diseases are rare, but notable because of their elucidating of the nature of the Y chromosome ... Goto H, Peng L, Makova KD (February 2009). "Evolution of X-degenerate Y chromosome genes in greater apes: conservation of gene ...
Centers for Disease Control and Prevention (5 Nisan 2020). "What to Do if You Are Sick". U.S. Centers for Disease Control and ... Rocheleau, Jackie (2020). "Protecting great apes from the unknown effects of Covid-19". Knowable Magazine. doi:10.1146/knowable ... "Coronavirus Disease 2019 (COVID-19)". U.S. Centers for Disease Control and Prevention (CDC). 11 Şubat 2020. 26 Ocak 2020 ... "Coronavirus Disease 2019 (COVID-19) - Prevention & Treatment". U.S. Centers for Disease Control and Prevention (CDC). 10 Mart ...
"National Institute of Allergy and Infectious Diseases. Archived from the original on 2015-04-10. Retrieved 2016-05-24.. ... Earliest apes. P. h. a. n. e. r. o. z. o. i. c. ...
Shea, Brian T. (1985). "The ontogeny of sexual dimorphism in the African apes". American Journal of Primatology. 8 (2): 183-188 ... lifestyle or disease, and many are the result of personal adornment. ...
The consequence of this, however, was an increase in sphingolipid diseases.[30] The final chapter, Evolution, gives a summary ... In my view, he spends too much time and space attempting to convince the reader that we did indeed evolve from apes (duh!) and ... Wade asserts that there is a clear continuity from the earlier apes of five million years ago to the anatomically modern humans ... have been more common in the human past by noting a common genetic adaptation that protects against Creutzfeldt-Jakob disease, ...
A demyelinating disease is any disease of the nervous system in which the myelin sheath of neurons is damaged.[1] This damage ... Demyelinating diseases are traditionally classified in two kinds: demyelinating myelinoclastic diseases and demyelinating ... Alzheimer's disease, depression, and other diseases affecting the brain. It has also been used to study the metabolism of other ... "demyelinating disease" at Dorland's Medical Dictionary *^ Lotti M, Moretto A (2005). "Organophosphate-induced delayed ...
The formation of goose bumps in humans under stress is considered to be a vestigial reflex;[2] and its function in other apes ... Some authors have applied "goosebumps" to the symptoms of sexually-transmitted diseases.[3] "Bitten by a Winchester goose" was ... Piloerection is also a classic symptom of some diseases, such as temporal lobe epilepsy, some brain tumors, and autonomic ...
"for his outstanding makeup achievement for Planet of the Apes.". Statuette. Onna WhiteOnna White. "for her outstanding ... he died of heart disease on July 9, 1948. ...
Major modern diseases such as Ebola virus disease and salmonellosis are zoonoses. HIV was a zoonotic disease transmitted to ... chimpanzees, monkeys, apes, baboons. mosquito bite, sexual intercourse, blood transfusion and sometimes bites of monkeys. ... Many modern diseases, even epidemic diseases, started out as zoonotic diseases. It is hard to establish with certainty which ... Lists of diseasesEdit. Disease[18]. Pathogen(s). Animals involved. Mode of transmission. ...
... is a skin and eye disease caused by the nematode worm Loa loa. Humans contract this disease through the bite ... A simian type of loiasis exists in monkeys and apes but it is transmitted by Chrysops langi. There is no cross-over between the ... The disease can cause red itchy swellings below the skin called "Calabar swellings". The disease is treated with the drug ... "The Lancet Infectious Diseases. doi:10.1016/S1473-3099(13)70263-9. ISSN 1473-3099. Retrieved 2014-02-24.. ...
Infectious disease → 감염병 (C) *Pathogen → 병원체 (D). *Sexually transmitted disease → 성병 (E) *AIDS → 후천면역결핍증후군 (B+) ... Ape → 유인원 (C) *Chimpanzee → 침팬지속 (E). *Gibbon → 긴팔원숭이 (C). *Gorilla → 고릴라 (C) ...
... from progressive heart ailments ranging from aneurisms to valvular disease to cardiomyopathy. ... Deadly Ape Heart Disease Puzzles Zoos. Published April 06, 2008. Associated Press ... Soon, these great apes may only exist in captivity, says Haley Murphy, director of veterinary services at Zoo New England, ... One is the need for echocardiograms of apes. To do the test, a gorilla must be anesthetized, which carries a certain amount of ...
... Share this:. *Click to share on Facebook (Opens in new window) ... "Soon, these great apes may only exist in captivity," says Haley Murphy, director of veterinary services at Zoo New England, ... Mopie looked the picture of ape fitness: His shoulders were broad and imposing, his silver-haired back sculpted and muscular, ... As the scope of the mystery widened, the number of cases of apes developing heart problems steadily climbed. ...
... Share this:. *Click to share on Facebook (Opens in new window) ... Chicken-killing Newcastle disease prompts euthanasia orders for parts of Chino * After 22 horse deaths at Santa Anita, race ... "Soon, these great apes may only exist in captivity," says Haley Murphy, director of veterinary services at Zoo New England, ... Mopie looked the picture of ape fitness: His shoulders were broad and imposing, his silver-haired back sculpted and muscular, ...
Examines Future Disease Threats 15th Nov 2016 , Full Article The direct and deadly links between Ebola outbreaks in... ... in addition to exploring future approaches to reduce spread of the disease between great apes and humans.. Ebola & Great Apes ... GRASPs Ebola & Great Apes Examines Future Disease Threats. 15th Nov 2016 , Full Article. The direct and deadly links between ... Great Apes, an information booklet produced by the Great Apes Survival Partnership (GRASP).. Great apes and humans are so ...
Apes - Apes are native to tropical Asia and Africa, but one species of great ape can now be found on every continent - do you ... Twycross Zoo begins great ape heart disease study. Posted on July 22, 2016. by admin ... Researchers are to look into why great apes are susceptible to heart disease while in the care of humans. ... Unlike humans, experts do not believe the disease in great apes is linked to poor diet and lifestyle. ...
Infectious diseases are major threats to apes in Africa. In addition to Ebola virus disease, a leading cause of death, the ... At the time of sampling, the animals were anesthetized and showed no evident signs of disease. All apes were born and reared in ... Chlamydia-Related Bacteria in Free-Living and Captive Great Apes, Gabon. Emerging Infectious Diseases. 2016;22(12):2199-2201. ... Chlamydia-Related Bacteria in Free-Living and Captive Great Apes, Gabon. Emerging Infectious Diseases, 22(12), 2199-2201. https ...
To estimate population exposure of apes and Old World monkeys in Africa to enteroviruses (EVs), we conducted a ... Centers for Disease Control and Prevention. CDC twenty four seven. Saving Lives, Protecting People Centers for Disease Control ... High Seroprevalence of Enterovirus Infections in Apes and Old World Monkeys. Emerging Infectious Diseases. 2012;18(2):283-286. ... High Seroprevalence of Enterovirus Infections in Apes and Old World Monkeys. Emerging Infectious Diseases, 18(2), 283-286. ...
DAWN OF THE PLANET OF THE APES, its time to dive head first into some viral fun! Follo... , Order popular ... Viral website for Dawn of the Planet of the Apes spreads the disease. 07.22.2013by: Ryan Miller ... DAWN OF THE PLANET OF THE APES has launched their Simian Flu marketing campaign that aims to spread awareness on the disease ... andy serkis, arrow in the head, dawn of the planet of the apes, Enrique Murciano, Gary Oldman, Jason Clarke, judy greer, Keri ...
Plasmalogen deficiency is also found in the brain tissue of individuals with Alzheimer disease. In a human and great ape cohort ... We propose that the observed differences in human and great ape RBC plasmalogens are primarily caused by their rates of ... Gene expression data raise the possibility that other human and great ape cells and tissues differ in plasmalogen levels. Based ... Furthermore, human and great ape skin fibroblasts showed only modest differences in peroxisomal plasmalogen biosynthetic ...
Great apes go through midlife crises just like humans, teen suffers from a disorder called sleeping beauty syndrome and more. ... Drinking Alcohol Increases Disease-Causing Mouth Bacteria. Changes in oral microbes may lead to gum disease, heart problems, ... Midlife Crises in Apes, Sleeping Beauty, Minds of Mediums, and Moon Madness. Great apes go through midlife crises just like ... High in youth, their happiness levels fall in middle age, and rise into old age - suggesting that great apes experience midlife ...
2004) in Infectious Disease and Host-Pathogen Evolution, ed Dronamraju KR (Cambridge Univ Press, Cambridge, UK), pp 113-140. ... The presence of P. falciparum in these apes would therefore have resulted from host transfer from humans to apes. The older age ... Ape malaria transmission and potential for ape-to-human transfers in Africa ... falciparum or ape parasites, suggesting that the falciparum + ape parasite cluster (Laverania clade) may have evolved from a ...
... from apes you will find medical scientists scrambling to study apes to make use of the similarities to better medical diseases ... why the human y have a big segment pink not found in other apes ys? they say it was transposed after human split from the apes ... Diseases and Pandemics: 13 hours ago, 11 flags * We should be asking ourselves who actually put Biden in the White House. US ... Diseases and Pandemics • 9 • : mysterioustranger * Former White House Physician Says President Biden Will Resign or Be Removed ...
Common misconceptions and unproven assumptions about the aquatic ape theory A Guest Post by Marc Verhaegen *2013 [email protected] ... The aquatic ape theory and some common diseases. 1987 Med Hypoth 24:293-9 ... The term "aquatic ape" is often misunderstood by outdated or ill-informed PAs: its not about apes, but about Pleistocene Homo ... Publications on ape and human evolution. *The aquatic ape theory: evidence and a possible scenario. 1985 Med Hypoth 16:17-32 ...
The aquatic ape theory and some common diseases. 1987 Med Hypoth 24:293-9 ... Publications on ape and human evolution. *The aquatic ape theory: evidence and a possible scenario. 1985 Med Hypoth 16:17-32 ... The term "aquatic ape" is often misunderstood by outdated or ill-informed PAs: its not about apes, but about Pleistocene Homo ... Frank, my article "The aquatic ape evolves: common misconceptions and unproven assumptions about the so-called Aquatic Ape ...
... number of MEI to SNP/indel gene-disruptive mutations observed between ape genomes is concordant with the ratio of disease- ... Rates and patterns of great ape retrotransposition. Fereydoun Hormozdiari, Miriam K. Konkel, Javier Prado-Martinez, Giorgia ... Rates and patterns of great ape retrotransposition. Fereydoun Hormozdiari, Miriam K. Konkel, Javier Prado-Martinez, Giorgia ... Ape phylogeny. Neighbor-joining trees constructed from (A) SNP, (B) Alu, and (C) L1 insertions define the genetic relationship ...
Original reporting and compelling writing on local news, restaurants, arts and culture have made Phoenix New Times a vital resource for readers who want to understand and engage with their community.
... the relatively intact forests of western equatorial Africa have been viewed as the last stronghold of African apes. Gabon and ... Catastrophic ape decline in western equatorial Africa Nature. 2003 Apr 10;422(6932):611-4. doi: 10.1038/nature01566. Epub 2003 ... Ape Diseases / epidemiology* * Commerce * Congo / epidemiology * Conservation of Natural Resources* / trends * Data Collection ... The primary cause of the decline in ape numbers during this period was commercial hunting, facilitated by the rapid expansion ...
Parkinsons disease. 03/21/2018 Parkinsons disease Systems Approaches to Optimizing Deep Brain Stimulation Therapies in ... "While its certainly possible that Oreopithecus walked on two legs to some extent, as apes are known to employ short bouts of ... As part of the study, the researchers analyzed the fossil ape to see whether it possessed lower spine anatomy consistent with ... Home Genetics and Birth Defects Extinct Ancient Ape Did Not Walk Like a Human, Study Shows ...
New drug may protect against memory loss in Alzheimers disease 09/05/2019 Alzheimers Creation of new brain cells plays ... Three groups of apes were tested in this study. One group consisted of chimpanzees that had been raised in standard laboratory ... The placement of the food in one of the containers was hidden from the apes, and a researcher indicated the correct container ... In the current experiment, the apes participated in an object-choice task - they had to choose between two containers, one of ...
Centers for Disease Control and Prevention (CDC), UNITED STATES. Dr. K.M. Bang, Dr. J.M. Mazurek, Dr. J. Wood JM ... Surviving Mesothelioma / News / Updates / Ape Virus Shrinks Mesothelioma Tumors in Lab. Ape Virus Shrinks Mesothelioma Tumors ... Gibbon ape leukemia virus (GALV) has been tested for years as a viral vector, a carrier of therapeutic genetic information, in ... This website should not be used for diagnosing or treating a health problem or disease and it is not a substitute for ...
Centers for Disease Control and Prevention (CDC), UNITED STATES. Dr. K.M. Bang, Dr. J.M. Mazurek, Dr. J. Wood JM ... Tag Archives: Ape Virus. Ape Virus Shrinks Mesothelioma Tumors in Lab. December 27, 2013. Alex Strauss ... A virus that causes leukemia in gibbon apes may have the power to help fight malignant mesothelioma in people. Gibbon ape ... Today, Id like to give you a copy for free because I want more people to survive this disease. ...
Because they are close to us, nonhuman great apes are suitable for research on several diseases that cause human suffering. Yet ... Supporters of the Great Ape Project point to the psychological similarity between nonhuman apes and ourselves: nonhuman apes, ... The "Great Ape Project" argues that because the differences between humans and other great apes (chimpanzees, bonobos, gorillas ... As a consequence of self-awareness great apes must suffer in captivity in ways similar to what we would experience. This is no ...
Differences shaped by disease. Differences between the saliva of humans and great apes were also found in proteins involved in ... Humans have waterier saliva than great apes. The overall protein content in human saliva was less than half of the amount found ... "Great apes and Old World monkeys chew on their fiber-rich food for longer periods of time, while humans swallow food faster, an ... BUFFALO, N.Y. - Two million years of eating meat and cooked food may have helped humans shift further from other great apes on ...
Animal Diseases and Animal Food. By D. E. Salmon. Packwood Turned into Coal. ...
Locals are killing them over disease fearsCredit: AFP or licensors. There has been a surge in killings because of the mistaken ... Samples will sometimes be sent to the Osvaldo Cruz research center to be tested for yellow fever and other diseases. ... Yellow fever is a disease caused by a virus that is spread through mosquito bites. ...
Can you name the APES Chapter 19? Test your knowledge on this miscellaneous quiz to see how you do and compare your score to ... Help prevent death from dehydration for victims of diarrheal diseases. Deliberate release of disease-causing bacteria or ...
Yonguesa was tied to a plank and left on the mud floor, picking up diseases. ... A UN study estimates 3,000 great apes are stolen per year to be sold on. A few end up taking part in boxing matches in Asian ... But poachers are also cashing in on the trafficking trade as demand soars for great apes in Far East theme parks and unlicensed ... Horrors of great ape trafficking exposed: Chimp captured and tormented by battle-hardened child soldiers. ...
How the Naked Ape Became the Fat Ape. News Anticancer Drug Candidate Inhibits Novel Alzheimers Disease Target to Protect ... Studies Show How Parkinsons Disease Spreads from the Gut to the Brain. ...
37.00 at Mighty Ape NZ. Catalog of the photo exhibition People, Places, Perspectives shown at the National Library of Kosovo ... Copyright © 1996 - 2020 Mighty Ape Limited. The words Mighty Ape and the Ape device are registered trademarks of Mighty Ape ... Mighty Ape New Zealand Mighty Ape Australia All prices are shown in New Zealand Dollars and include GST unless otherwise stated ... Mighty Ape is continuing to dispatch and deliver orders nationwide as normal while Auckland operates under COVID-19 Alert Level ...
The companys product portfolio is comprised of humanized antibodies, targeting diseases such as cancer, inflammatory diseases ... those living in larger cities are affected by air pollution related diseases. , That ... countries globally - decided to take ... and ophthalmic disease. Collaboration is an important aspect of Apexigens business model. At present, seven corporate ... advancing a pipeline of novel product candidates with the potential to address life-threatening and difficult to treat diseases ...
  • Now that we've seen the first look at Matt Reeves' DAWN OF THE PLANET OF THE APES , it's time to dive head first into some viral fun! (joblo.com)
  • Following in the viral footsteps of ROBOCOP and GODZILLA , DAWN OF THE PLANET OF THE APES has launched their Simian Flu marketing campaign that aims to spread awareness on the disease that proves to be fatal to humans. (joblo.com)
  • Remember one of the early scenes in the classic movie Planet of the Apes? (prisonplanet.com)
  • The Canódromo, Creative Research Park continues the 'Grades Obertes' outdoor film sessions with ' The Rise of the planet of the Apes ', directed by Rupert Wyatt in 2011. (timeout.com)
  • Althouse: Hey, I saw "Rise of the Planet of the Apes. (blogspot.com)
  • Some of the footage from the London riots when young males were leaping up on counters to wrest flat screen TVs from walls reminded me of one of the scenes from the Planet of the Apes trailer. (blogspot.com)
  • Rupert Wyatt Might Direct Fox's Planet of the Apes Prequel? (firstshowing.net)
  • Deadline is reporting that British director Rupert Wyatt is Fox's top choice to direct the Planet of the Apes prequel. (firstshowing.net)
  • Wait - there's a Planet of the Apes prequel? (firstshowing.net)
  • He hasn't directed anything since then, but if you've seen The Escapist (and not many people have), you will agree with me about how much potential this guy has, especially if they give him a huge project like Planet of the Apes . (firstshowing.net)
  • The last time we wrote about Planet of the Apes was back in December of 2008 and it was only to provide an update on an Apes prequel called Caesar written (and to be directed) by Scott Frank . (firstshowing.net)
  • The prequel was "Escape from the Planet Of the apes" right? (firstshowing.net)
  • So would a prequel be a remake of Conquest of the Planet of the Apes? (firstshowing.net)
  • I guess it could be set between Conquest and Battle for the Planet of the Apes. (firstshowing.net)
  • I have a feeling Fox wants to keep this grounded and low budget so that it can't potentially FLOP BIG TIME like Tim Burton's Planet Of The Apes. (firstshowing.net)
  • He had a healthy appetite (he'd put away 7 pounds of food daily) and Mopie was no couch gorilla, either: He'd nimbly scale the mesh of his enclosures at the National Zoo in Washington, D.C., playfully chase the younger gorillas, and perch himself high in an outdoor maple, as if to show the world he was the king of the Great Ape House. (foxnews.com)
  • Gorillas in zoos around the nation, particularly males and those in their 20s and 30s, have been falling ill - and sometimes dying suddenly - from progressive heart ailments ranging from aneurisms to valvular disease to cardiomyopathy. (foxnews.com)
  • Far less endangered than their relatives, the mountain gorillas, these apes were officially considered only as 'vulnerable. (foxnews.com)
  • Soon, these great apes may only exist in captivity,' says Haley Murphy, director of veterinary services at Zoo New England, which runs Boston's Franklin Park Zoo and the Stone Zoo in Stoneham, Mass. The zoos are home to seven western lowland gorillas, the only species kept in captivity. (foxnews.com)
  • The direct and deadly links between Ebola outbreaks in humans and contact with chimpanzees and gorillas and options for prevention are analyzed in Ebola & Great Apes , an information booklet produced by the Great Apes Survival Partnership (GRASP). (4apes.com)
  • The booklet is an important source of information for GRASP and its many partners working to save critically endangered populations of gorillas, chimpanzees and bonobos in Africa, and will act as a vital tool in informing GRASP's policies going forward on Ebola and other threatening zoonotic diseases. (4apes.com)
  • To learn more about the prevalence of Chlamydiales in great apes, we analyzed samples from critically endangered western lowland gorillas and endangered central chimpanzees from Gabon. (cdc.gov)
  • Although we recognize the close relationships among all five species, we use the term 'great apes' in reference to chimpanzees, bonobos, gorillas, and orangutans. (biomedcentral.com)
  • the y chromsome supposedly started 400 million years ago, and the yellow part is the oldest part found in insects 400 million years ago (supposedly), but how could it move to the center while it is always on the periphery in other animals and all of the apes (gorillas, chimps, macac, babon, bonono, orangotan. (abovetopsecret.com)
  • The "Great Ape Project" argues that because the differences between humans and other great apes (chimpanzees, bonobos, gorillas and orangutans) are so slight the Great Apes should share basic human rights. (project-syndicate.org)
  • The findings came as a big surprise to the researchers, since humans are known to be genetically close relatives of the great apes, chimpanzees and gorillas. (buffalo.edu)
  • In this study 1 , the authors investigate degenerative joint disease in the spine and major peripheral joints (shoulder, elbow, hip and knee) in chimpanzees, lowland gorillas and bonobos. (dynamicdiscdesigns.com)
  • Among the African apes, gorillas are slightly more involved in the spine than chimpanzees with almost no spinal degeneration. (dynamicdiscdesigns.com)
  • An estimated 77 per cent of chimpanzees that catch the virus die of it and, in certain areas, a staggering 95 per cent of gorillas (numbers in excess of 5,000) succumb to the disease. (geographical.co.uk)
  • Officials tested the troop of gorillas after two apes began coughing on Jan. 6. (wtop.com)
  • African apes (i.e., chimpanzees, bonobos, and to a lesser extent gorillas) show multi-male mating behavior that could offer opportunities for STD transmission, yet little is known about the prevalence and impact of STDs in this endangered primate group. (midasnetwork.us)
  • We used serology and PCR-based detection methods to screen biological samples from wild and orphaned eastern chimpanzees and gorillas (N = 172 individuals, including adults, and juveniles) for four classes of pathogens that either commonly cause human STDs or were previously detected in captive apes: trichomonads, Chlamydia spp. (midasnetwork.us)
  • in chimpanzees and gorillas has refuted these theories and instead revealed that both P. falciparum and P. vivax evolved from parasites infecting wild-living African apes. (upenn.edu)
  • He admits he was frankly unaware that gorillas have long been cast in Ishmael-like roles, that by his choice he now belonged to a literary tradition which included more than a remote philosophical connection between Kafka's ape and his Ishmael. (h-net.org)
  • GRASP is the unique alliance of 105 national governments, conservation organizations, research institutions, United Nations agencies and private companies, each committed to ensuring the long-term survival of great apes and their habitats in Africa and Asia. (4apes.com)
  • Infectious diseases are major threats to apes in Africa. (cdc.gov)
  • To estimate population exposure of apes and Old World monkeys in Africa to enteroviruses (EVs), we conducted a seroepidemiologic study of serotype-specific neutralizing antibodies against 3 EV types. (cdc.gov)
  • We estimated population exposure of apes in Africa and OWM species to EVs. (cdc.gov)
  • Because rapidly expanding human populations have devastated gorilla (Gorilla gorilla) and common chimpanzee (Pan troglodytes) habitats in East and West Africa, the relatively intact forests of western equatorial Africa have been viewed as the last stronghold of African apes. (nih.gov)
  • About 200 million people in Asia, Africa, South and Central America, and southern Europe live in areas where the disease is common. (wikipedia.org)
  • In particular, drastic declines in ape densities following repeated emergences of Ebola in Gabon and Congo have shown clearly that this virus poses a serious threat to the long-term survival of great apes in central Africa. (congo-apes.org)
  • But aside from the well-documented impact on humans, the virus also had a less well-known, yet no less devastating impact on our closest cousins: the great apes of Africa. (geographical.co.uk)
  • The discovery of P. vivax parasites (or P. vivax -like parasites) in the blood of African great apes leads to a question: could nonhuman primates in Africa be acting as Duffy-positive reservoirs of P. vivax in regions where the human population is almost entirely insusceptible? (blogspot.com)
  • catarrhine (narrow-nosed) monkeys and apes of Africa and Southeast Asia and platyrrhine ("flat-nosed") or New World monkeys of South and Middle America . (wikipedia.org)
  • Characterizing the evolutionary relationships of simian immunodeficiency viruses infecting different non-human primate species in sub-Saharan Africa, we found that Acquired Immunodeficiency Syndrome (AIDS) - one of the most devastating infectious diseases to have emerged in recent history - was the result of cross-species infections of humans by lentiviruses of primate origin. (upenn.edu)
  • Now a paper published in the medical journal The Lancet by an international team of researchers from Cameroon and the United States claims that people eating primate bushmeat in Africa have developed a form of a virus carried by apes and monkeys. (walesonline.co.uk)
  • including 56 countries distributed over Asia, Africa, Oceania and North, Central, and South America ( http://www.cabi.org/ ) and the number of countries affected by the disease is increasing. (frontiersin.org)
  • Numerous studies have tried to determine if great apes (for example, chimpanzees and bonobos) are able to understand declarative communication, but results have been mixed. (healthcanal.com)
  • The other two groups of apes consisted of chimpanzees and bonobos that had been raised in socio-linguistically rich environments, where they were routinely exposed to complex communicative interactions with humans. (healthcanal.com)
  • Chimpanzees are also helping scientists battle other health problems, including spongiform encephalitis ("mad-cow disease"), malaria, cystic fibrosis and emphysema. (project-syndicate.org)
  • More recent reports suggesting ape grammar are those of a bonobo named Kanzi, whose linguistic abilities are alleged to exceed those seen in earlier sign-language studies with chimpanzees. (project-syndicate.org)
  • In spite of their genetic similarity to humans, chimpanzees and great apes have maximum lifespans that rarely exceed 50 years. (innovations-report.com)
  • Correspondingly, chimpanzees in captivity have unusually low levels of heart disease and Alzheimer-like changes during aging. (innovations-report.com)
  • GRASP's 'Ebola & Great Apes' Examines Future Disease Threats. (4apes.com)
  • GRASP includes the monitoring of Ebola, anthrax, Marburg and other emerging infectious diseases among its priority work areas. (4apes.com)
  • As development pushes human populations deeper into primary forests, more outbreaks of Ebola and other similar zoonotic diseases are likely to occur. (4apes.com)
  • Ebola & Great Apes was derived from a literature review produced by Dr. Siv Anina Leendertz of the Robert Koch Institute, in collaboration with GRASP. (4apes.com)
  • It delivers important insight into the pressure Ebola exerts on populations of great apes, in addition to exploring future approaches to reduce spread of the disease between great apes and humans. (4apes.com)
  • Ebola & Great Apes is available in English and Chinese, with a French-language version to be released in 2017. (4apes.com)
  • In addition to Ebola virus disease, a leading cause of death, the health of great apes is compromised by infections with Bacillus anthracis , Staphylococcus aureus , and Plasmodium falciparum ( 1 - 4 ). (cdc.gov)
  • Furthermore, Ebola haemorrhagic fever is currently spreading through ape populations in Gabon and Congo and now rivals hunting as a threat to apes. (nih.gov)
  • Ebola outbreaks in humans have been associated with declines in local ape populations, and ape remains recovered near outbreak sites have tested positive for the Ebola virus. (congo-apes.org)
  • The Goualougo Triangle Ape Project has developed a strong relationship with the Wildlife Conservation Society's Global Health Program and is actively involved in implementing the Regional Ebola Action Plan to address the threat of Ebola in the Sangha Trinational Region. (congo-apes.org)
  • The Goualougo Triangle Ape Project has developed a strong relationship with the Wildlife Conservation Society-Global Health Program (WCS-GHP) to maximize existing expertise, field staff and infrastructure to ensure cost-effectiveness of initiatives to implement a Regional Ebola Action Plan. (congo-apes.org)
  • However, some scientists and conservationists suspect that right now the single biggest threat to the continued survival of Africa's apes is actually Ebola. (geographical.co.uk)
  • We know very little about how Ebola actually works in the wild because when it hits a population of apes normally all we find is just the carcass of a chimp or gorilla,' she explains. (geographical.co.uk)
  • On March 10-11 an international group of experts met in Washington to assess the magnitude of threat posed by Ebola and evaluate options for protecting apes from it. (mpg.de)
  • Two new co-editors and a globally diverse group of expert contributors each lend their expertise on a wide range of new topics - including a new section on emerging wildlife diseases covering topics like MERS, Equine Herpesvirus, and Ebola in great apes. (elsevier.com)
  • Section on emerging wildlife diseases includes chapters on MERS, SARS, Ebola in great apes, and a variety of other emerging wildlife diseases. (elsevier.com)
  • Here we present survey results conservatively indicating that ape populations in Gabon declined by more than half between 1983 and 2000. (nih.gov)
  • Degenerative joint disease is one of the most common pathological musculoskeletal conditions in human populations. (dynamicdiscdesigns.com)
  • Emerging infectious diseases are of great concern to both humans and wild ape populations in the Congo Basin. (congo-apes.org)
  • Selective logging results in a suite of alterations in host ecology and forest structure that may alter pathogen dynamics in resident ape populations. (congo-apes.org)
  • Observational health monitoring is an important aspect of great ape conservation, particularly in the Congo Basin where disease outbreaks have significantly reduced chimpanzee and gorilla populations in recent years. (congo-apes.org)
  • With the technical support of the Lincoln Park Zoo the Goualougo Triangle Ape Project ape health data are incorporated into the online IMPACT system for observational monitoring of wild apes which was designed by the Mountain Gorilla Veterinary Program and recently modified to include observational data from wild chimpanzee populations in Gombe National Park. (congo-apes.org)
  • This monitoring program has been successfully used to monitor ape health in the mountain gorilla populations and gather solid evidence on which to base intervention strategies for reducing disease transmission in these wild apes. (congo-apes.org)
  • At present, the only way to control the disease has been through culling farmed herds and thinning wild populations through hunting. (phys.org)
  • Sexually transmitted diseases (STDs) can persist endemically, are known to cause sterility and infant mortality in humans, and could have similar impacts in wildlife populations. (midasnetwork.us)
  • Some diseases can eat through these wild populations and leave mass destruction in their wake. (listverse.com)
  • Diseases from these jump over to the human populations in SE Asia, and then to the rest of the world, all the time. (slashdot.org)
  • Several articles, recent to early 2014, warn that human activities are spreading vector-borne zoonotic diseases. (wikipedia.org)
  • Examples of vector-borne zoonotic diseases include: Lyme disease Plague West Nile virus Many factors affect the incidence of vector-borne diseases. (wikipedia.org)
  • Vector-borne zoonotic diseases are those that naturally infect wildlife and are then transmitted to humans through carriers, or vectors, such as mosquitoes or ticks. (wikipedia.org)
  • Described by malaria researchers as a 'reservoir for human disease,' monkeys and apes are widely known for harboring emerging zoonotic diseases. (foreignpolicy.com)
  • Zoonotic diseases (i.e., zoonoses) are diseases transmitted between animals and humans. (cdc.gov)
  • In an accompanying article in The Lancet, Dr Martine Peeters from the Institut de Recherche pour le Developement in Montpellier, France, says zoonotic diseases - those that can pass from animals to humans - are among the most important public health threats facing humanity. (walesonline.co.uk)
  • Great apes and humans are so genetically similar that diseases that can impact one species can easily impact the other. (4apes.com)
  • All great apes in the wild are regularly or occasionally seen in the water, but possibly the Pleistocene coolings (Ice Ages 2.6-0.01 Ma) caused the ape ancestors to spend less time in the water, the different ape species to different degrees. (scienceblogs.com)
  • citation needed] There are several species of Thrips that act as vectors for over 20 viruses, especially Tospoviruses, and cause all sorts of plant diseases. (wikipedia.org)
  • The treatment needed is determined by where the disease is acquired, the species of Leishmania, and the type of infection. (wikipedia.org)
  • The Tapanuli orangutan has been identified as the newest species of great ape, but also likely the most endangered. (the-scientist.com)
  • We are an aquatic primate species, please eat like one if you truly want to be healthy and disease free. (abovetopsecret.com)
  • Some primates (including some great apes and baboons) are primarily terrestrial rather than arboreal, but all species possess adaptations for climbing trees. (wikipedia.org)
  • Given the size of the ape Plasmodium reservoir, we will examine the parasite, host and ecological factors that control cross-species transmission.The lack of in vitro culture systems poses a significant challenge to the functional studies of ape Plasmodium parasites, but whole genome sequencing, even from suboptimal specimens such as subpatently infected unprocessed blood, represents a critical first step towards understanding their biology. (upenn.edu)
  • Various species of apes (Greek pithekos , Latin simia ) were known in the ancient world and were occasionally trained and exhibited in theatrical performances. (h-net.org)
  • And we think that these species are very, very likely to transfer diseases across to us," she said. (voanews.com)
  • As they do, Cooper said, they're encountering new species of animals and possibly new diseases as well. (voanews.com)
  • Search for further pathogens that may threaten great apes from reservoir host species, including bats or rodents. (mpg.de)
  • Gonorrhea is one of very few diseases exclusive to our species, and is one of the oldest recorded diseases in human history. (discovermagazine.com)
  • Read our blog post on HFMD here: https://alissandjoel.com/2018/01/25/hand-foot-and-mouth-disease-treatment-tips/ PART 2 of our HFMD series. (1src.com)
  • As a result of poaching, diseases, and habitat loss, the western lowland gorilla ( Gorilla gorilla gorilla ) and the central chimpanzee ( Pan troglodytes troglodytes ), both referred to as great apes, have been decreasing in numbers since 1970 and are now red-listed by the International Union for Conservation of Nature ( 1 ). (cdc.gov)
  • For captive great apes, BLAST analysis of 1 rectal (gorilla) and 1 penile (chimpanzee) sample showed 100% and 98% sequence identity, respectively, with Waddlia chondrophila . (cdc.gov)
  • The other chimpanzee samples are different from those in the ape clade: two are Plasmodium ovale , and one is Plasmodium malariae . (pnas.org)
  • It was shown in 1994/1995 that the closest relative of Plasmodium falciparum , the agent of malignant malaria was Plasmodium reichenowi , a chimpanzee parasite, the only ape malaria parasite that had been molecularly characterized ( 1 - 4 ). (pnas.org)
  • The chimpanzee apoE functions more like the "good" apoE3, which contributes to low levels of heart disease and Alzheimer's," Finch said. (innovations-report.com)
  • Researchers are to look into why great apes are susceptible to heart disease while in the care of humans. (twycrosszoo.org)
  • Great apes go through midlife crises just like humans, teen suffers from a disorder called 'sleeping beauty syndrome,' researchers study mediums' brain activity during trance states, and lunar madness may be a myth. (everydayhealth.com)
  • An international team of researchers studied 508 great apes in zoos and sanctuaries across the globe, in the United States, Japan, Canada, Australia, and Singapore. (everydayhealth.com)
  • As part of the study, the researchers analyzed the fossil ape to see whether it possessed lower spine anatomy consistent with bipedal walking. (healthcanal.com)
  • The authors conclude, "Because the ability to acquire declarative comprehension is common to both apes and humans, researchers must look elsewhere for a candidate biological change that allowed for the evolution of human language and cognition. (healthcanal.com)
  • Describing it as 'a combination we haven't seen in disease before,' researchers warned that the new strain of influenza A could have severe repercussions for human health. (foreignpolicy.com)
  • But researchers at the Children's Hospital of Philadelphia have revealed positive results of a human drug tested on mice that may have the potential of curing adults and children suffering from mitochondrial diseases. (growingyourbaby.com)
  • The researchers fed the mutant mice probucol, an oral drug formerly used to treat people with high cholesterol which not only prevented the mice from kidney diseases but also reversed the condition in mice that had already developed it. (growingyourbaby.com)
  • Understandably, researchers are scrambling to shed light on the devastating impact that the disease has on humans, leaving the great apes hidden in the dark. (listverse.com)
  • Dedicated researchers brought apes like Koko into their homes or turned their labs into home-like environments where people and apes could play together and try, often awkwardly, to understand each other. (slate.com)
  • The researchers made these apes the center of their lives. (slate.com)
  • Researchers theorized that culture could have something to do with it-perhaps if apes were raised like humans, they would pick up our language. (slate.com)
  • The Biobank aims to develop a national veterinary health resource for vets and researchers, aimed at improving the understanding and treatment of a wide range of animals diseases. (nottingham.ac.uk)
  • The School of Veterinary Medicine and Science is establishing a biobank to collect and store biological samples for researchers to study human and animal diseases. (nottingham.ac.uk)
  • Researchers are not waiting for the next new disease to emerge. (voanews.com)
  • Researchers expected to find that humans would share diseases with primates with whom they're mostly closely related. (voanews.com)
  • Researchers did in fact confirm that we do share many diseases with the great apes. (voanews.com)
  • Several decades after an early report that humans and Japanese macaques ( Macaca fuscata ) have different susceptibilities to atheromatosis [ 1 ], it was established that lipid metabolism and cardiovascular disease risks vary among human and nonhuman primates [ 2 - 5 ]. (biomedcentral.com)
  • The lemur sample, provisionally named Plasmodium malagasi , is a sister lineage to the large cluster of primate parasites that does not include P. falciparum or ape parasites, suggesting that the falciparum + ape parasite cluster ( Laverania clade) may have evolved from a parasite present in hosts not ancestral to the primates. (pnas.org)
  • In the December issue of PNAS Early Edition, Finch reveals that these evolutionary genetic advantages, caused by slight differences in DNA sequencing and improvements in diet, make humans uniquely susceptible to diseases of aging such as cancer, heart disease and dementia when compared to other primates. (innovations-report.com)
  • [13] Commonly used names for groups of primates such as " prosimians ", " monkeys ", " lesser apes ", and " great apes " reflect this methodology. (wikipedia.org)
  • Contact with non-human primates, such as happens during hunting and butchering, can play a part in the emergence of human retroviruses - and the reduction of primate bushmeat hunting has the potential to decrease the frequency of disease emergence,' said Dr Wolfe. (walesonline.co.uk)
  • The disease - linked to African primates - has killed tens of millions and more than 30 million people are now living with the disease. (voanews.com)
  • Investigating diseases in primates gives us a really good model of the kinds of diseases which we might expect to see in humans. (voanews.com)
  • Alzheimer's and other forms of dementia are now the leading cause of death among women, amounting for 15.8 per cent of deaths, and experts believe the impact of the disease in damaging life expectancy has doubled in the last seven years. (telegraph.co.uk)
  • The paucity of effective treatments for cognitive aging disorders, and most importantly in Alzheimer's disease instigates a need for further research into novel therapeutic possibilities. (clinicaltrials.gov)
  • Alzheimer's disease is the most common neurodegenerative disorder and its prevalence steeply increases. (clinicaltrials.gov)
  • Glutamate-mediated excitotoxicity in neuropsychiatric disorders and in particular in Alzheimer's disease has been shown to cause significant cerebral damage. (clinicaltrials.gov)
  • Early effective therapeutic intervention in Alzheimer's disease is critical in order to prevent or at least retard neuropathological progression that will lead to widespread irreversible neuronal loss and significant cognitive dysfunction. (clinicaltrials.gov)
  • Riluzole, a glutamate modulator agent that is a proven safe medication and has not yet been used in cognitive aging disorders, will be tested in mild Alzheimer's disease patients. (clinicaltrials.gov)
  • Forty-eight individuals with a diagnosis of mild Alzheimer's disease between 60-85 years old will complete the study. (clinicaltrials.gov)
  • All forty-eight individuals will have been on donepezil, which is FDA approved for the treatment of Alzheimer's disease, at a dose of 5mg or 10mg per day for at least 3 months prior to consenting and will remain on the drug throughout this study. (clinicaltrials.gov)
  • Twenty-four mild Alzheimer's disease patients will receive riluzole and another 24 will receive a placebo (the placebo tablets will be generated at the Rockefeller University's pharmacy by the research pharmacist). (clinicaltrials.gov)
  • All patients will have a neurological evaluation and neuropsychological tests performed to confirm that they meet criteria for probable Alzheimer's disease set out by the National Institute on Aging - Alzheimer's disease Association that recently revisited the NINCDS-ADRDA criteria and to have mild Alzheimer's disease. (clinicaltrials.gov)
  • It follows Will, a doctor who seeks a cure for Alzheimer's disease that affects his father. (timeout.com)
  • ApoE4 carriers have higher totals of blood cholesterol, more oxidized blood lipids and early onset of coronary heart disease and Alzheimer's disease. (innovations-report.com)
  • Conditions like diabetes, epilepsy, Alzheimer's disease and Parkinson's disease are also the result of malfunctioning mitochondria. (growingyourbaby.com)
  • The first major discovery of a disease vector came from Ronald Ross in 1897, who discovered the malaria pathogen when he dissected a mosquito. (wikipedia.org)
  • Malaria is declining slowly, but skeeters carry other diseases, including dengue and West Nile. (whyfiles.org)
  • Mosquitos are a vector for several diseases, most notably malaria . (wikipedia.org)
  • This study can help understand basic processes in degenerative joint disease among humans and our closest relatives in a broader evolutionary context. (dynamicdiscdesigns.com)
  • So we were expecting - and all the previous research has suggested - that we'd share more with our very close relatives, the great apes. (voanews.com)
  • A behind-the-scenes look at what remains of this research today reveals a surprisingly dramatic world of lawsuits, mass resignations, and dysfunctional relationships between humans and apes. (slate.com)
  • While mosquitoes and ticks, those pesky harbingers of West Nile, dengue fever, cholera, Lyme disease , and Kyasanur fever (among other assorted viral, fungal, and bacterial pathogens) are universally hated, it's hard to believe the Earth's more cuddly creatures could breed evil. (foreignpolicy.com)
  • The deer tick , a vector for Lyme disease pathogens. (wikipedia.org)
  • The first is to identify pathogens causing death in wild great apes, and the second is to create baseline data on the 'physiological' or chronic pathogen presence in great apes. (mpg.de)
  • Peacocks are dying in droves in Pakistan's Thar Desert region in an outbreak scientists believe is linked to Newcastle disease. (foreignpolicy.com)
  • San Diego Zoo Global, which oversees the zoo and the safari park, plans to share what it has learned with other scientists with the hope that it will contribute to the understanding of how the virus can affect apes. (wtop.com)
  • He said that scientists have many questions about how this new population - called inflammatory macrophages - affects obesity as well as immune responses to other diseases. (k-state.edu)
  • In dozens of studies, scientists raised apes with humans and attempted to teach them language. (slate.com)
  • She said once those gaps are filled, scientists can determine how much of a risk monkey diseases pose to humans. (voanews.com)
  • Simians include monkeys and apes. (wikipedia.org)
  • These features are more developed in monkeys and apes and noticeably less so in lorises and lemurs. (wikipedia.org)
  • By the way, we also share diseases with macaques and baboons. (voanews.com)
  • Centers for Disease Control and Prevention. (cdc.gov)
  • Saving Lives, Protecting People Centers for Disease Control and Prevention. (cdc.gov)
  • The U.S. Centers for Disease Control estimates that more than one-third of adult Americans, or 78.6 million people, are obese. (k-state.edu)
  • This is the greatest nightmare of the Centers for Disease Control. (slashdot.org)
  • Their work comes after a mortality review of European zoos, between 2003-14, uncovered how the apes had suffered from the condition. (twycrosszoo.org)
  • The project has also produced some initial guidelines aimed at improving the health of apes at European zoos. (twycrosszoo.org)
  • It is hoped it will enable zoos to identify animals with heart disease problems before it is too late for treatment. (twycrosszoo.org)
  • But poachers are also cashing in on the trafficking trade as demand soars for great apes in Far East theme parks and unlicensed zoos , and as exotic pets. (mirror.co.uk)
  • Gibbon ape leukemia virus (GALV) has been tested for years as a viral vector, a carrier of therapeutic genetic information, in the treatment of various human illnesses, including cancer. (survivingmesothelioma.com)
  • W omen are believed to be disproportionately affected by dementia partly due to genetic reasons, but also because fewer die from heart-related diseases in their 50s and 60. (telegraph.co.uk)
  • Advances in genetics raise the stakes in genetic counseling, but the genetic role in disease can be complicated, elusive. (whyfiles.org)
  • Knowledge of the gene genealogy for a set of haplotypes is useful for estimation of population genetic parameters and it also has potential application in finding disease-predisposing genetic variants. (frontiersin.org)
  • In this work, we describe how our sampler can be used to find disease-predisposing genetic variants in samples of cases and controls. (frontiersin.org)
  • It is worth noting, however, that the concept also has potential application in finding disease-predisposing genetic variants. (frontiersin.org)
  • Given the increasing rarity of the great apes, however, their capacity to act as zoonotic reservoirs could be limited. (blogspot.com)
  • The company's product portfolio is comprised of humanized antibodies, targeting diseases such as cancer, inflammatory diseases and ophthalmic disease. (bio-medicine.org)
  • A growing nation of genetically evolved apes led by Caesar is threatened by a band of human survivors of the devastating virus unleashed a decade earlier. (joblo.com)
  • The tree-based association approach finds multiple sub-regions where the case haplotypes are more genetically related than the control haplotypes, and that there may be one or multiple disease-predisposing loci. (frontiersin.org)
  • Since haplotypes from case individuals are genetically more closely related to each other at the site of a disease-predisposing mutation, their haplotypes would appear to cluster together in the marginal ancestral tree at the site of the mutation. (frontiersin.org)
  • Except 1 report of bacteria of the order Chlamydiales in a fecal sample from a wild-living Congolese P. troglodytes troglodytes ( 5 ), nothing is known about the prevalence of Chlamydiales in great apes. (cdc.gov)
  • The global trade in wildlife has historically contributed to the emergence and spread of infectious diseases. (4apes.com)
  • These results are the first demonstration that illegal bushmeat importation into the United States could act as a conduit for pathogen spread, and suggest that implementation of disease surveillance of the wildlife trade will help facilitate prevention of disease emergence. (4apes.com)
  • NASPHV recommends that local and state public health, agricultural, environmental, and wildlife agencies use these recommendations to establish their own guidelines or regulations for reducing the risk for disease from human-animal contact in public settings. (cdc.gov)
  • Soon, these great apes may only exist in captivity," says Haley Murphy, director of veterinary services at Zoo New England, which runs Boston's Franklin Park Zoo and the Stone Zoo in Stoneham, Mass. (dailybulletin.com)
  • We screened 25 samples (8 ocular, 4 vaginal, 7 penile, and 6 rectal swab specimens) obtained noninvasively during routine health checks from 12 apes in captivity. (cdc.gov)
  • All apes were born and reared in captivity at the Primatology Unit of the International Centre for Medical Research of Franceville (Franceville, Gabon) and lived in social groups of ≈10 animals. (cdc.gov)
  • As a consequence of self-awareness great apes must suffer in captivity in ways similar to what we would experience. (project-syndicate.org)
  • Leishmaniasis is a disease caused by parasites of the Leishmania type. (wikipedia.org)
  • Over time, ingestion of red meat, particularly raw meat infected with parasites in the era before cooking, stimulates chronic inflammation that leads to some of the common diseases of aging," Finch said. (innovations-report.com)
  • The authors argue that the variation between humans and African apes in VOP and OA prevalence may be explained by human longevity. (dynamicdiscdesigns.com)
  • These studies provide a baseline for prevalence of these protozoa in forest-dwelling African apes and have allowed us to better understand the impact of logging on ape health in forests neighboring the Goualougo Triangle but outside the park border (Gillespie et al. (congo-apes.org)
  • This vaccine will be an important tool for the control of CWD, says Scott Napper, a research scientist at the U of S Vaccine and Infectious Disease Organization. (phys.org)
  • Obtain a consultation with an infectious disease specialist. (medscape.com)
  • During 1996--2010, approximately 150 human infectious disease outbreaks involving animals in public settings have been reported to CDC (CDC, unpublished data, 2010). (cdc.gov)
  • The infectious disease lab is located at the Robert Koch Institute (RKI) in Berlin. (mpg.de)
  • Christopher Eppig is back, this time in Scientific American , with his study showing a high correlation between average national IQs around the world and infectious disease burden. (blogspot.com)
  • But I can't say I've found Eppig's evidence highly persuasive yet that the arrow of causality doesn't mostly run in the opposite direction: e.g., that high average IQ Singapore has used its smarts to cut infectious disease more than low average IQ Lagos has managed to do so, despite both being at similar latitudes and altitudes. (blogspot.com)
  • Again, infectious disease was an excellent predictor of average state IQ. (blogspot.com)
  • I don't really get this idea that Californians have their high infectious disease burdens to blame for their stupidity. (blogspot.com)
  • It is hard for me to believe that infectious disease is by far the most important cause of IQ variation. (blogspot.com)
  • If this were so, I would expect to see significant numbers of very high IQs even in low-average-IQ regions (asymmetrically long high-end tails of IQ bell curves for these regions), because even in high-infectious-disease areas (I assume) the number of uninfected people is significant. (blogspot.com)
  • Only if everyone in low-average-IQ regions had been infected with IQ-lowering disease does the infectious disease hypothesis predict that normal distribution curves will be shifted to the left without the shape being affected. (blogspot.com)
  • The big problem with Eppig's study demonstrating that state IQs (actually, NAEP scores) correlate with infectious disease risk in the United States is that the study doesn't control for race. (blogspot.com)
  • Anyway, northern Europe until modern times was rife with infectious disease - think of how many tuberculosis alone killed, not to mention smallpox and a whole host of other nasties, and then you have that great destroyer itself typhus, that thrived in cold countries. (blogspot.com)
  • Infectious disease has joined poaching and habitat loss as a major threat to the survival of African apes. (theconversation.com)
  • Although vaccinations to prevent the spread of infectious disease are available there are are two key objections. (theconversation.com)
  • Dr Victoria Strong, from the university's School of Veterinary Medicine and Sciences, said: "At the moment we're unsure why great apes in human care develop heart disease. (twycrosszoo.org)
  • In a human and great ape cohort, we measured the red blood cell (RBC) levels of the most abundant types of plasmalogens. (biomedcentral.com)
  • Furthermore, human and great ape skin fibroblasts showed only modest differences in peroxisomal plasmalogen biosynthetic activity. (biomedcentral.com)
  • We propose that the observed differences in human and great ape RBC plasmalogens are primarily caused by their rates of biosynthesis and/or turnover. (biomedcentral.com)
  • Gene expression data raise the possibility that other human and great ape cells and tissues differ in plasmalogen levels. (biomedcentral.com)
  • It is often assumed that Alister Hardy's and Elaine Morgan's aquatic ape theory (AAT) suggests that more than 5 Ma (million years ago) there was a semi-aquatic phase in our past (explaining e.g. human fur loss, fatness and upright bipedalism), which was followed by a savanna phase on the African plains. (scienceblogs.com)
  • Here I very briefly describe my view of ape and human evolution (for details and references, see my publications at the end of this article). (scienceblogs.com)
  • Such lifestyles - climbing and hanging vertically, grasping branches above the water, wading on two legs, floating vertically collecting floating vegetation etc. - help explain hominoid (ape and human) body enlargement, tail loss, vertical spine, dorsal shoulder blades, and wide thorax and pelvis. (scienceblogs.com)
  • They compared measurements of its lumbar vertebrae (lower back) and sacrum (a triangular bone at the base of the spine) to those of modern humans, fossil hominins (extinct bipedal human ancestors), and a sample of mammals that commonly move around in trees, including apes, sloths and an extinct lemur. (healthcanal.com)
  • According to the findings, the anatomy of Oreopithecus lumbar vertebrae and sacrum is unlike that of humans, and more similar to apes, indicating that it is incompatible with the functional demands of walking upright as a human does. (healthcanal.com)
  • Kubo, S, et al, "Highly efficient tumor transduction and antitumor efficacy in experimental human malignant mesothelioma using replicating gibbon ape leukemia virus", November 8, 2013, Cancer Gene Therapy, Epub ahead of print. (survivingmesothelioma.com)
  • Because they are close to us, nonhuman great apes are suitable for research on several diseases that cause human suffering. (project-syndicate.org)
  • Did human salivary glands evolve to produce a more watery saliva to accommodate a diet which drastically differs from that of great apes? (buffalo.edu)
  • The burial of Julia Pastrana in her home town of Sinaloa de Leyva closed an undignified saga in which she was derided as a human-ape hybrid both in life and death and her mummified corpse was stolen, mutilated, salvaged from a dustbin and then banished for 16 years to a storage room at a Norwegian university. (thetimes.co.uk)
  • However, the minor allele, apoE4, when expressed in humans, can impair neuronal development, as well as shorten human lifespan by about four years and increase the risk of heart disease and Alzheimer disease by several-fold. (innovations-report.com)
  • Our work emphasizes that only a fraction of infectious agents affecting wild apes are presently known to science, and that further work on great ape STDs could offer insights for the management of endangered great apes and for understanding human STD origins. (midasnetwork.us)
  • For example, "ape" has been used either as an alternative for "monkey" or for any tailless, relatively human-like primate. (wikipedia.org)
  • My laboratory has had a long-standing interest in elucidating the origins and evolution of human and simian immunodeficiency viruses, and in studying HIV/SIV gene function and disease mechanisms from an evolutionary perspective. (upenn.edu)
  • Although human-animal contact has many benefits, human health problems are associated with these settings, including infectious diseases, exposure to rabies, and injuries. (cdc.gov)
  • Quinn's unconscious choice may have been partially the result of zeitgeist--emerging theories about the relatedness of the great apes to that other ape, the human. (h-net.org)
  • In The Monkey as Mirror: Symbolic Transformations in Japanese History and Ritual , Ohnuki-Tierney explains that throughout Japanese history, the monkey/ape has been seen as both mediator between and threat to the human-animal boundary (6). (h-net.org)
  • Work after work reveals as well how the ape has been valued or devalued in human cultures and how those human ideas about apes have changed the history of all the great apes. (h-net.org)
  • And so it's much easier for these diseases, if they're kind of adapted to this primate model system, to come into another primate, a human," she said. (voanews.com)
  • Too human is perhaps the point when, if, we get to making an animal that can perform as the midspecies link between two diseases? (slashdot.org)
  • A disease that affects sheep maybe can gestate over years in a flock of sheep and then suddenly because they have many human organs its affecting humans too. (slashdot.org)
  • anyway - just a thought….if this has human DNA, this might explain why, after 200,000 years, humans have NOT developed an immunity to the disease. (discovermagazine.com)
  • During 1991--2005, the number of enteric disease outbreaks associated with animals in public settings increased ( 1 ). (cdc.gov)
  • These population decreases were driven by poaching and disease ( Ebolavirus ) outbreaks. (iucnredlist.org)
  • Diseases - the third major threat for wild Great Apes? (mpg.de)
  • This listing is based on ongoing population losses due to illegal hunting, disease and habitat loss: poaching is intensifying with the expansion of access routes into forests and Zaire Ebolavirus remains a highly significant threat. (iucnredlist.org)
  • With poaching and habitat loss looming right over their heads, it's easy to dismiss a much quieter threat on the horizon: disease. (listverse.com)
  • Worse, equine encephalitis virus , a pathogen listed as a global priority by the Global Early Warning System for Major Animal Diseases, Including Zoonoses, has spread globally. (foreignpolicy.com)
  • Pathogen analysis in wild great apes is both time- and resource-consuming. (springer.com)
  • Therefore, we examined the potential use of urinary neopterin, a sensitive marker of cell-mediated immune system activation, as a disease marker and unspecific screening tool to facilitate informed pathogen analysis in great ape health monitoring. (springer.com)
  • We suggest the use of urinary neopterin as an unspecific screening tool in great ape health monitoring to identify relevant samples, individuals, and time periods for selective pathogen analysis and zoonotic risk assessment. (springer.com)
  • It is also hoped the Twycross Zoo project will uncover the specific type of heart disease affecting the animals. (twycrosszoo.org)
  • At the time of sampling, the animals were anesthetized and showed no evident signs of disease. (cdc.gov)
  • These factors include animals hosting the disease, vectors, and people. (wikipedia.org)
  • One reason to think so is the idea that the minds of nonhuman great apes are similar to ours because some of animals have been taught sign language. (project-syndicate.org)
  • The disease may occur in a number of other animals, including dogs and rodents. (wikipedia.org)
  • The vaccine will be given in a food packet that will be consumed by animals, and consequently immunize them against the disease. (phys.org)
  • The recommendation to wash hands is the most important for reducing the risk for disease transmission associated with animals in public settings. (cdc.gov)
  • Other important recommendations are that venues prohibit food in animal areas and include transition areas between animal areas and nonanimal areas, visitors receive information about disease risk and prevention procedures, and animals be properly cared for and managed. (cdc.gov)
  • These updated 2011 guidelines provide new information on the risks associated with amphibians and with animals in day camp settings, as well as the protective role of zoonotic disease education. (cdc.gov)
  • Guidelines to reduce risk for disease from animals in health-care and veterinary facilities and from service animals (e.g., guide dogs) have been developed ( 2--6 ). (cdc.gov)
  • Study leader Marni J. Falk, M.D., who cares for children in the Mitochondrial-Genetics Disease Clinic at The Children's Hospital said, "There are no effective cures for mitochondrial diseases, even in animals so these striking results in mice may suggest a novel therapy of direct relevance for humans. (growingyourbaby.com)
  • Bats and other animals may be responsible for carrying this deadly disease, which is easily spread from person to person through bodily fluids. (listverse.com)
  • The samples are residual material left over from the investigation and treatment of clinical diseases in animals, such as heart disease, cancer and arthritis. (nottingham.ac.uk)
  • HIV/AIDS is a well-known zoonotic disease, an illness transmitted from animals to humans. (voanews.com)
  • Dr. Natalie Cooper said there may be many more diseases ready to jump from animals to humans. (voanews.com)
  • 2. Studies of ape Plasmodium infections. (upenn.edu)
  • Macaques - who share a common, more distant ancestor with humans and great apes - were examined as well. (buffalo.edu)
  • As with previous research, the authors found that colony reared Old World monkeys, such as macaques, have higher OA levels than other free-ranging apes. (dynamicdiscdesigns.com)
  • BUFFALO, N.Y. - Two million years of eating meat and cooked food may have helped humans shift further from other great apes on the evolutionary tree. (buffalo.edu)
  • Home 1 / The Movement 2 / Osteoarthritis 3 / Degenerative joint disease in African great apes: an evolutionary pers. (dynamicdiscdesigns.com)
  • The authors want better to understand the evolutionary basis of degenerative joint disease. (dynamicdiscdesigns.com)
  • While completing my doctoral work in ecology and evolutionary biology at the University of Washington (1975-80), I became drawn to medical questions when I realized that most of the generalizations about the evolution of disease organisms in the medical literature had misapplied the principles of natural selection. (mcgill.ca)
  • She stressed that the minimum this study did was to increase the understanding of mitochondrial diseases. (growingyourbaby.com)
  • A 1994 study of 74 captive gorilla deaths, published by veterinarians Tom Meehan of the Brookfield Zoo in Chicago and Linda Lowenstine of the University of California at Davis, found that 41 percent - and 70 percent of males older than 30 - were from heart disease, mainly fibrosing cardiomyopathy. (foxnews.com)
  • Changes in oral microbes may lead to gum disease, heart problems, and cancer, study says. (everydayhealth.com)
  • According to a new study, led by University of Texas at Austin anthropologists Gabrielle A. Russo and Liza Shapiro , the 9- to 7-million-year-old ape from Italy did not, in fact, walk habitually on two legs. (healthcanal.com)
  • Three groups of apes were tested in this study. (healthcanal.com)
  • A UN study estimates 3,000 great apes are stolen per year to be sold on. (mirror.co.uk)
  • We illustrate the approach on a publicly-available dataset from a study of Crohn's disease that consists of genotypes at multiple SNP markers in a small genomic region. (frontiersin.org)
  • Relationships between disease markers were examined using a linear mixed model and a case study approach. (springer.com)
  • While the linear mixed model found no obvious relationship between urinary neopterin levels and other disease markers, the case study approach revealed a pattern resembling those found in humans. (springer.com)
  • A study of canine synovial fluid in osteoarthritis and cruciate disease. (nottingham.ac.uk)
  • New controls and frameworks are recommended to detect dengue and other infectious diseases and help prevent their spread duri. (labmanager.com)
  • There are a number of things that need to happen before an animal disease spreads among humans. (voanews.com)
  • Wild apes are considered to be the most serious reservoir and source of zoonoses. (nih.gov)
  • To investigate the effectiveness of case finding of patients at risk of developing chronic obstructive pulmonary disease, whether the method is suitable for use in general practice, how patients should be selected, and the time required. (bmj.com)
  • Trained practice assistants could check all patients who smoke for chronic obstructive pulmonary disease at little cost to the practice. (bmj.com)
  • Chronic obstructive pulmonary disease is a major health problem, and the number of patients with the disease is increasing. (bmj.com)
  • Ryan Taschuk is working on a vaccine against chronic wasting disease that could be delivered via feed packets to deer and elk in the wild. (phys.org)
  • Screening wild and semi-free ranging great apes for putative sexually transmitted diseases: Evidence of Trichomonadidae infections. (midasnetwork.us)
  • The challenges of understanding and controlling for wild ape health. (springer.com)
  • Goualougo Triangle Ape Project Research Assistants have been trained in great ape health monitoring protocols, including standardized observational data collection of physical condition. (congo-apes.org)
  • Though associated more with the bible than modern medicine, the disease remains active throughout the world - with armadillos responsible for more than a third of infections in the United States. (foreignpolicy.com)
  • Cassava production is constantly threatened by several diseases, including cassava bacterial blight (CBB) caused by Xanthomonas axonopodis pv. (frontiersin.org)
  • A virus that causes leukemia in gibbon apes may have the power to help fight malignant mesothelioma in people. (survivingmesothelioma.com)
  • Forty years after he discovered Java "man," Eugene Dubois conceded that it was not a man, but was similar to a large gibbon (an ape). (creationscience.com)
  • More directly, when they twine from one plant to another, parasitic plants such as Cuscuta and Cassytha have been shown to convey phytoplasmal and viral diseases between plants. (wikipedia.org)
  • The primary cause of the decline in ape numbers during this period was commercial hunting, facilitated by the rapid expansion of mechanized logging. (nih.gov)
  • Chronic wasting disease (CWD) has been responsible for the severe decline of Saskatchewan s game farm industry. (phys.org)
  • Now showing clinical progress against liver diseases, the gene-silencing technique begins to fulfill some of its promises. (the-scientist.com)
  • Bronchiolitis obliterans organizing pneumonia (BOOP) is a rare inflammatory lung disorder which was first described in the 1980's as a unique disease entity composed of clinical symptoms such as flu-like illness in many individuals as well as cough and shortness of breath with exertional activities. (rarediseases.org)
  • Observations on great apes showing clinical signs of disease. (mpg.de)
  • Plasmalogen deficiency is also found in the brain tissue of individuals with Alzheimer disease. (biomedcentral.com)
  • Mosquitoes spread a lot of disease, but they are not just "flying hypodermic needles. (whyfiles.org)