Anabaena variabilis: A species of ANABAENA that can form SPORES called akinetes.Anabaena: A genus of CYANOBACTERIA consisting of trichomes that are untapered with conspicuous constrictions at cross-walls. A firm individual sheath is absent, but a soft covering is often present. Many species are known worldwide as major components of freshwater PLANKTON and also of many saline lakes. The species ANABAENA FLOS-AQUAE is responsible for acute poisonings of various animals.Cyanobacteria: A phylum of oxygenic photosynthetic bacteria comprised of unicellular to multicellular bacteria possessing CHLOROPHYLL a and carrying out oxygenic PHOTOSYNTHESIS. Cyanobacteria are the only known organisms capable of fixing both CARBON DIOXIDE (in the presence of light) and NITROGEN. Cell morphology can include nitrogen-fixing heterocysts and/or resting cells called akinetes. Formerly called blue-green algae, cyanobacteria were traditionally treated as ALGAE.Nitrogenase: An enzyme system that catalyzes the fixing of nitrogen in soil bacteria and blue-green algae (CYANOBACTERIA). EC 1.18.6.1.AcetyleneNitrogen Fixation: The process in certain BACTERIA; FUNGI; and CYANOBACTERIA converting free atmospheric NITROGEN to biologically usable forms of nitrogen, such as AMMONIA; NITRATES; and amino compounds.Dinitrogenase Reductase: A non-heme iron-sulfur protein isolated from Clostridium pasteurianum and other bacteria. It is a component of NITROGENASE along with molybdoferredoxin and is active in nitrogen fixation.Phycocyanin: The metal-free blue phycobilin pigment in a conjugated chromoprotein of blue-green algae. It functions as light-absorbing substance together with chlorophylls.Dermacentor: A widely distributed genus of TICKS, in the family IXODIDAE, including a number that infest humans and other mammals. Several are vectors of diseases such as TULAREMIA; ROCKY MOUNTAIN SPOTTED FEVER; COLORADO TICK FEVER; and ANAPLASMOSIS.Dihydroorotate Oxidase: An enzyme that in the course of pyrimidine biosynthesis, catalyzes the oxidation of dihydro-orotic acid to orotic acid utilizing oxygen as the electron acceptor. This enzyme is a flavoprotein which contains both FLAVIN-ADENINE DINUCLEOTIDE and FLAVIN MONONUCLEOTIDE as well as iron-sulfur centers. EC 1.3.3.1.Methionine SulfoximinePhotosystem I Protein Complex: A large multisubunit protein complex that is found in the THYLAKOID MEMBRANE. It uses light energy derived from LIGHT-HARVESTING PROTEIN COMPLEXES to drive electron transfer reactions that result in either the reduction of NADP to NADPH or the transport of PROTONS across the membrane.Genes, Bacterial: The functional hereditary units of BACTERIA.Erythrokeratodermia Variabilis: An autosomal dominant skin disease characterized by transient and variable noninflammatory ERYTHEMA and hyperkeratosis. It has been associated with mutations in the genes that code for CONNEXINS. Erythrokeratodermia variabilis inherited in an autosomal recessive fashion has also been reported. Affected individuals often develop PALMOPLANTAR KERATODERMA.Dithionite: Dithionite. The dithionous acid ion and its salts.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Pigments, Biological: Any normal or abnormal coloring matter in PLANTS; ANIMALS or micro-organisms.Dahlia: A plant genus of the family ASTERACEAE that contains antifungal plant defensin.Nitrogen: An element with the atomic symbol N, atomic number 7, and atomic weight [14.00643; 14.00728]. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells.Bacterial Proteins: Proteins found in any species of bacterium.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Rhizomucor: A genus of zygomycetous fungi of the family Mucoraceae, order MUCORALES.Photosynthetic Reaction Center Complex Proteins: Protein complexes that take part in the process of PHOTOSYNTHESIS. They are located within the THYLAKOID MEMBRANES of plant CHLOROPLASTS and a variety of structures in more primitive organisms. There are two major complexes involved in the photosynthetic process called PHOTOSYSTEM I and PHOTOSYSTEM II.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Anabaena flos-aquae: A species in the genus ANABAENA containing gas vacuoles that gives buoyancy to the organism. It can form extensive blooms in FRESH WATER and is responsible for acute poisonings of various animals.Light: That portion of the electromagnetic spectrum in the visible, ultraviolet, and infrared range.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Arthropod Vectors: Arthropods, other than insects and arachnids, which transmit infective organisms from one host to another or from an inanimate reservoir to an animate host.Kinetics: The rate dynamics in chemical or physical systems.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Hyperkeratosis, Epidermolytic: A form of congenital ichthyosis inherited as an autosomal dominant trait and characterized by ERYTHRODERMA and severe hyperkeratosis. It is manifested at birth by blisters followed by the appearance of thickened, horny, verruciform scales over the entire body, but accentuated in flexural areas. Mutations in the genes that encode KERATIN-1 and KERATIN-10 have been associated with this disorder.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Anabaena cylindrica: A species in the genus ANABAENA whose trichomes are composed of cylindrical cells.D-Amino-Acid Oxidase

Respiratory terminal oxidases in the facultative chemoheterotrophic and dinitrogen fixing cyanobacterium Anabaena variabilis strain ATCC 29413: characterization of the cox2 locus. (1/21)

Upon nitrogen step-down, some filamentous cyanobacteria differentiate heterocysts, cells specialized for dinitrogen fixation, a highly oxygen sensitive process. Aerobic respiration is one of the mechanisms responsible for a microaerobic environment in heterocysts and respiratory terminal oxidases are the key enzymes of the respiratory chains. We used Anabaena variabilis strain ATCC 29413, because it is one of the few heterocyst-forming facultatively chemoheterotrophic cyanobacteria amenable to genetic manipulation. Using PCR with degenerate primers, we found four gene loci for respiratory terminal oxidases, three of which code for putative cytochrome c oxidases and one whose genes are homologous to cytochrome bd-type quinol oxidases. One cytochrome c oxidase, Cox2, was the only enzyme whose expression, tested by RT-PCR, was evidently up-regulated in diazotrophy, and therefore cloned, sequenced, and characterized. Up-regulation of Cox2 was corroborated by Northern and primer extension analyses. Strains were constructed lacking Cox1 (a previously characterized cytochrome c oxidase), Cox2, or both, which all grew diazotrophically. In vitro cytochrome c oxidase and respiratory activities were determined in all strains, allowing for the first time to estimate the relative contributions to total respiration of the different respiratory electron transport branches under different external conditions. Especially adding fructose to the growth medium led to a dramatic enhancement of in vitro cytochrome c oxidation and in vivo respiratory activity without significantly influencing gene expression.  (+info)

High-affinity vanadate transport system in the cyanobacterium Anabaena variabilis ATCC 29413. (2/21)

High-affinity vanadate transport systems have not heretofore been identified in any organism. Anabaena variabilis, which can fix nitrogen by using an alternative V-dependent nitrogenase, transported vanadate well. The concentration of vanadate giving half-maximum V-nitrogenase activity when added to V-starved cells was about 3 x 10(-9) M. The genes for an ABC-type vanadate transport system, vupABC, were found in A. variabilis about 5 kb from the major cluster of genes encoding the V-nitrogenase, and like those genes, the vupABC genes were repressed by molybdate; however, unlike the V-nitrogenase genes the vanadate transport genes were expressed in vegetative cells. A vupB mutant failed to grow by using V-nitrogenase unless high levels of vanadate were provided, suggesting that there was also a low-affinity vanadate transport system that functioned in the vupB mutant. The vupABC genes belong to a family of putative metal transport genes that include only one other characterized transport system, the tungstate transport genes of Eubacterium acidaminophilum. Similar genes are not present in the complete genomes of other bacterial strains that have a V-nitrogenase, including Azotobacter vinelandii, Rhodopseudomonas palustris, and Methanosarcina barkeri.  (+info)

Cross-functionality of nitrogenase components NifH1 and VnfH in Anabaena variabilis. (3/21)

Anabaena variabilis fixes nitrogen under aerobic growth conditions in differentiated cells called heterocysts using either a Mo nitrogenase or a V nitrogenase. The nifH1 gene, which encodes the dinitrogenase reductase of the Mo nitrogenase that is expressed only in heterocysts, is cotranscribed with nifD1 and nifK1, which together encode the Mo dinitrogenase. These genes were expressed in the presence or absence of molybdate or vanadate. The vnfH gene, which encodes the dinitrogenase reductase of the V nitrogenase, was located about 23 kb from vnfDGK, which encodes the V dinitrogenase; however, like vnfDGK, vnfH was expressed only in the absence of molybdate, with or without vanadate. Like nifH1, the vnfH gene was expressed exclusively in heterocysts under either aerobic or anaerobic growth conditions and thus is under the control of developmental factors. The vnfH mutant was able to grow diazotrophically using the V nitrogenase, because NifH1, which was also made in cells starved for molybdate, could substitute for VnfH. Under oxic conditions, the nifH1 mutant grew in the absence of molybdate but not in its presence, using VnfH, while the nifH1 vnfH double mutant did not grow diazotrophically with or without molybdate or vanadate. A nifH1 mutant that expressed nifDK and vnfH but not vnfDGK was able to grow and fix nitrogen normally, indicating that VnfH could substitute for NifH in the Mo nitrogenase and that these dinitrogenase reductases are not involved in determining the metal specificity of the Mo nitrogenase or the V nitrogenase.  (+info)

Discovery of two cyanobacterial phenylalanine ammonia lyases: kinetic and structural characterization. (4/21)

Phenylalanine ammonia lyase (PAL) catalyzes the deamination of phenylalanine to cinnamate and ammonia. While PALs are common in terrestrial plants where they catalyze the first committed step in the formation of phenylpropanoids, only a few prokaryotic PALs have been identified to date. Here we describe for the first time PALs from cyanobacteria, in particular, Anabaena variabilis ATCC 29413 and Nostoc punctiforme ATCC 29133, identified by screening the genome sequences of these organisms for members of the aromatic amino acid ammonia lyase family. Both PAL genes associate with secondary metabolite biosynthetic gene clusters as observed for other eubacterial PAL genes. In comparison to eukaryotic homologues, the cyanobacterial PALs are 20% smaller in size but share similar substrate selectivity and kinetic activity toward L-phenylalanine over L-tyrosine. Structure elucidation by protein X-ray crystallography confirmed that the two cyanobacterial PALs are similar in tertiary and quatenary structure to plant and yeast PALs as well as the mechanistically related histidine ammonia lyases.  (+info)

Transcription of hupSL in Anabaena variabilis ATCC 29413 is regulated by NtcA and not by hydrogen. (5/21)

 (+info)

Structural and biochemical characterization of the therapeutic Anabaena variabilis phenylalanine ammonia lyase. (6/21)

 (+info)

High cell density culture of Anabaena variabilis with controlled light intensity and nutrient supply. (7/21)

Controlling the light energy and major nutrients is important for high cell density culture of cyanobacterial cells. The growth phase of Anabaena variabilis can be divided into an exponential growth phase and a deceleration phase. In this study, the cell growth in the deceleration phase showed a linear growth pattern. Both the period of the exponential growth phase and the average cell growth rate in the deceleration phase increased by controlling the light intensity. To control the light intensity, the specific irradiation rate was maintained above 10 micromol/s/g dry cell by increasing the incident light intensity stepwise. The final cell density increased by controlling the nutrient supply. For the control of the nutrient supply, nitrate, phosphate, and sulfate were intermittently added based on the growth yield, along with the combined control of light intensity and nutrient concentration. Under these control conditions, both final cell concentration and cell productivity increased, to 8.2 g/l and 1.9 g/l/day, respectively.  (+info)

Regulation of fructose transport and its effect on fructose toxicity in Anabaena spp. (8/21)

 (+info)

*Anabaena variabilis

... though no such relationship has been observed with Anabaena variabilis. Anabaena variabilis is also a model organism for ... Anabaena variabilis is a species of filamentous cyanobacterium. This species of the genus Anabaena and the domain Eubacteria is ... Anabaena variabilis is a phylogenic-cousin of the more well-known species Nostoc spirrilum. Both of these species along with ... Anabaena variabilis". The Journal of Tropical Medicine and Hygiene. 93 (2): 133-9. PMID 2109096. Pearce, J.; Leach, C. K.; Carr ...

*1,2-diacylglycerol 3-glucosyltransferase

Sato N; Murata N (1982). "Lipid biosynthesis in the blue-green-alga (cyanobacterium), Anabaena variabilis. 3. UDP-glucose- ...

*Galactosylacylglycerol O-acyltransferase

... lysomonogalactosyldiacylglycerol acyltransferase from the cyanobacterium Anabaena variabilis". Biochim. Biophys. Acta. 963 (3 ...

*Phenylalanine ammonia-lyase

Lovelock, Sarah L.; Turner, Nicholas J. (2014). "Bacterial Anabaena variabilis phenylalanine ammonia lyase: A biocatalyst with ...

*List of restriction enzyme cutting sites: A

"The nucleotide sequences recognized by endonucleases AvaI and AvaII from Anabaena variabilis". Biochem J. 185 (1): 65-75. PMC ... de Waard A, Korsuize J, van Beveren CP, Maat J (December 1978). "A new sequence-specific endonuclease from Anabaena cylindrica ... Whitehead PR, Brown NL (April 1985). "Three restriction endonucleases from Anabaena flos-aquae". J Gen Microbiol. 131 (4): 951- ... "Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120". DNA Res. 8 (5): 227- ...

*Cyanophages

Kozayakov, SYa (1977). "Cyanophages of the series A(L) specific for the blue-green alga Anabaena variabilis. In". Experimental ... Cyanophages can infect and kill four common bloom-forming cyanobacteria: Lyngbya birgei, Anabaena circinalis, Anabaena ... The A-group of the virus causes lysis and infects Anabaena species. Similarly, the host range of the AN group includes both ... "New Anabaena and Nostoc cyanophages from sewage settling ponds". Virology. 114 (1): 236-246. doi:10.1016/0042-6822(81)90269-5. ...

*Vanadium nitrogenase

... found in members of the bacterial genus Azotobacter as well as the species Rhodopseudomonas palustris and Anabaena variabilis. ...

*Raymond C. Stevens

Structural and biochemical characterization of the therapeutic Anabaena variabilis phenylalanine ammonia lyase J Mol Biol 380: ...

*Restriction endonuclease BsobI/AvaI

... endonuclease BsobI/AvaI family of enzymes includes the AvaI and BsoBI restriction endonucleases from Anabaena variabilis and ...

*List of MeSH codes (B03)

Anabaena cylindrica MeSH B03.280.100.300 --- Anabaena flos-aquae MeSH B03.280.100.900 --- Anabaena variabilis MeSH B03.280. ... Anabaena cylindrica MeSH B03.440.475.100.100.300 --- Anabaena flos-aquae MeSH B03.440.475.100.100.900 --- Anabaena variabilis ...
Discover Lifes page about the biology, natural history, ecology, identification and distribution of Psithyrus variabilis, abdomen, UGCA195894 image
The aim of this thesis is to enhance heterocyst-based hydrogen production inNostoc punctiforme ATCC 29133. We envision to do so by finely regulatingthe ratio of heterocyst in order to optimize the filament energy balance. Wehereby report the development of an optogenetic synthetic switch basedon the native PcpeC promoter. The optogenetic switch featured a 24-folddynamic range when measuring reporter sfGFP fluorescence. Such a geneticgate was conceived to artificially drive the expression of hetR, the masterregulator of heterocyst development. We achieved to induce enhancedheterocyst differentiation in the presence of ammonia only by changing thechromatic properties of the light source. Thus, the natural cell developmentregulation was substituted by effectively introducing a full person-drivencontrol over the process.. ...
The suite of biological catalysts found in Nature has the potential to contribute immensely to scientific advancements, ranging from industrial biotechnology to innovations in bioenergy and medical intervention. The endeavour to obtain a catalyst of choice is, however, wrought with challenges. Herein we report the design of a structure-based annotation system for the identification of functionally similar enzymes from diverse sequence backgrounds. Focusing on an enzymatic activity with demonstrated synthetic and therapeutic relevance, five new phenylalanine ammonia lyase (PAL) enzymes were discovered and characterised with respect to their potential applications. The variation and novelty of various desirable traits seen in these previously uncharacterised enzymes demonstrates the importance of effective sequence annotation in unlocking the potential diversity that Nature provides in the search for tailored biological tools. This new method has commercial relevance as a strategy for assaying the ...
Nostoc punctiforme is a nitrogen-fixing cyanobacterium belonging to the family Nostocaceae in the order Nostocales (Castenholz and Waterbury, 1989). All cyanobacteria are characterized as eubacteria that grow as autotrophs with CO2 as the carbon source, utilizing an oxygen-producing photosynthetic mechanism for the generation of ATP and reductant. Members of the order Nostocales are broadly characterized by growth as unbranched filaments and the production of up to three kinds of differentiated cells. Heterocysts differentiate in response to the lack of combined nitrogen in the environment and are the sites of nitrogen fixation. Heterocysts occur singularly in a semi-regular spacing pattern in the filaments at a frequency of 3 to10 % of the total cells (panel A). Nostoc species also produce relatively short, motile filaments called hormogonia (panel B) and this characteristic, in part, distinguishes them from members of the closely related genus Anabaena. In addition, Nostoc species ...
Anabaena variabilis ATCC 29413 is a filamentous heterocyst-forming cyanobacterium that fixes nitrogen and CO2 using the energy of sunlight via oxygen-evolving plant-type photosynthesis. It has also been studied extensively for the production of hydrogen using solar energy. It has a complex life cycle that includes different types of differentiated cells: heterocysts for nitrogen fixation, and akinetes (spores) for survival. It has been studied extensively for over 40 years and is the strain of choice for many laboratories throughout the world. (EBI Integr8 ...
Quercus variabilis is a tree species of ecological and economic value that is widely distributed in China. To effectively evaluate, use, and conserve resources, we applied 25 pairs of simple sequence repeat (SSR) primers to study its genetic diversity and genetic structure in 19 natural forest or natural secondary forest populations of Q. variabilis (a total of 879 samples). A total of 277 alleles were detected. Overall, the average expected heterozygosity (He) was 0.707 and average allelic richness (AR) was 7.79. Q. variabilis manifested a loss of heterozygosity, and the mean of inbreeding coefficient (FIS) was 0.044. Less differentiation among populations was observed, and the genetic differentiation coefficient (FST) was 0.063. Bayesian clustering analysis indicated that the 19 studied populations could be divided into three groups based on their genetic makeup, namely, the Southwest group, Central group, and Northeastern group. The Central group, compared to the populations of the Southwest and
Dear Netters, I will be glad if someone can provide me the source from where I could obtain antibodies for the plant defense enzymes, phenylalanine ammonia lyase (PAL) and chalcone synthase (CHS). Thanks in advance for your cooperation. Sincerely, Balaji Please contact: B. Balaji Biology department (MRC 301) Rensselaer Polytechnic Institute Troy, NY 12180-3590 email: balajb at rpi.edu ...
phenylalanine ammonia-lyase [putative phenylalanine ammonia lyase EncP] ATGACCTTCGTCATAGAGCTCGACATGAACGTCACGCTCGACCAACTTGAGGACGCGGCG CGACAGCGCACGCCCGTGGAGCTGTCCGCACCCGTCCGCTCCCGCGTCCGCGCCTCGCGC GACGTGTTGGTGAAGTTCGTGCAGGACGAACGTGTCATCTACGGGGTCAACACCAGCATG GGGGGCTTCGTCGACCACCTCGTCCCGGTGTCCCAGGCCCGGCAGCTCCAGGAGAACCTG ATCAACGCGGTCGCCACCAACGTGGGGGCGTATCTGGACGACACGACCGCCCGGACCATC ATGCTGTCCCGCATCGTGTCGCTGGCGCGCGGGAACTCCGCGATCACCCCGGCGAATCTG GACAAGCTGGTGGCCGTACTCAACGCCGGGATCGTGCCGTGCATCCCGGAGAAGGGCTCT TTGGGCACCAGCGGTGACCTCGGCCCGCTGGCCGCGATCGCCCTGGTGTGCGCGGGGCAG TGGAAGGCCCGCTACAACGGTCAGATCATGCCCGGGCGGCAGGCCCTGTCCGAGGCCGGC GTCGAGCCGATGGAGCTGAGCTACAAGGATGGCCTGGCCCTGATCAACGGCACGTCAGGC ATGGTCGGCCTGGGCACCATGGTCCTCCAGGCCGCGCGCCGGCTCGTGGACCGCTACCTG CAGGTGTCCGCGTTGTCGGTCGAGGGCCTGGCAGGCATGACGAAACCGTTCGACCCTCGC GTGCACGGCGTCAAGCCGCACCGCGGGCAGCGTCAGGTGGCCTCGCGGTTGTGGGAGGGG CTTGCCGACTCGCACCTGGCGGTCAACGAACTGGACACCGAGCAGACCCTGGCCGGAGAG ATGGGCACGGTCGCCAAGGCCGGTTCGCTGGCGATCGAGGACGCCTACTCCATCCGGTGC ...
4JST: Structural and biochemical analysis of the phosphate donor specificity of the polynucleotide kinase component of the bacterial pnkphen1 RNA repair system.
Structural and biochemical analysis of the phosphate donor specificity of the polynucleotide kinase component of the bacterial pnkphen1 RNA repair system ...
Welcome to the famous Daves Garden website. Join our friendly community that shares tips and ideas for gardens, along with seeds and plants.
Phenylalanine ammonia lyase (EC 4.3.1.24) is an enzyme that catalyzes a reaction converting L-phenylalanine to ammonia and trans-cinnamic acid. Phenylalanine ammonia lyase (PAL) is the first and committed step in the phenyl propanoid pathway and is therefore involved in the biosynthesis of the polyphenol compounds such as flavonoids, phenylpropanoids, and lignin in plants. Phenylalanine ammonia lyase is found widely in plants, as well as some yeast and fungi, with isoenzymes existing within many different species. It has a molecular mass in the range of 270-330 kDa. The activity of PAL is induced dramatically in response to various stimuli such as tissue wounding, pathogenic attack, light, low temperatures, and hormones. PAL has recently been studied for possible therapeutic benefits in humans afflicted with phenylketonuria. It has also been used in the generation of L-phenylalanine as precursor of the sweetener aspartame. The enzyme is a member of the ammonia lyase family, which cleaves ...
Findings: Functional categorization of expressed transcripts revealed the conservation of genes involved in various biological processes like responses to chemical (12.7%), responses to abiotic stimulus (11.8%), biosynthesis processes (11.8%), and cellular metabolic processes (10.4%) in grape berries exposed to high temperature. The major up-regulated genes included isocitratelyase, cysteine proteinases superfamily protein, cupin family protein, and glycosyl hydrolase genes, and the major down-regulated genes included flavanone 3-hydroxylase, phenylalanine ammonia lyase, chlorophyll A-B binding family protein, and polygalacturonase inhibiting protein genes in grape berries exposed to high temperature. Among genes related to grape coloration, expressions of chalcone and stilbene synthase, flavanone 3-hydroxylase, leucoanthocyanidin dioxygenase, phenylalanine ammonia lyasegenes were more strongly inhibited in berries kept at 35°C than 25°C.. ...
SAN RAFAEL, Calif., June 5, 2013 (GLOBE NEWSWIRE) -- BioMarin Pharmaceutical Inc. (Nasdaq:BMRN) announced today that it has initiated the Phase 3 program for PEG-PAL (PEGylated recombinant Phenylalanine Ammonia Lyase) for the treatment of phenylketonuria (PKU).
The roots of cassava present high postharvest perishability due to physiological deterioration that develops in wounded tissues usaully within two to three days after harvest at room temperature. The physiological deterioration is characterized by the appearance of blue-black streaks in the root vascular tissue and storage parenchyma, which progresses through the whole length of the root, being the initial cause for the poor acceptability for fresh consumption. This darkening is attributed to reactions involving the enzymes phenylalanine ammonia lyase, polyphenol oxidase and peroxidase. The objective of this work was to evaluate the effects biochemical, physiological and physical phases by the called minimal processing, the use of antioxidants and of packaging on the development of physiological deterioration in cassava roots during a period of preservation, in order to extend the shelf-life of the product, as well as to ensure food safety during the commercialization, distribution and ...
4JSY: Structural and biochemical analysis of the phosphate donor specificity of the polynucleotide kinase component of the bacterial pnkphen1 RNA repair system.
In additon to the great finds of this and the Conops yesterday I also keyed out Platycheirus scutatus (s.l - it was a female) from the same day. That takes me to 41 species for the year, with another Cheilosia which is of the variabilis group and therefore also new. If not this year, then next year my target will certainly be 50, as well as trying to record more good data on host etc ...
Die Goethe-Universität ist eine forschungsstarke Hochschule in der europäischen Finanzmetropole Frankfurt. Lebendig, urban und weltoffen besitzt sie als Stiftungsuniversität ein einzigartiges Maß an Eigenständigkeit.
Morsy, F. M., Elbadry, M., El-Sayed, W. S., Abd El-Hady, D. 2019 Dark and photofermentation H2 production from hydrolyzed biomass of the potent extracellular polysaccharides producing cyanobacterium Nostoc commune and intracellular polysaccharide (glycogen) enriched Anabaena variabilis NIES-2095. Int. J. Hydrog. Energy, 44, 16199-16211 ...
A process is disclosed for preparing phenylalanine which comprises contacting phenylpyruvic acid or phenylpyruvate with immobilized whole cells having transaminase activity in the presence of an amine donor. The cells are preferably immobilized with a polyazetidine polymer. Ruptured or permeabilized cells, with the enzyme in the free or immobilized state, may also be used. The preparation of phenylalanine from cinnamic acid using immobilized cells having phenylalanine ammonia lyase activity is also disclosed.
An intensified, industrially-relevant strategy for the production of enantiopure halophenylalanines has been developed using the novel combination of a cyanobacterial phenylalanine ammonia lyase (PAL) and ammonium carbamate reaction buffer. The process boasts STYs up to |200 g L−1 d−1, ees ≥ 98% and simplifi Celebrating the 2017 RSC Prize and Award Winners
Coloured scanning electron micrograph (SEM) of Anabaena sp., Gram-negative, oxygenic, photosynthetic, nitrogen fixing, filamentous cyanobacterium (prokaryote). Note the larger cells in the filament called heterocysts which are involved in nitrogen fixation. Anabaena is a genus of filamentous cyanobacteria (formerly known as blue, Green algae). It found as planktonic cyanobacterium (all types of water) and is known for its nitrogen fixing abilities. Blooms or massive growths can occur in waters with a lot of nutrients. These blooms discolour the water and give it a bad odour when the cells die and decay. Anabaena is one of four genera of cyanobacteria that produce neurotoxins. These toxins are harmful to local wildlife, as well as farm animals and pets. Production of these neurotoxins is part of its symbiotic relationships it forms with certain plants. Some species of Anabaena are endophytes. Magnification: x660 when shortest axis printed at 25 - Stock Image C032/2525
References Mansfield SG, Chao H, Walsh CE. RNA repair using spliceosome-mediated RNA trans-splicing. Trends Mol Med. 2004 Jun;10(6):263-8. (...)
Ligand gated ion channels (LGICs) are a superfamily of transmembrane proteins that mediate synaptic signaling in eukaryotic nervous systems. Sequence profile searches have demonstrated the existence of homologous LGICs in several prokaryotic species, which share general structural and mechanistic pr.... Full description. ...
Anabaena: Genus of nitrogen-fixing blue-green algae with beadlike or barrel-like cells and interspersed enlarged spores (heterocysts), found as plankton in shallow water and on moist soil....
Restock - Dreamcolor1 Nobluk Restock - Kitty Kawai Mini Ava Detail Produk Diameter : 14.5mm Kadar Air : 42% Masa Pakai : 6-12bulan --Plano-- Dreamcolor1 Nobluk Grey, Brown, Blue, & Green Kitty Kawaii Mini Ava Grey --Ukuran Minus -- Kitty Kawai Mini Ava Blue -0.50/-0.75/-1.00/-1.25/-1.50/-2.00/-2.25/-2.50/-2.75/-3.00/-3.25/-3.50/-3.75/-4.00 Harga Dreamcolor1 Nobluk Harga Softlens Satuan Rp 95,000 / pasang --------------------------------------…
The research presented in this thesis describes the application of phenylalanine ammonia lyase from the bacteria Anabaena variabilis (AvPAL), as a biocatalyst for the asymmetric hydroamination of cinnamic acid derivatives. PALs from eukaryotic sources such as the plant Petroselinum crispum (PcPAL) and yeast Rhodotorula glutinis (RgPAL) have been widely used as biocatalysts for the synthesis of non-natural amino acids. For example the PAL catalyzed hydroamination of 2-chlorocinnamic acid has been implemented by DSM Pharma Chemicals on a tonne scale. However, there are very few examples of prokaryotic PALs and to our knowledge their activity towards unnatural substrates has not been investigated. Herein we explore the activity of AvPAL towards a panel of cinnamic acid analogues. For comparison, the activity of the commonly studied eukaryotic PcPAL and RgPAL towards the same substrate panel was also investigated. Although the difference in substrate conversions between the three PALs was fairly ...
Køb Ava 4043-101-20 Black i Nordens førende skobutik på nettet. Prøv skoene hjemme med fri retur, 30 dages åbent køb og prisgaranti.
A type of life reinsurance where mortality risks are transferred to a reinsurer. In the yearly renewable term plan of reinsurance, the primary insurer (the ceding company) yields to a reinsurer its net amount at risk (the difference between the face value and the cash value of a life insurance policy) for the amount that is greater than the retention limit on a life insurance policy to a reinsurer.
Видеокамера предназначена для преобразования оптического изображения, создаваемого эндоскопом при всех видах эндоскопических исследований и операций, в полный телевизионный сигнал цветного изображения в системе PAL. Камерная головка видеокамеры снабжена объективом с переменным фокусным расстоянием. Видеокамера оснащена встроенным блоком питания, предназначенным для подключения светодиодного осветителя в вариантах его исполнения ...
Effects of Abscisic acid and Temperature on the Anthocyanin Accumulation in Seedlings of Arabidopsis thaliana - Anthocyanin;Abscisic acid;Ethephon;Low temperature;Phenylalanine ammonia lyase(PAL);Arabidopsis thaliana;
Kudakasseril, G.J.; Minocha, S.C., 1984: Regulation of l phenyl alanine ammonia lyase ec 4.3.1.5 in germinating lettuce lactuca sativa seeds effects of substrate analogs and phenyl propanoid compounds
Discover Lifes page about the biology, natural history, ecology, identification and distribution of Dermacentor variabilis, female, bottom image
Messenger RNA repair and restoration of protein function by spliceosome-mediated RNA trans-splicing.s profile, publications, research topics, and co-authors
2-Methylhopanes, molecular fossils of 2-methylbacteriohopanepolyol (2-MeBHP) lipids, have been proposed as biomarkers for cyanobacteria, and by extension, oxygenic photosynthesis. However, the robustness of this interpretation is unclear, as 2-methylhopanoids occur in organisms besides cyanobacteria and their physiological functions are unknown. As a first step toward understanding the role of 2-MeBHP in cyanobacteria, we examined the expression and intercellular localization of hopanoids in the three cell types of Nostoc punctiforme: vegetative cells, akinetes, and heterocysts. Cultures in which N. punctiforme had differentiated into akinetes contained approximately 10-fold higher concentrations of 2-methylhopanoids than did cultures that contained only vegetative cells. In contrast, 2-methylhopanoids were only present at very low concentrations in heterocysts. Hopanoid production initially increased threefold in cells starved of nitrogen but returned to levels consistent with vegetative cells ...
Phenylketonuria (PKU) - Pipeline Review, H1 2017 Summary Phenylketonuria (also called PKU), is a rare inherited disorder that causes an amino acid c
Phenylketonuria (PKU) - an easy to understand guide covering causes, diagnosis, symptoms, treatment and prevention plus additional in depth medical information.
Phenylketonuria - genetic, clinical and therapeutic aspects. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Phenylketonuria Phenylketonuria (PKU) is a rare condition in which a baby is born without the ability to properly break down an amino acid called phenylalanine. Causes, incidence, and risk factors Phenylketonuria (PKU) is inherited, which means it is passed down through families. Both parents must pass on the defective gene in order for a baby…
A Natural Approach To Health Living With Phenylketonuria I had a question the other day about phenylketonuria. Phenylketonuria (PKU) is an inhe
Geosmin has often been associated with off-flavor problems in drinking water with *Anabaena* sp. as the major producer. Rapid on-site detection of geosmin-producers as well as geosmin is important for a timely management response to potential off-flavor events. In this study, quantitative polymerase chain reaction (qPCR) methods were developed to detect the levels of *Anabaena* sp. and geosmin, respectively, by designing two PCR primer sets to quantify the *rpoC₁* gene (ARG) and geosmin synthase one (GSG) in *Anabaena* sp. in freshwater systems. The ARG density determined by qPCR assay is highly related to microscopic cell count (r² = 0.726, p | 0.001), and the limit of detection (LOD) and limit of quantification (LOQ) of the qPCR method were 0.02 pg and 0.2 pg of DNA, respectively. At the same time, the relationship between geosmin concentrations measured by gas chromatography-mass spectrometry (GC-MS) and GSG copies was also established (r² = 0.742, p | 0.001) with similar LOD and LOQ values.
Abstract: Data on genetic nature of phenylketonuria molecular mechanisms of its pathogenesis and approaches to treatment and prophylaxis of the disease are reviewed. Genetic heterogeneity of phenylketonuria, dependent on polylocus control of phenylalanine hydroxylase complex, is considered in detail. A possibility is discussed of the existence of the genetically different forms of phenylketonuria. Data on the molecular structure of phenylalanine hydroxylase and cooperative nature of its active site are discussed. Variations in pathogenesis of different forms of the phenylketonuria, theoretical and practical significance of these investigations are considered ...
Acts on pelargonidin 3-O-glucoside in dahlia (Dahlia variabilis), delphinidin 3-O-glucoside, and on cyanidin 3-O-glucoside in transgenic petunia (Petunia hybrida ...
Learn more about Phenylketonuria at Oak Hill Hospital DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Eseja: Genetic Diseases - Phenylketonuria. Classical PKU (Phenyklketonuria) is an autonomic recessive disorder. It is caused by a shortage in the enzyme Phenyl
Ava Cadell, Actress: Gigi Does It. Dr. Avas personal brand is Sexual Empowerment. She is a media therapist, author of ten books, global speaker and founder of Lovelogy University. Dr. Ava, has appeared on hundreds of shows including The Doctors (2008), LA Shrinks (2013), Kendra on Top (2012), Cathouse: The Series (2005), and a variety of programs for MTV, VH1, Discovery, Lifetime, TLC, E and A&E. Dr. Ava has earned a doctorate ...
Click on a [studies] link to search within your current results for studies in that region. Use the back button to return to this list and try another region ...
Alkaahan se olla aika pitkälti kaikille selvää että WWE on näinä päivinä enemmälti puuduttava, tylsä ja pahimmillaan itseään toistava. Mutta aina kun edetään kohti seuraavaa Wrestlemaniaa, jotenkin he osaavat vain ottaa niskastaan kiinni ja kohottaa pari feudia sen verran korkealle että sitä alkaa taas odottamaan vesikielellä. Tämän viikon Rawssa oli tämä Shawn Michaelsin ja Undertakerin promo-paketti joka oli parasta antia mitä WWE on tuottanut pitkään aikaan. Niin ja Placebon huumaavasti coveroima "Running Up That Hill" oli kuin luotu tätä varten.. ...
Fabrico at EIS is the market leader in design and manufacturing services for flexible materials. Learn more about how EIS crafts industry leading solutions.
SUNRISE, Fla., Nov. 27, 2012-- On November 21, 2012, Federated National Insurance Company, a wholly owned subsidiary of Federated National Holding Company, received a Notice of 2012 Assessment from the Florida Insurance Guaranty Association, Inc..
Do You Have Erythrokeratodermia Variabilis Ichthyosis? Join friendly people sharing true stories in the I Have Erythrokeratodermia Variabilis Ichthyosis group. Find support forums, advice and chat with groups who share this life experience. A Erythro...
The freshwater cyanobacterium, Anabaena sp. 287 exhibited enhanced tolerance to NaCl in the presence of ammonium, nitrate, and the amino acids, alanine, valine, proline, lysine, histidine, methionine and aspartic acid. Apart from providing permanent
Watch the video to learn how to do the elevated bird dog with perfect form. Then try performing this movement in a total-body circuit or as part of your core workout. Do 16 reps on each side. And if youre ready for the best workout of.. Oct 30, 2017. Your own personal trainer wherever you are! FEATURES: • Two different 5 to 10 minute ab-sculpting workouts • Great for both men and women. You dont need to go to the gym and lift weights to make performance gains through cross training. Use this workout as a great way to improve your strength and.. Dec 16, 2016. Emily Skyes 20-Minute Core Workout for Strong, Sculpted Abs. (30 seconds). Rest for 60 seconds. Repeat the circuit up to 5 more times.. Lower Resting Heart Rate After Starting Keto Jawbone, to their credit, has had major major manufacturing difficulties, pushing back the release of its own heart rate. Calico Crab Diet Coenobita variabilis Credit -VanessaPikeRussell. Common name: Aussie Crab, Crazy Crab, Calico Crab. Latin Origins: ...
The start of newborn screening for phenylketonuria (PKU) during the early 1970s has given rise to an increasing number of women who have been identified and successfully treated for the disease in childhood and are now preparing to have children of t
Learn more about Phenylketonuria at Doctors Hospital of Augusta DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Your Genes, Your Health, DNA Learning Centers multimedia guide to genetic, inherited disorders: phenylketonuria, PKU, autosomal recessive, genetic disorder
Ava Marie says Monday will be humid and warm, a while there will be some sun peeking through early, the clouds will come back as shower chances again move in for the afternoon.
narratori sabucar acurçava ensostrau cicatritzaves atinguen condroblastos ennegridores enllomàvem exultéssim edafòlegs refiblassis neoromàntic sobreexcedí incriminesses epilogarem isolarem petresana encintaré Querós rarejàreu empudegaràs desnonés xafardejaràs [email protected] ...
Thank you for your interest in spreading the word about The BMJ.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...

Anabaena variabilis (strain ATCC 29413 / PCC 7937)Anabaena variabilis (strain ATCC 29413 / PCC 7937)

"Complete genome sequence of Anabaena variabilis ATCC 29413.". Thiel T., Pratte B.S., Zhong J., Goodwin L., Copeland A., Lucas S ... Anabaena variabilis ATCC 29413 is a filamentous heterocyst-forming cyanobacterium that fixes nitrogen and CO2 using the energy ...
more infohttps://www.uniprot.org/proteomes/UP000002533

Inhibition of growth of Anabaena variabilis population by single and mixed steroid hormones | SpringerLinkInhibition of growth of Anabaena variabilis population by single and mixed steroid hormones | SpringerLink

Culture conditions of Anabaena variabilis Anabaena variabilis ATCC-29413 was obtained from the Faculty of Biology, University ... Exposure of Anabaena variabilis to steroid hormones. The A. variabilis colonies were cultured in the presence of the following ... Measuring the growth of Anabaena variabilis The growth of the A. variabilis was assessed by counting the number of cells and ... Anabaena variabilis Cyanobacteria Phytoplankton Hormones Endocrine-disrupting compounds Growth inhibition Electronic ...
more infohttps://link.springer.com/article/10.1007%2Fs10811-018-1589-9

Anabaena variabilis - WikipediaAnabaena variabilis - Wikipedia

... though no such relationship has been observed with Anabaena variabilis. Anabaena variabilis is also a model organism for ... Anabaena variabilis is a species of filamentous cyanobacterium. This species of the genus Anabaena and the domain Eubacteria is ... Anabaena variabilis is a phylogenic-cousin of the more well-known species Nostoc spirrilum. Both of these species along with ... Anabaena variabilis". The Journal of Tropical Medicine and Hygiene. 93 (2): 133-9. PMID 2109096. Pearce, J.; Leach, C. K.; Carr ...
more infohttps://en.wikipedia.org/wiki/Anabaena_variabilis

Ava 1105 - TPR repeat protein - Anabaena variabilis (strain ATCC 29413 / PCC 7937) - Ava 1105 gene & proteinAva 1105 - TPR repeat protein - Anabaena variabilis (strain ATCC 29413 / PCC 7937) - Ava 1105 gene & protein

Anabaena variabilis (strain ATCC 29413 / PCC 7937)Imported. ,p>Information which has been imported from another database using ... Trichormus variabilis NIES-23. Anabaena sp. 39858. Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576). Tolypothrix sp. PCC ... Trichormus variabilis NIES-23. Anabaena sp. 39858. 732. UniRef90_Q8YTA0. Cluster: Alr2824 protein. 4. ... tr,Q3ME57,Q3ME57_ANAVT TPR repeat protein OS=Anabaena variabilis (strain ATCC 29413 / PCC 7937) OX=240292 GN=Ava_1105 PE=4 SV=1 ...
more infohttp://www.uniprot.org/uniprot/Q3ME57

Effect of growth temperature on lipid and fatty acid compositions in the blue-green algae, Anabaena variabilis and Anacystis...Effect of growth temperature on lipid and fatty acid compositions in the blue-green algae, Anabaena variabilis and Anacystis...

... but was not in Anabaena variabilis. A. variabilis contained fatty acids of 18 and 16 carbon atoms, which were localized at 1- ... Effect of growth temperature on lipid and fatty acid compositions in the blue-green algae, Anabaena variabilis and Anacystis ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/104734?dopt=Abstract

RCSB PDB - 4OTZ: The crystal structure of a solute-binding protein (N280D mutant) from Anabaena variabilis ATCC 29413 in...RCSB PDB - 4OTZ: The crystal structure of a solute-binding protein (N280D mutant) from Anabaena variabilis ATCC 29413 in...

... from Anabaena variabilis ATCC 29413 in complex with cystein ... Find proteins for Q3MFZ5 (Anabaena variabilis (strain ATCC ... The crystal structure of a solute-binding protein (N280D mutant) from Anabaena variabilis ATCC 29413 in complex with cystein. * ... The crystal structure of a solute-binding protein (N280D mutant) from Anabaena variabilis ATCC 29413 in complex with cystein. ... Anabaena variabilis (strain ATCC 29413 / PCC 7937). Mutation(s): 1 ...
more infohttps://www.rcsb.org/structure/4OTZ

Bacterial Anabaena variabilis phenylalanine ammonia lyase: A biocatalyst with broad substrate specificity | Research Explorer |...Bacterial Anabaena variabilis phenylalanine ammonia lyase: A biocatalyst with broad substrate specificity | Research Explorer |...

Bacterial Anabaena variabilis phenylalanine ammonia lyase: A biocatalyst with broad substrate specificity. Research output: ... HomeResearchResearch ExplorerPublicationsBacterial Anabaena variabilis phenylalanine ammonia lyase: A... ... Herein, we demonstrate that a bacterial PAL from Anabaena variabilis (AvPAL) displays significantly higher activity towards a ...
more infohttps://www.research.manchester.ac.uk/portal/en/publications/bacterial-anabaena-variabilis-phenylalanine-ammonia-lyase-a-biocatalyst-with-broad-substrate-specificity

2-epi-5-epi-Valiolone synthase activity is essential for maintaining phycobilisome composition in the cyanobacterium Anabaena...2-epi-5-epi-Valiolone synthase activity is essential for maintaining phycobilisome composition in the cyanobacterium Anabaena...

... to be a key enzyme for biosynthesis of the mycosporine-like amino acid shinorine in the cyanobacterium Anabaena variabilis ATCC ... 2-epi-5-epi-Valiolone synthase activity is essential for maintaining phycobilisome composition in the cyanobacterium Anabaena ... synthase activity is essential for maintaining phycobilisome composition in the cyanobacterium Anabaena variabilis ATCC 29413 ... variabilis ATCC 29413 when grown in the presence of a carbon source. ...
more infohttp://epubs.aims.gov.au/handle/11068/10412

Effect of Different  Anabaena variabilis  (Kütz) Treatments on Some Growth Parameters and Physiological Aspects of  Hordeum...Effect of Different Anabaena variabilis (Kütz) Treatments on Some Growth Parameters and Physiological Aspects of Hordeum...

In the present study four treatments of Anabaena variabilis (seeds primed in 1% fresh cyanobacterial extract, seeds sown in ... "Effect of Different Anabaena variabilis (Kütz) Treatments on Some Growth Parameters and Physiological Aspects of Hordeum ... Effect of Different Anabaena variabilis (Kütz) Treatments on Some Growth Parameters and Physiological Aspects of Hordeum ... Ismail, G., Abo-Hamad, S. (2017). Effect of Different Anabaena variabilis (Kütz) Treatments on Some Growth Parameters and ...
more infohttp://ejbo.journals.ekb.eg/article_4046.html

SWISS-MODEL Template Library | 3czoSWISS-MODEL Template Library | 3czo

Crystal Structure of Double Mutant Phenylalanine Ammonia-Lyase From Anabaena Variabilis ... Crystal Structure of Double Mutant Phenylalanine Ammonia-Lyase From Anabaena Variabilis; X-RAY DIFFRACTION 2.20 Å SMTL ID. 3czo ...
more infohttps://swissmodel.expasy.org/templates/3czo

Metabolites  | Free Full-Text | Multiple Roles of Photosynthetic and Sunscreen Pigments in Cyanobacteria Focusing on the...Metabolites | Free Full-Text | Multiple Roles of Photosynthetic and Sunscreen Pigments in Cyanobacteria Focusing on the...

In Anabaena variabilis (ATCC 29413), the gene involved in shinorine synthesis was found as Ava_3855, which combines serine onto ... and Anabaena variabilis [74]. It was found that this scytonemin-less cyanobacteria recovered almost 100% of their ... In Anabaena variabilis (ATCC 29413), the genes involved in the shikimate pathway were found as Ava_3856 (may code deoxy-D- ... The synthetic pathway apparently differs from Anabaena variabilis. Thus, at least two putative biogenesis routes for ...
more infohttp://www.mdpi.com/2218-1989/3/2/463/htm

Zeitschrift für Naturforschung CZeitschrift für Naturforschung C

Comparing Short-Term Effects of Ammonia and Methylamine on Nitrogenase Activity in Anabaena variabilis (ATCC 29413). Reich, ... Uptake and Utilization of Sulfonic Acids in the Cyanobacterial Strains Anabaena variabilis and Plectonema 73110. Biedlingmaier ...
more infohttps://www.degruyter.com/view/j/znc.1987.42.issue-7-8/issue-files/znc.1987.42.issue-7-8.xml

CiNii Articles - MASUKAWA HajimeCiNii Articles - MASUKAWA Hajime

Cloning and sequencing of uptake hydrogenase structural genes ,I,hupSL,/I,, in ,I,Anabaena variabilis,/I, IAM M58. (2003) ... Regulation of the Nitrogenase Genes Expression in Heterocysts of ,I,Anabaena variabilis,/I, (2006) ... Effects of disruption of homocitrate synthase genes on H,SUB,2,/SUB, productivity in ,I,Anabaena,/I, PCC 7120 and expression ... Effects of disruption of ,I,hypF,/I, gene on photobiological hydrogen production in ,I,Anabaena,/I, sp. PCC 7120 (2005) ...
more infohttps://ci.nii.ac.jp/author?q=MASUKAWA+Hajime

Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120.Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120.

strain PCC 7120, (B) Anabaena variabilis ATCC 29413, (C) Nostoc punctiforme PCC 73102, (D) Nodularia spumigena CCY9414, (E) ... Anabaena variabilis ATCC 29413. ava_4597. ava_4598. ava_4599. ava_4600. ava_4601. identical genomic arrangement. ... strain PCC 7120 and Anabaena variabilis ATCC 29413 or spread out in the genome as in Synechosystis sp. strain PCC 6803. There ... These five ORFs are present in other filamentous, heterocystous N2-fixing cyanobacteria, e.g. Anabaena variabilis ATCC 29413 [ ...
more infohttp://www.biomedsearch.com/nih/Transcription-extended-hyp-operon-in/18442387.html

Structural Classification of Bacterial Response Regulators: Diversity of Output Domains and Domain Combinations | Journal of...Structural Classification of Bacterial Response Regulators: Diversity of Output Domains and Domain Combinations | Journal of...

PCC 6803 slr0222 (11; BAA10222); Anabaena variabilis Ava_B0191 (14; ABA24903); Gloeobacter violaceus gll0634 (15; BAC88575); ... Genomic analysis of protein kinases, protein phosphatases and two-component regulatory systems of the cyanobacterium Anabaena ... controls heterocyst pattern formation in the cyanobacterium Anabaena 7120. Proc. Natl. Acad. Sci. USA 89:5655-5659. ... of genes encoding multi-domain proteins in the genome of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC ...
more infohttps://jb.asm.org/content/188/12/4169?ijkey=2aa7e95e22a6f6cd36f7fd76db96c557acdc5f03&keytype2=tf_ipsecsha

Industrial Production of Superoxide Dismutase (SOD): A Mini ReviewIndustrial Production of Superoxide Dismutase (SOD): A Mini Review

Anabaena variabilis Kütz. Journal of Agricultural and Biological Science 5: 4-9. ... Anabaena and Spirulina are the sources of commercial proteins and vitamins. Especially, the cyanobacteria have the ability of ... dismutase and Catalase in the protection of the Proton-donating systems of nitrogen fixation in the Blue-green alga Anabaena ...
more infohttps://www.omicsonline.org/open-access/industrial-production-of-superoxide-dismutase-sod-a-mini-review-2329-8901-1000179.php?aid=94014

CRISPRdirect update cyanobase.md · GitHubCRISPRdirect update cyanobase.md · GitHub

Anabaena variabilis ATCC 29413 genome, GCA_000204075.1. *Arthrospira platensis NIES-39 genome, GCA_000210375.1 ...
more infohttps://gist.github.com/meso-cacase/ef314e1e2ac4399fe20cd50fec77ce24

IJMS  | Free Full-Text | Biohydrogen Production: Strategies to Improve Process Efficiency through Microbial Routes | HTMLIJMS | Free Full-Text | Biohydrogen Production: Strategies to Improve Process Efficiency through Microbial Routes | HTML

Anabaena variabilis, Nostoc punctiforme, and Synechocystis sp., among others) use this process that requires only water and ...
more infohttp://www.mdpi.com/1422-0067/16/4/8266/htm

An Rrf2-Type Transcriptional Regulator Is Required for Expression of psaAB Genes in the Cyanobacterium Synechocystis sp. PCC...An Rrf2-Type Transcriptional Regulator Is Required for Expression of psaAB Genes in the Cyanobacterium Synechocystis sp. PCC...

Anabaena sp. PCC7120, NP_486121 and NP_488591; Anabaena variabilis ATCC29413, YP_323629 and YP_323019; Crocosphaera watsonii ... PCC7120; ava, Anabaena variabilis ATCC29413; cro, Crocosphaera watsonii WH8501; CY0110, Cyanothece sp. CCY0110; L8106, Lyngbya ... The organisms used here are as follows: eco, E. coli K-12 MG1655; bsu, B. subtilis; ana, Anabaena sp. ...
more infohttp://www.plantphysiol.org/content/151/2/882.full

Pathway of nitrogen metabolism after fixation of 13N-labeled nitrogen gas by the cyanobacterium, Anabaena cylindrica. -...Pathway of nitrogen metabolism after fixation of 13N-labeled nitrogen gas by the cyanobacterium, Anabaena cylindrica. -...

Anabaena cylindrica. This sequence of the formation of nitrogenous products was confirmed by the use of inhibitors. The ... Cell-specific gene expression in Anabaena variabilis grown phototrophically, mixotrophically, and heterotrophically. *J S Park ... Pathway of nitrogen metabolism after fixation of 13N-labeled nitrogen gas by the cyanobacterium, Anabaena cylindrica.. @article ... Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC ...
more infohttps://www.semanticscholar.org/paper/Pathway-of-nitrogen-metabolism-after-fixation-of-by-Wolk-Thomas/84dbd0500fbfb284f67638b302275b73f0d06db8

Milestones Tables : MetricsMilestones Tables : Metrics

Genus: Anabaena. 23. Anabaena sp.. 1. Anabaena variabilis. 22. Genus: Aquifex. 9. ...
more infohttp://www.sbkb.org/metrics/milestonestables.html

Frontiers | Conserved and Diversified Gene Families of Monovalent Cation/H+ Antiporters from Algae to Flowering Plants | Plant...Frontiers | Conserved and Diversified Gene Families of Monovalent Cation/H+ Antiporters from Algae to Flowering Plants | Plant...

... including Cyanobacteria Gloeobacter and Anabaena variabilis (Figure 3). Oddly, KEA or Kef-like genes have not been found in any ... as well as filamentous Anabaena variabilis (Ava1632). Many non-cyanobacteria do not have genes that cluster with the CHX/NhaS4 ...
more infohttps://www.frontiersin.org/articles/10.3389/fpls.2012.00025/full
  • Anabaena variabilis is a phylogenic-cousin of the more well-known species Nostoc spirrilum. (wikipedia.org)
  • Native Cyanobacteriel species such as Nostoc muscorum, Anabaena variabilis, Lyngbya majuscula and Oscillatoria salina were used for biotreatment which were cultured in BG11 media and inoculated onto the untreated effluent. (omicsonline.org)
  • Anabaena variabilis is also a model organism for studying the beginnings of multicellular life due to its filamentous characterization and cellular-differentiation capabilities. (wikipedia.org)
  • A. variabilis contained fatty acids of 18 and 16 carbon atoms, which were localized at 1- and 2-positions, respectively, of the glycerol moiety of lipids. (nih.gov)
  • Effect of growth temperature on lipid and fatty acid compositions in the blue-green algae, Anabaena variabilis and Anacystis nidulans. (nih.gov)
  • The lipid composition was affected by growth temperature in Anacystis nidulans, but was not in Anabaena variabilis. (nih.gov)
  • Effect of Different Anabaena variabilis (Kütz) Treatments on Some Growth Parameters and Physiological Aspects of Hordeum vulgare L. and Trigonella foenum-graecum L. (ekb.eg)
  • In the present study four treatments of Anabaena variabilis (seeds primed in 1% fresh cyanobacterial extract, seeds sown in soils inoculated with 3g fresh or dry cyanobacterial cells per 1 kg soil and wet seeds primed with 3g dry cyanobacterial powder per 1 kg seeds) were examined for their effect on Hordeum vulgare and Trigonella foenum-graecum L. plants. (ekb.eg)
  • Herein, we demonstrate that a bacterial PAL from Anabaena variabilis (AvPAL) displays significantly higher activity towards a series of non-natural substrates than previously described eukaryotic PALs. (manchester.ac.uk)
  • For example, when producing AvrII ( NEB #R0174 ) from the native strain Anabaena variabilis , great care must be taken to eliminate AvrI. (neb.com)