Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.
Membrane proteins that allow the exchange of hydrogen ions for potassium ions across the cellular membrane. The action of these antiporters influences intracellular pH and potassium ion homeostasis.
A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.
A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.
Metals that constitute group 1(formerly group Ia) of the periodic table. They are the most strongly electropositive of the metals. Note that HYDROGEN is not considered an alkali metal even though it falls under the group 1 heading in the periodic table.
An element in the alkali metals family. It has the atomic symbol Li, atomic number 3, and atomic weight [6.938; 6.997]. Salts of lithium are used in treating BIPOLAR DISORDER.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Positively charged atoms, radicals or group of atoms with a valence of plus 1, which travel to the cathode or negative pole during electrolysis.
A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.
A ubiquitous sodium salt that is commonly used to season food.
Usually a hydroxide of lithium, sodium, potassium, rubidium or cesium, but also the carbonates of these metals, ammonia, and the amines. (Grant & Hackh's Chemical Dictionary, 5th ed)
A salt of lithium that has been used experimentally as an immunomodulator.
Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.
Integral membrane proteins that transport protons across a membrane. This transport can be linked to the hydrolysis of ADENOSINE TRIPHOSPHATE. What is referred to as proton pump inhibitors frequently is about POTASSIUM HYDROGEN ATPASE.
Substances produced from the reaction between acids and bases; compounds consisting of a metal (positive) and nonmetal (negative) radical. (Grant & Hackh's Chemical Dictionary, 5th ed)
A genus of ascomycetous yeast in the family Dipodascaceae, order SACCHAROMYCETALES.
Proteins obtained from ESCHERICHIA COLI.
The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.
An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.
Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.
The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight [1.00784; 1.00811]. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are PROTONS. Besides the common H1 isotope, hydrogen exists as the stable isotope DEUTERIUM and the unstable, radioactive isotope TRITIUM.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.
Proteins found in any species of bacterium.
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
Cell membrane glycoproteins that form channels to selectively pass chloride ions. Nonselective blockers include FENAMATES; ETHACRYNIC ACID; and TAMOXIFEN.
Protein-lipid combinations abundant in brain tissue, but also present in a wide variety of animal and plant tissues. In contrast to lipoproteins, they are insoluble in water, but soluble in a chloroform-methanol mixture. The protein moiety has a high content of hydrophobic amino acids. The associated lipids consist of a mixture of GLYCEROPHOSPHATES; CEREBROSIDES; and SULFOGLYCOSPHINGOLIPIDS; while lipoproteins contain PHOSPHOLIPIDS; CHOLESTEROL; and TRIGLYCERIDES.
The processes whereby the internal environment of an organism tends to remain balanced and stable.
A flavoprotein and iron sulfur-containing oxidoreductase complex that catalyzes the conversion of UBIQUINONE to ubiquinol. In MITOCHONDRIA the complex also couples its reaction to the transport of PROTONS across the internal mitochondrial membrane. The NADH DEHYDROGENASE component of the complex can be isolated and is listed as EC 1.6.99.3.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
The relationships of groups of organisms as reflected by their genetic makeup.
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Transport proteins that carry specific substances in the blood or across cell membranes.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.
The functional hereditary units of BACTERIA.
Proteins found in any species of fungus.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Proteins prepared by recombinant DNA technology.
The rate dynamics in chemical or physical systems.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Electroneutral chloride bicarbonate exchangers that allow the exchange of BICARBONATE IONS exchange for CHLORIDE IONS across the cellular membrane. The action of specific antiporters in this class serve important functions such as allowing the efficient exchange of bicarbonate across red blood cell membranes as they passage through capillaries and the reabsorption of bicarbonate ions by the kidney.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.

Inactivation of the glucose 6-phosphate transporter causes glycogen storage disease type 1b. (1/1325)

Glycogen storage disease type 1b (GSD-1b) is proposed to be caused by a deficiency in microsomal glucose 6-phosphate (G6P) transport, causing a loss of glucose-6-phosphatase activity and glucose homeostasis. However, for decades, this disorder has defied molecular characterization. In this study, we characterize the structural organization of the G6P transporter gene and identify mutations in the gene that segregate with the GSD-1b disorder. We report the functional characterization of the recombinant G6P transporter and demonstrate that mutations uncovered in GSD-1b patients disrupt G6P transport. Our results, for the first time, define a molecular basis for functional deficiency in GSD-1b and raise the possibility that the defective G6P transporter contributes to neutropenia and neutrophil/monocyte dysfunctions characteristic of GSD-1b patients.  (+info)

Topology of the membrane domain of human erythrocyte anion exchange protein, AE1. (2/1325)

Anion exchanger 1 (AE1) is the chloride/bicarbonate exchange protein of the erythrocyte membrane. By using a combination of introduced cysteine mutants and sulfhydryl-specific chemistry, we have mapped the topology of the human AE1 membrane domain. Twenty-seven single cysteines were introduced throughout the Leu708-Val911 region of human AE1, and these mutants were expressed by transient transfection of human embryonic kidney cells. On the basis of cysteine accessibility to membrane-permeant biotin maleimide and to membrane-impermeant lucifer yellow iodoacetamide, we have proposed a model for the topology of AE1 membrane domain. In this model, AE1 is composed of 13 typical transmembrane segments, and the Asp807-His834 region is membrane-embedded but does not have the usual alpha-helical conformation. To identify amino acids that are important for anion transport, we analyzed the anion exchange activity for all introduced cysteine mutants, using a whole cell fluorescence assay. We found that mutants G714C, S725C, and S731C have very low transport activity, implying that this region has a structurally and/or catalytically important role. We measured the residual anion transport activity after mutant treatment with the membrane-impermeant, cysteine-directed compound, sodium (2-sulfonatoethyl)methanethiosulfonate) (MTSES). Only two mutants, S852C and A858C, were inhibited by MTSES, indicating that these residues may be located in a pore-lining region.  (+info)

Functional importance and local environments of the cysteines in the tetracycline resistance protein encoded by plasmid pBR322. (3/1325)

The properties of the cysteines in the pBR322-encoded tetracycline resistance protein have been examined. Cysteines are important but not essential for tetracycline transport activity. None of the cysteines reacted with biotin maleimide, suggesting that they are shielded from the aqueous phase or reside in a negatively charged local environment.  (+info)

Na+/H+ antiporter activity in hamster embryos is activated during fertilization. (4/1325)

This study characterized the activation of the regulatory activity of the Na+/H+ antiporter during fertilization of hamster embryos. Hamster oocytes appeared to lack any mechanism for the regulation of intracellular pH in the acid range. Similarly, no Na+/H+ antiporter activity could be detected in embryos that were collected from the reproductive tract between 1 and 5 h post-egg activation (PEA). Activity of the Na+/H+ antiporter was first detected in embryos collected at 5.5 h PEA and gradually increased to reach maximal activity in embryos collected at 7 h PEA. Parthenogenetically activated one-cell and two-cell embryos demonstrate Na+/H+ antiporter activity, indicating that antiporter activity is maternally derived and initiated by activation of the egg. The inability of cycloheximide, colchicine, or cytochalasin D to affect initiation of antiporter activity indicates that antiporter appearance is not dependent on the synthesis of new protein or recruitment of existing protein to the cell membrane. In contrast, incubation of one-cell embryos with sphingosine did inhibit the appearance of Na+/H+ antiporter activity, showing that inhibition of normal protein kinase C activity is detrimental to antiporter function. Furthermore, incubation of oocytes with a phorbol ester which stimulates protein kinase C activity induced Na+/H+ antiporter activity in oocytes in which the activity was previously absent. Incubation with an intracellular calcium chelator also reduced the appearance of antiporter activity. Taken together, these data indicate that the appearance of Na+/H+ antiporter activity following egg activation may be due, at least in part, to regulation by protein kinase C and intracellular calcium levels.  (+info)

Non-selective voltage-activated cation channel in the human red blood cell membrane. (5/1325)

Using the patch-clamp technique, a non-selective voltage-activated Na+ and K+ channel in the human red blood cell membrane was found. The channel operates only at positive membrane potentials from about +30 mV (inside positive) onwards. For sodium and potassium ions, similar conductances of about 21 pS were determined. Together with the recently described K+(Na+)/H+ exchanger, this channel is responsible for the increase of residual K+ and Na+ fluxes across the human red blood cell membrane when the cells are suspended in low ionic strength medium.  (+info)

Prospective analysis of traits related to 6-year change in sodium-lithium countertransport. Gubbio Population Study Research Group. (6/1325)

Sodium-lithium countertransport (Na-Li CT) activity in red blood cells relates cross-sectionally and longitudinally to blood pressure and hypertension. Lifestyle and metabolic factors relate cross-sectionally to this sodium transporter. The aim of this study was to conduct a prospective analysis of 6-year Na-Li CT change and of traits related to Na-Li CT change. In 2183 participants in the Gubbio Population Study (972 men and 1211 women; baseline ages, 18 to 74 years), the following data collected at baseline and 6-year follow-up were analyzed: Na-Li CT; gender; age; body mass index (BMI); blood pressure; antihypertensive treatment; alcohol intake; smoking habits; urinary sodium-to-potassium ratio; and plasma cholesterol, glucose, uric acid, sodium, potassium, and triglycerides (measured only at follow-up). Six-year changes were defined as follow-up minus baseline values. Na-Li CT was higher at follow-up than at baseline in both genders (P<0.001). Baseline Na-Li CT; baseline and change values of BMI; and change values of alcohol intake, plasma potassium, and plasma glucose related to Na-Li CT change significantly and independently with control for other variables. Follow-up plasma triglyceride levels also related independently to Na-Li CT change. Coefficients were positive for BMI, alcohol intake, and plasma glucose and triglyceride levels and were negative for baseline Na-Li CT and plasma potassium levels. Baseline and change values of other variables did not relate significantly to Na-Li CT change. In conclusion, in prospective analyses, BMI, alcohol intake, plasma glucose, and lipids were directly related to Na-Li CT change; baseline Na-Li CT and plasma potassium levels were inversely related. The data support the concept that lifestyle and related metabolic factors influence Na-Li CT.  (+info)

Peptide-bound major histocompatibility complex class I molecules associate with tapasin before dissociation from transporter associated with antigen processing. (7/1325)

Major histocompatibility complex (MHC) class I molecules present antigenic peptides to CD8 T cells. The peptides are generated in the cytosol, then translocated across the membrane of the endoplasmic reticulum by the transporter associated with antigen processing (TAP). TAP is a trimeric complex consisting of TAP1, TAP2, and tapasin (TAP-A) as indicated for human cells by reciprocal coprecipitation with anti-TAP1/2 and anti-tapasin antibodies, respectively. TAP1 and TAP2 are required for the peptide transport. Tapasin is involved in the association of class I with TAP and in the assembly of class I with peptide. The mechanisms of tapasin function are still unknown. Moreover, there has been no evidence for a murine tapasin analogue, which has led to the suggestion that murine MHC class I binds directly to TAP1/2. In this study, we have cloned the mouse analogue of tapasin. The predicted amino acid sequence showed 78% identity to human tapasin with identical consensus sequences of signal peptide, N-linked glycosylation site, transmembrane domain and double lysine motif. However, there was less homology (47%) found at the predicted cytosolic domain, and in addition, mouse tapasin is 14 amino acids longer than the human analogue at the C terminus. This part of the molecule may determine the species specificity for interaction with MHC class I or TAP1/2. Like human tapasin, mouse tapasin binds both to TAP1/2 and MHC class I. In TAP2-mutated RMA-S cells, both TAP1 and MHC class I were coprecipitated by anti-tapasin antiserum indicative of association of tapasin with TAP1 but not TAP2. With crosslinker-modified peptides and purified microsomes, anti-tapasin coprecipitated both peptide-bound MHC class I and TAP1/2. In contrast, anti-calreticulin only coprecipitated peptide-free MHC class I molecules. This difference in association with peptide-loaded class I suggests that tapasin functions later than calreticulin during MHC class I assembly, and controls peptide loading onto MHC class I molecules in the endoplasmic reticulum.  (+info)

Granulocyte-macrophage colony-stimulating factor modulates tapasin expression in human neutrophils. (8/1325)

Differential display-polymerase chain reaction (DD-PCR) was used to evaluate changes in mRNA expression of granulocyte-macrophage colony-stimulating factor (GM-CSF) treated human neutrophils to better understand how this cytokine affects the functions of neutrophils at the molecular level. Although a variety of cDNA fragments were identified as modulated by GM-CSF with the use of DD-PCR, one fragment in particular, NGS-17 (neutrophil GM-CSF-stimulated fragment #17), was characterized. The NGS-17 fragment hybridized to a 3.8-kh mRNA that encodes for a protein of a predicted molecular mass of 47.6 kDa. After cloning and sequencing, this gene was found to code for the recently sequenced tapasin or TAP-A protein. Immunoprecipitation and immunoblotting studies using anti-tapasin antibodies showed that tapasin is expressed in neutrophils and is associated with the MHC class I-TAP complex. Moreover, tapasin expression was found to be induced by dimethyl sulfoxide and by retinoic acid in HL-60 cells. This is the first report on the expression of tapasin in human neutrophils. It provides novel information, at the molecular level, on how GM-CSF enhances the functions of these cells.  (+info)

Cellular life, as we know it, is absolutely dependent on biological membranes; remarkable superstructures made of lipids and proteins. For example, all living cells are surrounded by at least one membrane that protects the cell and holds it together. The proteins that are embedded in the membranes carry out a wide variety of key functions, from nutrient uptake and waste disposal to cellular respiration and communication. In order to function accurately, any integral membrane protein needs to be inserted into the cellular membrane where it belongs, and in that particular membrane it has to attain its proper structure and find partners that might be required for proper function. All membrane proteins have evolved to be inserted in a specific overall orientation, so that e.g. substrate-binding parts are exhibited on the right side of the membrane. So, what determines in which way a membrane protein is inserted? Are all membrane proteins inserted just so?. The focus of this thesis is on these ...
TY - JOUR. T1 - Examination of EmrE conformational differences in various membrane mimetic environments. AU - Federkeil, Sandra L.. AU - Winstone, Tara L.. AU - Jickling, Glen. AU - Turner, Raymond J.. PY - 2003/4. Y1 - 2003/4. N2 - Ethidium multidrug resistance protein (EmrE) is a member of the small multidrug resistance family of proteins and is responsible for resistance in Escherichia coli to a diverse group of lipophilic cations. Research is beginning to elucidate structural information as well as substrate binding and extrusion mechanisms for this protein. However, the choice of membrane mimetic environment to perform structural studies needs to be made. In this study EmrE was solubilized in different membrane mimetic environments to investigate the influence of environment on the structure and dynamics of the protein by comparing the fluorescence properties of emission maxima, peak shifts, relative intensities, acrylamide quenching constants, and polarization. Taken together, the ...
Transport assays were performed as previously described [8] using radiolabelled 14C MV2+ (Sigma-Aldrich) (referred to as MV throughout). Protein was first exchanged from DDM into OG [28]: DDM-protein was incubated with 1.5 ml of Ni-NTA beads (pre-washed 1% OG and 20 mM Tris pH 7.5) for 1.5 h at 4°C; loaded onto a Pharmacia XK-16/20 glass column; washed 4-times with buffer containing 150 mM NaCl, 1% OG, 15 mM mercaptoethanol and 15 mM Tris pH 7.5 and then mixed with elution buffer (the previous buffer with 200 mM imidazole and 15 mM mercaptoethanol) and incubated at room temperature for 15 min. Eluted protein was concentrated by centrifugation at 4000 g using Amicon Ultra 50 000 MWCO centrifugal concentrator (Millipore). Protein in OG was immediately reconstituted into lipid vesicles (at a starting protein:lipid mole ratio of ~2900:1). Lipids were rehydrated (to 50 mg.ml-1 in 150 mM NaCl, 15 mM Tris, pH 7.5) and sonicated or extruded to 50 nm, 100 nm or 200 nm as stated in the text. The vesicles ...
The small multidrug transporter from Escherichia coli, EmrE, couples the energetically uphill extrusion of hydrophobic cations out of the cell to the transport of two protons down their electrochemical gradient. Although principal mechanistic elements of proton/substrate antiport have been described, the structural record is limited to the conformation of the substrate-bound state, which has been shown to undergo isoenergetic alternating access. A central but missing link in the structure/mechanism relationship is a description of the proton-bound state, which is an obligatory intermediate in the transport cycle. Here we report a systematic spin labeling and double electron electron resonance (DEER) study that uncovers the conformational changes of EmrE subsequent to protonation of critical acidic residues in the context of a global description of ligand-induced structural rearrangements. We find that protonation of E14 leads to extensive rotation and tilt of transmembrane helices 1-3 in ...
In plants, high capacity tonoplast cation/H(+) antiport is mediated in part by a family of CAX (cation exchanger) transporters. Functional association between CAX1 and CAX3 has previously been inferred; however, the nature of this interaction has not been established. Here we analyze the formation o …
Biochemistry of Bacterial Multidrug Efflux Pumps. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
View mouse Slc9b2 Chr3:135307700-135345387 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Researchers at the Max Planck Institute, Goethe University and Martin Luther University are deciphering the structure of the MHC-I peptide-loading complex.
This detailed volume utilizes our current understanding of the structural basis of multidrug recognition and multidrug efflux mechanisms to provide protocols involving these vital intrinsic membrane p
Whats new? jQuery Calx version 2.0 is the successor of jQuery Calx 1.x. It offer a lot of new feature since version 1.x, let see whats new in jQuery Calx 2.0 Rewrite the internal formula parser and plugin structure. Ability to register new function and override default one. Ability to register variable. Easy graph to […]
Whats new? jQuery Calx version 2.0 is the successor of jQuery Calx 1.x. It offer a lot of new feature since version 1.x, let see whats new in jQuery Calx 2.0 Rewrite the internal formula parser and plugin structure. Ability to register new function and override default one. Ability to register variable. Easy graph to […]
Tapasin Related Protein兔多克隆抗体(ab123238)可与小鼠样本反应并经WB实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
地域母子保健・福祉の連携・支援体制のあり方に関する研究 保健福祉における住民組織活動の実態と連携に関する研究(3) (2002 ...
The objective of the present study was to determine whether information about a biometrically inferred single gene with large effects on erythrocyte sodium-lithium countertransport is useful in predicting the probability of having hypertension. We used multivariate logistic regression to model the relationship between the probability of having hypertension and predictor traits in a sample of 382 unrelated adult women and 347 unrelated adult men from Rochester, Minn. First, we identified a set of demographic, biochemical, and physiological predictors. Second, we analyzed whether the relationship between the probability of having hypertension and the identified predictor traits was heterogeneous between the biometrically inferred single locus genotypes with large effects on sodium-lithium countertransport level. Third, if there was no heterogeneity, we assessed whether sodium-lithium countertransport genotypes made an additional contribution to predicting the probability of having hypertension ...
Selected publications:. Kanai,N Lu,R Satriano,J Bao,Y Wolkoff,AW Schuster,VL. Identification and characterization of a prostaglandin transporter. Science 268: 866-869, 1995.. Itoh,S Lu,R Bao,Y Morrow,JD Roberts,LJ Schuster,VL. Structural determinants of substrates for the prostaglandin transporter PGT. Mol Pharm 50: 736-742, 1996.. Lu,R Kanai,N Bao,Y Schuster,VL. Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter cDNA hPGT. J Clin Invest 98: 1142-1149, 1996.. Schuster,VL Lu,R Coca-Prados,M. Identification and characterization of a prostaglandin transporter widely-expressed in ocular and other secretory epithelia. Survey Ophthalmol 41: S41-S45, 1997.. Schuster,VL. Molecular mechanisms of prostaglandin transport. Ann Rev Physiol 60: 221-242, 1998.. Chan,B Satriano,JA Pucci,M Schuster,VL. Mechanism of PGE2 transport across the plasma membrane of HeLa cells and Xenopus oocytes expressing the prostaglandin transporter PGT. J Biol Chem 273: 6689-6697, ...
We report here the characterization of an Arabidopsis transporter, AtMHX, which is the first Mg2+ transporter to be cloned from a multicellular organism, and the first cloned exchanger of protons with Mg2+ and Zn2+ ions. Although AtMHX shows limited sequence homology with animal Na+/Ca2+ exchangers, the two transporter species are functionally distinct. In animals, Na+/K+‐ATPases generate Na+ gradients that provide the driving force for most transport processes, including Ca2+ extrusion from the cytosol to the extracellular space by Na+/Ca2+ exchangers localized in the plasma membrane. In plants, the driving force for most transport processes is the electrochemical H+ gradient, which is generated by H+‐ATPases localized in both the plasma membrane and the vacuolar membrane (Maathuis and Sanders, 1992). Notably, in contrast to animal Na+/Ca2+ exchangers, AtMHX is incapable of transporting Ca2+ ions, but can serve as an electrogenic exchanger of protons with Mg2+, Zn2+ and Fe2+ ions. The ...
Complete information for SCAX3 gene (Genetic Locus), Spinocerebellar Ataxia, X-Linked 3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
In article ,2q6job$21t at news.iastate.edu,, Bipin K Dalmia ,bipin at iastate.edu, wrote: ,im trying to purify a protein expressed in e. coli. there is tons of it ,in the soluble extract. the pI is about 9.5. so naturally i tried using ,a cation exchanger at pH 6.5 but my protein flows right thru it. ive ,checked the ionic strengths etc. and they look good. the resin was ,properly equilibrated too. im using bio-rads biorex-70 resin in the ,sodium form and eluting with a gradient of NaCl. , ,any clues? , ,bip ,-- ,bipin k. dalmia the other night i was lying on my bed, looking ,bipin at iastate.edu up at the beautiful stars, and i said to myself, ,n2.bkd at isumvs.iastate.edu where the F*CK is my ROOF !! ,-- Frequently this is due to nucleic acids contaminating a prep. Basic proteins stay tightly bound and their charge is thus masked and the protein flows through. If you have not already treated your extract to remove nucleic acids you might consider: PEI precipitation in high salt (0.5M) to ...
Bacterial pathogens that are multi-drug resistant compromise the effectiveness of treatment when they are the causative agents of infectious disease. These multi-drug resistance mechanisms allow bacteria to survive in the presence of clinically useful antimicrobial agents, thus reducing the efficacy of chemotherapy towards infectious disease. Importantly, active multi-drug efflux is a major mechanism for bacterial pathogen drug resistance. Therefore, because of their overwhelming presence in bacterial pathogens, these active multi-drug efflux mechanisms remain a major area of intense study, so that ultimately measures may be discovered to inhibit these active multi-drug efflux pumps.
Use shRNA set against Human SLC35E1(NM_024881.4) for fast, easy, and consistent DNA/RNA Purification, Antibody/Protein Purification, Cell Isolation.
Read writing from Cait Mack on Medium. Helping you improve incrementally until the day you die. Acclaimed critically. Every day, Cait Mack and thousands of other voices read, write, and share important stories on Medium.
Famodez VNX 150 - washing and cleaning of any acid and waterproof surfaces in the kitchen. Buy Famidez VNX 150 in MEGA-SPECTR manufacturer DesoMark.
Mitsue Y Yamaguchi PHD is a Psychologist who practices in Torrance, CA. Get a full report about this doctors background by clicking here.
Mustafa etin, Sinan Altan Kocaman, Turan Erdo an, Murtaza Emre Durako lugil, Y ksel i ek, ahin Bozok, Aytun anga, Ahmet Temiz, S tk Do an, mer at ro ...
购买SLC35D1兔多克隆抗体(ab106523),SLC35D1抗体经WB验证,可与人,小鼠,大鼠样本反应。产品出库一年都在质保范围内。中国现货速达。
TY - JOUR. T1 - Angiotensin-I converting enzyme (ACE) gene polymorphism and the erythrocyte sodium-lithium countertransport in hypertension (multiple letters) [2]. AU - Delanghe, J.. AU - De Buyzere, M.. AU - Wuyts, B.. AU - Tournoy, K.. AU - Duprez, D.. AU - Clement, D.. AU - Hardman, T.. AU - Lant, A.. AU - Wierzbicki, A.. PY - 1997. Y1 - 1997. UR - http://www.scopus.com/inward/record.url?scp=0030912115&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=0030912115&partnerID=8YFLogxK. M3 - Letter. C2 - 9185032. AN - SCOPUS:0030912115. VL - 11. SP - 251. EP - 252. JO - Journal of Human Hypertension. JF - Journal of Human Hypertension. SN - 0950-9240. IS - 4. ER - ...
Shop Vacuolar cation/proton exchanger ELISA Kit, Recombinant Protein and Vacuolar cation/proton exchanger Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
298093376 - EP 0868212 B1 2000-06-21 - PROCESS FOR THE PREPARATION OF FREE-FLOWING OR TEMPORARILY FREE-FLOWING VERY ACIDIC CATION EXCHANGERS - [origin: WO9723282A2] The invention relates to a process for the preparation of free-flowing end products of very acidic cation exchangers. The grain pile of end products of the very acidic cation exchangers produced in the process described in the patent application P 195 48 012.0 cannot flow freely. By adding linking wetting agents or water-soluble initiators or tensides during polymerisation or after filtration of the end product and/or by taking technical measures, the grain pile of the very acidic cation exchangers is able to flow freely permanently or temporarily using the following process: (1) by adding to the copolymerisation system, known wetting agents in quantities of up to 0.25 g/l of the aqueous phase or water-soluble initiators in quantities of from 0.05 to 20 g/l of the aqueous phase 20 to 120 minutes after reaching the point of gelification; (2)
anti-Solute Carrier Family 9, Subfamily A (NHE3, Cation Proton Antiporter 3), Member 3 Regulator 1 (SLC9A3R1) (Ala140) antibody ABIN328934 from antibodies-online
We studied 42 white subjects with normal glucose tolerance and microalbuminuria and 79 with normoalbuminuria. Because we were studying healthy subjects on two occasions over a period of 3 years and needed to maximize subject compliance, we estimated AER both at screening and at recall on two rather than three collections, as would be usual in diabetic patients. In consequence, we used for our main classification of microalbuminuria an AER of 20 to 200 μg/min on either or both collections. We found that only 29% of individuals identified as microalbuminuric at screening remained so at follow-up, while 15% of normoalbuminuric subjects changed category. Microalbuminuria is thus a highly unstable variable in nondiabetic subjects. Nevertheless, we have previously shown it to be powerfully related to cardiovascular risk in this population.6 These observations suggest that, allowing for biological variability, the relationship between microalbuminuria (or its genetic or environmental determinants) and ...
In the present study, we found that the C-1 carboxylic acid group was essential for optimal substrate binding to the FP receptor. Replacement of the carboxylic acid group by larger moieties with a similar pK a, such as acylsulfonamide and tetrazole, substantially decreased binding affinity. The prostaglandin transporter PGT, on the other hand, recognized a fairly wide range of anionic substrates at C-1. In contrast, insertion of cyclic substituents in the omega chain increased binding to the FP receptor but reduced affinity for PGT, and substitution for the 15-hydroxyl group produced only a modest reduction in FP receptor binding but eliminated binding by PGT.. Prostaglandins and thromboxanes bind to a number of structurally diverse molecules, such as their cell-surface receptors (EP, FP, IP, DP, and TP) (Breyer et al., 1996a), the prostaglandin transporter PGT (Itoh et al., 1996), peroxisome proliferator-activated receptors α and γ (Forman et al., 1995; Kliewer et al., 1995), and ...
zeosphere phases are fully porous silica gels in spherical shape zeosphere drp mixed-mode silica gels are reversed phase chromatography gels merged with different amounts of strong anion exchanger a or strong cation exchanger c both ionic and
Predicted to have potassium:proton antiporter activity and sodium:proton antiporter activity. Involved in flagellated sperm motility. Localizes to the motile cilium. Orthologous to human SLC9C1 (solute carrier family 9 member C1 ...
In order to remove tumor necrosis factor α (TNFα) or/and bacterial lipopolysaccharides (LPS, endotoxin) extracorporeally from whole blood or/and blood plasma in an extracorporeal perfusion system, the blood or plasma is passed over a cation exchanger and an anion exchanger material. A device according to the invention for the extracorporeal treatment of patients blood or plasma therefore contains a cation exchanger material and an anion exchanger material wherein these materials are contained in at least one compartment of an extracorporeal perfusion system.
The over-expression of Arabidopsis CAX1 and CAX2 causes transgenic tomato plants to reveal severe Ca2+ deficiency-like symptoms such as tip-burn and/or blossom end rot, despite there being sufficient
Autor: Călinescu, Octavian et al.; Genre: Zeitschriftenartikel; Im Druck veröffentlicht: 2014; Keywords: Archaea; Electrophysiology; Membrane Transport; pH Regulation; Sodium Proton Exchange; EcNhaA; MjNhaP1; Cation Proton Antiporter; Solid Supported Membrane; Titel: Keeping It Simple, Transport Mechanism and pH Regulation in Na+/H+
Precise regulation of calcium transporters is essential for modulating the Ca2+ signaling network that is involved in the growth and adaptation of all organisms. The Arabidopsis H+/Ca2+ antiporter, CAX1, is a high capacity and low affinity Ca2+ transporter and several CAX1-like transporters are foun …
Saccharomyces cerevisiae cells possess an alkali metal cation antiporter encoded by the NHA1 gene. Nha1p is unique in the family… Expand ...
mouse Slc16a7 protein: a monocarboxylate transporter; transports pyruvate and lactate; 60% identical to hamster MCT1; expressed in different cells than MCT1; RefSeq NM_011391
Has sugar-induced sodium-independent electrogenic activity. Generation of glucose-induced inward currents is pH-dependent, with activity in acidic conditions (pH 5) but not neutral conditions. Does not have sugar transport activity.
Using a variety of programs available online, including the Oligator and Optimoose, we were able to formulate a plan that would enable us to synthesize various optimized and deoptimized versions of the TetA gene. We relied on codon bias, the differences in frequency of occurrence of synonymous codons in coding DNA, to allow for varying expression levels of TetA in the cell. By using natural enzyme sites within TetA, we were able to conduct restriction digests on TetA that allowed us to alter roughly 150 base pairs within each segment using codon bias with a total of four segments available. The TetA vector that was used to synthesize segment 1 clones was digested with EcoRI and NheI. The TetA vector that was used to synthesize segment 2 clones was digested with NheI and BamHI. This gave us the ability to insert roughly 144 bp for each segment that were optimized or deoptimized using codon bias. These inserts were fairly large and thus were synthesized by annealing oligos. These annealed oligos ...
Using a variety of programs available online, including the Oligator and Optimoose, we were able to formulate a plan that would enable us to synthesize various optimized and deoptimized versions of the TetA gene. We relied on codon bias, the differences in frequency of occurrence of synonymous codons in coding DNA, to allow for varying expression levels of TetA in the cell. By using natural enzyme sites within TetA, we were able to conduct restriction digests on TetA that allowed us to alter roughly 150 base pairs within each segment using codon bias with a total of four segments available. The TetA vector that was used to synthesize segment 1 clones was digested with EcoRI and NheI. The TetA vector that was used to synthesize segment 2 clones was digested with NheI and BamHI. This gave us the ability to insert roughly 144 bp for each segment that were optimized or deoptimized using codon bias. These inserts were fairly large and thus were synthesized by annealing oligos. These annealed oligos ...
Shop Leucine efflux protein ELISA Kit, Recombinant Protein and Leucine efflux protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Rabbit anti Human SLC5A9 antibody recognizes sodium dependent glucose transporter 4 (SGLT4), also known as SLC5A9, a ~76 kDa member o
Complete information for VCX3B gene (Protein Coding), Variable Charge, X-Linked 3B, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Immunology , CM agarose Fast Flow is a weak cation exchanger based on the well established agarose Fast Flow ion exchange platform, e...
Cleanert Alumina A sorbent (pH = 4.5) can be used as a strong polar absorbent or a mild cation exchanger. This sorbent is processed with a special deactivation procedure which ensures high analytes recovery. ...
SLC9A1 (NHE1), a member of the Na+/H+ exchanger family, is a ubiquitous membrane protein that regulates intracellular pH and cell volume. Furthermore, SLC9A1 is known to
Teary-eyed and his voice shaking, pop star Tatsuya Yamaguchi apologized Thursday for kissing and engaging in indecent behavior with a high school-aged girl in a career-crushing scandal leading to his indefinite suspension from show business. I will spend my days taking a hard look at ... ...
This site uses cookies for analytics, personalized content and ads. By continuing to browse this site, you agree to this use. Learn more ...
Plasmid pDONR221_SLC25A31 from Dr. Giulio Superti-Furgas lab contains the insert SLC25A31. This plasmid is available through Addgene.
Plasmid pDONR221_SLC2A3 from Dr. Giulio Superti-Furgas lab contains the insert SLC2A3. This plasmid is available through Addgene.
Porters (uniporters, symporters, antiporters)[edit]. *Mitochondrial carrier proteins. *Major Facilitator Superfamily (Glycerol- ...
Na+/H+ antiporter A (NhaA) family (TC# 2.A.33) contains a number of bacterial sodium-proton antiporter (SPAP) proteins. These ... Sodium-Proton antiporter Antiporter Transporter Classification Database Williams KA, Geldmacher-Kaufer U, Padan E, Schuldiner S ... antiporter participates in the periplasmic cation passage and pH regulation of the antiporter". Journal of Molecular Biology. ... Na+-H+ antiporters are integral membrane proteins that exchange Na+ for H+ across the cytoplasmic membrane and many ...
Antiporter Symporter Cammack, Richard; Atwood, Teresa; Campbell, Peter; Parish, Howard; Smith, Anthony; Vella, Frank; Stirling ... Wolfersberger, MG (November 1994). "Uniporters, Symporters and Antiporters". J Exp Biol. 196: 5-6. PMID 7823043. Hoppe, U. ( ...
An example of an antiporter mediated transport protein is the sodium-calcium antiporter, a transport protein involved in ... This transport protein is an antiporter system because it transports three sodium ions across the plasma membrane in exchange ... WOLFERSBERGER, MICHAEL (1994). "UNIPORTERS, SYMPORTERS AND ANTIPORTERS" (PDF). Department of Biology, Temple University, ...
In an antiporter two species of ion or other solutes are pumped in opposite directions across a membrane. One of these species ... In an antiporter, one substrate is transported in one direction across the membrane while another is cotransported in the ... This antiporter mechanism is important within the membranes of cardiac muscle cells in order to keep the calcium concentration ... An example is the sodium-calcium exchanger or antiporter, which allows three sodium ions into the cell to transport one calcium ...
2.A: Porters (uniporters, symporters, antiporters), SLCs. Excitatory amino acid transporters (EAATs) EAAT1 EAAT2 EAAT3 EAAT4 ...
A Proton gradient moves the ions into the vacuole by proton-sodium antiporter or the proton-calcium antiporter. In plants, ... Antiporters and symporters both transport two or more different types of molecules at the same time in a coupled movement. An ... In contrast to antiporters, symporters move ions or molecules in the same direction. In this case both ions being transported ... The AE1 antiporter is essential in the removal of carbon dioxide waste that is converted to bicarbonate inside the erythrocyte ...
ClCF proteins have been shown to function as fluoride-specific fluoride/proton antiporters. The three-dimensional structure of ... "Fluoride resistance and transport by riboswitch-controlled CLC antiporters". Proc Natl Acad Sci U S A. 109 (38): 15289-15294. ...
... glucose-6-phosphate antiporters". PLOS ONE. 6 (9): e23157. doi:10.1371/journal.pone.0023157. PMC 3176764. PMID 21949678. ...
... inorganic phosphate antiporter, transporting glucose 6-phosphate from the cytoplasm into the lumen of the ER, while ... glucose-6-phosphate antiporters". PLOS ONE. 6 (9): e23157. Bibcode:2011PLoSO...623157P. doi:10.1371/journal.pone.0023157. PMC ...
"Entrez Gene: MATE2 H+/organic cation antiporter". Morita Y, Kodama K, Shiota S, Mine T, Kataoka A, Mizushima T, Tsuchiya T ( ... NorM seems to function as drug/sodium antiporter which is the first example of Na+-coupled multidrug efflux transporter ... organic cation antiporters". Biochemical Pharmacology. 74 (2): 359-71. doi:10.1016/j.bcp.2007.04.010. hdl:2433/124277. PMID ... "Identification and functional characterization of a new human kidney-specific H+/organic cation antiporter, kidney-specific ...
malate-alpha-ketoglutarate antiporter in the inner membrane. glutamate-aspartate antiporter in the inner membrane. The primary ... The second antiporter (the glutamate-aspartate antiporter) imports glutamate from the cytosol into the matrix and exports ... Once malate is formed, the first antiporter (malate-alpha-ketoglutarate) imports the malate from the cytosol into the ...
Specifically, he focuses on the multidrug antiporter EmrE. Investigation of its subunit structure led the Schuldiner Group to ... an electrogenic antiporter from Escherichia coli. J. Biol. Chem. 268, 5382-5387 Schuldiner, S., Shirvan, A., Stern-Bach, Y., ...
See: Sodium-proton antiporter Non-contrast helical CT. See computed tomography This disambiguation page lists articles ...
Antiporters also use the concentration gradient of one molecule to move another up its concentration gradient but the coupled ... There are different types of transporters including, pumps, uniporters, antiporters, and symporters. Active transporters or ion ...
Sodium-Proton antiporter Antiporter Transporter Classification Database Prakash, Shraddha; Cooper, Garret; Singhi, Soumya; ... Biology portal As of this edit, this article uses content from "2.A.34 The NhaB Na+:H+ Antiporter (NhaB) Family", which is ... The E. coli NhaB is 58% identical to the orthologous Vibrio alginolyticus Na+/H+ antiporter. Although the latter protein is ... antiporter NhaB of Vibrio alginolyticus plays a role in its activity". Journal of Bacteriology. 183 (19): 5762-5767. doi: ...
It also appears to inhibit the cystine-glutamate antiporter. It is a codrug which is a combination of sulfapyridine and 5- ... Bridges, Richard J; Natale, Nicholas R; Patel, Sarjubhai A (1 January 2012). "System xc- cystine/glutamate antiporter: an ...
One is believed to be a Na+:H+ antiporter; the other is a malate·H+:lactate·Na+ antiporter. Several paralogues are found in ... Sodium-Proton antiporter Antiporter Transporter Classification Database Ivey, D. M.; Guffanti, A. A.; Bossewitch, J. S.; Padan ... Ito, M.; Guffanti, A. A.; Zemsky, J.; Ivey, D. M.; Krulwich, T. A. (1997-06-01). "Role of the nhaC-encoded Na+/H+ antiporter of ... Biology portal As of this edit, this article uses content from "2.A.35 The NhaC Na+:H+ Antiporter (NhaC) Family", which is ...
Sodium-Proton antiporter Antiporter Transporter Classification Database Barrero-Gil, Javier; Rodríguez-Navarro, Alonso; Benito ... The Amylolytica antiporter has low Na+ affinity and has optimal activity at 600 mM Na+. Homologues are found in proteobacteria ... Melo, Ana M. P.; Felix, Nuno A. M.; Carita, João N.; Saraiva, Lígia M.; Teixeira, Miguel (2006-09-29)."The Na+/H+ antiporter of ... Biology portal As of this edit, this article uses content from "2.A.62 The NhaD Na+:H+ Antiporter (NhaD) Family", which is ...
Nearly all Prevotella-2 RNAs occur upstream of genes that encode sodium/proton antiporters. These data suggest that the RNAs ... In this model, their association with sodium/proton antiporters would be a coincidence. Most Prevotella-2 RNAs are followed by ...
... serves as a substrate for the cystine-glutamate antiporter. This transport system, which is highly specific for cystine ...
Most commonly it is an antiporter of H+ and K+. In the past nigericin was used as an antibiotic active against gram positive ...
Thus, Fpn does not function as an iron/calcium antiporter. The thermodynamic driving force for Fpn remains unknown. In addition ...
Active transport is mainly through the sodium/hydrogen antiporter NHE3. Paracellular transport increases transport efficiency, ...
The NapA Na+/H+ antiporter of Enterococcus hirae (CPA2 family; TC #2.A.37) also appears to be distantly related to MadM. The ...
Gong S, Richard H, Foster JW (August 2003). "YjdE (AdiC) is the arginine:agmatine antiporter essential for arginine-dependent ... Iyer R, Williams C, Miller C (November 2003). "Arginine-agmatine antiporter in extreme acid resistance in Escherichia coli". ... Arginine decarboxylase works in tandem with arginine decarboxylase antiporters (AdiC), another component of AR3, that exchange ...
Meseguer I, Torreblanca M, Konishi T (1995). "Specific inhibition of the halobacterial Na+/H+ antiporter by halocin H6". ...
The structures of the sodium-independent carnitine/butyrobetaine antiporter CaiT from Proteus mirabilis (PmCaiT) (4M8J​) and ... product antiporter. The three-dimensional architecture of CaiT resembles that of the Na+-dependent transporters LeuT and BetP, ... "Arginine oscillation explains Na+ independence in the substrate/product antiporter CaiT". Proc. Natl. Acad. Sci. U.S.A. 110 (43 ... L-carnitine/gamma-butyrobetaine antiporter. Crystal structures of CaiT from E. coli and Proteus mirabilis revealed the inverted ...
"Mammalian integral membrane receptors are homologous to facilitators and antiporters of yeast, fungi, and eubacteria". Protein ...
... whereas either K+/H+ antiporters or Na+/H+ antiporters can be utilized by neutrophilic bacteria. If Na+/H+ antiporters are ... The most characterized method of active acidification is in the form of Na+/H+ antiporters. In this model, H+ ions are first ... This proton extrusion establishes a proton gradient that drives electrogenic antiporters-which drive intracellular Na+ out of ...
Cation/proton antiporters (CPAs) play a major role in maintaining living cells homeostasis and are divided in two main groups ... Cation/proton antiporters (CPAs) play a major role in maintaining living cells homeostasis. CPAs are commonly divided into two ... It is thus not surprising that cation/proton antiporters (CPAs) are prevalent in almost all living species. These antiporters ... antiporter activity67,68. The antiporter activity assay was based on the measurement of Na+- or Li+-induced changes in the ΔpH ...
Oxalate/formate antiporter (IPR026355). Short name: Oxa/Form_antiport Overlapping homologous superfamilies *MFS transporter ... In many of these cassettes, two subunits are found rather than one, suggesting the antiporter is sometimes homodimeric, ... Family members include the known oxalate/formate antiporter of Oxalobacter formigenes, as well as transporter subunits co- ...
Na+/H+ Antiporters Antiporters, such as Na+/H+ antiporter protein, allows ions H+ and Na+ to travel across a membrane in order ... Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Pak, J. E.; Ekende, E. N.; Kifle, E. G.; et ... These antiporters can also close their channel to stop sodium from entering the cell, along with allowing excess sodium within ... Na+/H+ antiporters have been reviewed. In secondary active transport, one species of solute moves along its electrochemical ...
antiporter synonyms, antiporter pronunciation, antiporter translation, English dictionary definition of antiporter. n biology a ... antiporter. Also found in: Medical, Encyclopedia, Wikipedia. antiporter. (ˈæntɪˌpɔːtə) n. (Biology) biology a membrane protein ... antiporter NHalp: Implications for its antiporter activity.. CHARACTERIZATION OF A WILD STRAIN OF Saccharomyces cerevisiae FOR ... Antiporter - definition of antiporter by The Free Dictionary https://www.thefreedictionary.com/antiporter ...
X. Gao, F. Lu, L. Zhou, S. Dang, L. Sun, X. Li, J. Wang, Y. Shi, Structure and mechanism of an amino acid antiporter. Science ... Gao et al. now report a crystal structure of AdiC, an arginine:agmatine antiporter from E. coli. AdiC exhibits the same fold as ... The structure, together with biochemical data, suggests how the antiporter senses the pH and responds to transport the reaction ...
Oxalate/formate antiporter family transporter (IPR004741). Short name: Oxa_For_antiport_fam_transptr ... Members include the oxalate/formate antiporter of Oxalobacter formigenes, where one substrate is decarboxylated in the cytosol ...
The Ca2+:cation antiporter (CaCA) family (TC# 2.A.19) is a member of the cation diffusion facilitator (CDF) superfamily. This ... The original text was at "2.A.19 The Ca2+:Cation Antiporter (CaCA) Family" Biology portal. ... H+ antiporter of E. coli and the sixth contains only one distant S. cerevisiae homologue of unknown function. Several ... "Isolation and functional characterization of Ca2+/H+ antiporters from cyanobacteria". The Journal of Biological Chemistry. 279 ...
Antiporters[edit]. An antiporter is an integral protein involved in secondary active transport, which couples the energy of a ... Antiporter, also called exchanger and counter-transporter, is an integral membrane protein that involves in a secondary active ... The antiporter simultaneously transports two molecules at the same time in the opposite direction. ... ATP-ADP translocase is one type of antiporter that assist in oxidative phosphorylation, a key component of cellular respiration ...
A gene encoding an Na+/H+ antiporter was cloned from chromosomal DNA of Vibrio parahaemolyticus, a slightly halophilic ... Li+ was also a substrate for this antiporter. Activity of this antiporter was pH-dependent with highest activity at pH 8.5 to 9 ... The NhaD is a unique Na+/H+ antiporter with respect to the primary structure compared with known Na+/H+ antiporters. ... A new Na+/H+ antiporter, NhaD, of Vibrio parahaemolyticus Biochim Biophys Acta. 1998 Mar 2;1369(2):213-20. doi: 10.1016/s0005- ...
... PLoS One. 2011;6(9):e23157. doi: 10.1371/journal.pone ... We show that SLC37A1 and SLC37A2 are ER-associated, P(i)-linked antiporters, that can transport G6P. Unlike G6PT, neither is ... We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. However, only G6PT/SLC37A4 ... Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to ...
Gene Ontology Term: potassium:proton antiporter activity. GO ID. GO:0015386 Aspect. Molecular Function. Description. Enables ... potassium:hydrogen antiporter activity View GO Annotations in other species in AmiGO ...
Step 1, substrate binding to the antiporter results in occlusion of primary substrate to the periplasm. Step 2, the antiporter ... GABA antiporter GadC (3, 4) and the Arg:Agm antiporter AdiC (5, 6) are at the center of the systems. ... cadaverine antiporter, CadB (9, 10); and the ornithine:putrescine antiporter, PotE (11-13). AdiC couples the influx of Arg with ... Structure and Mechanism of an Amino Acid Antiporter. By Xiang Gao, Feiran Lu, Lijun Zhou, Shangyu Dang, Linfeng Sun, Xiaochun ...
Molecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter.. Wang S1, Yan R1, Zhang X1, Chu Q1 ... Identification of Tyr74 as a critical pH sensor in the amino acid antiporter AdiC. (A) The primary amino acid sequence AdiC. ... The latter process is mediated by the Arg:Agm antiporter AdiC, which is activated in response to acidic pH and remains fully ... Molecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter ...
This protein was shown to belong to the drug/H+ antiporters (DHA12) of the major facilitator superfamily. This family is ... Characterization of a Na+/H+ antiporter gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 84:2615-2619. ... The new sequences along with VMAT form a distinct cluster within the dendrogram of the MFS, drug-proton antiporters. A ... Characterization of Bacterial Drug Antiporters Homologous to Mammalian Neurotransmitter Transporters. Eyal Vardy, Sonia Steiner ...
It is found that both the antiporter substrates and the antiporter inhibitor operate as recouplers when uncoupling is caused by ... It is concluded that uncoupling by FFA in rat liver mitochondria is mediated not only by the ATP/ADP antiporter but also by the ... Involvement of aspartate/glutamate antiporter in fatty acid-induced uncoupling of liver mitochondria.. Samartsev VN1, Smirnov ... Half-maximal effects are observed at concentrations of glutamate and aspartate close the K(m) values of the antiporter. ...
"Structure and mechanism of an amino acid antiporter.". Gao X., Lu F., Zhou L., Dang S., Sun L., Li X., Wang J., Shi Y.. Science ... "Structure and mechanism of an amino acid antiporter.". Gao X., Lu F., Zhou L., Dang S., Sun L., Li X., Wang J., Shi Y.. Science ... "Structure and mechanism of an amino acid antiporter.". Gao X., Lu F., Zhou L., Dang S., Sun L., Li X., Wang J., Shi Y.. Science ... "Structure and mechanism of an amino acid antiporter.". Gao X., Lu F., Zhou L., Dang S., Sun L., Li X., Wang J., Shi Y.. Science ...
Li TX, Zhang Y, Liu H, Wu YT, Li WB, Zhang HX (2010) Stable expression of Arabidopsis vacuolar Na+/H+ antiporter gene AtNHX1, ... Xu K, Hong P, Luo L, Xia T (2009) Overexpression of AtNHX1, a vacuolar Na+/H+ antiporter from Arabidopsis thaliana, in Petunia ... Shi H, Quintero FJ, Pardo JM, Zhu JK (2002) The putative plasma membrane Na+/H+ antiporters SOS1 controls long distance Na+ ... Salt tolerance Sodium/proton antiporter Photosynthesis Photosynthetic parameters This is a preview of subscription content, log ...
Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis. H E Takiff ... Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis ... Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis ... Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis ...
Na+/H+ antiporters are found in all kingdoms of life and exhibit catalysis rates that are among the fastest of all known ... Integrating mass spectrometry with MD simulations reveals the role of lipids in Na+/H+ antiporters. Landreh, Michael ... We speculate that elevator-type antiporters such as NapA, and likely NHA2, use a subset of annular lipids as structural support ... lipid-binding properties of the Na+/H+ exchanger NapA from Thermus thermophilus and compare this to the prototypical antiporter ...
... antiporter that extrudes sodium in exchange for external protons. Catalyzes the exchange of 3 H(+) per 2 Na(+). Has a high ... sodium:proton antiporter activity Source: EcoliWiki ,p>Inferred from Direct Assay,/p> ,p>Used to indicate a direct assay for ... "Lithium toxicity and Na+(Li+)/H+ antiporter in Escherichia coli.". Inaba K., Kuroda T., Shimamoto T., Kayahara T., Tsuda M., ... Na+/H+ antiporter that extrudes sodium in exchange for external protons. Catalyzes the exchange of 3 H+ per 2 Na+. Has a high ...
Hirschi KD, Zhen R-G, Cunningham KW, Rea PA, Fink GR (1996) CAX1, an H+/Ca2+ antiporter from Arabidopsis. Proc Natl Acad Sci ... Unlike 35S::sCAX1 construct, sCAX2A antiporter gene driven by 35S promoter can be a valuable tool for enriching Ca2+ contents ... Solanum lycopersicum Genetic transformation Cation/H+ antiporter Ca2+ nutrition Blossom-end rot Tip-burn ... Shigaki T, Pittman JK, Hirschi KD (2003) Manganese specificity determinants in the Arabidopsis metal/H+ antiporter CAX2. J Biol ...
TRAP-seq identifies cystine/glutamate antiporter as a driver of recovery from liver injury. ... TRAP-seq identifies cystine/glutamate antiporter as a driver of recovery from liver injury. ... Specifically, we found that glutathione metabolism, particularly the gene Slc7a11 encoding the cystine/glutamate antiporter ( ...
Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, ... Sodium-Hydrogen Exchanger; Sodium-Proton Antiporter; Antiporter, Sodium-Hydrogen; Antiporter, Sodium-Proton; Exchanger, Sodium- ... Hydrogen; Sodium Hydrogen Antiporter; Sodium Hydrogen Exchanger; Sodium Proton Antiporter; Na(+)-H(+)-Antiporter; Na(+)-H(+)- ... Sodium-Hydrogen Antiporter. Subscribe to New Research on Sodium-Hydrogen Antiporter A plasma membrane exchange glycoprotein ...
... cation antiporter activity pathways, according to their Panther/Gene Ontology Classification ...
GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores. Penny D. Thackray, Javad Behravan, Thomas ... GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores. Penny D. Thackray, Javad Behravan, Thomas ... GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores. Penny D. Thackray, Javad Behravan, Thomas ... GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores Message Subject (Your Name) has forwarded ...
The crystal structure, obtained at pH 4, of NhaA, the main antiporter of Escherichia coli, has provided general insights into ... an antiporter mechanism and its unique pH regulation. Here, we describe a general method to select various NhaA mutants from a ... pH and Na+ homeostasis in all cells requires Na+/H+ antiporters. ...
... antiporter explanation free. What is antiporter? Meaning of antiporter medical term. What does antiporter mean? ... Looking for online definition of antiporter in the Medical Dictionary? ... Antiporter , definition of antiporter by Medical dictionary https://medical-dictionary.thefreedictionary.com/antiporter ... antiporter. Also found in: Dictionary, Encyclopedia, Wikipedia. an·ti·por·ter. (antē-pōr-ter), A protein responsible for ...
antiporter activity. Known as: porter, exchange transporter activity, Antiport (More). Enables the active transport of a solute ... A Na+/H+ antiporter coded by the nhaA (ant) gene of Escherichia coli has been overproduced and purified. The amino-terminal… ( ... A cDNA coding a new H+/organic cation antiporter, human kidney-specific multidrug and toxin extrusion 2 (hMATE2-K), has been… ( ... The Cl-/H+ antiporter ClC-7 is the primary chloride permeation pathway in lysosomes ...
One strategy is mediated by cation-proton antiporters (CPA). CPA1 genes found in bacteria, fungi, metazoa and plants have been ... K+-efflux antiporter) and CHX (cation/H+ exchanger) families are largely unknown. Phylogenetic analysis showed that three ... One strategy is mediated by cation-proton antiporters (CPA). CPA1 genes found in bacteria, fungi, metazoa and plants have been ... functionally-characterized; though roles of plant CPA2 genes in KEA (K+-efflux antiporter) and CHX (cation/H+ exchanger) ...
  • AX09 displays robust and specific antibody response against cystine-glutamate antiporter system protein xCT (SLC7A11), which has been found to be overexpressed in cancer stem cells. (thefreedictionary.com)
  • It has been known that the cystine/glutamate antiporter is a plasma membrane-bound protein critically involved in glutamatergic transmission. (thefreedictionary.com)
  • AX09 is a virus-like particle that displays a portion of the extracellular domain of the cystine-glutamate antiporter system protein xCT (SLC7A11), which has been found to be overexpressed in cancer stem cells which have unique biological properties that represent a key cellular reservoir for relapse, metastatic progression, and therapeutic resistance. (thefreedictionary.com)
  • Specifically, we found that glutathione metabolism, particularly the gene Slc7a11 encoding the cystine/glutamate antiporter (xCT), is massively upregulated during liver regeneration. (jci.org)
  • Pharmacogenomic approach reveals a role for the x- cystine/glutamate antiporter in growth and celastrol resistance of glioma cell lines. (thefreedictionary.com)
  • 44), (45) Glutamate is regulated by a cystine/glutamate antiporter that exchanges extracellular cystine for intracellular glutamate. (thefreedictionary.com)
  • The aim of this thesis is to better understand the regulation of the cystine/glutamate antiporter (system xc-) and its role in regulating neuronal survival and death. (marquette.edu)
  • This indicates that the primary origin of in vivo extrasynaptic glutamate in the striatum arises from nonvesicular glutamate release by the cystine-glutamate antiporter. (jneurosci.org)
  • By measuring [ 35 S]cystine uptake, it was shown that similar to vesicular release, the activity of the cystine-glutamate antiporter is negatively regulated by group II metabotropic glutamate receptors (mGluR2/3) via a cAMP-dependent protein kinase mechanism. (jneurosci.org)
  • These results suggest that nonvesicular release from the cystine-glutamate antiporter is the primary source of in vivo extracellular glutamate and that this glutamate can modulate both glutamate and dopamine transmission. (jneurosci.org)
  • Pow, DV & Barnett, NL 2000, ' Aminoadipic acid transport: Probing the role of the cystine-glutamate antiporter in the retina ', Investigative Ophthalmology and Visual Science , vol. 41, no. 4, pp. (edu.au)
  • The most prominent functions, including pH regulation, are completed by Na+/H+ antiporter family NhaA in prokaryotes like Escherichia coli. (wikipedia.org)
  • A gene encoding an Na+/H+ antiporter was cloned from chromosomal DNA of Vibrio parahaemolyticus, a slightly halophilic bacterium, and expressed in Escherichia coli cells. (nih.gov)
  • Here we combine ion mobility mass spectrometry and molecular dynamics simulations to study the conformational stability and lipid-binding properties of the Na+/H+ exchanger NapA from Thermus thermophilus and compare this to the prototypical antiporter NhaA from Escherichia coli and the human homologue NHA2. (diva-portal.org)
  • Overproduction and purification of a functional Na+/H+ antiporter coded by nhaA (ant) from Escherichia coli. (semanticscholar.org)
  • A Na+/H+ antiporter coded by the nhaA (ant) gene of Escherichia coli has been overproduced and purified. (semanticscholar.org)
  • Escherichia coli NhaA is a prototype sodium-proton antiporter, which has been extensively characterized by X-ray crystallography, biochemical and biophysical experiments. (umd.edu)
  • Na^+)/H^+ antiporter ChaA from Escherichia coli also works as a K^+/H^+ antiporter and extrude K^+ against its chemical gradient. (nii.ac.jp)
  • Genes encoding Vc-NhaP1-3 were cloned and antiporters expressed in their functional form in an antiporter-less strains of Escherichia coli. (umanitoba.ca)
  • We cloned several genes encoding an Na + /H + antiporter of Staphylococcus aureus from chromosomal DNA by using an Escherichia coli mutant, lacking all of the major Na + /H + antiporters, as the host. (elsevier.com)
  • abstract = "We cloned several genes encoding an Na+/H+ antiporter of Staphylococcus aureus from chromosomal DNA by using an Escherichia coli mutant, lacking all of the major Na+/H+ antiporters, as the host. (elsevier.com)
  • Isolation and properties of a mutant of Escherichia coli possessing defective Na+/H+ antiporter. (elsevier.com)
  • A mutant of Escherichia coli with defective Na+/H+ antiporter was isolated. (elsevier.com)
  • Fingerprint Dive into the research topics of 'Isolation and properties of a mutant of Escherichia coli possessing defective Na+/H+ antiporter. (elsevier.com)
  • Involvement of aspartate/glutamate antiporter in fatty acid-induced uncoupling of liver mitochondria. (nih.gov)
  • Effects of aspartate, glutamate and an inhibitor of the aspartate/glutamate antiporter, diethylpyrocarbonate (DEPC), on uncoupling of the energy transduction processes in rat liver mitochondria have been investigated. (nih.gov)
  • It is concluded that uncoupling by FFA in rat liver mitochondria is mediated not only by the ATP/ADP antiporter but also by the aspartate/glutamate antiporter. (nih.gov)
  • Erasin, an oncogenic RAS-selective lethal compound, as well as the kinase inhibitor sorafenib have been identified to inhibit the cysteine-glutamate antiporter complex [x. (thefreedictionary.com)
  • An antiporter (also called exchanger or counter-transporter) is a cotransporter and integral membrane protein involved in primary active transport of two or more different molecules or ions across a phospholipid membrane such as the plasma membrane in opposite directions, one into the cell and one out of the cell. (wikipedia.org)
  • Family members include the known oxalate/formate antiporter of Oxalobacter formigenes, as well as transporter subunits co-clustered with the two genes of a system that decarboxylates oxalate into formate. (ebi.ac.uk)
  • antiporter is a secondary transporter that depends on the activity of AtPases the primary transporters. (thefreedictionary.com)
  • The glucose-6-phosphate transporter is a phosphate-linked antiporter deficient in glycogen storage disease type Ib and Ic. (thefreedictionary.com)
  • Antiporter , also called exchanger and counter-transporter , is an integral membrane protein that involves in a secondary active transporter of two or more different substrates (molecules or ions). (wikibooks.org)
  • Under these conditions the sodium/proton antiporter adopts an 'inward-open' state, where the substrate-binding site-the region where the ions bind to be transported-of the transporter is open towards the cell interior. (elifesciences.org)
  • We concluded that this Na + /H + antiporter functioned as a Na + transporter in the vacuolar membranes. (oup.com)
  • A transporter such as the antiporter shown can be considered a 'passive element': it does not supply any energy itself, but only transduces free energy stored in gradients. (physicallensonthecell.org)
  • structural biologists from the Max Planck Institute of Biophysics in Frankfurt succeeded in solving the structure of similar antiporters from microorganisms and then teamed up with theoretical biophysicists who unravelled the transport mechanism of this type of electroneutral transporter. (cef-mc.de)
  • Na+/H+ Antiporters Antiporters, such as Na+/H+ antiporter protein, allows ions H+ and Na+ to travel across a membrane in order to change a concentration gradient. (wikipedia.org)
  • An ORF (RWLH02992) similar to the chloramphenicol export proton antiporter (multidrug efflux system protein MtdL) was identified, as in other pathogenic E. (thefreedictionary.com)
  • An antiporter is an integral protein involved in secondary active transport, which couples the energy of a molecule moving down its concentration gradient to another moving up its concentration gradient. (wikibooks.org)
  • NHE3 is the sodium hydrogen antiporter 3, a protein essential in the absorption of sodium in the intestines. (thefreedictionary.com)
  • Energetics and topology of CzcA, a cation/proton antiporter of the resistance-nodulation-cell division protein family. (semanticscholar.org)
  • A Na + /H + antiporter-like protein (NHXLP) was isolated from Sorghum bicolor L. ( SbNHXLP ) and validated by overexpressing in tomato for salt tolerance. (frontiersin.org)
  • These data establish the putative V. cholerae NhaP1 protein as a functional K+(Na+)/H+ antiporter of the CPA1 family that is required for bacterial pH homeostasis and growth in an acidic environment. (oregonstate.edu)
  • We examined the expression and subcellular localization of antiporter regulating protein OsARP in a submergence tolerant rice ( Oryza sativa L .) cultivar FR13A. (ajol.info)
  • Extracellular determinants of anion discrimination of the Cl-/H+ antiporter protein CLC-5. (ox.ac.uk)
  • Recently, the monomeric structure of the prokaryotic Na + /Ca 2+ exchanger (NCX) antiporter NCX_Mj protein from Methanococcus jannaschii shows an outward-facing conformation suggesting a hypothesis of alternating substrate access for Ca 2+ efflux. (uni-konstanz.de)
  • To demonstrate conformational changes essential for the CaCA mechanism, we present the crystal structure of the Ca 2+ /H + antiporter protein YfkE from Bacillus subtilis at 3.1-Å resolution. (uni-konstanz.de)
  • antiporter protein YfkE from Bacillus subtilis at 3.1-Å resolution. (uni-konstanz.de)
  • We conclude that the increase in the V max of the Na + -H + antiporter in cultured VSMCs from the SHR, compared to those from WKY rats, is due, at least in part, to increased levels of NHE-1 protein. (ahajournals.org)
  • 1 An increase in the abundance of NHE-1 protein in cultured VSMCs from the SHR seems a likely mechanism for such an alteration and one that could also explain the elevated V max of the Na + -H + antiporter. (ahajournals.org)
  • These antiporters mediate the exchange of monovalent cations, mainly Na + and K + , with one or two protons across the membrane. (nature.com)
  • The molecular nature of Na+ sensors is still unclear, the plasma membrane Na+/H+ antiporter SOS1 (Salt Overly Sensitive1) is a possible candidate because its cytoplasmic end is assumed to be involved in Na+ sensing (Zhu, 2003). (thefreedictionary.com)
  • The ATPases generate a proton electrochemical gradient across the vacuolar membrane Na+/H+ antiporter , to compartmentalize Na+ into the vacuole (Chinnusamy et al. (thefreedictionary.com)
  • We speculate that elevator-type antiporters such as NapA, and likely NHA2, use a subset of annular lipids as structural support to facilitate large-scale conformational changes within the membrane. (diva-portal.org)
  • Dietary NaCl modulates Na+-H+ antiporter activity in renal cortical apical membrane vesicles. (thefreedictionary.com)
  • Our results demonstrate that NHX5 and NHX6 function in auxin-mediated plant development by maintaining PIN abundance at the plasma membrane, and provide new insight into the regulation of plant development by endosomal NHX antiporters. (deepdyve.com)
  • When functionally expressed in an antiporterless Eschefichia coli strain and assayed in everted membrane vesicles, Vc-NhaP1 operated as an electroneutral alkali cation/proton antiporter, exchanging K+ or Na+ ions for H+ within a broad pH range (7.25-9.0). (oregonstate.edu)
  • Research for function of antiporters and devices for membrane biogenesis using bacteria. (nii.ac.jp)
  • KEA3 is a thylakoid membrane localized K+/H+ antiporter that regulates photosynthesis by modulating two components of proton motive force (pmf), the proton gradient (δpH) and the electric potential (δψ). (ovid.com)
  • Antiporters typically use proton motive force to transport a substrate across the membrane. (ccbcmd.edu)
  • The tolerance/sensitivity of four pathogenic Candida species to alkali metal cations was tested and the role of one of the cation transporters in that tolerance (presumed to be the plasma-membrane Na + /H + antiporter) was studied. (biomedcentral.com)
  • Our results show that the activity of plasma-membrane Na + /H + antiporters is one of the factors determining the tolerance of pathogenic Candida species to high external concentrations of alkali metal cations. (biomedcentral.com)
  • Free energy stored in a non-equilibrium gradient of concentrations across a membrane can be used by an antiporter ('exchanger') to pump another molecule against its gradient. (physicallensonthecell.org)
  • The situation of a thermodynamic equilibrium of Na+ or K+ on the membrane would result in toxic intracellular levels of these cations, so bacteria have cation/proton antiporters, which expel excess of alkali cations at the expense of the proton motive force. (umanitoba.ca)
  • Although initially annotated as Na+/H+ antiporters, when assayed in everted membrane vesicles, all three isoforms of Vc-NhaP were shown to be K+/H+ antiporters with only limited ability to Na+/H+ antiport. (umanitoba.ca)
  • Cation-proton antiporters are membrane-embedded transport proteins involved in a wide range of essential cellular processes, from controlling pH and salt concentration to osmoregulation of the cell volume. (cef-mc.de)
  • In most organisms, cation/proton antiporters (CPAs) mediate the exchange of K + , Na + and Ca 2+ for H + across the membrane in response to a variety of environmental stimuli. (elsevier.com)
  • Mammalian CLC proteins comprise both Cl- channels and Cl-/H+ antiporters that carry out fundamental physiological tasks by transporting Cl- across plasma membrane and intracellular compartments. (ox.ac.uk)
  • Ca 2+ efflux by Ca 2+ cation antiporter (CaCA) proteins is important for maintenance of Ca 2+ homeostasis across the cell membrane. (uni-konstanz.de)
  • Since resistance often relies on the action of membrane transporters, including drug efflux pumps from the ATP-binding cassette family or from the Drug:H + antiporter (DHA) 1 family, an iTRAQ-based membrane proteomics analysis was performed to identify all the membrane-associated proteins whose abundance changes in C. glabrata cells exposed to the azole drug clotrimazole. (mcponline.org)
  • Functional characterization of this putative drug:H + antiporter, and of its homolog CgTpo1_1 (ORF CAGL0G03927g ), allowed the identification of these proteins as localized to the plasma membrane and conferring azole drug resistance in this fungal pathogen by actively extruding the drug to the external medium. (mcponline.org)
  • antiporter activity and an increase in intracellular pH have been reported after exposure to estrogen and estradiol (Ediger et al. (thefreedictionary.com)
  • According to one recent study, glutamate inhibits the xCT glutamatecystine antiporter , leading to intracellular cysteine depletion. (thefreedictionary.com)
  • A major component of AR is an arginine-dependent arginine:agmatine antiporter that expels intracellular protons. (sciencemag.org)
  • One approach to improving salt tolerance in crops is through high expression of the Arabidopsis gene AtNHX1 , which encodes a vacuolar sodium/proton antiporter that sequesters excess sodium ion into the large intracellular vacuole. (springer.com)
  • Intracellular Na + /H + (NHX) antiporters have important roles in cellular pH and Na + , K + homeostasis. (plantcell.org)
  • Another important role of cation/proton antiporters is homeostasis of intracellular cation content. (umanitoba.ca)
  • Because ClC5 acts as a chloride/proton exchanger when activated by positive voltages (Picollo and Pusch 2005), it is believed to play a critical role in the endosomal acidification as an antiporter by coupling chloride ion ([Cl. (thefreedictionary.com)
  • though roles of plant CPA2 genes encoding K + -efflux antiporter (KEA) and cation/H + exchanger (CHX) families are largely unknown. (frontiersin.org)
  • In plants, CPA1 includes the well-studied Na + -H + exchanger (NHX) family, and the relatively obscure CPA2 family that includes K + efflux Antiporter (KEA) and Cation-H + exchanger (CHX) families. (frontiersin.org)
  • Identification and functional characterization of a new human kidney-specific H+/organic cation antiporter, kidney-specific multidrug and toxin extrusion 2. (semanticscholar.org)
  • These results indicate that hMATE2-K is a new human kidney-specific H + /organic cation antiporter that is responsible for the tubular secretion of cationic drugs across the brush border membranes. (asnjournals.org)
  • However, attempts at molecular identification of the apical H + /organic cation antiporter have failed for more than a decade. (asnjournals.org)
  • Recently, in silico homology screening of the human cDNA database identified a H + /organic cation antiporter, human multidrug and toxin extrusion 1 (hMATE1), from the human brain using the NorM Na + /multidrug antiporter in Vibrio parahaemolyticus as a reference ( 12 ). (asnjournals.org)
  • Here, we report the crystal structure of AdiC, the arginine:agmatine antiporter from E. coli O157:H7 and a member of the amino acid/polyamine/organocation (APC) superfamily of transporters at 3.6 Å resolution. (sciencemag.org)
  • Structure of AdiC, an amino acid antiporter of the APC superfamily. (sciencemag.org)
  • Identification of Tyr74 as a critical pH sensor in the amino acid antiporter AdiC. (nih.gov)
  • Ilgü H, Jeckelmann J-M, Colas C, Ucurum Z, Schlessinger A, Fotiadis D. Effects of Mutations and Ligands on the Thermostability of the l -Arginine/Agmatine Antiporter AdiC and Deduced Insights into Ligand-Binding of Human l -Type Amino Acid Transporters. (mdpi.com)
  • The acidity range under which the two transporters are most active is different, indicating that minor changes in the amino acid sequence that make up their structure can have a substantial effect on the activity of these antiporters. (elifesciences.org)
  • The antiporter system x c - imports the amino acid cystine, the oxidized form of cysteine, into cells with a 1:1 counter-transport of glutamate. (syr.edu)
  • The gene enabled mutant E. coli cells, which were unable to grow in the presence of 10 mM LiCl (or 0.2 M NaCl) because of the lack of major Na+(Li+)/H+ antiporters, to grow under such conditions. (nih.gov)
  • sCAX1 construct, s CAX2A antiporter gene driven by 35S promoter can be a valuable tool for enriching Ca 2+ contents in the tomato fruit without additional accumulation of the undesirable cations. (springer.com)
  • A homologue of the grmA spore germination gene of Bacillus megaterium and of a NaH-antiporter gene ( napA ) of Enterococcus hirae has been identified in Bacillus cereus 569 (ATCC 10876). (asm.org)
  • Together with the yhjX gene product, a putative oxalate:formate antiporter , these three proteins are theoretically sufficient to provide E. (thefreedictionary.com)
  • Root specific expression of Na^+/H^+ antiporter gene from Synechocystis sp. (nii.ac.jp)
  • This mutant will be useful for cloning the Na+/H+ antiporter gene and for detection of Na+-substrate cotransport systems. (elsevier.com)
  • strain PCC 6803 contains five putative Na + /H + antiporters, two of which are homologous to NhaP of Pseudomonas aeruginosa and three of which are homologous to NapA of Enterococcus hirae . (asm.org)
  • We have cloned two genes encoding putative Na + /H + antiporters in C. parapsilosis and C. dubliniensis , and characterized the transport properties of encoded proteins. (biomedcentral.com)
  • As a result of a homology search, we found that components of the respiratory chain showed sequence similarity with putative subunits of the Na + /H + antiporter. (elsevier.com)
  • When pH within a cell is higher or lower than the optimal range it can be detrimental, therefore, the Na+/H+ antiporter detects the pH level out of range and is activated to transport ions as a homeostatic mechanism to bring the pH level back to optimal range. (wikipedia.org)
  • Transporters that are found in all organisms include the sodium/proton antiporters, which exchange protons from inside the cell with sodium ions from outside. (elifesciences.org)
  • uncovered the structure of the antiporter in the presence of sodium ions and in alkaline conditions. (elifesciences.org)
  • Energy for transport of the substance moving against it's concentration gradient is provided by the potential energy stored in the electrochemical gradient of sodium ions (Na + ) or protons (H + ). Cardiac muscle cells, for example, use an antiporter to co-transfer sodium ions and calcium ions. (ccbcmd.edu)
  • Na + /H + antiporters exchange sodium ions and protons on opposite sides of lipid membranes. (cef-mc.de)
  • Na + /H + antiporter that extrudes sodium in exchange for external protons. (uniprot.org)
  • Antiporters that exchange alkali cations (Na+ or K+) for protons play an important role in the physiology of all known bacterial species. (umanitoba.ca)
  • 1996) Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis. (thefreedictionary.com)
  • Na + /H + antiporters of alkaliphilic A. halophytica may play a crucial role in Na + efflux and in cytoplasmic pH homeostasis. (asm.org)
  • Below are the list of possible K(+) efflux antiporter products. (mybiosource.com)
  • Also known as K(+) efflux antiporter 1, chloroplastic (AtKEA1). (mybiosource.com)
  • Also known as K(+) efflux antiporter 4 (AtKEA4). (mybiosource.com)
  • Also known as K(+) efflux antiporter 5 (AtKEA5). (mybiosource.com)
  • Also known as K(+) efflux antiporter 6 (AtKEA6). (mybiosource.com)
  • Efflux permease CgAcr3-1 of Corynebacterium glutamicum is an arsenite-specific antiporter. (ac.be)
  • Therefore, we propose that CgAcr3-1 is an antiporter that catalyzes arsenite-proton exchange with residues Cys129 and Glu305 involved in efflux. (ac.be)
  • The observed difference in activity was confirmed by direct measurements of sodium and potassium efflux mediated by these antiporters. (biomedcentral.com)
  • Two clusters consist exclusively of animal proteins, a third contains several bacterial and archaeal proteins, a fourth possesses yeast, plant and blue green bacterial homologues, the fifth contains only the ChaA Ca2+:H+ antiporter of E. coli and the sixth contains only one distant S. cerevisiae homologue of unknown function. (wikipedia.org)
  • The high-resolution structures of two bacterial MFS proteins were solved: LacY, the lactose permease ( 1 ), and GlpT, the phosphate, glycerol 3-phosphate antiporter ( 10 ). (asm.org)
  • Among the many proteins responsible for bacterial survival under these diverse conditions, we have identified Vc-NhaP1 as a K+(Na+)/H+ antiporter essential for V. cholerae growth at low environmental pH. (oregonstate.edu)
  • CDF antiporters derived from a primordial 2 transmembrane spanner (TMS) hairpin structure by intragenic triplication to yield 6 TMS proteins. (springer.com)
  • 2018-08-01 00:00:00 Abstract In Arabidopsis thaliana, the endosomal-localized Na+/H+ antiporters NHX5 and NHX6 regulate ion and pH homeostasis and are important for plant growth and development. (deepdyve.com)
  • now report a crystal structure of AdiC, an arginine:agmatine antiporter from E. coli . (sciencemag.org)
  • The Glu:GABA antiporter GadC ( 3 , 4 ) and the Arg:Agm antiporter AdiC ( 5 , 6 ) are at the center of the systems. (sciencemag.org)
  • The latter process is mediated by the Arg:Agm antiporter AdiC, which is activated in response to acidic pH and remains fully active at pH 6.0 and below. (nih.gov)
  • Na+/H+ antiporters are found in all kingdoms of life and exhibit catalysis rates that are among the fastest of all known secondary-active transporters. (diva-portal.org)
  • Understanding how these transporters work is also medically relevant, as defects in related sodium/proton antiporters in humans are implicated in serious and life-threatening diseases. (elifesciences.org)
  • Thus, the physiologic roles of basolateral transporters of neutral AAs, such as the antiporter LAT2/CD98hc (SLC7A8/SLC3A2), a heterodimer that exports most neutral AAs, and the uniporter TAT1 (SLC16A10), which exports only aromatic AAs, remain unclear. (uzh.ch)
  • We determined the structures of the archaeal sodium/proton antiporter MjNhaP1 in two complementary states. (elifesciences.org)
  • To elucidate the transport mechanism in atomic detail, theoretical biophysicists Gerhard Hummer and Kei-ichi Okazaki from the Max Planck Institute of Biophysics performed extensive molecular dynamics simulations using structures of the archaeal Na + /H + antiporter PaNhaP, which Werner Kühlbrandt and colleagues had previously solved. (cef-mc.de)
  • There are three antiporters of NhaP type encoded in the genome of the dangerous human pathogen, Vibrio cholerae. (umanitoba.ca)
  • To correct the symptoms and to moderately enhance the calcium level, a worldwide vegetable tomato was genetically engineered using a modified Arabidopsis cation/H + antiporter sCAX2A, a mutant form of Arabidopsis CAX2. (springer.com)
  • Hirschi KD, Zhen R-G, Cunningham KW, Rea PA, Fink GR (1996) CAX1, an H + /Ca 2+ antiporter from Arabidopsis . (springer.com)
  • Here, we show that overexpression of the Arabidopsis thylakoid K+ /H+ antiporter KEA3 accelerates the relaxation of photoprotective energy-dependent quenching after transitions from high to low light in Arabidopsis and tobacco. (illinois.edu)
  • Members include the oxalate/formate antiporter of Oxalobacter formigenes, where one substrate is decarboxylated in the cytosol into the other to consume a proton and drive an ion gradient. (ebi.ac.uk)
  • Li+ was also a substrate for this antiporter. (nih.gov)
  • Molecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter. (nih.gov)
  • NAC is converted to cystine and allows for the uptake of cystine, a substrate for the glutamate-cystine antiporter causing the reverse transport of glutamate into the extracellular space. (thefreedictionary.com)
  • Of many antiporters described to date, the NhaP-type family is one of the most interesting groups. (umanitoba.ca)
  • We conclude that three of the four SLC37 family members are functional sugar-phosphate antiporters. (nih.gov)
  • The physiological and functional properties of NapA-type antiporters are largely unknown. (asm.org)
  • PaNhaP is a functional homologue of the human antiporter NHE1, which is an important drug target. (cef-mc.de)
  • In summary, the production of IL-12 p40 requires a functional Na+/H+ antiporter. (brighton.ac.uk)
  • Epithelial plasma membranes from crustacean gut, kidney and gills have been shown recently to display an electrogenic 2Na+/1H+ antiporter that differs considerably in its physiological properties from the vertebrate electroneutral 1Na+/1H+ exchange paradigm. (semanticscholar.org)
  • Kei-ichi Okazaki*, David Wöhlert, Judith Warnau, Hendrik Jung, Özkan Yildiz, Werner Kühlbrandt & Gerhard Hummer* (2019) Mechanism of the electroneutral sodium/proton antiporter PaNhaP from transition-path shooting. (cef-mc.de)
  • Rice ( Oryza sativa L.) is a salt-sensitive crop whose vacuolar antiporter is unknown. (oup.com)
  • The amount of antiporter in the vacuolar membranes may be one of the most important factors determining salt tolerance. (oup.com)
  • antiporter in root for salt tolerance in plant. (nii.ac.jp)
  • These findings indicate that A. halophytica has two NapA1-type antiporters which exhibit different ion specificities and play an important role in salt tolerance at alkaline pH. (asm.org)
  • Cp Cnh1p provided cells with a much higher salt tolerance than the Cd Cnh1 antiporter. (biomedcentral.com)
  • In many of these cassettes, two subunits are found rather than one, suggesting the antiporter is sometimes homodimeric, sometimes heterodimeric. (ebi.ac.uk)
  • Thus, it seems that the seven ORFs comprise an operon and that the Na + /H + antiporter consists of seven kinds of subunits, suggesting that this is a novel type of multisubunit Na + /H + antiporter. (elsevier.com)
  • 5)Transgenic Na^+/H^+ antiporter genes into photosynthetic bacteria and rice and made them Na^+ tolerant. (nii.ac.jp)
  • The genes encoding these antiporters in the most and least salt sensitive species, C. dubliniensis and C. parapsilosis respectively, were identified, cloned and functionally expressed in the plasma membranes of Saccharomyces cerevisiae cells lacking their own cation exporters. (biomedcentral.com)
  • antiporter NHalp: Implications for its antiporter activity. (thefreedictionary.com)
  • Activity of this antiporter was pH-dependent with highest activity at pH 8.5 to 9 and no activity at 7.0 to 7.5. (nih.gov)
  • Using reconstituted proteoliposomes, we examine the antiporter activity of the other SLC37 members along with their ability to couple with G6Pase-α. (nih.gov)
  • Structural and biochemical analysis reveals the essential ligand-binding residues, defines the transport route, and suggests a conserved mechanism for the antiporter activity. (sciencemag.org)
  • Endosomal NHX antiporter activity is required for wortmannin-induced LE/MVB swelling. (biologists.org)
  • Here we show for the Cl-/H+ antiporter CLC-5 that the conserved and extracellularly exposed Lys210 residue is critical to determine the anion specificity for transport activity. (ox.ac.uk)
  • The mutant had no appreciable Na+/H+ antiporter activity, but its K+/H+ antiporter and Ca2+/H+ antiporter activities were normal. (elsevier.com)
  • Cultured vascular smooth muscle cells (VSMCs) from the spontaneously hypertensive rat (SHR) exhibit increased activity of the Na + -H + antiporter as compared to normotensive Wistar-Kyoto (WKY) rats. (ahajournals.org)
  • 1 2 Increased activity of the Na + -H + antiporter in cultured VSMCs from the SHR likewise is observed in early passaged cells (passages 2 through 6) but not in cells grown in late subpassages (passages 7 through 10). (ahajournals.org)
  • Because the NHE-1 isoform of the antiporter is involved in the regulation of cell growth, the alterations in Na + -H + antiporter activity and cell proliferation observed in cultured VSMCs from the SHR may be interrelated. (ahajournals.org)
  • This finding suggests that the greater level of Na + -H + antiporter activity in cultured VSMCs from the SHR is due to a posttranscriptional alteration. (ahajournals.org)
  • CLC-5 is a chloride/proton antiporter which, in conjunction with the proton V-ATPase, allows progressive ionic gradients to be established in endocytic vesicles ensuring their continuation through the endosome-lysosome pathway. (endocrine-abstracts.org)
  • The Ca2+:cation antiporter (CaCA) family (TC# 2.A.19) is a member of the cation diffusion facilitator (CDF) superfamily. (wikipedia.org)
  • This family should not be confused with the Ca2+:H+ Antiporter-2 (CaCA2) Family (TC# 2.A.106) which belongs to the Lysine Exporter (LysE) Superfamily. (wikipedia.org)
  • Though predicted to play a role in this phenomenon, the drug:H + antiporters (DHA) of the major facilitator superfamily have largely escaped characterization in pathogenic yeasts. (asm.org)
  • In this project, Janice Robertson devised a new method based on liposome extrusion and single-molecule fluorescence photobleaching analysis to accurately measure the dimer association free energy of a ClC-type chloride ion/hydrogen ion antiporter. (brandeis.edu)
  • For the organisms to maintain homeostasis and carry out crucial functions, Na+/H+ antiporters are used to rid the cytoplasm of excess sodium by pumping Na+ out of the cell. (wikipedia.org)
  • Cation/proton antiporters (CPAs) play a major role in maintaining living cells' homeostasis. (nature.com)
  • Sodium/proton antiporters are essential for sodium and pH homeostasis and play a major role in human health and disease. (elifesciences.org)
  • CPA antiporters are conserved across all biological kingdoms and play crucial roles in pH, ion and volume homeostasis ( Padan, 2013 ). (elifesciences.org)
  • K(+)/H(+) antiporter involved in K(+) homeostasis and osmotic adjustment. (mybiosource.com)
  • K+/H+ antiporter involved in K+ homeostasis and osmotic adjustment. (mybiosource.com)
  • Encodes a K(+)/H(+) antiporter that modulates monovalent cation and pH homeostasis in plant chloroplasts or plastids. (mybiosource.com)
  • R:AGTTCAAGTCTGCCCCATTG bulgaricus Lactobacillus F: CCAGATCAGCCAACTTCACA Arginine- fermentum R: GGCAAACTTCAAGAGGACCA Ornitine antiporter Salmonella spp. (thefreedictionary.com)
  • Therefore, the Na+/H+ antiporter, but not the K+/H+ antiporter or the Ca2+/H+ antiporter, seems to be responsible for pH regulation in alkaline medium. (elsevier.com)
  • Role of the invertebrate electrogenic 2Na+/1H+ antiporter in monovalent and divalent cation transport. (semanticscholar.org)
  • Sodium and calcium share the electrogenic 2 Na(+)-1 H+ antiporter in crustacean antennal glands. (semanticscholar.org)
  • Cloning and Characterization of a Ca2+/H+ Antiporter from Halophyte Suaeda salsa L. (thefreedictionary.com)
  • One strategy is mediated by monovalent cation-proton antiporters (CPA) that are classified in two superfamilies. (frontiersin.org)
  • The antiporter had a K m of 10 mM for Na + and was competitively inhibited by amiloride and its analogues. (oup.com)
  • The amiloride-inhibitable Na+/H+ antiporter plays an important role in macrophage activation. (brighton.ac.uk)
  • The order of potency of amiloride analogs was consistent with the proposition that the effect of amiloride is mediated by the inhibition of the Na+/H+ antiporter. (brighton.ac.uk)
  • Two sets of affinity-purified antibodies (Ab (765-778) and Ab (698-711) ) against different epitopes of the NHE-1 isoform of the Na + -H + antiporter were used. (ahajournals.org)
  • Our model for proton transport suggests acid-excreting cells in the gill with an apical Na+/H+ antiporter and basolateral Na+/K+-ATPase. (edu.au)
  • 28 ) showed that a NaH antiporter homologue, named grmA , was important for the germination of spores of B. megaterium ATCC 12872 in any of its germinants (glucose, l -proline, l -leucine, or KNO 3 ). (asm.org)
  • Molecular Basis of CLC Antiporter Inhibition by Fluoride by some members of IAS-5 / INM-9 in collaboration with an internaltional team. (fz-juelich.de)
  • The molecular basis for the observed increase in V max of the Na + -H + antiporter in cultured VSMCs has not been defined. (ahajournals.org)
  • It is thus not surprising that cation/proton antiporters (CPAs) are prevalent in almost all living species. (nature.com)
  • antiporter , CAX1, enhances survival on soils with a low calcium to magnesium ratio (Bradshaw, 2005). (thefreedictionary.com)
  • have now examined the structure of a sodium/proton antiporter from a single-celled organism called Methanocaldococcus jannaschii , a species of archaea that thrives at high temperature. (elifesciences.org)