A species of ANABAENA that can form SPORES called akinetes.
A genus of CYANOBACTERIA consisting of trichomes that are untapered with conspicuous constrictions at cross-walls. A firm individual sheath is absent, but a soft covering is often present. Many species are known worldwide as major components of freshwater PLANKTON and also of many saline lakes. The species ANABAENA FLOS-AQUAE is responsible for acute poisonings of various animals.
A phylum of oxygenic photosynthetic bacteria comprised of unicellular to multicellular bacteria possessing CHLOROPHYLL a and carrying out oxygenic PHOTOSYNTHESIS. Cyanobacteria are the only known organisms capable of fixing both CARBON DIOXIDE (in the presence of light) and NITROGEN. Cell morphology can include nitrogen-fixing heterocysts and/or resting cells called akinetes. Formerly called blue-green algae, cyanobacteria were traditionally treated as ALGAE.
An enzyme system that catalyzes the fixing of nitrogen in soil bacteria and blue-green algae (CYANOBACTERIA). EC 1.18.6.1.
The process in certain BACTERIA; FUNGI; and CYANOBACTERIA converting free atmospheric NITROGEN to biologically usable forms of nitrogen, such as AMMONIA; NITRATES; and amino compounds.
A non-heme iron-sulfur protein isolated from Clostridium pasteurianum and other bacteria. It is a component of NITROGENASE along with molybdoferredoxin and is active in nitrogen fixation.
The metal-free blue phycobilin pigment in a conjugated chromoprotein of blue-green algae. It functions as light-absorbing substance together with chlorophylls.
A widely distributed genus of TICKS, in the family IXODIDAE, including a number that infest humans and other mammals. Several are vectors of diseases such as TULAREMIA; ROCKY MOUNTAIN SPOTTED FEVER; COLORADO TICK FEVER; and ANAPLASMOSIS.
An enzyme that in the course of pyrimidine biosynthesis, catalyzes the oxidation of dihydro-orotic acid to orotic acid utilizing oxygen as the electron acceptor. This enzyme is a flavoprotein which contains both FLAVIN-ADENINE DINUCLEOTIDE and FLAVIN MONONUCLEOTIDE as well as iron-sulfur centers. EC 1.3.3.1.
A large multisubunit protein complex that is found in the THYLAKOID MEMBRANE. It uses light energy derived from LIGHT-HARVESTING PROTEIN COMPLEXES to drive electron transfer reactions that result in either the reduction of NADP to NADPH or the transport of PROTONS across the membrane.
The functional hereditary units of BACTERIA.
An autosomal dominant skin disease characterized by transient and variable noninflammatory ERYTHEMA and hyperkeratosis. It has been associated with mutations in the genes that code for CONNEXINS. Erythrokeratodermia variabilis inherited in an autosomal recessive fashion has also been reported. Affected individuals often develop PALMOPLANTAR KERATODERMA.
Dithionite. The dithionous acid ion and its salts.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Any normal or abnormal coloring matter in PLANTS; ANIMALS or micro-organisms.
A plant genus of the family ASTERACEAE that contains antifungal plant defensin.
An element with the atomic symbol N, atomic number 7, and atomic weight [14.00643; 14.00728]. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells.
Proteins found in any species of bacterium.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A genus of zygomycetous fungi of the family Mucoraceae, order MUCORALES.
Protein complexes that take part in the process of PHOTOSYNTHESIS. They are located within the THYLAKOID MEMBRANES of plant CHLOROPLASTS and a variety of structures in more primitive organisms. There are two major complexes involved in the photosynthetic process called PHOTOSYSTEM I and PHOTOSYSTEM II.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A species in the genus ANABAENA containing gas vacuoles that gives buoyancy to the organism. It can form extensive blooms in FRESH WATER and is responsible for acute poisonings of various animals.
That portion of the electromagnetic spectrum in the visible, ultraviolet, and infrared range.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Arthropods, other than insects and arachnids, which transmit infective organisms from one host to another or from an inanimate reservoir to an animate host.
The rate dynamics in chemical or physical systems.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A form of congenital ichthyosis inherited as an autosomal dominant trait and characterized by ERYTHRODERMA and severe hyperkeratosis. It is manifested at birth by blisters followed by the appearance of thickened, horny, verruciform scales over the entire body, but accentuated in flexural areas. Mutations in the genes that encode KERATIN-1 and KERATIN-10 have been associated with this disorder.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A species in the genus ANABAENA whose trichomes are composed of cylindrical cells.

Respiratory terminal oxidases in the facultative chemoheterotrophic and dinitrogen fixing cyanobacterium Anabaena variabilis strain ATCC 29413: characterization of the cox2 locus. (1/21)

Upon nitrogen step-down, some filamentous cyanobacteria differentiate heterocysts, cells specialized for dinitrogen fixation, a highly oxygen sensitive process. Aerobic respiration is one of the mechanisms responsible for a microaerobic environment in heterocysts and respiratory terminal oxidases are the key enzymes of the respiratory chains. We used Anabaena variabilis strain ATCC 29413, because it is one of the few heterocyst-forming facultatively chemoheterotrophic cyanobacteria amenable to genetic manipulation. Using PCR with degenerate primers, we found four gene loci for respiratory terminal oxidases, three of which code for putative cytochrome c oxidases and one whose genes are homologous to cytochrome bd-type quinol oxidases. One cytochrome c oxidase, Cox2, was the only enzyme whose expression, tested by RT-PCR, was evidently up-regulated in diazotrophy, and therefore cloned, sequenced, and characterized. Up-regulation of Cox2 was corroborated by Northern and primer extension analyses. Strains were constructed lacking Cox1 (a previously characterized cytochrome c oxidase), Cox2, or both, which all grew diazotrophically. In vitro cytochrome c oxidase and respiratory activities were determined in all strains, allowing for the first time to estimate the relative contributions to total respiration of the different respiratory electron transport branches under different external conditions. Especially adding fructose to the growth medium led to a dramatic enhancement of in vitro cytochrome c oxidation and in vivo respiratory activity without significantly influencing gene expression.  (+info)

High-affinity vanadate transport system in the cyanobacterium Anabaena variabilis ATCC 29413. (2/21)

High-affinity vanadate transport systems have not heretofore been identified in any organism. Anabaena variabilis, which can fix nitrogen by using an alternative V-dependent nitrogenase, transported vanadate well. The concentration of vanadate giving half-maximum V-nitrogenase activity when added to V-starved cells was about 3 x 10(-9) M. The genes for an ABC-type vanadate transport system, vupABC, were found in A. variabilis about 5 kb from the major cluster of genes encoding the V-nitrogenase, and like those genes, the vupABC genes were repressed by molybdate; however, unlike the V-nitrogenase genes the vanadate transport genes were expressed in vegetative cells. A vupB mutant failed to grow by using V-nitrogenase unless high levels of vanadate were provided, suggesting that there was also a low-affinity vanadate transport system that functioned in the vupB mutant. The vupABC genes belong to a family of putative metal transport genes that include only one other characterized transport system, the tungstate transport genes of Eubacterium acidaminophilum. Similar genes are not present in the complete genomes of other bacterial strains that have a V-nitrogenase, including Azotobacter vinelandii, Rhodopseudomonas palustris, and Methanosarcina barkeri.  (+info)

Cross-functionality of nitrogenase components NifH1 and VnfH in Anabaena variabilis. (3/21)

Anabaena variabilis fixes nitrogen under aerobic growth conditions in differentiated cells called heterocysts using either a Mo nitrogenase or a V nitrogenase. The nifH1 gene, which encodes the dinitrogenase reductase of the Mo nitrogenase that is expressed only in heterocysts, is cotranscribed with nifD1 and nifK1, which together encode the Mo dinitrogenase. These genes were expressed in the presence or absence of molybdate or vanadate. The vnfH gene, which encodes the dinitrogenase reductase of the V nitrogenase, was located about 23 kb from vnfDGK, which encodes the V dinitrogenase; however, like vnfDGK, vnfH was expressed only in the absence of molybdate, with or without vanadate. Like nifH1, the vnfH gene was expressed exclusively in heterocysts under either aerobic or anaerobic growth conditions and thus is under the control of developmental factors. The vnfH mutant was able to grow diazotrophically using the V nitrogenase, because NifH1, which was also made in cells starved for molybdate, could substitute for VnfH. Under oxic conditions, the nifH1 mutant grew in the absence of molybdate but not in its presence, using VnfH, while the nifH1 vnfH double mutant did not grow diazotrophically with or without molybdate or vanadate. A nifH1 mutant that expressed nifDK and vnfH but not vnfDGK was able to grow and fix nitrogen normally, indicating that VnfH could substitute for NifH in the Mo nitrogenase and that these dinitrogenase reductases are not involved in determining the metal specificity of the Mo nitrogenase or the V nitrogenase.  (+info)

Discovery of two cyanobacterial phenylalanine ammonia lyases: kinetic and structural characterization. (4/21)

Phenylalanine ammonia lyase (PAL) catalyzes the deamination of phenylalanine to cinnamate and ammonia. While PALs are common in terrestrial plants where they catalyze the first committed step in the formation of phenylpropanoids, only a few prokaryotic PALs have been identified to date. Here we describe for the first time PALs from cyanobacteria, in particular, Anabaena variabilis ATCC 29413 and Nostoc punctiforme ATCC 29133, identified by screening the genome sequences of these organisms for members of the aromatic amino acid ammonia lyase family. Both PAL genes associate with secondary metabolite biosynthetic gene clusters as observed for other eubacterial PAL genes. In comparison to eukaryotic homologues, the cyanobacterial PALs are 20% smaller in size but share similar substrate selectivity and kinetic activity toward L-phenylalanine over L-tyrosine. Structure elucidation by protein X-ray crystallography confirmed that the two cyanobacterial PALs are similar in tertiary and quatenary structure to plant and yeast PALs as well as the mechanistically related histidine ammonia lyases.  (+info)

Transcription of hupSL in Anabaena variabilis ATCC 29413 is regulated by NtcA and not by hydrogen. (5/21)

 (+info)

Structural and biochemical characterization of the therapeutic Anabaena variabilis phenylalanine ammonia lyase. (6/21)

 (+info)

High cell density culture of Anabaena variabilis with controlled light intensity and nutrient supply. (7/21)

Controlling the light energy and major nutrients is important for high cell density culture of cyanobacterial cells. The growth phase of Anabaena variabilis can be divided into an exponential growth phase and a deceleration phase. In this study, the cell growth in the deceleration phase showed a linear growth pattern. Both the period of the exponential growth phase and the average cell growth rate in the deceleration phase increased by controlling the light intensity. To control the light intensity, the specific irradiation rate was maintained above 10 micromol/s/g dry cell by increasing the incident light intensity stepwise. The final cell density increased by controlling the nutrient supply. For the control of the nutrient supply, nitrate, phosphate, and sulfate were intermittently added based on the growth yield, along with the combined control of light intensity and nutrient concentration. Under these control conditions, both final cell concentration and cell productivity increased, to 8.2 g/l and 1.9 g/l/day, respectively.  (+info)

Regulation of fructose transport and its effect on fructose toxicity in Anabaena spp. (8/21)

 (+info)

Discover Lifes page about the biology, natural history, ecology, identification and distribution of Psithyrus variabilis, abdomen, UGCA195894 image
The Joint Quantum Institute is a research partnership between University of Maryland (UMD) and the National Institute of Standards and Technology, with the support and participation of the Laboratory for Physical Sciences.. Created in 2006 to pursue theoretical and experimental studies of quantum physics in the context of information science and technology, JQI is located on UMDs College Park campus.. ...
The aim of this thesis is to enhance heterocyst-based hydrogen production inNostoc punctiforme ATCC 29133. We envision to do so by finely regulatingthe ratio of heterocyst in order to optimize the filament energy balance. Wehereby report the development of an optogenetic synthetic switch basedon the native PcpeC promoter. The optogenetic switch featured a 24-folddynamic range when measuring reporter sfGFP fluorescence. Such a geneticgate was conceived to artificially drive the expression of hetR, the masterregulator of heterocyst development. We achieved to induce enhancedheterocyst differentiation in the presence of ammonia only by changing thechromatic properties of the light source. Thus, the natural cell developmentregulation was substituted by effectively introducing a full person-drivencontrol over the process.. ...
The suite of biological catalysts found in Nature has the potential to contribute immensely to scientific advancements, ranging from industrial biotechnology to innovations in bioenergy and medical intervention. The endeavour to obtain a catalyst of choice is, however, wrought with challenges. Herein we report the design of a structure-based annotation system for the identification of functionally similar enzymes from diverse sequence backgrounds. Focusing on an enzymatic activity with demonstrated synthetic and therapeutic relevance, five new phenylalanine ammonia lyase (PAL) enzymes were discovered and characterised with respect to their potential applications. The variation and novelty of various desirable traits seen in these previously uncharacterised enzymes demonstrates the importance of effective sequence annotation in unlocking the potential diversity that Nature provides in the search for tailored biological tools. This new method has commercial relevance as a strategy for assaying the ...
Anabaena variabilis ATCC 29413 is a filamentous heterocyst-forming cyanobacterium that fixes nitrogen and CO2 using the energy of sunlight via oxygen-evolving plant-type photosynthesis. It has also been studied extensively for the production of hydrogen using solar energy. It has a complex life cycle that includes different types of differentiated cells: heterocysts for nitrogen fixation, and akinetes (spores) for survival. It has been studied extensively for over 40 years and is the strain of choice for many laboratories throughout the world. (EBI Integr8 ...
Salvia spp. (Labiatae) are important sources of antioxidants that are used aspreservatives in food industries, as well as pharmaceuticals for protecting the bodyagainst oxidative stress, free radi
Quercus variabilis is a tree species of ecological and economic value that is widely distributed in China. To effectively evaluate, use, and conserve resources, we applied 25 pairs of simple sequence repeat (SSR) primers to study its genetic diversity and genetic structure in 19 natural forest or natural secondary forest populations of Q. variabilis (a total of 879 samples). A total of 277 alleles were detected. Overall, the average expected heterozygosity (He) was 0.707 and average allelic richness (AR) was 7.79. Q. variabilis manifested a loss of heterozygosity, and the mean of inbreeding coefficient (FIS) was 0.044. Less differentiation among populations was observed, and the genetic differentiation coefficient (FST) was 0.063. Bayesian clustering analysis indicated that the 19 studied populations could be divided into three groups based on their genetic makeup, namely, the Southwest group, Central group, and Northeastern group. The Central group, compared to the populations of the Southwest and
Dear Netters, I will be glad if someone can provide me the source from where I could obtain antibodies for the plant defense enzymes, phenylalanine ammonia lyase (PAL) and chalcone synthase (CHS). Thanks in advance for your cooperation. Sincerely, Balaji Please contact: B. Balaji Biology department (MRC 301) Rensselaer Polytechnic Institute Troy, NY 12180-3590 email: balajb at rpi.edu ...
phenylalanine ammonia-lyase [putative phenylalanine ammonia lyase EncP] ATGACCTTCGTCATAGAGCTCGACATGAACGTCACGCTCGACCAACTTGAGGACGCGGCG CGACAGCGCACGCCCGTGGAGCTGTCCGCACCCGTCCGCTCCCGCGTCCGCGCCTCGCGC GACGTGTTGGTGAAGTTCGTGCAGGACGAACGTGTCATCTACGGGGTCAACACCAGCATG GGGGGCTTCGTCGACCACCTCGTCCCGGTGTCCCAGGCCCGGCAGCTCCAGGAGAACCTG ATCAACGCGGTCGCCACCAACGTGGGGGCGTATCTGGACGACACGACCGCCCGGACCATC ATGCTGTCCCGCATCGTGTCGCTGGCGCGCGGGAACTCCGCGATCACCCCGGCGAATCTG GACAAGCTGGTGGCCGTACTCAACGCCGGGATCGTGCCGTGCATCCCGGAGAAGGGCTCT TTGGGCACCAGCGGTGACCTCGGCCCGCTGGCCGCGATCGCCCTGGTGTGCGCGGGGCAG TGGAAGGCCCGCTACAACGGTCAGATCATGCCCGGGCGGCAGGCCCTGTCCGAGGCCGGC GTCGAGCCGATGGAGCTGAGCTACAAGGATGGCCTGGCCCTGATCAACGGCACGTCAGGC ATGGTCGGCCTGGGCACCATGGTCCTCCAGGCCGCGCGCCGGCTCGTGGACCGCTACCTG CAGGTGTCCGCGTTGTCGGTCGAGGGCCTGGCAGGCATGACGAAACCGTTCGACCCTCGC GTGCACGGCGTCAAGCCGCACCGCGGGCAGCGTCAGGTGGCCTCGCGGTTGTGGGAGGGG CTTGCCGACTCGCACCTGGCGGTCAACGAACTGGACACCGAGCAGACCCTGGCCGGAGAG ATGGGCACGGTCGCCAAGGCCGGTTCGCTGGCGATCGAGGACGCCTACTCCATCCGGTGC ...
Structural and biochemical analysis of the phosphate donor specificity of the polynucleotide kinase component of the bacterial pnkphen1 RNA repair system ...
Phenylalanine ammonia lyase (EC 4.3.1.24) is an enzyme that catalyzes a reaction converting L-phenylalanine to ammonia and trans-cinnamic acid. Phenylalanine ammonia lyase (PAL) is the first and committed step in the phenyl propanoid pathway and is therefore involved in the biosynthesis of the polyphenol compounds such as flavonoids, phenylpropanoids, and lignin in plants. Phenylalanine ammonia lyase is found widely in plants, as well as some yeast and fungi, with isoenzymes existing within many different species. It has a molecular mass in the range of 270-330 kDa. The activity of PAL is induced dramatically in response to various stimuli such as tissue wounding, pathogenic attack, light, low temperatures, and hormones. PAL has recently been studied for possible therapeutic benefits in humans afflicted with phenylketonuria. It has also been used in the generation of L-phenylalanine as precursor of the sweetener aspartame. The enzyme is a member of the ammonia lyase family, which cleaves ...
Findings: Functional categorization of expressed transcripts revealed the conservation of genes involved in various biological processes like responses to chemical (12.7%), responses to abiotic stimulus (11.8%), biosynthesis processes (11.8%), and cellular metabolic processes (10.4%) in grape berries exposed to high temperature. The major up-regulated genes included isocitratelyase, cysteine proteinases superfamily protein, cupin family protein, and glycosyl hydrolase genes, and the major down-regulated genes included flavanone 3-hydroxylase, phenylalanine ammonia lyase, chlorophyll A-B binding family protein, and polygalacturonase inhibiting protein genes in grape berries exposed to high temperature. Among genes related to grape coloration, expressions of chalcone and stilbene synthase, flavanone 3-hydroxylase, leucoanthocyanidin dioxygenase, phenylalanine ammonia lyasegenes were more strongly inhibited in berries kept at 35°C than 25°C.. ...
The roots of cassava present high postharvest perishability due to physiological deterioration that develops in wounded tissues usaully within two to three days after harvest at room temperature. The physiological deterioration is characterized by the appearance of blue-black streaks in the root vascular tissue and storage parenchyma, which progresses through the whole length of the root, being the initial cause for the poor acceptability for fresh consumption. This darkening is attributed to reactions involving the enzymes phenylalanine ammonia lyase, polyphenol oxidase and peroxidase. The objective of this work was to evaluate the effects biochemical, physiological and physical phases by the called minimal processing, the use of antioxidants and of packaging on the development of physiological deterioration in cassava roots during a period of preservation, in order to extend the shelf-life of the product, as well as to ensure food safety during the commercialization, distribution and ...
Definition: This organism produces this material or substance, either during its life or after death. A produces B if some process that occurs in A has output B ...
In additon to the great finds of this and the Conops yesterday I also keyed out Platycheirus scutatus (s.l - it was a female) from the same day. That takes me to 41 species for the year, with another Cheilosia which is of the variabilis group and therefore also new. If not this year, then next year my target will certainly be 50, as well as trying to record more good data on host etc ...
Die Goethe-Universität ist eine forschungsstarke Hochschule in der europäischen Finanzmetropole Frankfurt. Lebendig, urban und weltoffen besitzt sie als Stiftungsuniversität ein einzigartiges Maß an Eigenständigkeit.
Nutrient regulation of alkaline phosphatase (phosphomonoesterase - PMEase) was studied in some diazotrophic cyanobacterial strains like Anabaena variabilis, Anabaena torulosa, Calothrix brevissima, Scytonema javanicum and Hapalosiphon intricatus, in
Morsy, F. M., Elbadry, M., El-Sayed, W. S., Abd El-Hady, D. 2019 Dark and photofermentation H2 production from hydrolyzed biomass of the potent extracellular polysaccharides producing cyanobacterium Nostoc commune and intracellular polysaccharide (glycogen) enriched Anabaena variabilis NIES-2095. Int. J. Hydrog. Energy, 44, 16199-16211 ...
A process is disclosed for preparing phenylalanine which comprises contacting phenylpyruvic acid or phenylpyruvate with immobilized whole cells having transaminase activity in the presence of an amine donor. The cells are preferably immobilized with a polyazetidine polymer. Ruptured or permeabilized cells, with the enzyme in the free or immobilized state, may also be used. The preparation of phenylalanine from cinnamic acid using immobilized cells having phenylalanine ammonia lyase activity is also disclosed.
An intensified, industrially-relevant strategy for the production of enantiopure halophenylalanines has been developed using the novel combination of a cyanobacterial phenylalanine ammonia lyase (PAL) and ammonium carbamate reaction buffer. The process boasts STYs up to |200 g L−1 d−1, ees ≥ 98% and simplifi Celebrating the 2017 RSC Prize and Award Winners
Schorsch M, Kramer K, Goss T, Eisenhut M, Robinson N, Osman D, Wilde A, Sadaf S, Brückler H, Walder L, Scheibe R, Hase T, Hanke G (2018) A unique ferredoxin acts as a novel player in the low iron response of photosynthetic organisms. Proceedings of the National Academy of Sciences USA (in press). Balevičius V, Fox K, Bricker W, Jurinovich S, Prandi I, Mennucci B, Duffy C (2017). Fine control of chlorophyll-carotenoid interactions defines the functionality of light-harvesting proteins in plants. Scientific Reports. Sacharz J, Giovagnetti V, Ungerer P, Mastrioanni G, Ruban A (2017). The xanthophyll cycle affects reversible PsbS-LHCII interactions to control non-photochemical quenching. Nature Plants. Engl C, Schaefer J, Kotta-Loizou I, Buck M (2016). Cellular and molecular phenotypes depending upon the RNA repair system RtcAB in Escherichia coli. Nucleic Acids Research. Schuergers N, Lenn T, Kampmann R, Meissner M, Esteves T, Temerinac-Ott M, Korvink J, Lowe A, Mullineaux C, Wilde A (2016). ...
Research in my laboratory focuses on understanding the cell and molecular biology of resistance and pathogenesis to fungal caused vascular wilt diseases of plants. In particular, we are studying diseases caused by fungi of the genus Verticillium, which infect over 400 different crop plants worldwide and account for major crop loss in most countries. In Canada, substantial losses in potatoes, tomatoes, alfalfa and strawberries occur each year. We are using biotechnology to develop plant pathogen diagnostics and to genetically engineer more wilt-resistant cultivars by manipulating the expression of plant genes involved in host (eg. phenylalanine ammonia lyase, PAL) or resistance (eg. Verticillium-resistance, Ve).. ...
Coloured scanning electron micrograph (SEM) of Anabaena sp., Gram-negative, oxygenic, photosynthetic, nitrogen fixing, filamentous cyanobacterium (prokaryote). Note the larger cells in the filament called heterocysts which are involved in nitrogen fixation. Anabaena is a genus of filamentous cyanobacteria (formerly known as blue, Green algae). It found as planktonic cyanobacterium (all types of water) and is known for its nitrogen fixing abilities. Blooms or massive growths can occur in waters with a lot of nutrients. These blooms discolour the water and give it a bad odour when the cells die and decay. Anabaena is one of four genera of cyanobacteria that produce neurotoxins. These toxins are harmful to local wildlife, as well as farm animals and pets. Production of these neurotoxins is part of its symbiotic relationships it forms with certain plants. Some species of Anabaena are endophytes. Magnification: x660 when shortest axis printed at 25 - Stock Image C032/2525
References Mansfield SG, Chao H, Walsh CE. RNA repair using spliceosome-mediated RNA trans-splicing. Trends Mol Med. 2004 Jun;10(6):263-8. (...)
Ligand gated ion channels (LGICs) are a superfamily of transmembrane proteins that mediate synaptic signaling in eukaryotic nervous systems. Sequence profile searches have demonstrated the existence of homologous LGICs in several prokaryotic species, which share general structural and mechanistic pr.... Full description. ...
Anabaena: Genus of nitrogen-fixing blue-green algae with beadlike or barrel-like cells and interspersed enlarged spores (heterocysts), found as plankton in shallow water and on moist soil....
Restock - Dreamcolor1 Nobluk Restock - Kitty Kawai Mini Ava Detail Produk Diameter : 14.5mm Kadar Air : 42% Masa Pakai : 6-12bulan --Plano-- Dreamcolor1 Nobluk Grey, Brown, Blue, & Green Kitty Kawaii Mini Ava Grey --Ukuran Minus -- Kitty Kawai Mini Ava Blue -0.50/-0.75/-1.00/-1.25/-1.50/-2.00/-2.25/-2.50/-2.75/-3.00/-3.25/-3.50/-3.75/-4.00 Harga Dreamcolor1 Nobluk Harga Softlens Satuan Rp 95,000 / pasang --------------------------------------…
Anabaena sp. PCC 7120 (hereafter Anabaena) is a model cyanobacterium to study nitrogen fixation, cellular differentiation and several other key biological functions that are analogous in plants. As with any other organism, many genes in Anabaena encode an essential life function and hence cannot be deleted, causing a bottleneck in the elucidation of its genomic function. Antisense RNA (asRNA) mediated approach renders the study of essential genes possible by suppressing (but not completely eliminating) expression of the target gene, thus allowing them to function to some extent. Recently, we have successfully implemented this approach using the strong endogenous promoter of the psbA1 gene (D1 subunit of Photosystem II) introduced into a high-copy replicative plasmid (pAM1956) to suppress the transcript level of the target gene alr0277 (encoding a sigma factor, SigJ/Alr0277) in Anabaena. This protocol represents an efficient and easy procedure to further explore the functional genomics, expanding the
A koronav rus terjed se miatt a sz nh zakat is bez rt k, Poly k Lilla m gis nyugodt s der s tud maradni, b r desanyja eg szs g t f lti. A N k Lapja Eg szs g prilisi sz m ban a sz n szn a k nyszerpihen r l s a terveir l is besz l.
If you have multiple, parallel reactions set up in AVA (in one AVA software instance/window), you can view a summary of all the reactions together in the Overview tab (which is between the Reporting and Reaction 1 tabs).. In the Schedule section of the Overview tab, there is a play (triangle) button to start all reactions, and a stop (square) button to stop all reactions.. ...
Køb Ava 4043-101-20 Black i Nordens førende skobutik på nettet. Prøv skoene hjemme med fri retur, 30 dages åbent køb og prisgaranti.
A type of life reinsurance where mortality risks are transferred to a reinsurer. In the yearly renewable term plan of reinsurance, the primary insurer (the ceding company) yields to a reinsurer its net amount at risk (the difference between the face value and the cash value of a life insurance policy) for the amount that is greater than the retention limit on a life insurance policy to a reinsurer.
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Developments of SEINet, Symbiota, and associated specimen databases have been supported by National Science Foundation Grants (DBI 9983132, BRC 0237418, DBI 0743827, DBI 0847966 ...
U ovom se radu objektno orijentirana ontologija (OOO) pokušava primijeniti na igru. Prvo se iz anti-redukcionističkog pristupa OOO-a daje osvrt na neka dosadašnja tumačenja igre u filozofiji i znanosti. Potom se, zbog konceptualne...
Видеокамера предназначена для преобразования оптического изображения, создаваемого эндоскопом при всех видах эндоскопических исследований и операций, в полный телевизионный сигнал цветного изображения в системе PAL. Камерная головка видеокамеры снабжена объективом с переменным фокусным расстоянием. Видеокамера оснащена встроенным блоком питания, предназначенным для подключения светодиодного осветителя в вариантах его исполнения ...
Effects of Abscisic acid and Temperature on the Anthocyanin Accumulation in Seedlings of Arabidopsis thaliana - Anthocyanin;Abscisic acid;Ethephon;Low temperature;Phenylalanine ammonia lyase(PAL);Arabidopsis thaliana;
TY - JOUR. T1 - Evaluation of Soybean for Resistance to Neohyadatothrips variabilis (Thysanoptera: Thripidae) Noninfected and Infected with Soybean Vein Necrosis Virus. AU - Lagos-Kutz, D.. AU - Pawlowski, M. L.. AU - Haudenshield, J.. AU - Han, J.. AU - Domier, L. L.. AU - Hartman, G. L.. AU - Hesler, Louis. N1 - Funding Information: We thank the United Soybean Board for financial support. We are grateful to Roger Bowen and Todd Bedford, USDA-ARS, who provided seeds of soybean breeding lines and cultivars, respectively. Publisher Copyright: © 2019 Published by Oxford University Press on behalf of Entomological Society of America 2019. Copyright: Copyright 2020 Elsevier B.V., All rights reserved.. PY - 2020/4/6. Y1 - 2020/4/6. N2 - Soybean vein necrosis virus (SVNV) was first identified in Arkansas and Tennessee in 2008 and is now known to be widespread in the United States and Canada. Multiple species of thrips transmit this and other tospoviruses with Neohydatothrips variabilis (Beach) ...
Phenylketonuria (PKU) - Pipeline Review, H1 2017 Summary Phenylketonuria (also called PKU), is a rare inherited disorder that causes an amino acid c
Phenylketonuria is an inherited disorder of metabolism that causes an increase in the blood of a chemical known as phenylalanine.
The PNKP gene provides instructions for making the polynucleotide kinase-phosphatase (PNKP) enzyme. Learn about this gene and related health conditions.
Phenylketonuria - genetic, clinical and therapeutic aspects. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Phenylketonuria Phenylketonuria (PKU) is a rare condition in which a baby is born without the ability to properly break down an amino acid called phenylalanine. Causes, incidence, and risk factors Phenylketonuria (PKU) is inherited, which means it is passed down through families. Both parents must pass on the defective gene in order for a baby…
A Natural Approach To Health Living With Phenylketonuria I had a question the other day about phenylketonuria. Phenylketonuria (PKU) is an inhe
When you make a purchase via the Avast Store, you may be notified that you need to enable JavaScript and / or cookies in your web browser. This is because the Avast Store is unable to load and function correctly without these settings enabled.. To enable JavaScript and / or cookies, refer to the information in the relevant section below according to your web browser:. ...
When you make a purchase via the Avast Store, you may be notified that you need to enable JavaScript and / or cookies in your web browser. This is because the Avast Store is unable to load and function correctly without these settings enabled.. To enable JavaScript and / or cookies, refer to the information in the relevant section below according to your web browser:. ...
Geosmin has often been associated with off-flavor problems in drinking water with *Anabaena* sp. as the major producer. Rapid on-site detection of geosmin-producers as well as geosmin is important for a timely management response to potential off-flavor events. In this study, quantitative polymerase chain reaction (qPCR) methods were developed to detect the levels of *Anabaena* sp. and geosmin, respectively, by designing two PCR primer sets to quantify the *rpoC₁* gene (ARG) and geosmin synthase one (GSG) in *Anabaena* sp. in freshwater systems. The ARG density determined by qPCR assay is highly related to microscopic cell count (r² = 0.726, p | 0.001), and the limit of detection (LOD) and limit of quantification (LOQ) of the qPCR method were 0.02 pg and 0.2 pg of DNA, respectively. At the same time, the relationship between geosmin concentrations measured by gas chromatography-mass spectrometry (GC-MS) and GSG copies was also established (r² = 0.742, p | 0.001) with similar LOD and LOQ values.
Acts on pelargonidin 3-O-glucoside in dahlia (Dahlia variabilis), delphinidin 3-O-glucoside, and on cyanidin 3-O-glucoside in transgenic petunia (Petunia hybrida ...
Phenylketonuria, also called PKU, is a genetic disorder that increases the levels of phenylalanine in the blood. Phenylalanine is an ...
Hong Kong Western District Residential Sales. AVA 128 | Flat for Sale. Sales Listings: HK$ 5.88M. 124-128 Des Voeux Road West (Agent Ref: XGZXQ000100042)
Alkaahan se olla aika pitkälti kaikille selvää että WWE on näinä päivinä enemmälti puuduttava, tylsä ja pahimmillaan itseään toistava. Mutta aina kun edetään kohti seuraavaa Wrestlemaniaa, jotenkin he osaavat vain ottaa niskastaan kiinni ja kohottaa pari feudia sen verran korkealle että sitä alkaa taas odottamaan vesikielellä. Tämän viikon Rawssa oli tämä Shawn Michaelsin ja Undertakerin promo-paketti joka oli parasta antia mitä WWE on tuottanut pitkään aikaan. Niin ja Placebon huumaavasti coveroima Running Up That Hill oli kuin luotu tätä varten.. ...
Fabrico at EIS is the market leader in design and manufacturing services for flexible materials. Learn more about how EIS crafts industry leading solutions.
SUNRISE, Fla., Nov. 27, 2012-- On November 21, 2012, Federated National Insurance Company, a wholly owned subsidiary of Federated National Holding Company, received a Notice of 2012 Assessment from the Florida Insurance Guaranty Association, Inc..
... though no such relationship has been observed with Anabaena variabilis. Anabaena variabilis is also a model organism for ... Anabaena variabilis is a species of filamentous cyanobacterium. This species of the genus Anabaena and the domain Eubacteria is ... Anabaena variabilis is a phylogenic-cousin of the more well-known species Nostoc spirrilum. Both of these species along with ... Anabaena variabilis". The Journal of Tropical Medicine and Hygiene. 93 (2): 133-9. PMID 2109096. Pearce, J.; Leach, C. K.; Carr ...
Others, such as Anabaena variabilis, can steer by bending the trichome. Finally, photophobic microorganisms respond to spatial ... Nultsch, Wilhelm; Schuchart, Hartwig; Höhl, Marga (1979). "Investigations on the phototactic orientation of Anabaena variabilis ... Anabaena spp. colonize the roots of wheat and cotton plants. Calothrix sp. has also been found on the root system of wheat. ... Cyanobacteria such as Anabaena (a symbiont of the aquatic fern Azolla) can provide rice plantations with biofertilizer. ...
Nultsch, Wilhelm; Schuchart, Hartwig; Höhl, Marga (1979). "Investigations on the phototactic orientation of Anabaena variabilis ... Anabaena, Synechocystis) can slowly orient along a light vector. This orientation occurs in filaments or colonies, but only on ...
Nultsch, Wilhelm; Schuchart, Hartwig; Höhl, Marga (1979). "Investigations on the phototactic orientation of Anabaena variabilis ... Anabaena, Synechocystis) can slowly orient along a light vector. This orientation occurs in filaments or colonies, but only on ...
Sato N, Murata N (1982). "Lipid biosynthesis in the blue-green-alga (cyanobacterium), Anabaena variabilis. 3. UDP-glucose- ...
... lysomonogalactosyldiacylglycerol acyltransferase from the cyanobacterium Anabaena variabilis". Biochim. Biophys. Acta. 963 (3 ...
Lovelock SL, Turner NJ (October 2014). "Bacterial Anabaena variabilis phenylalanine ammonia lyase: a biocatalyst with broad ...
"The nucleotide sequences recognized by endonucleases AvaI and AvaII from Anabaena variabilis". Biochem J. 185 (1): 65-75. doi: ... de Waard A, Korsuize J, van Beveren CP, Maat J (December 1978). "A new sequence-specific endonuclease from Anabaena cylindrica ... Whitehead PR, Brown NL (April 1985). "Three restriction endonucleases from Anabaena flos-aquae". J Gen Microbiol. 131 (4): 951- ... "Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120". DNA Res. 8 (5): 227- ...
Kozayakov, SYa (1977). "Cyanophages of the series A(L) specific for the blue-green alga Anabaena variabilis. In". Experimental ... Cyanophages can infect and kill four common bloom-forming cyanobacteria: Lyngbya birgei, Anabaena circinalis, Anabaena ... The A-group of the virus causes lysis and infects Anabaena species. Similarly, the host range of the AN group includes both ... They play an important role in infecting and causing lysis of members of the genera Nostoc, Anabaena and Plectonema. ...
In her masters she switched to botany, studying the biochemistry of a cyanobacteria (Anabaena variabilis). After completing her ...
"High recovery of nitrogenase activity and of 55Fe-labeled nitrogenase in heterocysts isolated from Anabaena variabilis". ... Nitrogenase and Ferredoxin in the Mechanism of Bioelectrocatalytic Nitrogen Fixation by the Cyanobacteria Anabaena variabilis ... Species of nitrogen fixing cyanobacteria in fresh waters include: Aphanizomenon and Dolichospermum (previously Anabaena). Such ... "An increase in the level of 2-oxoglutarate promotes heterocyst development in the cyanobacterium Anabaena sp. strain PCC 7120 ...
... found in members of the bacterial genus Azotobacter as well as the species Rhodopseudomonas palustris and Anabaena variabilis. ...
Structural and biochemical characterization of the therapeutic Anabaena variabilis phenylalanine ammonia lyase J Mol Biol 380: ...
... of the lakes at Waw an Namus The caldera List of volcanoes in Libya Individual species are the cyanophyceae Anabaena variabilis ...
Anabaena cylindrica MeSH B03.440.475.100.100.300 - Anabaena flos-aquae MeSH B03.440.475.100.100.900 - Anabaena variabilis MeSH ... Anabaena cylindrica MeSH B03.280.100.300 - Anabaena flos-aquae MeSH B03.280.100.900 - Anabaena variabilis MeSH B03.280.575.150 ...
Purchase Recombinant Anabaena variabilis Glycerol-3-phosphate acyltransferase(plsY). It is produced in in vitro E.coli ... Recombinant Anabaena variabilis Glycerol-3-phosphate acyltransferase(plsY). Recombinant Anabaena variabilis Glycerol-3- ... Recombinant Anabaena variabilis Glycerol-3-phosphate acyltransferase(plsY),partial ( Yeast-CSB-YP659487BYN1 E.coli-CSB- ...
Anabaena variabilis 1 * Anaplasma marginale 1 * Anoxybacillus flavithermus 1 * Archaeoglobus fulgidus 1 ...
... from Anabaena variabilis ATCC 29413. Plus protein sequence and external database links. ... Domain assignment for gi,75908459,ref,YP_322755.1, from Anabaena variabilis ATCC 29413. Domain architecture ... histidinol-phosphate aminotransferase [Anabaena variabilis ATCC 29413]. Sequence. ...
Response of multiple herbicide resistant strain of diazotrophic cyanobacterium, Anabaena variabilis, exposed to atrazine and ... Response of multiple herbicide resistant strain of diazotrophic cyanobacterium, Anabaena variabilis, exposed to atrazine and ... variabilis was studied. Cyanobacterial strains showed gradual inhibition in growth with increasing dosage of herbicides. Both ...
Physiological responses of Anabaena variabilis (cyanophyceae) to instantaneous exposure to various combinations of light ... Physiological responses of Anabaena variabilis (cyanophyceae) to instantaneous exposure to various combinations of light ...
... and interannual dynamics of polyphenols in Myriophyllum verticillatum and their allelopathic activity on Anabaena variabilis. ...
The RbpA3 protein of Anabaena variabilis contains one RNA-binding domain with a carboxy-terminal glycine-rich domain. Levels of ... Anabaena variabilis; Triticum aestivum; Synechococcus; Arabidopsis thaliana; Zea mays; humans; transcription (genetics); ... Nostoc; Anabaena; Triticum aestivum; Zea mays; Phaseolus vulgaris; Beta vulgaris; Oryza sativa; shoots; roots; dry matter ... Differential regulation by low temperature of the gene for a RNA-binding protein, rbpA3, in the cyanobacterium Anabaena ...
gi,75908513,ref,YP_322809.1, hypothetical protein Ava_2296 [Anabaena variabilis ATCC 29413] >gi,75702238,gb,ABA21914..... ...
PAL from Anabaena variabilis (AvPAL) modified with polyethylene glycol was instead developed for subcutaneous injection. ...
Potamogeton crispus inhibited the growth of the cyanobacteria, Anabaena variabilis, via allelopathy, but had no effect on the ...
... that is also present in a putative hydrolase protein of the bacterium Anabaena variabilis (Trp-291). Moreover, the A. ... variabilis, further support the connection between bacterial and metazoan DCE/yellow genes. ...
Anabaena variabilis Kützing ex Bornet & Flahault Subculture; Unialgal; Clonal; Axenic[2017 Dec] Axenic. ... Anabaena variabilis Kützing ex Bornet & Flahault Subculture; Unialgal; Clonal; Axenic[2018 Jan] Axenic. ... Anabaena variabilis Kützing ex Bornet & Flahault Subculture; Unialgal; Clonal; Axenic[2018 Jan] Axenic. ...
Samuilov, V.D., Fedorenko, T.A. Lag Phase of CO2-Dependent O2 Evolution by Illuminated Anabaena variabilis Cells. 1999. ... Samuilov, V.D., Fedorenko, T.A. Lag Phase of CO2-Dependent O2 Evolution by Illuminated Anabaena variabilis Cells. 1999. ...
By using a direct detection method, V. cholerae was observed to be associated with the cyanobacterium Anabaena variabilis, ...
Anabaena B3.585.51 Anabaena cylindrica B3.585.51.150 Anabaena flos-aquae B3.585.51.300 Anabaena variabilis B3.585.51.900 ...
Anabaena variabilis ATCC 29413 Bacteria normal 1 normal 1 -. NC_007492 Pfl01_4496 hypothetical protein 31.79 ...
Anabaena variabilis ATCC 29413 Bacteria normal 1 normal 1 -. NC_007498 Pcar_3081 two component signal transduction response ... Anabaena variabilis ATCC 29413 Bacteria normal 0.0841359 normal 0.719107 -. NC_011884 Cyan7425_3411 two component ...
Anabaena variabilis double mutant (C503S/C565S) phenylalanine ammonia-lyase (PAL) is an appealing enzyme in the enzyme- ... A comprehensive in silico characterization of bacterial signal peptides for the excretory production of Anabaena variabi... ...
... whereas Anabaena variabilis and Nostoc spongiaeforme showed the doubling time of 14.8 and 16.6 hours, respectively. All the ... Anabaena variabilis and Nostoc spongiaeforme) was measured as optical density. Chlamydomonas noctigama and Chlorella vulgaris ...
... or a siderophore of the filamentous cyanobacterium Anabaena variabilis ATCC 29413 (SAV), as the sole source of iron in a TonB- ...
For example, almost all such genes in Anabaena variabilis ATCC29413 are annotated as transposases of IS4 from the IS4 family, ... Anabaena variabilis ATCC29413 (19.32%), Pyrobaculum islandicum DSM 4184 (21.43%) and Sulfolobus solfataricus (15.40%). Many of ...
... inactivation of the DDGS gene in Anabaena variabilis ATCC 29413 did not abolish the production of MAAs, suggesting that ... The residue numbers given correspond to the reference proteins D. rerio EEVS, ValA, and A. variabilis DDGS, respectively. ...
Introduction: Pegvaliase is a recombinant Anabaena variabilis phenylalanine ammonia lyase (PAL) enzyme under investigation for ... N2 - Introduction: Pegvaliase is a recombinant Anabaena variabilis phenylalanine ammonia lyase (PAL) enzyme under investigation ... AB - Introduction: Pegvaliase is a recombinant Anabaena variabilis phenylalanine ammonia lyase (PAL) enzyme under investigation ... abstract = "Introduction: Pegvaliase is a recombinant Anabaena variabilis phenylalanine ammonia lyase (PAL) enzyme under ...
Anabaena variabilis Spanish from Spain Descriptor. Anabaena variabilis. Scope note:. Especie de ANABAENA que puede formar ... A species of ANABAENA that can form SPORES called akinetes.. Allowable Qualifiers:. CH chemistry. CL classification. CY ... Anabaena variabilis Descriptor French: Anabaena variabilis Tree number(s):. B03.280.100.900. B03.440.475.100.100.900. B03.585. ... Anabaena variabilis - Preferred Concept UI. M0455839. Scope note. A species of ANABAENA that can form SPORES called akinetes. ...
PCC 7120 started to produce MAAs after genomic transfer (YP_324358 and YP_324357 genes) from Anabaena variabilis PCC 7937. The ... variabilis PCC 7937 and missing in the other Cyanobacteria Anabaena sp. ... Anabaena variabilist PCC 7937 (Cyanobacterium) is able to synthesize MAAs .. Genome studies identified a combination of genes, ...
... and Anabaena variabilis (Schmitz et al. 1995) where they occur in the heterocysts. They may also occur in vegetative Anabaena ... Anabaena variabilis; Avi, Azotobacter vinelandii; Bja, Bradyrhizobium japonicum; Cfr, Citrobacter freundii; Cac, Clostridium ... Calderobacterium Hydrogenobacter Cyanobacteria Chroococcales Synechococcus Synechocystis Nostocales Anabaena Anabaena Anabaena ... In A. variabilis and A. nidulans the enzyme is thought to be membrane bound. Examination of the interrelationship between ...
Anabaena variabilis ATCC 29413 Bacteria normal 0.5525 normal 0.406937 -. NC_011138 MADE_00486 transcriptional regulator, TetR ... Anabaena variabilis ATCC 29413 Bacteria hitchhiker 0.00074883 normal 1 -. NC_011757 Mchl_4471 transcriptional regulator, TetR ...
5264463 Anabaena variabilis ATCC 29413, complete genome. D: 29.8807. Host Lineage: Anabaena variabilis; Anabaena; Nostocaceae; ... Anabaena variabilis ATCC 29413, complete genome. 76.826 %. Subject ←→ Query. 27.5809. NC_003272:1862487*. Nostoc sp. PCC 7120, ... Anabaena variabilis is a filamentous heterocyst-forming cyanobacterium that fixes nitrogen and CO2 using the energy of sunlight ... Anabaena variabilis ATCC 29413, complete genome. 80.9007 %. Subject ←→ Query. 23.7415. NC_003272:3237643. Nostoc sp. PCC 7120, ...
mycosporine-glycine pathway from Minnesota 2012 team is NOT available; need to reorder! Anabaena variabilis Ava_3855 to 3858 ... Jay found the Anabaena genes available on plasmids at Addgene - $65 each! ... description of Anabaena gene cluster:. =",a rel="nofollow" class="external free" href="https://www.google.com/url?q=https:// ... Need to finalize gene order for Anabaena gene cluster - see =",a rel="nofollow" class="external free" href="https://www.google. ...
  • An E. coli strain that carries the AvaI gene from Anabaena variabilis (ATCC 27892). (neb.sg)
  • Potamogeton crispus inhibited the growth of the cyanobacteria, Anabaena variabilis, via allelopathy, but had no effect on the green alga, Scenedesmus quadricauda. (usgs.gov)
  • IMSEAR at SEARO: Response of multiple herbicide resistant strain of diazotrophic cyanobacterium, Anabaena variabilis, exposed to atrazine and DCMU. (who.int)
  • Effect of two photosynthetic inhibitor herbicides, atrazine (both purified and formulated) and [3-(3,4-dichlorophenyl)-1,1-dimethyl urea] (DCMU), on the growth, macromolecular contents, heterocyst frequency, photosynthetic O2 evolution and dark O2 uptake of wild type and multiple herbicide resistant (MHR) strain of diazotrophic cyanobacterium A. variabilis was studied. (who.int)
  • Anabaena variabilis is a filamentous heterocyst-forming cyanobacterium that fixes nitrogen and CO2 using the energy of sunlight via oxygen-evolving plant-type photosynthesis. (up.ac.za)
  • The most effective lyase therapeutically was one produced by the cyanobacterium, Anabaena variabilis . (drugdiscoveryopinion.com)
  • Detection of reactive oxygen species (ROS) by the oxidant-sensing probe 2′,7′-dichlorodihydrofluorescein diacetate in the cyanobacterium Anabaena variabilis PCC 7937. (keyworddensitychecker.com)
  • Introduction: Pegvaliase is a recombinant Anabaena variabilis phenylalanine ammonia lyase (PAL) enzyme under investigation for treatment of adult phenylketonuria (PKU). (elsevier.com)
  • Anabaena variabilis double mutant (C503S/C565S) phenylalanine ammonia-lyase (PAL) is an appealing enzyme in the enzyme-replacement therapy of phenylketonuria. (mysciencework.com)
  • A species of ANABAENA that can form SPORES called akinetes. (bvsalud.org)
  • The species ANABAENA FLOS-AQUAE is responsible for acute poisonings of various animals. (jefferson.edu)
  • Biochemical and Structural Study of Anabaena sp. (nchu.edu.tw)
  • Anabaena" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (jefferson.edu)
  • This graph shows the total number of publications written about "Anabaena" by people in this website by year, and whether "Anabaena" was a major or minor topic of these publications. (jefferson.edu)
  • Impact of intracellular build-up of mercury on phycocyanin leakage in the planktonic cyanobacteria Nostoc muscorum and Anabaena variabilis. (jalgalbiomass.com)
  • HN - 2005 MH - Anabaena flos-aquae UI - D046869 MN - B3.280.100.300 MN - B3.440.475.100.100.300 MS - A species in the genus ANABAENA containing gas vacuoles that gives buoyancy to the organism. (nih.gov)
  • Fingerprinting of repetitive DNA sequences in the genus Anabaena using PCR-based techniques. (emanresearch.org)
  • AN - not for activation of enzymes, receptors, cells, etc. by amino acids: index ENZYME ACTIVATION or specific term with /metab HN - 2005 MH - Anabaena cylindrica UI - D046868 MN - B3.280.100.150 MN - B3.440.475.100.100.150 MS - A species in the genus ANABAENA whose trichomes are composed of cylindrical cells. (nih.gov)
  • HN - 2005 MH - Anabaena variabilis UI - D046870 MN - B3.280.100.900 MN - B3.440.475.100.100.900 MS - A species of ANABAENA that can form SPORES called akinetes. (nih.gov)
  • The RbpA3 protein of Anabaena variabilis contains one RNA-binding domain with a carboxy-terminal glycine-rich domain. (usda.gov)
  • A. variabilis C503S/C565S PAL is shown to be both more thermally stable and more resistant to proteolytic cleavage than R. toruloides PAL. (scripps.edu)
  • Phase I and II trials have shown that injectable recombinant Anabaena variabilis PAL produced in Escherichia coli conjugated with PEG can reduce phenylalanine levels in subjects with PKU. (nih.gov)
  • Examination of the A. variabilis C503S/C565S PAL structure, combined with analysis of its physical properties, provides a structural basis for further engineering of residues that could result in a better therapeutic molecule. (scripps.edu)