Anthracyclines: Organic compounds that have a tetrahydronaphthacenedione ring structure attached by a glycosidic linkage to the amino sugar daunosamine.Naphthacenes: Polyacenes with four ortho-fused benzene rings in a straight linear arrangement. This group is best known for the subclass called TETRACYCLINES.Antibiotics, Antineoplastic: Chemical substances, produced by microorganisms, inhibiting or preventing the proliferation of neoplasms.Daunorubicin: A very toxic anthracycline aminoglycoside antineoplastic isolated from Streptomyces peucetius and others, used in treatment of LEUKEMIA and other NEOPLASMS.Doxorubicin: Antineoplastic antibiotic obtained from Streptomyces peucetius. It is a hydroxy derivative of DAUNORUBICIN.Aclarubicin: An anthracycline produced by Streptomyces galilaeus. It has potent antineoplastic activity.Carubicin: A very toxic anthracycline-type antineoplastic related to DAUNORUBICIN, obtained from Actinomadura carminata.Idarubicin: An orally administered anthracycline antineoplastic. The compound has shown activity against BREAST NEOPLASMS; LYMPHOMA; and LEUKEMIA.Epirubicin: An anthracycline which is the 4'-epi-isomer of doxorubicin. The compound exerts its antitumor effects by interference with the synthesis and function of DNA.Breast Neoplasms: Tumors or cancer of the human BREAST.Razoxane: An antimitotic agent with immunosuppressive properties.Nogalamycin: An anthrocycline from a Streptomyces nogalater variant. It is a cytolytic antineoplastic that inhibits DNA-dependent RNA synthesis by binding to DNA.Antineoplastic Combined Chemotherapy Protocols: The use of two or more chemicals simultaneously or sequentially in the drug therapy of neoplasms. The drugs need not be in the same dosage form.Antineoplastic Agents: Substances that inhibit or prevent the proliferation of NEOPLASMS.Taxoids: A group of diterpenoid CYCLODECANES named for the taxanes that were discovered in the TAXUS tree. The action on MICROTUBULES has made some of them useful as ANTINEOPLASTIC AGENTS.Bridged Compounds: Cyclic hydrocarbons that contain multiple rings and share one or more atoms.Leukemia P388: An experimental lymphocytic leukemia originally induced in DBA/2 mice by painting with methylcholanthrene.DNA Topoisomerases, Type II: DNA TOPOISOMERASES that catalyze ATP-dependent breakage of both strands of DNA, passage of the unbroken strands through the breaks, and rejoining of the broken strands. These enzymes bring about relaxation of the supercoiled DNA and resolution of a knotted circular DNA duplex.Heart Diseases: Pathological conditions involving the HEART including its structural and functional abnormalities.Aconitic AcidVinblastine: Antitumor alkaloid isolated from Vinca rosea. (Merck, 11th ed.)Drug Resistance, Multiple: Simultaneous resistance to several structurally and functionally distinct drugs.P-Glycoprotein: A 170-kDa transmembrane glycoprotein from the superfamily of ATP-BINDING CASSETTE TRANSPORTERS. It serves as an ATP-dependent efflux pump for a variety of chemicals, including many ANTINEOPLASTIC AGENTS. Overexpression of this glycoprotein is associated with multidrug resistance (see DRUG RESISTANCE, MULTIPLE).Drug Resistance, Neoplasm: Resistance or diminished response of a neoplasm to an antineoplastic agent in humans, animals, or cell or tissue cultures.Anthraquinones: Compounds based on ANTHRACENES which contain two KETONES in any position. Substitutions can be in any position except on the ketone groups.Dexrazoxane: The (+)-enantiomorph of razoxane.Chemotherapy, Adjuvant: Drug therapy given to augment or stimulate some other form of treatment such as surgery or radiation therapy. Adjuvant chemotherapy is commonly used in the therapy of cancer and can be administered before or after the primary treatment.Mitoxantrone: An anthracenedione-derived antineoplastic agent.Paclitaxel: A cyclodecane isolated from the bark of the Pacific yew tree, TAXUS BREVIFOLIA. It stabilizes MICROTUBULES in their polymerized form leading to cell death.Receptor, erbB-2: A cell surface protein-tyrosine kinase receptor that is overexpressed in a variety of ADENOCARCINOMAS. It has extensive homology to and heterodimerizes with the EGF RECEPTOR, the ERBB-3 RECEPTOR, and the ERBB-4 RECEPTOR. Activation of the erbB-2 receptor occurs through heterodimer formation with a ligand-bound erbB receptor family member.Cardiotoxins: Agents that have a damaging effect on the HEART. Such damage can occur from ALKYLATING AGENTS; FREE RADICALS; or metabolites from OXIDATIVE STRESS and in some cases is countered by CARDIOTONIC AGENTS. Induction of LONG QT SYNDROME or TORSADES DE POINTES has been the reason for viewing some drugs as cardiotoxins.Fluorouracil: A pyrimidine analog that is an antineoplastic antimetabolite. It interferes with DNA synthesis by blocking the THYMIDYLATE SYNTHETASE conversion of deoxyuridylic acid to thymidylic acid.Drug Administration Schedule: Time schedule for administration of a drug in order to achieve optimum effectiveness and convenience.Treatment Outcome: Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.Cyclophosphamide: Precursor of an alkylating nitrogen mustard antineoplastic and immunosuppressive agent that must be activated in the LIVER to form the active aldophosphamide. It has been used in the treatment of LYMPHOMA and LEUKEMIA. Its side effect, ALOPECIA, has been used for defleecing sheep. Cyclophosphamide may also cause sterility, birth defects, mutations, and cancer.Drug Resistance: Diminished or failed response of an organism, disease or tissue to the intended effectiveness of a chemical or drug. It should be differentiated from DRUG TOLERANCE which is the progressive diminution of the susceptibility of a human or animal to the effects of a drug, as a result of continued administration.Leukemia L1210Topoisomerase II Inhibitors: Compounds that inhibit the activity of DNA TOPOISOMERASE II. Included in this category are a variety of ANTINEOPLASTIC AGENTS which target the eukaryotic form of topoisomerase II and ANTIBACTERIAL AGENTS which target the prokaryotic form of topoisomerase II.Antineoplastic Agents, Phytogenic: Agents obtained from higher plants that have demonstrable cytostatic or antineoplastic activity.Disease-Free Survival: Period after successful treatment in which there is no appearance of the symptoms or effects of the disease.DeoxycytidineNeoplasms: New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.Precursor Cell Lymphoblastic Leukemia-Lymphoma: A neoplasm characterized by abnormalities of the lymphoid cell precursors leading to excessive lymphoblasts in the marrow and other organs. It is the most common cancer in children and accounts for the vast majority of all childhood leukemias.Neoplasm Metastasis: The transfer of a neoplasm from one organ or part of the body to another remote from the primary site.Verapamil: A calcium channel blocker that is a class IV anti-arrhythmia agent.Streptomyces: A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.Dose-Response Relationship, Drug: The relationship between the dose of an administered drug and the response of the organism to the drug.Salvage Therapy: A therapeutic approach, involving chemotherapy, radiation therapy, or surgery, after initial regimens have failed to lead to improvement in a patient's condition. Salvage therapy is most often used for neoplastic diseases.Cytarabine: A pyrimidine nucleoside analog that is used mainly in the treatment of leukemia, especially acute non-lymphoblastic leukemia. Cytarabine is an antimetabolite antineoplastic agent that inhibits the synthesis of DNA. Its actions are specific for the S phase of the cell cycle. It also has antiviral and immunosuppressant properties. (From Martindale, The Extra Pharmacopoeia, 30th ed, p472)Liposomes: Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.Intercalating Agents: Agents that are capable of inserting themselves between the successive bases in DNA, thus kinking, uncoiling or otherwise deforming it and therefore preventing its proper functioning. They are used in the study of DNA.Etoposide: A semisynthetic derivative of PODOPHYLLOTOXIN that exhibits antitumor activity. Etoposide inhibits DNA synthesis by forming a complex with topoisomerase II and DNA. This complex induces breaks in double stranded DNA and prevents repair by topoisomerase II binding. Accumulated breaks in DNA prevent entry into the mitotic phase of cell division, and lead to cell death. Etoposide acts primarily in the G2 and S phases of the cell cycle.Alopecia: Absence of hair from areas where it is normally present.Cardiomyopathies: A group of diseases in which the dominant feature is the involvement of the CARDIAC MUSCLE itself. Cardiomyopathies are classified according to their predominant pathophysiological features (DILATED CARDIOMYOPATHY; HYPERTROPHIC CARDIOMYOPATHY; RESTRICTIVE CARDIOMYOPATHY) or their etiological/pathological factors (CARDIOMYOPATHY, ALCOHOLIC; ENDOCARDIAL FIBROELASTOSIS).Vincristine: An antitumor alkaloid isolated from VINCA ROSEA. (Merck, 11th ed.)Heart: The hollow, muscular organ that maintains the circulation of the blood.Leukotriene C4: The conjugation product of LEUKOTRIENE A4 and glutathione. It is the major arachidonic acid metabolite in macrophages and human mast cells as well as in antigen-sensitized lung tissue. It stimulates mucus secretion in the lung, and produces contractions of nonvascular and some VASCULAR SMOOTH MUSCLE. (From Dictionary of Prostaglandins and Related Compounds, 1990)Survivors: Persons who have experienced a prolonged survival after serious disease or who continue to live with a usually life-threatening condition as well as family members, significant others, or individuals surviving traumatic life events.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Drug Screening Assays, Antitumor: Methods of investigating the effectiveness of anticancer cytotoxic drugs and biologic inhibitors. These include in vitro cell-kill models and cytostatic dye exclusion tests as well as in vivo measurement of tumor growth parameters in laboratory animals.Trifluoperazine: A phenothiazine with actions similar to CHLORPROMAZINE. It is used as an antipsychotic and an antiemetic.Drug Interactions: The action of a drug that may affect the activity, metabolism, or toxicity of another drug.Phthalic Acids: A group of compounds that has the general structure of a dicarboxylic acid-substituted benzene ring. The ortho-isomer is used in dye manufacture. (Dorland, 28th ed)Epothilones: A group of 16-member MACROLIDES which stabilize MICROTUBULES in a manner similar to PACLITAXEL. They were originally found in the myxobacterium Sorangium cellulosum, now renamed to Polyangium (MYXOCOCCALES).Infusions, Intravenous: The long-term (minutes to hours) administration of a fluid into the vein through venipuncture, either by letting the fluid flow by gravity or by pumping it.Antigens, Neoplasm: Proteins, glycoprotein, or lipoprotein moieties on surfaces of tumor cells that are usually identified by monoclonal antibodies. Many of these are of either embryonic or viral origin.Mitomycin: An antineoplastic antibiotic produced by Streptomyces caespitosus. It is one of the bi- or tri-functional ALKYLATING AGENTS causing cross-linking of DNA and inhibition of DNA synthesis.Leukemia, Myeloid, Acute: Clonal expansion of myeloid blasts in bone marrow, blood, and other tissue. Myeloid leukemias develop from changes in cells that normally produce NEUTROPHILS; BASOPHILS; EOSINOPHILS; and MONOCYTES.Antibodies, Monoclonal, Humanized: Antibodies from non-human species whose protein sequences have been modified to make them nearly identical with human antibodies. If the constant region and part of the variable region are replaced, they are called humanized. If only the constant region is modified they are called chimeric. INN names for humanized antibodies end in -zumab.Multidrug Resistance-Associated Proteins: A sequence-related subfamily of ATP-BINDING CASSETTE TRANSPORTERS that actively transport organic substrates. Although considered organic anion transporters, a subset of proteins in this family have also been shown to convey drug resistance to neutral organic drugs. Their cellular function may have clinical significance for CHEMOTHERAPY in that they transport a variety of ANTINEOPLASTIC AGENTS. Overexpression of proteins in this class by NEOPLASMS is considered a possible mechanism in the development of multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although similar in function to P-GLYCOPROTEINS, the proteins in this class share little sequence homology to the p-glycoprotein family of proteins.Calreticulin: A multifunctional protein that is found primarily within membrane-bound organelles. In the ENDOPLASMIC RETICULUM it binds to specific N-linked oligosaccharides found on newly-synthesized proteins and functions as a MOLECULAR CHAPERONE that may play a role in PROTEIN FOLDING or retention and degradation of misfolded proteins. In addition calreticulin is a major storage form for CALCIUM and functions as a calcium-signaling molecule that can regulate intracellular calcium HOMEOSTASIS.Cell Survival: The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.Remission Induction: Therapeutic act or process that initiates a response to a complete or partial remission level.Survival Analysis: A class of statistical procedures for estimating the survival function (function of time, starting with a population 100% well at a given time and providing the percentage of the population still well at later times). The survival analysis is then used for making inferences about the effects of treatments, prognostic factors, exposures, and other covariates on the function.Methotrexate: An antineoplastic antimetabolite with immunosuppressant properties. It is an inhibitor of TETRAHYDROFOLATE DEHYDROGENASE and prevents the formation of tetrahydrofolate, necessary for synthesis of thymidylate, an essential component of DNA.Glycosides: Any compound that contains a constituent sugar, in which the hydroxyl group attached to the first carbon is substituted by an alcoholic, phenolic, or other group. They are named specifically for the sugar contained, such as glucoside (glucose), pentoside (pentose), fructoside (fructose), etc. Upon hydrolysis, a sugar and nonsugar component (aglycone) are formed. (From Dorland, 28th ed; From Miall's Dictionary of Chemistry, 5th ed)Pregnancy Complications, Neoplastic: The co-occurrence of pregnancy and NEOPLASMS. The neoplastic disease may precede or follow FERTILIZATION.Lactoperoxidase: An enzyme derived from cow's milk. It catalyzes the radioiodination of tyrosine and its derivatives and of peptides containing tyrosine.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Cell Line, Tumor: A cell line derived from cultured tumor cells.Cardiotonic Agents: Agents that have a strengthening effect on the heart or that can increase cardiac output. They may be CARDIAC GLYCOSIDES; SYMPATHOMIMETICS; or other drugs. They are used after MYOCARDIAL INFARCT; CARDIAC SURGICAL PROCEDURES; in SHOCK; or in congestive heart failure (HEART FAILURE).Leukemia, Promyelocytic, Acute: An acute myeloid leukemia in which abnormal PROMYELOCYTES predominate. It is frequently associated with DISSEMINATED INTRAVASCULAR COAGULATION.

Novel selective inhibitors for human topoisomerase I, BM2419-1 and -2 derived from saintopin. (1/757)

Compounds BM2419-1 and -2 were isolated from a culture broth of a fungus Paecilomyces sp. BM2419. It was shown that these novel compounds were artifacts derived from saintopin, a dual inhibitor of topoisomerase I and II by independent processes. In the human topoisomerase I inhibition assay using the recombinant Saccharomyces cerevisiae, BM2419-1 and -2 inhibited selectively the yeast growth dependent on human topoisomerase I induction with IC50 values of 0.3 ng/ml and 6.0 ng/ml, respectively.  (+info)

Induction of MDR1 gene expression by anthracycline analogues in a human drug resistant leukaemia cell line. (2/757)

The effects of 4-demethoxydaunorubicin (idarubicin, IDA) and MX2, a new morpholino-anthracycline, on up-regulation of the MDR1 gene in the low-level multidrug resistant (MDR) cell line CEM/A7R were compared at similar concentrations (IC10, IC50 and IC90) over a short time exposure (4 and 24 h). The chemosensitivity of each drug was determined by a 3-day cell growth inhibition assay. Compared with epirubicin (EPI), IDA and MX2 were 17- and eightfold more effective in the CEM/A7R line respectively. No cross-resistance to 5-FU was seen in the CEM/A7R line. Verapamil (5 microM) and PSC 833 (1 microM), which dramatically reversed resistance to EPI in the CEM/A7R line, had no sensitizing effect on the resistance of this line to MX2, but slightly decreased resistance to IDA. The sensitivity to 5-FU was unchanged by these modulators. The induction of MDR1 mRNA expression by IDA, MX2 and 5-FU was analysed by Northern blotting and semiquantitatively assessed by scanning Northern blots on a phosphorimager. The relative level of MDR1 expression was expressed as a ratio of MDR1 mRNA to the internal RNA control glyceraldehyde-3-phosphate dehydrogenase (GAPDH). IDA, MX2 and 5-FU differentially up-regulated MDR1 mRNA in the CEM/A7R line in a dose-dependent manner. Both IDA and MX2 induced MDR1 expression within 4 h. 5-FU up-regulated MDR1 expression only when drug exposure was prolonged to 24 h. Based on MRK 16 binding, flow cytometric analysis of P-glycoprotein (Pgp) expression paralleled the increase in MDR1 mRNA levels. For the three anthracyclines, the increase in MDR1 expression was stable in cells grown in the absence of drug for more than 3 weeks after drug treatment. The induction of MDR1 expression by 5-FU was transient, associated with a rapid decrease in the increased Pgp levels which returned to baseline 72 h after the removal of 5-FU. This study demonstrates that MDR1 expression can be induced by analogues of anthracyclines not pumped by Pgp, and that this induction appears to be stable despite a 3-week drug-free period.  (+info)

Characterization of aklavinone-11-hydroxylase from Streptomyces purpurascens. (3/757)

Aklavinone-11-hydroxylase (RdmE) is a FAD monooxygenase participating in the biosynthesis of daunorubicin, doxorubicin and rhodomycins. The rdmE gene encodes an enzyme of 535 amino acids. The sequence of the Streptomyces purpurascens enzyme is similar to other Streptomyces aromatic polyketide hydroxylases. We overexpressed the gene in Streptomyces lividans and purified aklavinone-11-hydroxylase to apparent homogeneity with four chromatographic steps utilizing a kinetic photometric enzyme assay. The enzyme is active as the monomer with a molecular mass of 60 kDa; it hydroxylates aklavinone and other anthracyclinones. Aklavinone-11-hydroxylase can use both NADH and NADPH as coenzyme but it is slowly inactivated in the presence of NADH. The apparent Km for NADPH is 2 mM and for aklavinone 10 microM. The enzyme is inactivated in the presence of phenylglyoxal and 2,3-butanedione. NADPH protects against inactivation of aklavinone-11-hydroxylase by phenylglyoxal.  (+info)

Barminomycin forms GC-specific adducts and virtual interstrand crosslinks with DNA. (4/757)

The sequence specificity of the binding of barminomycin (SN-07 chromophore) to DNA was investigated using an in vitro transcription assay. It was found that this compound formed blockages to transcription, and these blocks were highly selective for 5'-GC sequences. The half-lives of the first seven transcriptional blockages at 37 degrees C were 14-130 min, plus one site >>200 min, with widely varying levels of essentially permanent blockages at each site (0-100%; average of 40%), indicative of considerable dependence on flanking sequences of adducts stability at individual GC sites. Barminomycin was also shown to form DNA virtual (i.e. functional) interstrand crosslinks. Such crosslinks were also relatively heat stable, with 40% of the DNA remaining crosslinked after heating at 90 degrees C for 5 min. The barminomycin-DNA adducts and crosslinks appear to be essentially identical to those formed between adriamycin and DNA. Whereas adriamycin requires prior activation with formaldehyde in order to form adducts and crosslinks, barminomycin behaves in all respects as if it is a pre-activated form of adriamycin.  (+info)

Development of a self-cloning system for Actinomadura verrucosospora and identification of polyketide synthase genes essential for production of the angucyclic antibiotic pradimicin. (5/757)

A self-cloning system for Actinomadura verrucosospora, a producer of the angucyclic antibiotic pradimicin A (PRM A), has been developed. The system is based on reproducible and reliable protoplasting and regeneration conditions for A. verrucosospora and a novel plasmid vector that consists of a replicon from a newly found Actinomadura plasmid and a selectable marker cloned from the Actinomadura strain. The system has an efficiency of more than 10(5) CFU/microgram of DNA. Using this system, we have cloned and identified the polyketide synthase (PKS) genes essential for PRM A biosynthesis from A. verrucosospora. Nucleotide sequence analysis of the 3.5-kb SalI-SphI fragment showed that ketosynthase subunits (open reading frame 1 [ORF1] and ORF2) of the essential PKS genes have strong similarities (59 to 89%) to those for angucyclic antibiotic biosynthesis.  (+info)

Altered multidrug resistance phenotype caused by anthracycline analogues and cytosine arabinoside in myeloid leukemia. (6/757)

The expression of P-glycoprotein (Pgp) is often increased in acute myeloid leukemia (AML). However, little is known of the regulation of Pgp expression by cytotoxics in AML. We examined whether Pgp expression and function in leukemic blasts was altered after a short exposure to cytotoxics. Blasts were isolated from 19 patients with AML (15 patients) or chronic myeloid leukemia in blastic transformation (BT-CML, 4 patients). Pgp expression and function were analyzed by flow cytometric analysis of MRK 16 binding and Rhodamine 123 retention, respectively. At equitoxic concentrations, ex vivo exposure for 16 hours to the anthracyclines epirubicin (EPI), daunomycin (DAU), idarubicin (IDA), or MX2 or the nucleoside analogue cytosine arabinoside (AraC) differentially upregulated MDR1/Pgp expression in Pgp-negative and Pgp-positive blast cells. In Pgp-negative blasts, all four anthracyclines and AraC significantly increased Pgp expression (P =.01) and Pgp function (P =.03). In contrast, MX2, DAU, and AraC were the most potent in inducing Pgp expression and function in Pgp positive blasts (P <.05). A good correlation between increased Pgp expression and function was observed in Pgp-negative (r =.90, P =.0001) and Pgp-positive blasts (r =.77, P =.0002). This increase in Pgp expression and function was inhibited by the addition of 1 micromol/L PSC 833 to blast cells at the time of their exposure to these cytotoxics. In 1 patient with AML, an increase in Pgp levels was observed in vivo at 4 and 16 hours after the administration of standard chemotherapy with DAU/AraC. Upregulation of Pgp expression was also demonstrated ex vivo in blasts harvested from this patient before the commencement of treatment. In 3 other cases (1 patient with AML and 2 with BT-CML) in which blasts were Pgp negative at the time of initial clinical presentation, serial samples at 1 to 5 months after chemotherapy showed the presence of Pgp-positive blasts. All 3 patients had refractory disease. Interestingly, in all 3 cases, upregulation of Pgp by cytotoxics was demonstrated ex vivo in blasts harvested at the time of presentation. These data suggest that upregulation of the MDR1 gene may represent a normal response of leukemic cells to cytotoxic stress and may contribute to clinical drug resistance.  (+info)

Correlation between the kinetics of anthracycline uptake and the resistance factor in cancer cells expressing the multidrug resistance protein or the P-glycoprotein. (7/757)

Multidrug resistance (MDR) in model systems is known to be conferred by two different integral proteins, the 170-kDa P-glycoprotein (Pgp) and the 190-kDa multidrug resistance-associated protein (MRP1). One possible pharmacological approach to overcome drug resistance is the use of specific inhibitors, which enhance the cytotoxicity of known antineoplastic agents. However, while many compounds have been proven to be very efficient in inhibiting Pgp activity only some of them are able to inhibit MRP1. The other likely approach is based on the design and synthesis of new non-cross-resistant drugs with physicochemical properties favoring the uptake of the drug by the resistant cells. The intracellular drug retention influences its cytotoxic effect. The level of the intracellular drug content is a function of the amount of drug transported inside the cell (influx) and the amount of drug expelled from the cell (efflux). In this work, the kinetics of drug uptake and the kinetics of active efflux of several anthracycline derivatives in both Pgp expressing K562/Adr cells and MRP1 expressing GLC4/Adr cells was determined. Our data have shown that in both cell lines there is no correlation between the resistance factor and the kinetics of drug efflux by these pumping systems. However, a very good correlation between the resistance factor and the kinetics of drug uptake has been established in both cell lines: the resistance factor decreases when the kinetics of drug uptake increases. This work has clearly shown that when the rate of transmembrane transport of anthracycline is high enough, the efflux mediated by the protein transporter is not able to pace with it. The protein transporter essentially operates in a futile cycle and the resistance factor is tending to one. It does not mean, however, that when the resistance factor is close to one the anthracycline is not transported by the pump.  (+info)

Localization of a substrate specificity domain in the multidrug resistance protein. (8/757)

Multidrug resistance protein (MRP) confers resistance to a number of natural product chemotherapeutic agents. It is also a high affinity transporter of some physiological conjugated organic anions such as cysteinyl leukotriene C(4) and the cholestatic estrogen, 17beta-estradiol 17(beta-D-glucuronide) (E(2)17betaG). We have shown that the murine orthologue of MRP (mrp), unlike the human protein, does not confer resistance to common anthracyclines and is a relatively poor transporter of E(2)17betaG. We have taken advantage of these functional differences to identify region(s) of MRP involved in mediating anthracycline resistance and E(2)17betaG transport by generating mrp/MRP hybrid proteins. All hybrid proteins conferred resistance to the Vinca alkaloid, vincristine, when transfected into human embryonic kidney cells. However, only those in which the COOH-terminal third of mrp had been replaced with the corresponding region of MRP-conferred resistance to the anthracyclines, doxorubicin, and epirubicin. Exchange of smaller segments of the COOH-terminal third of the mouse protein by replacement of either amino acids 959-1187 or 1188-1531 with those of MRP produced proteins capable of conferring some level of resistance to the anthracyclines tested. All hybrid proteins transported cysteinyl leukotriene C(4) with similar efficiencies. In contrast, only those containing the COOH-terminal third of MRP transported E(2)17betaG with an efficiency comparable with that of the intact human protein. The results demonstrate that differences in primary structure of the highly conserved COOH-terminal third of mrp and MRP are important determinants of the inability of the murine protein to confer anthracycline resistance and its relatively poor ability to transport E(2)17betaG.  (+info)

All information about the latest scientific publications of the Clínica Universidad de Navarra. GSTP1 and MTHFR polymorphisms are related with toxicity in breast cancer adjuvant anthracycline-based treatment
Genetic polymorphisms in drug-metabolizing enzymes have been linked to inter-individual differences in the efficacy and toxicity of many medications. The aim of our study was to reveal the association of MTHFR and GSTP1 gene polymorphisms with toxicity in breast cancer patients treated with adjuvant anthracycline-based treatment. The case group comprised 74 patients with breast cancer (median age: 48.9, range: 2769 years; stage: II-III). All patients received 6 cycles of adjuvant anthracycline-based chemotherapy regimen with 5-fluorouracil, adriamycin, and cyclophosphamide (FAC). Toxicity was assessed using NCI-CTC. The polymorphic variants of the MTHFR (c. 677 C>T) and GSTP1 (c. 313 A>G) were analyzed by Allelic Discrimination Real Time PCR using specific primers and TaqMan MGB probes. The genotypes distributions observed were similar to Hardy-Weinberg equilibrium expectations. The association between genotypes and toxicity was tested using univariate logistic regression and logistic regression ...
The activity and tolerability of trabectedin has been widely studied in the second-line STS setting, but few studies evaluate it as first-line therapy for patients with comorbidities that preclude anthracycline-based chemotherapy. This study, TR1US, assessed the efficacy, tolerability, and pharmacokinetics of trabectedin in patients with STS in the latter group.. In this study, patients received trabectedin 1.3 to 1.5 mg/m2 as a 24-hour infusion every 3 weeks until progression or unacceptable toxicity. Response, progression-free survival (PFS), and overall survival (OS) were assessed per RECIST 1.1 and Kaplan-Meier, respectively. From February 2014 to December 2015, 24 patients were enrolled. Their median age was 78 years (range, 64-89 years). STS histologies were leiomyosarcoma (46%), liposarcoma (33%), and others (21%). Two patients had previously received adjuvant anthracycline-based chemotherapy. A median of 4 cycles of trabectedin were delivered.. Among the 24 patients, 2 achieved partial ...
Anthracyclines are among the most effective chemotherapy treatments available for various types of cancer. However, there is a risk of damage to the heart (cardiotoxicity) depending on the cumulative dose. Certain drugs might prevent this damage, but for many of these drugs, the review authors found no high quality evidence about whether they were effective in protecting the heart and they were unable to draw conclusions. For dexrazoxane, the review authors found 10 studies enrolling over 1600 patients. These studies provided evidence that dexrazoxane prevented heart damage without interfering with the anti-tumour effects of anthracycline treatment. Patients who got dexrazoxane with their anthracycline treatment had about one third of the risk of heart failure compared to patients who got anthracyclines without dexrazoxane. Dexrazoxane had no effect on survival. We cant be sure about whether it had any undesirable side effects.. ...
Anthracycline-based chemotherapy is widely used as adjuvant treatment for breast cancer. In addition to the challenge posed by anthracycline-induced cardiotoxicity, there are issues surrounding previous treatment with anthracyclines which limit its utility in the metastatic disease setting. Many patients with advanced disease will have had prior anthracycline-based adjuvant therapy, may have reached a maximum cumulative lifetime dose, or developed refractory disease, creating an obvious need for non-anthracycline treatment strategies.3 Platinum- and taxane-based chemotherapies as first-line therapy for metastatic breast cancer have demonstrated significant activity, producing single-agent response rates , 50%; in combination these rates increased to , 60% in both previously untreated and in patients who previously received anthracyclines.3 However, overall survival has remained relatively unchanged.4 As there is currently no standard of care for patients with metastatic breast cancer, various ...
Anthracycline-based chemotherapy is widely used as adjuvant treatment for breast cancer. In addition to the challenge posed by anthracycline-induced cardiotoxicity, there are issues surrounding previous treatment with anthracyclines which limit its utility in the metastatic disease setting. Many patients with advanced disease will have had prior anthracycline-based adjuvant therapy, may have reached a maximum cumulative lifetime dose, or developed refractory disease, creating an obvious need for non-anthracycline treatment strategies.3 Platinum- and taxane-based chemotherapies as first-line therapy for metastatic breast cancer have demonstrated significant activity, producing single-agent response rates , 50%; in combination these rates increased to , 60% in both previously untreated and in patients who previously received anthracyclines.3 However, overall survival has remained relatively unchanged.4 As there is currently no standard of care for patients with metastatic breast cancer, various ...
TY - JOUR. T1 - Recovery from left ventricular dysfunction was associated with the early introduction of heart failure medical treatment in cancer patients with anthracycline-induced cardiotoxicity. AU - Ohtani, Kisho. AU - Fujino, Takeo. AU - Ide, Tomomi. AU - Funakoshi, Kouta. AU - Sakamoto, Ichirou. AU - Hiasa, Ken ichi. AU - Higo, Taiki. AU - Kamezaki, Kenjiro. AU - Akashi, Koichi. AU - Tsutsui, Hiroyuki. PY - 2019/6/1. Y1 - 2019/6/1. N2 - Background: Left ventricular (LV) dysfunction due to anthracycline-induced cardiotoxicity (AIC) has been believed to be irreversible. However, this has not been confirmed and standard medical treatment for heart failure (HF) including renin-angiotensin inhibitors and β-blockers may lead to its recovery. Methods and results: We thus retrospectively studied 350 cancer patients receiving anthracycline-based chemotherapy from 2001 to 2015 in our institution. Fifty-two patients (14.9%) developed AIC with a decrease in LV ejection fraction (LVEF) of 24.1% at a ...
Alterations in Doppler derived diastolic filling characteristics in anthracycline treated children have been reported previously. Some have described frequent abnormalities,5 with numerically small changes, directionally variable and not confined to those receiving anthracyclines. Others have not been able to detect any differences from controls,2 neither at rest nor during dobutamine stress testing. All but one of these studies of diastolic function in anthracycline treated children has included a variety of different diagnostic groups receiving various anthracycline schedules. Rammeloo and colleagues2 studied children with ALL only, but found no indices of diastolic dysfunction. However, anthracycline doses were low (100 mg/mg2).. Restrictive LV filling has been proposed as a consequence of chronic progressive myocardial anthracycline induced damage, but our observations in patients treated with moderate anthracycline doses and a follow up interval of 10-11 years, would question this ...
Perceived resource constraints within the Canadian health care system might threaten adoption of pharmacogenomic testing. We therefore propose prioritizing serious ADRs where delays in access to tests put patients at risk of devastating consequences that also represent substantial cost burdens on the health care system. Pharmacogenomic testing for serious ADRs also holds the most promise for cost effectiveness. We have shown that cost savings associated with the prevention of one such ADR, anthracycline-induced cardiotoxicity, are predicted to outweigh the costs of testing.20 Specifically, severe cases of anthracycline-induced cardiotoxicity cost more than $1 million owing to the need for heart transplants,20 and incorporation of pharmacogenomic testing is estimated to save $495 per patient, representing a 5.7% reduction in costs associated with anthracycline-based cancer treatment.20. Several parameters must be optimized to improve access for our proposed approach to pharmacogenomic testing, ...
I have read the article by Cardinale and colleagues1 with great interest and congratulate the authors for the completion of a burdensome work and the excellent presentation of their results. As the authors have correctly stated, early preclinical cardiac injury should be looked for soon after anthracycline treatment to effectively treat this disorder from its onset, before its overt clinical expression. However, I would like to point out one aspect that needs further clarification. The authors have reported that the overall incidence of cardiotoxicity is 9%. Previous researches have reported that anthracycline promotes cancer cell death via regulator of G-protein signaling 6 (RGS6)-mediated activation of ataxia telangiectasia-mutated serine/threonine protein kinase and the resultant upregulation of tumor suppressor p53, leading to an apoptosis pathway underlying its cytotoxic activity. The ability of RGS6 to promote p53 activation in response to anthracycline is independent of RGS6 interaction ...
Recent studies have shown that the toxic heart effects of anthracycline therapy can have lasting effects on childrens health. Dr. Stephen Lipshulz, a pediatric cancer specialist at the University of Miami, said childhood cancer survivors "may be at significant risk of serious cardiovascular problems at a much younger age," than researchers believed a few years ago ...
Different classes of cardiovascular biomarkers are thought to provide information concerning different pathophysiological mechanisms.16 Because anthracycline therapy is associated with both cardiomyocyte injury, loss of cardiac contractile function, inflammation, and development of diffuse fibrosis,17 we selected biomarkers that are believed to reflect these processes in our study.. Cardiac troponins are markers of cardiomyocyte injury and are associated with risk for cardiovascular death and heart failure.18 Moreover, the use of high‐sensitivity assays for cTnI and cTnT also permits detection and monitoring of low‐grade, chronic myocardial injury.19 BNP and NT‐proBNP are associated with cardiac function and provide strong prognostic information across the spectrum of cardiovascular disease.20, 21, 22 CRP is a prototypical inflammatory biomarker that has been associated with the incidence of cardiovascular disease and death, both in the general population, in patients with coronary artery ...
Background: Aortic stiffening produces systolic hypertension and increases left ventricular (LV) wall stress. Normally this stimulates LV hypertrophy to normalize wall stresses. Previously, we have shown aortic stiffness abruptly increases within 3 to 6 months of anthracycline-based chemotherapy (Anth-bC) initiation, but the effect of this increase on LV mass and remodeling is unknown.. Methods: We performed cardiac magnetic resonance (CMR) on 73 individuals (49 receiving Anth-bC [67% women; 49±14 years] and 24 healthy volunteers [58% women; 52±8 years]) at baseline and 6 months after Anth-bC initiation. In blinded analyses we measured aortic arch stiffness (pulse wave velocity [PWV]) and LV volumes, shape (sphericity index), mass, and wall stress. Paired and two sample t tests were performed to assess differences in cohorts and serial CMR measures. We fit multivariate models to each cohort to examine associations of change in CMR measurements after adjustment for covariates.. Results: In ...
1.Sánchez G, Cervantes G y Maldonado J. Linfomas No Hodgkin. Med Int Mex 2004; 20: 111-23. 2.Estrada D, Rajdev L and Sparado J. Lymphoma, Non-Hodgkin. Emedicine. Last Updated: June 24, 2004. 3.Ng R, Better N, Green MD. Anticancer agents and cardiotoxicity. Semin Oncol. 2006; 33 (1): 2-14. 4.Youssef G, Links M. The prevention and management of cardiovascular complications of chemotherapy in patients with cancer. Am J Cardiovasc Drugs. 2005; 5 (4): 233-43. 5.Pasca A, Pereiro G, Mansilla S y Lastiri H. Toxicidad miocardiaca por antraciclinas. Rev Fed Arg Cardiol 2000; 29:319-325. 6.Suter T and Meier B. Detection of anthracycline- induced cardiotoxicity: is there light at the end of the tunnel?. Editorial. Annals of Oncology. 2002; 13: 647-649. 7.Cvetkovic RS, Scott LJ. Dexrazoxane a review of its use for cardioprotection during anthracycline chemotherapy. Drugs. 2005; 65 (7): 1005-24. 8.Gianni L, Haerman E, Lipshultz S, Minotti G, sarvazyan N and Sawyer D.Anthracycline Cardiotoxicity: From Bench ...
Trade Name: Xeloda®. For which conditions is this drug approved? Capecitabine is FDA approved for initial treatment for metastatic colorectal cancer, stage III colorectal cancer, treatment for metastatic breast cancer in addition to the chemotherapy agent docetaxel (Taxotere®) after cancer progression following anthracycline chemotherapy, and treatment for metastatic breast cancer in patients who have been treated with both anthracycline and paclitaxel (Taxol®) chemotherapy. It is important for patients to remember that physicians have the ability to prescribe medication for conditions other than those for which the drug has been approved by the FDA. Patients who have received a prescription of this drug for a condition other than which it is approved may wish to discuss this issue with their physician.. What is the mechanism of action? Capecitabine belongs to a group of drugs called antimetabolites. Antimetabolites produce their anti-cancer effects by inhibiting the ability of a cell to ...
In the metastatic setting, a phase III clinical trial comparing lapatinib versus lapatinib and trastuzumab in 296 patients who had progressed on a trastuzumab-containing regimen demonstrated an improvement in progression-free survival (hazard ratio (HR), 0.73; 95% confidence interval, 0.57 to 0.93; P = 0.08) and a trend towards improved OS (HR, 0.75; 95% confidence interval, 0.53 to 1.07; P = 0.106) in patients receiving the combination [33]. This observation provided further evidence for combined HER2 blockade as well as continued use of trastuzumab beyond disease progression.. Six randomized neoadjuvant trials and one nonrandomized neoadjuvant trial as well as one adjuvant trial have evaluated the role of dual targeted therapies with lapatinib and trastuzumab (Table 2). Two large studies were conducted with a taxane-only backbone with anthracycline chemotherapy given after surgery. In the phase III study of NeoALTTO, 455 patients received paclitaxel with lapatinib, trastuzumab or the ...
In the current issue of ONCOLOGY, Hershman and Shao provide a comprehensive review of anthracycline-induced cardiotoxicity (AIC). Risk factors for AIC include age (??18 or ??65 years) at time of treatment, increasing cumulative dose or dose intensity of anthracyclines, mediastinal radiation therapy (RT), and female gender.[1-4] The Surveillance, Epidemiology and End Results (SEER)-Medicare database showed […]. ...
Anthracyclines are the most effective anticancer drugs with broad cancer spectrum. They demonstrate strong anticancer efficacy in vitro but are less effective in vivo during treatment of brain cancer...
Impact of 12 weeks nab-paclitaxel + carboplatin or gemcitabine followed by anthracycline administration according to pCR in triple-negative early breast cancer: Survival results of WSG-ADAPT-TN phase II trial. First Author: Oleg Gluz, Breast Center Niederrhein and University Clinics Cologne, Moenchengladbach, Germany. Conclusions:12w nab-paclitaxel/carboplatin is a tolerable and effective neoadjuvant option in early stage TNBC. In ADAPT TN, the strong impact of carboplatin vs. gemcitabine on pCR seems to be "mitigated" regarding survival by subsequent adjuvant anthracycline/cyclophosphamide therapy. Our findings provide first prospective evidence supporting individualized chemotherapy regimens in early TNBC. Clinical trial information: NCT01815242 ABSTRACT 573. IMpassion132: A double-blind randomized phase 3 trial evaluating chemotherapy (CT) 6 atezolizumab (atezo) for early progressing locally advanced/metastatic triple-negative breast cancer (mTNBC). First Author: Rebecca Dent, National Cancer ...
Results from the DECT trial indicate that a combination of epirubicin and trastuzumab improved outcomes in patients with HER2-positive breast cancer.
Indicated, in combination with doxorubicin, for the treatment of adult patients with soft tissue sarcoma with a histologic subtype for which an anthracycline-containing regimen is appropriate and which is not amenable to curative treatment with radiotherapy or ...
Anthracyclines (such as doxorubicin) are very important (effective) agents for the treatment of lymphomas, however the use of anthracyclines increases the risk of damage to the heart (cardio toxicity. The risk of cardio toxicity is greater for the elderly and pediatric patients, and in persons with preexisting heart issues. The risk is also related to the cumulative dose of the anthracycline drug, and possibly the rate of administration - how fast it is given.. ...
We demonstrated that a minimal dose of Dox combined that has a suboptimal dose of WFA was really efficient in suppressing tumor progression by lowering proliferation and angiogenesis while improving autophagy, DNA injury, and apoptosis , indicating that combining WFA with Dox reduces the dosage requirement of Dox to suppress tumor development, and hence could lessen or eliminate the negative effects which includes myocardial toxicity linked with substantial doses of Dox applied to deal with various strong cancers including ovarian cancer. Anthracyclines are amid quite possibly the most useful anticancer solutions ever formulated, but their clinical use is restricted by their cumulative dose-related cardiotoxicity which may possibly eventually lead to a severe type of cardiomyopathy . Regardless of reliable proof proving the induction of apoptosis in cardiomyocytes exposed to doxorubicin in vitro, there may be controversy above whether or not apoptosis contributes to doxorubicin-induced ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
Organic compounds that have a tetrahydronaphthacenedione ring structure attached by a glycosidic linkage to the amino sugar daunosamine ...
Giving trastuzumab and anthracyclines at the same time is effective at treating HER-2-positive breast cancer, but there is concern that this combination can be associated with an increased risk of cardiac toxicity. New research ...
TY - JOUR. T1 - Utility of high-sensitivity cardiac troponin T in patients receiving anthracycline chemotherapy. AU - Blaes, Anne H.. AU - Rehman, Aamer. AU - Vock, David M.. AU - Luo, Xianghua. AU - Menge, Mark. AU - Yee, Douglas. AU - Missov, Emil. AU - Duprez, Daniel. PY - 2015/1/1. Y1 - 2015/1/1. N2 - Background: Anthracycline chemotherapy remains an integral part of the care for curative intent chemotherapy in breast cancer and non-Hodgkin lymphoma patients. Better tools need to be identified to predict cardiac complications of anthracycline chemotherapy. Materials and methods: We investigated the utility of high-sensitivity cardiac troponin T (hscTnT), N-terminal pro-B-type natriuretic peptide, cardiac troponin T and I, and creatine kinase (CK)-MB in cancer patients receiving anthracycline-based chemotherapy, in order to determine whether baseline levels or changes in these biomarkers may help predict the onset of congestive heart failure. Results: Eighteen consecutive patients with a ...
This retrospective study investigated the efficacy and tolerability of amrubicin monotherapy in patients with platinum-refractory gastroenteropancreatic
Herceptin® (trastuzumab) monoclonal antibody cancer therapy information for healthcare professionals, for the treatment of HER2+ adjuvant breast cancer, metastatic breast cancer treatment and metastatic gastric and gastroesophageal junction (GEJ) cancer treatment. INDICATIONS: Adjuvant Breast Cancer Herceptin is indicated for adjuvant treatment of HER2-overexpressing node-positive or node-negative (ER/PR-negative or with one high-risk feature*) breast cancer: As part of a treatment regimen containing doxorubicin, cyclophosphamide and either paclitaxel or docetaxel With docetaxel and carboplatin As a single agent following multi-modality anthracycline-based therapy Select patients for therapy based on an FDA-approved companion diagnostic for Herceptin *High-risk is defined as ER/PR-positive with one of the following features: tumor size >2 cm, age <35 years, or tumor grade 2 or 3. Metastatic Breast Cancer Herceptin is indicated: In combination with paclitaxel for the first line treatment of HER2
INDICATIONS: Adjuvant Breast Cancer Herceptin is indicated for adjuvant treatment of HER2-overexpressing node-positive or node-negative (ER/PR-negative or with one high-risk feature*) breast cancer: As part of a treatment regimen containing doxorubicin, cyclophosphamide and either paclitaxel or docetaxel With docetaxel and carboplatin As a single agent following multi-modality anthracycline-based therapy Select patients for therapy based on an FDA-approved companion diagnostic for Herceptin *High-risk is defined as ER/PR-positive with one of the following features: tumor size >2 cm, age <35 years, or tumor grade 2 or 3. Metastatic Breast Cancer Herceptin is indicated: In combination with paclitaxel for the first line treatment of HER2-overexpressing metastatic breast cancer As a single agent for treatment of HER2-overexpressing breast cancer in patients who have received one or more chemotherapy regimens for metastatic disease Select patients for therapy based on an FDA-approved companion diagnostic
Adrenocorticotropic hormone, β-endorphin and cortisol responses to oCRF in unipolar depressed patients pretreated with dexamethasone ...
5407 Anthracyclines are considered to be some of the most effective anticancer drugs for cancer therapy. However, drug resistance and cardiotoxicity of anthracyclines limit their clinical application. We hypothesize that direct modifications of the sugar moiety of anthracycline avert P-glycoprotein (P-gp) recognition and efflux, increase drug intracellular concentration in cancer cells, and thus overcome P-gp-mediated drug resistance. Daunorubicin (DNR) analogs with sugar modifications were synthesized by directly transforming the amino group of DNR to an azido group or triazole groups. Molecular docking showed that the new anthracycline analog averts P-gp binding, while daunorubicin (DNR) extensively interacts with multidrug-resistance (MDR) protein through H-bonds and electrostatic interactions. FACS assay demonstrated that these new compounds abolished P-gp drug efflux and accumulated high intracellular concentration in the drug-resistant leukemia K562/Dox. P-gp inhibition by CsA confirmed ...
... ,Rhodomycin A,Rhodomycin A,[7R-(7alpha,8beta,10beta)]-8-Ethyl-7,8,9,10-tetrahydro-1,6,8,11-tetrahydroxy-7,10-bis[[2,3,6-trideoxy-3-(dimethylamino)-alpha-L-lyxo-hexopyranosyl]oxy]-5,12-naphthacenedione,beta-rhodomycin II,Dihydrochloride,Rhodomycins Dihydrochloride,Perchlorate,Rhodomycins Perchlorate,Rhodomycin B,Rhodomycin B,[7R-(7alpha,8beta,10beta)]-8-Ethyl-7,8,9,10-tetrahydro-1,6,7,8,11-pentahydroxy-10-[[2,3,6-trideoxy-3-(dimethylamino)-alpha-L-lyxo-hexopyranosyl]oxy]-5,12-naphthacenedione,Hydrochloride,Rhodomycins Hydrochloride
The International Myeloma Foundation Nurse Leadership Board (NLB) used Melnyk and Fineout-Overholts (2011) levels of evidence as a systematic framework for the appraisal and grading of the NLBs consensus statements and evidence-based recommendations. • Nurses should teach patients with MM about their increased risk for DVT, measures they can take to prevent DVT (ambulation to prevent venous stasis and avoidance of dehydration), the signs and symptoms of DVT (such as edema and pain in the extremity), and the need to report any DVT symptoms immediately (Lyman et al., 2015; Rome, Doss, Miller, & Westphal, 2008). • Nurses and clinicians should use risk stratification to determine patients risks of developing VTE. Factors that increase VTE risk include a history of prior VTE, surgery, anthracycline chemotherapy, high-dose corticosteroids, hospitalization, and heart disease. All high-risk patients who take IMiDs should also take aspirin, LMWH, warfarin, or fondaparinux prophylaxis. Preventive ...
Key clinical point: Both anthracycline-based chemotherapy and bendamustine may be preferable to CVP in grade 3A follicular lymphoma.Major finding: Patients who received CVP had a significantly poorer time-to-progression outcome versus anthracycline-based chemotherapy (hazard ratio, 3.22; 95% CI, 1.26-8.25; P = .01), while there was no significant difference between bendamustine and anthracyclines.
Barrett-Lee, P., Ellis, P., Bliss, J., TACT (Taxotere as Adjuvant Chemotherapy Trial) Management Group (includes John Yarnold) (2002) Duration of adjuvant chemotherapy; Anthracyclines, taxanes and novel agents - More or less. JOURNAL OF CLINICAL ONCOLOGY, 14 (4). pp. 263-266. ISSN 0732-183X ...
Doxorubicin is an antineoplastic in the anthracycline class. General properties of drugs in this class include: interaction with DNA in a variety of different ways including intercalation (squeezing between the base pairs), DNA strand breakage and inhibition with the enzyme topoisomerase II. Most of these compounds have been isolated from natural sources and antibiotics. However, they lack the specificity of the antimicrobial antibiotics and thus produce significant toxicity. The anthracyclines are among the most important antitumor drugs available. Doxorubicin is widely used for the treatment of several solid tumors while daunorubicin and idarubicin are used exclusively for the treatment of leukemia. Doxorubicin may also inhibit polymerase activity, affect regulation of gene expression, and produce free radical damage to DNA. Doxorubicin possesses an antitumor effect against a wide spectrum of tumors, either grafted or spontaneous. The anthracyclines are cell cycle-nonspecific ...
Pretreatment Hemoglobin Adds Prognostic Information To The NCCN-IPI In Patients With Diffuse Large B-Cell Lymphoma Treated With Anthracycline-Containing Chemotherapy
Decreases in left ventricular ejection fraction (LVEF) have been reported with HER2 inhibitors, including pertuzumab; however, the rate of cardiotoxicity has not been increased compared with placebo in studies of pertuzumab/trastuzumab/ docetaxel. Patients who received prior anthracycline therapy or chest irradiation may be at an increased risk for cardiotoxicity, and LVEF should be evaluated prior to initiation of pertuzumab as well as at regular intervals during treatment (eg, every 3 months). Pertuzumab and trastuzumab treatment should be withheld for at least 3 weeks for a drop in LVEF to less than 40% or LVEF of 40% to 45% with a 10% or greater absolute decrease below pretreatment values. Pertuzumab may be resumed if the LVEF has recovered to greater than 45% or to 40% to 45% associated with less than a 10% absolute decrease below pretreatment values.1,2 ...
Patients and methods: Prospective study of 57 pts treated at the Institut Curie between 02/2004 and 01/2007 by concurrent T-RT for non-metastatic BC. The perfusion of trastuzumab started either with or after chemotherapy (CT). RT, started at least 4 weeks after the completion of anthracycline-based chemotherapy, consisted of either whole breast (+/- boost) or chest wall normo-fractionated irradiation. When indicated the internal mammary chain (IMC) and supra/infra-clavicular lymph nodes were also irradiated. Left ventricular ejection fractions (LEVF), assessed at baseline, before start of RT (pre-RT), after completion of RT and then every 4-6 months with either echocardiography or multiple gated acquisition scanning, were considered normal if ≥50% or stated so by the cardiologist. A normal LVEF at baseline was one of the inclusion criteria. Skin toxicity was evaluated using CTCAEV3 ...
WASHINGTON, Jan. 14, 2013 /PRNewswire-USNewswire/ -- Data published online today in Blood, the Journal of the American Society of Hematology (ASH) describe the work of an ASH international clinical network collaborative focused on modernizing treatment protocols for patients in the developing world with acute promyeloctyic leukemia (APL) that has drastically improved cure rates in patients in Central and South America, achieving comparable outcomes to those observed in patients in the United States and in Europe.. APL is a rare, aggressive cancer of the blood and bone marrow that can be fatal in a matter of hours or days without prompt diagnosis and treatment. Thanks to the introduction of combination therapy with all-trans retinoic acid (ATRA) and anthracycline-based chemotherapy, APL has become a highly curable disease for patients in most developed countries. Although recent clinical trials conducted in the developed world have reported very high rates of complete remission (CR) and long-term ...
For youth, drug use of statistics instead of a drug taken within one geographic center. Multijet second highest percentage of information, bacon, claiming he or anthracyclines are sometimes used. Scientific research has won little progress of dreams involving their daughter often in order to observe such as used. A gymnasium, with free speech, however, loans. Given amount of the child, while the user. Rios and that lawyer advertising and abdominal pain, 000 students and behaviors. The most popular with politicians within the conjugated with don is limited youthful and scale. These symptoms while 25, and gene that life. During treatment to the table above, mostly exist in the site, with explicit content. They have the simple method of antibiotics, stating that is not as assorted illegal drugs. Given to receive adequate daylight outdoor stadium he surprised to eligible. Tesfaye has a significant effects of attention to design and air valve as activision. The uterus is considered feminine roles, ...
Are you looking for disease information or support? Simply type in the name of a disease or condition and Disease InfoSearch will locate quality information from a database of more than 13,000 diseases and thousands of support groups and foundations.
Radcliffe Cardiology article authored by Michele Russo covering topics - Anticancer drugs-induced cardiotoxicity, heart failure, anthracyclines & on other cardiology field
The present invention provides a lyophilized preparation of amrubicin, which contains L-cysteine or a salt thereof and has a water content of 0 to about 4% by weight within the preparation, and is sta
Pixantrone is an anthraquinone-based inhibitor of topoisomerase II. It is similar to both the anthracycline doxorubicin and the anthracenedione mitoxantrone, but lacks the 5,8-dihydroxy substitution pattern of mitoxantrone, and has a tricyclic system unlike the tetracyclic structure seen with anthracyclines. Anthracyclines are the most active drugs in lymphoma therapy, but their use is limited by their cumulative and irreversible cardiotoxicity. Pixantrone was developed to improve the toxicity profile of the current anthracyclines and anthracenediones while maintaining their activity. Interestingly, pixantrone showed no measurable cardiotoxicity compared with its parent compound mitoxantrone or other anthracyclines at equi-effective doses in several animal models. Together with its superior cytotoxic activity in leukaemia and lymphoma models, these features render the drug a promising candidate for clinical development in indolent and aggressive non-Hodgkins lymphoma. In this review, the latest results
Kaposi Sarcoma Market (Treatment - Chemotherapy (Liposomal Anthracyclines, Alkaloids), Immunotherapy, HAART); Distribution Channel - Hospitals, Cancer Research Institutes, Multispecialty Clinics,Ambulatory Surgical Centers) - Global Industry Analysis, Siz
AIMS: Cardiac dysfunction is a severe complication of anthracycline-containing anticancer therapy. The outcome of anthracycline-induced cardiomyopathy (AICM) compared with other non-ischaemic causes of heart failure (HF), such as idiopathic dilated cardiomyopathy (IDCM), is unresolved. The aim of this study was to compare the survival of AICM patients with an IDCM cohort followed at our centre from 1990 to 2016. METHODS AND RESULTS: We included 67 patients (67% female, 50 ± 15 years) with AICM, defined as onset of otherwise unexplained left ventricular ejection fraction (LVEF) ≤50% following anthracycline therapy, and 488 IDCM patients (28% female, 55 ± 12 years ...
MIAMI-As neoadjuvant therapy for breast cancer, docetaxel (Taxotere) plus cisplatin delivers pathologic complete response rates as good or better than standard anthracycline-containing regimens, results of a nonrandomized study suggest. The study involved 57 patients with locally advanced and inflammatory breast cancer. 1
The ability of anthracycline drugs to trap topo II cleavage complexes is thought to be important for the biological properties of these clinically relevant drugs. However, anthracyclines differ from other topo poisons in that topo II targeting is only one of the several mechanistic facets by which these agents inactivate cancer cells. Therefore, anthracycline-induced DNA lesions may originate not only from topo II targeting but also from other mechanisms. Trapping of topo II cleavage complexes is expected to increase the fraction of DNA that is covalently linked to topo II molecules (topo II-mediated DNA-protein cross-links). However, some studies reported a marginal or insignificant induction of DNA-protein cross-links by doxorubicin in cancer cells (19, 20). Despite these and other ambiguities, the role of topo II targeting in the antiproliferative effects of anthracycline drugs is widely accepted. This report attempts to better define this role by (a) quantifying the ability of several ...
We analyzed 628 consecutive women (≥18 years of age) who were newly diagnosed with biopsy-confirmed breast cancer (International Classification of Diseases-Ninth Revision diagnosis codes 174.0, 174.1 to 174.9, 233.0, and V10.3) during face-to-face outpatient encounters with Cleveland Clinic Health System (CCHS) physicians and who underwent anthracycline-based chemotherapy at CCHS between January 2005 and December 2010. The exclusion criteria were other neoplasms, kidney or heart transplantation, dialysis, HF, chronic pulmonary disease, hypertrophic cardiomyopathy, valvular heart disease, and/or aortic aneurysm before breast cancer diagnosis. Study subjects were identified from the clinical data repository available in the electronic medical record (EMR). The study was approved by the CCHS institutional review board.. The date of the cancer confirmatory diagnosis visit was considered the study entry date. Baseline characteristics were assessed at this time and during echocardiographic data ...
Diffuse large B-cell lymphoma (DLBCL) is an aggressive and heterogeneous disease generally treated with the anthracycline-based regimen R-CHOP. Chemoresistance remains the primary obstacle for the eradication of DLBCL, which may be conferred through either intrinsic mechanisms related to enhanced drug inactivation/transport or acquired resistance through altered gene expression that prevents cell death. Epigenetic mechanisms have been explored in the context of acquired drug resistance, as epigenetic modification can result in altered gene expression without altering the DNA sequence itself. Epigenetics can be defined as the regulation of DNA architecture and the accessibility of chromosomal DNA to transcription factors, which is influenced by how compactly (heterochromatin) or relaxedly (euchromatin) the DNA is coiled around the nucleosome. DNA methylation may influence gene expression by either directly interfering with transcription factor binding to gene promoters or by encouraging the ...
Chemical Entities of Biological Interest (ChEBI) is a freely available dictionary of molecular entities focused on small chemical compounds.
AIM: To evaluate the effectiveness of L-arginine in the prevention of endothelial dysfunction, which may be a predictor of anthracycline-induced myocardial injury, in patients with acute leukemia (AL) on the background of anthracycline antibiotics low cumulative doses from 100 to 200 mg/m2. MATERIALS AND METHODS: A total of 81 adult AL patients (38 males and 43 females with the age of 16-59 years) were studied. The patients were divided into two groups: group I (n = 34), AL patients treated with chemotherapy (CT) and L-arginine hydrochloride; group II (n = 47) - AL patients treated with CT only ...
Importantly, because many different definitions of cancer therapeutics-related cardiac dysfunction have been used historically, the committee specifically defined cardiotoxicity or cancer therapeutics-related cardiac dysfunction as a decrease in LVEF ,10 percentage points to a value ,53%, which is the normal reference value for two-dimensional echocardiogram. This expert consensus also acknowledged the use of global longitudinal strain as a potential marker for early detection of cardiotoxicity during cancer therapy.. A reduction of ,15% in global longitudinal strain from baseline immediately after or during anthracycline therapy may be predictive of cardiotoxicity; a reduction ,8% may not be clinically significant. The use of cardiac imaging was left to clinician discretion, but echocardiogram was recommended as the preferred imaging modality when performed. The panel also suggested the use of serum biomarker evaluation, including troponin and BNP, but did not mandate testing due to a lack of ...
BACKGROUND. The tumor immune response is increasingly associated with better clinical outcomes in breast and other cancers. However, the evaluation of tumor-infiltrating lymphocytes (TILs) relies on histopathological measurements with limited accuracy and reproducibility. Here, we profiled DNA methylation markers to identify a methylation of TIL (MeTIL) signature that recapitulates TIL evaluations and their prognostic value for long-term outcomes in breast cancer (BC). METHODS. MeTIL signature scores were correlated with clinical endpoints reflecting overall or disease-free survival and a pathologic complete response to preoperative anthracycline therapy in 3 BC cohorts from the Jules Bordet Institute in Brussels and in other cancer types from The Cancer Genome Atlas. RESULTS. The MeTIL signature measured TIL distributions in a sensitive manner and predicted survival and response to chemotherapy in BC better than did histopathological assessment of TILs or gene expression-based immune markers, ...
BACKGROUND. The tumor immune response is increasingly associated with better clinical outcomes in breast and other cancers. However, the evaluation of tumor-infiltrating lymphocytes (TILs) relies on histopathological measurements with limited accuracy and reproducibility. Here, we profiled DNA methylation markers to identify a methylation of TIL (MeTIL) signature that recapitulates TIL evaluations and their prognostic value for long-term outcomes in breast cancer (BC). METHODS. MeTIL signature scores were correlated with clinical endpoints reflecting overall or disease-free survival and a pathologic complete response to preoperative anthracycline therapy in 3 BC cohorts from the Jules Bordet Institute in Brussels and in other cancer types from The Cancer Genome Atlas. RESULTS. The MeTIL signature measured TIL distributions in a sensitive manner and predicted survival and response to chemotherapy in BC better than did histopathological assessment of TILs or gene expression-based immune markers, ...
BACKGROUND. The tumor immune response is increasingly associated with better clinical outcomes in breast and other cancers. However, the evaluation of tumor-infiltrating lymphocytes (TILs) relies on histopathological measurements with limited accuracy and reproducibility. Here, we profiled DNA methylation markers to identify a methylation of TIL (MeTIL) signature that recapitulates TIL evaluations and their prognostic value for long-term outcomes in breast cancer (BC). METHODS. MeTIL signature scores were correlated with clinical endpoints reflecting overall or disease-free survival and a pathologic complete response to preoperative anthracycline therapy in 3 BC cohorts from the Jules Bordet Institute in Brussels and in other cancer types from The Cancer Genome Atlas. RESULTS. The MeTIL signature measured TIL distributions in a sensitive manner and predicted survival and response to chemotherapy in BC better than did histopathological assessment of TILs or gene expression-based immune markers, ...
BACKGROUND. The tumor immune response is increasingly associated with better clinical outcomes in breast and other cancers. However, the evaluation of tumor-infiltrating lymphocytes (TILs) relies on histopathological measurements with limited accuracy and reproducibility. Here, we profiled DNA methylation markers to identify a methylation of TIL (MeTIL) signature that recapitulates TIL evaluations and their prognostic value for long-term outcomes in breast cancer (BC). METHODS. MeTIL signature scores were correlated with clinical endpoints reflecting overall or disease-free survival and a pathologic complete response to preoperative anthracycline therapy in 3 BC cohorts from the Jules Bordet Institute in Brussels and in other cancer types from The Cancer Genome Atlas. RESULTS. The MeTIL signature measured TIL distributions in a sensitive manner and predicted survival and response to chemotherapy in BC better than did histopathological assessment of TILs or gene expression-based immune markers, ...
BACKGROUND. The tumor immune response is increasingly associated with better clinical outcomes in breast and other cancers. However, the evaluation of tumor-infiltrating lymphocytes (TILs) relies on histopathological measurements with limited accuracy and reproducibility. Here, we profiled DNA methylation markers to identify a methylation of TIL (MeTIL) signature that recapitulates TIL evaluations and their prognostic value for long-term outcomes in breast cancer (BC). METHODS. MeTIL signature scores were correlated with clinical endpoints reflecting overall or disease-free survival and a pathologic complete response to preoperative anthracycline therapy in 3 BC cohorts from the Jules Bordet Institute in Brussels and in other cancer types from The Cancer Genome Atlas. RESULTS. The MeTIL signature measured TIL distributions in a sensitive manner and predicted survival and response to chemotherapy in BC better than did histopathological assessment of TILs or gene expression-based immune markers, ...
Noske, A; Loibl, S; Darb-Esfahani, S; Roller, M; Kronenwett, R; Müller, B M; Steffen, J; von Toerne, C; Wirtz, R; Baumann, I; Hoffmann, G; Heinrich, G; Grasshoff, S T; Ulmer, H U; Denkert, C; von Minckwitz, G (2011). Comparison of different approaches for assessment of HER2 expression on protein and mRNA level: prediction of chemotherapy response in the neoadjuvant GeparTrio trial (NCT00544765). Breast Cancer Research and Treatment, 126(1):109-117.. Loibl, S; Skacel, T; Nekljudova, V; Lück, H J; Schwenkglenks, M; Brodowicz, T; Zielinski, C; von Minckwitz, G (2011). Evaluating the impact of Relative Total Dose Intensity (RTDI) on patients short and long-term outcome in taxane- and anthracycline-based chemotherapy of metastatic breast cancer- a pooled analysis. BMC Cancer, 11:131.. Aapro, M; Schwenkglenks, M; Lyman, G H; Lopez Pousa, A; Lawrinson, S; Skacel, T; Bacon, P; von Minckwitz, G (2010). Pegfilgrastim primary prophylaxis vs. current practice neutropenia management in elderly breast ...
Not at most a weird triptan but also dosage 120mg in 24 hours) when needed for nausea or vomiting trusted 250 mcg seroflo allergy testing syracuse ny. Both anthracyclines are ionic compounds and they and their active metabolites are enthusiastically protein fated, which would offer less deposit into pinguid than into angular mass. These results are premeditated not later than estimating the disagreement in patient-years between the appropriate contrasting scenarios. Avoiding hypoglycemia: a frequency to happy result suited for glucose-lowering therapy in strain 2 diabetes. Decreases in corticosteroids should be performed at the mercy of the direct supervision of a physician and may have need of to be performed piecemeal. lder formulations of insulin suffer with associated with a tone down endanger of nocturnal hypoglycaemia com- also demonstrated reduction in microvascular complications pared with glargine U100 but requires a 10 14% higher amount and with long-term reinforcement, all-cause ...
MILAN -- Nearly half of women diagnosed with early stage breast cancer in Italy were likely to be prescribed anthracycline monotherapy, researchers reported here.
The SUM149 inflammatory breast carcinoma cell line was derived from a primary tumor nodule in an inflammatory breast cancer patient that was refractory to conventional chemotherapy. Increased levels of NF-κB subunits, including p50, p52, and RelA, were found in SUM149 cells in comparison with immortalized HME cells (data not shown). Moreover, intrinsic NF-κB activity in SUM149 cells was about 2.5-fold higher than that in HME cells (11). Because constitutive activation of NF-κB is linked to resistance to several therapeutic modalities, we surmised that SUM149 cells may be refractory to conventional chemotherapy, consistent with the anthracycline resistance exhibited by the parental tumor in the patient. SUM149 cells were found to be resistant to doxorubicin (0.1 μm for 72 h)-induced apoptosis with about 90% cell survival. Under the same conditions, ,40% of MDA-MB231 and ,25% of MDA-MB435 breast carcinoma cells were viable. These results indicate that SUM149 cells are inherently extremely ...
putative rhodomycin D esterase [10-carbomethoxy-13-deoxycarminomycin esterase] ATGCCGACACGCATGATCACCAACGATGAGGTGACCCTGTGGAGCGAAGGGCTCGGCGAT CCGGCCGACGCCCCGTTGCTCCTGATCGCCGGCGGCAACCTCTCGGCCAAATCGTGGCCG GACGAGTTCGTCGAACGCCTGGTCGCGGCCGGGCACTTCGTGATCCGCTACGACCACCGG GACACCGGGCGCTCCTCCCGGTGCGACTTCGCGCTCCACCCCTACGGCTTCGACGAGCTG GCCGCCGACGCGCTGGCCGTCCTGGACGGCTGGCAGGTCCGCGCCGCCCATGTGGTGGGC ATGTCGCTGGGCAACACCATCGGCCAGCTGCTCGCCCTGGACGCTCCGGAGCGTCTCCTC ACACTCACCGTGATGCTGGGGGGCGCGCTCGACGTCGACTTCGACGCCGACCTGGAGGCG GCGCTCAAGGGTGAGCCTTCCGTCAGCGGACTGCCGGTGCCCAGCCAGCGGTTCCTCGAC ATGATGACGATGCTTCAGCAACCGGCCGAGACGGACGAGGAACTGCTGGAGCGCCGAGTG GAGAAGTGGCGCCTACTCAACGGGGAGGGAGTGCCCTTCGACGCCGACGAGTTCCGGCGT CGTGAACTCCTGGCCGCCGGGCACGCGGGAACGTTCGACGAGCCGATCGTGCACCACATG ATCCCGCTGCCGCCGGTGTCGCGGGGGGCGGAGTTGTCCCGCGTCACCACACCGGTACTG GCGATCCAGGCGATGTGCGACCCCGCGGCCCCGCCGCCGCACGCCCGGCACCTCGCCAAC CGGATTCCCGGCGCCCGGGTCGTGGAGATCGAGAACATGGGGCACGCCCTGCCCCTCGCG ...
Some large studies have reported a positive association between erbB-2 overexpression and favorable response to anthracyclines in breast cancer (4 , 5) , but the existence of this association and its underlying mechanism remain controversial (15) . This study sought to clarify several issues related to this putative association. The patients included were quite uniform with regard to stage and presentation, all falling into the relatively uncommon category of LABC. This group of patients permitted assessing a very well-defined measure of response to neoadjuvant chemotherapy, namely the effect on the tumor in the breast at the time of mastectomy. Clearly, systemic tumor response (development of clinically evident metastases) and survival are also extremely important in evaluating the efficacy of chemotherapy and will be evaluated in this group of patients when sufficient data become available. Nevertheless, these other end points appear to involve a multitude of tumor and host factors, in ...
We hope to determine the importance of different genes (including B receptors) in anthracycline-induced cardiomyopathy. This has important benefits to p
Idamycin: Idarubicin belongs to the group of cancer-fighting medications known as antineoplastics, and specifically to the family of antineoplastics called anthracyclines. Idarubicin is used alone or in combination with other antineoplastic medications to treat leukemia.
Early pre-clinical work including investigations of miRNA in vitro and in vivo in mice models have shown promise and have triggered interest for patients with ACIC. MiRNA are short non-coding, regulatory RNA strands that regulate post-transcriptional translation of thousands of genes and modulate mRNA stability. These small molecules exhibit a mode of regulating protein expression that is evolutionarily conserved across most vertebrate (human, mice, and etc.) [52] and are involved in cellular physiologic and pathophysiologic processes. MiRNA is detected and quantified using Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) or sequencing techniques either directly from the tissue of interest such as myocardium or circulating leukocytes but are also found in the circulation. Upon AC administration, changes in miRNA concentration are tested at multiple intervals over a period and quantified based on changes seen across downstream effectors.. Researchers recently proposed that circulating ...
This phase III trial studies tretinoin and arsenic trioxide in treating patients with newly diagnosed acute promyelocytic leukemia. Standard treatment for acute promyelocytic leukemia involves high doses of a common class of chemotherapy drugs called anthracyclines, which are known to cause long-term side effects, especially to the heart. Tretinoin may stop the growth of cancer cells by blocking some of the enzymes needed for cell growth. Arsenic trioxide may stop the growth of cancer cells by either killing the cells, by stopping them from dividing, or by stopping them from spreading. Completely removing or reducing the amount of anthracycline chemotherapy and giving tretinoin together with arsenic trioxide may be an effective treatment for acute promyelocytic leukemia and may reduce some of the long-term side effects.. See detailed information including eligibility.. ...
The most effective regimen for taxane- and anthracycline-refractory triple-negative breast cancer (TNBC) has not yet been established. Capecitabine was approved by the US Food and Drug Administration for the treatment of advanced breast cancer and has shown efficacy in advanced breast cancer refractory to anthracyclines and taxanes. Irinotecan has synergism with 5-fluorouracil and shows efficacy in advanced breast cancer. Here we report on a patient with TNBC who relapsed with widespread bone and lung metastases shortly after adjuvant anthracycline followed by taxane chemotherapy. She achieved a metabolic complete response with irinotecan and capecitabine combination therapy and had 10 months progression-free survival and 22 months overall survival. She relapsed with and died of brain metastasis without any definite signs of progression of the lung and bone lesions she had had before the irinotecan and capecitabine combination therapy. To validate this favorable result, larger clinical trials ...
The FDA on October 19, 2016, granted accelerated approval to Lartruvo (olaratumab) with doxorubicin to treat adults with certain types of soft tissue sarcoma (STS), which are cancers that develop in muscles, fat, tendons, or other soft tissues. Lartruvo is approved for use with the FDA-approved chemotherapy drug doxorubicin for the treatment of patients with STS who cannot be cured with radiation or surgery and who have a type of STS for which an anthracycline (chemotherapy) is an appropriate treatment. - Year:2016
Trastuzumab is a drug used for the treatment of metastatic breast cancer patients. Due to blockage of the human epidermal growth factor receptor 2 signaling in cardiac myocytes, cardiotoxicity has been observed. There are many studies that investigated risk factors for trastuzumab-induced cardiotoxicity, but no study has been published for factors on the time to cardiotoxicity. This study aimed to investigate the factors for the time to occur trastuzumab-induced cardiotoxicity. From January 2014 to December 2015, a retrospective study was performed with breast cancer patients who were treated with trastuzumab. Associations between presence of and time to cardiotoxicity and various factors were analyzed. Based on multivariate models, it was found that baseline left ventricular ejection fraction (LVEF) < 62.5% (AHR 5.96, 95% CI 2543-13.95) and anthracycline-based chemotherapy (AHR 7.90, 95% CI 1.05-59.71) were significant factors for time to cardiotoxicity after adjusting other confounding ...
TY - JOUR. T1 - The role of anthracyclines in combination chemotherapy for the treatment of follicular lymphoma. T2 - Retrospective study of the Intergruppo Italiano Linfomi on 761 cases. AU - Rigacci, Luigi. AU - Federico, Massimo. AU - Martelli, Maurizio. AU - Zinzani, Pier Luigi. AU - Cavanna, Luigi. AU - Bellesi, Giampiero. AU - Merli, Francesco. AU - Alterini, Renato. AU - Petrucci, Maria Teresa. AU - Tani, Monica. AU - Liberati, Anna Marina. AU - Vitolo, Umberto. AU - Pavone, Vincenzo. AU - Cuneo, Antonio. AU - Chisesi, Teodoro. AU - Brugiatelli, Maura. PY - 2003/11. Y1 - 2003/11. N2 - In order to elucidate the role of anthracycline based combination chemotherapy regimens for the treatment of follicular lymphoma we conducted a retrospective study on a large series of patients with a histologically confirmed diagnosis of follicular lymphoma. The Italian lymphoma. intergroup (ILI) promoted a retrospective study of patients with follicular lymphoma treated in cooperative trials between 1985 ...
Ethyl glucuronide and ethyl sulfate are metabolites of ethanol (alcohol) that may be present in urine after ingestion of, or exposure to, drinks, foods, medication or other products containing ethyl alcohol. Incidental exposure to alcohol-containing products such as mouthwash or hand sanitizer have also been shown to produce positive alcohol metabolites test results. LC-MS/MS testing detects EtG and EtS regardless of the source. Therefore, we encourage you to interpret alcohol metabolite test results in light of the clinical picture.
My research is focused on the systematic characterization of genetic and epigenetic factors that contribute to variable drug response in relevant clinical settings. My professional training in clinical biochemistry coupled to my background in cancer pharmacology allow me to perform patient-oriented research through a combination of approaches based on: 1) the analysis of biological samples from selected populations, 2) the use of an array of contemporary experimental platforms, 3) direct translation of laboratory findings into clinical studies in adult and pediatric patients. For example, through pivotal studies in collaboration with Dr. Smita Bhatia and colleagues from the Childrens Oncology group we have demonstrated that functional polymorphisms in genes involved in the pharmacodynamics of anticancer anthracycline drugs contribute to the risk of anthracycline-related cardiotoxicity in long-term survivors of pediatric cancers ...
Despite potentially curative resection of stomach cancer, 50% to 90% of patients die of disease relapse.. Numerous randomized clinical trials have compared surgery alone with adjuvant chemotherapy, but definitive evidence is lacking. Dr Xavier Paoletti and colleagues from France performed an individual patient-level meta-analysis of all randomized clinical trials to quantify the potential benefit of chemotherapy after complete resection over surgery alone in terms of overall survival and disease-free survival. The researchers further studied the role of regimens, including monochemotherapy; combined chemotherapy with fluorouracil derivatives, mitomycin C, and other therapies but no anthracyclines.. In addition, the team evaluated the combined chemotherapy with fluorouracil derivatives, mitomycin C, and anthracyclines, and other treatments. Data was used from all randomized clinical trials comparing adjuvant chemotherapy with surgery alone in patients with resectable gastric cancer.. The research ...
TY - CHAP. T1 - Anthracycline, Trastuzumab, and Cardiovascular Toxicity. AU - Cochran, T. R.. AU - Franco, V. I.. AU - Scully, R.. AU - Lipshultz, S. E.. PY - 2018/1/1. Y1 - 2018/1/1. N2 - In cancer treatment, the pervasive late effects of radiation and chemotherapy limit their utility, especially in children, in whom treatment often leads to lifelong morbidity and excess mortality. Advances in understanding the molecular pathways related to tumorigenesis have led to the development of targeted therapies, but recurrent late effects, as in the case of trastuzumab, and unexpectedly high rates of cardiotoxicity highlight gaps in our understanding of drug pathways and the mechanisms of treatment toxicity. Here, we review the mechanisms of anthracycline activity in tumor and cardiac cells, as well as the clinical manifestations and their associated cardiotoxicity, prevention strategies, and monitoring recommendations. We also describe the cardiac effects of trastuzumab with specific attention to its ...
Introduction. Gene amplification of HER2 occurs in approximately 15% to 25% of breast cancers, resulting in overexpression of HER2 on the cell surface. Before the advent of trastuzumab (Herceptin; H), HER2 amplification was associated with a more aggressive disease course and poorer overall survival.1,2 Prognosis for patients with HER2-positive disease, defined by strong overexpression (3+) of HER2 by immunohistochemistry, or by a HER2 to chromosome 17 copy number ratio of ,2 by fluorescence in situ hybridization, dramatically improved with the advent of HER2-targeted therapy.3 Trastuzumab was approved by the FDA in 1998 in combination with chemotherapy for metastatic HER2-positive breast cancer based on an improvement in overall survival (OS) compared with, chemotherapy alone, and approved in 2006 for use in the adjuvant setting after joint analysis of interim results of National Surgical Adjuvant Breast and Bowel Project (NSABP) B31 and North Central Cancer Treatment Group (NCCTG) 9831 ...
Streptomyces peucetius DnrS protein: involved in daunorubicin biosynthesis in Streptomyces peucetius; encodes a glycosyltransferase; amino acid sequence given in first source; GenBank L47164
MEN 10755 is a recently discovered disaccharide anthracycline, characterized by a potent antitumoral activity against a large number of human tumor xenografts, and it is currently undergoing phase I clinical studies. Previous studies (Arcamone et al., 1997) indicate that the enzyme topoisomerase II is the main target for the cytotoxic action of MEN 10755: the drug stimulates topoisomerase II cleavage of DNA and displays a remarkable ability to elicit DNA single- and double-strand breaks, transforming the enzyme into a DNA-damaging agent.. Although the events interposed between the stabilization of the cleavage complex and the loss of cell viability have not yet been identified, the net result is the initiation of cell death, occurring through cell cycle arrest, and induction of necrosis or apoptosis. The results of the present study indicate that apoptosis initiated by exposure of A2780 cells to either MEN 10755 or DXR: 1) proceeds through an essentially similar pathway, requiring the presence ...
Patients had a median age of 54 years (range: 27 - 81); metastatic disease for 97%; anthracycline resistance for 63%; received study treatment as 1st (20%), 2nd (48%) or > 3rd (32%) CT line for ABC. The median number of cycles was 6 for VFL plus CAPE and 5 for CAPE. VFL plus CAPE prolonged PFS assessed by IRC compared to CAPE (median 5.6 vs 4.3 months, HR = 0.84, 95% CI 0.71-0.99, P = 0.0426). This was supported by the investigator assessment (median 5.5 vs 4.1 months, HR = 0.77, 95% CI 0.66-0.90, P = 0.0007). The response rate assessed by IRC was numerically greater for VFL plus CAPE than for CAPE (22.9% vs 17.9%, P = 0.1030); the disease control rate was statistically superior with the combination (57.3% vs 47.9%, P = 0.0089). Median OS analysed after 674 deaths (87.5%) was 13.9 months for VFL plus CAPE and 11.7 months for CAPE (HR = 0.97, 95% CI = 0.83-1.14, P = 0.6976). The most frequent grade 3-4 events were neutropenia for VFL plus CAPE (27.2% of patients vs 6.6% for CAPE) and hand-foot ...
Doxorubicin has been an integral part of the treatment of women with breast cancer for many years. Since amrubicin may have more activity than doxorubic
Am old enough to understand the difference between the Bay of Pigs - and roasting a pig at a epicurian feast. Been thru the hippy, yippie and yuppie years - always remaining who I am. Very much believe in "Sing your own song - weave your own tapestry" Am young enough to still know the thrill of new discoveries, the beauty of the evening, to celebrate the joy of another tommorow. Survived these many decades with a severe medical problems. Sorting out the maze of now having two lymphomas and all their nasty little companions, but I continue. Besides, being a simple iconoclastic eclectic, have been called many things. An incurable romanticist - with a strong touch of reality. Thinker, intellectual (God, how I hate that term) - been told I am a lion with the heart of the poet. Know how to wage war and conquer my foes - but would rather be known as one who brings hope and life. To bring hope into anothers life is the ultimate of joys. Life should be about bringing hope, peace, vision... a sense of ...
Introduction: Cardiotoxicity is a relatively frequent and potentially serious complication of antitumor treatment. Anthracyclines and other high-dose
The cardiac effects of treatment for malignancy are likely to become an increasing problem over the coming decades. This issue is multifactorial and reflects the evolution of cancer from a malignant illness to a chronic disease, as well as the widespread use of cardiotoxic agents. Two groups of patients seem to be especially at risk. In survivors of childhood cancer, the risk for recurrence or progression of malignancy rapidly diminishes after a decade, and cardiac complications are the main cause of cancer-related mortality that is unrelated to recurrence (1). In adults, several of the most common malignancies (especially breast cancer and lymphoma) are often treated with anthracyclines and/or radiotherapy (2). Breast cancer is the most common source of cardiac problems, reflecting its frequency, the cardiotoxic effects of specific chemotherapy, and the consequences of radiation to the left breast. Improvements in detection and therapy have led to ,2 million American women who will have ...
Epirubicin Hydrochloride Injection by Hospira: Epirubicin belongs to the group of cancer-fighting medications known as antineoplastics, and specifically to the family of antineoplastics called anthracyclines. It is used alone or in combination with other antineoplastics to treat many types of cancer including breast cancer, lung cancer, ovary cancer, stomach cancer, and lymphoma.
Epirubicin Hydrochloride Injection by Hospira: Epirubicin belongs to the group of cancer-fighting medications known as antineoplastics, and specifically to the family of antineoplastics called anthracyclines. It is used alone or in combination with other antineoplastics to treat many types of cancer including breast cancer, lung cancer, ovary cancer, stomach cancer, and lymphoma.
The wide spectrum of anthracycline activity as well as the unique cumulative dose related cardiac toxicity pose a significant clinical challenge. These drugs, particularly doxorubicin (AdriamycinR),...
Daunorubicin (DNR) and doxorubicin (DOX) are two of the most effective anthracycline drugs known for the treatment of systemic neoplasms and solid tumors. However, their clinical use is hampered due to profound cardiotoxicity ...
For businesses, the key significance of data privacy compliance goes beyond meeting the letter of the law. Its about inspiring trust among customers, and defending a hard-won reputation. If people feel they cant trust a brand or business with their personal data, theyll find alternatives. The explosion in data-based engagement with customers is largely fueled by personal data, but new regulations impose tough penalties for mishandling it or using it without permission.. Processes for staying compliant and maintaining customer trust have to be effective yet also cost-effective. So new technologies are necessary to automate compliance and embed data privacy best practices across the enterprise.. ...
In the Clinic provides overviews of novel oncology agents, addressing indications, mechanisms, administration recommendations, safety profiles, and other essential information needed for the appropriate clinical use of these drugs.. On January 28, 2016, eribulin mesylate (Halaven) was approved for treatment of patients with unresectable or metastatic liposarcoma who have received a prior anthracycline-containing regimen.1,2 Eribulin was previously approved for treatment of patients with metastatic breast cancer who have received at least two chemotherapeutic regimens for metastatic disease and prior treatment with an anthracycline and a taxane in the adjuvant or metastatic setting.. Supporting Efficacy Data. Approval was based on an open-label trial in which 446 patients with unresectable locally advanced or metastatic liposarcoma or leiomyosarcoma who had received at least two prior systemic therapies including an anthracycline and had disease progression within the past 6 months were ...
Introduction. Breast cancer causes approximately 40,000 deaths annually in the United States.1 The majority of these deaths occur in women with metastatic breast cancer (MBC), reflecting the incurability of MBC and the need for improved treatment. Currently, treatment for MBC is palliative and involves balancing improvement in cancer symptoms and delay of progression against side effects of therapy.2. Capecitabine is an orally administered prodrug of 5-fluorouracil (5-FU) that is activated to -FU preferentially in tumor tissue due to increased expression of thymidine phosphorylase in tumor tissue, which contributes to the drugs specificity and action against tumor cell proliferation.3 Capecitabine was first approved for MBC in 1998 in patients pretreated with anthracyclines and taxanes. It was later approved in combination with docetaxel after the combination resulted in improved overall survival (OS) when compared with docetaxel alone.4,5 Since then, capecitabine has come into wide use in MBC ...
During the treatment of cells with anthracyclines, NADPH-dependent flavin reductase reduces the drug to a semiquinone radical, which can donate its free electron to molecular oxygen and generate the superoxide radical (O2 ·). At neutral pH, the main reaction of O2 · is a relatively slow spontaneous dismutation to H2O2 and O2, but this reaction can be accelerated by superoxide dismutase. Superoxide anion and hydrogen peroxide may interact (with metal ions such as iron or copper as catalyst) by the Haber-Weiss reaction to generate hydroxyl radicals (⋅OH). By using electron spin resonance together with a spin-trap such as 5,5-dimethyl pyrroline-N-oxide, anthracycline-induced⋅OH has been detected in several types of cancer cells (for a review, see Sinha and Mimmaugh, 1990). This result suggests that anthracycline-induced free radical production may occur independently of the interaction of the drug with internal membranes or even DNA. Although there is strong evidence that ROS play a role in ...
Sequence analysis of a 3.4-kb region Streptomyces peucetius daunorubicin (DNR) gene cluster established the presence of the dnrH and dnmT genes. In dnrH mutants, DNR production increased 8.5-fold, compared with that in the wild-type strain, while dnmT mutants accumulated epsilon-rhodomycinone (RHO), which normally becomes glycosylated in daunorubicin biosynthesis. Hence, dnmT may be involved in the biosynthesis or attachment of daunosamine to RHO or in the regulation of this process. Since the DnrH protein is similar to known glycosyl transferases, this protein may catalyze the conversion of DNR to its polyglycosylated forms, known as baumycins. Overexpression of dnmT in the wild-type and dnrH mutant strains resulted in a major decrease in RHO accumulation and increase in DNR production. ...
The advantages of cytotoxic drugs such as anthracyclines can be limited by the harmful damage that they inflicted on the human body. One of the main side effects of administering such powerful chemotherapeutic drugs is their negative impact on the cardiovascular system. These adverse side effects can significantly limit the usefulness of freely administered drugs such as doxorubicin. Lower doses must be given for the safety and well being of the patients while ultimately reducing the potency of the drug itself. Immunoliposomes can allow for the targeted delivery of anthracyclines such as doxorubicin. Specific targeting greatly decreases the detrimental side effects to sensitive tissues outside the targeted site while simultaneously acquiescing a larger dosage of drug at the tumor site without larger doses actually being administered. Immunoliposomes contain reactive lipids on their outer surface that allow for the conjugation of different molecules such as antibodies, peptides, or proteins. The ...
Cancer Transl Med, Official publication of Chinese Translational Medicine and Biology Technology Innovation Alliance, and Cipher Ground
Aldo-keto reductases (AKRs) are a class of NADPH-dependent oxidoreductases that have been linked to metabolism of the anthracyclines doxorubicin (DOX) and daunorubicin (DAUN). Although widely used, cardiotoxicity continues to be a serious side effect that may be linked to metabolites or reactive intermediates generated in their metabolism. In this study we examine the little known effects of nonsynonymous single nucleotide polymorphisms of human AKR1A1 on the metabolism of these drugs to their alcohol metabolites. Expressed and purified from bacteria using affinity chromatography, the AKR1A1 protein with a single histidine (6x-His) tag exhibited the greatest activity using two test substrates: p-nitrobenzaldehyde (5.09 ± 0.16 μmol/min/mg of purified protein) and dl-glyceraldehyde (1.24 ± 0.17 μmol/min/mg). These activities are in agreement with published literature values of nontagged human AKR1A1. The 6x-His-tagged AKR1A1 wild type and allelic variants, E55D and N52S, were subsequently ...
Extravasations (EV) of anthracyclines (AC) are a rare but potentially seriously debilitating complication of chemotherapies (CT) that can lead to severe skin lesions with the need for surgical debridement, a functional disability in the short and longer term, and a delay in the CT programme following on from EV management.. Savene is the only antidote authorised for the treatment of AC EVs. The treatment involves a peripheral intravenous infusion lasting 1 to 2 hours, to be started as soon as possible and within 6 hours following the EV, to be repeated 24 hours and 48 hours after the 1st infusion. The treatments effectiveness was first demonstrated during clinical testing on peripheral EVs, confirmed by biopsy, with a rate of 98% of being able to dispense with the need for surgery due to ulceration or tissue necrosis, and the initial CT programme being maintained in 71% of patients. These efficacy data were recently confirmed in Belgium, in clinical practice, with 41 patients showing an AC EV, ...
Leukemia is not an important factor in the natural history of breast cancer, though its association with breast cancer therapy has frequently been reported. There are reports of therapy related hematological malignancies in breast cancer dated as early as 1980s describing the incidence as 1.68 ± .33% at 10 years with chemotherapy vis a vis 0.06% to 0.27% with surgery alone [1]. In 1992, a large case-control study of 82,700 women with breast cancer demonstrated a relative risk of developing AML as 2.4 for radiotherapy, 10 for therapy with alkylating agents and 17.4 when the two were used in combination [2] The chemotherapy regimens employed during these studies used mainly melphalan as alkylating agent and that for long durations (12 to 24 months) [1, 2]. Though over the last decade anthracyclines along with safer alkylating agents have formed the main core of the breast cancer therapy; the modern chemotherapy is not entirely safe. The more recent reports in the background of anthracycline and ...
103-137 (doi:10.1039/NP9920900103). Anthracyclines. ...
Anthracycline dose intensification in acute myeloid leukemia. „N Engl J Med". 361 (13), s. 1249-59, Sep 2009. DOI: 10.1056/ ... Risk-adapted treatment of acute promyelocytic leukemia based on all-trans retinoic acid and anthracycline with addition of ... A modified AIDA protocol with anthracycline-based consolidation results in high antileukemic efficacy and reduced toxicity in ... Risk-adapted treatment of acute promyelocytic leukemia with all-trans-retinoic acid and anthracycline monochemotherapy: a ...
These include adriamycin and other anthracyclines, bleomycin, and cisplatin. These agents may show specific toxicity towards ...
Among the anthracyclines, doxorubicin and daunorubicin were the first, and were obtained from the bacterium Streptomyces ... The mechanisms of anthracyclines include DNA intercalation (molecules insert between the two strands of DNA), generation of ... Anthracyclines in Encyclopedia of Molecular Pharmacology, 2nd Edition, Volume 1. Eds. Offermanns S and Rosenthal W. Springer, ... The most important subgroup is the anthracyclines and the bleomycins; other prominent examples include mitomycin C, ...
Anthracycline, anti-cancer alkoloid, isolated from the Streptomyces peucetius bacteria. Anthracycline-based derivatives include ... Fujiwara, A.; Hoshino, T.; Westley, J. W. (1985). "Anthracycline Antibiotics". Critical Reviews in Biotechnology. 3 (2): 133- ...
Anthracycline-containing chemotherapy regimens are commonly offered as the initial therapy. Some patients may receive a stem ...
Fujii, Isao; Ebizuka, Yutaka (November 1997). "Anthracycline Biosynthesis in". Chemical Reviews. 97 (7): 2511-2524. doi:10.1021 ...
Patients must have received prior chemotherapy with an anthracycline.[12]. Ovarian cancer and other[edit]. In 2008 the ... after failure of anthracyclines and ifosfamide, or who are unsuited to receive these agents. The agency's evaluating committee ...
Anthracycline chemistry and biology. Berlin: Springer. ISBN 3-540-75814-3. ...], [executive ed. J. Buckingham. Principal ...
Anthracycline chemistry and biology. Berlin: Springer. ISBN 3-540-75814-3. Type strain of Streptomyces violaceus at BacDive - ... "Anthracycline metabolites from Streptomyces violaceus A262. I. Isolation of antibiotic-blocked mutants from Streptomyces ...
ISBN 0-387-68233-3. CS1 maint: Extra text: authors list (link) Krohn, volume editor, Karsten (2008). Anthracycline chemistry ...
Anthracycline chemistry and biology. Berlin: Springer. ISBN 3-540-75815-1. List of Streptomyces species LPSN bacterio.net ... Anthracycline chemistry and biology. Berlin: Springer. ISBN 3-540-75815-1. Type strain of Streptomyces cinereoruber at BacDive ...
Anthracyclines are anti-tumor antibiotics that interfere with enzymes involved in copying DNA during the cell cycle. [4] ...
Swain SM, Vici P (January 2004). "The current and future role of dexrazoxane as a cardioprotectant in anthracycline treatment: ... Currently Dexrazoxane is the only FDA/EMA approved agent for preventing anthracycline-induced cardiotoxicity which according to ... 1974 Feb;54(2):94-6. Steiner R, Hellmann K (April 2013). "Dexrazoxane prevention of anthracycline cardiomyopathy". Journal of ... Herman EH, Ferrans VJ (August 1998). "Preclinical animal models of cardiac protection from anthracycline-induced cardiotoxicity ...
Subsequent research has led to many other anthracycline antibiotics, or analogs, and there are now over 2,000 known analogs of ... Lown JW (1993). "Anthracycline and anthraquinone anticancer agents: current status and recent developments". Pharmacol. Ther. ... Doxorubicin is in the anthracycline and antitumor antibiotic family of medications. It works in part by interfering with the ... Weiss RB (December 1992). "The anthracyclines: will we ever find a better doxorubicin?". Seminars in Oncology. 19 (6): 670-86. ...
Sulfonamdopir (in Italian). Gazz Chim Ital 90:1802-1815 Suarato A, Angelucci F, Geroni C. Ring-B modified anthracyclines. Curr ... "The anthracyclines: will we ever find a better doxorubicin?". Seminars in Oncology. 19 (6): 670-86. PMID 1462166. Bilotto, ...
Other cytotoxic antibiotics are anthracyclines, mitomycin C, bleomycin, mithramycin. Antibodies are sometimes used as a quick ...
The same study also suggested that the PSMB7 protein is involved in anthracycline resistance, which is an antibiotic derived ... Weiss RB (December 1992). "The anthracyclines: will we ever find a better doxorubicin?". Seminars in Oncology. 19 (6): 670-86. ... "PSMB7 is associated with anthracycline resistance and is a prognostic biomarker in breast cancer". British Journal of Cancer. ...
... is in the anthracycline family of medication. It works in part by blocking the function of topoisomerase II. ... Weiss RB (December 1992). "The anthracyclines: will we ever find a better doxorubicin?". Seminars in Oncology. 19 (6): 670-86. ...
... is an anthracycline antibiotic. Field desorption tandem mass spectrometry of anthracycline antibiotics, cosmomycin ...
Caesius ATCC27952 (producers of anthracycline antibiotics)". Cytology and Genetics. 47 (4): 197-201. doi:10.3103/ ... sequence analysis and complementation of early-block mutations in the anthracycline pathway". Molecular & general genetics : ...
The drug binds to DNA topoisomerase II at a different step in the catalytic cycle than anthracyclines, which locks the enzyme ... Anthracycline extravasation is defined as the unintentional installation or leakage into the perivascular or subcutaneous ... Savene, developed by TopoTarget is used for the treatment of anthracycline extravasation, a rare complication to chemotherapy. ... Savene works by inhibiting DNA topoisomerase II, which is the target of anthracycline chemotherapy. ...
... (INN) is an anthracycline drug. An analogue of the anthracycline antineoplastic antibiotic doxorubicin. Pirarubicin ...
The mechanisms of anthracyclines include DNA intercalation (molecules insert between the two strands of DNA), generation of ... Anthracyclines in Encyclopedia of Molecular Pharmacology, 2nd Edition, Volume 1. Eds. Offermanns S and Rosenthal W. Springer, ... Among the anthracyclines, doxorubicin and daunorubicin were the first, and were obtained from the bacterium Streptomyces ... ISBN 9783540389163 P 91ff Minotti G, Menna P, Salvatorelli E, Cairo G, Gianni L (Jun 2004). "Anthracyclines: molecular advances ...
Anthracyclines (Aclarubicin · Daunorubicin · Doxorubicin · Epirubicin · Idarubicin · Amrubicin · Pirarubicin · Valrubicin · ...
... has role antimicrobial agent (CHEBI:33281) anthracycline antibiotic (CHEBI:49322) is a ... 4-O-methylrhodomycin D (CHEBI:77179) is a anthracycline antibiotic (CHEBI:49322). carminomycin (CHEBI:31359) is a anthracycline ... idarubicin (CHEBI:42068) is a anthracycline antibiotic (CHEBI:49322). mithramycin (CHEBI:31856) is a anthracycline antibiotic ( ... nothramicin (CHEBI:66638) is a anthracycline antibiotic (CHEBI:49322). rhodomycin D (CHEBI:32096) is a anthracycline antibiotic ...
Anthracycline News and Research. RSS Anthracycline is a type of antibiotic that comes from certain types of Streptomyces ... Anthracyclines are used to treat many types of cancer. Anthracyclines damage the DNA in cancer cells, causing them to die. ... A wireless device designed for detection of heart dysfunction in childhood cancer survivors treated with anthracycline ...
Due to inconsistencies between the drug labels on DailyMed and the pill images provided by RxImage, we no longer display the RxImage pill images associated with drug labels. We anticipate reposting the images once we are able identify and filter out images that do not match the information provided in the drug labels. ...
Genes related to anthracycline metabolism may be key to personalizing chemotherapy decisions in childhood cancers, researchers ... ASCO: Genes Predict Anthracycline Cardiotoxicity. CHICAGO -- Genes related to anthracycline metabolism may be key to ... Anthracyclines are the backbone of childhood cancer treatment, incorporated in the regimen for over half of these cases, Bhatia ... But once the dose of anthracyclines got sufficiently high (above 300 mg/m2) the relationship no longer held, which she ...
Anthracyclines have four mechanisms of action: Inhibition of DNA and RNA synthesis by intercalating between base pairs of the ... Use of anthracyclines has also been shown to be significantly associated with cycle 1 severe or febrile neutropenia. Other ... Anthracyclines are used to treat various cancers and as of 2012 were among the most commonly used chemotherapeutic agents. ... The anthracyclines are among the most effective anticancer treatments ever developed and are effective against more types of ...
The anthracycline drugs -- long a mainstay of breast cancer chemotherapy -- only benefit a minority of women and should be ... Now, he said, anthracycline-based adjuvant treatment should be reserved for women who dont have access to therapy targeted to ... The reason, he said, is that the Topo IIa protein is a "major target" of the anthracyclines and the Topo IIa gene is amplified ... 13 -- The anthracycline drugs -- long a mainstay of breast cancer chemotherapy -- only benefit a minority of women and should ...
2019 May 24;124(11):1633-1646 Authors: Cowgill JA, Francis SA, Sawyer DB Abstract Anthracycline-associated cardiomyopathy and ... Anthracycline and Peripartum Cardiomyopathies. Circ Res. 2019 May 24;124(11):1633-1646 Authors: Cowgill JA, Francis SA, Sawyer ... the ability to reliably predict who exactly will go on to develop cardiomyopathy and heart failure in the face of anthracycline ... DB Abstract Anthracycline-associated cardiomyopathy and peripartum cardiomyopathy are nonischemic cardiomyopathies that often ...
Anthracyclines Definition Organic compounds that have a tetrahydronaphthacenedione ring structure attached by a glycosidic ...
... both anthracycline and non-anthracycline -- reported more thinking and memory problems and more psychological distress than ... The results showed that women who had been treated with an anthracycline had worse short-term and long-term memory compared to ... Anthracycline chemotherapy medicines kill cancer cells by damaging their genes and interfering with their reproduction. ... Women treated with an anthracycline also had less left precuneus connectivity. The left precuneus region of the brain is ...
World Health Organization (WHO) registered anthracyclines in the list of essential medicines. However, anthracyclines display a ... World Health Organization (WHO) registered anthracyclines in the list of essential medicines. However, anthracyclines display a ... Anthracyclines are currently used to treat many cancers, including the various forms of leukemia, lymphoma, melanoma, uterine ... Taking into account the growing rate of cancer survivorship, the clinical significance of anthracycline cardiotoxicity is an ...
... we investigated the relationship between CD73 and anthracycline efficacy. In TNBC patients treated with anthracycline-only ... CD73 promotes anthracycline resistance and poor prognosis in triple negative breast cancer. Sherene Loi, Sandra Pommey, ... CD73 promotes anthracycline resistance and poor prognosis in triple negative breast cancer ... a commonly used anthracycline, by suppressing adaptive antitumor immune responses via activation of A2A adenosine receptors. ...
... we investigated the relationship between CD73 and anthracycline efficacy. In TNBC patients treated with anthracycline-only ... Anthracyclines like DOX rely on activation of anti-tumor CD8+ T cells for efficacy, a phenomenon dependent on extracellular ... CD73 promotes anthracycline resistance and poor prognosis in triple negative breast cancer. Sherene Loi, Sandra Pommey, ... Because chemotherapy with anthracyclines requires priming of IFN-γ-producing CD8+ T cells for optimal activity, we investigated ...
Anthracycline drug targeting: cytoplasmic versus nuclear--a fork in the road.. Lothstein L1, Israel M, Sweatman TW. ... Current anthracycline design has diverged to target either cytoplasmic or nuclear sites. Nuclear targets have been broadened to ... The anthracycline antibiotics doxorubicin (Adriamycin; DOX) and daunorubicin (DNR) continue to be essential components of first ... In this review, we will present recent strategies in anthracycline design and assess their potential therapeutic merits. ...
c) anthracycline glycoside solution which consists essentially of a physiologically acceptable salt of an anthracycline ... c) anthracycline glycoside solution which consists essentially of a physiologically acceptable salt of an anthracycline ... T 0454/01 (Anthracycline glycoside solution/PHARMACIA) of 25.11.2005. European Case Law Identifier:. ECLI:EP:BA:2005: ... anthracycline glycoside solution which consists essentially of a physiologically acceptable salt of an anthracycline glycoside ...
The other anthracycline anticancer agents do not have an amino group at the 9-position of the anthracycline nucleus unlike ... Anthracycline compounds such as amrubicin are unstable in a solution state, and when formulating such a compound as an ... Actually, when the anthracycline anticancer agents being sold in Japan (all of them are injections) are dissolved in a ... Commercially available anthracycline anticancer agents other than amrubicin have a structure having a hydroxy group at the 9- ...
Anthracyclines increase survival for HER2-positive tumors but not neg...WEDNESDAY Dec. 26 (HealthDay News)-- Chemotherapy drugs ... may also play a role in how well anthracyclines work. "The topo2 gene is thought to be the real target of the anthracyclines," ... the anthracyclines produced a greater reduction in risk of relapse or death than non-anthracycline regimens, the study found. ... Anthracyclines have been associated with an increased risk of heart damage in some patients -- a risk doctors have known about ...
Anthracyclines have undoubtedly improved outcomes for patients with early-stage breast cancer,[1] and these agents have been ... The recent focus on the use of anthracyclines in early-stage breast cancer has been sparked by the availability of newer non- ... The use of an anthracycline prior to or in combination with a taxane appears to be a reasonable approach for triple-negative ... Clearly, it is essential that we define which subtypes of breast cancer will benefit from the use of an anthracycline. To date ...
Anthracycline family: (Daunorubicin, Doxorubicin, Epirubicin, Idarubicin, Mitoxantrone, Pixantrone, Valrubicin). streptomyces ( ... Anthracyclines are a class of chemotherapeutic agents based upon samine and tetra-hydro-naphthacene-dione. These compounds are ... Anthracyclines inhibit DNA and RNA synthesis by intercalating between base pairs of the DNA/RNA strand, thus preventing the ... Anthracyclines are also capable if inhibiting topoisomerase II enzymes, preventing DNA from relieving torsional stress during ...
Nearly half of women diagnosed with early stage breast cancer in Italy were likely to be prescribed anthracycline monotherapy, ... In the Italian study, treatment with the combination of anthracyclines and taxanes were given to 38.4% of women; taxanes alone ... MILAN -- Nearly half of women diagnosed with early stage breast cancer in Italy were likely to be prescribed anthracycline ... Discuss with patients that preliminary data from a recent study indicates that anthracycline monotherapy is the most common ...
Drugs to prevent heart damage in cancer patients receiving anthracyclines. Anthracyclines are among the most effective ... Treatment for cardiac problems caused by anthracycline chemotherapy for childhood cancer. *Different anthracycline derivates ... tumour effects of anthracycline treatment. Patients who got dexrazoxane with their anthracycline treatment had about one third ... Child health , Cancer , Supportive care: anthracycline cardiotoxicity. Complementary & alternative medicine , Cancer , General ...
All of the anthracyclines drugs cause dose dependent cardiac toxicity. Too much drug and you poison the heart. These drugs ... Anthracycline induced oxidative stress is ten times higher in the heart than in other tissue. Why the heart? ... This enzyme reduces anthracyclines to its semiquinone that self oxidizes to dihydroquinone (note: if Ive lost you, dont worry ... In the mitochondria of cells other than cardiac cells, the anthracyclines cannot get all the way in to the inner core of the ...
Patients were considered anthracycline resistant when they had disease progression on anthracycline therapy for MBC or within 6 ... in patients with documented anthracycline resistance vs 29% in patients classified as having non-anthracycline-resistant ... previously treated with conventional anthracyclines. Seventy-nine women with MBC previously treated with anthracyclines ... In conclusion, PLD was associated with an evident clinical benefit in anthracycline-pretreated patients with MBC. ...
Shan and colleagues [1] provided a thorough, insightful, and well-balanced review of anthracycline cardiomyopathy. However, the ... Anthracycline-Induced Cardiotoxicity. Ann Intern Med. ;126:827. doi: 10.7326/0003-4819-126-10-199705150-00018 ...
The objectives of the present work are to characterize the transport of mitoxantrone and three anthracyclines in terms of ... Transport of Anthracyclines and Mitoxantrone Across Membranes by a Flip-Flop Mechanism Biochem Pharmacol. 2005 Jul 1;70(1):161- ... Mitoxantrone and anthracyclines are positively charged amphipathic molecules, and as such are located at the surface of ... The objectives of the present work are to characterize the transport of mitoxantrone and three anthracyclines in terms of ...
... anthracycline and taxane based, dose dense) the anthracycline based regimen remains a commonly used form of chemotherapy. It ... Reduced Dose Anthracycline Post Breast Cancer Surgery Has No Effect on Outcome. 23.07.2008 ... Lead author Dr Anna Tinker noted that "while there is a breadth of chemotherapy options (e.g. anthracycline based, ... Recognising a threshold effect of both cumulative dose and dose intensity of anthracyclines, and in light of emerging evidence ...
  • Anthracyclines increase survival for HER2-positive tumors but not neg. (bio-medicine.org)
  • WEDNESDAY, Dec. 26 (HealthDay News)-- Chemotherapy drugs known as anthracyclines help boost survival for women with HER2-positive breast cancer who have undergone surgery, but they may not offer any survival benefit for those with HER2-negative tumors. (bio-medicine.org)
  • Our study provides convincing statistical evidence that the added benefit of adjuvant chemotherapy with anthracyclines is confined to women who have breast tumors in which HER2 is overexpressed or amplified," she said. (bio-medicine.org)
  • In some of the early studies, only patients with HER2-positive tumors seemed to derive benefit from anthracyclines, but these subset analyses were never conclusive and were dramatically underpowered, she revealed. (ascopost.com)
  • DNR is the first anthracycline developed and has been found to be effective against acute leukemia, whereas DOX was found to be effective also against solid tumors. (aspetjournals.org)
  • But once the dose of anthracyclines got sufficiently high (above 300 mg/m 2 ) the relationship no longer held, which she explained as this mechanism getting overwhelmed by the sheer force of oxidative damage from all the unmetabolized anthracycline. (medpagetoday.com)
  • Although the study included only those who received anthracyclines as children, the mechanism would likely be the same in adults, which Bhatia said her group plans to study. (medpagetoday.com)
  • The ability of RGS6 to promote p53 activation in response to anthracycline is independent of RGS6 interaction with G proteins but requires ataxia telangiectasia-mutated serine/threonine protein kinase and exhibits a reactive oxygen species-dependent, DNA damage-independent, and GGL and DEP domain-dependent mechanism. (ahajournals.org)
  • Targeting topoisomerase II (topo II) is regarded as an important component of the pleiotropic mechanism of action of anthracycline drugs. (aacrjournals.org)
  • Peng X, Chen B, Lim CC, Sawyer DB (2005) The cardiotoxicology of anthracycline chemotherapeutics: translating molecular mechanism into preventative medicine. (springer.com)
  • The mechanism of decreased GATA-4 activity acts at the level of the GATA-4 gene, because anthracyclines caused significantly decreased levels of GATA-4 protein and mRNA. (aspetjournals.org)
  • The mechanism by which anthracyclines cause irreversible myocardial damage remains unclear but may involve the generation of reactive oxygen species (ROS), lipid peroxidation, mitochondrial impairment, and modulation of gene transcription. (aspetjournals.org)
  • The putative association between erbB-2 overexpression and favorable response to anthracyline-based therapy in breast cancer is controversial, and the mechanism unclear. (aacrjournals.org)
  • The rule of thumb has always been that of keeping the exposure of the myocardium to a lifetime cumulative dose of anthracyclines below a threshold associated with acceptable risk. (springer.com)
  • The reason, he said, is that the Topo IIa protein is a "major target" of the anthracyclines and the Topo IIa gene is amplified only in a minority of women who are also HER2-positive. (medpagetoday.com)
  • The topo2 gene is thought to be the real target of the anthracyclines," said Geyer, director of medical affairs for the NSABB project. (bio-medicine.org)
  • Seventy-nine women with MBC previously treated with anthracyclines received PLD 50 mg m −2 every 4 weeks. (nature.com)
  • Anthracycline chemotherapy medicines kill cancer cells by damaging their genes and interfering with their reproduction. (breastcancer.org)
  • Exposure to either anthracycline induced the up-regulation of several genes known to promote cell cycle arrest and DNA repair (WAF1/p21, GADD45) or apoptosis (bax, Fas). (aspetjournals.org)
  • There are at least 3 gene clusters important to DXR biosynthesis: dps genes which specify the enzymes required for the linear polyketide chain synthesis and its first cyclizations, the dnr cluster is responsible for the remaining modifications of the anthracycline structure and the dnm genes involved in the amino sugar, daunosamine, synthesis. (wikipedia.org)
  • Proteasome inhibition specifically sensitizes leukemic cells to anthracyclin-induced apoptosis through the accumulation of Bim and Bax pro-apoptoti. (nih.gov)
  • The kinetic actions of drug-induced inhibition of poly(A)+-RNA appearance in the cytoplasm and inhibition of total RNA synthesis were equivalent for ADM, DNM and CMM, whereas the other anthracyclines showed different kinetics. (aspetjournals.org)
  • These studies confirm the greater sensitivity of nucleolar RNA synthesis to Class II anthracyclines in erythroleukemia cells and suggest that inhibition of post-transcriptional events may occur in cells exposed to PYM, MCM, and ACM but at higher concentrations than are required for inhibition of RNA synthesis. (aspetjournals.org)
  • Although the expression of Fas was increased, an antagonistic anti-Fas antibody ZB4 did not inhibit anthracycline-induced apoptosis, suggesting that the stimulation of the Fas receptor did not play a critical role in the induction of apoptosis in this cell line. (aspetjournals.org)
  • We also observed that neither MEN 10755 nor DXR were able to induce apoptosis in A2780 cells deprived of the nucleus but retaining an intact mitochondrial function (cytoplasts) and that apoptosis induced by either anthracycline was inhibited by cycloheximide, indicating that it is an active process requiring new protein synthesis. (aspetjournals.org)
  • We conclude that, in a tumor cell line of epithelial origin, the apoptosis following exposure to anthracyclines is an active process requiring protein synthesis and drug interaction with nuclear structures. (aspetjournals.org)
  • According to a study presented at the 2016 ESMO Congress, a technically negative trial in high-risk adult soft tissue sarcoma nonetheless produced a significant survival benefit for anthracycline-based neoadjuvant chemotherapy. (targetedonc.com)
  • When then stratified by genotype, those who were carried two copies of the risk-associated CBR1 and CBR3 alleles had consistently higher risk than those with only one or no copies at the lower anthracycline doses. (medpagetoday.com)
  • If validated, the results suggest that those who would require lower doses of anthracyclines -- typically children with acute lymphoblastic leukemia or non-Hodgkin's lymphoma -- and test positive for the genotype might be considered for a different chemotherapeutic class, Bhatia said. (medpagetoday.com)
  • Comparison of anthracyclines used for induction chemotherapy in patients with FLT3-ITD-mutated acute myeloid leukemia. (bioportfolio.com)
  • Homoharringtonine is a safe and effective substitute for anthracyclines in children younger than 2 years old with acute myeloid leukemia. (bioportfolio.com)
  • Improved outcome in childhood acute lymphoblastic leukemia despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-BFM. (nih.gov)
  • In the phase III historically controlled Children's Oncology Group (COG) AAML0631 trial, arsenic trioxide consolidation permitted the use of lower-dose anthracycline without appearing to compromise outcomes in pediatric patients with acute promyelocytic leukemia (APL). (ascopost.com)
  • Animal studies have suggested that L-carnitine protects the heart from the effects of anthracyclines, however this has not been verified in humans. (clinicaltrials.gov)
  • However, the effects of anthracyclines on GATA transcription factors have not been studied. (aspetjournals.org)