Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.Potassium-Hydrogen Antiporters: Membrane proteins that allow the exchange of hydrogen ions for potassium ions across the cellular membrane. The action of these antiporters influences intracellular pH and potassium ion homeostasis.Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.Zygosaccharomyces: A genus of ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES.Metals, Alkali: Metals that constitute group 1(formerly group Ia) of the periodic table. They are the most strongly electropositive of the metals. Note that HYDROGEN is not considered an alkali metal even though it falls under the group 1 heading in the periodic table.Lithium: An element in the alkali metals family. It has the atomic symbol Li, atomic number 3, and atomic weight [6.938; 6.997]. Salts of lithium are used in treating BIPOLAR DISORDER.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Cations, Monovalent: Positively charged atoms, radicals or group of atoms with a valence of plus 1, which travel to the cathode or negative pole during electrolysis.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Sodium Chloride: A ubiquitous sodium salt that is commonly used to season food.Alkalies: Usually a hydroxide of lithium, sodium, potassium, rubidium or cesium, but also the carbonates of these metals, ammonia, and the amines. (Grant & Hackh's Chemical Dictionary, 5th ed)Lithium Chloride: A salt of lithium that has been used experimentally as an immunomodulator.Cation Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.Proton Pumps: Integral membrane proteins that transport protons across a membrane. This transport can be linked to the hydrolysis of ADENOSINE TRIPHOSPHATE. What is referred to as proton pump inhibitors frequently is about POTASSIUM HYDROGEN ATPASE.Salts: Substances produced from the reaction between acids and bases; compounds consisting of a metal (positive) and nonmetal (negative) radical. (Grant & Hackh's Chemical Dictionary, 5th ed)Yarrowia: A genus of ascomycetous yeast in the family Dipodascaceae, order SACCHAROMYCETALES.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Ion Transport: The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.Potassium: An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Vacuoles: Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.Cations: Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.Hydrogen: The first chemical element in the periodic table. It has the atomic symbol H, atomic number 1, and atomic weight [1.00784; 1.00811]. It exists, under normal conditions, as a colorless, odorless, tasteless, diatomic gas. Hydrogen ions are PROTONS. Besides the common H1 isotope, hydrogen exists as the stable isotope DEUTERIUM and the unstable, radioactive isotope TRITIUM.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Protons: Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.Bacterial Proteins: Proteins found in any species of bacterium.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Chloride Channels: Cell membrane glycoproteins that form channels to selectively pass chloride ions. Nonselective blockers include FENAMATES; ETHACRYNIC ACID; and TAMOXIFEN.Proteolipids: Protein-lipid combinations abundant in brain tissue, but also present in a wide variety of animal and plant tissues. In contrast to lipoproteins, they are insoluble in water, but soluble in a chloroform-methanol mixture. The protein moiety has a high content of hydrophobic amino acids. The associated lipids consist of a mixture of GLYCEROPHOSPHATES; CEREBROSIDES; and SULFOGLYCOSPHINGOLIPIDS; while lipoproteins contain PHOSPHOLIPIDS; CHOLESTEROL; and TRIGLYCERIDES.Homeostasis: The processes whereby the internal environment of an organism tends to remain balanced and stable.Electron Transport Complex I: A flavoprotein and iron sulfur-containing oxidoreductase complex that catalyzes the conversion of UBIQUINONE to ubiquinol. In MITOCHONDRIA the complex also couples its reaction to the transport of PROTONS across the internal mitochondrial membrane. The NADH DEHYDROGENASE component of the complex can be isolated and is listed as EC 1.6.99.3.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Bacillus: A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Protein Structure, Secondary: The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Membrane Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Chlorides: Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.Genes, Bacterial: The functional hereditary units of BACTERIA.Fungal Proteins: Proteins found in any species of fungus.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Kinetics: The rate dynamics in chemical or physical systems.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Chloride-Bicarbonate Antiporters: Electroneutral chloride bicarbonate exchangers that allow the exchange of BICARBONATE IONS exchange for CHLORIDE IONS across the cellular membrane. The action of specific antiporters in this class serve important functions such as allowing the efficient exchange of bicarbonate across red blood cell membranes as they passage through capillaries and the reabsorption of bicarbonate ions by the kidney.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.

Inactivation of the glucose 6-phosphate transporter causes glycogen storage disease type 1b. (1/1325)

Glycogen storage disease type 1b (GSD-1b) is proposed to be caused by a deficiency in microsomal glucose 6-phosphate (G6P) transport, causing a loss of glucose-6-phosphatase activity and glucose homeostasis. However, for decades, this disorder has defied molecular characterization. In this study, we characterize the structural organization of the G6P transporter gene and identify mutations in the gene that segregate with the GSD-1b disorder. We report the functional characterization of the recombinant G6P transporter and demonstrate that mutations uncovered in GSD-1b patients disrupt G6P transport. Our results, for the first time, define a molecular basis for functional deficiency in GSD-1b and raise the possibility that the defective G6P transporter contributes to neutropenia and neutrophil/monocyte dysfunctions characteristic of GSD-1b patients.  (+info)

Topology of the membrane domain of human erythrocyte anion exchange protein, AE1. (2/1325)

Anion exchanger 1 (AE1) is the chloride/bicarbonate exchange protein of the erythrocyte membrane. By using a combination of introduced cysteine mutants and sulfhydryl-specific chemistry, we have mapped the topology of the human AE1 membrane domain. Twenty-seven single cysteines were introduced throughout the Leu708-Val911 region of human AE1, and these mutants were expressed by transient transfection of human embryonic kidney cells. On the basis of cysteine accessibility to membrane-permeant biotin maleimide and to membrane-impermeant lucifer yellow iodoacetamide, we have proposed a model for the topology of AE1 membrane domain. In this model, AE1 is composed of 13 typical transmembrane segments, and the Asp807-His834 region is membrane-embedded but does not have the usual alpha-helical conformation. To identify amino acids that are important for anion transport, we analyzed the anion exchange activity for all introduced cysteine mutants, using a whole cell fluorescence assay. We found that mutants G714C, S725C, and S731C have very low transport activity, implying that this region has a structurally and/or catalytically important role. We measured the residual anion transport activity after mutant treatment with the membrane-impermeant, cysteine-directed compound, sodium (2-sulfonatoethyl)methanethiosulfonate) (MTSES). Only two mutants, S852C and A858C, were inhibited by MTSES, indicating that these residues may be located in a pore-lining region.  (+info)

Functional importance and local environments of the cysteines in the tetracycline resistance protein encoded by plasmid pBR322. (3/1325)

The properties of the cysteines in the pBR322-encoded tetracycline resistance protein have been examined. Cysteines are important but not essential for tetracycline transport activity. None of the cysteines reacted with biotin maleimide, suggesting that they are shielded from the aqueous phase or reside in a negatively charged local environment.  (+info)

Na+/H+ antiporter activity in hamster embryos is activated during fertilization. (4/1325)

This study characterized the activation of the regulatory activity of the Na+/H+ antiporter during fertilization of hamster embryos. Hamster oocytes appeared to lack any mechanism for the regulation of intracellular pH in the acid range. Similarly, no Na+/H+ antiporter activity could be detected in embryos that were collected from the reproductive tract between 1 and 5 h post-egg activation (PEA). Activity of the Na+/H+ antiporter was first detected in embryos collected at 5.5 h PEA and gradually increased to reach maximal activity in embryos collected at 7 h PEA. Parthenogenetically activated one-cell and two-cell embryos demonstrate Na+/H+ antiporter activity, indicating that antiporter activity is maternally derived and initiated by activation of the egg. The inability of cycloheximide, colchicine, or cytochalasin D to affect initiation of antiporter activity indicates that antiporter appearance is not dependent on the synthesis of new protein or recruitment of existing protein to the cell membrane. In contrast, incubation of one-cell embryos with sphingosine did inhibit the appearance of Na+/H+ antiporter activity, showing that inhibition of normal protein kinase C activity is detrimental to antiporter function. Furthermore, incubation of oocytes with a phorbol ester which stimulates protein kinase C activity induced Na+/H+ antiporter activity in oocytes in which the activity was previously absent. Incubation with an intracellular calcium chelator also reduced the appearance of antiporter activity. Taken together, these data indicate that the appearance of Na+/H+ antiporter activity following egg activation may be due, at least in part, to regulation by protein kinase C and intracellular calcium levels.  (+info)

Non-selective voltage-activated cation channel in the human red blood cell membrane. (5/1325)

Using the patch-clamp technique, a non-selective voltage-activated Na+ and K+ channel in the human red blood cell membrane was found. The channel operates only at positive membrane potentials from about +30 mV (inside positive) onwards. For sodium and potassium ions, similar conductances of about 21 pS were determined. Together with the recently described K+(Na+)/H+ exchanger, this channel is responsible for the increase of residual K+ and Na+ fluxes across the human red blood cell membrane when the cells are suspended in low ionic strength medium.  (+info)

Prospective analysis of traits related to 6-year change in sodium-lithium countertransport. Gubbio Population Study Research Group. (6/1325)

Sodium-lithium countertransport (Na-Li CT) activity in red blood cells relates cross-sectionally and longitudinally to blood pressure and hypertension. Lifestyle and metabolic factors relate cross-sectionally to this sodium transporter. The aim of this study was to conduct a prospective analysis of 6-year Na-Li CT change and of traits related to Na-Li CT change. In 2183 participants in the Gubbio Population Study (972 men and 1211 women; baseline ages, 18 to 74 years), the following data collected at baseline and 6-year follow-up were analyzed: Na-Li CT; gender; age; body mass index (BMI); blood pressure; antihypertensive treatment; alcohol intake; smoking habits; urinary sodium-to-potassium ratio; and plasma cholesterol, glucose, uric acid, sodium, potassium, and triglycerides (measured only at follow-up). Six-year changes were defined as follow-up minus baseline values. Na-Li CT was higher at follow-up than at baseline in both genders (P<0.001). Baseline Na-Li CT; baseline and change values of BMI; and change values of alcohol intake, plasma potassium, and plasma glucose related to Na-Li CT change significantly and independently with control for other variables. Follow-up plasma triglyceride levels also related independently to Na-Li CT change. Coefficients were positive for BMI, alcohol intake, and plasma glucose and triglyceride levels and were negative for baseline Na-Li CT and plasma potassium levels. Baseline and change values of other variables did not relate significantly to Na-Li CT change. In conclusion, in prospective analyses, BMI, alcohol intake, plasma glucose, and lipids were directly related to Na-Li CT change; baseline Na-Li CT and plasma potassium levels were inversely related. The data support the concept that lifestyle and related metabolic factors influence Na-Li CT.  (+info)

Peptide-bound major histocompatibility complex class I molecules associate with tapasin before dissociation from transporter associated with antigen processing. (7/1325)

Major histocompatibility complex (MHC) class I molecules present antigenic peptides to CD8 T cells. The peptides are generated in the cytosol, then translocated across the membrane of the endoplasmic reticulum by the transporter associated with antigen processing (TAP). TAP is a trimeric complex consisting of TAP1, TAP2, and tapasin (TAP-A) as indicated for human cells by reciprocal coprecipitation with anti-TAP1/2 and anti-tapasin antibodies, respectively. TAP1 and TAP2 are required for the peptide transport. Tapasin is involved in the association of class I with TAP and in the assembly of class I with peptide. The mechanisms of tapasin function are still unknown. Moreover, there has been no evidence for a murine tapasin analogue, which has led to the suggestion that murine MHC class I binds directly to TAP1/2. In this study, we have cloned the mouse analogue of tapasin. The predicted amino acid sequence showed 78% identity to human tapasin with identical consensus sequences of signal peptide, N-linked glycosylation site, transmembrane domain and double lysine motif. However, there was less homology (47%) found at the predicted cytosolic domain, and in addition, mouse tapasin is 14 amino acids longer than the human analogue at the C terminus. This part of the molecule may determine the species specificity for interaction with MHC class I or TAP1/2. Like human tapasin, mouse tapasin binds both to TAP1/2 and MHC class I. In TAP2-mutated RMA-S cells, both TAP1 and MHC class I were coprecipitated by anti-tapasin antiserum indicative of association of tapasin with TAP1 but not TAP2. With crosslinker-modified peptides and purified microsomes, anti-tapasin coprecipitated both peptide-bound MHC class I and TAP1/2. In contrast, anti-calreticulin only coprecipitated peptide-free MHC class I molecules. This difference in association with peptide-loaded class I suggests that tapasin functions later than calreticulin during MHC class I assembly, and controls peptide loading onto MHC class I molecules in the endoplasmic reticulum.  (+info)

Granulocyte-macrophage colony-stimulating factor modulates tapasin expression in human neutrophils. (8/1325)

Differential display-polymerase chain reaction (DD-PCR) was used to evaluate changes in mRNA expression of granulocyte-macrophage colony-stimulating factor (GM-CSF) treated human neutrophils to better understand how this cytokine affects the functions of neutrophils at the molecular level. Although a variety of cDNA fragments were identified as modulated by GM-CSF with the use of DD-PCR, one fragment in particular, NGS-17 (neutrophil GM-CSF-stimulated fragment #17), was characterized. The NGS-17 fragment hybridized to a 3.8-kh mRNA that encodes for a protein of a predicted molecular mass of 47.6 kDa. After cloning and sequencing, this gene was found to code for the recently sequenced tapasin or TAP-A protein. Immunoprecipitation and immunoblotting studies using anti-tapasin antibodies showed that tapasin is expressed in neutrophils and is associated with the MHC class I-TAP complex. Moreover, tapasin expression was found to be induced by dimethyl sulfoxide and by retinoic acid in HL-60 cells. This is the first report on the expression of tapasin in human neutrophils. It provides novel information, at the molecular level, on how GM-CSF enhances the functions of these cells.  (+info)

  • The gene enabled mutant E. coli cells, which were unable to grow in the presence of 10 mM LiCl (or 0.2 M NaCl) because of the lack of major Na+(Li+)/H+ antiporters, to grow under such conditions. (nih.gov)
  • sCAX1 construct, s CAX2A antiporter gene driven by 35S promoter can be a valuable tool for enriching Ca 2+ contents in the tomato fruit without additional accumulation of the undesirable cations. (springer.com)
  • A homologue of the grmA spore germination gene of Bacillus megaterium and of a NaH-antiporter gene ( napA ) of Enterococcus hirae has been identified in Bacillus cereus 569 (ATCC 10876). (asm.org)
  • Together with the yhjX gene product, a putative oxalate:formate antiporter , these three proteins are theoretically sufficient to provide E. (thefreedictionary.com)
  • Root specific expression of Na^+/H^+ antiporter gene from Synechocystis sp. (nii.ac.jp)
  • Molecular characterization and functional analysis of a vacuolar Na(+)/H(+) antiporter gene (HcNHX1) from Halostachys caspica. (qxmd.com)
  • Characterization and expression of a vacuolar Na(+)/H(+) antiporter gene from the monocot halophyte Aeluropus littoralis. (qxmd.com)
  • The ZxNHX gene encoding tonoplast Na(+)/H(+) antiporter from the xerophyte Zygophyllum xanthoxylum plays important roles in response to salt and drought. (qxmd.com)
  • Transgenic salt-tolerant sugar beet (Beta vulgaris L.) constitutively expressing an Arabidopsis thaliana vacuolar Na/H antiporter gene, AtNHX3, accumulates more soluble sugar but less salt in storage roots. (qxmd.com)
  • Incorporation of Na+/H+ antiporter gene from Aeluropus littoralis confers salt tolerance in soybean (Glycine max L. (bvsalud.org)
  • To develop a salt-tolerant soybean (Glycine max L.) cultivar, a minimal linear Na+/H+ antiporter gene cassette (35S CaMV promoter, open-reading-frame of AlNHX1 from Aeluropus littoralis and NOS terminator) was successfully expressed in soybean cultivar TF-29. (bvsalud.org)
  • strain PCC 6803 contains five putative Na + /H + antiporters, two of which are homologous to NhaP of Pseudomonas aeruginosa and three of which are homologous to NapA of Enterococcus hirae . (asm.org)
  • These data establish the putative V. cholerae NhaP1 protein as a functional K+(Na+)/H+ antiporter of the CPA1 family that is required for bacterial pH homeostasis and growth in an acidic environment. (oregonstate.edu)
  • We have cloned two genes encoding putative Na + /H + antiporters in C. parapsilosis and C. dubliniensis , and characterized the transport properties of encoded proteins. (biomedcentral.com)
  • Functional characterization of this putative drug:H + antiporter, and of its homolog CgTpo1_1 (ORF CAGL0G03927g ), allowed the identification of these proteins as localized to the plasma membrane and conferring azole drug resistance in this fungal pathogen by actively extruding the drug to the external medium. (mcponline.org)
  • Both these effects of insulin on TH and pH(i) were prevented by the 5-(N-methyl-N-(guanidinocarbonylmethyl) amiloride (MGCMA), a putative selective inhibitor of the Na+-H+ antiporter. (unimol.it)
  • An antiporter is an integral protein involved in secondary active transport, which couples the energy of a molecule moving down its concentration gradient to another moving up its concentration gradient. (wikibooks.org)
  • NHE3 is the sodium hydrogen antiporter 3, a protein essential in the absorption of sodium in the intestines. (thefreedictionary.com)
  • A Na + /H + antiporter-like protein (NHXLP) was isolated from Sorghum bicolor L. ( SbNHXLP ) and validated by overexpressing in tomato for salt tolerance. (frontiersin.org)
  • We examined the expression and subcellular localization of antiporter regulating protein OsARP in a submergence tolerant rice ( Oryza sativa L .) cultivar FR13A. (ajol.info)
  • Extracellular determinants of anion discrimination of the Cl-/H+ antiporter protein CLC-5. (ox.ac.uk)
  • Recently, the monomeric structure of the prokaryotic Na + /Ca 2+ exchanger (NCX) antiporter NCX_Mj protein from Methanococcus jannaschii shows an outward-facing conformation suggesting a hypothesis of alternating substrate access for Ca 2+ efflux. (uni-konstanz.de)
  • To demonstrate conformational changes essential for the CaCA mechanism, we present the crystal structure of the Ca 2+ /H + antiporter protein YfkE from Bacillus subtilis at 3.1-Å resolution. (uni-konstanz.de)
  • antiporter protein YfkE from Bacillus subtilis at 3.1-Å resolution. (uni-konstanz.de)
  • We conclude that the increase in the V max of the Na + -H + antiporter in cultured VSMCs from the SHR, compared to those from WKY rats, is due, at least in part, to increased levels of NHE-1 protein. (ahajournals.org)
  • 1 An increase in the abundance of NHE-1 protein in cultured VSMCs from the SHR seems a likely mechanism for such an alteration and one that could also explain the elevated V max of the Na + -H + antiporter. (ahajournals.org)
  • To examine the role of protein kinase C as a chronic regulator of proximal tubule Na/H antiporter activity, the effect of phorbol 12-myristate 13-acetate (PMA) on the Na/H antiporter was studied in cultured proximal tubule cells. (elsevier.com)
  • Short-term activation of protein kinase C by 5 min exposure to PMA caused an acute increase in Na/H antiporter activity that was not prevented by cycloheximide or actinomycin D and did not persist 24 h later. (elsevier.com)
  • Long-term activation of protein kinase C by 2 h exposure to PMA caused a dose-dependent increase in Na/H antiporter activity 24 h later. (elsevier.com)
  • In conclusion, short-term activation of protein kinase C leads to a transient increase in Na/H antiporter activity that is independent of transcription and translation, whereas long-term activation of protein kinase C causes a persistent increase in antiporter activity that is dependent on transcription and translation and is associated with increased mRNA Na/H abundance. (elsevier.com)
  • Two clusters consist exclusively of animal proteins, a third contains several bacterial and archaeal proteins, a fourth possesses yeast, plant and blue green bacterial homologues, the fifth contains only the ChaA Ca2+:H+ antiporter of E. coli and the sixth contains only one distant S. cerevisiae homologue of unknown function. (wikipedia.org)
  • The high-resolution structures of two bacterial MFS proteins were solved: LacY, the lactose permease ( 1 ), and GlpT, the phosphate, glycerol 3-phosphate antiporter ( 10 ). (asm.org)
  • Among the many proteins responsible for bacterial survival under these diverse conditions, we have identified Vc-NhaP1 as a K+(Na+)/H+ antiporter essential for V. cholerae growth at low environmental pH. (oregonstate.edu)
  • CDF antiporters derived from a primordial 2 transmembrane spanner (TMS) hairpin structure by intragenic triplication to yield 6 TMS proteins. (springer.com)
  • The acidity range under which the two transporters are most active is different, indicating that minor changes in the amino acid sequence that make up their structure can have a substantial effect on the activity of these antiporters. (elifesciences.org)
  • it encoded a polypeptide of 401 amino acids and had a high (83%) homology to the tomato K+/H+antiporter, LeNHX2. (deepdyve.com)
  • In this project, Janice Robertson devised a new method based on liposome extrusion and single-molecule fluorescence photobleaching analysis to accurately measure the dimer association free energy of a ClC-type chloride ion/hydrogen ion antiporter. (brandeis.edu)
  • Na+/H+ antiporters are found in all kingdoms of life and exhibit catalysis rates that are among the fastest of all known secondary-active transporters. (diva-portal.org)
  • Thus, the physiologic roles of basolateral transporters of neutral AAs, such as the antiporter LAT2/CD98hc (SLC7A8/SLC3A2), a heterodimer that exports most neutral AAs, and the uniporter TAT1 (SLC16A10), which exports only aromatic AAs, remain unclear. (uzh.ch)
  • R:AGTTCAAGTCTGCCCCATTG bulgaricus Lactobacillus F: CCAGATCAGCCAACTTCACA Arginine- fermentum R: GGCAAACTTCAAGAGGACCA Ornitine antiporter Salmonella spp. (thefreedictionary.com)
  • abstract = "The amiloride-inhibitable Na+/H+ antiporter plays an important role in macrophage activation. (brighton.ac.uk)
  • Epithelial plasma membranes from crustacean gut, kidney and gills have been shown recently to display an electrogenic 2Na+/1H+ antiporter that differs considerably in its physiological properties from the vertebrate electroneutral 1Na+/1H+ exchange paradigm. (semanticscholar.org)
  • Two sets of affinity-purified antibodies (Ab (765-778) and Ab (698-711) ) against different epitopes of the NHE-1 isoform of the Na + -H + antiporter were used. (ahajournals.org)
  • 5)Transgenic Na^+/H^+ antiporter genes into photosynthetic bacteria and rice and made them Na^+ tolerant. (nii.ac.jp)
  • The genes encoding these antiporters in the most and least salt sensitive species, C. dubliniensis and C. parapsilosis respectively, were identified, cloned and functionally expressed in the plasma membranes of Saccharomyces cerevisiae cells lacking their own cation exporters. (biomedcentral.com)
  • The full-length cDNAs of two Karelinia caspica genes, KcNHX1 and KcNHX2, were isolated by RACE and RT-PCR based on the conserved regions of Na(+)/H(+) antiporter (NHX) genes from other halophyte species. (qxmd.com)
  • In many of these cassettes, two subunits are found rather than one, suggesting the antiporter is sometimes homodimeric, sometimes heterodimeric. (ebi.ac.uk)
  • Molecular Basis of CLC Antiporter Inhibition by Fluoride by some members of IAS-5 / INM-9 in collaboration with an internaltional team. (fz-juelich.de)
  • The molecular basis for the observed increase in V max of the Na + -H + antiporter in cultured VSMCs has not been defined. (ahajournals.org)
Transmembrane protein - Wikipedia
Transmembrane protein - Wikipedia (en.wikipedia.org)
Table of Contents - June 23, 2009, 2 (76) | Science Signaling
Table of Contents - June 23, 2009, 2 (76) | Science Signaling (stke.sciencemag.org)
Ab initio electron density determination directly from solution scattering data | Nature Methods
Ab initio electron density determination directly from solution scattering data | Nature Methods (nature.com)
Forschungszentrum Jülich  -  News
Forschungszentrum Jülich - News (fz-juelich.de)
Expression of an Arabidopsis sodium/proton antiporter gene ( AtNHX1) in peanut to improve salt tolerance | SpringerLink
Expression of an Arabidopsis sodium/proton antiporter gene ( AtNHX1) in peanut to improve salt tolerance | SpringerLink (link.springer.com)
Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis | PNAS
Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis | PNAS (pnas.org)
The Sodium-Hydrogen Exchanger | SpringerLink
The Sodium-Hydrogen Exchanger | SpringerLink (link.springer.com)
Roles of Staphylococcus aureus Mnh1 and Mnh2 Antiporters in Salt Tolerance, Alkali Tolerance, and Pathogenesis | Journal of...
Roles of Staphylococcus aureus Mnh1 and Mnh2 Antiporters in Salt Tolerance, Alkali Tolerance, and Pathogenesis | Journal of... (jb.asm.org)
Chemometrical-electrochemical investigation for comparing inhibitory effects of quercetin and its sulfonamide derivative on...
Chemometrical-electrochemical investigation for comparing inhibitory effects of quercetin and its sulfonamide derivative on... (bioportfolio.com)
Cellular Ca2+ Regulation | D. Pfeiffer | Springer
Cellular Ca2+ Regulation | D. Pfeiffer | Springer (springer.com)
Transporters and Pumps in Plant Signaling | Markus Geisler | Springer
Transporters and Pumps in Plant Signaling | Markus Geisler | Springer (springer.com)
Cellular Ca2 Plus Regulation by Douglas R. Pfeiffer,  Jeanie B. McMillin-Wood,  Steve Little | | 9780306429040 | Hardcover |...
Cellular Ca2 Plus Regulation by Douglas R. Pfeiffer, Jeanie B. McMillin-Wood, Steve Little | | 9780306429040 | Hardcover |... (barnesandnoble.com)
STAble: a novel approach to de novo assembly of RNA-seq data and its application in a metabolic model network based...
STAble: a novel approach to de novo assembly of RNA-seq data and its application in a metabolic model network based... (link.springer.com)
Advances in Genetics and Breeding of Salt Tolerance in Soybean | SpringerLink
Advances in Genetics and Breeding of Salt Tolerance in Soybean | SpringerLink (link.springer.com)
Membrane Proteome-Wide Response to the Antifungal Drug Clotrimazole in Candida glabrata: Role of the Transcription Factor...
Membrane Proteome-Wide Response to the Antifungal Drug Clotrimazole in Candida glabrata: Role of the Transcription Factor... (mcponline.org)
Frontiers | Variation in the Abundance of OsHAK1 Transcript Underlies the Differential Salinity Tolerance of an indica and a...
Frontiers | Variation in the Abundance of OsHAK1 Transcript Underlies the Differential Salinity Tolerance of an indica and a... (frontiersin.org)
Transport of diamines by Enterococcus faecalis is mediated by an agmatine-putrescine antiporter. | Journal of Bacteriology
Transport of diamines by Enterococcus faecalis is mediated by an agmatine-putrescine antiporter. | Journal of Bacteriology (jb.asm.org)
Zinc and insulin in pancreatic beta-cells | SpringerLink
Zinc and insulin in pancreatic beta-cells | SpringerLink (link.springer.com)
MrpA Functions in Energy Conversion during Acetate-Dependent Growth of Methanosarcina acetivorans | Journal of Bacteriology
MrpA Functions in Energy Conversion during Acetate-Dependent Growth of Methanosarcina acetivorans | Journal of Bacteriology (jb.asm.org)
Antibiotic resistance Flashcards by Isabel Leach | Brainscape
Antibiotic resistance Flashcards by Isabel Leach | Brainscape (brainscape.com)
Oncogenic PI3K promotes methionine dependency in breast cancer cells through the cystine-glutamate antiporter xCT | Science...
Oncogenic PI3K promotes methionine dependency in breast cancer cells through the cystine-glutamate antiporter xCT | Science... (stke.sciencemag.org)
Table of Contents - December 19, 2017, 10 (510) | Science Signaling
Table of Contents - December 19, 2017, 10 (510) | Science Signaling (stke.sciencemag.org)
Anti-Sodium / Hydrogen Exchanger 1 antibody (ab181479)
Anti-Sodium / Hydrogen Exchanger 1 antibody (ab181479) (abcam.com)
Natural Variation in the Multidrug Efflux Pump SGE1 Underlies Ionic Liquid Tolerance in Yeast | Genetics
Natural Variation in the Multidrug Efflux Pump SGE1 Underlies Ionic Liquid Tolerance in Yeast | Genetics (genetics.org)
Cystine - Wikipedia
Cystine - Wikipedia (en.wikipedia.org)
Frontiers | The Aging of Iron Man | Frontiers in Aging Neuroscience
Frontiers | The Aging of Iron Man | Frontiers in Aging Neuroscience (frontiersin.org)