Agmatine: Decarboxylated arginine, isolated from several plant and animal sources, e.g., pollen, ergot, herring sperm, octopus muscle.Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Oxalobacter formigenes: The sole species of the genus Oxalobacter consisting of straight or curved gram-negative rods with rounded ends. Cells are nonmotile, nonsporing, and use oxylates as the only source of CARBON and energy, with formate and CARBON DIOXIDE as end products. They are isolated from lake sediments and from the rumen or large bowel of humans and animals. (From Bergey's Manual of Determinative Bacteriology, 9th ed)Fatigue: The state of weariness following a period of exertion, mental or physical, characterized by a decreased capacity for work and reduced efficiency to respond to stimuli.Oxalates: Derivatives of OXALIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that are derived from the ethanedioic acid structure.Databases, Protein: Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.Formate Dehydrogenases: Flavoproteins that catalyze reversibly the reduction of carbon dioxide to formate. Many compounds can act as acceptors, but the only physiologically active acceptor is NAD. The enzymes are active in the fermentation of sugars and other compounds to carbon dioxide and are the key enzymes in obtaining energy when bacteria are grown on formate as the main carbon source. They have been purified from bovine blood. EC Oxalate: The calcium salt of oxalic acid, occurring in the urine as crystals and in certain calculi.Sequence Analysis, Protein: A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.Systems Integration: The procedures involved in combining separately developed modules, components, or subsystems so that they work together as a complete system. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Internet: A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.Dictionaries, MedicalDictionaries as Topic: Lists of words, usually in alphabetical order, giving information about form, pronunciation, etymology, grammar, and meaning.Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.Dictionaries, ChemicalPotassium-Hydrogen Antiporters: Membrane proteins that allow the exchange of hydrogen ions for potassium ions across the cellular membrane. The action of these antiporters influences intracellular pH and potassium ion homeostasis.Terminology as Topic: The terms, expressions, designations, or symbols used in a particular science, discipline, or specialized subject area.Lycopersicon esculentum: A plant species of the family SOLANACEAE, native of South America, widely cultivated for their edible, fleshy, usually red fruit.Plants, Genetically Modified: PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.Cecropins: Antimicrobial peptides that form channels in membranes that are more permeable to anions than cations. They resemble MAGAININS, with their N-terminal region forming a positively charged amphipathic alpha helix, but containing an additional C-terminal segment.Fruit: The fleshy or dry ripened ovary of a plant, enclosing the seed or seeds.Gene Expression Regulation, Plant: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.Plant Proteins: Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.Arabidopsis Proteins: Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Sodium-Hydrogen Antiporter: A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.

Inactivation of the glucose 6-phosphate transporter causes glycogen storage disease type 1b. (1/1325)

Glycogen storage disease type 1b (GSD-1b) is proposed to be caused by a deficiency in microsomal glucose 6-phosphate (G6P) transport, causing a loss of glucose-6-phosphatase activity and glucose homeostasis. However, for decades, this disorder has defied molecular characterization. In this study, we characterize the structural organization of the G6P transporter gene and identify mutations in the gene that segregate with the GSD-1b disorder. We report the functional characterization of the recombinant G6P transporter and demonstrate that mutations uncovered in GSD-1b patients disrupt G6P transport. Our results, for the first time, define a molecular basis for functional deficiency in GSD-1b and raise the possibility that the defective G6P transporter contributes to neutropenia and neutrophil/monocyte dysfunctions characteristic of GSD-1b patients.  (+info)

Topology of the membrane domain of human erythrocyte anion exchange protein, AE1. (2/1325)

Anion exchanger 1 (AE1) is the chloride/bicarbonate exchange protein of the erythrocyte membrane. By using a combination of introduced cysteine mutants and sulfhydryl-specific chemistry, we have mapped the topology of the human AE1 membrane domain. Twenty-seven single cysteines were introduced throughout the Leu708-Val911 region of human AE1, and these mutants were expressed by transient transfection of human embryonic kidney cells. On the basis of cysteine accessibility to membrane-permeant biotin maleimide and to membrane-impermeant lucifer yellow iodoacetamide, we have proposed a model for the topology of AE1 membrane domain. In this model, AE1 is composed of 13 typical transmembrane segments, and the Asp807-His834 region is membrane-embedded but does not have the usual alpha-helical conformation. To identify amino acids that are important for anion transport, we analyzed the anion exchange activity for all introduced cysteine mutants, using a whole cell fluorescence assay. We found that mutants G714C, S725C, and S731C have very low transport activity, implying that this region has a structurally and/or catalytically important role. We measured the residual anion transport activity after mutant treatment with the membrane-impermeant, cysteine-directed compound, sodium (2-sulfonatoethyl)methanethiosulfonate) (MTSES). Only two mutants, S852C and A858C, were inhibited by MTSES, indicating that these residues may be located in a pore-lining region.  (+info)

Functional importance and local environments of the cysteines in the tetracycline resistance protein encoded by plasmid pBR322. (3/1325)

The properties of the cysteines in the pBR322-encoded tetracycline resistance protein have been examined. Cysteines are important but not essential for tetracycline transport activity. None of the cysteines reacted with biotin maleimide, suggesting that they are shielded from the aqueous phase or reside in a negatively charged local environment.  (+info)

Na+/H+ antiporter activity in hamster embryos is activated during fertilization. (4/1325)

This study characterized the activation of the regulatory activity of the Na+/H+ antiporter during fertilization of hamster embryos. Hamster oocytes appeared to lack any mechanism for the regulation of intracellular pH in the acid range. Similarly, no Na+/H+ antiporter activity could be detected in embryos that were collected from the reproductive tract between 1 and 5 h post-egg activation (PEA). Activity of the Na+/H+ antiporter was first detected in embryos collected at 5.5 h PEA and gradually increased to reach maximal activity in embryos collected at 7 h PEA. Parthenogenetically activated one-cell and two-cell embryos demonstrate Na+/H+ antiporter activity, indicating that antiporter activity is maternally derived and initiated by activation of the egg. The inability of cycloheximide, colchicine, or cytochalasin D to affect initiation of antiporter activity indicates that antiporter appearance is not dependent on the synthesis of new protein or recruitment of existing protein to the cell membrane. In contrast, incubation of one-cell embryos with sphingosine did inhibit the appearance of Na+/H+ antiporter activity, showing that inhibition of normal protein kinase C activity is detrimental to antiporter function. Furthermore, incubation of oocytes with a phorbol ester which stimulates protein kinase C activity induced Na+/H+ antiporter activity in oocytes in which the activity was previously absent. Incubation with an intracellular calcium chelator also reduced the appearance of antiporter activity. Taken together, these data indicate that the appearance of Na+/H+ antiporter activity following egg activation may be due, at least in part, to regulation by protein kinase C and intracellular calcium levels.  (+info)

Non-selective voltage-activated cation channel in the human red blood cell membrane. (5/1325)

Using the patch-clamp technique, a non-selective voltage-activated Na+ and K+ channel in the human red blood cell membrane was found. The channel operates only at positive membrane potentials from about +30 mV (inside positive) onwards. For sodium and potassium ions, similar conductances of about 21 pS were determined. Together with the recently described K+(Na+)/H+ exchanger, this channel is responsible for the increase of residual K+ and Na+ fluxes across the human red blood cell membrane when the cells are suspended in low ionic strength medium.  (+info)

Prospective analysis of traits related to 6-year change in sodium-lithium countertransport. Gubbio Population Study Research Group. (6/1325)

Sodium-lithium countertransport (Na-Li CT) activity in red blood cells relates cross-sectionally and longitudinally to blood pressure and hypertension. Lifestyle and metabolic factors relate cross-sectionally to this sodium transporter. The aim of this study was to conduct a prospective analysis of 6-year Na-Li CT change and of traits related to Na-Li CT change. In 2183 participants in the Gubbio Population Study (972 men and 1211 women; baseline ages, 18 to 74 years), the following data collected at baseline and 6-year follow-up were analyzed: Na-Li CT; gender; age; body mass index (BMI); blood pressure; antihypertensive treatment; alcohol intake; smoking habits; urinary sodium-to-potassium ratio; and plasma cholesterol, glucose, uric acid, sodium, potassium, and triglycerides (measured only at follow-up). Six-year changes were defined as follow-up minus baseline values. Na-Li CT was higher at follow-up than at baseline in both genders (P<0.001). Baseline Na-Li CT; baseline and change values of BMI; and change values of alcohol intake, plasma potassium, and plasma glucose related to Na-Li CT change significantly and independently with control for other variables. Follow-up plasma triglyceride levels also related independently to Na-Li CT change. Coefficients were positive for BMI, alcohol intake, and plasma glucose and triglyceride levels and were negative for baseline Na-Li CT and plasma potassium levels. Baseline and change values of other variables did not relate significantly to Na-Li CT change. In conclusion, in prospective analyses, BMI, alcohol intake, plasma glucose, and lipids were directly related to Na-Li CT change; baseline Na-Li CT and plasma potassium levels were inversely related. The data support the concept that lifestyle and related metabolic factors influence Na-Li CT.  (+info)

Peptide-bound major histocompatibility complex class I molecules associate with tapasin before dissociation from transporter associated with antigen processing. (7/1325)

Major histocompatibility complex (MHC) class I molecules present antigenic peptides to CD8 T cells. The peptides are generated in the cytosol, then translocated across the membrane of the endoplasmic reticulum by the transporter associated with antigen processing (TAP). TAP is a trimeric complex consisting of TAP1, TAP2, and tapasin (TAP-A) as indicated for human cells by reciprocal coprecipitation with anti-TAP1/2 and anti-tapasin antibodies, respectively. TAP1 and TAP2 are required for the peptide transport. Tapasin is involved in the association of class I with TAP and in the assembly of class I with peptide. The mechanisms of tapasin function are still unknown. Moreover, there has been no evidence for a murine tapasin analogue, which has led to the suggestion that murine MHC class I binds directly to TAP1/2. In this study, we have cloned the mouse analogue of tapasin. The predicted amino acid sequence showed 78% identity to human tapasin with identical consensus sequences of signal peptide, N-linked glycosylation site, transmembrane domain and double lysine motif. However, there was less homology (47%) found at the predicted cytosolic domain, and in addition, mouse tapasin is 14 amino acids longer than the human analogue at the C terminus. This part of the molecule may determine the species specificity for interaction with MHC class I or TAP1/2. Like human tapasin, mouse tapasin binds both to TAP1/2 and MHC class I. In TAP2-mutated RMA-S cells, both TAP1 and MHC class I were coprecipitated by anti-tapasin antiserum indicative of association of tapasin with TAP1 but not TAP2. With crosslinker-modified peptides and purified microsomes, anti-tapasin coprecipitated both peptide-bound MHC class I and TAP1/2. In contrast, anti-calreticulin only coprecipitated peptide-free MHC class I molecules. This difference in association with peptide-loaded class I suggests that tapasin functions later than calreticulin during MHC class I assembly, and controls peptide loading onto MHC class I molecules in the endoplasmic reticulum.  (+info)

Granulocyte-macrophage colony-stimulating factor modulates tapasin expression in human neutrophils. (8/1325)

Differential display-polymerase chain reaction (DD-PCR) was used to evaluate changes in mRNA expression of granulocyte-macrophage colony-stimulating factor (GM-CSF) treated human neutrophils to better understand how this cytokine affects the functions of neutrophils at the molecular level. Although a variety of cDNA fragments were identified as modulated by GM-CSF with the use of DD-PCR, one fragment in particular, NGS-17 (neutrophil GM-CSF-stimulated fragment #17), was characterized. The NGS-17 fragment hybridized to a 3.8-kh mRNA that encodes for a protein of a predicted molecular mass of 47.6 kDa. After cloning and sequencing, this gene was found to code for the recently sequenced tapasin or TAP-A protein. Immunoprecipitation and immunoblotting studies using anti-tapasin antibodies showed that tapasin is expressed in neutrophils and is associated with the MHC class I-TAP complex. Moreover, tapasin expression was found to be induced by dimethyl sulfoxide and by retinoic acid in HL-60 cells. This is the first report on the expression of tapasin in human neutrophils. It provides novel information, at the molecular level, on how GM-CSF enhances the functions of these cells.  (+info)

*Sodium-hydrogen antiporter 3

The NHE3 antiporter imports one sodium ion into the cytosol of a tubule cell as it ejects one hydrogen ion from the cell into ... Sodium-hydrogen antiporter 3 also known as sodium-hydrogen exchanger 3 (NHE3) or solute carrier family 9 member 3 (SLC9A3) is a ... SLC9A3 is a sodium-hydrogen antiporter. It is found on the apical side of the epithelial cells of the tubulus proximal of the ... The NHE3 antiporter indirectly contributes to blood buffering capacity because hydrogen ions that are ejected are the products ...


Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Pak, J. E.; Ekende, E. N.; Kifle, E. G.; et ... Na+/H+ antiporters have been reviewed. In secondary active transport, one species of solute moves along its electrochemical ... An antiporter (also called exchanger or counter-transporter) is a cotransporter and integral membrane protein involved in ... Nov 12, 2013). "Structures of intermediate transport states of ZneA, a Zn(II)/proton antiporter". Proc Natl Acad Sci U S A. 110 ...

*Calcium:cation antiporter

The Ca2+:cation antiporter (CaCA) family (TC# 2.A.19) is a member of the cation diffusion facilitator (CDF) superfamily. This ... The original text was at "2.A.19 The Ca2+:Cation Antiporter (CaCA) Family". Molecular and Cellular Biology portal. ... H+ antiporter of E. coli and the sixth contains only one distant S. cerevisiae homologue of unknown function. Several ... "Isolation and functional characterization of Ca2+/H+ antiporters from cyanobacteria". The Journal of Biological Chemistry. 279 ...

*Uniporter, Symporter, Antiporter

Uniporter A Goswitz, V. C., & Brooker, R. J. (1995). Structural features of the uniporter/symporter/antiporter superfamily. ... The Uniporter, symporter and antiporter are evolutionary groups of solute transporters. The transporters help facilitate the ... PMID 7795534doi:10.1002/pro.5560040319 M. G. Wolfersberger: Uniporters, symporters and antiporters. In: The Journal of ...

*Sodium-proton antiporter

H+ Antiporter (NhaB) Family TC# 2.A.35 - Na+:H+ Antiporter (NhaC) Family TC# 2.A.36 - Monovalent Cation:Proton Antiporter-1 ( ... H+ Antiporter (NhaD) Family TC# 2.A.63 - Monovalent Cation (K+ or Na+):Proton Antiporter-3 (CPA3) Family TC# 2.A.111 - Na+:H+ ... Sodium/proton antiporters are essential secondary-active transporters for sodium and pH homeostasis. Defects in sodium/proton ... Sodium-Proton (Na+/H+) Antiporters:Properties and Roles in Health and Disease". In Astrid, Sigel; Helmut, Sigel; Roland K.O., ...

*Sodium-hydrogen antiporter

... antiporter 1 Sodium-hydrogen antiporter 2 Sodium-hydrogen antiporter 3 Sodium-hydrogen antiporter 5 Sodium-hydrogen antiporter ... The sodium-hydrogen antiporter or sodium-hydrogen exchanger is a membrane protein found in many cells, and especially in those ... Angiotensin II upregulates this antiporter in the proximal convoluted tubule in order to promote Na+ reabsorption and H+ ... There are several isoforms of the antiporter: Sodium-hydrogen ... 6 Sodium-hydrogen antiporter 8 Bobulescu, IA; Moe, OW. "Na+/H+ ...

*Calcium:cation antiporter-2

The Ca2+:H+ antiporter-2 (CaCA2) family (TC# 2.A.106) is a member of the lysine exporter (LysE) superfamily. Note that this ... Gdt1p and TMEM165 are probably Golgi-localized Ca2+:H+ antiporters. Modification of the Golgi Ca2+ and pH balance could explain ... "2.A.106 Ca2+:H+ Antiporter-2 (CaCA2) Family". Transporter Classification Database. Retrieved 2016-03-01. Molecular and Cellular ... family differs from the calcium:cation antiporter (CaCA) family which belongs to the cation diffusion facilitator (CDF) ...

*Sodium-hydrogen antiporter 1

... is an isoform of sodium-hydrogen antiporter that in humans is encoded by the SLC9A1 gene. The Na+/H+ antiporter (SLC9A1) is a ... Sodium-hydrogen antiporter 1 has been shown to interact with carbonic anhydrase II and CHP. It is also the target of the ... The sodium-hydrogen antiporter 1 (NHE-1) also known as sodium/hydrogen exchanger 1 or SLC9A1 (SoLute Carrier family 9A1) ... Dudley CR, Giuffra LA, Tippett P, Kidd KK, Reeders ST (1990). "The Na+/H+ antiporter: a "melt" polymorphism allows regional ...

*ATP:ADP antiporter family

The ATP:ADP Antiporter (AAA) Family (TC# 2.A.12) is a member of the major facilitator superfamily. Members of the AAA family ... As of this edit, this article uses content from "2.A.12 The ATP:ADP Antiporter (AAA) Family", which is licensed in a way that ... The transport reaction catalyzed by the antiporters is: ATP (out) + ADP (in) ⇌ ATP (in) + ADP (out) The AAA family proteins are ...

*Monovalent cation:proton antiporter-3

Sodium-Proton antiporter Monovalent Cation (K+ or Na+):Proton Antiporter-1 Monovalent Cation (K+ or Na+):Proton Antiporter-2 ... In this system, YufT is believed to be responsible for Na+:H+ antiporter activity, but it does not have activity in the absence ... The Monovalent Cation (K+ or Na+):Proton Antiporter-3 (CPA3) Family (TC# 2.A.63) is a member of the Na+ transporting Mrp ... Kosono, S.; Ohashi, Y.; Kawamura, F.; Kitada, M.; Kudo, T. (2000-02-01). "Function of a principal Na(+)/H(+) antiporter, ShaA, ...

*Monovalent cation:proton antiporter-1

Sodium-proton antiporter Monovalent cation:Proton antiporter-2 Monovalent cation:Proton antiporter-3 Transporter Classification ... proton antiporter-1 family in Arabidopsis thaliana, encodes a putative Li/H antiporter". The Plant Journal: For Cell and ... The Monovalent Cation:Proton Antiporter-1 (CPA1) Family (TC# 2.A.36) is a large family of proteins derived from Gram-positive ... Krauke, Yannick; Sychrova, Hana (2008). "Functional comparison of plasma-membrane Na+/H+ antiporters from two pathogenic ...

*Monovalent cation:proton antiporter-2

CPA superfamily Sodium-Proton antiporter Monovalent cation:Proton antiporter-1 Monovalent cation:Proton antiporter-3 ... depending on conditions Na+/H+ antiporter of Enterococcus hirae (i.e., NapA, TC# 2.A.37.2.1) K+/H+ antiporter of S. cerevisiae ... Waser, M.; Hess-Bienz, D.; Davies, K.; Solioz, M. (1992-03-15). "Cloning and disruption of a putative NaH-antiporter gene of ... The Monovalent Cation:Proton Antiporter-2 (CPA2) Family (TC# 2.A.37) is a moderately large family of transporters belonging to ...

*Basic amino acid antiporter family

The Basic Amino Acid Antiporter (ArcD) family (TC# 2.A.118) is a constituent of the IT superfamily. This family consists of ... "2.A.118 The Basic Amino Acid Antiporter (ArcD) Family", which is licensed in a way that permits reuse under the Creative ...

*Sodium-hydrogen antiporter 3 regulator 1

... is a regulator of Sodium-hydrogen antiporter 3. It is encoded by the gene SLC9A3R1. It ... Sodium-hydrogen antiporter 3 regulator 1 has been shown to interact with: ADRB2, Beta-catenin, CFTR, GNAQ, OPRK1, PAG1, PDGFRA ...

*NhaA family

Na+/H+ antiporter A (NhaA) family (TC# 2.A.33) contains a number of bacterial sodium-proton antiporter (SPAP) proteins. These ... 4AU5​ Sodium-Proton antiporter Antiporter Transporter Classification Database Appel, Matthias; Hizlan, Dilem; Vinothkumar, ... antiporter participates in the periplasmic cation passage and pH regulation of the antiporter". Journal of Molecular Biology. ... Na+-H+ antiporters are integral membrane proteins that exchange Na+ for H+ across the cytoplasmic membrane and many ...


M. G. Wolfersberger: Uniporters, symporters and antiporters. In: The Journal of Experimental Biology. Band 196, November 1994, ... Antiporter Symporter Alberts, Bruce et al. - Essential Cell Biology, 1st edition. Garland Publishing, New York: 1998. ...

*Active transport

In an antiporter two species of ion or other solutes are pumped in opposite directions across a membrane. One of these species ... In an antiporter, one substrate is transported in one direction across the membrane while another is cotransported in the ... This antiporter mechanism is important within the membranes of cardiac muscle cells in order to keep the calcium concentration ... An example is the sodium-calcium exchanger or antiporter, which allows three sodium ions into the cell to transport one calcium ...

*Membrane transport protein

2.A: Porters ( uniporters, symporters, antiporters), SLCs. Excitatory amino acid transporters (EAATs) EAAT1 EAAT2 EAAT3 EAAT4 ...


A Proton gradient moves the ions into the vacuole by proton-sodium antiporter or the proton-calcium antiporter. In plants, ... Antiporters and symporters both transport two or more different types of molecules at the same time in a coupled movement. An ... In contrast to antiporters, symporters move ions or molecules in the same direction. In this case both ions being transported ... The AE1 antiporter is essential in the removal of carbon dioxide waste that is converted to bicarbonate inside the erythrocyte ...

*CrcB RNA motif

F proteins have been shown to function as fluoride-specific fluoride/proton antiporters. The three-dimensional structure of a ... "Fluoride resistance and transport by riboswitch-controlled CLC antiporters". Proc Natl Acad Sci U S A. 109 (38): 15289-94. doi: ...


... glucose-6-phosphate antiporters". PLoS One. 6 (9): e23157. doi:10.1371/journal.pone.0023157. PMC 3176764 . PMID 21949678. ...


NorM seems to function as drug/sodium antiporter which is the first example of Na+-coupled multidrug efflux transporter ... organic cation antiporters". Biochemical Pharmacology. 74 (2): 359-71. doi:10.1016/j.bcp.2007.04.010. PMID 17509534. Omote H, ... MATE2 H+/organic cation antiporter". Morita Y, Kodama K, Shiota S, Mine T, Kataoka A, Mizushima T, Tsuchiya T (July 1998). " ... "Identification and functional characterization of a new human kidney-specific H+/organic cation antiporter, kidney-specific ...

*Malate-aspartate shuttle

malate-alpha-ketoglutarate antiporter in the inner membrane. glutamate-aspartate antiporter in the inner membrane. The primary ... The second antiporter (the glutamate-aspartate antiporter) imports glutamate from the cytosol into the matrix and exports ... Once malate is formed, the first antiporter (malate-alpha-ketoglutarate) imports the malate from the cytosol into the ...


This antiporter imports cystine and exports glutamate, which are both amino acids. An antiporter functions with a one-to-one ... The antiporter is a heterodimeric amino acid transporter. The structure of this protein includes a specific light chain, xCT, ... Cystine/glutamate transporter is an antiporter that in humans is encoded by the SLC7A11 gene. The SLC7A11 gene codes for a ... Bridges RJ, Natale NR, Patel SA (January 2012). "System xc⁻ cystine/glutamate antiporter: an update on molecular pharmacology ...

*Shimon Schuldiner

Specifically, he focuses on the multidrug antiporter EmrE. Investigation of its subunit structure led the Schuldiner Group to ... an electrogenic antiporter from Escherichia coli. J. Biol. Chem. 268, 5382-5387 Schuldiner, S., Shirvan, A., Stern-Bach, Y., ...
Cellular life, as we know it, is absolutely dependent on biological membranes; remarkable superstructures made of lipids and proteins. For example, all living cells are surrounded by at least one membrane that protects the cell and holds it together. The proteins that are embedded in the membranes carry out a wide variety of key functions, from nutrient uptake and waste disposal to cellular respiration and communication. In order to function accurately, any integral membrane protein needs to be inserted into the cellular membrane where it belongs, and in that particular membrane it has to attain its proper structure and find partners that might be required for proper function. All membrane proteins have evolved to be inserted in a specific overall orientation, so that e.g. substrate-binding parts are exhibited on the right side of the membrane. So, what determines in which way a membrane protein is inserted? Are all membrane proteins inserted just so?. The focus of this thesis is on these ...
TY - JOUR. T1 - Examination of EmrE conformational differences in various membrane mimetic environments. AU - Federkeil, Sandra L.. AU - Winstone, Tara L.. AU - Jickling, Glen. AU - Turner, Raymond J.. PY - 2003/4. Y1 - 2003/4. N2 - Ethidium multidrug resistance protein (EmrE) is a member of the small multidrug resistance family of proteins and is responsible for resistance in Escherichia coli to a diverse group of lipophilic cations. Research is beginning to elucidate structural information as well as substrate binding and extrusion mechanisms for this protein. However, the choice of membrane mimetic environment to perform structural studies needs to be made. In this study EmrE was solubilized in different membrane mimetic environments to investigate the influence of environment on the structure and dynamics of the protein by comparing the fluorescence properties of emission maxima, peak shifts, relative intensities, acrylamide quenching constants, and polarization. Taken together, the ...
Transport assays were performed as previously described [8] using radiolabelled 14C MV2+ (Sigma-Aldrich) (referred to as MV throughout). Protein was first exchanged from DDM into OG [28]: DDM-protein was incubated with 1.5 ml of Ni-NTA beads (pre-washed 1% OG and 20 mM Tris pH 7.5) for 1.5 h at 4°C; loaded onto a Pharmacia XK-16/20 glass column; washed 4-times with buffer containing 150 mM NaCl, 1% OG, 15 mM mercaptoethanol and 15 mM Tris pH 7.5 and then mixed with elution buffer (the previous buffer with 200 mM imidazole and 15 mM mercaptoethanol) and incubated at room temperature for 15 min. Eluted protein was concentrated by centrifugation at 4000 g using Amicon Ultra 50 000 MWCO centrifugal concentrator (Millipore). Protein in OG was immediately reconstituted into lipid vesicles (at a starting protein:lipid mole ratio of ~2900:1). Lipids were rehydrated (to 50 in 150 mM NaCl, 15 mM Tris, pH 7.5) and sonicated or extruded to 50 nm, 100 nm or 200 nm as stated in the text. The vesicles ...
Biochemistry of Bacterial Multidrug Efflux Pumps. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
View mouse Slc9b2 Chr3:135307700-135345387 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Influence of GEX1 and GEX2 on the PKA and MAPK pathways. (A) WT cells transformed with pADH1-MSN2-GFP alone or in combination with the pØ or pGEX1-HA plasmids,
Tapasin Related Protein兔多克隆抗体(ab123238)可与小鼠样本反应并经WB实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
地域母子保健・福祉の連携・支援体制のあり方に関する研究 保健福祉における住民組織活動の実態と連携に関する研究(3) (2002 ...
The objective of the present study was to determine whether information about a biometrically inferred single gene with large effects on erythrocyte sodium-lithium countertransport is useful in predicting the probability of having hypertension. We used multivariate logistic regression to model the relationship between the probability of having hypertension and predictor traits in a sample of 382 unrelated adult women and 347 unrelated adult men from Rochester, Minn. First, we identified a set of demographic, biochemical, and physiological predictors. Second, we analyzed whether the relationship between the probability of having hypertension and the identified predictor traits was heterogeneous between the biometrically inferred single locus genotypes with large effects on sodium-lithium countertransport level. Third, if there was no heterogeneity, we assessed whether sodium-lithium countertransport genotypes made an additional contribution to predicting the probability of having hypertension ...
Selected publications:. Kanai,N Lu,R Satriano,J Bao,Y Wolkoff,AW Schuster,VL. Identification and characterization of a prostaglandin transporter. Science 268: 866-869, 1995.. Itoh,S Lu,R Bao,Y Morrow,JD Roberts,LJ Schuster,VL. Structural determinants of substrates for the prostaglandin transporter "PGT". Mol Pharm 50: 736-742, 1996.. Lu,R Kanai,N Bao,Y Schuster,VL. Cloning, in vitro expression, and tissue distribution of a human prostaglandin transporter cDNA "hPGT". J Clin Invest 98: 1142-1149, 1996.. Schuster,VL Lu,R Coca-Prados,M. Identification and characterization of a prostaglandin transporter widely-expressed in ocular and other secretory epithelia. Survey Ophthalmol 41: S41-S45, 1997.. Schuster,VL. Molecular mechanisms of prostaglandin transport. Ann Rev Physiol 60: 221-242, 1998.. Chan,B Satriano,JA Pucci,M Schuster,VL. Mechanism of PGE2 transport across the plasma membrane of HeLa cells and Xenopus oocytes expressing the prostaglandin transporter "PGT". J Biol Chem 273: 6689-6697, ...
Citation: Pittman,J.K., Shigaki,T., Cheng,N.H., Hirschi,K.D. 2002. Mechanism of N-terminal autoinhibition in the Arabidopsis Ca(2+)/H(+) antiporter CAX1. Journal of Biological Chemistry. 277(29):26452-26459. Interpretive Summary: A small weed, termed Arabidopsis, can be used as a model to understand complex biological processes in agriculturally important plants. In this study, we have used Arabidopsis to analyze the regulation of calcium transporters. For the first time, we have shown that specific types of calcium transporters are tightly controlled. These results will form a foundation for future studies in agriculturally important crops. Eventually, we hope to manipulate these calcium transporters to increase the calcium levels in important crops. These engineered crops will allow greater consumption of important nutrients by consumers. Technical Abstract: Regulation of Ca2+/H+ antiporters may be an important component in determining the duration and amplitude of cytosolic Ca2+ oscillations. ...
We report here the characterization of an Arabidopsis transporter, AtMHX, which is the first Mg2+ transporter to be cloned from a multicellular organism, and the first cloned exchanger of protons with Mg2+ and Zn2+ ions. Although AtMHX shows limited sequence homology with animal Na+/Ca2+ exchangers, the two transporter species are functionally distinct. In animals, Na+/K+‐ATPases generate Na+ gradients that provide the driving force for most transport processes, including Ca2+ extrusion from the cytosol to the extracellular space by Na+/Ca2+ exchangers localized in the plasma membrane. In plants, the driving force for most transport processes is the electrochemical H+ gradient, which is generated by H+‐ATPases localized in both the plasma membrane and the vacuolar membrane (Maathuis and Sanders, 1992). Notably, in contrast to animal Na+/Ca2+ exchangers, AtMHX is incapable of transporting Ca2+ ions, but can serve as an electrogenic exchanger of protons with Mg2+, Zn2+ and Fe2+ ions. The ...
Complete information for SCAX3 gene (Genetic Locus), Spinocerebellar Ataxia, X-Linked 3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
In article ,2q6job$21t at,, Bipin K Dalmia ,bipin at, wrote: ,im trying to purify a protein expressed in e. coli. there is tons of it ,in the soluble extract. the pI is about 9.5. so naturally i tried using ,a cation exchanger at pH 6.5 but my protein flows right thru it. ive ,checked the ionic strengths etc. and they look good. the resin was ,properly equilibrated too. im using bio-rads biorex-70 resin in the ,sodium form and eluting with a gradient of NaCl. , ,any clues? , ,bip ,-- ,bipin k. dalmia the other night i was lying on my bed, looking ,bipin at up at the beautiful stars, and i said to myself, ,n2.bkd at where the F*CK is my ROOF !! ,-- Frequently this is due to nucleic acids contaminating a prep. Basic proteins stay tightly bound and their charge is thus masked and the protein flows through. If you have not already treated your extract to remove nucleic acids you might consider: PEI precipitation in high salt (0.5M) to ...
Bacterial pathogens that are multi-drug resistant compromise the effectiveness of treatment when they are the causative agents of infectious disease. These multi-drug resistance mechanisms allow bacteria to survive in the presence of clinically useful antimicrobial agents, thus reducing the efficacy of chemotherapy towards infectious disease. Importantly, active multi-drug efflux is a major mechanism for bacterial pathogen drug resistance. Therefore, because of their overwhelming presence in bacterial pathogens, these active multi-drug efflux mechanisms remain a major area of intense study, so that ultimately measures may be discovered to inhibit these active multi-drug efflux pumps.
Famodez VNX 150 - washing and cleaning of any acid and waterproof surfaces in the kitchen. Buy Famidez VNX 150 in MEGA-SPECTR manufacturer DesoMark.
Mitsue Y Yamaguchi PHD is a Psychologist who practices in Torrance, CA. Get a full report about this doctors background by clicking here.
Mustafa etin, Sinan Altan Kocaman, Turan Erdo an, Murtaza Emre Durako lugil, Y ksel i ek, ahin Bozok, Aytun anga, Ahmet Temiz, S tk Do an, mer at ro ...
SLC40A1兔多克隆抗体(ab58695)可与大鼠样本反应并经WB, ELISA实验严格验证,被3篇文献引用并得到1个独立的用户反馈。所有产品均提供质保服务,中国75%以上现货。
Upward-flow process for treating liquids in ion exchange filters containing cation exchangers and anion exchangers in separate layers arranged one on top of the other, in which the cation and anion exchangers are separated from one another by a resin layer which does not participate in the ion exchange, the anion exchanger is regenerated externally and the cation exchanger, which remains in the filter, is regenerated in the counter-current and the anion exchanger is removed from and recycled to the filter without whirling up the separating layer and cation exchanger layer. The invention furthermore relates to a new counter-current ion exchange filter for carrying out the process.
Shop Vacuolar cation/proton exchanger ELISA Kit, Recombinant Protein and Vacuolar cation/proton exchanger Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
298093376 - EP 0868212 B1 2000-06-21 - PROCESS FOR THE PREPARATION OF FREE-FLOWING OR TEMPORARILY FREE-FLOWING VERY ACIDIC CATION EXCHANGERS - [origin: WO9723282A2] The invention relates to a process for the preparation of free-flowing end products of very acidic cation exchangers. The grain pile of end products of the very acidic cation exchangers produced in the process described in the patent application P 195 48 012.0 cannot flow freely. By adding linking wetting agents or water-soluble initiators or tensides during polymerisation or after filtration of the end product and/or by taking technical measures, the grain pile of the very acidic cation exchangers is able to flow freely permanently or temporarily using the following process: (1) by adding to the copolymerisation system, known wetting agents in quantities of up to 0.25 g/l of the aqueous phase or water-soluble initiators in quantities of from 0.05 to 20 g/l of the aqueous phase 20 to 120 minutes after reaching the point of gelification; (2)
Na+/Ca2+ exchangers are low affinity, high capacity transporters that rapidly transport calcium at the plasma membrane, mitochondrion, endoplasmic (and sarcoplasmic) reticulum, and the nucleus. Na+/Ca2+ exchangers are widely expressed in diverse cell types where they contribute homeostatic balance to calcium levels. In animals, Na+/Ca2+ exchangers are divided into three groups based upon stoichiometry: Na+/Ca2+ exchangers (NCX), Na+/Ca2+/K+ exchangers (NCKX), and Ca2+/Cation exchangers (CCX). In mammals there are three NCX genes, five NCKX genes and one CCX (NCLX) gene. The genome of the nematode Caenorhabditis elegans contains ten Na+/Ca2+ exchanger genes: three NCX; five CCX; and two NCKX genes. Here we set out to characterize structural and taxonomic specializations within the family of Na+/Ca2+ exchangers across the phylum Nematoda. In this analysis we identify Na+/Ca2+ exchanger genes from twelve species of nematodes and reconstruct their phylogenetic and evolutionary relationships. The most
We studied 42 white subjects with normal glucose tolerance and microalbuminuria and 79 with normoalbuminuria. Because we were studying healthy subjects on two occasions over a period of 3 years and needed to maximize subject compliance, we estimated AER both at screening and at recall on two rather than three collections, as would be usual in diabetic patients. In consequence, we used for our main classification of microalbuminuria an AER of 20 to 200 μg/min on either or both collections. We found that only 29% of individuals identified as microalbuminuric at screening remained so at follow-up, while 15% of normoalbuminuric subjects changed category. Microalbuminuria is thus a highly unstable variable in nondiabetic subjects. Nevertheless, we have previously shown it to be powerfully related to cardiovascular risk in this population.6 These observations suggest that, allowing for biological variability, the relationship between microalbuminuria (or its genetic or environmental determinants) and ...
In the present study, we found that the C-1 carboxylic acid group was essential for optimal substrate binding to the FP receptor. Replacement of the carboxylic acid group by larger moieties with a similar pK a, such as acylsulfonamide and tetrazole, substantially decreased binding affinity. The prostaglandin transporter PGT, on the other hand, recognized a fairly wide range of anionic substrates at C-1. In contrast, insertion of cyclic substituents in the omega chain increased binding to the FP receptor but reduced affinity for PGT, and substitution for the 15-hydroxyl group produced only a modest reduction in FP receptor binding but eliminated binding by PGT.. Prostaglandins and thromboxanes bind to a number of structurally diverse molecules, such as their cell-surface receptors (EP, FP, IP, DP, and TP) (Breyer et al., 1996a), the prostaglandin transporter PGT (Itoh et al., 1996), peroxisome proliferator-activated receptors α and γ (Forman et al., 1995; Kliewer et al., 1995), and ...
Predicted to have potassium:proton antiporter activity and sodium:proton antiporter activity. Involved in flagellated sperm motility. Localizes to the motile cilium. Orthologous to human SLC9C1 (solute carrier family 9 member C1 ...
In order to remove tumor necrosis factor α (TNFα) or/and bacterial lipopolysaccharides (LPS, endotoxin) extracorporeally from whole blood or/and blood plasma in an extracorporeal perfusion system, the blood or plasma is passed over a cation exchanger and an anion exchanger material. A device according to the invention for the extracorporeal treatment of patients blood or plasma therefore contains a cation exchanger material and an anion exchanger material wherein these materials are contained in at least one compartment of an extracorporeal perfusion system.
The over-expression of Arabidopsis CAX1 and CAX2 causes transgenic tomato plants to reveal severe Ca2+ deficiency-like symptoms such as tip-burn and/or blossom end rot, despite there being sufficient
Autor: Călinescu, Octavian et al.; Genre: Zeitschriftenartikel; Im Druck veröffentlicht: 2014; Keywords: Archaea; Electrophysiology; Membrane Transport; pH Regulation; Sodium Proton Exchange; EcNhaA; MjNhaP1; Cation Proton Antiporter; Solid Supported Membrane; Titel: Keeping It Simple, Transport Mechanism and pH Regulation in Na+/H+
mouse Slc16a7 protein: a monocarboxylate transporter; transports pyruvate and lactate; 60% identical to hamster MCT1; expressed in different cells than MCT1; RefSeq NM_011391
Has sugar-induced sodium-independent electrogenic activity. Generation of glucose-induced inward currents is pH-dependent, with activity in acidic conditions (pH 5) but not neutral conditions. Does not have sugar transport activity.
Using a variety of programs available online, including the Oligator and Optimoose, we were able to formulate a plan that would enable us to synthesize various optimized and deoptimized versions of the TetA gene. We relied on codon bias, the differences in frequency of occurrence of synonymous codons in coding DNA, to allow for varying expression levels of TetA in the cell. By using natural enzyme sites within TetA, we were able to conduct restriction digests on TetA that allowed us to alter roughly 150 base pairs within each segment using codon bias with a total of four segments available. The TetA vector that was used to synthesize segment 1 clones was digested with EcoRI and NheI. The TetA vector that was used to synthesize segment 2 clones was digested with NheI and BamHI. This gave us the ability to insert roughly 144 bp for each segment that were optimized or deoptimized using codon bias. These inserts were fairly large and thus were synthesized by annealing oligos. These annealed oligos ...
Using a variety of programs available online, including the Oligator and Optimoose, we were able to formulate a plan that would enable us to synthesize various optimized and deoptimized versions of the TetA gene. We relied on codon bias, the differences in frequency of occurrence of synonymous codons in coding DNA, to allow for varying expression levels of TetA in the cell. By using natural enzyme sites within TetA, we were able to conduct restriction digests on TetA that allowed us to alter roughly 150 base pairs within each segment using codon bias with a total of four segments available. The TetA vector that was used to synthesize segment 1 clones was digested with EcoRI and NheI. The TetA vector that was used to synthesize segment 2 clones was digested with NheI and BamHI. This gave us the ability to insert roughly 144 bp for each segment that were optimized or deoptimized using codon bias. These inserts were fairly large and thus were synthesized by annealing oligos. These annealed oligos ...
Shop Leucine efflux protein ELISA Kit, Recombinant Protein and Leucine efflux protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Rabbit anti Human SLC5A9 antibody recognizes sodium dependent glucose transporter 4 (SGLT4), also known as SLC5A9, a ~76 kDa member o
Complete information for VCX3B gene (Protein Coding), Variable Charge, X-Linked 3B, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Immunology , CM agarose Fast Flow is a weak cation exchanger based on the well established agarose Fast Flow ion exchange platform, e...
Cleanert Alumina A sorbent (pH = 4.5) can be used as a strong polar absorbent or a mild cation exchanger. This sorbent is processed with a special deactivation procedure which ensures high analytes recovery. ...
SLC9A1 (NHE1), a member of the Na+/H+ exchanger family, is a ubiquitous membrane protein that regulates intracellular pH and cell volume. Furthermore, SLC9A1 is known to
Teary-eyed and his voice shaking, pop star Tatsuya Yamaguchi apologized Thursday for kissing and engaging in indecent behavior with a high school-aged girl in a career-crushing scandal leading to his indefinite suspension from show business. "I will spend my days taking a hard look at ... ...
The AikiWeb Forums serves the Internet Aikido community as a repository and dissemination point for sharing and discussing the Japanese art of Aikido.
Plasmid pDONR221_SLC25A31 from Dr. Giulio Superti-Furgas lab contains the insert SLC25A31. This plasmid is available through Addgene.
Plasmid pDONR221_SLC2A3 from Dr. Giulio Superti-Furgas lab contains the insert SLC2A3. This plasmid is available through Addgene.
TY - JOUR. T1 - Quantitative analysis of glucose-6-phosphate translocase gene expression in various human tissues and haematopoietic progenitor cells. AU - Ihara, K.. AU - Nomura, A.. AU - Hikino, S.. AU - Takada, Hidetoshi. AU - Hara, T.. PY - 2000/1/1. Y1 - 2000/1/1. N2 - We investigated the quantitative expression of the human glucose-6-phosphate translocase gene (G6PT1) and its splicing variants in human tissues. The G6PT1 gene was strongly expressed in liver, kidney and haematopoietic progenitor cells, which might explain major clinical symptoms such as hepatomegaly, nephromegaly and neutropenia in glycogen storage diseases type 1b. Reverse transcriptase-mediated PCR amplification of G6PT1 cDNA revealed several splicing variants in tissue-specific manners. The brain-specific isoform, which has an additional 22 amino acids between exons 6 and 8, was also identified in heart and skeletal muscle. A new splicing variant, although less prominent in quantity and lacking polypeptide loops ...
Congenital hereditary endothelial dystrophy (CHED) is an inherited disorder of the corneal endothelium characterised by bilateral non-inflammatory corneal clouding ranging from a diffuse haze to a ground-glass appearance. CHED can be inherited in an autosomal dominant (CHED1) or recessive (CHED2) manner. CHED2 usually presents at birth or early infancy. Bilateral corneal clouding can lead to visual impairment often accompanied by nystagmus in CHED2 patients requiring corneal transplantation.1 Mutations in the solute carrier family 4 member 11 (SLC4A11) gene have been identified in most patients with CHED2. With PCR sequencing of the entire coding and putative promoter regions of SLC4A11, there were, however, some clinically confirmed CHED2 patients with undetected SLC4A11 mutations.2 ...
Enteropathogenic E. coli (EPEC) is a major cause of infantile diarrhea, but the pathophysiology underlying associated diarrhea is poorly understood. We examined the role of the luminal membrane Cl-/OH- exchange process in EPEC pathogenesis using in vitro and in vivo models. Cl-/OH- exchange activity was measured as OH- gradient-driven 36Cl- uptake. EPEC infection (60 minutes-3 hours) inhibited apical Cl-/OH- exchange activity in human intestinal Caco-2 and T84 cells. This effect was dependent upon the bacterial type III secretory system (TTSS) and involved secreted effector molecules EspG and EspG2, known to disrupt the host microtubular network. The microtubule-disrupting agent colchicine (100 μM, 3 hours) also inhibited 36Cl- uptake. The plasma membrane expression of major apical anion exchanger DRA (SLC26A3) was considerably reduced in EPEC-infected cells, corresponding with decreased Cl-/OH- exchange activity. Confocal microscopic studies showed that EPEC infection caused a marked ...
Looking for online definition of Anion Exchanger 1 in the Medical Dictionary? Anion Exchanger 1 explanation free. What is Anion Exchanger 1? Meaning of Anion Exchanger 1 medical term. What does Anion Exchanger 1 mean?
All information about the latest scientific publications of the Clínica Universidad de Navarra. Abnormal expression of anion exchanger genes in primary biliary cirrhosis
Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U,Markovich D, Kere J. Functional characterization of three novel tissue-specific anion exchangersSLC26A7, -A8, and -A9.J Biol Chem. 2002 Apr 19;277(16):14246-54. Epub 2002 Feb 07. PMID: 11834742 [PubMed - indexed for MEDLINE]. A second distinct family of anion exchangers, SLC26, in addition to the classical SLC4 (or anion exchanger) family, has recently been delineated. Particular interest in this gene family is stimulated by the fact that the SLC26A2, SLC26A3, and SLC26A4 genes have been recognized as the disease genes mutated in diastrophic dysplasia, congenital chloride diarrhea, and Pendred syndrome, respectively. We report the expansion of the SLC26 gene family by characterizing three novel tissue-specific members, named SLC26A7, SLC26A8, and SLC26A9, on chromosomes 8, 6, and 1, respectively. The SLC26A7-A9 proteins are structurally very similar at the amino acid level to the previous family members and show tissue-specific ...
Looking for online definition of antiporter in the Medical Dictionary? antiporter explanation free. What is antiporter? Meaning of antiporter medical term. What does antiporter mean?
Bacteria that survive in the acidic environment of the stomach have mechanisms to maintain a high intracellular pH. In Escherichia coli, glutamate (Glu) and arginine (Arg) are decarboxylated intracellularly and the reaction products are exchanged with extracellular Glu and Arg. Gao et al. now report a crystal structure of AdiC, an arginine:agmatine antiporter from E. coli. AdiC exhibits the same fold as that of the Na+-coupled symporters, including LeuT. It contains 12 transmembrane segments, forms a homodimer, and exists in an outward-facing, open conformation in the crystals. The structure, together with biochemical data, suggests how the antiporter senses the pH and responds to transport the reaction product agmatine out of the cell and Arg into the cell.. X. Gao, F. Lu, L. Zhou, S. Dang, L. Sun, X. Li, J. Wang, Y. Shi, Structure and mechanism of an amino acid antiporter. Science 324, 1565-1568 (2009). [Abstract] [Full Text] ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Emre Kiciman is a researcher in MSR focusing on solving hard problems in the field of automated systems management of large scale distributed systems. Basically, he works on algorithms and systems tha
Emre Kiciman is a researcher in MSR focusing on solving hard problems in the field of automated systems management of large scale distributed systems. Basically, he works on algorithms and systems tha
Visit Healthgrades for information on Dr. Gaku Yamaguchi, MD Find Phone & Address information, medical practice history, affiliated hospitals and more.
L. D. Zhao, H. J. Wu, S. Q. Hao, C. I. Wu, X. Y. Zhou, Kanishka Biswas, J. Q. He, T. P. Hogan, C. Uher, C. Wolverton, V. P. Dravid and M. G. Kanatzidis, All-scale hierarchical thermoelectrics: MgTe in PbTe facilitates valence band convergence and suppresses bipolar thermal transport for high performance, Energy Environ. Sci. 6, 3346 - 3355 (2013 ...
L. D. Zhao, H. J. Wu, S. Q. Hao, C. I. Wu, X. Y. Zhou, Kanishka Biswas, J. Q. He, T. P. Hogan, C. Uher, C. Wolverton, V. P. Dravid and M. G. Kanatzidis, All-scale hierarchical thermoelectrics: MgTe in PbTe facilitates valence band convergence and suppresses bipolar thermal transport for high performance, Energy Environ. Sci. 6, 3346 - 3355 (2013 ...
View Notes - Answers for Assignment_9 (Fall 2008) from BBA STAS2126 at Laurentian. STAS2126 Assignment#9 (Fall 2008) Submit to Dropbox not by emailUse your first and last name as the file name Do NOT
MetabolismTransport and binding proteinsCations and iron carrying compoundsH+ Antiporter protein (TIGR00900; HMM-score: 136.1) ...
MetabolismTransport and binding proteinsCations and iron carrying compoundsNa+/H+ antiporter NhaC (TIGR00931; HMM-score: 86.9) ...
Signs of Congenital chloride diarrhea including medical signs and symptoms of Congenital chloride diarrhea, symptoms, misdiagnosis, tests, common medical issues, duration, and the correct diagnosis for Congenital chloride diarrhea signs or Congenital chloride diarrhea symptoms.
Glycogen storage disease type Ib (GSD-Ib) is caused by a deficiency in the glucose-6-phosphate transporter (G6PT), a 10 transmembrane domain endoplasmic reticulum protein. To date, 69 G6PT mutations, including 28 missenses and 2 codon deletions, have been identified in GSD-Ib patients. We previously characterized 15 of the missense and one codon deletion mutations using a pSVL-based expression assay. A lack of sensitivity in this assay limited the discrimination between mutations that lead to loss of function and mutations that leave a low residual activity. We now report an improved G6PT assay, based on an adenoviral vector-mediated expression system and its use in the functional characterization of all 30 codon mutations found in GSD-Ib patients. Twenty of the naturally occurring mutations completely abolish microsomal G6P uptake activity while the other 10 mutations, including 5 previously characterized ones, partially inactivate the transporter. This information should greatly facilitate ...
Congenital Chloride diarrhea (CLD) is an intestinal transport defect of chloride ions. Retention of intestinal chloride causes water retention, which leads to watery diarrhea with an abnormally high chloride concentration. This defect presents in utero, with hydramnion presumably due to intrauterine diarrhea. The gestational period is shortened, and newborn babies have abdominal distension and chronic watery diarrhea. If untreated the condition leads to severe electrolyte changes with a fatal outcome, or to permanent damage of kidneys and brain. Treatment with chloride substitution and control of electrolyte balance is effective and patients can live an almost normal life complicated only by relatively loose stools.
Browse Sigma-Aldrichs Anion Exchange Media to find products in Amberlite Strong Anion Exchangers, Amberlite® Weak Anion Exchangers, Diaion® Strong Anion Exchanger, Diaion® Weak Anion Exchangers, Dowex® Strong Anion Exchangers, Dowex® Weak Anion Exchangers, Lewatit® Strong Anion Exchanger, Lewatit® Weak Anion Exchanger
Previous studies have demonstrated that systemic administration of glucocorticoids stimulates proximal tubule acidification in part by increasing Na+/H+ antiporter activity; however, these studies could not exclude the possibility that changes in Na+/H+ antiporter activity were secondary to glucocorticoid-induced hemodynamic changes. The present study examined the effect of dexamethasone on Na+/H+ antiporter activity in quiescent OKP cells. Na+/H+ antiporter activity was assayed as the initial rate of Na(+)-dependent pH recovery from an acid load. Intracellular pH was measured using the pH-sensitive dye 2,7-bis(carboxyethyl)-5(6)-carboxyfluorescein (BCECF). Dexamethasone produced a dose- and time-dependent stimulation of Na+/H+ antiporter activity in OKP cells. Dexamethasone produced a 24% stimulation in Na+/H+ antiporter activity at 10(-9) M and an approximately 40% stimulation of Na+/H+ antiporter activity at both 10(-8) and 10(-6) M. The effect of 10(-6) M dexamethasone was seen within 4 h ...
Thank you for your interest in spreading the word about Science Translational Medicine.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
The anion exchanger family (TC# 2.A.31) is a member of the large APC superfamily of secondary carriers. Members of the AE family are generally responsible for the transport of anions across cellular barriers, although their functions may vary. Characterized protein members of the AE family are found in plants, animals, insects and yeast. Uncharacterized AE homologues may be present in bacteria (e.g., in Enterococcus faecium, 372 aas; gi 22992757; 29% identity in 90 residues). Animal AE proteins consist of homodimeric complexes of integral membrane proteins that vary in size from about 900 amino acyl residues to about 1250 residues. Their N-terminal hydrophilic domains may interact with cytoskeletal proteins and therefore play a cell structural role. Some of the currently characterized members of the AE family can be found in the Transporter Classification Database. In humans, anion exchangers fall under the solute carrier family 4 (SLC4) family, which is composed of 10 paralogous members ...
LmrP is an electrogenic H(+)/drug antiporter that extrudes a broad spectrum of antibiotics. Five carboxylic residues are implicated in drug binding (Asp142 and Glu327) and proton motive force-mediated restructuring (Asp68, Asp128 and Asp235). ATR-FTIR (Attenuated Total Reflection - Fourier Transform Infrared) and tryptophan quenching experiments revealed that phosphatidylethanolamine (PE) is required to generate the structural intermediates induced by ionization of carboxylic residues. Surprisingly, no ionization-induced conformational changes were detectable in the absence of PE, suggesting either that carboxylic acid residues do not ionize or that ionization does not lead to any conformational change. The mean pKa of carboxylic residues evaluated by ATR-FTIR spectroscopy was 6.5 for LmrP reconstituted in PE liposomes, whereas the pKa calculated in the absence of PE was 4.6. Considering that 16 of the 19 carboxylic residues are located in the extramembrane loops, the pKa values obtained in the ...
Cl-/HCO3- exchangers are expressed abundantly in cardiac muscle, suggesting that HCO3- extrusion serves an important function in heart. Mice lacking Anion Exchanger Isoform 3 (AE3), a major cardiac Cl-/HCO3- exchanger, appear healthy, but loss of AE3 causes decompensation in a hypertrophic cardiomyopathy (HCM) model. Using intra-ventricular pressure analysis, in vivo pacing, and molecular studies we identified physiological and biochemical changes caused by loss of AE3 that may contribute to decompensation in HCM. AE3-null mice had normal cardiac contractility under basal conditions and after -adrenergic stimulation, but pacing of hearts revealed that frequency-dependent inotropy was blunted, suggesting that AE3-mediated HCO3- extrusion is required for a robust force-frequency response (FFR) during acute biomechanical stress in vivo. Modest changes in expression of proteins that affect Ca2+-handling were observed, but Ca2+-transient analysis of AE3-null myocytes showed normal twitch-amplitude and Ca2
Mutations in several SLC26 transporters are linked to human diseases, most of which involve epithelia dysfunction in specific organs. This indicates that SLC26 transporters play a central role in transepithelial fluid and electrolyte transport, including Cl− absorption and HCO3− secretion by the kidney, the GI tract, and secretory glands (Kunzelmann and Mall, 2002; Ko et al., 2004; Melvin et al., 2005; Steward et al., 2005). To understand the function of the SLC26 transporters in epithelial Cl− absorption and HCO3− secretion, it is essential to know their transport mechanism and Cl−/HCO3− transport stoichiometry. Two of the most studied SLC26 transporters are slc26a3 and slc26a6. Both were shown to function as Cl−/HCO3− exchangers (Melvin et al., 1999; Ko et al., 2002; Wang et al., 2002) and as electrogenic transporters (Ko et al., 2002; Xie et al., 2002) with isoform-specific stoichiometry (Ko et al., 2002). However, the electrogenicity of the transporters was called into ...
It was long thought that this coupled exchange of protons (in) and drugs (out) by the transporter was very strict. However, in a study published today (Nov. 7, 2017) in the journal Proceedings of the National Academy of Sciences, UW-Madison biochemistry professor Katherine Henzler-Wildman and collaborators at the Washington University School of Medicine in St. Louis have found that for E. colis small multidrug resistance transporter, called EmrE, proton and drug movements are not as strictly coupled. This transporter can actually also move drugs and protons across the membrane in the same direction, as well as the opposite direction - introducing the option of moving molecules both into or out of the cell ...
Get an answer for What causes a infant to have congential chloride diarrhea? and find homework help for other Science questions at eNotes
Disease: (OMIM: 126650 214700) Defects in SLC26A3 are the cause of diarrhea type 1 (DIAR1) [MIM:214700]; also known as congenital chloride diarrhea (CLD). DIAR1 is a disease characterized by voluminous watery stools containing an excess of chloride. The children with this disease are often premature ...
Beyond their roles in generating nerve impulses, ion channels are important for many facets of cell biology, including swelling and osmotic stress responses. Sabirov and colleagues now report that the prostaglandin transporter SLCO2A1 is a central component of the ubiquitous Maxi‐Cl anion channel. These findings add to a growing number of transporters displaying ion channel activity and not only provide a molecular handle for future Maxi‐Cl physiological and biophysical studies, but also underscore general questions about the principles that underlie such transporter/channel dual‐use behavior.. See also: RZ Sabirov et al (November 2017) ...
Curiously, instead of conferring tolerance to moderate Na+ stress or high K+, CHX20 consistently caused mutant KTA40-2 (Δena1-4 Δnha1 Δnhx1 Δkha1) to be more sensitive to salt. In another salt-sensitive yeast mutant, AXT3 (Δena1-4 Δnha1 Δnhx1), expression of AtCHX20 also resulted in increased sensitivity to moderate Na+ stress and high K+, although AtNHX1 or AtNHX2 conferred moderate tolerance to Na+ stress (data not shown) as shown before (Yokoi et al., 2002). Furthermore, CHX20 was unable to confer hygromycin B tolerance. Thus, AtCHX20 is functionally distinct from the vacuolar AtNHX1 that sequesters excess Na+ or K+ into vacuoles and confers tolerance to high Na+ or K+ and to hygromycin B (Pardo et al., 2006).. Instead, CHX20 function appears to be important particularly when K+ is depleted and when the external pH is slightly alkaline. This is shown by improved growth of KTA40-2 expressing CHX20 at pH 7.5 and when [K+]ext was low (between 0.4 and 3 mm). Yeast growth and budding ...
Thank you for your interest in spreading the word about Clinical Science.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Thank you for sharing this Drug Metabolism & Disposition article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
mode, was anticipated by work with more intensively These additional catalytic modes, which will be detailed studied Tet proteins and was confirmed by Yamaguchi et further below, have in common the use of cationic al. (1995) and Guffanti and Krulwich (1995). Modes II and substrates with single net charge, but the cytoplasmic III, the Monovalent cation/H+ Antiport and Monovalent substrates range from a Tc- -Me2+ complex that has regions cation or Tc- -Me2+/K+ Antiport (the Net K+ Uptake Mode), with highly non-polar features to highly hydrated respectively, were unanticipated, although Ives and Bott monovalent cations. The substrate diversity of Tet(L) and (1990) speculated that tetL was likely to have a Tc-unrelated Tet(K) opens up some of the same questions that are function of physiological significance. Chromosomally central to function of those MDRs whose substrates encoded Tet(L) from Bacillus subtilis was identified as a encompass diverse structures and both non-polar and polar possible ...
Principal Investigator:NAKAMURA Tatsunosuke, Project Period (FY):2002 - 2005, Research Category:Grant-in-Aid for Scientific Research (C), Section:一般, Research Field:Biological pharmacy
There are a number of resistance mechanisms, most require tetracycline antiporters. The most commonly used is the tetA(C) gene. The gene product of tetA(C) forms a pore in the inner membrane and exports one tet molecule for every proton imported. Molecular Cloning states that tet resistance has a number of adverse affects on the cell, chief among those being a reduction in growth rate and viability. ...
Issuu is a digital publishing platform that makes it simple to publish magazines, catalogs, newspapers, books, and more online. Easily share your publications and get them in front of Issuus millions of monthly readers. Title: Totem Report, Author: Cait Stevens, Name: Totem Report, Length: 102 pages, Page: 1, Published: 2016-04-25
Shop gex metal prints from thousands of artists from around the world. Our metal wall art produces vibrant colors and amazing details. Worldwide shipping available at
43 MemProtMD simulations of Antiporter activity in a lipid bilayer at both coarse-grained and atomistic respresentation, including both file download and analysis. Classification based on GO GO:0015297.
antiport definition: A structure in a cell membrane layer that simultaneously transports different molecules or ions through membrane in other directions; See anteport.; A structure in a cell membrane…
Infórmate sobre el Master in Sports Therapy - Máster en Terapia Deportiva Presencial en Northampton de Deporte impartido por University of Northampton
Uehara TN, Mizutani Y, Kuwata K, Hirota T, Sato A, Mizoi J, Takao S, Matsuo H, Suzuki T, Ito S, Saito AN, Nishiwaki-Ohkawa T, Yamaguchi-Shinozaki K, Yoshimura T, Kay SA, Itami K, Kinoshita T, Yamaguchi J, Nakamichi ...
The sodium-driven chloride/bicarbonate exchanger (NDCBE), a member of the SLC4 family of bicarbonate transporters, was recently found to modulate excitatory neurotransmission in hippocampus. et al., 2008). Comparable Na+-driven exchangers have been shown to regulate pH in invertebrate neuronal systems, including molluscan neurons and the squid giant axon (Boron and De Weer, 1976; Thomas, 1977). However, recent work raises the possibility that NDCBE may influence neurotransmission impartial of its effects on pH (Kim and Trussell, 2009). NDCBE and NDCBE-like activity has been detected in multiple brain regions in both rodents and humans (Baxter and Church, 1996; Chen et al., 2008; Damkier et al., 2007; Schwiening and Boron, 1994). The present study reveals a highly selective targeting of NDCBE to axon terminals, where it is closely associated with synaptic vesicles. Because NDCBE is an integral membrane protein, we conclude that this large majority of the vesicle-associated pool must be inserted ...
Congenital chloride diarrhea is an autosomal recessive type of chronic diarrhea characterized by voluminous watery stool containing high levels of chloride. It can present in patients of any age from newborns to adults, but onset is most often in the first weeks to months of life. Clinically, congenital chloride diarrhea is similar to Bartter syndrome, except these patients do not have calcium dysregulation ...
Junji Umeno, Tadakazu Hisamatsu, Motohiro Esaki, Atsushi Hirano, Takayuki Matsumoto, Kitazono T, A Hereditary Enteropathy Caused by Mutations in the SLCO2A1 Gene, Encoding a Prostaglandin Transporter., e1005581, 2015.11, Previously, we proposed a rare autosomal recessive inherited enteropathy characterized by persistent blood and protein loss from the small intestine as chronic nonspecific multiple ulcers of the small intestine (CNSU). By whole-exome sequencing in five Japanese patients with CNSU and one unaffected individual, we found four candidate mutations in the SLCO2A1 gene, encoding a prostaglandin transporter. The pathogenicity of the mutations was supported by segregation analysis and genotyping data in controls. By Sanger sequencing of the coding regions, 11 of 12 other CNSU patients and 2 of 603 patients with a diagnosis of Crohns disease were found to have homozygous or compound heterozygous SLCO2A1 mutations. In total, we identified recessive SLCO2A1 mutations located at seven ...
The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008 ...
Root efflux of organic acid anions underlies a major mechanism of plant aluminium (Al) tolerance on acid soils. This efflux is mediated by transporters of the Al-activated malate transporter (ALMT) or the multi-drug and toxin extrusion (MATE) families. ZmALMT2 was previously suggested to be involved in Al tolerance based on joint association-linkage mapping for maize Al tolerance. In the current study, we functionally characterized ZmALMT2 by heterologously expressing it in Xenopus laevis oocytes and transgenic Arabidopsis. In oocytes, ZmALMT2 mediated an Al-independent electrogenic transport product of organic and inorganic anion efflux. Ectopic overexpression of ZmALMT2 in an Al-hypersensitive Arabidopsis KO/KD line lacking the Al tolerance genes, AtALMT1 and AtMATE, resulted in Al-independent constitutive root malate efflux which partially restored the Al tolerance phenotype. The lack of correlation between ZmALMT2 expression and Al tolerance (e.g., expression not localized to the root tip, ...
Hypertension. 1984 Sep-Oct;6(5):731-5. Clinical Trial; Randomized Controlled Trial; Research Support, Non-U.S. Govt; Research Support, U.S. Govt, P.H.S.
A collection of disease information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Congenital chloride diarrhea
The mitochondrial aspartate/glutamate carrier catalyzes an important step in both the urea cycle and the aspartate/malate NADH shuttle. Citrin and aralar1 are homologous proteins belonging to the mitochondrial carrier family with EF-hand Ca(2+)-binding motifs in their N-terminal domains. Both proteins and their C-terminal domains were overexpressed in Escherichia coli, reconstituted into liposomes and shown to catalyze the electrogenic exchange of aspartate for glutamate and a H(+). Overexpression of the carriers in transfected human cells increased the activity of the malate/aspartate NADH shuttle. These results demonstrate that citrin and aralar1 are isoforms of the hitherto unidentified aspartate/glutamate carrier and explain why mutations in citrin cause type II citrullinemia in humans. The activity of citrin and aralar1 as aspartate/glutamate exchangers was stimulated by Ca(2+) on the external side of the inner mitochondrial membrane, where the Ca(2+)-binding domains of these proteins are ...
Anion exchanger 1 (AE1), also known as band 3 or SLC4A1, plays a key role in the removal of carbon dioxide from tissues by facilitating the exchange of chloride and bicarbonate across the plasma membrane of erythrocytes. An isoform of AE1 is also present in the kidney. Specific mutations in human AE1 cause several types of hereditary hemolytic anemias and/or distal renal tubular acidosis. Here we report the crystal structure of the band 3 anion exchanger domain (AE1CTD) at 3.5 angstroms. The structure is locked in an outward-facing open conformation by an inhibitor. Comparing this structure with a substrate-bound structure of the uracil transporter UraA in an inward-facing conformation allowed us to identify the anion-binding position in the AE1CTD, and to propose a possible transport mechanism that could explain why selected mutations lead to disease. ...

Antiporter Antics | Science SignalingAntiporter Antics | Science Signaling

X. Gao, F. Lu, L. Zhou, S. Dang, L. Sun, X. Li, J. Wang, Y. Shi, Structure and mechanism of an amino acid antiporter. Science ... Gao et al. now report a crystal structure of AdiC, an arginine:agmatine antiporter from E. coli. AdiC exhibits the same fold as ... The structure, together with biochemical data, suggests how the antiporter senses the pH and responds to transport the reaction ...
more info

Oxalate/formate antiporter (IPR026355) | InterPro | EMBL-EBIOxalate/formate antiporter (IPR026355) | InterPro | EMBL-EBI

Oxalate/formate antiporter (IPR026355). Short name: Oxa/Form_antiport Overlapping homologous superfamilies *MFS transporter ... In many of these cassettes, two subunits are found rather than one, suggesting the antiporter is sometimes homodimeric, ... Family members include the known oxalate/formate antiporter of Oxalobacter formigenes, as well as transporter subunits co- ...
more info

Antiporter - definition of antiporter by The Free DictionaryAntiporter - definition of antiporter by The Free Dictionary

antiporter synonyms, antiporter pronunciation, antiporter translation, English dictionary definition of antiporter. n biology a ... antiporter. Also found in: Medical, Encyclopedia, Wikipedia. antiporter. (ˈæntɪˌpɔːtə) n. (Biology) biology a membrane protein ... antiporter NHalp: Implications for its antiporter activity.. CHARACTERIZATION OF A WILD STRAIN OF Saccharomyces cerevisiae FOR ... Antiporter - definition of antiporter by The Free Dictionary ...
more info

Oxalate/formate antiporter family transporter (IPR004741) | InterPro | EMBL-EBIOxalate/formate antiporter family transporter (IPR004741) | InterPro | EMBL-EBI

Oxalate/formate antiporter family transporter (IPR004741). Short name: Oxa_For_antiport_fam_transptr ... Members include the oxalate/formate antiporter of Oxalobacter formigenes, where one substrate is decarboxylated in the cytosol ...
more info

Structural Biochemistry/Membrane Proteins/Antiporters - Wikibooks, open books for an open worldStructural Biochemistry/Membrane Proteins/Antiporters - Wikibooks, open books for an open world

Antiporters[edit]. An antiporter is an integral protein involved in secondary active transport, which couples the energy of a ... Antiporter, also called exchanger and counter-transporter, is an integral membrane protein that involves in a secondary active ... The antiporter simultaneously transports two molecules at the same time in the opposite direction. ... ATP-ADP translocase is one type of antiporter that assist in oxidative phosphorylation, a key component of cellular respiration ...
more info

Structure and Mechanism of an Amino Acid Antiporter | ScienceStructure and Mechanism of an Amino Acid Antiporter | Science

Step 1, substrate binding to the antiporter results in occlusion of primary substrate to the periplasm. Step 2, the antiporter ... GABA antiporter GadC (3, 4) and the Arg:Agm antiporter AdiC (5, 6) are at the center of the systems. ... cadaverine antiporter, CadB (9, 10); and the ornithine:putrescine antiporter, PotE (11-13). AdiC couples the influx of Arg with ... Structure and Mechanism of an Amino Acid Antiporter. By Xiang Gao, Feiran Lu, Lijun Zhou, Shangyu Dang, Linfeng Sun, Xiaochun ...
more info

antiporter activity - Semantic Scholarantiporter activity - Semantic Scholar

antiporter activity. Known as: porter, exchange transporter activity, Antiport (More). Enables the active transport of a solute ... A Na+/H+ antiporter coded by the nhaA (ant) gene of Escherichia coli has been overproduced and purified. The amino-terminal… ( ... A cDNA coding a new H+/organic cation antiporter, human kidney-specific multidrug and toxin extrusion 2 (hMATE2-K), has been… ( ... The Cl-/H+ antiporter ClC-7 is the primary chloride permeation pathway in lysosomes ...
more info

Antiporter - WikipediaAntiporter - Wikipedia

Antiporters at the US National Library of Medicine Medical Subject Headings (MeSH) Pak, J. E.; Ekende, E. N.; Kifle, E. G.; et ... Na+/H+ antiporters have been reviewed. In secondary active transport, one species of solute moves along its electrochemical ... An antiporter (also called exchanger or counter-transporter) is a cotransporter and integral membrane protein involved in ... Nov 12, 2013). "Structures of intermediate transport states of ZneA, a Zn(II)/proton antiporter". Proc Natl Acad Sci U S A. 110 ...
more info

Characterization of Bacterial Drug Antiporters Homologous to Mammalian Neurotransmitter Transporters | Journal of BacteriologyCharacterization of Bacterial Drug Antiporters Homologous to Mammalian Neurotransmitter Transporters | Journal of Bacteriology

This protein was shown to belong to the drug/H+ antiporters (DHA12) of the major facilitator superfamily. This family is ... Characterization of a Na+/H+ antiporter gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 84:2615-2619. ... The new sequences along with VMAT form a distinct cluster within the dendrogram of the MFS, drug-proton antiporters. A ... Characterization of Bacterial Drug Antiporters Homologous to Mammalian Neurotransmitter Transporters. Eyal Vardy, Sonia Steiner ...
more info

Antiporter | definition of antiporter by Medical dictionaryAntiporter | definition of antiporter by Medical dictionary

... antiporter explanation free. What is antiporter? Meaning of antiporter medical term. What does antiporter mean? ... Looking for online definition of antiporter in the Medical Dictionary? ... Antiporter , definition of antiporter by Medical dictionary ... antiporter. Also found in: Dictionary, Encyclopedia, Wikipedia. an·ti·por·ter. (antē-pōr-ter), A protein responsible for ...
more info

Calcium:cation antiporter - WikipediaCalcium:cation antiporter - Wikipedia

The Ca2+:cation antiporter (CaCA) family (TC# 2.A.19) is a member of the cation diffusion facilitator (CDF) superfamily. This ... The original text was at "2.A.19 The Ca2+:Cation Antiporter (CaCA) Family". Molecular and Cellular Biology portal. ... H+ antiporter of E. coli and the sixth contains only one distant S. cerevisiae homologue of unknown function. Several ... "Isolation and functional characterization of Ca2+/H+ antiporters from cyanobacteria". The Journal of Biological Chemistry. 279 ...
more info

Molecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter.  - PubMed - NCBIMolecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter. - PubMed - NCBI

Molecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter.. Wang S1, Yan R1, Zhang X1, Chu Q1 ... Identification of Tyr74 as a critical pH sensor in the amino acid antiporter AdiC. (A) The primary amino acid sequence AdiC. ... The latter process is mediated by the Arg:Agm antiporter AdiC, which is activated in response to acidic pH and remains fully ... Molecular mechanism of pH-dependent substrate transport by an arginine-agmatine antiporter ...
more info

hydrogen:vesicular amine antiporter activity QuickView - Correlation Enginehydrogen:vesicular amine antiporter activity QuickView - Correlation Engine

Catalysis of the transfer of a solute or solutes from one side of a vesicle membrane to the other according to the reaction: H+(in) + amino acid(out) = H+(out) + amino acid(in).
more info

Modest calcium increase in tomatoes expressing a variant ofArabidopsiscation/H+antiporter | SpringerLinkModest calcium increase in tomatoes expressing a variant ofArabidopsiscation/H+antiporter | SpringerLink

Hirschi KD, Zhen R-G, Cunningham KW, Rea PA, Fink GR (1996) CAX1, an H+/Ca2+ antiporter from Arabidopsis. Proc Natl Acad Sci ... Unlike 35S::sCAX1 construct, sCAX2A antiporter gene driven by 35S promoter can be a valuable tool for enriching Ca2+ contents ... Solanum lycopersicum Genetic transformation Cation/H+ antiporter Ca2+ nutrition Blossom-end rot Tip-burn ... Shigaki T, Pittman JK, Hirschi KD (2003) Manganese specificity determinants in the Arabidopsis metal/H+ antiporter CAX2. J Biol ...
more info

Integrating mass spectrometry with MD simulations reveals the role of lipids in Na+/H+ antiportersIntegrating mass spectrometry with MD simulations reveals the role of lipids in Na+/H+ antiporters

Na+/H+ antiporters are found in all kingdoms of life and exhibit catalysis rates that are among the fastest of all known ... Integrating mass spectrometry with MD simulations reveals the role of lipids in Na+/H+ antiporters. Landreh, Michael ... We speculate that elevator-type antiporters such as NapA, and likely NHA2, use a subset of annular lipids as structural support ... lipid-binding properties of the Na+/H+ exchanger NapA from Thermus thermophilus and compare this to the prototypical antiporter ...
more info

Involvement of aspartate/glutamate antiporter in fatty acid-induced uncoupling of liver mitochondria.  - PubMed - NCBIInvolvement of aspartate/glutamate antiporter in fatty acid-induced uncoupling of liver mitochondria. - PubMed - NCBI

It is found that both the antiporter substrates and the antiporter inhibitor operate as recouplers when uncoupling is caused by ... It is concluded that uncoupling by FFA in rat liver mitochondria is mediated not only by the ATP/ADP antiporter but also by the ... Involvement of aspartate/glutamate antiporter in fatty acid-induced uncoupling of liver mitochondria.. Samartsev VN1, Smirnov ... Half-maximal effects are observed at concentrations of glutamate and aspartate close the K(m) values of the antiporter. ...
more info

Expression of an Arabidopsis sodium/proton antiporter gene ( AtNHX1) in peanut to improve salt tolerance | SpringerLinkExpression of an Arabidopsis sodium/proton antiporter gene ( AtNHX1) in peanut to improve salt tolerance | SpringerLink

Li TX, Zhang Y, Liu H, Wu YT, Li WB, Zhang HX (2010) Stable expression of Arabidopsis vacuolar Na+/H+ antiporter gene AtNHX1, ... Xu K, Hong P, Luo L, Xia T (2009) Overexpression of AtNHX1, a vacuolar Na+/H+ antiporter from Arabidopsis thaliana, in Petunia ... Shi H, Quintero FJ, Pardo JM, Zhu JK (2002) The putative plasma membrane Na+/H+ antiporters SOS1 controls long distance Na+ ... Salt tolerance Sodium/proton antiporter Photosynthesis Photosynthetic parameters This is a preview of subscription content, log ...
more info

Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis | PNASEfflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis | PNAS

Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis. H E Takiff ... Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis ... Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis ... Efflux pump of the proton antiporter family confers low-level fluoroquinolone resistance in Mycobacterium smegmatis ...
more info

GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores | Journal of BacteriologyGerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores | Journal of Bacteriology

GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores. Penny D. Thackray, Javad Behravan, Thomas ... GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores. Penny D. Thackray, Javad Behravan, Thomas ... GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores. Penny D. Thackray, Javad Behravan, Thomas ... GerN, an Antiporter Homologue Important in Germination of Bacillus cereus Endospores Message Subject (Your Name) has forwarded ...
more info

Frontiers | Conserved and Diversified Gene Families of Monovalent Cation/H+ Antiporters from Algae to Flowering Plants | Plant...Frontiers | Conserved and Diversified Gene Families of Monovalent Cation/H+ Antiporters from Algae to Flowering Plants | Plant...

One strategy is mediated by cation-proton antiporters (CPA). CPA1 genes found in bacteria, fungi, metazoa and plants have been ... K+-efflux antiporter) and CHX (cation/H+ exchanger) families are largely unknown. Phylogenetic analysis showed that three ... One strategy is mediated by cation-proton antiporters (CPA). CPA1 genes found in bacteria, fungi, metazoa and plants have been ... functionally-characterized; though roles of plant CPA2 genes in KEA (K+-efflux antiporter) and CHX (cation/H+ exchanger) ...
more info

Structure and transport mechanism of the sodium/proton antiporter MjNhaP1 | eLifeStructure and transport mechanism of the sodium/proton antiporter MjNhaP1 | eLife

found that the structure of the M. jannaschii antiporter is very similar to the structures of an antiporter from another ... Na+/H+ antiporters are essential secondary-active transporters of the cation-proton antiporter (CPA) family (Brett et al., 2005 ... Sodium/proton antiporters maintain intracellular pH and sodium levels. Detailed structures of antiporters with bound substrate ... The electroneutral CPA1 and electrogenic CPA2 antiporters have different ion transport stoichiometries. CPA2 antiporters, such ...
more info

Mechanism of pH-dependent activation of the sodium-proton antiporter NhaAMechanism of pH-dependent activation of the sodium-proton antiporter NhaA

Escherichia coli NhaA is a prototype sodium-proton antiporter, which has been extensively characterized by X-ray ...
more info

nhaP2 - K(+)/H(+) antiporter NhaP2 - Escherichia coli O6:K15:H31 (strain 536 / UPEC) - nhaP2 gene & proteinnhaP2 - K(+)/H(+) antiporter NhaP2 - Escherichia coli O6:K15:H31 (strain 536 / UPEC) - nhaP2 gene & protein

... antiporter that extrudes potassium in exchange for external protons and maintains the internal concentration of potassium under ... sp,Q0TII4,NHAP2_ECOL5 K(+)/H(+) antiporter NhaP2 OS=Escherichia coli O6:K15:H31 (strain 536 / UPEC) OX=362663 GN=nhaP2 PE=3 SV= ... K(+)/H(+) antiporter NhaP2UniRule annotation. Manual assertion according to rulesi ... K+/H+ antiporter that extrudes potassium in exchange for external protons and maintains the internal concentration of potassium ...
more info

Molecular basis of substrate-induced permeation by an amino acid antiporter | IRB BarcelonaMolecular basis of substrate-induced permeation by an amino acid antiporter | IRB Barcelona

Kowalczyk L, Ratera M, Paladino A, Bartoccioni P, Errasti-Murugarren E, Valencia E, Portella G, Bial S, Zorzano A, Fita I, Orozco M, Carpena X, Vázquez-Ibar JL and Palacín M ...
more info
  • Two clusters consist exclusively of animal proteins, a third contains several bacterial and archaeal proteins, a fourth possesses yeast, plant and blue green bacterial homologues, the fifth contains only the ChaA Ca2+:H+ antiporter of E. coli and the sixth contains only one distant S. cerevisiae homologue of unknown function. (
  • K + /H + antiporter that extrudes potassium in exchange for external protons and maintains the internal concentration of potassium under toxic levels. (
  • An antiporter is an integral protein involved in secondary active transport, which couples the energy of a molecule moving down its concentration gradient to another moving up its concentration gradient. (
  • NHE3 is the sodium hydrogen antiporter 3, a protein essential in the absorption of sodium in the intestines. (
  • The high-resolution structures of two bacterial MFS proteins were solved: LacY, the lactose permease ( 1 ), and GlpT, the phosphate, glycerol 3-phosphate antiporter ( 10 ). (
  • 28 ) showed that a NaH antiporter homologue, named grmA , was important for the germination of spores of B. megaterium ATCC 12872 in any of its germinants (glucose, l -proline, l -leucine, or KNO 3 ). (
  • R:AGTTCAAGTCTGCCCCATTG bulgaricus Lactobacillus F: CCAGATCAGCCAACTTCACA Arginine- fermentum R: GGCAAACTTCAAGAGGACCA Ornitine antiporter Salmonella spp. (
  • Structural and biochemical analysis reveals the essential ligand-binding residues, defines the transport route, and suggests a conserved mechanism for the antiporter activity. (
  • To correct the symptoms and to moderately enhance the calcium level, a worldwide vegetable tomato was genetically engineered using a modified Arabidopsis cation/H + antiporter sCAX2A, a mutant form of Arabidopsis CAX2. (
  • Hirschi KD, Zhen R-G, Cunningham KW, Rea PA, Fink GR (1996) CAX1, an H + /Ca 2+ antiporter from Arabidopsis . (
  • There are two main forms of secondary active transport, antiporters and symporters. (
  • Na+/H+ antiporters are found in all kingdoms of life and exhibit catalysis rates that are among the fastest of all known secondary-active transporters. (
  • The physiological and functional properties of NapA-type antiporters are largely unknown. (
  • found that the structure of the M. jannaschii antiporter is very similar to the structures of an antiporter from another archaea species, which was studied in separate work. (
  • The structure, together with biochemical data, suggests how the antiporter senses the pH and responds to transport the reaction product agmatine out of the cell and Arg into the cell. (
  • The requirement for GerN function in the response to a particular germinant suggests that a germination receptor may have a specifically associated antiporter, which is required at the initiation of germination and which, in the case of the inosine receptor, is GerN. (
  • CPA antiporters are conserved across all biological kingdoms and play crucial roles in pH, ion and volume homeostasis ( Padan, 2013 ). (
  • We speculate that elevator-type antiporters such as NapA, and likely NHA2, use a subset of annular lipids as structural support to facilitate large-scale conformational changes within the membrane. (
  • This activating structural change occurs when a sodium ion binds to the antiporter rather than by a change in acidity. (
  • One of NapA-type antiporters in Synechocystis sp. (
  • These findings indicate that A. halophytica has two NapA1-type antiporters which exhibit different ion specificities and play an important role in salt tolerance at alkaline pH. (
  • In many of these cassettes, two subunits are found rather than one, suggesting the antiporter is sometimes homodimeric, sometimes heterodimeric. (
  • The main difference between this and the inward-open state is the movement of a bundle of six helices within the antiporter. (