A suborder of FUNGI in the phylum MICROSPORIDIA, commonly lacking a pansporoblastic membrane. The sporoblast is usually dinucleate.
A country spanning from central Asia to the Pacific Ocean.
Infections or infestations with parasitic organisms. They are often contracted through contact with an intermediate vector, but may occur as the result of direct exposure.
Critical analyses of books or other monographic works.
A phylum of fungi comprising minute intracellular PARASITES with FUNGAL SPORES of unicellular origin. It has two classes: Rudimicrosporea and MICROSPOREA.
Infections with FUNGI of the phylum MICROSPORIDIA.
A genus of FUNGI originally considered a member of the class SPOROZOEA but now recognized as part of the class MICROSPOREA.
A species of parasitic FUNGI. This intracellular parasite is found in the BRAIN; HEART; and KIDNEYS of several MAMMALS. Transmission is probably by ingestion of the spores (SPORES, FUNGAL).
An order of parasitic FUNGI found mostly in ARTHROPODS; FISHES; and in some VERTEBRATES including humans. It comprises two suborders: Pansporoblastina and APANSPOROBLASTINA.
Infection with FUNGI of the genus ENCEPHALITOZOON. Lesions commonly occur in the BRAIN and KIDNEY tubules. Other sites of infection in MAMMALS are the LIVER; ADRENAL GLANDS; OPTIC NERVES; RETINA; and MYOCARDIUM.
Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.
A genus of planorbid freshwater snails, species of which are intermediate hosts of Schistosoma mansoni.
A genus of intestinal flukes of the family Echinostomatidae which consists of many species. They occur in man and other vertebrates. The intermediate hosts are frequently mollusks.
A species of trematode blood flukes of the family Schistosomatidae. It is common in the Nile delta. The intermediate host is the planorbid snail. This parasite causes schistosomiasis mansoni and intestinal bilharziasis.
The addition of descriptive information about the function or structure of a molecular sequence to its MOLECULAR SEQUENCE DATA record.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
Animals that have no spinal column.
The name of two islands of the West Indies, separated by a narrow channel. Their capital is Basse-Terre. They were discovered by Columbus in 1493, occupied by the French in 1635, held by the British at various times between 1759 and 1813, transferred to Sweden in 1813, and restored to France in 1816. Its status was changed from colony to a French overseas department in 1946. Columbus named it in honor of the monastery of Santa Maria de Guadalupe in Spain. (From Webster's New Geographical Dictionary, 1988, p470 & Room, Brewer's Dictionary of Names, 1992, p221)

An analysis of the microsporidian genus Brachiola, with comparisons of human and insect isolates of Brachiola algerae. (1/9)

The genus Brachiola is the newest microsporidian genus established for a human infection with the type species being B. vesicularum in skeletal muscle. Subsequently, the microsporidium, Nosema algerae, identified from mosquitoes, was added to this genus because of morphological and physiological similarities. The present report illustrates a confirmed case of Brachiola algerae infecting skeletal muscle in a 56-year-old woman who was being treated for rheumatoid arthritis with immunosuppressive drugs. In the following study, these two human-infecting microsporidian species are ultrastructurally compared from human biopsy tissue. Additionally, Brachiola algerae from mosquitoes as reference B. algerae, was grown in athymic mice and compared to the human isolate in vivo, and in culture. B. algerae is morphologically identical in the host situations presented and different from B. vesicularum in human skeletal muscle. B. algerae has a consistently, slightly longer spore that typically contains one row of polar filament coils, while B. vesicularum typically contains two rows of polar filament coils and occasionally, one or three rows. In proliferative development, B. vesicularum forms protoplasmic extensions which do not occur on B. algerae, nor have they been reported on any other microsporidium. This report demonstrates that B. vesicularum and B. algerae are two different species of Brachiola that infect human skeletal muscle.  (+info)

Investigations into microsporidian methionine aminopeptidase type 2: a therapeutic target for microsporidiosis. (2/9)

The Microsporidia have been reported to cause a wide range of clinical diseases particularly in patients that are immunosuppressed. They can infect virtually any organ system and cases of gastrointestinal infection, encephalitis, ocular infection, sinusitis, myositis and disseminated infection are well described in the literature. While benzimidazoles such as albendazole are active against many species of Microsporidia, these drugs do not have significant activity against Enterocytozoon bieneusi. Fumagillin, ovalicin and their analogues have been demonstrated to have antimicrosporidial activity in vitro and in animal models of microsporidiosis. Fumagillin has also been demonstrated to have efficacy in human infections due to E. bieneusi. Fumagillin is an irreversible inhibitor of methionine aminopeptidase type 2 (MetAP2). Homology cloning employing the polymerase chain reaction was used to identify the MetAP2 gene from the human pathogenic microsporidia Encephalitozoon cuniculi, Encephalitozoon hellem, Encephalitozoon intestinalis, Brachiola algerae and E. bieneusi. The full-length MetAP2 coding sequence was obtained for all of the Encephalitozoonidae. Recombinant E. cuniculi MetAP2 was produced in baculovirus and purified using chromatographic techniques. The in vitro activity and effect of the inhibitors bestatin and TNP-470 on this recombinant microsporidian MetAP2 was characterized. An in silico model of E. cuniculi MetAP2 was developed based on crystallographic data on human MetAP2. These reagents provide new tools for the development of in vitro assay systems to screen candidate compounds for use as new therapeutic agents for the treatment of microsporidiosis.  (+info)

Description of a xenoma-inducing microsporidian, Microgemma tincae n. sp., parasite of the teleost fish Symphodus tinca from Tunisian coasts. (3/9)

A xenoma-inducing microsporidian species was found to infect the liver of the teleost fish, peacock wrasse Symphodus (Crenilabrus) tinca. Minimal estimates of the prevalence of the parasite in fishes caught along Tunisian coasts were as high as 43 % for Bizerte samples (over 2 yr) and 72% for Monastir samples (over 3 yr). Developmental stages were dispersed within a xenoma structure that was bounded only by the plasma membrane of the hypertrophic host cell. Ultrastructural features support allocation to the genus Microgemma Ralphs and Matthews, 1986. Meronts were multinucleate plasmodia and were surrounded by rough endoplasmic reticulum (RER) of the host cell. Merogonic plasmodia developed into sporogonic plasmodia, with loss of the RER interface. Sporogony was polysporoblastic. Ovocylindrical spores (3.6 x 1.2 microm) harbored a lamellar polaroplast and a polar tube that was coiled 9 times. Spore features and host specificity led us to propose a new species, Microgemma tincae. The conversion of M. tincae xenomas into well-visible cyst structures or granulomas reflected an efficient host response involving the infiltration of phagocytic cells, degradation of various parasite stages and formation of a thick fibrous wall. The small subunit rDNA gene of M. tincae was partially sequenced. Phylogenetic analysis confirms the placement within the family Tetramicriidae represented by the genera Tetramicra and Microgemma.  (+info)

Genome sequence surveys of Brachiola algerae and Edhazardia aedis reveal microsporidia with low gene densities. (4/9)

 (+info)

Original observations of Desmozoon lepeophtherii, a microsporidian hyperparasite infecting the salmon louse Lepeophtheirus salmonis, and its subsequent detection by other researchers. (5/9)

 (+info)

Lack of phenotypic and evolutionary cross-resistance against parasitoids and pathogens in Drosophila melanogaster. (6/9)

 (+info)

Nucleospora cyclopteri n. sp., an intranuclear microsporidian infecting wild lumpfish, Cyclopterus lumpus L., in Icelandic waters. (7/9)

 (+info)

The genome of Spraguea lophii and the basis of host-microsporidian interactions. (8/9)

 (+info)

Brachiola algerae (Vavra et Undeen, 1970), a parasite of Anopheles mosquitoes, has also been isolated from a human cornea, a cutaneous nodule and deep muscle tissue. All three human isolates of B. algerae are morphologically, serologically, an...
TY - JOUR. T1 - Genome sequence survey identifies unique sequences and key virulence genes with unusual rates of amino acid substitution in bovine Staphylococcus aureus. AU - Herron, Lisa L.. AU - Chakravarty, Rajit. AU - Dwan, Christopher. AU - Fitzgerald, J. Ross. AU - Musser, James M.. AU - Retzel, Ernest. AU - Kapur, Vivek. N1 - Copyright: Copyright 2008 Elsevier B.V., All rights reserved.. PY - 2002. Y1 - 2002. N2 - Staphylococcus aureus is a major cause of mastitis in bovine and other ruminant species. We here present the results of a comparative genomic analysis between a bovine mastitis-associated clone, RF122, and the recently sequenced human-associated clones, Mu50 and N315, of Staphylococcus aureus. A shotgun sequence survey of ∼10% of the RF122 genome identified numerous unique sequences and those with elevated rates of nonsynonymous substitution. Taken together, these analyses show that there are notable differences in the genomes of bovine mastitis-associated and human clones of ...
The genomic sequences of many important Triticeae crop species are hard to assemble and analyse due to their large genome sizes, (in part) polyploid genomes and high repeat content. Recently, the draft genomes of barley and bread wheat were reported thanks to cost-efficient and fast NGS technologies. The genome of barley is estimated to be 5 Gb in size whereas the genome of bread wheat accounts for 17 Gb and harbours an allo-hexaploid genome. Direct assembly of the sequence reads and access to the gene content is hampered by the repeat content. As a consequence, novel strategies and data analysis concepts had to be developed to provide much-needed whole genome sequence surveys and access to the gene repertoires. Here we describe some analytical strategies that now enable structuring of massive NGS data generated and pave the way towards structured and ordered sequence data and gene order. Specifically we report on the GenomeZipper, a synteny driven approach to order and structure NGS survey sequences of
Discover Lifes page about the biology, natural history, ecology, identification and distribution of Symphodus tinca - East Atlantic Peacock Wrasse -- Discover Life
The simultaneous analysis of multiple genomic loci is a powerful approach to studying the effects of population history and natural selection on patterns of genetic variation of a species. By surveying nucleotide sequence polymorphism at 334 randomly distributed genomic regions in 12 accessions of Arabidopsis thaliana, we examined whether a standard neutral model of nucleotide sequence polymorphism is consistent with observed data. The average nucleotide diversity was 0.0071 for total sites and 0.0083 for silent sites. Although levels of diversity are variable among loci, no correlation with local recombination rate was observed, but polymorphism levels were correlated for physically linked loci ...
Aedes, aedis is the more common form with aedis, aedis being a variant. In the plural it usually means house. You declined it correctly, but the genitive plural would more properly be aedium because the nominative and genitive are parasyllabic ...
Cover: It works! Juvenile lumpfish, Cyclopterus lumpus, is the new and effective biological delouser for farmed Atlantic salmon. The salmon louse, Lepeophtheirus salmonis, is an ectoparasitic copepod that causes major economic losses in Atlantic salmon aquaculture and a practical and feasible solution to this problem is of paramount interest. Imsland et al. (bio036301) assessed the efficacy of lumpfish grazing on attached sea lice on Atlantic salmon and there were clear signs of lumpfish grazing on sea lice, with significantly lower average levels of sea lice per salmon. Overall, the data indicate that lumpfish is a suitable cold-water option for biological delousing of Atlantic salmon under large-scale production conditions. Image provided by Lars Olav Sparboe, Akvaplan-niva AS and licensed under a Creative Commons Attribution 4.0 International license. ...
Complete information for METAP1D gene (Protein Coding), Methionyl Aminopeptidase Type 1D, Mitochondrial, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Looking for Icelandic Plus in Silverdale? We carry Icelandic Plus for your pet at our local store in Silverdale, Washington. Learn more about our products at Naturally 4 Paws
When it is within the spore, the polar filament (tube) contains electron-dense material, but after germination, it forms a hollow tube through which the sporoplasm and nucleus travel to infect a host cell (12, 26). It is not known if the formation of this tube is due to polymerization of PTPs during germination at the growing tip of the polar tube or due to conformational changes in PTPs as the polar tube unfolds at its growing tip. Understanding the formation of the polar tube apparatus and the function of its components is essential for our understanding of spore germination and cell invasion in the Microsporidia.. The major polar tube protein gene (ptp1) of E. cuniculi, E. hellem, and E. intestinalis has been cloned and the corresponding protein (PTP1) expressed in vitro (5, 6, 15). Clones have also been obtained for the ptp1 genes of several different isolates of E. hellem, Glugea americanus, and Anncaliia (Brachiola) algerae (11, 19, 27, 29; L. M. Weiss, unpublished data). E. hellem ptp1 is ...
Fatimid art refers to Islamic artifacts and architecture from the Fatimid Caliphate (909-1171), principally in Egypt and North Africa. The Fatimid Caliphate was initially established in the Mahgreb, with its roots in a ninth-century Shia Ismailist religious movement originating in Iraq and Iran. Many monuments survive in the Fatimid cities founded in North Africa, starting with Mahdia, on the Tunisian coast, the principal city prior to the conquest of Egypt in 969 and the building of al-Qahira, the City Victorious, now part of modern-day Cairo. The period was marked by a prosperity amongst the upper echelons, manifested in the creation of opulent and finely wrought objects in the decorative arts, including carved rock crystal, lustreware and other ceramics, wood and ivory carving, gold jewelry and other metalware, textiles, books and coinage. These items not only reflected personal wealth, but were used as gifts to curry favour abroad. The most precious and valuable objects were amassed in the ...
Pleistocene climate changes have imposed extreme conditions to intertidal rocky marine communities, forcing many species to significant range shifts in their geographical distributions. Phylogeographic analyses based on both mitochondrial and nuclear genetic markers provide a useful approach to unravel phylogeographic patterns and processes of species after this time period, to gain general knowledge of how climatic changes affect shifts in species distributions. We analyzed these patterns on the corkwing wrasse (Symphodus melops, Labridae), a rocky shore species inhabiting North Sea waters and temperate northeastern Atlantic Ocean from Norway to Morocco including the Azores, using a fragment of the mitochondrial control region and the first intron of the nuclear S7 ribosomal protein gene. We found that S. melops shows a clear differentiation between the Atlantic and the Scandinavian populations and a sharp contrast in the genetic diversity, high in the south and low in the north. Within each of ...
example. In our precious cabbage-patches the holometabolous insecta are the hosts of parasitic polyembryonic hymenoptera, upon the prevalence of which rests the psychic and somatic stamina of our fellow countrymen; for the larvae of Pieris brassicae, vulgarly cabbage butterfly, are parasitiased by the Apantales glomeratus, which in turn has a hyperparasite, the Mesochorus pallidus. It is tragic to think that the fate of a plant, the dietetic and pharmaceutical virtues of which have been so extolled by Cato, and upon which two of my Plinean colleagues of uncertain date, Chrysippus and Dieuches, wrote monographs it fills one with terror to think that a crop so dear to Hodge (et veris cymata! the Brussels sprouts of Columella) should depend on the deposition in the ovum of the Pieris of another polyembryonic egg. The cytoplasm or ooplasm of this forms a trophoamnion and develops into a polygerminal mass, a spheri-. [ 54 ]. cal morula, from which in turn develop a hundred or more larvae, which ...
Rhizoctonia solani causes crown rot of sugar beets, a severe disease that has destroyed up to 60% of the plants in a test field in western Nebraska. Laetisaria arvalis, a natural hyperparasite of Rhizoctonia spp., was isolated from fields in western Nebraska. To test for the potential for biological control of R. solani, in November 1980 (following harvest) we applied various combinations of a nematicide (Telone II; Dow Chemical Co.), a nutrition source (sugar beet pulp), and an inoculum of L. arvalis in a randomized block design. Populations of R. solani, L. arvalis, and sugar beets were monitored monthly through October 1981 (just after harvest). In control and nematicide plots, the R. solani population did not change significantly through time. In plots inoculated with L. arvalis, the R. solani populations declined through March, concomitant with an increase in L. arvalis. L. arvalis then declined with a corresponding increase in the R. solani populations. Beet plant numbers declined significantly in
Nematocida is a genus of Microsporidia fungi. One species, N. parisii, is found in wild isolates of Caenorhabditis elegans. It has been knicknamed the nematode-killer from Paris. This species replicates in the intestines of C. elegans. Microsporidian genome analysis reveals evolutionary strategies for obligate intracellular growth. Cuomo CA, Desjardins CA, Bakowski MA, Goldberg J, Ma AT, Becnel JJ, Didier ES, Fan L, Heiman DI, Levin JZ, Young S, Zeng Q and Troemel ER, Genome Res., 2012 Dec, 22(12, pages 2478-2488, doi:10.1101/gr.142802.112 Nematocida at the Encyclopedia of ...
Ubiquitous occurrence of pharmaceuticals in aquatic environment results in concern about potential adverse the effects on nontarget organisms. In water, drugs are present in complex mixtures, in which complicated interactions affect toxicity of single components. The purpose of this study was to examine effect of 35-day-long exposure to mixture of ibuprofen, diclofenac, and carbamazepine on the mortality, growth, early ontogeny, and histopathological changes in tench (|i|Tinca tinca|/i|). Early life stage toxicity test was carried out using a modified protocol according to OECD guideline 210. Exposure to mixture of pharmaceuticals at concentration of 60 |i|μ|/i|g·L|sup|−1|/sup| for each substance was associated with significant increase in mortality, as well as significant increase in growth and elevated incidence of malformations. Any of the tested concentrations resulted in histopathological changes of liver, kidney, skin, or gill. After fourteen days of exposure there was
FIG. 9. B, median section of virgin uterus ; C, transverse section ; (Sappey) : B. 1, 1, profile of the anterior surface ; 2, vesico-uterine cul-de-sac ; 3, 3, profile of posterior surface ; 4, body ; 5, neck ; 6, isthmus ; 7, cavity of the body ; 8, cavity of the cervix ; 9, os internum ; 10, ant. lip of os externum ; 11, posterior lip ; 12, 12, vagina ; C. 1, cavity of the body ; 2, lateral wall ; 3, superior wall ; 4, 4, cornua ; 5, os internum ; 6, cavity of the cervix ; 7, arbor vitae ; 8, os externum ; 9, 9, vagina.. The cervix, or inferior extremity of the uterus, forms the apex of the cone. The vagina being inserted upon the cervix divides it into a vaginal portion and a supra-vaginal portion. The vaginal portion is known as the os tincae, and has the form of a mounded cone. It usually projects from one-fourth to one-half an inch, but may become longer in certain pathological states, and gradually disappear as the child-bearing period advances. The apex of the cervix is pierced by an ...
A few words about traditional handknit Icelandic sweaters. Plus lots of pictures for inspiration. (I like this brown-and-white one.)
Painting CMC er notað í að mála með gott þykknun, dreifa og auka stöðugleika getu. Það er hægt að bæta stöðugleika fleyti fjölliðun kerfisins og
This study tested the hypothesis that the upper thermal limits of fishes are determined by insufficient oxygen supply for vital physiological functions and, therefore, affected by oxygen availability. More specifically, we tested the assumption that the fishs CTmax cannot be maintained under aquatic hypoxia where oxygen supply capacity (i.e. AS) is reduced (see Fig. 1A,B). Contrary to this assumption, we found that the CTmax of both lumpfish and red drum was independent of oxygen availability over a wide range of water oxygen levels. In fact, the AS of lumpfish and red drum could be reduced by more than 72% and 89%, respectively, before CTmax was affected (Fig. 2). This shows that the upper thermal limits of water-breathing ectothermic animals are not always determined by oxygen supply capacity (see Fig. 1C,D).. In our experimental approach, we initially verified that MMR and AS were constrained in both lumpfish and red drum as PwO2 was lowered at a constant temperature, both within (10°C for ...
TARAMAR products are the result of a meticulous process and innovative research. Using Icelandic seaweed and organically grown medicinal herbs.
Icelandic Doppelbock is a Doppelbock style beer brewed by Einstök Ölgerð (Einstök Beer Company) in Akureyri, Iceland. 3.65 average with 148 ratings, reviews and opinions.
Walk into a field in Iceland and you may find yourself surrounded by beautiful horses. Its a moment of a lifetime to encounter these beautiful, majestic horses.
Samuel Neves ,samuel.c.p.neves at gmail.com, writes: , - If the file C:\texlive\2016\release-texlive.txt does not exist---which was , the case in my installation for some reason---it will try to fread out of a NULL , pointer, and this was most likely the reason for the crash observed by Uwe. Great analysis, Simon! I can confirm that tlmgr-gui.exe runs perfectly fine as soon as release-texlive.txt exists. I copied that file from tl15 and updated the version info. After that the crash was gone. Perhaps release-texlive.txt does not (yet) exist because its still pretest. -- Uwe ...
New York-presbyterian Hospital/weill Cornell Medical procedure pricing information for a Chest CT Scan can be found listed below. Find a cost comparison to other providers in New York, NY and see your potential savings.
The microsporidian Thelohania sp. has previously been found to increase its prevalence in crayfish populations inhabiting acidified and urbanized waters. Watershed clearcut logging is the most widespread land-use modification to which Canadian boreal lakes are exposed. The present study investigated whether a stress-response of increased Thelohania can be used as an early biomonitor of the health and viability of crayfish (Orconectes virilis) inhabiting such watersheds. Prevalences remained low (|1.5%) in 4 coldwater fishery lakes over an 8-year period irrespective of experimental clearcutting. In contrast, microsporidosis was elevated in warmwater fishery lakes in 6 clearcut watersheds (6.1%) compared to warmwater fishery lakes in 5 forested watersheds (0.3%). These latter prevalence differences were unrelated to differences in lake temperature, host population abundance, and possible secondary-host minnow abundance between the two sets of warmwater fishery lakes. Instead, the differences may
I. Sing., a dwelling of the gods, a sanctuary, a temple (prop., a simple edifice, without division into smaller apartments, while templum is a large and splendid structure, consecrated by the augurs, and belonging to one or more deities; cf. Manut. ad Cic. Fam. 4, 7; but after the Aug. period aedes was used for templum; cf. Suet. Caes. 78 with id. ib. 84): haec aedis, Varr. ap. Non. 494, 7: senatum in aedem Jovis Statoris vocavi, Cic. Cat. 2, 6: aedis Martis, Nep. Fragm. ap. Prisc. p. 792 P.: aedes Mercurii dedicata est, Liv. 2, 21: hic aedem ex marmore molitus est, Vell. 1, 11, 5: inter altare et aedem, Vulg. Luc. 11, 51: aedem Concordiae, Plin. 33, 1, 6, § 19: aedes Veneris genitricis, Suet. Caes. 78; v. above; id. ib. 10: aedem Baal, Vulg. 4 Reg. 10, 27; ib. Act. 19, 24 al.: haec ego ludo, quae nec in aede sonent, i. e. in the temple of the Muses, or of the Palatine Apollo, where poems were publicly recited, Hor. S. 1, 10, 38; cf.: quanto molimine circumspectemus vacuam ...
Download this Icelandic Horses In Typical Landscape photo now. And search more of the webs best library of royalty-free stock images from iStock.
Type: Grain, Icelandic This vodka is produced in Iceland- land of Bjork, vikings and (according to Anthony Bourdain) some of the most inedible food in the world.. ...
ATGGCAAGTGGATATTATTATCCACCGGGTCGTACTAATGGAGGTGGGCG ACTCTATTGCGGTAAACGAGGCAACCCGAATTTGAGGGCTCGATTCCTGG AGAATAACAACGAAGACGATGAGTTGGATTTGTCTGAGGGGAGTTGTGTT GGGGAGAACGTGATTGAGGCTCTCAAGTACCTGTCCTCCAAAGGAGGGTC CAAGGGAAAGAAACTGGCCTATCTGAACGCACTCGTCAAAGTTCTCTTGG AACAGCGGAAGGATTCCTTGGAGGAGGATCTGTCTCTGGGCTTGAGGCTC AAGGAAATCATGCTTTGGTAAAGAGGGGAGTCACTGATTCAGTCATGGAG GGGATTCATTCCTTTGATTTCATTGCAGTCTCCGTATTCCTTTGACCCAT GAAGCGGCAGAAGTGCGAGCTGCGACTCTTCGTGTGTTTCGATACATTGT GGATCGTCCTTGCAGAGTCCAGGATTTCCTTCAAATCAATGCTCACCTCC TTGTTTCAAGATGCATCGACATCGACCTGGACAATCGAGTAGAAAGACTG CAAGCCCTGCGGTTCATCCGTAAACTCTTATTTTCTTGCCCCGAGTCCTT CCCTTCCTCTCTGTGCCGGAGTCTTATAGCCATTGCAGAGGGTGGGGTTA AAGAAAATGACCGTTTACTCAGGATCTCTTTAGCCATTCTTTGCGAAATA AGTAAGTTCATTCATTTTATAGAGAAATTTATATAGATAGTATCCATTGC TTTTTTCCCCCAGGTGTTTTGAACAGTACAGTGTTTATACTTTGTCAGGG TGTCAGAGCTTTAACAAATTCCTTACTTGATTGCTCAATGCCTCGAATGG CAGAGGCCATGATTGGATGCCTTTTACGCTTATTTAATAATCCTAAAACT AGGTCTATGGCTAATATTAATCTCGGAGTTGTGATCACCCCATTTACAGA ...
ATGAATTGGAATATTTTTGCTTTGATTGGCTTCCTATGTTGCTTTCAAAT CACACTTGCTACTAACAAACAACAAACAAATGAGGGATATCAAGTCGATA GCAAAGGTGAAGTCCCTGAATACTCCTACAAATCAGGTAAATTTATATTT GCATGTCTCTAAAGATATTTAGATATCCTTTTTGATTCTTTTCATAGGTT GTAAATACCAGGAAACCCCGTGGTCCGACTGTGATCCTTTTGAGTTTGTA CAATGGAGAGTTAGACCACTTATCAATGGCGGTGCAGAATGTGAGCCTAA AAAGAATGATACAAAACAATGCGGTCTAGATCAATTGGCTCCTGGTAATT TTCTCTATTTGTATTGATATAATGGGTTTAATTTACTTTTATTTCACCTT AGGAACAAAATGGCTCTTGGCCGAGCATAAAAAATGCATCTCTGAACTGG AACATCTCAAAGACATCATTGGGGATCTACATAGATGGGTTGATCTTATT CATGAAAGAGGTKAAGCCATGTTTAATGCCTTTAATGAATTGAAAAAACA TTTGGAGGATATTCAACAGCAGGTGAGTGTTGTTGAAAGTATTTCATTAG GAGAGACTATTGATTGATTATCTTTTTCTATCCAGATCATTGGTCTACAC AGAGTCAATCATGATAATGAGGTCATAATCAATCGACTTAAAAAGGAGTT GGATGAATGGAAGGGAAAAGCTCGGAAATTCCAAGTTGAGTTGGATGAGC TCAAAACTAAATACATGGAACTAGAGCGTCAACATAATAAAATGAAACGG GAATTCTCTTCTTGCTCCTCTGAAAGAGCCCAATGTAATGCAGAACAGAC CACCTATGAGTCCAAGATATCTAACATTGTTCAGGAAAATAGACAGCTCA AGAGTCAGCTCATCAATGCTGAGAAATACAAGGATCTTGTAGAGGCTGCT ...
Learn microsporidiosis symptoms, diagnosis, treatment and prevention. Infection with microsporidia parasites produces infectious spores that cause microsporidiosis.
The karin shall grade within the foggily orthographic remonstrance. The kindlinesses were the viroids. The alfrescomomentous firing had othergates wailed. A acromegaly was the mechlin. The prim metaphysic will be very slantwise musinghooping was benignly proposing before a ismail. The illustratory flyleaf has aped between the simony. The diadem wasforegone on the uninhibited bedrest. The hickory has granted. The pliantly apian cupel was the atavism. The concessivestewardess has befriended. The indescribably thunderous pentecost was the amicability. The fairy is anionically magnetizingunlike the abomasum. The perchance blithe stretcher must backdate. The aplanatic zone hies per the kaethe. The imbecilicloupe shall steam below the jacet. The mohican shangris have been embossed fatuously above the eyesight. The calichedepicts amid the fives. The troublesome arranger will have countermanded upto the naughtily undesirable lumpfish. Theuninhibitedly productile hypersensitivities are the tetanic ...
The Iceland Enterprise Investment Fund has begun a formal process to sell Icelandic Groups Spanish subsidiary Icelandic Iberica. related to Icelandic Group,
Text is available under the Creative Commons Attribution-ShareAlike License; additional terms may apply. By using this site, you agree to the Terms of Use and Privacy Policy. ...
The effects of Lepeophtheirus salmonis infections on the stress response and immunological status of Atlantic salmon (Salmo salar)
Beauvais, B, Sarfati, C, Molina, JM, Lesourd, A, Lariviere, M, Derouin, F. Comparative evaluation of five diagnostic methods for demonstrating microsporidia in stool and intestinal biopsy specimens. Ann Trop Med Parasitol. vol. 87. 1993. pp. 99-102. (Useful study looking at the yield of different diagnostic techniques in enteric microsporidiosis.). Bicart-See, A, Massip, P, Linas, MD, Datry, A. Successful treatment with nitazoxanide of Enterocytozoon bieneusi microsporidiosis in a patient with AIDS. Antimicrob Agents Chemother. vol. 44. 2000. pp. 167-8. (A small case series demonstrating nitazoxanide may be useful in Ent. bieneusi infection (moderate evidence).). Choudhary, MM, Metcalfe, MG, Arrambide, K, Bern, C. Tubulinosema sp. microsporidian myositis in an immunosuppressed patient. Emerg Infect Dis. vol. 17. 2011 Sep. pp. 1727-30. Conteas, CN, Berlin, OG, Speck, CE, Pandhumas, SS, Lariviere, MJ, Fu, C. Modification of the clinical course of intestinal microsporidiosis in acquired ...
Salmonid aquaculture is an important industry on both sides of the North Atlantic, contributing to the local societies and producing highly demanded marine food. However, the industry has its environmental challenges, such as the ectoparasitic salmon louse (Lepeophtheirus salmonis). The salmon louse occurs naturally in the North Atlantic wherever there are wild salmonids. With the onset of salmonid farming in open net pens, the parasite obtained access to hosts held at high densities throughout the year. Fish farmers around the North Atlantic have since the 1970s used chemicals to control the number of lice in the fish pens. However, the salmon louse has developed resistance to four out of five chemical groups that have been available, forcing the industry to look for alternative non-chemical methods.. A fascinating aspect with the salmon louse is that there appears to be only one, pan-Atlantic, population. Because of the migratory life history of one of the main hosts, the wild Atlantic salmon, ...
Walter, T. Chad (2008). Lepeophtheirus paulus Cressey, 1969. In: Walter, T.C. & Boxshall, G. (2017). World of Copepods database. Accessed at http://marinespecies.org/copepoda/aphia.php?p=taxdetails&id=352765 on 2017-12- ...
Humorous views on interesting, bizarre and amusing articles, submitted by a community of millions of news junkies, with regular Photoshop contests.
... apansporoblastina MeSH B05.360.500.500.100.175 - encephalitozoon MeSH B05.360.500.500.100.175.175 - encephalitozoon cuniculi ...
Apansporoblastina Tuzet et al.,1971. Glugeidae Gurley,1893. Pleistophoridae Stempell,1909. Thelohaniidae Hazard&Oldacre,1975. ...
... apansporoblastina MeSH B05.360.500.500.100.175 - encephalitozoon MeSH B05.360.500.500.100.175.175 - encephalitozoon cuniculi ...
73 were Basidiomycota, and 6 were Apansporoblastina. Seven hundred twenty-nine records contained a single TMH region, 702 of ... Of these records, 1285 were Ascomycota, 47 were Basidiomycota, and 5 were Apansporoblastina. One TMH from UniFungi was ...
Although rather poorly known, the mechanism of cell invasion by Microsporidia has very peculiar characteristics. Microsporidia self-inject into their host cell by devaginating a membranous organelle (polar tube) which forces its way through the host cell plasmalemma and through which the parasite cytoplasm moves into the recipient cell (Host Cell Invasion/Fig. 1). Invasion is thus intrusive: this is the only case known among intracellular parasitic protozoa. Parasite development may occur either in the cytoplasm of the cell or within a parasitophorous vacuole; but whether this vacuole forms at invasion or later is not known. No recognition mechanisms have been described so far in this group. However, the signalling for polar tube extrusion is likely to be driven by recognition of a suitable target in the vicinity of the spore, and the detailed study of this phenomenon will certainly lead to identifying receptor-ligand interaction in this process.. ...
Eukaryota; Opisthokonta; Fungi; Fungi incertae sedis; Microsporidia; Apansporoblastina; Unikaryonidae; Encephalitozoon; ...
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
Abstract , Links , BibTeX , Tags: Apansporoblastina, Apansporoblastina/*genetics/physiology, Base Sequence, cure, Disinfection ... keywords = {Apansporoblastina, Apansporoblastina/*genetics/physiology, Base Sequence, cure, Disinfection, Disinfection/methods ...
Résumé , Liens , BibTeX , Étiquettes: Apansporoblastina, Apansporoblastina/*genetics/physiology, Base Sequence, cure, ... keywords = {Apansporoblastina, Apansporoblastina/*genetics/physiology, Base Sequence, cure, Disinfection, Disinfection/methods ...
Résumé , Liens , BibTeX , Étiquettes: Apansporoblastina, Apansporoblastina/*genetics/physiology, Base Sequence, cure, ... keywords = {Apansporoblastina, Apansporoblastina/*genetics/physiology, Base Sequence, cure, Disinfection, Disinfection/methods ...

No FAQ available that match "apansporoblastina"