A colorless alkaline gas. It is formed in the body during decomposition of organic materials during a large number of metabolically important reactions. Note that the aqueous form of ammonia is referred to as AMMONIUM HYDROXIDE.
A class of enzymes that catalyze the cleavage of C-C, C-O, and C-N, and other bonds by other means than by hydrolysis or oxidation. (Enzyme Nomenclature, 1992) EC 4.
Enzymes which catalyze the elimination of delta-4,5-D-glucuronate residues from polysaccharides containing 1,4-beta-hexosaminyl and 1,3-beta-D-glucuronosyl or 1,3-alpha-L-iduronosyl linkages thereby bringing about depolymerization. EC 4.2.2.4 acts on chondroitin sulfate A and C as well as on dermatan sulfate and slowly on hyaluronate. EC 4.2.2.5 acts on chondroitin sulfate A and C.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria that causes vascular wilts on a wide range of plant species. It was formerly named Erwinia chrysanthemi.
Enzymes which catalyze the elimination of glucuronate residues from chondroitin A,B, and C or which catalyze the hydrolysis of sulfate groups of the 2-acetamido-2-deoxy-D-galactose 6-sulfate units of chondroitin sulfate. EC 4.2.2.-.
High molecular weight polysaccharides present in the cell walls of all plants. Pectins cement cell walls together. They are used as emulsifiers and stabilizers in the food industry. They have been tried for a variety of therapeutic uses including as antidiarrheals, where they are now generally considered ineffective, and in the treatment of hypercholesterolemia.
Light harvesting proteins found in phycobilisomes.
A thick-rooted perennial (Cichorium intybus) native to Europe but widely grown for its young leaves used as salad greens and for its roots, dried and ground-roasted, used to flavor or adulterate coffee. (From Webster, 3d ed)
Enzymes that catalyze a reverse aldol condensation. A molecule containing a hydroxyl group and a carbonyl group is cleaved at a C-C bond to produce two smaller molecules (ALDEHYDES or KETONES). EC 4.1.2.
A genus of gram-negative, ellipsoidal or rod-shaped bacteria whose major source of energy and reducing power is from the oxidation of ammonia to nitrite. Its species occur in soils, oceans, lakes, rivers, and sewage disposal systems.
Enzymes that catalyze the cleavage of a carbon-oxygen bond by means other than hydrolysis or oxidation. EC 4.2.
A genus of gram-negative, facultatively anaerobic, rod-shaped bacteria whose organisms are associated with plants as pathogens, saprophytes, or as constituents of the epiphytic flora.
An enzyme of the isomerase class that catalyzes the eliminative cleavage of polysaccharides containing 1,4-linked D-glucuronate or L-iduronate residues and 1,4-alpha-linked 2-sulfoamino-2-deoxy-6-sulfo-D-glucose residues to give oligosaccharides with terminal 4-deoxy-alpha-D-gluc-4-enuronosyl groups at their non-reducing ends. (From Enzyme Nomenclature, 1992) EC 4.2.2.7.
An enzyme that catalyzes the formation of carbamoyl phosphate from ATP, carbon dioxide, and ammonia. This enzyme is specific for arginine biosynthesis or the urea cycle. Absence or lack of this enzyme may cause CARBAMOYL-PHOSPHATE SYNTHASE I DEFICIENCY DISEASE. EC 6.3.4.16.
Enzymes that catalyze the cleavage of a carbon-carbon bond of a 3-hydroxy acid. (Dorland, 28th ed) EC 4.1.3.
An element with the atomic symbol N, atomic number 7, and atomic weight [14.00643; 14.00728]. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells.
A cell wall-degrading enzyme found in microorganisms and higher plants. It catalyzes the random hydrolysis of 1,4-alpha-D-galactosiduronic linkages in pectate and other galacturonans. EC 3.2.1.15.
Elevated level of AMMONIA in the blood. It is a sign of defective CATABOLISM of AMINO ACIDS or ammonia to UREA.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A compound formed in the liver from ammonia produced by the deamination of amino acids. It is the principal end product of protein catabolism and constitutes about one half of the total urinary solids.
An enzyme that catalyzes the conversion of ATP, L-glutamate, and NH3 to ADP, orthophosphate, and L-glutamine. It also acts more slowly on 4-methylene-L-glutamate. (From Enzyme Nomenclature, 1992) EC 6.3.1.2.
Salts of alginic acid that are extracted from marine kelp and used to make dental impressions and as absorbent material for surgical dressings.
A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
An acidifying agent that has expectorant and diuretic effects. Also used in etching and batteries and as a flux in electroplating.
Unstable isotopes of nitrogen that decay or disintegrate emitting radiation. N atoms with atomic weights 12, 13, 16, 17, and 18 are radioactive nitrogen isotopes.
Term used to designate tetrahydroxy aldehydic acids obtained by oxidation of hexose sugars, i.e. glucuronic acid, galacturonic acid, etc. Historically, the name hexuronic acid was originally given to ascorbic acid.
A key enzyme in the glyoxylate cycle. It catalyzes the conversion of isocitrate to succinate and glyoxylate. EC 4.1.3.1.
A process facilitated by specialized bacteria involving the oxidation of ammonium to nitrite and nitrate.
Plants of the division Rhodophyta, commonly known as red algae, in which the red pigment (PHYCOERYTHRIN) predominates. However, if this pigment is destroyed, the algae can appear purple, brown, green, or yellow. Two important substances found in the cell walls of red algae are AGAR and CARRAGEENAN. Some rhodophyta are notable SEAWEED (macroalgae).
Open chain tetrapyrroles that function as light harvesting chromophores in PHYCOBILIPROTEINS.
An enzyme that catalyzes the eliminative degradation of polysaccharides containing 1,4-beta-D-hexosaminyl and 1,3-beta-D-glucuronosyl or 1,3-alpha-L-iduronosyl linkages to disaccharides containing 4-deoxy-beta-D-gluc-4-enuronosyl groups. (Enzyme Nomenclature, 1992)
A genus of gram-negative, aerobic, rod-shaped bacteria characterized by an outer membrane that contains glycosphingolipids but lacks lipopolysaccharide. They have the ability to degrade a broad range of substituted aromatic compounds.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The 30-kDa membrane-bound c-type cytochrome protein of mitochondria that functions as an electron donor to CYTOCHROME C GROUP in the mitochondrial and bacterial RESPIRATORY CHAIN. (From Enzyme Nomenclature, 1992, p545)
A genus of gram-negative, anaerobic, rod-shaped bacteria. Its organisms are normal inhabitants of the oral, respiratory, intestinal, and urogenital cavities of humans, animals, and insects. Some species may be pathogenic.
The rate dynamics in chemical or physical systems.
A sugar acid formed by the oxidation of the C-6 carbon of GLUCOSE. In addition to being a key intermediate metabolite of the uronic acid pathway, glucuronic acid also plays a role in the detoxification of certain drugs and toxins by conjugating with them to form GLUCURONIDES.
A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in SOIL and WATER. Its organisms are also found in raw meats, MILK and other FOOD, hospital environments, and human clinical specimens. Some species are pathogenic in humans.
An enzyme that, in the course of purine ribonucleotide biosynthesis, catalyzes the conversion of 5'-phosphoribosyl-4-(N-succinocarboxamide)-5-aminoimidazole to 5'-phosphoribosyl-4-carboxamide-5-aminoimidazole and the conversion of adenylosuccinic acid to AMP. EC 4.3.2.2.
A species of gram-positive bacteria in the STREPTOCOCCUS MILLERI GROUP. It is the most frequently seen isolate of that group, has a proclivity for abscess formation, and is most often isolated from the blood, gastrointestinal, and urogenital tract.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A plant genus of the family EUPHORBIACEAE, order Euphorbiales, subclass Rosidae. Commercial natural RUBBER is mainly obtained from Hevea brasiliensis but also from some other plants.
Proteins found in any species of bacterium.
A syndrome characterized by central nervous system dysfunction in association with LIVER FAILURE, including portal-systemic shunts. Clinical features include lethargy and CONFUSION (frequently progressing to COMA); ASTERIXIS; NYSTAGMUS, PATHOLOGIC; brisk oculovestibular reflexes; decorticate and decerebrate posturing; MUSCLE SPASTICITY; and bilateral extensor plantar reflexes (see REFLEX, BABINSKI). ELECTROENCEPHALOGRAPHY may demonstrate triphasic waves. (From Adams et al., Principles of Neurology, 6th ed, pp1117-20; Plum & Posner, Diagnosis of Stupor and Coma, 3rd ed, p222-5)
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Accumulations of solid or liquid animal excreta usually from stables and barnyards with or without litter material. Its chief application is as a fertilizer. (From Webster's 3d ed)
The type species of the genus NITROSOMONAS, a gram-negative chemolithotroph that oxidizes ammonia to nitrite. It is found in soil, sewage, freshwater, and on building walls, and especially in polluted areas where air contains high levels of nitrogen compounds.
Enzymes that catalyze the cleavage of a carbon-nitrogen bond by means other than hydrolysis or oxidation. Subclasses are the AMMONIA-LYASES, the AMIDINE-LYASES, the amine-lyases, and other carbon-nitrogen lyases. EC 4.3.
An enzyme that catalyzes the conversion of L-glutamate and water to 2-oxoglutarate and NH3 in the presence of NAD+. (From Enzyme Nomenclature, 1992) EC 1.4.1.2.
Enzymes that catalyze the cleavage of a carbon-carbon bond by means other than hydrolysis or oxidation. This subclass contains the DECARBOXYLASES, the ALDEHYDE-LYASES, and the OXO-ACID-LYASES. EC 4.1.
Heteropolysaccharides which contain an N-acetylated hexosamine in a characteristic repeating disaccharide unit. The repeating structure of each disaccharide involves alternate 1,4- and 1,3-linkages consisting of either N-acetylglucosamine or N-acetylgalactosamine.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria that occurs in soil, fecal matter, and sewage. It is an opportunistic pathogen and causes cystitis and pyelonephritis.
Acids derived from monosaccharides by the oxidation of the terminal (-CH2OH) group farthest removed from the carbonyl group to a (-COOH) group. (From Stedmans, 26th ed)
The first stomach of ruminants. It lies on the left side of the body, occupying the whole of the left side of the abdomen and even stretching across the median plane of the body to the right side. It is capacious, divided into an upper and a lower sac, each of which has a blind sac at its posterior extremity. The rumen is lined by mucous membrane containing no digestive glands, but mucus-secreting glands are present in large numbers. Coarse, partially chewed food is stored and churned in the rumen until the animal finds circumstances convenient for rumination. When this occurs, little balls of food are regurgitated through the esophagus into the mouth, and are subjected to a second more thorough mastication, swallowed, and passed on into other parts of the compound stomach. (From Black's Veterinary Dictionary, 17th ed)
A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.
Derivatives of chondroitin which have a sulfate moiety esterified to the galactosamine moiety of chondroitin. Chondroitin sulfate A, or chondroitin 4-sulfate, and chondroitin sulfate C, or chondroitin 6-sulfate, have the sulfate esterified in the 4- and 6-positions, respectively. Chondroitin sulfate B (beta heparin; DERMATAN SULFATE) is a misnomer and this compound is not a true chondroitin sulfate.
Oligosaccharides containing two monosaccharide units linked by a glycosidic bond.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Sulfur compounds in which the sulfur atom is attached to three organic radicals and an electronegative element or radical.
An enzyme that catalyzes the deamination of PHENYLALANINE to form trans-cinnamate and ammonia.
Paired respiratory organs of fishes and some amphibians that are analogous to lungs. They are richly supplied with blood vessels by which oxygen and carbon dioxide are exchanged directly with the environment.
A naturally occurring glycosaminoglycan found mostly in the skin and in connective tissue. It differs from CHONDROITIN SULFATE A (see CHONDROITIN SULFATES) by containing IDURONIC ACID in place of glucuronic acid, its epimer, at carbon atom 5. (from Merck, 12th ed)
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The sequence of carbohydrates within POLYSACCHARIDES; GLYCOPROTEINS; and GLYCOLIPIDS.
An enzyme that catalyzes the formation of 2 molecules of glutamate from glutamine plus alpha-ketoglutarate in the presence of NADPH. EC 1.4.1.13.
A DNA repair enzyme that catalyses the excision of ribose residues at apurinic and apyrimidinic DNA sites that can result from the action of DNA GLYCOSYLASES. The enzyme catalyzes a beta-elimination reaction in which the C-O-P bond 3' to the apurinic or apyrimidinic site in DNA is broken, leaving a 3'-terminal unsaturated sugar and a product with a terminal 5'-phosphate. This enzyme was previously listed under EC 3.1.25.2.
Derivatives of ammonium compounds, NH4+ Y-, in which all four of the hydrogens bonded to nitrogen have been replaced with hydrocarbyl groups. These are distinguished from IMINES which are RN=CR2.
Derivatives of GLUTAMIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the 2-aminopentanedioic acid structure.
The relationships of groups of organisms as reflected by their genetic makeup.
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
One of the three domains of life (the others being BACTERIA and Eukarya), formerly called Archaebacteria under the taxon Bacteria, but now considered separate and distinct. They are characterized by: (1) the presence of characteristic tRNAs and ribosomal RNAs; (2) the absence of peptidoglycan cell walls; (3) the presence of ether-linked lipids built from branched-chain subunits; and (4) their occurrence in unusual habitats. While archaea resemble bacteria in morphology and genomic organization, they resemble eukarya in their method of genomic replication. The domain contains at least four kingdoms: CRENARCHAEOTA; EURYARCHAEOTA; NANOARCHAEOTA; and KORARCHAEOTA.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A class of enzymes involved in the hydrolysis of the N-glycosidic bond of nitrogen-linked sugars.
An enzyme that catalyzes the conversion of urea and water to carbon dioxide and ammonia. EC 3.5.1.5.
Short-chain fatty acids of up to six carbon atoms in length. They are the major end products of microbial fermentation in the ruminant digestive tract and have also been implicated in the causation of neurological diseases in humans.
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
A kingdom of eukaryotic, heterotrophic organisms that live parasitically as saprobes, including MUSHROOMS; YEASTS; smuts, molds, etc. They reproduce either sexually or asexually, and have life cycles that range from simple to complex. Filamentous fungi, commonly known as molds, refer to those that grow as multicellular colonies.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The functional hereditary units of BACTERIA.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
A pathologic condition of acid accumulation or depletion of base in the body. The two main types are RESPIRATORY ACIDOSIS and metabolic acidosis, due to metabolic acid build up.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The facilitation of biochemical reactions with the aid of naturally occurring catalysts such as ENZYMES.
Stable nitrogen atoms that have the same atomic number as the element nitrogen, but differ in atomic weight. N-15 is a stable nitrogen isotope.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
Proteins obtained from species of fish (FISHES).
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.
The characteristic 3-dimensional shape of a carbohydrate.
A family of DNA repair enzymes that recognize damaged nucleotide bases and remove them by hydrolyzing the N-glycosidic bond that attaches them to the sugar backbone of the DNA molecule. The process called BASE EXCISION REPAIR can be completed by a DNA-(APURINIC OR APYRIMIDINIC SITE) LYASE which excises the remaining RIBOSE sugar from the DNA.
Proteins prepared by recombinant DNA technology.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
Rare congenital metabolism disorders of the urea cycle. The disorders are due to mutations that result in complete (neonatal onset) or partial (childhood or adult onset) inactivity of an enzyme, involved in the urea cycle. Neonatal onset results in clinical features that include irritability, vomiting, lethargy, seizures, NEONATAL HYPOTONIA; RESPIRATORY ALKALOSIS; HYPERAMMONEMIA; coma, and death. Survivors of the neonatal onset and childhood/adult onset disorders share common risks for ENCEPHALOPATHIES, METABOLIC, INBORN; and RESPIRATORY ALKALOSIS due to HYPERAMMONEMIA.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
Enzymes of the isomerase class that catalyze reactions in which a group can be regarded as eliminated from one part of a molecule, leaving a double bond, while remaining covalently attached to the molecule. (From Enzyme Nomenclature, 1992) EC 5.5.
The mixture of gases present in the earth's atmosphere consisting of oxygen, nitrogen, carbon dioxide, and small amounts of other gases.
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
The extent to which an enzyme retains its structural conformation or its activity when subjected to storage, isolation, and purification or various other physical or chemical manipulations, including proteolytic enzymes and heat.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
A heteropolysaccharide that is similar in structure to HEPARIN. It accumulates in individuals with MUCOPOLYSACCHARIDOSIS.
Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.
Foodstuff used especially for domestic and laboratory animals, or livestock.
Techniques used to separate mixtures of substances based on differences in the relative affinities of the substances for mobile and stationary phases. A mobile phase (fluid or gas) passes through a column containing a stationary phase of porous solid or liquid coated on a solid support. Usage is both analytical for small amounts and preparative for bulk amounts.
A large stout-bodied, sometimes anadromous, TROUT found in still and flowing waters of the Pacific coast from southern California to Alaska. It has a greenish back, a whitish belly, and pink, red, or lavender stripes on the sides, with usually a sprinkling of black dots. It is highly regarded as a sport and food fish. Its former name was Salmo gairdneri. The sea-run rainbow trouts are often called steelheads. Redband trouts refer to interior populations of rainbows.
A plant genus in the LAURACEAE family. The tree, Persea americana Mill., is known for the Avocado fruit, the food of commerce.
A family of compounds containing an oxo group with the general structure of 1,5-pentanedioic acid. (From Lehninger, Principles of Biochemistry, 1982, p442)
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Carbohydrates consisting of between two (DISACCHARIDES) and ten MONOSACCHARIDES connected by either an alpha- or beta-glycosidic link. They are found throughout nature in both the free and bound form.

The crystal structure of the formiminotransferase domain of formiminotransferase-cyclodeaminase: implications for substrate channeling in a bifunctional enzyme. (1/224)

BACKGROUND: The bifunctional enzyme formiminotransferase-cyclodeaminase (FTCD) contains two active sites at different positions on the protein structure. The enzyme binds a gamma-linked polyglutamylated form of the tetrahydrofolate substrate and channels the product of the transferase reaction from the transferase active site to the cyclodeaminase active site. Structural studies of this bifunctional enzyme and its monofunctional domains will provide insight into the mechanism of substrate channeling and the two catalytic reactions. RESULTS: The crystal structure of the formiminotransferase (FT) domain of FTCD has been determined in the presence of a product analog, folinic acid. The overall structure shows that the FT domain comprises two subdomains that adopt a novel alpha/beta fold. Inspection of the folinic acid binding site reveals an electrostatic tunnel traversing the width of the molecule. The distribution of charged residues in the tunnel provides insight into the possible mode of substrate binding and channeling. The electron density reveals that the non-natural stereoisomer, (6R)-folinic acid, binds to the protein; this observation suggests a mechanism for product release. In addition, a single molecule of glycerol is bound to the enzyme and indicates a putative binding site for formiminoglutamate. CONCLUSIONS: The structure of the FT domain in the presence of folinic acid reveals a possible novel mechanism for substrate channeling. The position of the folinic acid and a bound glycerol molecule near to the sidechain of His82 suggests that this residue may act as the catalytic base required for the formiminotransferase mechanism.  (+info)

Mechanism of action of ethanolamine ammonia-lyase, an adenosylcobalamin-dependent enzyme. Proton nuclear magnetic resonance studies of the binding of adenine nucleosides and substrate to ethanolamine ammonia-lyase. (2/224)

Proton NMR spectroscopy was used to study the binding of adenosine, 5'-deoxyadenosine, adenine, and ethanolamine to the adenosylcobalamin-dependent enzyme ethanolamine ammonia-lyase. Broadening of ligand resonances in the presence of ethanolamine ammonia-lyase indicated that adenosine, 5'-deoxyadenosine, and ethanolamine all formed complexes with the enzyme (KD(mM) = 3.5, 3.0, and 2.5 respectively). The methyl group of enzyme-bound 5'-deoxyadenosine rotated at a rate exceeding 10(7) revolutions/s. Adenine did not appear to bind to the enzyme. Rates of dissociation of nucleosides from the enzyme were fast on the NMR time scale, precluding measurements of rate constants for the binding reaction. The departure of ethanolamine was slow, however, permitting their determination. The values for these rate constants were: k1 = 4.4 times 10(5) M-1 S-1; k-1 = 1.1 times 10(3) S-1. Addition of 1 mol of cyanocobalamin/mol of active sites led to narrowing of the enzyme-broadened ligand resonances. With 5'-deoxyadenosine, linewidths still exceeded those of the free ligand, indicating that binding to enzyme was weakened but not abolished. The KD for this nucleoside in the presence of CNCbl was 8.0 mM. With ethanolamine and adenosine, however, linewidths reverted to values characteristic of the unbound ligand, indicating either that CNCbl greatly lowered the rate of dissociation of the ligand or displaced the ligand from the enzyme. A decision between these two possibilities could not be made from the data at hand, although analogy with the situation obtaining with 5'-deoxyadenosine suggests that adenosine is displaced from the enzyme by CNCbl. 5'-Deoxyadenosine inhibited catalytic activity of the enzyme, competing with adenosylcobalamin (Ki = 2.7 mM). Adenosine had no effect, despite NMR evidence indicating that it formed a complex with free enzyme. These experiments showed that ethanolamine ammonia-lyase possesses binding sites for adenine nucleosides, a class of compounds chemically related to the Cobeta-ligand of the cofactor, as well as for ethanolamine. Binding to the enzyme has now been demonstrated for all three categories of low molecular weight compounds thought to be involved in the reaction; namely, substrate (ethanolamine), corrin, and adenine nucleoside.  (+info)

Interaction between ethanolamine ammonia-lyase and methylcobalamin. Half-site reactivity with an adenosylcobalamin-dependent enzyme. (3/224)

The adenosylcobalamin-dependent enzyme ethanolamine ammonia-lyase contains two active sites per molecule. The effects of methylcobalamin on the properties of this enzyme differ qualitatively depending on whether one or both of these sites is occupied by the cobamide. At 0.5 mol of methylcobalamin/mol of active sites, catalytic activity fell rapidly to approximately 30% of control levels, thereafter remaining constant for an hour. With the partially inhibited enzyme, Km values for ethanolamine and adenosylcobalamin were 5.5 muM and 1.6 muM, respectively, values that do not differ significantly from those of uninhibited enzyme. When the methylcobalamin per active site ratio was increased to 1, the decline in activity became progressive with time, eventually falling to levels much lower than seen at a cobamide per active site ratio of 0.5. Methylcobalamin also promotes the formation of a complex stable to gel filtration between ethanolamine and enzyme. Complex formation increased with increasing methylcobalamin per active site ratios up to a ratio of 0.7/1, at which point 0.5 mol of ethanol/mol of active sites was taken up. Ethanolamine uptake did not increase at higher methylcobalamin to active sites ratios. Methylcobalamin itself was taken up by enzyme, forming a complex containing 0.5 mol of methylcobalamin/mol of active sites that was stable to gel filtration. Measurement by the technique of Hummel and Dreyer ((1962) Biochim. Biophys. Acta 63, 530-532), however, showed one methylcobalamin binding site per active site. The formation of enzyme-ligand complexes stable to gel filtration was not affected by 5'-deoxyadenosine nor did 5'-deoxyadenosine by itself promote the formation of a stable complex between enzyme and ethanolamine. These observations were interpreted as evidence indicating half-site reactivity of ethanolamine ammonia-lyase with methylcobalamin. Comparison with previous results suggested that this half-site reactivity was an epiphenomenon not related to catalysis.  (+info)

The mechanism of action of ethanolamine ammonia-lyase, an adenosylcobalamin-dependent enzyme. The source of the third methyl hydrogen in the 5'-deoxyadenosine generated from the cofactor during catalysis. (4/224)

Ethanolamine ammonia-lyase is an adenosylcobalamin-dependent enzyme which catalyzes the conversion of ethanolamine and propanolamine to ammonia and the corresponding aldehydes. A mechanism has been proposed for this and other adenosylcobalamin-dependent reactions which involves cleavage of the carbon-cobalt bond of the cofactor followed by abstraction of a substrate hydrogen atom by the adenosyl fragment to form 5'-deoxyadenosine. In support of this proposal, a previous study demonstrated that the deamination of propanolamine by ethanolamine ammonia-lyase is accompanied by the reversible cleavage of the carbon-cobalt bond of the cofactor, with the production of 5'-deoxyadenosine (Babior, B.M., Carty, T.J., and Abeles, R.H. (1974) J. Biol. Chem. 249, 1689-1695). The present study is concerned with the origin of the third hydrogen atom on the methyl group of the 5'-deoxyadenosine produced in that reaction. The 5'-deoxyadenosine isolated from an incubation mixture initially containing enzyme, [5',5'-D2]adenosylcobalamin, and [1,1-D2]propanolamine was chemically degraded so that the 4' and 5' carbon atoms were, respectively, converted to the carbonyl and methyl carbons of acetaldehyde. Analysis of the p-nitrophenylhydrazone of the acetaldehyde by gas-liquid chromatography-mass spectroscopy revealed 3 deuterium atoms/molecule, indicating that two of the methyl hydrogens originated from adenosylcobalamin and the third was donated by substrate. This observation provides further support for the participation of 5'-deoxyadenosine in the mechanism of adenosylcobalamin-dependent reactions.  (+info)

Cloning and characterization of the pnb genes, encoding enzymes for 4-nitrobenzoate catabolism in Pseudomonas putida TW3. (5/224)

Pseudomonas putida strain TW3 is able to metabolize 4-nitrotoluene via 4-nitrobenzoate (4NBen) and 3, 4-dihydroxybenzoic acid (protocatechuate [PCA]) to central metabolites. We have cloned, sequenced, and characterized a 6-kbp fragment of TW3 DNA which contains five genes, two of which encode the enzymes involved in the catabolism of 4NBen to PCA. In order, they encode a 4NBen reductase (PnbA) which is responsible for catalyzing the direct reduction of 4NBen to 4-hydroxylaminobenzoate with the oxidation of 2 mol of NADH per mol of 4NBen, a reductase-like enzyme (Orf1) which appears to have no function in the pathway, a regulator protein (PnbR) of the LysR family, a 4-hydroxylaminobenzoate lyase (PnbB) which catalyzes the conversion of 4-hydroxylaminobenzoate to PCA and ammonium, and a second lyase-like enzyme (Orf2) which is closely associated with pnbB but appears to have no function in the pathway. The central pnbR gene is transcribed in the opposite direction to the other four genes. These genes complete the characterization of the whole pathway of 4-nitrotoluene catabolism to the ring cleavage substrate PCA in P. putida strain TW3.  (+info)

A novel interaction of the Golgi complex with the vimentin intermediate filament cytoskeleton. (6/224)

The integration of the vimentin intermediate filament (IF) cytoskeleton and cellular organelles in vivo is an incompletely understood process, and the identities of proteins participating in such events are largely unknown. Here, we show that the Golgi complex interacts with the vimentin IF cytoskeleton, and that the Golgi protein formiminotransferase cyclodeaminase (FTCD) participates in this interaction. We show that the peripherally associated Golgi protein FTCD binds directly to vimentin subunits and to polymerized vimentin filaments in vivo and in vitro. Expression of FTCD in cultured cells results in the formation of extensive FTCD-containing fibers originating from the Golgi region, and is paralleled by a dramatic rearrangements of the vimentin IF cytoskeleton in a coordinate process in which vimentin filaments and FTCD integrate into chimeric fibers. Formation of the FTCD fibers is obligatorily coupled to vimentin assembly and does not occur in vim(-/-) cells. The FTCD-mediated regulation of vimentin IF is not a secondary effect of changes in the microtubule or the actin cytoskeletons, since those cytoskeletal systems appear unaffected by FTCD expression. The assembly of the FTCD/vimentin fibers causes a coordinate change in the structure of the Golgi complex and results in Golgi fragmentation into individual elements that are tethered to the FTCD/vimentin fibers. The observed interaction of Golgi elements with vimentin filaments and the ability of FTCD to specifically interacts with both Golgi membrane and vimentin filaments and promote their association suggest that FTCD might be a candidate protein integrating the Golgi compartment with the IF cytoskeleton.  (+info)

Quantitative measurement of the course of bean callus differentiation. (7/224)

Two strains of callus have been isolated from bean hypocotyl and grown on a defined maintenance medium supplemented with 2 mg/l. 2:4-dichlorophenoxyacetic acid (2:4D) and 2% sucrose. Root initiation was observed in one strain and formation of nodules containing xylem and phloem in both strains after transfer to an induction medium supplemented with 1 mg/l. naphthyleneacetic acid, 0-2 mg/l. kinetin and 3% sucrose, after 3 transfers to maintenance medium. The number of nodules per gramme increased 10-fold between 6 and 12 days after transfer, and thereafter remained constant. Phenylalanine ammonia lyase (PAL) activity rose to a maximum value when the rate of nodule formation was greatest, and decreased after the maximum nodule concentration was reached. The final constant value for PAL activity was above that of callus grown on maintenance medium. Beta I leads to 3 glucan synthetase activity rose to a maximum 15 days after transfer, and then fell gradually to a level above that measured in callus on maintenance medium. Callus was transferred from maintenance medium after 3, 4, 5 and 6 transfers. The concentration of nodules after 21 days on induction medium decreased as the callus was kept in culture. No further differentiation could be induced after 6 transfers. The fall in nodule formation was paralleled by a decrease in PAL and betaI leads to 3 glucan synthetase activities measured 21 days after transfer.  (+info)

Methanococcus jannaschii generates L-proline by cyclization of L-ornithine. (8/224)

Cell extracts of Methanococcus jannaschii have been shown to readily convert L-ornithine to L-proline. This cyclization reaction proceeds with the loss of only the C-2 nitrogen, as has been documented for ornithine cyclodeaminase (EC 4.3.1.12). Since no gene homologous to that coding for ornithine cyclodeaminase is present in the genome of M. jannaschii, these results indicate that proline biosynthesis in M. jannaschii is accomplished by a previously unrecognized enzyme.  (+info)

4.3.1.1 Aspartate ammonia-lyase 4.3.1.2 Methylaspartate ammonia-lyase 4.3.1.3 Histidine ammonia-lyase 4.3.1.4 Formimidoyltetrahydrofolate cyclodeaminase 4.3.1.5 Transferred entry: 4.3.1.23, 4.3.1.24 and 4.3.1.25 4.3.1.6 Beta-alanyl-CoA ammonia-lyase 4.3.1.7 Ethanolamine ammonia-lyase 4.3.1.8 Transferred entry: 2.5.1.61 4.3.1.9 Glucosaminate ammonia-lyase 4.3.1.10 Serine-sulfate ammonia-lyase 4.3.1.11 Deleted entry 4.3.1.12 Ornithine cyclodeaminase 4.3.1.13 Carbamoyl-serine ammonia-lyase 4.3.1.14 3-aminobutyryl-CoA ammonia-lyase 4.3.1.15 Diaminopropionate ammonia-lyase 4.3.1.16 Threo-3-hydroxy-L-aspartate ammonia-lyase 4.3.1.17 L-serine ammonia-lyase 4.3.1.18 D-serine ammonia-lyase 4.3.1.19 Threonine ammonia-lyase 4.3.1.20 Erythro-3-hydroxy-L-aspartate ammonia-lyase 4.3.1.21 Transferred entry: 4.3.1.9 4.3.1.22 3,4-dihydroxyphenylalanine reductive deaminase 4.3.1.23 Tyrosine ammonia-lyase 4.3.1.24 Phenylalanine ammonia-lyase 4.3.1.25 Phenylalanine/tyrosine ammonia-lyase 4.3.1.26 Transferred entry: ...
TY - JOUR. T1 - Discovery of a Substrate Selectivity Switch in Tyrosine Ammonia-Lyase, a Member of the Aromatic Amino Acid Lyase Family. AU - Watts, Kevin T.. AU - Mijts, Benjamin N.. AU - Lee, Pyung Cheon. AU - Manning, Andrew J.. AU - Schmidt-Dannert, Claudia. N1 - Funding Information: The authors gratefully acknowledge Dr. Gordon Louie and Dr. Joseph Noel (Salk Institute) for the communication of their TAL structural data immediately prior to publication. The authors also acknowledge Dr. Yuk Yin Sham for assistance with TAL modeling. This investigation has been supported by a grant from the David and Lucile Packard Foundation (grant 2001-18996). K.T.W. was supported by an NIGMS/NIH Biotechnology Training Grant (T32 GM08347) and the University of Minnesota Presidential Initiative on Biocatalysis. PY - 2006/12. Y1 - 2006/12. N2 - Tyrosine ammonia-lyase (TAL) is a recently described member of the aromatic amino acid lyase family, which also includes phenylalanine (PAL) and histidine ...
Kwiatkowski, M, Wang, J, Forster, A C. Manuscript in preparation on improved synthesis of unnatural aminoacyl-tRNAs. Gynnå, A H, Gullberg, E, Forster, A C. Generalizable tailoring of inhibition and fitness costs of artificial small RNAs in E. coli. Submitted. AD Edlund, S Jamal, H Elofsson, P Yuen, K Dyrhage, E Marklund, J Liljeruhm, M Nissbeck, A Gynnå, C Ahlström, L Alexis, N Anlind, AA Avalos, A Berglund, M Bergman, M Beyan, V Blomkvist, M Borg, F Boström, K Braesch-Andersen, L Bransell, J Brisvåg, P Cederberg, S Ciftci, T Dalmo, P Danielsson, C Frisk, H Gavali, SMR Gunja, A Gustafsson, S Herman, K Holdar, M Hong, K Ivermark, J Karlsson, K Lundmark, J Lövgren, T Löwe, O Nordesjö, A Nyberg, L Pello-Esso, L Pettersson, A Saffari, N Sandberg, CO Sidibeh, V Sjöstedt, J Spaak, A Srivastava, M Strandgren, L Sun, V Törnblom, E Vu, A Wirtanen, C Wärn, J Ås, C Östlin, G Johansson, A Virtanen, AC Forster, ER Lundin and E Gullberg. Optimizing chromoproteins and tyrosine ammonia-lyase for ...
Plasmid C321 from Dr. George Churchs lab contains the insert Recoded E. coli genome with all instances of the UAG codon removed, but wild type UAG termination function is not changed and is published in Science. 2013 Oct 18;342(6156):357-60. doi: 10.1126/science.1241459. This plasmid is available through Addgene.
Plasmid C5V from Dr. Steven Vogels lab contains the insert Cerulean-5-Venus and is published in Biophys J. 2006 Dec 15. 91(12):L99-L101. This plasmid is available through Addgene.
NIH Rare Diseases : 50 glutamate formiminotransferase deficiency is an inheritedmetabolic disorder that affects physical and mental development. there are two forms of this condition, a mild form and a severe form. people with the mild form have minor delays in physical and mental development and may have mild intellectual disability. they also have unusually high levels of a molecule called formiminoglutamate (figlu) in their urine. individuals with the severe form have profound intellectual disability, delayed development of motor skills (sitting, standing, and walking) and megaloblastic anemia. in addition to figlu in their urine, they have elevated amounts of certain b vitamins (called folates) in their blood. glutamate formiminotransferase deficiency is caused by mutations in the ftcd gene. it is inherited in an autosomal recessive pattern. there are currently no treatments known to prevent or delay the signs and symptoms of glutamate formiminotransferase deficiency. last updated: 8/10/2016 ...
Looking for online definition of ammonia-lyases in the Medical Dictionary? ammonia-lyases explanation free. What is ammonia-lyases? Meaning of ammonia-lyases medical term. What does ammonia-lyases mean?
The loss of morphogenetic potential in bean suspension cultures has been investigated by measuring the amounts of phenylalanine ammonia-lyase activity induced in the cells when they are transferred from a medium in which they are grown and maintained to an induction medium. The tissue has been grown …
GLUTAMATE FORMIMINOTRANSFERASE DEFICIENCY description, symptoms and related genes. Get the complete information in our medical search engine for pheno
Shop Histidine ammonia-lyase ELISA Kit, Recombinant Protein and Histidine ammonia-lyase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Ornithine cyclodeaminase (OCD) is an NAD+-dependent deaminase that is found in bacterial species such as Pseudomonas putida. Importantly, it catalyzes the direct conversion of the amino acid L-ornithine to L-proline. Using molecular dynamics (MD) and a hybrid quantum mechanics/molecular mechanics (QM/MM) method in the ONIOM formalism, the catalytic mechanism of OCD has been examined. The rate limiting step is calculated to be the initial step in the overall mechanism: hydride transfer from the L-ornithines Cα-H group to the NAD+ cofactor with concomitant formation of a Cα=NH2+ Schiff base with a barrier of 90.6 kJ mol−1. Importantly, no water is observed within the active site during the MD simulations suitably positioned to hydrolyze the Cα=NH2+ intermediate to form the corresponding carbonyl. Instead, the reaction proceeds via a non-hydrolytic mechanism involving direct nucleophilic attack of the δ-amine at the Cα-position. This is then followed by cleavage and loss of the α-NH2 group to give
1AH5: Determination of the structure of seleno-methionine-labelled hydroxymethylbilane synthase in its active form by multi-wavelength anomalous dispersion.
American Phytopathological Society Board & Staff. VIEW ABSTRACT , VIEW ARTICLE The Relationship Between Glycoalkaloids and Disease Resistance in Potatoes. J. A. Frank, J. M. Wilson, and R. E. Webb. Pages 1045-1049. VIEW ABSTRACT , VIEW ARTICLE Levels of Chlorogenic Acid in Tobacco Cultivars, Healthy and Infected with Thielaviopsis basicola. S. K. Gayed, Nestor Rosa. Pages 1049-1053. VIEW ABSTRACT , VIEW ARTICLE On Exclusion as the Mechanism of Ozone Resistance in Virus-Infected Plants. Eileen Brennan. Pages 1054-1055. VIEW ABSTRACT , VIEW ARTICLE Attempts to Use Satellite Data to Detect Vegetative Damage and Alteration Caused by Air and Soil Pollutants. E. L. Fritz, S. P. Pennypacker. Pages 1056-1060. VIEW ABSTRACT , VIEW ARTICLE , VIEW ERRATUM Types of Germination and Differentiation of Vesicles by Basidiospores of Cronartium ribicola. Everett M. Hansen, Robert F. Patton. Pages 1061-1071. VIEW ABSTRACT , VIEW ARTICLE Phenylalanine Ammonia-lyase, Tyrosine Ammonia-lyase, and Lignin in Wheat ...
Porphobilinogen deaminase (also known as hydroxymethylbilane synthase, EC 2.5.1.61 ) functions during the second stage of tetrapyrrole biosynthesis. This enzyme catalyses the polymerisation of four PBG molecules into the tetrapyrrole structure, preuroporphyrinogen, with the concomitant release of four molecules of ammonia. This enzyme uses a unique dipyrro-methane cofactor made from two molecules of PBG, which is covalently attached to a cysteine side chain. The tetrapyrrole product is synthesized in an ordered, sequential fashion, by initial attachment of the first pyrrole unit (ring A) to the cofactor, followed by subsequent additions of the remaining pyrrole units (rings B, C, D) to the growing pyrrole chain [ (PUBMED:11215515) ]. The link between the pyrrole ring and the cofactor is broken once all the pyrroles have been added. This enzyme is folded into three distinct domains that enclose a single, large active site that makes use of an aspartic acid as its one essential catalytic residue, ...
Kwiatkowski, M, Wang, J, Forster, A C. Manuscript in preparation on improved synthesis of unnatural aminoacyl-tRNAs. Edlund, A, Jamal, S, Elofsson, H, Yuen, P, Dyrhagen, K, Marklund, E, Liljeruhm, J, Nissbeck, M, Gynnå, A, Ahlström, C, Alexis, L, Anlind, N, Ascue Avalos, G A, Berglund, A, Bergman, M, Beyan, M, Blomkvist, V, Borg, M, Boström, F, Braesch-Andersen, K, Bransell, L, Brisvåg, J, Cederberg, P, Ciftci, S, Dalmo, T, Danielsson, P, Frisk, C, Gavali, H, Gunja, S, Gustafsson, A, Herman, S, Holdar, K, Hong, M, Karlsson, J, Lundmark, K, Löwe, T, Nordsjö, O, Nyberg, A, Pello-Esso, L, Pettersson, L, Saffari, A, Sandberg, N, Sidibeh, C, Sjöstedt, V, Spaak, J, Srivastava, A, Strandgren, M, Sun, L, Törnblom, V, Vu, E, Wirtanen, A, Wärn, C, Ås, J, Östlin, C, Virtanen, A, Forster, A C, Lundin, E, Gullberg, E. Optimizing chromoproteins and tyrosine ammonia-lyase for use in Escherichia coli. Under revision for ACS Synthetic Biology. Liljeruhm, J, Gullberg, E, Forster A C. Synthetic biology: ...
Human formiminotransferase cyclodeamidase (FTCD) is an approximately 60 kDa, liver specific, bifunctional enzyme, involved in both histidine and folate metabolism. It is identical with the so-called liver cytosol type 1 antigen (LC1), and has been reported to oligomerize in the cytoplasm. DIARECT™ antigens are for further manufacturing or research use only. ...
Phenylpropanoid derivatives are a complex class of secondary metabolites that have many important roles in plants during normal growth and in responses to environmental stress. Phenylalanine ammonialyase (PAL) catalyzes the first step in the biosynthesis of phenylpropanoids, and is usually encoded b …
Porphobilinogen deaminase mutants that cause acute intermittent porphyria have been investigated as recombinant proteins expressed in Escherichia coli, yielding important insight into the mechanism of dipyrromethane cofactor assembly and tetrapyrrole chain polymerization. A mutation that affects a key catalytic residue, D99G, results in an inactive holo-protein that exists as a complex with two substrate molecules covalently bound to the dipyrromethane cofactor arising from the reaction between the apo-protein and pre-uroporphyrinogen. The R149Q mutant is also devoid of catalytic activity but the mutant protein is unable to assemble the dipyrromethane cofactor from pre-uroporphyrinogen and persists as an unstable, heat-labile apo-protein. The mutant, R173Q, has very low activity and, like R149Q, also exhibits largely as an apo-protein. The inability to reconstitute either R149Q or R173Q with exogenous pre-uroporphyrinogen confirms the importance of these two arginine residues for dipyrromethane ...
TY - JOUR. T1 - Microbial aspartase and its activity on deamination of L-aspartyl-L-phenylalanine methyl ester. AU - Chung, Wonyoon. AU - Goo, Yang Mo. PY - 1988/6. Y1 - 1988/6. N2 - Examination of many microorganisms and soil isolates for the activity of aspartase proved that R. rubra, G. suboxydans, A. versicolor, P. purpurogenum, E. coli, Ps. aeruginosa, A. gigantus, A. unguis, A. parasiticus and a soil isolate(S-90) had high activity of aspartase. Comparision of the activity of the aspartase by cell free extracts of these micro-organisms with the activity of the enzyme catalyzing the deamination of aspartame by the same cell free extracts showed similar kinetic characteristics. The aspartase existing in the cell free extracts seemed to catalyze the deamination of aspartame, too.. AB - Examination of many microorganisms and soil isolates for the activity of aspartase proved that R. rubra, G. suboxydans, A. versicolor, P. purpurogenum, E. coli, Ps. aeruginosa, A. gigantus, A. unguis, A. ...
SARAH J. AWAN, GIULIANO SILIGARDI, MARTIN J. WARREN, PETER M. SHOOLINGIN-JORDAN; Discovery of a novel mechanism for cofactor assembly by Escherichia coli porphobilinogen deaminase. Biochem Soc Trans 1 February 1997; 25 (1): 79S. doi: https://doi.org/10.1042/bst025079s. Download citation file:. ...
Epithelial and fibroblast cells were obtained from cultures of amniotic fluid cells. Epithelial cells demonstrated high activities of histidase. In contrast, histidase activity was not detected in fibroblasts derived from the same original culture. This observation indicates that cultures of amniotic fluid cells consist of cells with different biochemical properties as well as morphological characteristics. ...
The nucleotide sequences of two segments of DNA (2250 and 2921 base-pairs) containing the functionally related fumarase (fumC) and aspartase (aspA) genes of Escherichia coli K12 were determined. The fumC structural gene comprises 1398 base-pairs (466 codons, excluding the initiation codon), and it encodes a polypeptide of Mr 50353 that resembles the fumarases of Bacillus subtilis 168 (citG-gene product), rat liver and pig heart. The fumC gene starts 140 base-pairs downstream of the structurally-unrelated fumA gene, but there is no evidence that both genes form part of the same operon. The aspA structural gene comprises 1431 base-pairs (477 codons excluding the initiation codon), and it encodes a polypeptide of Mr 52190, similar to that predicted from maxicell studies and for the enzyme from E. coli W. Remarkable homologies were found between the primary structures of the fumarase (fumC and citG) and aspartase (aspA) genes and their products, suggesting close structural and evolutionary ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Gene target information for HEM3 - hydroxymethylbilane synthase (Saccharomyces cerevisiae S288C). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Porphobilinogen Deaminase; Catalyzes The Conversion Of 4-porphobilinogen To Hydroxymethylbilane, The Third Step In Heme Biosynthesis; Localizes To The Cytoplasm And Nucleus; Expression Is Regulated By Hap2p-Hap3p, But Not By Levels Of Heme
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Japanese green tea cultivars and 463 local tea plants including mountainous tea, yama-cha, were analyzed to determine the process of differentiation of Jap
Find Out How Many Calories Are In Rold Gold Tiny Twists Snack Bag, Good or Bad Points and Other Nutrition Facts about it. Take a look at Rold Gold Tiny Twists Snack Bag related products and other millions of foods.
phenylalanine ammonia-lyase [putative phenylalanine ammonia lyase EncP] ATGACCTTCGTCATAGAGCTCGACATGAACGTCACGCTCGACCAACTTGAGGACGCGGCG CGACAGCGCACGCCCGTGGAGCTGTCCGCACCCGTCCGCTCCCGCGTCCGCGCCTCGCGC GACGTGTTGGTGAAGTTCGTGCAGGACGAACGTGTCATCTACGGGGTCAACACCAGCATG GGGGGCTTCGTCGACCACCTCGTCCCGGTGTCCCAGGCCCGGCAGCTCCAGGAGAACCTG ATCAACGCGGTCGCCACCAACGTGGGGGCGTATCTGGACGACACGACCGCCCGGACCATC ATGCTGTCCCGCATCGTGTCGCTGGCGCGCGGGAACTCCGCGATCACCCCGGCGAATCTG GACAAGCTGGTGGCCGTACTCAACGCCGGGATCGTGCCGTGCATCCCGGAGAAGGGCTCT TTGGGCACCAGCGGTGACCTCGGCCCGCTGGCCGCGATCGCCCTGGTGTGCGCGGGGCAG TGGAAGGCCCGCTACAACGGTCAGATCATGCCCGGGCGGCAGGCCCTGTCCGAGGCCGGC GTCGAGCCGATGGAGCTGAGCTACAAGGATGGCCTGGCCCTGATCAACGGCACGTCAGGC ATGGTCGGCCTGGGCACCATGGTCCTCCAGGCCGCGCGCCGGCTCGTGGACCGCTACCTG CAGGTGTCCGCGTTGTCGGTCGAGGGCCTGGCAGGCATGACGAAACCGTTCGACCCTCGC GTGCACGGCGTCAAGCCGCACCGCGGGCAGCGTCAGGTGGCCTCGCGGTTGTGGGAGGGG CTTGCCGACTCGCACCTGGCGGTCAACGAACTGGACACCGAGCAGACCCTGGCCGGAGAG ATGGGCACGGTCGCCAAGGCCGGTTCGCTGGCGATCGAGGACGCCTACTCCATCCGGTGC ...
Trade leads from 3,7-dihydro-1,3-dimethyl-1H-purine-2,6-dione, compound with 1-aminopropan-2-ol (1:1) exporters and 3,7-dihydro-1,3-dimethyl-1H-purine-2,6-dione, compound with 1-aminopropan-2-ol (1:1) suppliers provided by ChemNet.com
ASPA兔多克隆抗体(ab97454)可与人样本反应并经WB, IP, IHC, ICC/IF实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
Photo/image Capillary Thread-moss (Bryum capillare), Family: Bryaceae. Location Buderupholm Bjergskov, Rold Skov, Jylland, Danmark. Photographer: JC Schou, Photoid 54728
PBGD_ : The porphyrias are a group of inherited disorders resulting from enzyme defects in the heme biosynthetic pathway. Acute intermittent porphyria (AIP) is caused by diminished erythrocyte activity of porphobilinogen deaminase (PBGD), also known as uroporphyrinogen I synthase or hydroxymethylbilane synthase. Onset of AIP typically occurs during puberty or later. Individuals may experience acute episodes of neuropathic symptoms. Common symptoms include severe abdominal pain, peripheral neuropathy, and psychiatric symptoms. Crises may be precipitated by a broad range of medications (including barbiturates and sulfa drugs), alcohol, infection, starvation, heavy metals, and hormonal changes. AIP is inherited in an autosomal dominant manner. At-risk family members of patients with a biochemical diagnosis of AIP should undergo appropriate testing. Timely diagnosis is important as acute episodes of AIP can be fatal. Treatment of AIP includes the prevention of symptoms through avoidance of precipitating
TY - JOUR. T1 - Asymptomatic erythrocyte disorder presenting as increased porphobilinogen deaminase and uroporphyrinogen decarboxylase.. AU - Anderson, Karl. AU - Goeger, D. E.. AU - Bessman, J. D.. PY - 1995/11. Y1 - 1995/11. UR - http://www.scopus.com/inward/record.url?scp=0029410609&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=0029410609&partnerID=8YFLogxK. M3 - Article. C2 - 7586564. AN - SCOPUS:0029410609. VL - 41. SP - 1670. JO - Clinical Chemistry. JF - Clinical Chemistry. SN - 0009-9147. IS - 11. ER - ...
In enzymology, a dihydroxyphenylalanine ammonia-lyase (EC 4.3.1.11) is an enzyme that catalyzes the chemical reaction 3,4-dihydroxy-L-phenylalanine ⇌ {\displaystyle \rightleftharpoons } trans-caffeate + NH3 Hence, this enzyme has one substrate, 3,4-dihydroxy-L-phenylalanine (L-DOPA), and two products, trans-caffeate and NH3. This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic name of this enzyme class is 3,4-dihydroxy-L-phenylalanine ammonia-lyase (trans-caffeate-forming). Other names in common use include beta-(3,4-dihydroxyphenyl)-L-alanine (DOPA) ammonia-lyase, and 3,4-dihydroxy-L-phenylalanine ammonia-lyase. This enzyme participates in tyrosine metabolism. MacLeod NJ; Pridham JB (1963). Deamination of beta-(3,4-dihydroxyphenyl)-L-alanine by plants. Biochem. J. 88 (1): 45-52. PMC 1203845 . PMID 16749027. Molecular and Cellular Biology ...
Shop Aspartate ammonia-lyase ELISA Kit, Recombinant Protein and Aspartate ammonia-lyase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Funded by the NIH National Center for Advancing Translational Sciences through its Clinical and Translational Science Awards Program, grant number UL1TR002541 ...
Khaw, L.E., Bohm, G.A., Metcalfe, S., Staunton, J. and Leadlay, P.F. (1998). „Mutational biosynthesis of novel rapamycins by a strain of Streptomyces hygroscopicus NRRL 5491 disrupted in rapL, encoding a putative lysine cyclodeaminase. J. Bacteriol. 180: 809-814. PMID 9473033 ...
Directors Ezequiel Torres and Pablo Roldán at Buenos Aires studio Rudo Company create a rush of animated mania for Argentinian band SIAMES.
Axon is a Brutal Death Metal band from Mexico. Discography: Dominant, Leper Viper, War Anthems. Line-up: Herbert Baéz Calderón, Luis Hernández Roldán, Raymundo Hernández Roldán.
EaseChem provides information about Z-(4-tert-butyloxycarbonyl)-L-phenylalanine, Z-(4-tert-butyloxycarbonyl)-L-phenylalanine, CAS No.: 270567-85-6.,Z-(4-tert-butyloxycarbonyl)-L-phenylalanine
Parsley was used as far back as the times of Hippocrates as a medicine believed to help rheumatism, relieve kidney pains, and improve general health
Nasdaq DM ASPA Ex Japan Large Cap Index Net Total Return Index im Überblick: Aktuelle Kurse (Realtimekurs), Chart, Nachrichten und Diskussionen zum Nasdaq DM ASPA Ex Japan Large Cap Index Net Total Return (NQDMASPAXJPL)
[117 Pages Report] Check for Discount on United States L-Phenylalanine Market Report 2016 report by QYResearch Group. Notes: Sales, means the sales volume of L-Phenylalanine Revenue,...
L-Phenylalanine,N-[(1,1-dimethylethoxy)carbonyl]-N-methyl-4-nitro-/ACM70663568 can be provided in Alfa Chemistry. We are dedicated to provide our customers the best products and services.
Now Foods L-Phenylalanine is a natural supplement to promote fat burning and improving mood by reducing stress. Contain 60 capsules of 500 mg.
Links to sites outside of Pfizer Medical Information are provided as a resource to the viewer. This third-party website is neither owned nor controlled by Pfizer, and Pfizer does not endorse and is not responsible for the content or services of this site. ...
Acute intermittent porphyria (AIP) is a condition that can cause sudden, severe attacks of stomach pain that may last for a days to weeks. It is called a porphyria because substances called porphyrins build up in the body and can cause the symptoms. Porphyrins are normally used by the body to help cells use oxygen. In AIP, people may also experience mental changes in attacks of acute intermittent porphyria that can include insomnia or difficulty sleeping, anxiety, depression, hallucinations, confusion, paranoia, and amnesia or memory loss.. To understand more about AIP from someone who has the condition, watch this video from the American Porphyria Foundation.. ...
We report a case of early onset recurrent preeclampsia in a patient with positive family history of preeclampsia and a newly discovered acute intermittent porphyria. A 28 years old patient was admitted to our Clinic, due to early onset of preeclampsia in her third pregnancy. She had refractory hypertension with tachycardia, facial flush, anxiety and difficulty in breathing. During hospitalization, she reported occurrence of opalescent orange to reddish morning urine, which turned dark after a while. The dipstick test revealed positive urobilinogen in the urine. The same sample of urine was tested for porphobilinogens in the urine (by the use of Ehrlichs reagent) which were found positive and also porphyrins which were found negative; therefore, her medication was switched to a beta blocker. She decided to terminate pregnancy and this was done in the next few days by the use of anesthetics that are approved for acute intermittent porphyria. At her check up one month after delivery, her blood ...
Looking for online definition of dihydroxyphenylalanine ammonia-lyase in the Medical Dictionary? dihydroxyphenylalanine ammonia-lyase explanation free. What is dihydroxyphenylalanine ammonia-lyase? Meaning of dihydroxyphenylalanine ammonia-lyase medical term. What does dihydroxyphenylalanine ammonia-lyase mean?
Acute Intermittent porphyria (AIP) is a rare genetic disease which is caused by mutations in the porphobilinogen deaminase (PBGD) gene; one of the enzymes of the heme biosynthesis pathway. Mutations in this gene cause insufficient activity of the protein resulting in partially disruption of heme synthesis. This in turn leads to accumulation of toxic intermediates (ALA and PBG) giving rise to a wide variety of problems including acute, severe abdominal pains, psychiatric and neurological disorders, and muscular weakness. Acute porphyric attacks can be life-threatening and the long-term consequences include irreversible nerve damage, liver cancer and kidney failure. Currently, the only curative therapy is liver transplantation and thus, new curative options are urgently needed. Severe AIP patients are suffering poor quality of life with palliative treatments for the different symptoms including glucose or heme infusions for metabolic replacement and inhibition of toxic metabolic production.. About ...
Scientists within the European research project AIPgene have developed a new gene therapy for Acute Intermittent Porphyria (AIP).
A genetic survey which was carried out on 11 affected families with acute intermittent porphyria (AIP) confirmed autosomal dominant mode of transmission.
TY - JOUR. T1 - Acute intermittent porphyria.. AU - Anderson, Karl. AU - Sassa, S.. AU - Kappas, A.. PY - 1981/12. Y1 - 1981/12. UR - http://www.scopus.com/inward/record.url?scp=0019743244&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=0019743244&partnerID=8YFLogxK. M3 - Article. C2 - 7305168. AN - SCOPUS:0019743244. VL - 95. SP - 784. EP - 785. JO - Annals of Internal Medicine. JF - Annals of Internal Medicine. SN - 0003-4819. IS - 6. ER - ...
So Alone : A true, personal story from the experience, I Have Acute Intermittent Porphyria. As I lay here wondering how my life went from perfect ( for me) to this! How did I go from an able bodied mom and wife? I worked, cleaned and had dinner on the table when my husband got home. I was th...
Acute intermittent porphyria may present with symptoms and signs such as recurrent intermittent abdominal pain, peripheral neuropathy, hyporeflexia, hallucinations and blurred vision as well as neuropsychiatric signs.
Phenylalanine ammonia lyase (EC 4.3.1.24) is an enzyme that catalyzes a reaction converting L-phenylalanine to ammonia and trans-cinnamic acid. Phenylalanine ammonia lyase (PAL) is the first and committed step in the phenyl propanoid pathway and is therefore involved in the biosynthesis of the polyphenol compounds such as flavonoids, phenylpropanoids, and lignin in plants. Phenylalanine ammonia lyase is found widely in plants, as well as some yeast and fungi, with isoenzymes existing within many different species. It has a molecular mass in the range of 270-330 kDa. The activity of PAL is induced dramatically in response to various stimuli such as tissue wounding, pathogenic attack, light, low temperatures, and hormones. PAL has recently been studied for possible therapeutic benefits in humans afflicted with phenylketonuria. It has also been used in the generation of L-phenylalanine as precursor of the sweetener aspartame. The enzyme is a member of the ammonia lyase family, which cleaves ...
The amino acid histidine, when catalyzed by the enzyme histidase, forms urocanic acid. Disruptions in this pathway, caused by a deficiency of histidase, is the underlying cause of histidinemia. This results in reduced levels of skin and serum urocanic acid, the primary indicator of insufficient histidase activity. In urocanic aciduria, increased urocanic acid in the urine indicates a deficiency of the enzyme urocanase. This enzyme breaks down urocanic acid, forming formininoglutamic acid, and also forms imidazolonepropionic acid from trans-urocanic acid. With normal to only slightly elevated levels of histidine present in the liver during urocanic aciduria, the only true metabolic indicator of the disorder can be found in the urine.[2] ...
Urocanic acid is a cinnamic acid-like compound formed by the decarboxylation of histidine by the enzyme, histidase. Urocanic acid is produced by a number of Bacillus, Streptomyces and other bacteria, but is also broadly found in microbial fermentations. Urocanic acid has weak activity in a diverse range of bioassays and is a useful standard for analytical and bioassay dereplication of crude microbial extracts ...
1. 3-Ethyl-5-hydroxy-4,5-dimethyl-Δ3-pyrrolin-2-one (HPL, mauve factor) was determined quantitatively in the urine of schizophrenic, general medical and porphyric subjects by a sensitive gas/liquid-chromatographic method using a nitrogen-specific detector.. 2. A comparative evaluation with previously used methods for HPL was made and some problems of specificity are discussed.. 3. The concentration of HPL in early morning and spot samples of urine from 146 subjects with schizophrenia was not greater than that in 42 general medical patients, contrary to previous reports.. 4. Of the three patients with acute intermittent porphyria, two excreted HPL. One subject, studied over a 2 year period, did so intermittently in a manner unrelated to her attacks of porphyria.. 5. It is concluded that the urine content of HPL is unlikely to be causally related to schizophrenia or to the clinical manifestations of acute intermittent porphyria. ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
SWISS-MODEL Repository entry for A0LN73 (HEM3_SYNFM), Porphobilinogen deaminase. Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Urocanic acid Urocanic acid IUPAC name 3-(3H-imidazol-4-yl)prop-2-enoic acid Identifiers CAS number 104-98-3 PubChem 1178 MeSH Urocanic+acid SMILES
Posted on September 2, 2013 by Ivan Gary The report firstly introduced L-Phenylalanine basic information included definition classification application industry chain structure industry overview; international market analysis, Global and China domestic market analysis, Macroeconomic environment and economic situation analysis and influence, L-Phenylalanine Industry policy and plan, L-Phenylalanine product specification, manufacturing process, product cost structure etc.. Browse Complete Report with TOC: http://www.qyresearchreports.com/report/global-and-china-l-phenylalanine-industry-2013-market-research-report.htm. Then statistics Global and China key manufacturers L-Phenylalanine capacity production cost price profit production value gross margin etc details information, at the same time, statistics these manufacturers L-Phenylalanine products customers application capacity market position information etc company related information, then collect all these manufacturers data and listed Global ...
Read the latest L-Phenylalanine 500 mg by Source Naturals reviews and find the latest results, side effects and user experiences from eVitamins. Have you taken L-Phenylalanine 500 mg by Source Naturals? Submit your own L-Phenylalanine 500 mg review and let the world know what you think. United Kingdom
4-(Trifluoromethyl)-L-phenylalanine chemical properties, What are the chemical properties of 4-(Trifluoromethyl)-L-phenylalanine 114926-38-4, What are the physical properties of 4-(Trifluoromethyl)-L-phenylalanine ect.
Buy L-Phenylalanine Powder - Nootropics Depot is the #1 most trusted source for high quality L-Phenylalanine Powder. Read reviews, learn uses and benefits. 10% off first order
Vitadigest.com offer top selection of l-phenylalanine, big blend, l tyrosine, l arginine, amino, tyrosine, dietary supplement, nutrition
Information of L-Phenylalanine. L-Phenylalanine essential amino acid is classified as neutral and nonpolar because of the inert and hydrophobic.
Human ASPA Partial ORF (NP_000040, 1 a.a. - 100 a.a.) Recombinant Protein with GST-tag at N-terminal, Abnova; For use in AP, Array, ELISA, WB-Re Shop Abnova™ Human
Видеокамера предназначена для преобразования оптического изображения, создаваемого эндоскопом при всех видах эндоскопических исследований и операций, в полный телевизионный сигнал цветного изображения в системе PAL. Камерная головка видеокамеры снабжена объективом с переменным фокусным расстоянием. Видеокамера оснащена встроенным блоком питания, предназначенным для подключения светодиодного осветителя в вариантах его исполнения ...
Conn researched phenylalanine ammonia-lyase and cyanogenic glycosides. In 1988, he was elected to the National Academy of ...
Wanner, L.A.; Ware, D.; Somssich, I.E.; Davis, K.R. (1995). "The phenylalanine ammonia-lyase gene family in Arabidopsis ...
Phenylalanine is first converted to cinnamic acid by the action of the enzyme phenylalanine ammonia-lyase (PAL). Some plants, ... "Role of bifunctional ammonia-lyase in grass cell wall biosynthesis". Nat. Plants. 2: 16050. doi:10.1038/nplants.2016.50. PMID ... use tyrosine to synthesize p-coumaric acid by the action of the bifunctional enzyme Phenylalanine/tyrosine ammonia-lyase (PTAL ...
Phenylalanine ammonia lyase as a precursory enzyme of legume stem lignification. Can. J. Plant Sci. 75:135-140. Bidlack, J.E., ... Arthropod population, phenylalanine ammonia lyase activity, and fresh weight of sweet basil (Ocimum basilicum) as affected by ... Phenylalanine ammonia lyase and syringaldazine oxidase activities in relation to lignin deposition in legumes. Recent Res. ...
Levy, Harvey L.; Sarkissian, Christineh N.; Stevens, Raymond C.; Scriver, Charles R. (June 2018). "Phenylalanine ammonia lyase ... Pegvaliase (Biomarin) - PEGylated recombinant phenylalanine ammonia-lyase for the treatment of Phenylketonuria, approved by the ...
... was long thought to be an important electrophilic catalytic residue in histidine ammonia-lyase and phenylalanine ammonia-lyase ... "Crystal structure of phenylalanine ammonia lyase: multiple helix dipoles implicated in catalysis". Biochemistry. 43 (36): 11403 ...
The enzyme histidine ammonia-lyase converts histidine into ammonia and urocanic acid. A deficiency in this enzyme is present in ... Overall, these reactions result in the formation of glutamate and ammonia. Glutamate can then be deaminated by glutamate ...
Kong, Jian-Qiang (2015-07-20). "Phenylalanine ammonia-lyase, a key component used for phenylpropanoids production by metabolic ... of cinnamaldehyde begins with deamination of L-phenylalanine into cinnamic acid by the action of phenylalanine ammonia lyase ( ...
Aspartic acid is produced by the addition of ammonia to fumarate using a lyase. In plants, nitrogen is first assimilated into ... For example, serine dehydratase converts serine to pyruvate and ammonia. After removal of one or more amino groups, the ... However, amino acid degradation can produce uric acid or ammonia instead. ... organic compounds in the form of glutamate, formed from alpha-ketoglutarate and ammonia in the mitochondrion. For other amino ...
Its biosynthesis involves the action of the enzyme phenylalanine ammonia-lyase (PAL) on phenylalanine. It is obtained from oil ...
Aspartic acid is produced by the addition of ammonia to fumarate using a lyase. Annigan, Jan. "How Many Amino Acids Does the ... In rich nitrogenous media or growth conditions containing high quantities of ammonia there is a low level of GS, whereas in ... This enzyme requires either glutamine as the amino group donor or ammonia itself. Anthranilate synthase is regulated by the ... Cystathionine-β-lyase (in mammals, this step is performed by homocysteine methyltransferase or betaine-homocysteine S- ...
Food portal Medicine portal Aspartame controversy Phenylalanine ammonia lyase Stevia Budavari S, ed. (1989). "861. Aspartame". ...
The second utilizes enzymatic synthesis from phenolics, pyruvate, and ammonia through the use of tyrosine phenol-lyase. ... Tyrosine ammonia lyase (TAL) is an enzyme in the natural phenols biosynthesis pathway. It transforms L-tyrosine into p-coumaric ...
L-tyrosine is converted to p-coumaric acid by the enzyme tyrosine ammonia lyase (TAL). From here, p-coumaric acid is converted ...
... is converted to cinnamic acid by the enzyme phenylalanine ammonia-lyase. The genetic disorder phenylketonuria ( ... In 1882, Erlenmeyer and Lipp first synthesized phenylalanine from phenylacetaldehyde, hydrogen cyanide, and ammonia. The ...
Phenylalanine Ammonia Lyase (PAL): From Discovery to Enzyme Substitution Therapy for Phenylketonuria. Molecular Genetics and ...
It is converted into Cinnamic acid (2) via phenylalanine ammonia lyase (PAL). Then it is turned into p-Coumaric acid (3) with ...
This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... and L-ornithine ammonia-lyase (cyclizing). This enzyme participates in arginine and proline biosynthesis. It employs one ... name of this enzyme class is L-ornithine ammonia-lyase (cyclizing; L-proline-forming). Other names in common use include ...
This enzyme belongs to the family of lyases, specifically ammonia lyases, which cleave carbon-nitrogen bonds. The systematic ... and 5-formimidoyltetrahydrofolate ammonia-lyase (cyclizing). This enzyme participates in folate metabolism by catabolising ... name of this enzyme class is 5-formimidoyltetrahydrofolate ammonia-lyase (cyclizing 5,10-methenyltetrahydrofolate-forming). ...
Weise's work in general is based on industrial biotechnology including the enzyme Phenylalanine Ammonia Lyases (PALs). In 2018 ... Nigel Scrutton in which via the combination of three biocatalyst classes (phenylalanine ammonia lyase, carboxylic acid ... Amino Acids Using a Combination of Phenylalanine Ammonia Lyase and Aminomutase Biocatalysts". Adv. Synth. Catal. 359 (9): 1570 ... He then continued to read for his Doctor of Philosophy degree on Discovery and Development of Class I Lyase-like Enzymes for ...
Ethanolamine is cleaved to ammonia and acetaldehyde through the action of ethanolamine-ammonia lyase, which also requires ... ethanolamine ammonia-lyase (EutBC) and the operon activator (EutR) compete for adenosyl-cobalamin in Salmonella typhimurium". ... "Crystal structure of the EutL shell protein of the ethanolamine ammonia lyase microcompartment". Proceedings of the National ... "Crystal Structures of Ethanolamine Ammonia-lyase Complexed with Coenzyme B12 Analogs and Substrates". Journal of Biological ...
Phenylalanine is first converted to cinnamic acid by the action of the enzyme phenylalanine ammonia-lyase (PAL). A series of ...
Aspartic acid is produced by the addition of ammonia to fumarate using a lyase. One of the oldest methods begins with the ... Ammonia is subsequently eliminated after the protonation of the amino group, and finally the deprotonation of a hydroxyl group ... Nucleophilic substitution with ammonia then converts the alkyl bromide to the amino acid. "dl-ALANINE". Organic Syntheses. 9: 4 ... By replacing ammonia with (S)-alpha-phenylethylamine as chiral auxiliary the ultimate reaction product was chiral alanine. ...
This work included the earliest experimental demonstration of the important enzyme phenylalanine ammonia-lyase, which regulates ...
L-phenylalanine then undergoes an elimination of the primary amine with Phenylalanine ammonia-lyase (PAL) to form cinnamate. ...
Cystathionine γ-lyase then converts this double amino acid to cysteine, ammonia, and α-ketobutyrate. Bacteria and plants rely ...
strain TAL1145 is a C-N lyase that catabolizes L-mimosine into 3-hydroxy-4-pyridone, pyruvate, and ammonia". Amino Acids. 44 (6 ... "A Carbon-Nitrogen Lyase from Leucaena leucocephala Catalyzes the First Step of Mimosine Degradation". Plant Physiology. 164 (2 ...
The first enzyme involved is phenylalanine ammonia-lyase (PAL) that converts L-phenylalanine to trans-cinnamic acid and ammonia ...
The phenylalanine undergoes a non-oxidative deamination by phenylalanine ammonia-lyase (PAL) to trans-cinnamic acid. Afterwards ... Enzymes such as ammonialyases, methylases and hydroxylases then transform these amino acids to cinnamic acid derivatives which ...
... to 4-coumaroyl-CoA in a series of steps known as the general phenylpropanoid pathway using phenylalanine ammonia-lyase, ...
He found that citrulline acted as a catalyst in the metabolic reactions of urea from ammonia and carbon dioxide. He and ... One was malate synthase, which condenses acetate with glyoxylate to form malate, and the other was isocitrate lyase, which ...
... histidine ammonia-lyase". http://www.ncbi.nlm.nih.gov/sites/entrez?Db=gene&Cmd=ShowDetailView&TermToSearch=3034. ...
A new pathway proposed suggests that phenylalanine first forms cinnamoyl-CoA via the enzymes phenylalanine ammonia-lyase and ... in that it uses anhydrous ammonia and lithium metal in the reaction. The second-most popular method uses red phosphorus and ...
20-lyase, 21-hydroxylase, or 11β-hydroxylase.[51] Since it is not aromatized (and hence cannot be transformed into an ... is synthesized by partial reduction of the aromatic region of the 3-O-methyl ether of estrone with lithium in liquid ammonia, ...
... which reacts with ammonia, forming glutamine and inorganic phosphate. ADP and Pi do not dissociate until ammonia binds and ... EC4 Lyases (list). *EC5 Isomerases (list). *EC6 Ligases (list). *EC7 Translocases (list) ... glutamate-ammonia ligase. Active site between two monomers of glutamine synthetase from Salmonella typhimurium. Cation binding ... Ammonium, rather than ammonia, binds to GS because the binding site is polar and exposed to solvent.[7] In the second step, ...
Carboxy phosphate reacts with ammonia to give carbamic acid. In turn, carbamic acid reacts with a second ATP to give carbamoyl ... The small subunit contains the glutamine binding site and catalyses the hydrolysis of glutamine to glutamate and ammonia, which ... The carboxylphosphate then reacts with ammonia to form carbamic acid, releasing inorganic phosphate. ... or ammonia (EC 6.3.4.16) and bicarbonate.[1] This enzyme catalyzes the reaction of ATP and bicarbonate to produce carboxy ...
The cystathionine is then converted to hypotaurine by the sequential action of three enzymes: cystathionine gamma-lyase, ... In the laboratory taurine can be produced by alkylation of ammonia with bromoethanesulfonate salts.[9] ...
Histidine ammonia-lyase. *Urocanate hydratase. *Formiminotransferase cyclodeaminase. proline→. *Proline oxidase. *Pyrroline-5- ...
The enzyme histidine ammonia-lyase converts histidine into ammonia and urocanic acid. A deficiency in this enzyme is present in ... these reactions result in the formation of glutamate and ammonia.[21] Glutamate can then be deaminated by glutamate ...
The ammonia generated by the glycine cleavage system, is assimilated by the Glutamine synthetase-Glutamine oxoglutarate ... HMG-CoA lyase. *HMG-CoA reductase. *Isovaleryl coenzyme A dehydrogenase. *α-Ketoisocaproate dioxygenase ... The H-protein forms a complex with the T-protein that uses tetrahydrofolate and yields ammonia and 5,10- ...
The first enzyme involved is phenylalanine ammonia-lyase (PAL) that converts L-phenylalanine to trans-cinnamic acid and ammonia ...
... ammonia lyase (TAL) is an enzyme in the natural phenols biosynthesis pathway. It transforms L-tyrosine into p-coumaric ... The second utilizes enzymatic synthesis from phenolics, pyruvate, and ammonia through the use of tyrosine phenol-lyase.[29] ...
Phenylalanine ammonia lyase. *Stevia. References[edit]. *^ Budavari S, ed. (1989). "861. Aspartame". The Merck Index (11th ed ...
The gene that encodes for Histidine ammonia-lyase (HAL) spans a roughly 25 kb and consists of 21 exons[4] located at the 12q22- ... the result of an inborn error of metabolism that may result in either an inactive or a severely reduced Histidine ammonia-lyase ...
MeSH Threonine+ammonia-lyase. *v. *r. *u. Proteini: enzimi. Teme. Aktivno mesto • Alosterna regulacija • Mesto vezivanja • ...
Histidine ammonia-lyase. *Urocanate hydratase. *Formiminotransferase cyclodeaminase. proline→. *Proline oxidase. *Pyrroline-5- ...
Category:EC 4.3 (carbon-nitrogen lyases)Edit. *Category:EC 4.3.1 *Phenylalanine ammonia-lyase (EC 4.3.1.24) ... Category:Lyases (EC 4) (Lyase)Edit. Category:EC 4.1 (carbon-carbon lyases)Edit. *Category:EC 4.1.1 *Ornithine decarboxylase (EC ... 4 Category:Lyases (EC 4) (Lyase) *4.1 Category:EC 4.1 (carbon-carbon lyases) ... Category:EC 4.4 (carbon-sulfur lyases)Edit. *Category:EC 4.4.1 *Cystathionine gamma-lyase ...
... phenylalanine ammonia lyase (PAL), cinnamate 4-hydroxylase (C4H), caffeic acid O-methyltransferase (COMT) and their function in ... phenylalanine ammonia lyase, cinnamate 4-hydroxylase, caffeic acid O-methyltransferase. Similar studies showed high ...
The most important process is the Andrussow oxidation invented by Leonid Andrussow at IG Farben in which methane and ammonia ... "Cyanogenesis in Cassava, The Role of Hydroxynitrile Lyase in Root Cyanide Production". Plant Physiology. 116 (4): 1219-1225. ... In the Shawinigan Process, hydrocarbons, e.g. propane, are reacted with ammonia. In the laboratory, small amounts of HCN are ... Andrussow, L. (1935). "The catalytic oxydation of ammonia-methane-mixtures to hydrogen cyanide". Angewandte Chemie. 48 (37): ...
Impurities cogenerated by this route include glycine and nitrilotriacetic acid; they arise from reactions of the ammonia ... N Lyase", Applied and Environmental Microbiology, 70 (7): 3941-3947, doi:10.1128/aem.70.7.3941-3947.2004, PMC 444814, PMID ... N lyase found in Agrobacterium tumefaciens (BY6), which can be harvested on a large scale. Additionally, the reactions ...
Histidine ammonia-lyase. *Urocanate hydratase. *Formiminotransferase cyclodeaminase. proline→. *Proline oxidase. *Pyrroline-5- ...
... into ammonia (NH3) which supplies the plant with nitrogen to make its amino acids and nucleotides.[158] ... "Subcellular Distribution of O-Acetylserine(thiol)lyase in Cauliflower (Brassica oleracea L.) Inflorescence". Plant Physiology ...
Biomarin is currently conducting clinical trials to investigate PEG-PAL (PEGylated recombinant phenylalanine ammonia lyase or ' ...
The acylenzyme is hydrolyzed by ammonia, displacing the enzyme and forming the amide product. Most nitrilases are made up of a ... Nitrilase should not be confused with nitrile hydratase (nitrile hydro-lyase; EC 4.2.1.84) which hydrolyses nitriles to amides ... The thioimidate formed is subsequently hydrolyzed to the acylenzyme and ammonia is created as a byproduct. The acylenzyme can ... Nitrilase enzymes (nitrile aminohydrolase; EC 3.5.5.1) catalyse the hydrolysis of nitriles to carboxylic acids and ammonia, ...
Methylaspartate is an unusual amino acid formed by glutamate mutase and can be metabolised by methylaspartate ammonia-lyase. It ...
Tyrosine ammonia lyase (L-tyrosine ammonia-lyase, TAL or Tyrase) is an enzyme in the natural phenols biosynthesis pathway. It ... phenylalanine ammonia-lyase) EC 4.3.1.25 (phenylalanine/tyrosine ammonia-lyase) Louie GV, Bowman ME, Moffitt MC, Baiga TJ, ... "Discovery of a substrate selectivity switch in tyrosine ammonia-lyase, a member of the aromatic amino acid lyase family". ... Tyrosine+ammonia-lyase at the US National Library of Medicine Medical Subject Headings (MeSH) www.hhmi.org Biology portal v t e ...
A number of enzymes, belonging to the lyase class, for which fumarate is a substrate have been shown [PMID: 3282546] to share a ...
Threonine ammonia-lyase is a tetramer of identical subunits, and is arranged as a dimer of dimers. Each subunit has two domains ... Threonine ammonia-lyase is a member of the Fold Type II family, also known as the tryptophan synthase family. Though threonine ... Threonine ammonia-lyase is not found in humans. Thus, this is one example of why humans cannot synthesize all 20 proteinogenic ... In fact, threonine ammonia-lyase has been shown to exhibit some specificity towards serine and can convert serine into pyruvate ...
Histidase converts histidine into ammonia and urocanic acid. Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first ... Histidine ammonia-lyase (or histidase, or histidinase) is an enzyme that in humans is encoded by the HAL gene. ... "Entrez Gene: histidine ammonia-lyase". Suchi M, Sano H, Mizuno H, Wada Y (September 1995). "Molecular cloning and structural ... Histidine+Ammonia-Lyase at the US National Library of Medicine Medical Subject Headings (MeSH) This article incorporates text ...
Ammonia-lyase definition at Dictionary.com, a free online dictionary with pronunciation, synonyms and translation. Look it up ... ammonia-lyase in Medicine Expand. ammonia-lyase n. Any of various enzymes that remove ammonia or an amino compound by breaking ...
ethanolamine ammonia-lyase small subunit [Psychromonas ingrahamii 37]. * Record removed. The sequence YP_941742 is 100% ...
... ammonia-lyases explanation free. What is ammonia-lyases? Meaning of ammonia-lyases medical term. What does ammonia-lyases mean? ... Looking for online definition of ammonia-lyases in the Medical Dictionary? ... Ammonia-lyases , definition of ammonia-lyases by Medical dictionary https://medical-dictionary.thefreedictionary.com/ammonia- ... ammonia-lyases. am·mo·ni·a-ly·as·es. (ă-mōnē-ă-līās-ēz), Enzymes that remove ammonia or an amino compound nonhydrolytically ( ...
Occurrence of Phenylalanine Ammonia-Lyase (PAL) in isolated tapetum cells ofTulipa anthers. ... It was our purpose to investigate the localization of the key phenylpropanoid enzyme, phenylalanine ammonia-lyase, within the ...
Figure 4: Temperature dependence studies on the PAL enzyme from the yeast Trichosporon cutaneum. A temperature optimum of 32°C was observed ...
A combination of oral enzyme therapy with phenylalanine ammonia lyase (PAL; EC 4.3.1.5) and controlled low protein diet might ... A different approach to treatment of phenylketonuria: Phenylalanine degradation with recombinant phenylalanine ammonia lyase. ... A different approach to treatment of phenylketonuria: Phenylalanine degradation with recombinant phenylalanine ammonia lyase ... A different approach to treatment of phenylketonuria: Phenylalanine degradation with recombinant phenylalanine ammonia lyase ...
... Plant Mol Biol. 1995 Jan;27(2):327-38. doi: 10.1007/ ...
Schomburg D., Salzmann M. (1990) Glucosaminate ammonia-lyase. In: Schomburg D., Salzmann M. (eds) Enzyme Handbook 1. Springer, ...
... histidine ammonia lyase, EC 4.3.1.3) deficiency [18].. *The human gene for histidase (histidine ammonia-lyase; HAL), the enzyme ... Discovery of a substrate selectivity switch in tyrosine ammonia-lyase, a member of the aromatic amino Acid lyase family. Watts ... Tyrosine ammonia-lyase (TAL) is a recently described member of the aromatic amino acid lyase family, which also includes ... Computational analysis of the autocatalytic posttranslational cyclization observed in histidine ammonia-lyase. A comparison ...
Histidine ammonia-lyase homotetramer, Pseudomonas putida }} Histidine ammonia-lyase (or histidase, or ... ammonia]] and [[urocanic acid]]. == Function == Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in ... Ammonia-Lyase}} {{NLM content}} {{Amino acid metabolism enzymes}} {{Carbon-nitrogen lyases}} {{Enzymes}} {{Portal bar,Molecular ... Infobox_gene}} {{enzyme , Name = histidine ammonia-lyase , EC_number = 4.3.1.3 , CAS_number = 9013-75-6 , IUBMB_EC_number = 4/3 ...
Differentiation of Japanese green tea cultivars as revealed by RFLP analysis of phenylalanine ammonia-lyase DNA. * S. Matsumoto ... Differentiation of Japanese green tea cultivars as revealed by RFLP analysis of phenylalanine ammonia-lyase DNA. Theor Appl ... were analyzed to determine the process of differentiation of Japanese tea plants using phenylalanine ammonia lyase (PAL) as a ...
This study focuses on the expansion of the substrate scope of phenylalanine ammonia-lyase from Petroselinum crispum (PcPAL) ... Expanding the substrate scope of phenylalanine ammonia-lyase from Petroselinum crispum towards styrylalanines L. C. Bencze, A. ... Expanding the substrate scope of phenylalanine ammonia-lyase from Petroselinum crispum towards styrylalanines† ... This study focuses on the expansion of the substrate scope of phenylalanine ammonia-lyase from Petroselinum crispum (PcPAL) ...
Phenylalanine ammonia-lyase (PAL) catalyzes the first step in phenylpropanoid synthesis. The role of PAL in pathway regulation ... Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco ... Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco ... Quantitative relationship between phenylalanine ammonia-lyase levels and phenylpropanoid accumulation in transgenic tobacco ...
... protein synthesis and L-phenylalanine ammonia lyase (PAL; EC 4.3.1.5) activity in the Malaysian medicinal herb Labisia pumila ( ... Ibrahim, M.H.; Jaafar, H.Z. Involvement of Carbohydrate, Protein and Phenylanine Ammonia Lyase in Up-Regulation of Secondary ... Involvement of Carbohydrate, Protein and Phenylanine Ammonia Lyase in Up-Regulation of Secondary Metabolites in Labisia pumila ... Involvement of Carbohydrate, Protein and Phenylanine Ammonia Lyase in Up-Regulation of Secondary Metabolites in Labisia pumila ...
What is dihydroxyphenylalanine ammonia-lyase? Meaning of dihydroxyphenylalanine ammonia-lyase medical term. What does ... Looking for online definition of dihydroxyphenylalanine ammonia-lyase in the Medical Dictionary? dihydroxyphenylalanine ammonia ... dihydroxyphenylalanine ammonia-lyase. dihydroxyphenylalanine ammonia-lyase. This enzyme name was retired in 2007, as ... Dihydroxyphenylalanine ammonia-lyase , definition of dihydroxyphenylalanine ammonia-lyase by Medical dictionary https://medical ...
Home » Phenylalanine Ammonia-Lyase and Phenolic Compounds in Chamomile Tolerance to Cadmium and Copper Excess ... Phenylalanine ammonia-lyase activity (PAL, EC 4.3.1.5), total phenolics, soluble proteins, malondialdehyde and metals ... Phenylalanine Ammonia-Lyase and Phenolic Compounds in Chamomile Tolerance to Cadmium and Copper Excess. ... The effects of nitrogen deficiency on selected physiological attributes, phenylalanine ammonia-lyase (PAL, EC. 4.3.1.5) ...
Biochemical studies of phenylalanine ammonia-lyase encapsulated in erythrocytes. ULRICH SPRANDEL, NEPOMUK ZÖLLNER ... Biochemical studies of phenylalanine ammonia-lyase encapsulated in erythrocytes Message Subject (Your Name) has forwarded a ...
... *. Naoki Shibata,‡§,1 Hiroko ... Ethanolamine ammonia-lyase (EAL) (EC 4.3.1.7) or ethanolamine deaminase catalyzes the AdoCbl-dependent conversion of ... N-terminal truncation of the Escherichia coli ethanolamine ammonia-lyase β-subunit does not affect the catalytic properties of ... ethanolamine ammonia-lyase. PA. 2-amino-1-propanol. SAD. single-wavelength anomalous dispersion.. ...
... tyrosine ammonia-lyases (TAL; EC 4.3.1.23), phenylalanine ammonia-lyases (PAL; EC 4.3.1.24), or phenylalanine/tyrosine ammonia- ... Maize phenylalanine ammonia-lyase has tyrosine ammonia-lyase activity. Plant Physiol 113:175-179. doi:10.1104/pp.113.1.175. ... Some enzymes had both phenylalanine ammonia-lyase activity (PAL) and tyrosine ammonia-lyase activity (TAL), while others showed ... we aimed at increasing the range of characterized phenylalanine ammonia-lyases (PAL) and tyrosine ammonia-lyases (TAL), and in ...
1996) Phenlyalanine ammonia-lyase gene, structure, expression, and evolution in Nicotiana. Plant Mol Biol 30:711-722. ... Novel Anther-Specific myb Genes from Tobacco as Putative Regulators of Phenylalanine Ammonia-Lyase Expression Seungchan Yang, ... 1993) Involvement of phenylalanine ammonia-lyase in the development of pollen in broccoli (Brassica oleracea L.) Sex Plant ... Novel Anther-Specific myb Genes from Tobacco as Putative Regulators of Phenylalanine Ammonia-Lyase Expression ...
... of morphogenetic potential in bean suspension cultures has been investigated by measuring the amounts of phenylalanine ammonia- ... lyase activity induced in the cells when they are transferred from a medium in which they are grown and maintained to an ... The loss of morphogenetic potential and induction of phenylalanine ammonia-lyase in suspension cultures of Phaseolus vulgaris J ... Cells grown in the presence of coconut milk did not lose the ability to induce phenylalanine ammonia-lyase or xylem elements. ...
Methods: Phenylalanine ammonialyase (PAL), phenylpropanoids and peroxidases (POD) were investigated in elicited cassava ... Phenylpropanoids, Phenylalanine Ammonia Lyase and Peroxidases in Elicitor-challenged Cassava (Manihot esculenta) Suspension ... Phenylpropanoids, Phenylalanine Ammonia Lyase and Peroxidases in Elicitor-challenged Cassava (Manihot esculenta) Suspension ... Phenylalanine Ammonia Lyase and Peroxidases in Elicitor-challenged Cassava (Manihot esculenta) Suspension Cells and Leaves. ...
Bolwell, G.P., Sap, J., Cramer, C.L., Schuch, W., Lamb, C.J., and Dixon, R.A. (1985). L-Phenylalanine ammonia-lyase from ... Wanner, L.A., Li, G., Ware, D., Somssich, I.E., and Davis, K.R. (1995). The phenylalanine ammonia-lyase gene family in ... To determine whether isoforms of l-Phe ammonia-lyase (PAL), the first enzyme in the pathway, can associate with the next enzyme ... Allwood, E.G., Davies, D.R., Gerrish, C., Ellis, B.E., and Bolwell, G.P. (1999). Phosphorylation of phenylalanine ammonia-lyase ...
Synechocystis PCC 6803 cells heterologously expressing bacterial tyrosine ammonia lyase can use exogenous tyrosine for p- ... We demonstrate that the Synechocystis PCC 6803 expressing tyrosine ammonia-lyase from Rhodobacter sphaeroides under Ptrc1O ...
An enzyme complex that catalyzes the breakdown of ethanolamine to form acetaldehyde and ammonia.. ...
"Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen Cercospora beticola is mediated at ... Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen... Schmidt, Klaus; Heberle, Brigitte ... Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen Cercospora beticola is mediated at ... Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen Cercospora beticola is mediated at ...
Low Temperature Induces the Accumulation of Phenylalanine Ammonia-Lyase and Chalcone Synthase mRNAs of Arabidopsis thaliana in ... Low Temperature Induces the Accumulation of Phenylalanine Ammonia-Lyase and Chalcone Synthase mRNAs of Arabidopsis thaliana in ... Low Temperature Induces the Accumulation of Phenylalanine Ammonia-Lyase and Chalcone Synthase mRNAs of Arabidopsis thaliana in ... Low Temperature Induces the Accumulation of Phenylalanine Ammonia-Lyase and Chalcone Synthase mRNAs of Arabidopsis thaliana in ...
  • A number of enzymes, belonging to the lyase class, for which fumarate is a substrate have been shown [ PMID: 3282546 ] to share a short conserved sequence around a methionine which is probably involved in the catalytic activity of this type of enzymes. (ebi.ac.uk)
  • The mechanism of threonine ammonia-lyase is analogous to other deaminating PLP enzymes in its use of Schiff base intermediates. (wikipedia.org)
  • Any of various enzymes that remove ammonia or an amino compound by breaking the C-N bond, leaving a C=C. (dictionary.com)
  • Three novel enzymes were found to have activity exclusively for phenylalanine, including an enzyme from the low-GC Gram-positive bacterium Brevibacillus laterosporus , a bacterial-type enzyme from the amoeba Dictyostelium discoideum , and a phenylalanine ammonia-lyase from the moss Physcomitrella patens (producing 230 μM cinnamic acid per unit of optical density at 600 nm [OD 600 ]) in the medium using Escherichia coli as the heterologous host). (asm.org)
  • Novel tyrosine ammonia-lyases having higher reported substrate specificity than previously characterized enzymes were also identified. (asm.org)
  • The enzymes were also efficient in Saccharomyces cerevisiae , where p -coumaric acid accumulation was improved 5-fold over that in strains expressing previously characterized tyrosine ammonia-lyases. (asm.org)
  • Anthocyanins, which accumulate in leaves and stems in response to low temperature and changes in light intensity, are synthesized through the phenylpropanoid pathway that is controlled by key enzymes that include phenylalanine ammonia-lyase (PAL) and chalcone synthase (CHS). (plantphysiol.org)
  • With the exception of cinnamate 4-hydroxylase, the enzymes which act downstream of phenylalanine ammonia lyase are encoded by small gene families in all species analyzed so far. (tuscany-diet.net)
  • Crystal structure information is used to make substrate-switched amino acid ammonia lyase enzymes, including TALs, PALs and HALs. (patentsencyclopedia.com)
  • Several ammonia lyases were considered as interesting enzymes to study since these enzymes are able to do a deamination on aminoacids, though different than than lysine. (chalmers.se)
  • The assays provided the kinetic constants of the conversion of the natural substrate, 3‐methyl aspartate, by the mutated enzymes and their plausible activity on lysine by detecting the theoretical conversion products: 6‐aminohex‐2‐enoic acid and ammonia. (chalmers.se)
  • Focusing on an enzymatic activity with demonstrated synthetic and therapeutic relevance, five new phenylalanine ammonia lyase (PAL) enzymes were discovered and characterised with respect to their potential applications. (manchester.ac.uk)
  • Ammonia lyase belongs to the family of enzymes that catalyzes the deamination of amino acids. (eurekaselect.com)
  • A positive correlation was found between the activity of bioagents and improvement of peroxidase and phenylalanine ammonia-lyase enzymes in onion plants to resist infection with the pathogen. (springer.com)
  • 2016 ). The antioxidant enzymes peroxidase (PO), phenylalanine ammonia-lyase (PAL), and polyphenoloxidase (PPO) were mentioned as elicitors of the systemic resistance (ISR) in the plants that have a correlation with disease control (Yasmin et al. (springer.com)
  • Ammonia-lyases (ALs) represent an interesting pool of targets for the ongoing research project aimed to engineer known enzymes to modify their substrate specificity and allow the biosynthesis of 6-aminohex-2-enoic acid (6-AHEA) from lysine (Lys). (snic.se)
  • In the framework of a European ERA-IB project, two different types of enzymes ( ammonia lyases and aminotransferases ) have been selected as biocatalysts for the synthesis of industrially relevant amines . (bvsalud.org)
  • This superfamily represents the N-terminal of the enolase and similar structural domains found in several enzymes, such as D-glucarate dehydratases, muconate-lactonizing enzymes, mandelate racemases, d-galactonate dehydratase, O-succinylbenzoate synthases and chlormuconate cycloisomerases, l-Ala-d/l-Glu epimerases, 3-methylaspartate ammonia lyase, etc [ PMID: 15581566 ]. (ebi.ac.uk)
  • Thermal bifunctionality of bacterial phenylalanine aminomutase and ammonia lyase enzymes. (innspub.net)
  • Ethanolamine ammonia-lyase (EAL) (EC 4.3.1.7) or ethanolamine deaminase catalyzes the AdoCbl-dependent conversion of ethanolamine (EA) to acetaldehyde and ammonia ( 3 ) ( Equation 1 ). (pubmedcentralcanada.ca)
  • Ethanolamine ammonia lyase catalyzes the deamination of ethanolamine to form acetaldehyde and ammonia - a transformation that requires coenzyme 612- The function of coenzyme 612 is to abstract a hydrogen atom from C1 of the substrate, ethanolamine, to generate a free radical intermediate. (elsevier.com)
  • A DNA sequence encoding the Escherichia coli (strain K12) Ethanolamine ammonia-lyase light chain, was expressed in the hosts and tags indicated. (fishersci.fi)
  • Histidine ammonia-lyase (or histidase, or histidinase) is an enzyme that in humans is encoded by the HAL gene. (wikipedia.org)
  • In all plant species investigated, several copies of phenylalanine ammonia lyase gene are found, copies that probably respond differentially to internal and external stimuli. (tuscany-diet.net)
  • Characterization of the phenylalanine ammonia lyase gene from the rubber tree (Hevea brasiliensis Müll. (plantprotection.pl)
  • Characterization, and expression profile of a phenylalanine ammonia lyase gene from Jatropha curcas L. Molecular Biology Reports 39 (4): 3443-3452. (plantprotection.pl)
  • Van Havere2017, author={Van Havere, Robin}, title={Engineering of 3 methylaspartate ammonia-lyases for biobased adipic acid production}, abstract={The current traditional adipic acid production is a highly polluting process. (chalmers.se)
  • In the early phase of infection of sugar beet (Beta vulgaris L.) leaves with the phytopathogenic fungus Cercospora beticola, a reduction in the expression of the phenylalanine ammonia lyase (BvPAL) and cinnamic acid 4-hydroxylase (BvC4H) genes was observed. (deepdyve.com)
  • Biochemical Evaluation of Phenylalanine Ammonia Lyase from Endemic Plant Cyathobasis fruticulosa (Bunge) Aellen. (com.hr)
  • Phenylalanine and tyrosine ammonia-lyases form cinnamic acid and p -coumaric acid, which are precursors of a wide range of aromatic compounds of biotechnological interest. (asm.org)
  • Lack of highly active and specific tyrosine ammonia-lyases has previously been a limitation in metabolic engineering approaches. (asm.org)
  • Phenylalanine (Phe) may be converted into β-phenylalanine (β-Phe) by phenylalanine aminomutase (PAM) or deaminated to cinnamic acid (CA). Similarly, tyrosine (Tyr) may be converted to β-tyrosine by tyrosine aminomutase (TAM) or p -coumaric acid (pHCA) by tyrosine ammonia-lyase (TAL). (asm.org)
  • We demonstrate that the Synechocystis PCC 6803 expressing tyrosine ammonia-lyase from Rhodobacter sphaeroides under Ptrc1O promoter produce p-coumaric acid at a rate three times higher than that under Ptrc1Ocore promoter, accounting for 18.4 +/- 1.5 mu g of p-coumaric acid per 10(8) cells (0.36 mg L-1). (diva-portal.org)
  • The enzyme from monocots is also able to act as tyrosine ammonia lyase (EC 4.3.1.25), converting tyrosine to p-coumaric acid directly, (therefore without the 4-hydroxylation step), but with a lower efficiency. (tuscany-diet.net)
  • 7. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the mutation is in a residue corresponding to His 89 of Rhodobacter sphaeroides Tyrosine Ammonia Lyase. (patentsencyclopedia.com)
  • Fingerprint Dive into the research topics of 'Possible regulatory role of phenylalanine ammonia-lyase in the production of anthocyanins in asparagus (Asparagus officinalis L)'. Together they form a unique fingerprint. (wur.nl)
  • Suppression of phenylalanine ammonia lyase expression in sugar beet by the fungal pathogen. (deepdyve.com)
  • The effect of thyme oil (96 μL L−1) vapours on the expression of phenylalanine ammonia-lyase (PAL) and lipoxygenase (LOX) genes, and control of anthracnose was investigated in naturally infected 'Hass' and 'Ryan' avocado fruit stored for 21 d at 7-7.5 °C, and thereafter kept for 5 d at 20 °C, simulating the supply chain conditions. (up.ac.za)
  • Modulating the pH Activity Profiles of Phenylalanine Ammonia Lyase from Anabaena variabilis by Modification of Center-Near Surface Residues. (semanticscholar.org)
  • These and former results are discussed in terms of the mechanism of action of phenyalalanine and histidine ammonia lyases. (elsevier.com)
  • Phenylalanine ammonia lyase (PAL): From discovery to enzyme substitution therapy for phenylketonuria. (cdc.gov)
  • Enzyme substitution therapy with the phenylalanine ammonia lyase (PAL) is a new approach to the treatment of patients with phenylketonuria (PKU). (com.hr)
  • Ranjith N. Kumavath, Ch.V. Ramana, Ch. Sasikala, Debmalya Barh, Alan Prem Kumar and Vasco Azevedo, "Isolation and Characterization of L-Tryptophan Ammonia Lyase from Rubrivivax benzoatilyticus Strain JA2", Current Protein & Peptide Science (2015) 16: 775. (eurekaselect.com)
  • One of the most promising targets is the 3-methylaspartate ammonia-lyase (MAL) that we aim to engineer to be able to perform the biosynthesis of 6-AHEA. (snic.se)
  • An enzyme complex that catalyzes the breakdown of ethanolamine to form acetaldehyde and ammonia. (yeastrc.org)
  • Deamination of the carbinolamine affords acetaldehyde and ammonia. (elsevier.com)
  • Aspartate ammonia-lyase catalyses the conversion of aspartate to fumarate. (ebi.ac.uk)
  • Below are the list of possible Aspartate ammonia-lyase products. (mybiosource.com)
  • Also known as Aspartate ammonia-lyase (Aspartase). (mybiosource.com)
  • To determine whether isoforms of l -Phe ammonia-lyase (PAL), the first enzyme in the pathway, can associate with the next enzyme, the endomembrane-bound cinnamate 4-hydroxylase (C4H), to facilitate channeling, we generated transgenic tobacco ( Nicotiana tabacum ) plants independently expressing epitope-tagged versions of two PAL isoforms (PAL1 and PAL2) and C4H. (plantcell.org)
  • Phenylalanine ammonia-lyase (PAL) catalyses the first step controlling the rate of phenylpropanoid metabolism. (escholarship.org)
  • The enzyme studied in this research project is 3‐methylaspartate ammonia lyase (MAL) which catalyses the deamination reaction on 3methylaspartic acid. (chalmers.se)
  • Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. (wikipedia.org)
  • Furthermore, F137V-PcPAL showed superior catalytic efficiency in the ammonia elimination reaction of several racemic styrylalanine derivatives ( rac - 1a-d ) providing access to D - 1a-d by kinetic resolution, even though the D -enantiomers proved to be reversible inhibitors. (rsc.org)
  • The low equilibrium constant of the ammonia addition, the poor ligand binding affinities of 2a-d , and the non-productive binding states of the unsaturated ligands 2a-d within the active sites of either wt-PcPAL or F137V-PcPAL - as indicated by molecular modeling - might be responsible for the inactivity of the PcPAL variants in the reverse reaction. (rsc.org)
  • It requires no cofactors and catalyzes the reaction that links primary and secondary metabolism: the deamination of phenylalanine to trans -cinnamic acid, with the release of nitrogen as ammonia and introduction of a trans double bond between carbon atoms 7 and 8 of the side chain. (tuscany-diet.net)
  • The released ammonia is probably fixed in the reaction catalyzed by glutamine synthetase. (tuscany-diet.net)
  • The K m value for ammonia in the reverse reaction by using (E)-cinnamate (2) was determined to be 4.4 and 2.6M at pH 8.8 and 10, respectively. (elsevier.com)
  • The isolated L-tryptophan ammonia lyase found to catalyze the reaction of L-tryptophan to produce indole 3-acrylic acid and NH 3 . (eurekaselect.com)
  • 11. Steady-state rates of phenylalanine ammonia-lyase reaction in the presence of inhibitors like D-phenylalanine, cinnamic, p-coumaric, caffeic, dihydrocaffeic and phenylpyruvic acid have shown that only one molecule of each type of inhibitor binds to a molecule of the enzyme. (iisc.ac.in)
  • Compound 5 is fumaric acid generated in the reaction that converts ASA to arginine (6), which is mediated by ASA lyase. (medscape.com)
  • Catalyzes the anaerobic formation of alpha-ketobutyrate and ammonia from threonine in a two-step reaction. (uniprot.org)
  • Threonine ammonia-lyase, also commonly referred to as threonine deaminase or threonine dehydratase, is an enzyme responsible for catalyzing the conversion of L-threonine into alpha-ketobutyrate and ammonia. (wikipedia.org)
  • Histidase converts histidine into ammonia and urocanic acid. (wikipedia.org)
  • Also known as Histidine ammonia-lyase (Histidase). (mybiosource.com)
  • Phenylalanine ammonia-lyase activity (PAL, EC 4.3.1.5), total phenolics, soluble proteins, malondialdehyde and metals accumulation in four-week old chamomile ( Matricaria chamomilla) plants cultivated in nutrient solution and exposed to low (3 μM) and high (60 and 120 μM) levels of cadmium (Cd) or copper (Cu) for 7 days were studied. (ebscohost.com)
  • The loss of morphogenetic potential in bean suspension cultures has been investigated by measuring the amounts of phenylalanine ammonia-lyase activity induced in the cells when they are transferred from a medium in which they are grown and maintained to an induction medium. (nih.gov)
  • When cells were grown in medium with only 2,4-dichlorophenoxyacetic acid for a period of 5--10 subcultures and samples were transferred to the induction medium at intervals during the subcultures, the amounts of phenylalanine ammonia-lyase activity and the number of xylem elements induced progressively declined. (nih.gov)
  • In addition to the induction brought about by the presence of naphthylacetic acid and kinetin in the induction medium the cells could also be stimulated to produce phenylalanine ammonia-lyase activity by dilution at subculture. (nih.gov)
  • Thus the mechanism that produced the increase in phenylalanine ammonia-lyase activity was intact but had lost its ability to respond to the hormones of the induction medium. (nih.gov)
  • As a consequence, a complex pattern of phenylalanine ammonia lyase time course specific activity levels was evident. (semanticscholar.org)
  • Production of l-Phenylalanine from trans-Cinnamic Acid with Rhodotorula glutinis Containing l-Phenylalanine Ammonia-Lyase Activity. (semanticscholar.org)
  • The activity of phenylalanine ammonia lyase (the active portion of pegvaliase) was equal to background levels found in blank breastmilk and TRIS buffer solution. (nih.gov)
  • Depending on the relative activity towards the substrates, L-tryptophan ammonia lyase converts L-tryptophan to indole 3-acrylic acid and ammonia. (eurekaselect.com)
  • The main pigments found in orchid flower petals, as well as their relationships with phenylalanine ammonia-lyase (PAL) activity, were investigated. (2pressrelease.net)
  • Capsaicin formation in p-fluorophenylalanine resistant and normal cell cultures of Capsicum frutescens and activity of phenylalanine ammonia lyase. (cftri.com)
  • Overall, the cycle's activity is regulated by the rate of synthesis of N -acetylglutamate , the enzyme activator that initiates incorporation of ammonia into the cycle. (medscape.com)
  • Transient expression analyses of the N-terminal MYB domain demonstrated the presence of functional nuclear localization signals, and full-length NtMYBAS1 was able to activate two different phenylalanine ammonia-lyase promoters ( PALA and gPAL1 ) in tobacco leaf protoplasts. (plantphysiol.org)
  • The expression of phenylalnine ammonia lyase (LJPAL1) is closely related to the content of active compounds in Lonicera japonica. (bvsalud.org)
  • In this work, expression of phenylalanine ammonia-lyase (PAL) was monitored in infected leaves of two barley genotypes, Banteng (resistant) and Furat1 (susceptible) across four-time points of Pg systemic movement using qRT-PCR approach. (journal-of-agroalimentary.ro)
  • Ammonia elimination from L -styrylalanine ( L - 1a ) catalyzed by non-mutated PcPAL (wt-PcPAL) took place with a 777-fold lower k cat / K M value than the deamination of the natural substrate, L -Phe. (rsc.org)
  • 9. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the enzyme produces trans-cinnamic acid. (patentsencyclopedia.com)
  • Phenylalanine ammonia lyase (PAL) is the key enzyme that catalyzes the conversion of L-Phenylalanine to ammonia and trans- cinnamic acid. (innspub.net)
  • Phenylalanine ammonia-lyase (PAL) catalyzes the first step in phenylpropanoid synthesis. (pnas.org)
  • Phenylalanine ammonia-lyase [PAL] is the first entry enzyme of the phenylpropanoid pathway that converts phenylalanine to cinnamic acid which is the precursor of various secondary metabolites. (who.int)
  • She, who was diagnosed as ASL deficiency after the laboratory examinations, had normal blood ammonia levels. (bezmialem.edu.tr)
  • Failure to suspect hyperammonemia and to obtain blood ammonia levels results in certain morbidity and, likely, death because routine laboratory test findings are unrevealing. (medscape.com)
  • The regulatory role of phenylalanine ammonia-lyase (PAL) in the light-induced accumulation of anthocyanins in the epidermis of asparagus spears has been analysed. (wur.nl)
  • N-Methyl-L-phenylalanine (5), N-methyl-4-nitro-L-phenylalanine (6), and N,N-dimethyl-4-nitro-L-phenyl-alanine (7·H + ) were investigated as substrates of inhibitors of phenylalanine ammonia lyase from Petroselinum crispum. (elsevier.com)
  • The present study was conducted with the main objective to optimize the phenylalanine ammonia lyase (PAL) production process by Bacillus subtilis GCB-31 on agro-industrial wastes as carrier substrates in solid state fermentation. (innspub.net)
  • The pharmacokinetics of L-histidine in humans has been investigated to evaluate the in vivo histidine ammonia lyase system for the conversion of L-histidine to urocanic acid. (aspetjournals.org)
  • This study focuses on the expansion of the substrate scope of phenylalanine ammonia-lyase from Petroselinum crispum (PcPAL) towards the L -enantiomers of racemic styrylalanines rac - 1a-d - which are less studied and synthetically challenging unnatural amino acids - by reshaping the aromatic binding pocket of the active site of PcPAL by point mutations. (rsc.org)
  • Aromatic amino acid ammonia-lyases and aminomutases. (asm.org)
  • 3. The recombinant amino acid ammonia lyase enzyme of claim 2, wherein the first and second amino acids are aromatic amino acids. (patentsencyclopedia.com)
  • We also show that the identity of the amino acid at the switch position can serve as a guide to predict substrate specificities of annotated aromatic amino acid lyases in genome sequences. (umn.edu)
  • Structural and catalytic properties of the four phenylalanine ammonia-lyase isoenzymes from parsley (Petroselinum crispum Nym. (plantprotection.pl)
  • Two phenylalanine ammonia lyase isoforms are involved in the elicitor-induced response of rice to the fungal pathogen Magnaporthe oryzae. (semanticscholar.org)
  • In plants, threonine ammonia-lyase is important in defense mechanisms against herbivores and is upregulated in response to abiotic stress. (wikipedia.org)
  • Stabilization of phenylalanine ammonia lyase containing Rhodotorulaglutinis cells for the continuous synthesis of L-phenylalanine methyl ester/96. (innspub.net)
  • Alpha-ketobutyrate can be converted into L-isoleucine, so threonine ammonia-lyase functions as a key enzyme in BCAA synthesis. (wikipedia.org)
  • Threonine ammonia-lyase is a tetramer of identical subunits, and is arranged as a dimer of dimers. (wikipedia.org)
  • Threonine ammonia-lyase has been shown to not follow Michaelis-Menten kinetics, rather, it is subject to complex allosteric control. (wikipedia.org)
  • Multiple forms of threonine ammonia-lyase have been observed in a variety of species of organism. (wikipedia.org)
  • 1. A recombinant amino acid ammonia lyase enzyme, comprising at least one mutation in an active site of the enzyme, wherein the mutation switches substrate preference of the lyase enzyme from a first substrate to a second substrate. (patentsencyclopedia.com)
  • 2. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the first substrate is an amino acid, and the second substrate is an amino acid. (patentsencyclopedia.com)
  • 5. The recombinant amino acid ammonia lyase enzyme of claim 3, wherein the first amino acid is tyrosine or histidine and the second amino acid is phenylalanine. (patentsencyclopedia.com)
  • 6. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the recombinant enzyme is derived from a tyrosine or histidine ammonia lyase, and wherein the recombinant enzyme preferentially deaminates L-Phe. (patentsencyclopedia.com)
  • 8. The recombinant amino acid ammonia lyase enzyme of claim 1, wherein the enzyme comprises a 4-methylidene-imidazole-5-one (MOI) cofactor prosthetic group. (patentsencyclopedia.com)
  • 12. The recombinant cell of claim 11, wherein the cell encodes a recombinant tyrosine amino acid-type ammonia lyase enzyme that comprises a mutation converting a kinetic preference of the enzyme for tyrosine into a preference for phenylalanine. (patentsencyclopedia.com)
  • 17. A library of amino acid ammonia lyase polypeptides, the library comprising:a plurality of polypeptides comprising or derived from amino acid ammonia lyase enzyme polypeptides, wherein the plurality of polypeptides collectively comprise a plurality of mutations of at least one amino acid in at least one region of the polypeptides, the region corresponding to an active site of an amino acid ammonia lyase enzyme. (patentsencyclopedia.com)
  • EC: 4.3.1.24) of the thermophilic and radiotolerant bacterium Rubrobacter xylanophilus (RxPAL) was identified by screening the genomes of bacteria for members of the phenylalanine ammonia-lyase family. (elsevier.com)
  • Phenylalanine ammonia lyases (PALs) catalyse the regio- and stereoselective hydroamination of cinnamic acid analogues to yield optically enriched α-amino acids. (manchester.ac.uk)
  • They learned that the critical element in this synthesis was an intermediary enzyme that deaminates phenylalanine to cinnamic acid and ammonia (later called phenylalanine ammonia lyase or PAL). (cdc.gov)
  • The relationship between the formation of cell wall-bound ferulic acid (FA) and diferulic acid (DFA) and the change in activities of phenylalanine ammonia-lyase (PAL) and cell wall-bound peroxidase (CW-PRX) was studied in rice shoots. (spacestationresearch.com)
  • Synthesis and degradation of phenylalanine ammonia-lyase of Rhodosporidium toruloides. (semanticscholar.org)
  • The effects of nitrogen deficiency on selected physiological attributes, phenylalanine ammonia-lyase (PAL, EC. (ebscohost.com)
  • Arginine succinate lyase (ASL) deficiency is one of the most common cause of urea cycle defect and shows all characteristics of this disorders. (bezmialem.edu.tr)
  • ASL deficiency must be thought when a child has mental retardation and cerebellar ataxia, even if normal ammonia levels. (bezmialem.edu.tr)
  • Argininosuccinate (ASA) lyase deficiency results in defective cleavage of ASA. (medscape.com)
  • [ 1 ] The most important characteristic of ASA lyase deficiency is its propensity to cause hyperammonemia in affected individuals. (medscape.com)
  • [ 7 ] According a study of urea cycle diseases in Finland, 20 cases of ASA lyase deficiency had been reported by 2007. (medscape.com)
  • ASA lyase deficiency is associated with high mortality and morbidity rates. (medscape.com)
  • Although intellectual impairment is the rule, even among patients who receive excellent and timely treatment, some patients with ASA lyase deficiency reportedly develop normally. (medscape.com)
  • The profile of phenylalanine ammonia lyase (PAL), the key enzyme in pheny1propanoid pathway in resistant cell cultures was studied and compared with normal cell cultures to understand its role in capsaicin formation. (cftri.com)
  • Microbial L-phenylalanine ammonia-lyase. (semanticscholar.org)
  • 2014. Biotechnological production and applications of microbial phenylalanine ammonia lyase: a recent review. (innspub.net)
  • The journey of phenylalanine ammonia lyase (PAL) from plant enzyme to enzyme substitution therapy for PKU is a fascinating story that illustrates the importance of collaboration between basic scientists and industry in the drug development process. (cdc.gov)
  • Phenylalanine ammonia-lyase (EC 4.3.1.5) was purified to homogeneity from the acetone-dried powders of the mycelial felts of the plant pathogenic fungus Rhizoctonia solani. (iisc.ac.in)