Anion Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of negatively charged molecules (anions) across a biological membrane.Anion Exchange Protein 1, Erythrocyte: A major integral transmembrane protein of the ERYTHROCYTE MEMBRANE. It is the anion exchanger responsible for electroneutral transporting in CHLORIDE IONS in exchange of BICARBONATE IONS allowing CO2 uptake and transport from tissues to lungs by the red blood cells. Genetic mutations that result in a loss of the protein function have been associated with type 4 HEREDITARY SPHEROCYTOSIS.Anions: Negatively charged atoms, radicals or groups of atoms which travel to the anode or positive pole during electrolysis.4-Acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic Acid: A non-penetrating amino reagent (commonly called SITS) which acts as an inhibitor of anion transport in erythrocytes and other cells.Sulfobromophthalein: A phenolphthalein that is used as a diagnostic aid in hepatic function determination.Erythrocyte Membrane: The semi-permeable outer structure of a red blood cell. It is known as a red cell 'ghost' after HEMOLYSIS.Organic Anion Transport Polypeptide C: An organic anion transporter found in human liver. It is capable of transporting a variety organic anions and mediates sodium-independent uptake of bile in the liver.4,4'-Diisothiocyanostilbene-2,2'-Disulfonic Acid: An inhibitor of anion conductance including band 3-mediated anion transport.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Stilbenes: Organic compounds that contain 1,2-diphenylethylene as a functional group.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Chlorides: Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.Organic Anion Transport Protein 1: A polyspecific transporter for organic cations found primarily in the kidney. It mediates the coupled exchange of alpha-ketoglutarate with organic ions such as P-AMINOHIPPURIC ACID.Erythrocytes: Red blood cells. Mature erythrocytes are non-nucleated, biconcave disks containing HEMOGLOBIN whose function is to transport OXYGEN.Membrane Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.Fatty Acid Transport Proteins: A broad category of membrane transport proteins that specifically transport FREE FATTY ACIDS across cellular membranes. They play an important role in LIPID METABOLISM in CELLS that utilize free fatty acids as an energy source.Biological Transport, Active: The movement of materials across cell membranes and epithelial layers against an electrochemical gradient, requiring the expenditure of metabolic energy.Probenecid: The prototypical uricosuric agent. It inhibits the renal excretion of organic anions and reduces tubular reabsorption of urate. Probenecid has also been used to treat patients with renal impairment, and, because it reduces the renal tubular excretion of other drugs, has been used as an adjunct to antibacterial therapy.Ion Transport: The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.p-Aminohippuric Acid: The glycine amide of 4-aminobenzoic acid. Its sodium salt is used as a diagnostic aid to measure effective renal plasma flow (ERPF) and excretory capacity.Organic Anion Transporters: Proteins involved in the transport of organic anions. They play an important role in the elimination of a variety of endogenous substances, xenobiotics and their metabolites from the body.Bicarbonates: Inorganic salts that contain the -HCO3 radical. They are an important factor in determining the pH of the blood and the concentration of bicarbonate ions is regulated by the kidney. Levels in the blood are an index of the alkali reserve or buffering capacity.Sulfates: Inorganic salts of sulfuric acid.Monosaccharide Transport Proteins: A large group of membrane transport proteins that shuttle MONOSACCHARIDES across CELL MEMBRANES.Kinetics: The rate dynamics in chemical or physical systems.Organic Anion Transporters, Sodium-Independent: A subclass of ORGANIC ANION TRANSPORTERS that do not rely directly or indirectly upon sodium ion gradients for the transport of organic ions.Antiporters: Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Acanthocytes: Erythrocytes with protoplasmic projections giving the cell a thorny appearance.Cation Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.Choroid Plexus: A villous structure of tangled masses of BLOOD VESSELS contained within the third, lateral, and fourth ventricles of the BRAIN. It regulates part of the production and composition of CEREBROSPINAL FLUID.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.PhloretinAxonal Transport: The directed transport of ORGANELLES and molecules along nerve cell AXONS. Transport can be anterograde (from the cell body) or retrograde (toward the cell body). (Alberts et al., Molecular Biology of the Cell, 3d ed, pG3)Killifishes: Small oviparous fishes in the family Cyprinodontidae, usually striped or barred black. They are much used in mosquito control.Chloride-Bicarbonate Antiporters: Electroneutral chloride bicarbonate exchangers that allow the exchange of BICARBONATE IONS exchange for CHLORIDE IONS across the cellular membrane. The action of specific antiporters in this class serve important functions such as allowing the efficient exchange of bicarbonate across red blood cell membranes as they passage through capillaries and the reabsorption of bicarbonate ions by the kidney.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Kidney Tubules, Proximal: The renal tubule portion that extends from the BOWMAN CAPSULE in the KIDNEY CORTEX into the KIDNEY MEDULLA. The proximal tubule consists of a convoluted proximal segment in the cortex, and a distal straight segment descending into the medulla where it forms the U-shaped LOOP OF HENLE.Phenylglyoxal: A reagent that is highly selective for the modification of arginyl residues. It is used to selectively inhibit various enzymes and acts as an energy transfer inhibitor in photophosphorylation.Multidrug Resistance-Associated Proteins: A sequence-related subfamily of ATP-BINDING CASSETTE TRANSPORTERS that actively transport organic substrates. Although considered organic anion transporters, a subset of proteins in this family have also been shown to convey drug resistance to neutral organic drugs. Their cellular function may have clinical significance for CHEMOTHERAPY in that they transport a variety of ANTINEOPLASTIC AGENTS. Overexpression of proteins in this class by NEOPLASMS is considered a possible mechanism in the development of multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although similar in function to P-GLYCOPROTEINS, the proteins in this class share little sequence homology to the p-glycoprotein family of proteins.Chloride Channels: Cell membrane glycoproteins that form channels to selectively pass chloride ions. Nonselective blockers include FENAMATES; ETHACRYNIC ACID; and TAMOXIFEN.Ion Exchange: Reversible chemical reaction between a solid, often one of the ION EXCHANGE RESINS, and a fluid whereby ions may be exchanged from one substance to another. This technique is used in water purification, in research, and in industry.Taurocholic Acid: The product of conjugation of cholic acid with taurine. Its sodium salt is the chief ingredient of the bile of carnivorous animals. It acts as a detergent to solubilize fats for absorption and is itself absorbed. It is used as a cholagogue and cholerectic.Symporters: Membrane transporters that co-transport two or more dissimilar molecules in the same direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.ATP-Binding Cassette Transporters: A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.Fluorescein: A phthalic indicator dye that appears yellow-green in normal tear film and bright green in a more alkaline medium such as the aqueous humor.Uricosuric Agents: Gout suppressants that act directly on the renal tubule to increase the excretion of uric acid, thus reducing its concentrations in plasma.Kidney: Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.Cell Membrane Permeability: A quality of cell membranes which permits the passage of solvents and solutes into and out of cells.Glycophorin: The major sialoglycoprotein of the human erythrocyte membrane. It consists of at least two sialoglycopeptides and is composed of 60% carbohydrate including sialic acid and 40% protein. It is involved in a number of different biological activities including the binding of MN blood groups, influenza viruses, kidney bean phytohemagglutinin, and wheat germ agglutinin.Oxalates: Derivatives of OXALIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that are derived from the ethanedioic acid structure.Adenosine Triphosphate: An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.Iodides: Inorganic binary compounds of iodine or the I- ion.Sulfinpyrazone: A uricosuric drug that is used to reduce the serum urate levels in gout therapy. It lacks anti-inflammatory, analgesic, and diuretic properties.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Cystic Fibrosis Transmembrane Conductance Regulator: A chloride channel that regulates secretion in many exocrine tissues. Abnormalities in the CFTR gene have been shown to cause cystic fibrosis. (Hum Genet 1994;93(4):364-8)Tardigrada: A phylum of microscopic ecdysozoan invertebrates, closely related to ARTHROPODS. Members exhibit anabiosis and cryptobiosis, dormant states where metabolic activity is reduced or absent, thus making them tolerant to extreme environmental conditions. They are distributed worldwide and most are semi-aquatic.Vesicular Transport Proteins: A broad category of proteins involved in the formation, transport and dissolution of TRANSPORT VESICLES. They play a role in the intracellular transport of molecules contained within membrane vesicles. Vesicular transport proteins are distinguished from MEMBRANE TRANSPORT PROTEINS, which move molecules across membranes, by the mode in which the molecules are transported.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Phenolsulfonphthalein: Red dye, pH indicator, and diagnostic aid for determination of renal function. It is used also for studies of the gastrointestinal and other systems.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Ion Channels: Gated, ion-selective glycoproteins that traverse membranes. The stimulus for ION CHANNEL GATING can be due to a variety of stimuli such as LIGANDS, a TRANSMEMBRANE POTENTIAL DIFFERENCE, mechanical deformation or through INTRACELLULAR SIGNALING PEPTIDES AND PROTEINS.2,4-Dichlorophenoxyacetic Acid: An herbicide with irritant effects on the eye and the gastrointestinal system.Phosphates: Inorganic salts of phosphoric acid.Phosphate-Binding Proteins: Proteins that bind to and are involved in the metabolism of phosphate ions.Electron Transport: The process by which ELECTRONS are transported from a reduced substrate to molecular OXYGEN. (From Bennington, Saunders Dictionary and Encyclopedia of Laboratory Medicine and Technology, 1984, p270)Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Bacterial Proteins: Proteins found in any species of bacterium.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Potassium: An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.Membrane Potentials: The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).Thiocyanates: Organic derivatives of thiocyanic acid which contain the general formula R-SCN.Transport Vesicles: Vesicles that are involved in shuttling cargo from the interior of the cell to the cell surface, from the cell surface to the interior, across the cell or around the cell to various locations.Glucose Transport Proteins, Facilitative: A family of monosaccharide transport proteins characterized by 12 membrane spanning helices. They facilitate passive diffusion of GLUCOSE across the CELL MEMBRANE.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Oocytes: Female germ cells derived from OOGONIA and termed OOCYTES when they enter MEIOSIS. The primary oocytes begin meiosis but are arrested at the diplotene state until OVULATION at PUBERTY to give rise to haploid secondary oocytes or ova (OVUM).Eosine Yellowish-(YS): A versatile red dye used in cosmetics, pharmaceuticals, textiles, etc., and as tissue stain, vital stain, and counterstain with HEMATOXYLIN. It is also used in special culture media.Taurine: A conditionally essential nutrient, important during mammalian development. It is present in milk but is isolated mostly from ox bile and strongly conjugates bile acids.Microvilli: Minute projections of cell membranes which greatly increase the surface area of the cell.Niflumic Acid: An analgesic and anti-inflammatory agent used in the treatment of rheumatoid arthritis.Fluorescent Dyes: Agents that emit light after excitation by light. The wave length of the emitted light is usually longer than that of the incident light. Fluorochromes are substances that cause fluorescence in other substances, i.e., dyes used to mark or label other compounds with fluorescent tags.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Sodium-Bicarbonate Symporters: Proteins that cotransport sodium ions and bicarbonate ions across cellular membranes.Blood Proteins: Proteins that are present in blood serum, including SERUM ALBUMIN; BLOOD COAGULATION FACTORS; and many other types of proteins.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Amino Acid Transport Systems: Cellular proteins and protein complexes that transport amino acids across biological membranes.Xenopus laevis: The commonest and widest ranging species of the clawed "frog" (Xenopus) in Africa. This species is used extensively in research. There is now a significant population in California derived from escaped laboratory animals.Bumetanide: A sulfamyl diuretic.Rats, Sprague-Dawley: A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.Glucose: A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.Fluoresceins: A family of spiro(isobenzofuran-1(3H),9'-(9H)xanthen)-3-one derivatives. These are used as dyes, as indicators for various metals, and as fluorescent labels in immunoassays.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Epithelium: One or more layers of EPITHELIAL CELLS, supported by the basal lamina, which covers the inner or outer surfaces of the body.Organic Cation Transport Proteins: A family of proteins involved in the transport of organic cations. They play an important role in the elimination of a variety of endogenous substances, xenobiotics, and their metabolites from the body.Kidney Cortex: The outer zone of the KIDNEY, beneath the capsule, consisting of KIDNEY GLOMERULUS; KIDNEY TUBULES, DISTAL; and KIDNEY TUBULES, PROXIMAL.Golgi Apparatus: A stack of flattened vesicles that functions in posttranslational processing and sorting of proteins, receiving them from the rough ENDOPLASMIC RETICULUM and directing them to secretory vesicles, LYSOSOMES, or the CELL MEMBRANE. The movement of proteins takes place by transfer vesicles that bud off from the rough endoplasmic reticulum or Golgi apparatus and fuse with the Golgi, lysosomes or cell membrane. (From Glick, Glossary of Biochemistry and Molecular Biology, 1990)Nucleotide Transport Proteins: Proteins involved in the transport of NUCLEOTIDES across cellular membranes.Valinomycin: A cyclododecadepsipeptide ionophore antibiotic produced by Streptomyces fulvissimus and related to the enniatins. It is composed of 3 moles each of L-valine, D-alpha-hydroxyisovaleric acid, D-valine, and L-lactic acid linked alternately to form a 36-membered ring. (From Merck Index, 11th ed) Valinomycin is a potassium selective ionophore and is commonly used as a tool in biochemical studies.Chlorine: A greenish-yellow, diatomic gas that is a member of the halogen family of elements. It has the atomic symbol Cl, atomic number 17, and atomic weight 70.906. It is a powerful irritant that can cause fatal pulmonary edema. Chlorine is used in manufacturing, as a reagent in synthetic chemistry, for water purification, and in the production of chlorinated lime, which is used in fabric bleaching.Estrone: An aromatized C18 steroid with a 3-hydroxyl group and a 17-ketone, a major mammalian estrogen. It is converted from ANDROSTENEDIONE directly, or from TESTOSTERONE via ESTRADIOL. In humans, it is produced primarily by the cyclic ovaries, PLACENTA, and the ADIPOSE TISSUE of men and postmenopausal women.RNA, Complementary: Synthetic transcripts of a specific DNA molecule or fragment, made by an in vitro transcription system. This cRNA can be labeled with radioactive uracil and then used as a probe. (King & Stansfield, A Dictionary of Genetics, 4th ed)Amiloride: A pyrazine compound inhibiting SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS. This inhibition creates a negative potential in the luminal membranes of principal cells, located in the distal convoluted tubule and collecting duct. Negative potential reduces secretion of potassium and hydrogen ions. Amiloride is used in conjunction with DIURETICS to spare POTASSIUM loss. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p705)Microscopy, Confocal: A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.Nucleoside Transport Proteins: Proteins involved in the transport of NUCLEOSIDES across cellular membranes.Succinimides: A subclass of IMIDES with the general structure of pyrrolidinedione. They are prepared by the distillation of ammonium succinate. They are sweet-tasting compounds that are used as chemical intermediates and plant growth stimulants.Epithelial Cells: Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.Voltage-Dependent Anion Channels: A family of voltage-gated eukaryotic porins that form aqueous channels. They play an essential role in mitochondrial CELL MEMBRANE PERMEABILITY, are often regulated by BCL-2 PROTO-ONCOGENE PROTEINS, and have been implicated in APOPTOSIS.Xenopus: An aquatic genus of the family, Pipidae, occurring in Africa and distinguished by having black horny claws on three inner hind toes.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.Dose-Response Relationship, Drug: The relationship between the dose of an administered drug and the response of the organism to the drug.Acidosis, Renal Tubular: A group of genetic disorders of the KIDNEY TUBULES characterized by the accumulation of metabolically produced acids with elevated plasma chloride, hyperchloremic metabolic ACIDOSIS. Defective renal acidification of URINE (proximal tubules) or low renal acid excretion (distal tubules) can lead to complications such as HYPOKALEMIA, hypercalcinuria with NEPHROLITHIASIS and NEPHROCALCINOSIS, and RICKETS.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Nitrobenzoates: Benzoic acid or benzoic acid esters substituted with one or more nitro groups.Pyridoxal Phosphate: This is the active form of VITAMIN B 6 serving as a coenzyme for synthesis of amino acids, neurotransmitters (serotonin, norepinephrine), sphingolipids, aminolevulinic acid. During transamination of amino acids, pyridoxal phosphate is transiently converted into pyridoxamine phosphate (PYRIDOXAMINE).Sodium-Potassium-Chloride Symporters: A subclass of symporters that specifically transport SODIUM CHLORIDE and/or POTASSIUM CHLORIDE across cellular membranes in a tightly coupled process.Iron: A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.Periplasmic Binding Proteins: Periplasmic proteins that scavenge or sense diverse nutrients. In the bacterial environment they usually couple to transporters or chemotaxis receptors on the inner bacterial membrane.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Arginine: An essential amino acid that is physiologically active in the L-form.Coenzyme A Ligases: Enzymes that catalyze the formation of acyl-CoA derivatives. EC 6.2.1.Rats, Wistar: A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.Diphtheria Toxin: An ADP-ribosylating polypeptide produced by CORYNEBACTERIUM DIPHTHERIAE that causes the signs and symptoms of DIPHTHERIA. It can be broken into two unequal domains: the smaller, catalytic A domain is the lethal moiety and contains MONO(ADP-RIBOSE) TRANSFERASES which transfers ADP RIBOSE to PEPTIDE ELONGATION FACTOR 2 thereby inhibiting protein synthesis; and the larger B domain that is needed for entry into cells.Molecular Weight: The sum of the weight of all the atoms in a molecule.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Extracellular Space: Interstitial space between cells, occupied by INTERSTITIAL FLUID as well as amorphous and fibrous substances. For organisms with a CELL WALL, the extracellular space includes everything outside of the CELL MEMBRANE including the PERIPLASM and the cell wall.Voltage-Dependent Anion Channel 1: Voltage-dependent anion channel 1 is the major pore-forming protein of the mitochondrial outer membrane. It also functions as a ferricyanide reductase in the PLASMA MEMBRANE.P-Glycoprotein: A 170-kDa transmembrane glycoprotein from the superfamily of ATP-BINDING CASSETTE TRANSPORTERS. It serves as an ATP-dependent efflux pump for a variety of chemicals, including many ANTINEOPLASTIC AGENTS. Overexpression of this glycoprotein is associated with multidrug resistance (see DRUG RESISTANCE, MULTIPLE).Dicarboxylic Acid Transporters: A family of organic anion transporters that specifically transport DICARBOXYLIC ACIDS such as alpha-ketoglutaric acid across cellular membranes.Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.Superoxides: Highly reactive compounds produced when oxygen is reduced by a single electron. In biological systems, they may be generated during the normal catalytic function of a number of enzymes and during the oxidation of hemoglobin to METHEMOGLOBIN. In living organisms, SUPEROXIDE DISMUTASE protects the cell from the deleterious effects of superoxides.Furosemide: A benzoic-sulfonamide-furan. It is a diuretic with fast onset and short duration that is used for EDEMA and chronic RENAL INSUFFICIENCY.Rats, Inbred Strains: Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.Equilibrative Nucleoside Transport Proteins: A class of sodium-independent nucleoside transporters that mediate the facilitative transport of NUCLEOSIDES.Glutathione: A tripeptide with many roles in cells. It conjugates to drugs to make them more soluble for excretion, is a cofactor for some enzymes, is involved in protein disulfide bond rearrangement and reduces peroxides.Cyclic AMP: An adenine nucleotide containing one phosphate group which is esterified to both the 3'- and 5'-positions of the sugar moiety. It is a second messenger and a key intracellular regulator, functioning as a mediator of activity for a number of hormones, including epinephrine, glucagon, and ACTH.Amino Acid Transport Systems, Basic: Amino acid transporter systems capable of transporting basic amino acids (AMINO ACIDS, BASIC).Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Bile Canaliculi: Minute intercellular channels that occur between liver cells and carry bile towards interlobar bile ducts. Also called bile capillaries.Genes, Bacterial: The functional hereditary units of BACTERIA.Dicarboxylic AcidsEthylmaleimide: A sulfhydryl reagent that is widely used in experimental biochemical studies.Intestinal Absorption: Uptake of substances through the lining of the INTESTINES.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Fatty Acids: Organic, monobasic acids derived from hydrocarbons by the equivalent of oxidation of a methyl group to an alcohol, aldehyde, and then acid. Fatty acids are saturated and unsaturated (FATTY ACIDS, UNSATURATED). (Grant & Hackh's Chemical Dictionary, 5th ed)Intracellular Membranes: Thin structures that encapsulate subcellular structures or ORGANELLES in EUKARYOTIC CELLS. They include a variety of membranes associated with the CELL NUCLEUS; the MITOCHONDRIA; the GOLGI APPARATUS; the ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.Cystic Fibrosis: An autosomal recessive genetic disease of the EXOCRINE GLANDS. It is caused by mutations in the gene encoding the CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR expressed in several organs including the LUNG, the PANCREAS, the BILIARY SYSTEM, and the SWEAT GLANDS. Cystic fibrosis is characterized by epithelial secretory dysfunction associated with ductal obstruction resulting in AIRWAY OBSTRUCTION; chronic RESPIRATORY INFECTIONS; PANCREATIC INSUFFICIENCY; maldigestion; salt depletion; and HEAT PROSTRATION.Amino Acid Transport Systems, Neutral: Amino acid transporter systems capable of transporting neutral amino acids (AMINO ACIDS, NEUTRAL).Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.Aquaporins: A class of porins that allow the passage of WATER and other small molecules across CELL MEMBRANES.Cations: Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.Active Transport, Cell Nucleus: Gated transport mechanisms by which proteins or RNA are moved across the NUCLEAR MEMBRANE.Vesicular Biogenic Amine Transport Proteins: Integral membrane proteins of the LIPID BILAYER of SECRETORY VESICLES that catalyze transport and storage of biogenic amine NEUROTRANSMITTERS such as ACETYLCHOLINE; SEROTONIN; MELATONIN; HISTAMINE; and CATECHOLAMINES. The transporters exchange vesicular protons for cytoplasmic neurotransmitters.Sodium-Potassium-Exchanging ATPase: An enzyme that catalyzes the active transport system of sodium and potassium ions across the cell wall. Sodium and potassium ions are closely coupled with membrane ATPase which undergoes phosphorylation and dephosphorylation, thereby providing energy for transport of these ions against concentration gradients.GABA Plasma Membrane Transport Proteins: A family of plasma membrane neurotransmitter transporter proteins that regulates extracellular levels of the inhibitory neurotransmitter GAMMA-AMINOBUTYRIC ACID. They differ from GABA RECEPTORS, which signal cellular responses to GAMMA-AMINOBUTYRIC ACID. They control GABA reuptake into PRESYNAPTIC TERMINALS in the CENTRAL NERVOUS SYSTEM through high-affinity sodium-dependent transport.Mesocricetus: A genus of the family Muridae having three species. The present domesticated strains were developed from individuals brought from Syria. They are widely used in biomedical research.Enzyme Inhibitors: Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.Chromatography, High Pressure Liquid: Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Peptide Fragments: Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.Prealbumin: A tetrameric protein, molecular weight between 50,000 and 70,000, consisting of 4 equal chains, and migrating on electrophoresis in 3 fractions more mobile than serum albumin. Its concentration ranges from 7 to 33 per cent in the serum, but levels decrease in liver disease.Protons: Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.Anion Exchange Resins: High-molecular-weight insoluble polymers that contain functional cationic groups capable of undergoing exchange reactions with anions.

Canalicular multispecific organic anion transporter/multidrug resistance protein 2 mediates low-affinity transport of reduced glutathione. (1/811)

The canalicular multispecific organic anion transporter (cMOAT), a member of the ATP-binding cassette transporter family, mediates the transport of a broad range of non-bile salt organic anions from liver into bile. cMOAT-deficient Wistar rats (TR-) are mutated in the gene encoding cMOAT, leading to defective hepatobiliary transport of a whole range of substrates, including bilirubin glucuronide. These mutants also have impaired hepatobiliary excretion of GSH and, as a result, the bile flow in these animals is reduced. In the present work we demonstrate a role for cMOAT in the excretion of GSH both in vivo and in vitro. Biliary GSH excretion in rats heterozygous for the cMOAT mutation (TR/tr) was decreased to 63% of controls (TR/TR) (114+/-24 versus 181+/-20 nmol/min per kg body weight). Madin-Darby canine kidney (MDCK) II cells stably expressing the human cMOAT protein displayed >10-fold increase in apical GSH excretion compared with wild-type MDCKII cells (141+/-6.1 pmol/min per mg of protein versus 13.2+/-1.3 pmol/min per mg of protein in wild-type MDCKII cells). Similarly, MDCKII cells expressing the human multidrug resistance protein 1 showed a 4-fold increase in GSH excretion across the basolateral membrane. In several independent cMOAT-transfectants, the level of GSH excretion correlated with the expression level of the protein. Furthermore, we have shown, in cMOAT-transfected cells, that GSH is a low-affinity substrate for the transporter and that its excretion is reduced upon ATP depletion. In membrane vesicles isolated from cMOAT-expressing MDCKII cells, ATP-dependent S-(2,4-dinitrophenyl)glutathione uptake is competitively inhibited by high concentrations of GSH (Ki approximately 20 mM). We concluded that cMOAT mediates low-affinity transport of GSH. However, since hepatocellular GSH concentrations are high (5-10 mM), cMOAT might serve an important physiological function in maintenance of bile flow in addition to hepatic GSH turnover.  (+info)

Genomic structure of the canalicular multispecific organic anion-transporter gene (MRP2/cMOAT) and mutations in the ATP-binding-cassette region in Dubin-Johnson syndrome. (2/811)

Dubin-Johnson syndrome (DJS) is an autosomal recessive disease characterized by conjugated hyperbilirubinemia. Previous studies of the defects in the human canalicular multispecific organic anion transporter gene (MRP2/cMOAT) in patients with DJS have suggested that the gene defects are responsible for DJS. In this study, we determined the exon/intron structure of the human MRP2/cMOAT gene and further characterized mutations in patients with DJS. The human MRP2/cMOAT gene contains 32 exons, and it has a structure that is highly conserved with that of another ATP-binding-cassette gene, that for a multidrug resistance-associated protein. We then identified three mutations, including two novel ones. All mutations identified to date are in the cytoplasmic domain, which includes the two ATP-binding cassettes and the linker region, or adjacent putative transmembrane domain. Our results confirm that MRP2/cMOAT is the gene responsible for DJS. The finding that mutations are concentrated in the first ATP-binding-cassette domain strongly suggests that a disruption of this region is a critical route to loss of function.  (+info)

Immunohistochemical localization of multispecific renal organic anion transporter 1 in rat kidney. (3/811)

Renal proximal convoluted tubules have an important role, i.e., to excrete organic anions, including numerous drugs and endogenous substances. Recently, multispecific organic anion transporter 1 (OAT1) was isolated from rat kidney. In this study, the cellular and subcellular localization of OAT1 in rat kidney was investigated. Kidneys from normal rats were perfused and fixed with periodate-lysine-paraformaldehyde solution and were then processed for immunohistochemical analysis using the labeled streptavidin-biotin method, preembedding horseradish peroxidase method, and immunogold method. Light microscopic examination revealed immunostaining for OAT1 in the middle portion of the proximal tubule (S2 segment), but not in the initial portion of the proximal convoluted tubule, next to the glomerulus. Nephron segments other than the S2 segment and the renal vasculature were not stained with antibody to OAT1. Electron-microscopic observation using a preembedding method revealed that OAT1 was exclusively expressed in the basolateral membrane of S2 segments of proximal tubules. The immunogold method showed no labeling for OAT1 in the cytoplasmic vesicles, suggesting that OAT1 may not move together with organic anions into the cells. These results are consistent with previous physiologic data showing that organic anions, including para-aminohippurate, are taken up by the basolateral Na+-independent organic anion/dicarboxylate exchanger and excreted at S2 segments. In conclusion, OAT1 was localized to the basolateral membrane of S2 segments of proximal tubules in rat kidneys.  (+info)

Immunohistochemical distribution and functional characterization of an organic anion transporting polypeptide 2 (oatp2). (4/811)

The rabbit polyclonal antibody against rat organic anion transporting polypeptide 2 (oatp2) was raised and immunoaffinity-purified. Western blot analysis for oatp2 detected two bands ( 74 and 76 kDa) in rat brain and a single band (76 kDa) in the liver. By immunohistochemical analysis, the oatp2 immunoreactivity was specifically high at the basolateral membrane of rat hepatocytes. Functionally, the oatp2-expressing oocytes were found to transport dehydroepiandrosterone sulfate, delta1 opioid receptor agonist [D-Pen2,D-Pen5]enkephalin, Leuenkephalin, and biotin significantly, as well as the substrates previously reported. These data reveal the exact distribution of the rat oatp2 at the protein level in the liver, and that oatp2 appears to be involved in the multispecificity of the uptaking substrates in the liver and brain.  (+info)

Polyspecific substrate uptake by the hepatic organic anion transporter Oatp1 in stably transfected CHO cells. (5/811)

The rat liver organic anion transporting polypeptide (Oatp1) has been extensively characterized mainly in the Xenopus laevis expression system as a polyspecific carrier transporting organic anions (bile salts), neutral compounds, and even organic cations. In this study, we extended this characterization using a mammalian expression system and confirm the basolateral hepatic expression of Oatp1 with a new antibody. Besides sulfobromophthalein [Michaelis-Menten constant (Km) of approximately 3 microM], taurocholate (Km of approximately 32 microM), and estradiol- 17beta-glucuronide (Km of approximately 4 microM), substrates previously shown to be transported by Oatp1 in transfected HeLa cells, we determined the kinetic parameters for cholate (Km of approximately 54 microM), glycocholate (Km of approximately 54 microM), estrone-3-sulfate (Km of approximately 11 microM), CRC-220 (Km of approximately 57 microM), ouabain (Km of approximately 3,000 microM), and ochratoxin A (Km of approximately 29 microM) in stably transfected Chinese hamster ovary (CHO) cells. In addition, three new substrates, taurochenodeoxycholate (Km of approximately 7 microM), tauroursodeoxycholate (Km of approximately 13 microM), and dehydroepiandrosterone sulfate (Km of approximately 5 microM), were also investigated. The results establish the polyspecific nature of Oatp1 in a mammalian expression system and definitely identify conjugated dihydroxy bile salts and steroid conjugates as high-affinity endogenous substrates of Oatp1.  (+info)

Transcriptional regulation of molybdoenzyme synthesis in Escherichia coli in response to molybdenum: ModE-molybdate, a repressor of the modABCD (molybdate transport) operon is a secondary transcriptional activator for the hyc and nar operons. (6/811)

Escherichia coli growing under anaerobic conditions produces several molybdoenzymes, such as formate hydrogenlyase (formate to H2 and CO2; hyc and fdhF genes) and nitrate reductase (narGHJI genes). Synthesis of these molybdoenzymes, even in the presence of the cognate transcriptional activators and effectors, requires molybdate in the medium. Besides the need for molybdopterin cofactor synthesis, molybdate is also required for transcription of the genes encoding these molybdoenzymes. In E. coli, ModE was previously identified as a repressor controlling transcription of the operon encoding molybdate transport components (modABCD). In this work, the ModE protein was also found to be a required component in the activation of hyc-lacZ to an optimum level, but only in the presence of molybdate. Mutant ModE proteins which are molybdate-independent for repression of modA-lacZ also restored hyc-lacZ expression to the wild-type level even in the absence of molybdate. Nitrate-dependent enhancement of transcription of narX-lacZ was completely abolished in a modE mutant. Nitrate-response by narG-lacZ and narK-lacZ was reduced by about 50% in a modE mutant. DNase I footprinting experiments revealed that the ModE protein binds the hyc promoter DNA in the presence of molybdate. ModE-molybdate also protected DNA in the intergenic region between narXL and narK from DNase I hydrolysis. DNA sequences (5' TAYAT 3' and 5' GTTA 3') found in ModE-molybdate-protected modABCD operator DNA were also found in the ModE-molybdate-protected region of hyc promoter DNA (5' GTTA-7 bp-CATAT 3') and narX-narK intergenic region (5' GTTA-7 bp-TACAT 3'). Based on these results, a working model is proposed in which ModE-molybdate serves as a secondary transcriptional activator of both the hyc and narXL operons which are activated primarily by the transcriptional activators, FhlA and NarL, respectively.  (+info)

A spliced variant of AE1 gene encodes a truncated form of Band 3 in heart: the predominant anion exchanger in ventricular myocytes. (7/811)

The anion exchangers (AE) are encoded by a multigenic family that comprises at least three genes, AE1, AE2 and AE3, and numerous splicoforms. Besides regulating intracellular pH (pHi) via the Cl-/HCO3- exchange, the AEs exert various cellular functions including generation of a senescent antigen, anchorage of the cytoskeleton to the membrane and regulation of metabolism. Most cells express several AE isoforms. Despite the key role of this family of proteins, little is known about the function of specific AE isoforms in any tissue, including the heart. We therefore chose isolated cardiac cells, in which a tight control of pHi is mandatory for the excitation-contraction coupling process, to thoroughly investigate the expression of the AE genes at both the mRNA and protein levels. RT-PCR revealed the presence of AE1, AE2 and AE3 mRNAs in both neonatal and adult rat cardiomyocytes. AE1 is expressed both as the erythroid form (Band 3 or eAE1) and a novel alternate transcript (nAE1), which was more specifically characterized using a PCR mapping strategy. Two variants of AE2 (AE2a and AE2c) were found at the mRNA level. Cardiac as well as brain AE3 mRNAs were expressed in both neonatal and adult rat cardiomyocytes. Several AE protein isoforms were found, including a truncated form of AE1 and two AE3s, but there was no evidence of AE2 protein in adult rat cardiomyocytes. In cardiomyocytes transfected with an AE3 oligodeoxynucleotide antisense, AE3 immunoreactivity was dramatically decreased but the activity of the Cl-/HCO3- exchange was unchanged. In contrast, intracellular microinjection of blocking anti-AE1 antibodies inhibited the AE activity. Altogether, our findings suggest that a specific and novel AE1 splicoform (nAE1) mediates the cardiac Cl-/HCO3- exchange. The multiple gene and protein expression within the same cell type suggest numerous functions for this protein family.  (+info)

Active lucifer yellow secretion in renal proximal tubule: evidence for organic anion transport system crossover. (8/811)

Recent studies show that organic anion secretion in renal proximal tubule is mediated by distinct sodium-dependent and sodium-independent transport systems. Here we investigated the possibility that organic anions entering the cells on one system can exit into the lumen on a transporter associated with the other system. In isolated rat kidneys perfused with 10 microM lucifer yellow (LY, a fluorescent organic anion) plus 100 micrograms/ml inulin, the LY-to-inulin clearance ratio averaged 1.6 +/- 0.2, indicating net tubular secretion. Probenecid significantly reduced both LY clearance and LY accumulation in kidney tissue. In intact killifish proximal tubules, confocal microscopy was used to measure steady-state LY uptake into cells and secretion into the tubular lumen. Probenecid, p-aminohippurate, and ouabain nearly abolished both uptake and secretion. To this point, the data indicated that LY was handled by the sodium-dependent and ouabain-sensitive organic anion transport system. However, leukotriene C4, an inhibitor of the luminal step for the sodium-independent and ouabain-insensitive organic anion system, reduced luminal secretion of LY by 50%. Leukotriene C4 did not affect cellular accumulation of LY or the transport of fluorescein on the sodium-dependent system. A similar inhibition pattern was found for another fluorescent organic anion, a mercapturic acid derivative of monochlorobimane. Thus, both organic anions entered the cells on the basolateral transporter for the classical, sodium-dependent system, but about half of the transport into the lumen was handled by the luminal carrier for the sodium-independent system, which is most likely the multidrug resistance-associated protein. This is the first demonstration that xenobiotics can enter renal proximal tubule cells on the carrier associated with one organic anion transport system and exit into the tubular lumen on multiple carriers, one of which is associated with a second system.  (+info)

*Solute carrier family 10 member 4

... a putative organic anion transport protein". World Journal of Gastroenterology. 12 (42): 6797-805. doi:10.3748/wjg.v12.i42.6797 ... Solute carrier family 10 member 4 is a protein that in humans is encoded by the SLC10A4 gene. In mice, it appears to promote ...

*SLC4A2

Anion exchange protein 2 (AE2) is a membrane transport protein that in humans is encoded by the SLC4A2 gene. AE2 is ... Gehrig H, Müller W, Appelhans H (1992). "Complete nucleotide sequence of band 3 related anion transport protein AE2 from human ... "Entrez Gene: SLC4A2 solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)". Gawenis ... Huang QR, Li Q, Chen YH, Li L, Liu LL, Lei SH, Chen HP, Peng WJ, He M (June 2010). "Involvement of anion exchanger-2 in ...

*SLCO1B1

"The human organic anion transport protein SLC21A6 is not sufficient for bilirubin transport". J. Biol. Chem. 278 (23): 20695-9 ... "A novel human hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human organic anion ... Solute carrier organic anion transporter family member 1B1 is a protein that in humans is encoded by the SLCO1B1 gene. ... Campbell SD, de Morais SM, Xu JJ (2005). "Inhibition of human organic anion transporting polypeptide OATP 1B1 as a mechanism of ...

*Cotransporter

Cells also contain anion antiporters such as the Band 3 (or AE1) anion transport protein. This cotransporter is an important ... to provide the power needed for transport. This type of transport is known as secondary active transport and is powered by the ... For instance the wheat HKT1 transporter shows two modes of transport by the same protein. Cotransporters can be classified as ... Cotransporters are a subcategory of membrane transport proteins (transporters) that couple the favorable movement of one ...

*SLCO4A1

2005). "Interaction with PDZK1 is required for expression of organic anion transporting protein 1A1 on the hepatocyte surface ... Solute carrier organic anion transporter family member 4A1 is a protein that in humans is encoded by the SLCO4A1 gene. Solute ... "Entrez Gene: SLCO4A1 solute carrier organic anion transporter family, member 4A1". Fujiwara K, Adachi H, Nishio T, et al. (2001 ... 2003). "Identification of steroid sulfate transport processes in the human mammary gland". J. Clin. Endocrinol. Metab. 88 (8): ...

*Band 3

... anion transport protein is a phylogenetically-preserved transport protein responsible for mediating the exchange of ... Band 3 anion transport protein, also known as anion exchanger 1 (AE1) or band 3 or solute carrier family 4 member 1 (SLC4A1), ... Diego blood group system at BGMUT Blood Group Antigen Gene Mutation Database at NCBI, NIH Band 3 Protein at the US National ... The erythrocyte and kidney forms are different isoforms of the same protein. The erythrocyte isoform of AE1, known as eAE1, is ...

*OST Family

Organic cation transport proteins Organic anion-transporting polypeptide Solute carrier family Osmoregulation Organic anion ... The generalized transport reaction catalyzed by OSTα/OSTβ is: organic anion (out) ⇌ organic anion (in) Each transport system ... The two proteins are highly expressed in many human tissues. The β-subunit is not required to target the α-subunit to the ... Transport of estrone sulfate by the two subunit Ost transporter of Raja erinacea (TC# 2.A.82.1.1) is Na+-independent, ATP- ...

*SLC4A3

Anion exchange protein 3 is a membrane transport protein that in humans is encoded by the SLC4A3 gene. AE3 is functionally ... Morgans CW, Kopito RR (1993). "Association of the brain anion exchanger, AE3, with the repeat domain of ankyrin". J. Cell Sci. ... "Entrez Gene: SLC4A3 solute carrier family 4, anion exchanger, member 3". Casey JR, Sly WS, Shah GN, Alvarez BV (November 2009 ... 2001). "Human intestinal anion exchanger isoforms: expression, distribution, and membrane localization". Biochim. Biophys. Acta ...

*ABCC5

"Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs". Proceedings ... Multidrug resistance-associated protein 5 is a protein that in humans is encoded by the ABCC5 gene. The protein encoded by this ... ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct ... "Characterization of the transport of nucleoside analog drugs by the human multidrug resistance proteins MRP4 and MRP5". ...

*Rotor syndrome

... and organic anion transporting polypeptide 1B3 (OATP1B3), respectively. Both proteins are found in liver cells; they transport ... nonfunctional OATP1B1 and OATP1B3 proteins or an absence of these proteins. Without the function of either transport protein, ... The SLCO1B1 and SLCO1B3 genes provide instructions for making similar proteins, called organic anion transporting polypeptide ...

*Bicarbonate transporter protein

Anion exchanger proteins exchange HCO3 − for Cl− in a reversible, electroneutral manner. Na+/HCO3 − co-transport proteins ... In molecular biology, bicarbonate transporter proteins are proteins which transport bicarbonate. Bicarbonate (HCO3 −) transport ... In these proteins it covers almost the entire length of the sequence. The Band 3 anion exchange proteins that exchange ... A conserved domain is found at the C terminus of many bicarbonate transport proteins. It is also found in some plant proteins ...

*Alkalosis

As the blood pH increases, blood transport proteins, such as albumin, become more ionized into anions. This causes the free ...

*SLC22A12

"The multivalent PDZ domain-containing protein PDZK1 regulates transport activity of renal urate-anion exchanger URAT1 via its C ... The protein encoded by this gene is a urate transporter and urate-anion exchanger which regulates the level of urate in the ... Solute carrier family 22 (organic anion/cation transporter), member 12, also known as SLC22A12 and URAT1, is a protein which in ... This protein is an integral membrane protein primarily found in kidney. Two transcript variants encoding different isoforms ...

*Arsenite-transporting ATPase

Rosen BP, Weigel U, Monticello RA, Edwards BP (1991). "Molecular analysis of an anion pump: purification of the ArsC protein". ... Rosen BP, Weigel U, Monticello RA, Edwards BP (1991). "Molecular analysis of an anion pump: purification of the ArsC protein". ... In enzymology, an arsenite-transporting ATPase (EC 3.6.3.16) is an enzyme that catalyzes the chemical reaction ATP + H2O + ...

*Organic anion transporter 1

2004). "Protein kinase C activation downregulates human organic anion transporter 1-mediated transport through carrier ... OAT1 functions as organic anion exchanger. When the uptake of one molecule of an organic anion is transported into a cell by an ... It is a member of the organic anion transporter (OAT) family of proteins. OAT1 is a transmembrane protein that is expressed in ... and OATP4C1 transport small organic anions from the plasma into the S2 cells. MDR1, MRP2, MRP4 and URAT1 then transports these ...

*PDZK1

"The multivalent PDZ domain-containing protein PDZK1 regulates transport activity of renal urate-anion exchanger URAT1 via its C ... Na(+)/H(+) exchange regulatory cofactor NHE-RF3 is a protein that in humans is encoded by the PDZK1 gene. PDZK1 has been shown ... Kocher O, Comella N, Gilchrist A, Pal R, Tognazzi K, Brown LF, Knoll JH (1999). "PDZK1, a novel PDZ domain-containing protein ... White KE, Biber J, Murer H, Econs MJ (1999). "A PDZ domain-containing protein with homology to Diphor-1 maps to human ...

*Organic cation transport proteins

This family of proteins can also transport zwitterions and anions, though it is a different subfamily of solute carrier ... An organic cation transport protein mediates the transport of organic cations across the cell membrane. These proteins are ...

*Anion exchanger family

Nine encode proteins that transport HCO− 3. Functionally, eight of these proteins fall into two major groups: three Cl-HCO− 3 ... The same transport site within the AE1 spanning domain is involved in both anion exchange and cation transport. AE1 in human ... Several possibilities (uniport, anion:anion exchange and anion:cation exchange) can account for the data. The physiologically ... "Dual transport properties of anion exchanger 1: the same transmembrane segment is involved in anion exchange and in a cation ...

*Marinobacter algicola

"Borate as a synergistic anion for Marinobacter algicola ferric binding protein, FbpA: a role for boron in iron transport in ...

*Southeast Asian ovalocytosis

... increased tyrosine phosphorylation of the band 3 protein, reduced sulfate anion transport through the cell membrane, and more ... Rather, the defect lies in a protein known as the band 3 protein, which lies in the cell membrane itself. The band 3 protein ... The band 3 proteins aggregate on the cell membrane at the site of entry, forming a circular orifice that the parasite squeezes ... These band 3 proteins act as receptors for the parasite. Normally a process much like endocytosis occurs, and the parasite is ...

*Organic anion-transporting polypeptide

An organic anion-transporting polypeptide (OATP) is a membrane transport protein or 'transporter' that mediates the transport ... transporting anions, as well as neutral and even cationic compounds. They also transport an extremely diverse range of drug ... Hagenbuch B, Meier PJ (February 2004). "Organic anion transporting polypeptides of the OATP/ SLC21 family: phylogenetic ... Organic anion transporting polypeptides carry bile acids as well as bilirubin and numerous hormones such as thyroid and steroid ...

*Blumeria graminis

... they release proteins which facilitate active transport of lightweight anions between leaf and fungus even before germination. ... from which 437 encoded candidate secretor proteins and 165 for non-secreted candidate secretor proteins. These were shown to be ... The exact mechanism of action is unknown, but one known effect is that ferroglobulin, a protein in whey, produces oxygen ... selective pressure acting on genes that code for candidate secretor proteins and non-secreted candidate secretor proteins, ...

*SLC26A6

... whose members encode anion transporter proteins. This particular family member encodes a protein involved in transporting ... Solute carrier family 26 member 6 is a protein that in humans is encoded by the SLC26A6 gene. It is an anion-exchanger ... 2005). "Functional comparison of mouse slc26a6 anion exchanger with human SLC26A6 polypeptide variants: differences in anion ... 2007). "Anion exchangers in flux: functional differences between human and mouse SLC26A6 polypeptides". Novartis Found. Symp. ...

*ARC3 family

In the latter case ATP hydrolysis again energizes transport. ARC3 homologues transport the same anions as ArsA/AB homologues, ... These proteins are the ACR3 protein of Saccharomyces cerevisiae, also called the ARR3 protein, and the 'ArsB' protein of ... The Bacillus protein exports both arsenite and antimonite. The exact transport mechanism has not established. The generalized ... "The Saccharomyces cerevisiae ACR3 gene encodes a putative membrane protein involved in arsenite transport". The Journal of ...

*Grapefruit-drug interactions

For medications that interact due to inhibition of OATP (organic anion-transporting polypeptides), a relative short period of ... Bioactive compounds in grapefruit juice may also interfere with MDR1 (multidrug resistance protein 1) and OATP (organic anion ... Andrade, Chittaranjan (24 November 2014). "Fruit Juice, Organic Anion Transporting Polypeptides, and Drug Interactions in ... possible role of organic anion transporting polypeptides". Clinical Pharmacology and Therapeutics. 77 (3): 170-7. doi:10.1016/j ...

*Sulfide

The disulfide bond (-S-S-) plays a major role in the conformation of proteins and in the catalytic activity of enzymes. Sulfide ... Sulfide is the simplest sulfur anion. The systematic names sulfanediide and sulfide(2−), valid IUPAC names, are determined ... pipelines transporting soured oil, Kraft paper factories. Microbially-induced corrosion (MIC) or biogenic sulfide corrosion are ... Sulfide (systematically named sulfanediide, and sulfide(2−)) (British English sulphide) is an inorganic anion of sulfur with ...
Uchiumi T., Hinoshita E., Haga S., Nakamura T., Tanaka T., Toh S., Furukawa M., Kawabe T., Wada M., Kagotani K., Okumura K., Kohno K., Akiyama S., Kuwano M.. The human multidrug resistance protein (MRP) gene encodes a membrane protein involved in the ATP-dependent transport of hydrophobic compounds. We previously isolated a canalicular multispecific organic anion transporter, cMOAT1/MRP2, that belongs to the ATP binding cassette (ABC) superfamily, which is specifically expressed in liver, and cMOAT1/MRP2 is responsible for the defects in hyperbilirubinemia II/Dubin-Johnson syndrome. In this study, we isolated a new cDNA of the ABC superfamily designated cMOAT2/MRP3 that is homologous to human MRP1 and cMOAT1/MRP2: cMOAT2/MRP3 is 56% identical to MRP1 and 45% identical to cMOAT1/MRP2, respectively. Fluorescence in situ hybridization demonstrated the chromosomal locus of this gene on chromosome 17q22. The human cMOAT2 cDNA hybridized to a 6.5-kb mRNA that was mainly expressed in liver and to a ...
1. Bailey, AJ, et al. Abnormal collagen cross-linking in the cartilage of a Diastrophic Dysplasia patient. British Journal of Rheumatology. 1995 June; 34(6): 512-515 2. Cetta, G, et al. Diastrophic Dysplasia sulfate transporter gene is not involved in Pseudodiastrophic Dysplasia. American Journal of Medical Genetics. 1997 Dec; 73(4): 493-494. 3. Domer, Timothy P. Diastrophic Dysplasia. The Orthopedic Department; The Alfred Dupont Center. http://gait.aidi.udel.edu/res695/homepage/pd_ortho/orthhome.htm. Feb 1, 2000. 4. Forese, LL, et al. Severe mid-cervical kyphosis with cord compression in Larsen`s syndrome and Diastrophic Dysplasia: unrelated syndromes with similar radiologic findings and neurosurgical implications. Pediatric Radiology. 1995; 25(2): 136-139. 5. Greenberg Center for Skeletal Dysplasias. http://ww2.med.jhu.edu/Greenberg.Center/ diastrop.htm. Feb 1, 2000. 6. Hastbacka, J, et al. The Diastrophic Dysplasia gene encodes a novel sulfate transporter: positional cloning by time structure ...
Achondrogenesis, type IB (ACG1B; MIM 600972) is a lethal condition caused by the diastrophic dysplasia sulfate transporter gene mutations (DTDST/SLC26A2). Affected fetuses are usually in breech position and appear hydropic. The limbs and the trunk are shortened. In contrast to the findings in achondrogenesis, type II (ACG2; MIM 200610), the head is of a normal or near normal size and the fingers and toes are short. The feet and toes are rotated inward, a finding shared with diastrophic dysplasia (DTD; MIM 222600), another disorder caused by DTDST mutations.. Read less ...
J:223752 Cai T, Yang L, Cai W, Guo S, Yu P, Li J, Hu X, Yan M, Shao Q, Jin Y, Sun ZS, Luo ZJ, Dysplastic spondylolysis is caused by mutations in the diastrophic dysplasia sulfate transporter gene. Proc Natl Acad Sci U S A. 2015 Jun 30;112(26):8064-9 ...
Summary is not available for the mouse gene. This summary is for the human ortholog.] The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008 ...
Irinotecan, 7-ethyl-10-[4-(1-piperidino)-1-piperidino]-carbonyloxycamptothecin (CPT-11), is a potent anticancer drug that is increasingly used in chemotherapy. A frequent limiting side effect involves gastrointestinal toxicity (diarrhea), which is thought to be related to the biliary excretion of CPT-11 and its metabolites. Accordingly, the biliary excretion mechanisms for both the lactone and carboxylate forms of CPT-11 and its metabolites, SN-38 and its glucuronide (SN38-Glu), were investigated using Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic rats (EHBR), with the latter being mutant rats with a genetic deficiency of the canalicular multispecific organic anion transporter. After i.v. administration of CPT-11, the biliary excretion clearance, defined as the biliary excretion rate normalized to the hepatic concentration, of both the lactone and carboxylate forms of SN38-Glu was much lower in EHBR. The biliary excretion clearance for the carboxylate form of both CPT-11 and SN-38 was ...
Multidrug resistance-associated protein (MRP) and canalicular multispecific organic anion transporter (cMOAT) are closely related mammalian ATP-binding cassette transporters that export organic anions from cells. Transfection studies have established that MRP confers resistance to natural product cytotoxic agents, and recent evidence suggests the possibility that cMOAT may contribute to cytotoxic drug resistance as well. Based upon the potential importance of these transporters in clinical drug resistance and their important physiological roles in the export of the amphiphilic products of phase I and phase II metabolism, we sought to identify other MRP-related transporters. Using a degenerate PCR approach, we isolated a cDNA that encodes a novel ATP-binding cassette transporter, which we designated MOAT-B. The MOAT-B gene was mapped using fluorescence in situ hybridization to chromosome band 13q32. Comparison of the MOAT-B predicted protein with other transporters revealed that it is most ...
... , AS12 2611, antibody to AtNRT1, Nitrate/chlorate transporter, protein CHLORINA 1, AtNPF6.3, Q05085, AT1G12110
Nitrate transporter structure paves the way for exciting new areas of work, Representing biochemistry research at Oxford University
Member of the two-component regulatory system NreB/NreC involved in the control of dissimilatory nitrate/nitrite reduction in response to oxygen. Phosphorylated NreC binds to a GC-rich palindromic sequence at the promoters of the nitrate (narGHJI) and nitrite (nir) reductase operons, as well as the putative nitrate transporter gene narT, and activates their expression (By similarity).
Shop High affinity sulfate transporter ELISA Kit, Recombinant Protein and High affinity sulfate transporter Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Shop Probable sulfate transporter ELISA Kit, Recombinant Protein and Probable sulfate transporter Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Find reviews, trailers, release dates, news, screenshots, walkthroughs, and more for Choaniki: Sei Naru Protein Densetsu here on GameSpot.
Looking for online definition of solute carrier organic anion transporter family, member 2A1 in the Medical Dictionary? solute carrier organic anion transporter family, member 2A1 explanation free. What is solute carrier organic anion transporter family, member 2A1? Meaning of solute carrier organic anion transporter family, member 2A1 medical term. What does solute carrier organic anion transporter family, member 2A1 mean?
Disruption of the high-affinity nitrate transporter NRT2.1 activates the priming defence against Pseudomonas syringae, resulting in enhanced resistance. In this study, it is demonstrated that the high-affinity ammonium transporter AMT1.1 is a negative regulator of Arabidopsis defence responses. The T-DNA knockout mutant amt1.1 displays enhanced resistance against Plectosphaerella cucumerina and reduced susceptibility to P. syringae. The impairment of AMT1.1 induces significant metabolic changes in the absence of challenge, suggesting that amt1.1 retains constitutive defence responses. Interestingly, amt1.1 combats pathogens differently depending on the lifestyle of the pathogen. In addition, N starvation enhances the susceptibility of wild type plants and the mutant amt1.1 to P. syringae whereas it has no effect on P. cucumerina resistance. The metabolic changes of amt1.1 against P. syringae are subtler and are restricted to the phenylpropanoid pathway, which correlates with its reduced susceptibility.
Lin, R., Wang, X., Zhou, W., Fu, W., Wang, Y., Huang, W. and Jin, L. (2011), Association of Polymorphisms in the Solute Carrier Organic Anion Transporter Family Member 1B1 Gene with Essential Hypertension in the Uyghur Population. Annals of Human Genetics, 75: 305-311. doi: 10.1111/j.1469-1809.2010.00622.x ...
Atelosteogenesis type 2 is one of several skeletal disorders caused by mutations in the slc26a2 gene. This gene provides instructions for making a protein that is essential for the normal development of cartilage and for its conversion to bone.
The symptoms and physical findings associated with diastrophic dysplasia may be extremely variable, differing in range and severity even among affected family members (kindreds). However, in all individuals with the disorder, there is abnormal development of bones and joints of the body (skeletal and joint dysplasia).. During normal development before birth (embryonic and fetal development) as well as development during early childhood, cartilage in many areas of the body is gradually replaced by bone (ossification). In addition, a layer of cartilage (epiphyseal cartilage [growth plate]) separates the shafts (diaphyses) of long bones (e.g., bones of the arms and legs) from their ends (epiphyses), allowing long bones to grow until the cartilage is no longer present. In those affected by diastrophic dysplasia, however, there is delayed growth before and after birth (prenatal and postnatal growth retardation), the development of the ends of the long bones (epiphyses) is irregular, and the ...
This project is supported by the Canadian Institutes of Health Research (award #111062), Alberta Innovates - Health Solutions, and by The Metabolomics Innovation Centre (TMIC), a nationally-funded research and core facility that supports a wide range of cutting-edge metabolomic studies. TMIC is funded by Genome Alberta, Genome British Columbia, and Genome Canada, a not-for-profit organization that is leading Canadas national genomics strategy with funding from the federal government. Maintenance, support, and commercial licensing is provided by OMx Personal Health Analytics, Inc. Designed by Educe Design & Innovation Inc. ...
View mouse Slco1b2 Chr6:141629518-141686646 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
The human solute carrier 26 (SLC26) family of anion transporters consists of ten members that are found in various organs in the body including the stomach, intestine, kidney, thyroid and ear where they transport anions including bicarbonate, chloride and sulfate, typically in an exchange mode. Mutations in these genes cause a plethora of diseases such as diastrophic dysplasia affecting sulfate uptake into chondrocytes (SLC26A2), congenital chloride-losing diarrhoea (SLC26A3) affecting chloride secretion in the intestine and Pendreds syndrome (SLC26A4) resulting in hearing loss. To understand how these mutations affect the structures of the SLC26 membrane proteins and their ability to function properly, 12 human disease-causing mutants from SLC26A2, SLC26A3 and SLC26A4 were introduced into the equivalent sites of the sulfate transporter anti-sigma factor antagonist (STAS) domain of a bacterial homologue SLC26 protein DauA (YchM). Biophysical analyses including size-exclusion chromatography, ...
The macronutrient nitrogen (N) is an essential component of numerous important compounds, including amino acids, proteins, nucleic acids, chlorophyll, and some plant hormones. This element is a major limiting factor in most agricultural systems. Because the N-utilization efficiency strongly influences crop productivity, a vast amount of N fertilizers is applied to maximize yields. However, it is estimated that more than half of that N is lost from the plant-soil system, with unused N fertilizers severely polluting the environment [1]. Thus, N-uptake efficiency must be increased to improve productivity and reduce pollution.. During periods of N-starvation, various deficiency-responsive genes function to support plant survival by increasing the level of chlorophyll synthesis [2], altering root architecture [3], improving N-assimilation [4], enhancing lignin content [5], and changing the amounts of sugars and sugar phosphates [6]. Nitrate transporter genes (NRTs) are responsible for the ...
Although 2C8dH crystallizes as a dimer, high concentrations of a protein modified by deletion of the signal anchor are required for crystallization, which could result in artifactual dimerization (Schoch et al., 2004). In solution, 2C8dH typically elutes as a dimer from size exclusion columns during purification, and dimerization is concentration-dependent and influenced by fatty acids bound to the dimer interface (Schoch et al., 2004). In this study, we present evidence that 2C8H and native CYP2C8 exist as dimers when bound to natural bacterial and mammalian membranes, respectively. Cross-linking of Cys in either the signal anchor/linker or F-G loop regions resulted in covalently linked dimers of the 2C8 proteins. Considering the reported efficiency of cross-linking, which ranged from 25 to 80% for different Cys pairs in the human erythrocyte anion exchange protein (Taylor et al., 2001), a substantial fraction of CYP2C8 is likely to exist as a dimer.. The evidence indicates that cross-linking ...
Complete information for SLCO1B3 gene (Protein Coding), Solute Carrier Organic Anion Transporter Family Member 1B3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Complete information for SLCO1A2 gene (Protein Coding), Solute Carrier Organic Anion Transporter Family Member 1A2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
SLCO1A2 antibody (solute carrier organic anion transporter family, member 1A2) for ELISA, WB. Anti-SLCO1A2 pAb (GTX87607) is tested in Human samples. 100% Ab-Assurance.
Gene target information for Slco1a1 - solute carrier organic anion transporter family, member 1a1 (house mouse). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
In this study, we describe transcriptional regulation of the hPDS gene encoding pendrin, a major anion exchanger in the CCD, by UGN, an important modulator of fluid and electrolyte homeostasis. We demonstrate a UGN-induced decrease in both pendrin protein expression (Fig. 2) and pendrin mRNA level (Fig. 3, A and B) in kidneys harvested from mice that were injected with this modulator as well as a UGN-induced reduction in endogenous pendrin mRNA level in renal cells (Fig. 3C). In addition, we demonstrate that UGN decreases hPDS promoter activity in transfected renal cells (Figs. 4 and 5). We show that UGN modulates hPDS promoter activity in large part via a HSE located between nt −1119 and −1115 of the hPDS promoter (Figs. 5 and 6), and we demonstrate that HSF1 likely mediates this UGN-induced modulation (Fig. 7). These findings suggest that pendrin gene expression is subject to HSE/HSF1-mediated transcriptional regulation by UGN.. The renal CCD plays a vital role in acid-base homeostasis and ...
Antivirotika jsou extrémně pestrou skupinou léčiv, které nejrůznějšími mechanizmy působí proti virovým částicím. Některé narušují replikaci virové DNA, jiné blokují tvorbu virových částic v postižené buňce, další narušují průnik virů do buňky atp ...
View Notes - Answers for Assignment_9 (Fall 2008) from BBA STAS2126 at Laurentian. STAS2126 Assignment#9 (Fall 2008) Submit to Dropbox not by emailUse your first and last name as the file name Do NOT
1) We have prepared murine monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein (band 3). (2) All of these antibodies react with regions of the protein located at the cytoplasmic surface of the red cell. (3) One of the antibodies reacts with an epitope present on a cytoplasmic loop of the protein located between the C-terminus and a point 168 amino acids from the C-terminus. The other antibodies recognize different epitopes on the C-terminal tail of the protein and the sequences likely to be involved in these epitopes are defined. (4) Our results show that the C-terminus of the red-cell anion transport protein is located on the cytoplasmic side of the red-cell membrane. (5) None of the antibodies inhibited sulphate exchange transport when introduced into resealed red-cell membranes; however, the bivalent form of one of the antibodies reduced the inhibitory potency of 4-acetamido-4-isothiocyanatostilbene disulphonate on sulphate exchange transport in ...
Purpose. Biliary organic anion excretion is mediated by an ATP-dependent primary active transporter, a so-called canalicular multispecific organic anion transporter (cMOAT). As there appear to be many canalicular organic anion transports, we examined the effects of various organic anions and bile acid conjugates on the biliary excretion of pravastatin in rats. Methods. [l4C]pravastatin was intravenously injected into rats with bile drainage in the presence and absence of the continuous infusion of organic anions and bile acids, and radioactivity of its biliary excretion was studied. Results. Biliary excretion of [14C]pravastatin was markedly inhibited by sulfobromophthalein-glutathione, taurolithocholate-3-sulfate, ursodeoxycholate-3,7-sulfate, and ursodeoxycholate-3-O-glucuronide. In contrast, dibromosulfophthalein only slightly inhibited biliary pravastatin excretion, and cefpiramide did not affect biliary pravastatin excretion. Conclusions. These findings further support the multiplicity of
Congenital hereditary endothelial dystrophy (CHED) is an inherited disorder of the corneal endothelium characterised by bilateral non-inflammatory corneal clouding ranging from a diffuse haze to a ground-glass appearance. CHED can be inherited in an autosomal dominant (CHED1) or recessive (CHED2) manner. CHED2 usually presents at birth or early infancy. Bilateral corneal clouding can lead to visual impairment often accompanied by nystagmus in CHED2 patients requiring corneal transplantation.1 Mutations in the solute carrier family 4 member 11 (SLC4A11) gene have been identified in most patients with CHED2. With PCR sequencing of the entire coding and putative promoter regions of SLC4A11, there were, however, some clinically confirmed CHED2 patients with undetected SLC4A11 mutations.2 ...
Irinotecan is a relatively new anticancer agent of interest for both its clinical activity and its complex clinical pharmacology. It is a prodrug, requiring activation by carboxylesterases to SN-38, an inhibitor of topoisomerase I. Recent studies suggest that human carboxylesterase-2 is the primary carboxylesterase involved in the hydrolysis at pharmacological concentrations (1) . Irinotecan is also oxidized by CYP3A43 to the inactive metabolite 7-ethyl-10-[4-N-(5-aminopentanoic acid)-1-piperidino]carbonyloxycamptothecin as well as to 7-ethyl-10-[4-(piperidino)-1-amino]carbonyloxycamptothecin, which can undergo hydrolysis to SN-38 (2, 3, 4) . SN-38 undergoes glucuronidation by UGT1A1 (5) and is possibly oxidized by CYP3A4 as well (6) . Mass balance studies have demonstrated that 64% of the total dose is excreted in the feces, confirming the important role of biliary excretion (7) . Studies suggest that canalicular multispecific organic anion transporter is the major transporter of irinotecan and ...
Diastrophic dysplasia (DTD) is a chondrodysplasia causing severe growth retardation, and structural and functional abnormalities of joints. Growth retardation and joint abnormalities are already present in utero, and mean height at birth is 32.5 cm. Extremities are short while the trunk is of normal size, upper arms show ulnar deviation with stiff fingers and a hitchhiker thumb. Hips are stiff and most patients have club foot. A cleft palate is frequent. Growth remains slow, the median adult height for males is 135 cm and 129 cm for females. Changes in the joints often progress with age and corrective surgery becomes necessary.
TY - JOUR. T1 - The extracellular loop of pendrin and prestin modulates their voltage-sensing property. AU - Kuwabara, Makoto F.. AU - Wasano, Koichiro. AU - Takahashi, Satoe. AU - Bodner, Justin. AU - Komori, Tomotaka. AU - Uemura, Sotaro. AU - Zheng, Jing. AU - Shima, Tomohiro. AU - Homma, Kazuaki. PY - 2018/1/1. Y1 - 2018/1/1. N2 - Pendrin and prestin belong to the solute carrier 26 (SLC26) family of anion transporters. Prestin is unique among the SLC26 family members in that it displays voltage-driven motor activity (electromotility) and concurrent gating currents that manifest as nonlinear cell membrane electrical capacitance (nonlinear capacitance (NLC)). Although the anion transport mechanism of the SLC26 proteins has begun to be elucidated, the molecular mechanism of electromotility, which is thought to have evolved from an ancestral ion transport mechanism, still remains largely elusive. Here, we demonstrate that pendrin also exhibits large NLC and that charged residues present in one ...
Solute carrier organic anion transporter family member 1A2 is a protein that in humans is encoded by the SLCO1A2 gene.[1][2] This gene encodes a sodium-independent transporter which mediates cellular uptake of organic ions in the liver. Its substrates include bile acids, bromosulphophthalein, and some steroidal compounds. The protein is a member of the SLC21A family of solute carriers. Alternate splicing of this gene results in three transcript variants encoding two different isoforms.[2] ...
Find all books from Novartis Foundation - Epithelial Anion Transport in Health and Disease. At find-more-books.com you can find used, antique and new books, COMPARE results and immediately PURCHASE your selection at the best price. 9780470029565
1UC0: X-ray structural analysis of the ligand-recognition mechanism in the dual-affinity labeling of c-type lysozyme with 2,3-epoxypropyl beta-glycoside of N-acetyllactosamine
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
V deln kolon da byla postavena v dob od 1. jna 1878 do 27. dubna 1879 na m st star d ev n kolon dy podle projektu v de sk ch architekt Ferdinanda Fellnera a Hermanna Gottlieba Helmera. Proto e litinov d ly byly spojov ny ocelov mi prvky, do lo k naru en stability a na ja e roku 1939 bylo p ikro eno k jej demolici. V roce 1946 byla postavena dal konstrukce od architekta Ladislava Koz ka, kter vydr ela tvrt stolet , ve fotogalerii je uvedena jako prozat mn kolon da. V roce 1975 byla otev ena nov V deln kolon da, d lo architekta J. Otruby. ...
购买SLC35D1兔多克隆抗体(ab106523),SLC35D1抗体经WB验证,可与人,小鼠,大鼠样本反应。产品出库一年都在质保范围内。中国现货速达。
SLC39A10兔多克隆抗体(ab83947)可与小鼠, 大鼠, 人样本反应并经WB, ELISA, ICC实验严格验证。所有产品均提供质保服务,中国75%以上现货。
OAT1 is a multispecific organic anion transporter exclusively located on the basolateral membrane of the middle proximal tubule, S2 segment (Tojo et al., 1999). PAH is a high-affinity substrate of OAT1 (Km = 14.3 μM), and OAT1-mediated PAH transport was inhibited by a variety of anionic drugs (Sekine et al., 1997). OAT1 is an organic anion/dicarboxylate exchanger; preloaded glutarate trans-stimulates the uptake of PAH via OAT1 (Sekine et al., 1997). From these findings, we inferred that OAT1 is the major renal organic anion transporter at the basolateral membrane of the proximal tubule. However, the contribution of OAT1 in the renal excretion of organic anions remains to be elucidated. In fact, we have already identified several isoforms of OAT1 (Sekine et al., 1998), one of which shows higher affinity to PCG.. This study demonstrated the inhibition of PAH transport via OAT1 by all the penicillins and cephalosporins tested and OAT1-mediated transport of [3H]PCG and [14C]cephaloridine (Fig. 3). ...
Legionella pneumophila is a gram-negative, non-encapsulated, rod-shaped facultative intracellular pathogen with a single, polar flagellum. The SO42- transporter protein (LPL0734) is a membrane protein of Legionella pneumophila. The LPL0734 protein has 12 trans-membrane helices and consists of 768 residues with the expected molecular weight of 84 kDa. LPL0734 belong to a sulfate transporter family. In this thesis, we attempt to study the characteristics of LPL0734; a suspected sulfate transporter in Legionella pneumophila by cloning, expressing, purifying and crystallizing this protein. Stability testing was also conducted. In the first part of this research, we focused on the expression of a GFP-tagged SO42- transporter in Escherichia coli strains (Rosetta-II and C43 cells) and then purification of proteins (LPL0734) by metal-affinity chromatography on Ni-column followed by size-exclusion chromatography. Protein lipidation and detergent tests were also performed in order to check the stability ...
A 3.3-kb DNA transposable element of Arabidopsis thaliana, Tag1, was discovered as an insertion in the nitrate transporter gene NRT1 (CHL1) (Tsayet al. 1993). Tag1 is the only known mobile element native to the Arabidopsis genome to date although sequences or elements with similarity to a large variety of retrotransposon and transposons including Ac, En/Spm, MuDR, MITES, foldbacks and copia have been identified (Voytas and Ausubel 1988; Voytaset al. 1990; Casacubertaet al. 1998; Wright and Voytas 1998; Ade and Belzile 1999; Copenhaveret al. 1999; Henket al. 1999; Linet al. 1999; Mayeret al. 1999). Tag1 is an autonomous element (Franket al. 1997) and has the interesting feature that its transposition is controlled during shoot development (Liu and Crawford 1998a). Using 35S-Tag1-GUS constructs, it was found that Tag1 excision is restricted with a few exceptions to late events as manifested by tiny sectors in leaves, flowers, and siliques (Liu and Crawford 1998a), reminiscent of the late excision ...
A two-years postdoc position is open for non-french applicants at the Laboratoire de Biochimie et Physiologie Moléculaire des Plantes located at INRA Montpellier, France. The aim of the work is to investigate auxin transport and signalling in Arabidopsis thaliana and Casuarina glauca in relation to the regulation of root development by the nitrogen nutrition of the plant (mutation in nitrate transporter genes in A. thaliana, or formation of N2-fixing nodules in C. glauca). Highly motivated applicants with a strong publication record will be considered. The requested experimental skills include a solid background in cell and molecular biology. A good experience in protein localisation will be an advantage. Montpellier is a very attractive city of southern France, with a rich academic environment in plant sciences (several universities, many research institutions). The position has to be filled by March 2008, and the salary will be modulated according to the previous research experience of the ...
This study shows that the maximum nitrate uptake rates (Vmax) and half saturation constants for nitrate uptake (Ks-NO3) of P. micans at 20 μE m−2 s−1 measured using the nutrient repletion method are similar to those measured using the nutrient depletion method. Thus, the new repletion method of measuring the nitrate uptake rate and Ks-NO3 using cells maintained under a nitrate repletion condition gives results similar to that using cells maintained under a nitrate depletion condition. However, the Vmax of P. micans originally maintained under nitrate repletion at 50 μE m−2 s−1 obtained in this study (7.49 pM cell−1 d−1, equivalent to 21 × 10−3 h−1) is much lower than that at 56-63 μE m−2 s−1 under nutrient depletion (113 pM cell−1 d−1, equivalent to 319 × 10−3 h−1) as observed by Qi and Zhu (1994), while the Ks-NO3 of P. micans originally under nitrate repletion at 50 μE m−2 s−1 in this study was greater than that at 56-63 μE m−2 s−1. Qi and Zhu (1994) ...
N-linked glycosylation of proteins in the endoplasmic reticulum and Golgi apparatus vastly increases the structural complexity of membrane proteins. Several cellular functions have been attributed to protein glycosylation: protein folding, quality control and degradation, protein sorting, trafficking and translocation, and raft or membrane microdomain localization (Helenius and Aebi 2001). We have previously shown that membrane cholesterol modulates prestin function as well as overall auditory function (Sturm et al. 2006; Rajagopalan et al. 2007), underlining the dynamic interplay between prestin and the membrane in the generation of OHC electromotility. The involvement of N-glycosylation in protein sorting and raft interactions of some membrane proteins prompted the present investigation of the role of glycosylation in prestin function.. We have confirmed that prestin is a glycoprotein in HEK 293 cells and the double mutation of putative N-glycosylation sites results in prestinNN163/166AA being ...
Myc-DDK-tagged ORF clone of Homo sapiens solute carrier family 38, member 8 (SLC38A8) as transfection-ready DNA - 10 µg - OriGene - cdna clones
1 Oktober 2010 : Pemisahan anion Tujuan : Siswa mampu memahami prosedur identifikasi anion dengan baik dan benar Siswa mampu melaksanakn setiap proses yang terjadi pada analisis kualitatif anion Dapat melaksanakan prosedur analisis dan membuat kesimpulan dari hasil analisis yang diperoleh Siswa dapat mengidentifikasi sampel apakah terdapat anion Dasar teori : Analisa anion adalah analisa yang bertujuan untuk menganalisa adanya ion dalam sampel. Sedangkan analisa kualitatif dilakukan untuk mengetahui jenis unsur atau ion yang terdapat dalam suatu sampel. Jadi, analisa anion secara kualitatif merupakan analisa yang dilakukan untuk mengetahui adanya anion serta jenis anion apa saja yang terdapat dalam suatu sampel. Anion merupakan ion bermuatan negtif. Dalam analisa anion dikenal adanya analisa pendahuluan yang meliputi analisa kering dan analisa basah. Analisa kering meliputi pemeriksaan organoleptis (warna, bau, rasa) dan pemanasan. Analisa basah adalah analisa dengan melarutkan zat-zat dalam ...
The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012 ...
Reaktivität: Fledermaus, Rind (Kuh), Hund and more. 66 verschiedene SLC5A3 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Tetrachlorodecaoxygen anion is used in the treatment of infections.get complete information about tetrachlorodecaoxygen anion including usage, side effects, drug interaction, expert advice along with medicines associated with tetrachlorodecaoxygen anion at 1mg.com
Naručite Disk (Surgical Steel 316L) iz kategorije Kuglice i zamjenski nastavci online, sada. Besplatna dostava za iznos od $25,00 - Ovdje pronađite online prodavaonicu nakita za piercing ➔
America is on a verge now. How will be, what will be, when will be…The investments and the "so called Advisers…" went bad because for them Read More » ...
Addgene NGS Result CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGC CGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGC CTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG TGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCG TCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGG CCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAA CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCT ACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGC TCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATG CTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTCCCTGCTGGGCAGGGACTACAAC TCTGAGCTGAATAGCCTGGATAACGGCCCTCAGTCCCCATCTGAGAGCTCCTCTAGCATCACATCTGAGA ATGTGCACCCAGCAGGAGAGGCAGGACTGAGCATGATGCAGACCCTGATCCACCTGCTGAAGTGCAATAT CGGAACAGGACTGCTGGGACTGCCACTGGCCATCAAGAACGCAGGACTGCTGGTGGGACCCGTGAGCCTG ...
TY - JOUR. T1 - Functional analysis of rat renal organic anion transporter OAT-K1. T2 - Bidirectional methotrexate transport in apical membrane. AU - Masuda, Satohiro. AU - Takeuchi, Ayako. AU - Saito, Hideyuki. AU - Hashimoto, Yukiya. AU - Inui, Ken Ichi. PY - 1999/10/1. Y1 - 1999/10/1. N2 - Renal organic anion transporter OAT-K1 was stably transfected in MDCK cells and examined for its transport characteristics and membrane localization. OAT-K1 mediated both uptake and efflux of methotrexate in the apical membranes. Immunoblotting showed that the apparent molecular mass of the expressed OAT-K1 was 50 kDa, which was comparable to that found in the rat renal brush-border membranes. The OAT-K1-mediated methotrexate transport was significantly inhibited in the presence of several organic anions such as folate and sulfobromophthalein. These findings suggest that OAT-K1 mediates bidirectional methotrexate transport across the apical membranes, and may be involved in the renal handling of ...
Looking for online definition of Sodium-independent organic anion transporter E in the Medical Dictionary? Sodium-independent organic anion transporter E explanation free. What is Sodium-independent organic anion transporter E? Meaning of Sodium-independent organic anion transporter E medical term. What does Sodium-independent organic anion transporter E mean?
The newly identified chloroplast envelope-localized sulfate permease gene (sulP) and the hydrogenase gene (hydA) from the green alga Tetraspora sp. CU2551 are reported in this study. The sulP showed an open reading frame of 1014 bp with the 5- and 3-UTR being 285 and 225 bp, respectively. The deduced amino acid sequence of SulP revealed an extended N-terminus where the putative chloroplast transit peptide was identified. This suggests a close relationship between Tetraspora and Chlamydomonas reinhardtii SulPs, as confirmed by phylogenetic tree analysis. In addition, the Tetraspora hydA was identified. The cDNA sequence showed an 878 bp encoding 292 amino acid residues. The deduced amino acid sequence of Tetraspora HydA is closely related to HydA of Chlorella fusca. The transcript levels of both sulP and hydA of Tetraspora showed an up-regulation of about 2.3 times after sulfur deprivation, whereas upon sulfur repletion the expression of both genes decreased. The production of H-2 and PSII ...
Organic anions of diverse chemical structures are secreted in renal proximal tubules. The first step in secretion, uptake of organic anions across the basolateral membrane of tubule cells, is...
A collection of disease information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Atelosteogenesis type 1
Solute carrier organic anion transporter family member 2A1 (OATP2A1, encoded by the SLCO2A1 gene), which was initially identified as prostaglandin transporter (PGT), is expressed ubiquitously in tissues and mediates the distribution of prostanoids, such as PGE, PGF, PGDand TxB. It is well known to play a key role in the metabolic clearance of prostaglandins, which are taken up into the cell by OATP2A1 and then oxidatively inactivated by 15-ketoprostaglandin dehydrogenase (encoded by HPGD); indeed, OATP2A1-mediated uptake is the rate-limiting step of PGEcatabolism. Consequently, since OATP2A1 activity is required for termination of prostaglandin signaling via prostanoid receptors, its inhibition can enhance such signaling. Read More ...
Affiliation:The University of Tokyo,Faculty of Medicine,Research Associate,医学部附属病院,助手, Research Field:応用薬理学・医療系薬学,General pharmacology,Kidney internal medicine,Pediatrics,Pediatrics, Keywords:エストロン硫酸,Na^+,近位尿細管性アシドーシス,パラアミノ馬尿酸,rBAT,オクラトキシンA,organic anion transporter2,organic anion transporter3,organic anion transporter1,BAT1, # of Research Projects:8, # of Research Products:9
Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U,Markovich D, Kere J. Functional characterization of three novel tissue-specific anion exchangersSLC26A7, -A8, and -A9.J Biol Chem. 2002 Apr 19;277(16):14246-54. Epub 2002 Feb 07. PMID: 11834742 [PubMed - indexed for MEDLINE]. A second distinct family of anion exchangers, SLC26, in addition to the classical SLC4 (or anion exchanger) family, has recently been delineated. Particular interest in this gene family is stimulated by the fact that the SLC26A2, SLC26A3, and SLC26A4 genes have been recognized as the disease genes mutated in diastrophic dysplasia, congenital chloride diarrhea, and Pendred syndrome, respectively. We report the expansion of the SLC26 gene family by characterizing three novel tissue-specific members, named SLC26A7, SLC26A8, and SLC26A9, on chromosomes 8, 6, and 1, respectively. The SLC26A7-A9 proteins are structurally very similar at the amino acid level to the previous family members and show tissue-specific ...
solute carrier family 22, member 18 antisense Proteins available through Novus Biologicals. Browse our solute carrier family 22, member 18 antisense Protein catalog backed by our Guarantee+.
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
A dating site for LP singles (Little People). We have members with all types of dwarfism such as Achondroplasia, Diastrophic Dysplasia, Spondyloepiphyseal Dysplasia, and more.
A dating site for LP singles (Little People). We have members with all types of dwarfism such as Achondroplasia, Diastrophic Dysplasia, Spondyloepiphyseal Dysplasia, and more.
Thank you for sharing this Molecular Pharmacology article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
View Notes - Lab_3_-_TESTS_for_ANIONS_and_CATIONS from CHEM 111 at Abraham Baldwin Agricultural College. Lab Experiment 3: Tests for Anions and Cations Table 1 Tests for Anions Anion Symbol Test
Except cations, any electrolyte consists of anions. So, the analysis of salts, acids, natural waters and industrial solutions will be incomplete, without identification of anions. Anions are divided into three (3) analytical groups (as it is shown in the table 7.1). First group contains such anions that form insoluble barium salts. Second group contains anions, that form precipitates with
SLC22A24 - SLC22A24 (untagged)-Human solute carrier family 22, member 24 (SLC22A24) available for purchase from OriGene - Your Gene Company.
A simple three equation model is proposed for the feedback regulation of nitrate uptake and N2 fixation, based on the concentration of the organic N substrate pool within the plant and two parameters denoting the N substrate ...
China Professional Lady Anion Sanitary Pads Free Sample, Find details about China Sanitary Pads, Anion Sanitary Pads from Professional Lady Anion Sanitary Pads Free Sample - Fujian Hui′an Hecheng Household Products Co., Ltd.
Chromatografické standardyCombined Seven Anion Standard ICombined Seven Anion Standard IICombined Five Anion StandardFluoride StandardChloride StandardSulfate StandardCombined Six Cation Standard-ICombined Six Cation Standard-IIStandard for Mass Calibrati
When herbal products are used in combination therapy with drugs, alterations in pharmacokinetics, pharmacodynamics, and toxicity can result. Many active components of herbal products are organic anions, and human organic anion transporter 1 (hOAT1, S
Dammann, H.G.; Czok, G., 1975: Differences of re absorption of unconjugated sulfobromophthalein sodium and sulfobromophthalein sodium glutathione from the rat biliary tree after retrograde intra biliary injection
Community standard: a Community standard is an official position of the OGC endorsing a specification or standard developed external to the OGC. A Community standard is considered to be a normative standard by OGC membership and part of the OGC Standards Baseline. The key consideration for a Community standard is that there must be strong evidence of implementation. OGC does not take over the maintenance of the work, rather a Community standard is a "snapshot" of a mature standard for which the originator has either shared the Intellectual Property Rights with the OGC or granted unlimited free use of the Intellectual Property to all implementers.. ...
SLC22A8 - SLC22A8 (untagged)-Human solute carrier family 22 (organic anion transporter), member 8 (SLC22A8), transcript variant 1 available for purchase from OriGene - Your Gene Company.
Ortho-Phenylene bis-ureas serve as anionophores in cells expressing halide-sensitive yellow fluorescent protein, as well as in synthetic vesicles. Activities can reach high levels, and are strongly dependent on the deliverability of the transporters.. ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Build: Wed Jun 21 18:33:50 EDT 2017 (commit: 4a3b2dc). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
This OGC interoperability pilot initiative, sponsored by Geoscience Australia, the Canadian Hydrographic Service, Natural Resources Canada and the United Kingdom Hydrographic Office, will help to progress the implementation of the S-121 standard. The pilot will advance the implementation of the S-121 data model and architecture, and will implement operational prototypes to support the creation, management, integration, dissemination and onward use of official data for maritime baselines, limits, zones and boundaries. Specifically, the prototypes implemented as part of this pilot will demonstrate the ability to support:. ...
Ne propustite ovu super akciju, kupite jedno pakiranje Complete Proteina od Optimum Nutritiona, a drugo dobivate gratis. Naručite odmah putem webshopa.
Naručite Vintage Flesh Tunnel (Gold-plated) iz kategorije Tuneli & čepovi online, sada. Besplatna dostava za iznos od $25,00 - Ovdje pronađite online prodavaonicu nakita za piercing ➔
வேதியியலில் உப்பு (salt) என்பது ஒரு காடியும், காரமும் சேர்ந்து வேதியியல் வினைப்படும் பொழுது நடுமை அடைகையில் உருவாகும் பொருள். உப்புகள் மின்ம முனைப்படும் சேர்மங்கள் ஆகும். உப்புகளில் நேர்மின்மம் கொண்ட நேர்முனையி அல்லது கேட்டயான் (cation) பகுதியும், எதிர்மின்மம் கொண்ட எதிர்முனையி அல்லது ஆனையான் (anion) பகுதியும் கொண்ட ஆனால் மொத்தமாக மின்மம் ஏதுமற்ற, மின்மநடுநிலை கொண்ட ஒரு பொருள். ...
Disease: (OMIM: 217400 217700 610206 613268) Defects in SLC4A11 are the cause of corneal dystrophy and perceptive deafness (CDPD) [MIM:217400]; also known as corneal dystrophy and sensorineural deafness or Harboyan syndrome. CDPD consists of congenital corneal endothelial dystrophy and progressive perceptive deafness. Inheritance is autosomal recessive; Defects in SLC4A11 are the cause of corneal endothelial dystrophy type 2 (CHED2) [MIM:217700]; also known as congenital hereditary endothelial dystrophy of cornea. This bilateral corneal dystrophy is characterized by corneal opacification and nystagmus. Inheritance is autosomal recessive; Defects in SLC4A11 are the cause of corneal dystrophy Fuchs endothelial type 4 (FECD4) [MIM:613268]; also known as Corneal dystrophy Fuchs endothelial late-onset. It is an ocular disorder caused by loss of endothelium of the central cornea. It is characterized by focal wart-like guttata that arise from Descemet membrane and develop in the central cornea, ...
Gout, a common disease, is a consequence of hyperuricemia, and increases the risks of hypertension, cardiovascular diseases, cerebrovascular diseases and renal failure. Gout can be classified into 3 types: the renal underexcretion (RUE) type, renal overload type and combined type. RUE type is a major type of gout; however, its genetic causes are still unclear. Since human organic anion transporter 4 (OAT4/SLC22A11) is expressed in the kidney and mediates urate transport, we investigated the effects of a common variant of OAT4/SLC22A11 on the susceptibility to gout. Five hundred and forty-five Japanese male gout cases and 1,115 male individuals as a control group were genotyped with rs17300741, a single nucleotide polymorphism in the OAT4/SLC22A11 gene. The association analysis of rs17300741 showed no significant association for all gout cases; however, there was a slight but significant association for RUE type gout cases (p = 0.049). These results also suggest that OAT4 contributes to urate ...
The anion exchanger family (TC# 2.A.31) is a member of the large APC superfamily of secondary carriers. Members of the AE family are generally responsible for the transport of anions across cellular barriers, although their functions may vary. Characterized protein members of the AE family are found in plants, animals, insects and yeast. Uncharacterized AE homologues may be present in bacteria (e.g., in Enterococcus faecium, 372 aas; gi 22992757; 29% identity in 90 residues). Animal AE proteins consist of homodimeric complexes of integral membrane proteins that vary in size from about 900 amino acyl residues to about 1250 residues. Their N-terminal hydrophilic domains may interact with cytoskeletal proteins and therefore play a cell structural role. Some of the currently characterized members of the AE family can be found in the Transporter Classification Database. In humans, anion exchangers fall under the solute carrier family 4 (SLC4) family, which is composed of 10 paralogous members ...
Copyright in the material you requested is held by the American Society of Mechanical Engineers (unless otherwise noted). This email ability is provided as a courtesy, and by using it you agree that you are requesting the material solely for personal, non-commercial use, and that it is subject to the American Society of Mechanical Engineers Terms of Use. The information provided in order to email this topic will not be used to send unsolicited email, nor will it be furnished to third parties. Please refer to the American Society of Mechanical Engineers Privacy Policy for further information ...
... , Authors: Renty B Franklin, Leslie C Costello. Published in: Atlas Genet Cytogenet Oncol Haematol.
PLATFORMS: The National Rural Telecommunications Cooperative (NRTC) runs its data warehouse on Sequents NUMA-Q 2000 server with 512MB of memory and 500GB of disk storage. The RDBMS is Oracle version 7 with analysis tools from Cognos.. BACKGROUND: NRTC is a national cooperative agency established in 1987 to provide modern telecommunications services to rural America. NRTC currently has more than 800 members throughout the US, primarily local telephone and electric cooperatives. In 1994, through a partnership with DIRECTV, NRTC launched a Digital Broadcast Satellite (DBS) business.. PROBLEM SOLVED: Since its initial service offering, NRTC subscribers have grown to over 800,000. Due to an outdated IT infrastructure, NRTC had a growing volume of data, but no analysis capabilities. Manual reports generated by the large centralized databases were slow and did not provide sufficient detail. With only limited remote access to the DIRECTV database, data access and response time were unsatisfactory. ...
A feverish quest exists to uncover the events that lead to cochlear amplification in mammals. The role of the OHC is certainly paramount, and we now have identified many componentsthat form the basis of the cells unique contribution. In my mind, a few observations leadthe story on this hot topic, including the molecular identification of the OHC motor, its modulation by anions and the demonstration of the motors anion transport capabilities. Here I review some of this recent work.. ...
Browse Sigma-Aldrichs Anion Exchange Media to find products in Amberlite Strong Anion Exchangers, Amberlite® Weak Anion Exchangers, Diaion® Strong Anion Exchanger, Diaion® Weak Anion Exchangers, Dowex® Strong Anion Exchangers, Dowex® Weak Anion Exchangers, Lewatit® Strong Anion Exchanger, Lewatit® Weak Anion Exchanger
The cornea, blood-retinal barrier and blood-aqueous humor barrier are a significant impediment to ocular drug delivery. These barriers are comprised of endothelial and/or epithelial tissues that act as a physical barrier to drug movement into the intraocular compartment from the outside. There is increasing evidence that these endothelial and epithelial tissues contain drug transporters, and that through active transport they play a functional role in ocular drug disposition as well. Early in vivo and in vitro studies showed that drugs containing a net negative charge at physiological pH (organic anions) are actively eliminated from the eye, with the ciliary body epithelium being a likely site of elimination. An initial screen of drug transporter gene expression by microarray showed that several transporters that contribute to the renal elimination of organic anions are also expressed in the human ciliary body. These included the organic anion transporter 1 (OAT1), organic anion transporter 3 ...

Monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein. Localization of the C-terminus...Monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein. Localization of the C-terminus...

4) Our results show that the C-terminus of the red-cell anion transport protein is located on the cytoplasmic side of the red- ... Monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein. Localization of the C-terminus ... Monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein. Localization of the C-terminus ... Monoclonal antibodies to the membrane domain of the human erythrocyte anion transport protein. Localization of the C-terminus ...
more infohttp://www.biochemj.org/content/258/1/211

distal Renal Tubular Acidosis (dRTA) - Medical Needdistal Renal Tubular Acidosis (dRTA) - Medical Need

This gene provides instructions for making the anion exchanger 1 (AE1) protein, which transports negatively charged atoms ( ... and normal AE1 protein is produced from the other copy. However, the altered protein attaches to the normal protein and keeps ... In red blood cells, interaction with a protein called glycophorin A can often help the altered AE1 protein get to the cell ... However, some altered AE1 proteins cannot be helped by glycophorin A and are not found in the cell membrane. Without AE1, the ...
more infohttp://medicalneed.com/healthcare-professionals/renal-tubular-acidosis/

Cystic fibrosis transmembrane conductance regulator: a molecular model defines the architecture of the anion conduction path...Cystic fibrosis transmembrane conductance regulator: a molecular model defines the architecture of the anion conduction path...

The predicted geometry of the anion conduction path was defined by a space-filling model of the pore and confirmed by ... The predicted dimensions of the bottleneck are consistent with the demonstrated permeation of Cl(-), pseudohalide anions, water ... with particular attention being paid to the location of the rate-limiting barrier for anion conduction. Side-chain orientations ... Ion Transport, Models, Molecular, Molecular Dynamics Simulation, Oocytes, Protein Conformation, Xenopus laevis ...
more infohttps://www.neuroscience.ox.ac.uk/publications/322751

CLIC4 (chloride intracellular channel 4)CLIC4 (chloride intracellular channel 4)

Overexpressed chloride intracellular channel protein CLIC4 (p64H1) is an essential component of novel plasma membrane anion ... morphogenesis in camera-type eye extracellular exosome cellular response to calcium ion chloride transmembrane transport NDEx ... Protein : pattern, domain, 3D structure. UniProt/SwissProt. Q9Y696 [function] [subcellular_location] [family_and_domains] [ ... The human protein consists of 253 amino acids with an N-terminal transmembrane domain and C-terminal nuclear localisation ...
more infohttp://atlasgeneticsoncology.org/Genes/CLIC4ID40102ch1p36.html

Structures: Band 3 anion transport protein (P02730) | InterPro | EMBL-EBIStructures: Band 3 anion transport protein (P02730) | InterPro | EMBL-EBI

We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their ... InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites ... Solved structures for this protein. ID. Structure. Description. 1btq THE SOLUTION STRUCTURES OF THE FIRST AND SECOND ... STRUCTURAL STUDIES ON THE EFFECTS OF THE DELETION IN THE RED CELL ANION EXCHANGER (BAND3, AE1) ASSOCIATED WITH SOUTH EAST ASIAN ...
more infohttp://www.ebi.ac.uk/interpro/protein/P02730/structures

RCSB PDB - Protein Feature View 









 - Band 3 anion transport protein - P02730 (B3AT HUMAN)RCSB PDB - Protein Feature View - Band 3 anion transport protein - P02730 (B3AT HUMAN)

The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex ... Protein Feature View of PDB entries mapped to a UniProtKB sequence * Number of PDB entries for P78487: no matching PDB entries ... This protein in other organisms (by gene name): P78487 - Homo sapiens 0 * P15575 - Gallus gallus no matching PDB entries ... Protein disorder predictions are based on JRONN (Troshin, P. and Barton, G. J. unpublished), a Java implementation of RONN * ...
more infohttp://www.rcsb.org/pdb/protein/P78487

SLC4A1 elisa kit | Human Band 3 anion transport protein (SLC4A1) ELISA Kit-NP 000333.1SLC4A1 elisa kit | Human Band 3 anion transport protein (SLC4A1) ELISA Kit-NP 000333.1

Human Band 3 anion transport protein (SLC4A1) ELISA Kit-NP_000333.1 (MBS7230564) product datasheet at MyBioSource, ELISA Kits ... UniProt Protein Name Band 3 anion transport protein UniProt Synonym Protein Names Anion exchange protein 1; AE 1; Anion ... Band 3 anion transport protein (SLC4A1), ELISA Kit. ★Popular Item★ Also Known As Human Band 3 anion transport protein (SLC4A1) ... NCBI Protein Information band 3 anion transport protein; Diego blood group; Swann blood group; anion exchanger 1; anion ...
more infohttps://www.mybiosource.com/prods/ELISA-Kit/Human/Band-3-anion-transport-protein-SLC4A1/SLC4A1/datasheet.php?products_id=7230564

Classification of inhibitors of hepatic organic anion transporting polypeptides (OATPs): influence of protein expression on...Classification of inhibitors of hepatic organic anion transporting polypeptides (OATPs): influence of protein expression on...

Classification of inhibitors of hepatic organic anion transporting polypeptides (OATPs): influence of protein expression on ... Classification of Inhibitors of Hepatic Organic Anion Transporting Polypeptides (OATPs): Influence of Protein Expression on ... Classification of Inhibitors of Hepatic Organic Anion Transporting Polypeptides (OATPs): Influence of Protein Expression on ... Classification of Inhibitors of Hepatic Organic Anion Transporting Polypeptides (OATPs): Influence of Protein Expression on ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/22541068?dopt=Abstract

Interindividual Variability in Hepatic Organic Anion-Transporting Polypeptides and P-Glycoprotein (ABCB1) Protein Expression:...Interindividual Variability in Hepatic Organic Anion-Transporting Polypeptides and P-Glycoprotein (ABCB1) Protein Expression:...

Interindividual variability in protein expression of organic anion-transporting polypeptides (OATPs) OATP1B1, OATP1B3, OATP2B1 ... Interindividual Variability in Hepatic Organic Anion-Transporting Polypeptides and P-Glycoprotein (ABCB1) Protein Expression: ... Interindividual Variability in Hepatic Organic Anion-Transporting Polypeptides and P-Glycoprotein (ABCB1) Protein Expression: ... The mean ± S.D. (maximum/minimum range in parentheses) protein expression (fmol/µg of membrane protein) in human liver tissue ...
more infohttp://dmd.aspetjournals.org/content/42/1/78.abstract

Molecular alterations of canalicular transport systems in experimental models of cholestasis: possible functional correlations.Molecular alterations of canalicular transport systems in experimental models of cholestasis: possible functional correlations.

ATP-dependent canalicular transport systems (also termed export pumps) for bile salts, amphiphilic anionic conjugates, ... 0/Anion Transport Proteins; 0/Bicarbonates; 0/Bile Acids and Salts; 0/Carrier Proteins; 0/P-Glycoprotein; 0/Phospholipids; 56- ... Anion Transport Proteins. Bicarbonates / metabolism. Bile Acids and Salts / metabolism. Bile Canaliculi / physiopathology*. ... Biological Transport, Active. Carrier Proteins / metabolism. Cholestasis / etiology, genetics, physiopathology*. Cholesterol / ...
more infohttp://www.biomedsearch.com/nih/Molecular-alterations-canalicular-transport-systems/9626757.html

Protein kinase C regulates the internalization and function of the human organic anion transporting polypeptide 1A2.  - PubMed ...Protein kinase C regulates the internalization and function of the human organic anion transporting polypeptide 1A2. - PubMed ...

Protein kinase C regulates the internalization and function of the human organic anion transporting polypeptide 1A2.. Zhou F1, ... Protein kinase C regulates the internalization and function of the human organic anion transporting polypeptide 1A2 ... Protein kinase C regulates the internalization and function of the human organic anion transporting polypeptide 1A2 ... Protein kinase C regulates the internalization and function of the human organic anion transporting polypeptide 1A2 ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/21133891?dopt=Abstract

The role of multidrug resistance protein 1 (MRP1) in transport of fluorescent anions across the human erythrocyte membrane, The...The role of multidrug resistance protein 1 (MRP1) in transport of fluorescent anions across the human erythrocyte membrane, The...

... in transport of fluorescent anions across the human erythrocyte membrane, The Journal of Membrane Biology" on DeepDyve, the ... Transport of organic anions by multidrug resistanceassociated protein in the erythrocyte. Rychlik, B.; Pulaski, L.; Sokal, A.; ... The role of multidrug resistance protein 1 (MRP1) in transport of fluorescent anions across the human erythrocyte membrane. ... The role of multidrug resistance protein 1 (MRP1) in transport of fluorescent anions across the... Rychlik, B.; Balcerczyk, A ...
more infohttps://www.deepdyve.com/lp/springer_journal/the-role-of-multidrug-resistance-protein-1-mrp1-in-transport-of-CSW2cCJq2X

Effect of total saponin of Dioscorea on chronic hyperuricemia and expression of URAT1 in rats]. | CureHunterEffect of total saponin of Dioscorea on chronic hyperuricemia and expression of URAT1 in rats]. | CureHunter

Anion Transport Proteins (biosynthesis, genetics, metabolism) *Benzbromarone (pharmacology) *Dioscorea (chemistry) *Gout ... with high expressions of renal URAT1 mRNA and URAT1 protein. TSD could dose-dependently reduce the serum uric acid level of ... and reduce renal URAT1 mRNA and URAT1 protein expression. Its effects were similar with that of benzbromarone, but with no ... URAT1 mRNA and URAT1 protein expression in rat renal tubular cells were determined by RT-PCR and immunohistochemistry method ...
more infohttp://www.curehunter.com/public/pubmed24199570.do

Simultaneous Assessment of Uptake and Metabolism in Rat Hepatocytes: A Comprehensive Mechanistic Model | Journal of...Simultaneous Assessment of Uptake and Metabolism in Rat Hepatocytes: A Comprehensive Mechanistic Model | Journal of...

... shows relevant inhibition of organic anion-transporting protein 1B1-mediated transport of atorvastatin. Drug Metab Dispos 38: ... organic anion-transporting protein. ABT. 1-aminobenzotriazole. M1. 2-despiperidyl-2-amino repaglinide. M2. 2-despiperidyl-2(5- ... Organic anion-transporting proteins (OATPs) are expressed on the sinusoidal membrane of hepatocytes and have been identified as ... 2008) Xenobiotic transporters of the human organic anion transporting polypeptides (OATP) family. Xenobiotica 38:778-801. ...
more infohttp://jpet.aspetjournals.org/content/341/1/2?ijkey=c8948829a37d6a24aaabbb1116c824434608f37f&keytype2=tf_ipsecsha

SWISS-MODEL Template Library | 1hynSWISS-MODEL Template Library | 1hyn

CRYSTAL STRUCTURE OF THE CYTOPLASMIC DOMAIN OF HUMAN ERYTHROCYTE BAND-3 PROTEIN ... BAND 3 ANION TRANSPORT PROTEIN. Oligo-state. homo-dimer. SMTL ID. 1hyn.2. Ligands. -. Polypeptides. BAND 3 ANION TRANSPORT ... PROTEIN. Oligo-state. homo-dimer. SMTL ID. 1hyn.3. Ligands. -. Polypeptides. BAND 3 ANION TRANSPORT PROTEIN. Oligo-state. homo- ... CRYSTAL STRUCTURE OF THE CYTOPLASMIC DOMAIN OF HUMAN ERYTHROCYTE BAND-3 PROTEIN; X-RAY DIFFRACTION 2.60 Å SMTL ID. 1hyn.1. ...
more infohttps://swissmodel.expasy.org/templates/1hyn

Plasma S1P concentration is decreased in SPNS2-deficien | Open-iPlasma S1P concentration is decreased in SPNS2-deficien | Open-i

Anion Transport Proteins/deficiency/genetics/metabolism*. *Endothelial Cells/metabolism*. *Lysophospholipids/blood/metabolism* ...
more infohttps://openi.nlm.nih.gov/detailedresult.php?img=PMC3379171_pone.0038941.g003&req=4

SLC22A8 gene - Semantic ScholarSLC22A8 gene - Semantic Scholar

Impaired organic anion transport in kidney and choroid plexus of organic anion transporter 3 (Oat3 (Slc22a8)) knockout mice. ... Murine renal organic anion transporters mOAT1 and mOAT3 facilitate the transport of neuroactive tryptophan metabolites. ... Known as: SOLUTE CARRIER FAMILY 22 (ORGANIC ANION TRANSPORTER), MEMBER 8, OAT3, ORGANIC ANION TRANSPORTER 3 (More). ... Functional involvement of rat organic anion transporter 3 (rOat3; Slc22a8) in the renal uptake of organic anions. ...
more infohttps://www.semanticscholar.org/topic/SLC22A8-gene/55257

Interleukin-13 induces a hypersecretory ion transport phenotype in human bronchial epithelial cells. - Semantic ScholarInterleukin-13 induces a hypersecretory ion transport phenotype in human bronchial epithelial cells. - Semantic Scholar

Membrane permeablization studies indicated that IL-13 induced the functional expression of an apical Ca(2+)-activated anion ... We have investigated the effects of IL-13 on the ion transport characteristics of human bronchial epithelial cells cultured at ... secretory phenotype that is the result of loss of amiloride-sensitive current and an increase in a DIDS-sensitive apical anion ... Electrophysiological characteristics of the Ca2+-activated Cl- channel family of anion transport proteins.. *C M Fuller, D J ...
more infohttps://www.semanticscholar.org/paper/Interleukin-13-induces-a-hypersecretory-ion-in-Danahay-Atherton/40b14aa52780306a934b4b8a7d1dd54ae09f3fef

Inhibition of EMT reduces immune infiltration in kidney | Open-iInhibition of EMT reduces immune infiltration in kidney | Open-i

Organic Anion Transport Protein 1/genetics. Related in: MedlinePlus. © Copyright Policy Related In: Results - Collection ...
more infohttps://openi.nlm.nih.gov/detailedresult.php?img=PMC4587560_nihms700914f4&req=4

Systemic gut microbial modulation of bile acid metabolism in host tissue compartments | PNASSystemic gut microbial modulation of bile acid metabolism in host tissue compartments | PNAS

1996) Immunologic distribution of an organic anion transport protein in rat liver and kidney. Am J Physiol 271:G231-G238. ... organic anion transporting polypeptide 1 (OATP1) (29), and kidney specific organic anion transporter (OATK2) (30)] and ... multidrug resistance-associated protein 2 (MRP2), multidrug resistance protein 3 (MDR3), and ATP-binding cassette (ABC) G5/G8] ... G protein-coupled bile acid receptor 1. The importance of gut microbiome variation in relation to human health and diverse ...
more infohttps://www.pnas.org/content/108/Supplement_1/4523

Biology  | Free Full-Text | Transcriptional Regulation of the Mitochondrial Citrate and Carnitine/Acylcarnitine Transporters:...Biology | Free Full-Text | Transcriptional Regulation of the Mitochondrial Citrate and Carnitine/Acylcarnitine Transporters:...

Streptozotocin-induced alterations in the levels of functional mitochondrial anion transport proteins. Arch. Biochem. Biophys. ... Ma, C.; Kotaria, R.; Mayor, J.A.; Remani, S.; Walters, D.E.; Kaplan, R.S. The yeast mitochondrial citrate transport protein: ... Kaplan, R.S.; Mayor, J.A.; Kotaria, R.; Walters, D.E.; McHaourab, H.S. The yeast mitochondrial citrate transport protein: ... Aluvila, S.; Sun, J.; Harrison, D.H.; Walters, D.E.; Kaplan, R.S. Inhibitors of the mitochondrial citrate transport protein: ...
more infohttp://www.mdpi.com/2079-7737/2/1/284/htm

Index by author - January 01, 2001, 296 (1) | Journal of Pharmacology and Experimental TherapeuticsIndex by author - January 01, 2001, 296 (1) | Journal of Pharmacology and Experimental Therapeutics

Hepatic Uptake of Synthetic Chlorogenic Acid Derivatives by the Organic Anion Transport Proteins Dietmar Schwab, Andreas W. ... Hepatic Uptake of Synthetic Chlorogenic Acid Derivatives by the Organic Anion Transport Proteins Dietmar Schwab, Andreas W. ... Hepatic Uptake of Synthetic Chlorogenic Acid Derivatives by the Organic Anion Transport Proteins Dietmar Schwab, Andreas W. ... Hepatic Uptake of Synthetic Chlorogenic Acid Derivatives by the Organic Anion Transport Proteins Dietmar Schwab, Andreas W. ...
more infohttp://jpet.aspetjournals.org/content/296/1.index-by-author

Slc4a1 MGI Mouse Gene Detail - MGI:109393 - solute carrier family 4 (anion exchanger), member 1Slc4a1 MGI Mouse Gene Detail - MGI:109393 - solute carrier family 4 (anion exchanger), member 1

Protein Ontology. PR:000002033 band 3 anion transport protein. (term hierarchy). * InterPro Domains ... protein coding gene. Chr11:102348820-102366203 (-). 129S1/SvImJ MGP_129S1SvImJ_G0019232. protein coding gene. Chr11:105314974- ... protein coding gene. Chr11:100876913-100894310 (-). AKR/J MGP_AKRJ_G0019169. protein coding gene. Chr11:103990994-104009893 (-) ... protein coding gene. Chr11:105188738-105206833 (-). CBA/J MGP_CBAJ_G0018952. protein coding gene. Chr11:113086883-113106934 (-) ...
more infohttp://www.informatics.jax.org/marker/MGI:109393

Recombinant Human Band 3/AE 1 protein (Tagged) (ab235968) | AbcamRecombinant Human Band 3/AE 1 protein (Tagged) (ab235968) | Abcam

... is an Escherichia coli Protein fragment 1 to 403 aa range, , 90% purity and validated in SDS-PAGE. ... Anion exchanger 1. *B3AT_HUMAN. *Band 3. *Band 3 anion transport protein ... Detected in erythrocytes (at protein level) (PubMed:7506871, PubMed:26542571). Isoform 2 is expressed in kidney (at protein ... Proteins and Peptides. Proteomics tools. Agonists, activators, antagonists and inhibitors. Lysates. Multiplex Assays. By ...
more infohttps://www.abcam.com/recombinant-human-band-3ae-1-protein-tagged-ab235968.html
  • URAT1 mRNA and URAT1 protein expression in rat renal tubular cells were determined by RT-PCR and immunohistochemistry method respectively. (curehunter.com)
  • Canalicular excretion of bile salts and several non-bile acid organic anions is impaired in various experimental models of cholestasis. (biomedsearch.com)
  • MBS7230564 is a ready-to-use microwell, strip plate Competitive ELISA (enzyme-linked immunosorbent assay) Kit for analyzing the presence of the Band 3 anion transport protein (SLC4A1) ELISA Kit target analytes in biological samples. (mybiosource.com)
  • The discovery of unidirectional, ATP-dependent canalicular transport systems (also termed "export pumps") for bile salts, amphiphilic anionic conjugates, lipophilic cations, and phospholipids has opened new opportunities for understanding biliary physiology and the pathophysiology of cholestasis. (biomedsearch.com)
  • 7. Nagase K, Tomi M, Tachikawa M, Hosoya K. Functional and molecular characterization of adenosine transport at the rat inner blood-retinal barrier. (springer.com)
  • Indiveri C, Iacobazzi V, Giangregorio N, Palmieri F (1997) The mitochondrial carnitine carrier protein: cDNA cloning, primary structure, and comparison with other mitochondrial transport proteins. (springer.com)
  • Recent cloning of several canalicular transport systems now facilitates studies on their molecular regulation in cholestasis. (biomedsearch.com)
  • With the increasing availability of molecular probes for these transport systems in humans, new information on the molecular regulation of canalicular transport proteins in human cholestatic liver diseases is beginning to emerge and should bring new insights into their pathophysiology and treatment. (biomedsearch.com)
  • In the present study the role of protein kinase C (PKC) in the regulation of OATP1A2 was investigated in an in vitro cell model. (nih.gov)
  • Nafcillin, a model beta-lactam antibiotic showing extensive biliary excretion, was taken up by isolated rat hepatocytes, and this transport could be inhibited with estrone-3-sulfate and sulfobromophthalein. (solvobiotech.com)
  • Unlike rOatp1a1, rOatp1a4 was shown to transport digoxin, and is thus a likely player in the hepatobiliary excretion and brain accumulation of this drug . (solvobiotech.com)
  • rOatp1a4 was able to transport taurocholate, cholate, 17b-estradiol-glucuronide, estrone-3-sulfate and ouabain, the latter with higher affinity than rOatp1a1, suggesting that rOatp1a4 may play the dominant role in ouabain transport in the rat liver. (solvobiotech.com)
  • Electrophysiological characteristics of the Ca2+-activated Cl- channel family of anion transport proteins. (semanticscholar.org)