Amino Sugars: SUGARS containing an amino group. GLYCOSYLATION of other compounds with these amino sugars results in AMINOGLYCOSIDES.HexosaminesGlucosamineAmino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.Carbohydrates: The largest class of organic compounds, including STARCH; GLYCOGEN; CELLULOSE; POLYSACCHARIDES; and simple MONOSACCHARIDES. Carbohydrates are composed of carbon, hydrogen, and oxygen in a ratio of Cn(H2O)n.Acetylglucosamine: The N-acetyl derivative of glucosamine.Neuraminic AcidsUridine Diphosphate N-Acetylgalactosamine: A nucleoside diphosphate sugar which serves as a source of N-acetylgalactosamine for glycoproteins, sulfatides and cerebrosides.GalactosamineUridine Diphosphate SugarsUridine Diphosphate N-Acetylglucosamine: Serves as the biological precursor of insect chitin, of muramic acid in bacterial cell walls, and of sialic acids in mammalian glycoproteins.Chromatography, Paper: An analytical technique for resolution of a chemical mixture into its component compounds. Compounds are separated on an adsorbent paper (stationary phase) by their varied degree of solubility/mobility in the eluting solvent (mobile phase).HexosesGlutamine-Fructose-6-Phosphate Transaminase (Isomerizing): An enzyme that catalyzes the synthesis of fructose-6-phosphate plus GLUTAMINE from GLUTAMATE plus glucosamine-6-phosphate.Monosaccharides: Simple sugars, carbohydrates which cannot be decomposed by hydrolysis. They are colorless crystalline substances with a sweet taste and have the same general formula CnH2nOn. (From Dorland, 28th ed)Muramic Acids: Compounds consisting of glucosamine and lactate joined by an ether linkage. They occur naturally as N-acetyl derivatives in peptidoglycan, the characteristic polysaccharide composing bacterial cell walls. (From Dorland, 28th ed)Uronic Acids: Acids derived from monosaccharides by the oxidation of the terminal (-CH2OH) group farthest removed from the carbonyl group to a (-COOH) group. (From Stedmans, 26th ed)Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Cell Wall: The outermost layer of a cell in most PLANTS; BACTERIA; FUNGI; and ALGAE. The cell wall is usually a rigid structure that lies external to the CELL MEMBRANE, and provides a protective barrier against physical or chemical agents.Acetylgalactosamine: The N-acetyl derivative of galactosamine.Carbohydrate Metabolism: Cellular processes in biosynthesis (anabolism) and degradation (catabolism) of CARBOHYDRATES.Aldose-Ketose Isomerases: Enzymes that catalyze the interconversion of aldose and ketose compounds.Pimelic Acids: A group of compounds that are derivatives of heptanedioic acid with the general formula R-C7H11O4.Carbohydrate Epimerases: Enzymes that catalyze the epimerization of chiral centers within carbohydrates or their derivatives. EC 5.1.3.Galactose: An aldohexose that occurs naturally in the D-form in lactose, cerebrosides, gangliosides, and mucoproteins. Deficiency of galactosyl-1-phosphate uridyltransferase (GALACTOSE-1-PHOSPHATE URIDYL-TRANSFERASE DEFICIENCY DISEASE) causes an error in galactose metabolism called GALACTOSEMIA, resulting in elevations of galactose in the blood.N-Acetylneuraminic Acid: An N-acyl derivative of neuraminic acid. N-acetylneuraminic acid occurs in many polysaccharides, glycoproteins, and glycolipids in animals and bacteria. (From Dorland, 28th ed, p1518)Electrophoresis, Paper: Electrophoresis in which paper is used as the diffusion medium. This technique is confined almost entirely to separations of small molecules such as amino acids, peptides, and nucleotides, and relatively high voltages are nearly always used.Polysaccharides, Bacterial: Polysaccharides found in bacteria and in capsules thereof.Chemistry: A basic science concerned with the composition, structure, and properties of matter; and the reactions that occur between substances and the associated energy exchange.Chemical Phenomena: The composition, conformation, and properties of atoms and molecules, and their reaction and interaction processes.Rhamnose: A methylpentose whose L- isomer is found naturally in many plant glycosides and some gram-negative bacterial lipopolysaccharides.Mannose: A hexose or fermentable monosaccharide and isomer of glucose from manna, the ash Fraxinus ornus and related plants. (From Grant & Hackh's Chemical Dictionary, 5th ed & Random House Unabridged Dictionary, 2d ed)Imino Furanoses: Five-carbon furanose sugars in which the OXYGEN is replaced by a NITROGEN atom.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Periodic Acid: A strong oxidizing agent.FucoseMolecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Pronase: A proteolytic enzyme obtained from Streptomyces griseus.GluconatesCarbohydrate Conformation: The characteristic 3-dimensional shape of a carbohydrate.Amino Acid Substitution: The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.HeptosesMutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Glucose: A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.Carbohydrate Sequence: The sequence of carbohydrates within POLYSACCHARIDES; GLYCOPROTEINS; and GLYCOLIPIDS.Magnetic Resonance Spectroscopy: Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).Enzyme Repression: The interference in synthesis of an enzyme due to the elevated level of an effector substance, usually a metabolite, whose presence would cause depression of the gene responsible for enzyme synthesis.Hydrolysis: The process of cleaving a chemical compound by the addition of a molecule of water.Carbon Isotopes: Stable carbon atoms that have the same atomic number as the element carbon, but differ in atomic weight. C-13 is a stable carbon isotope.Bacterial Proteins: Proteins found in any species of bacterium.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Chromatography: Techniques used to separate mixtures of substances based on differences in the relative affinities of the substances for mobile and stationary phases. A mobile phase (fluid or gas) passes through a column containing a stationary phase of porous solid or liquid coated on a solid support. Usage is both analytical for small amounts and preparative for bulk amounts.Glycoproteins: Conjugated protein-carbohydrate compounds including mucins, mucoid, and amyloid glycoproteins.Sialic Acids: A group of naturally occurring N-and O-acyl derivatives of the deoxyamino sugar neuraminic acid. They are ubiquitously distributed in many tissues.AmidohydrolasesTransaminases: A subclass of enzymes of the transferase class that catalyze the transfer of an amino group from a donor (generally an amino acid) to an acceptor (generally a 2-keto acid). Most of these enzymes are pyridoxyl phosphate proteins. (Dorland, 28th ed) EC 2.6.1.Autoanalysis: Method of analyzing chemicals using automation.Sugar Alcohols: Polyhydric alcohols having no more than one hydroxy group attached to each carbon atom. They are formed by the reduction of the carbonyl group of a sugar to a hydroxyl group.(From Dorland, 28th ed)Oligosaccharides: Carbohydrates consisting of between two (DISACCHARIDES) and ten MONOSACCHARIDES connected by either an alpha- or beta-glycosidic link. They are found throughout nature in both the free and bound form.Kinetics: The rate dynamics in chemical or physical systems.Isomerases: A class of enzymes that catalyze geometric or structural changes within a molecule to form a single product. The reactions do not involve a net change in the concentrations of compounds other than the substrate and the product.(from Dorland, 28th ed) EC 5.Chromatography, Gel: Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.Chromatography, Ion Exchange: Separation technique in which the stationary phase consists of ion exchange resins. The resins contain loosely held small ions that easily exchange places with other small ions of like charge present in solutions washed over the resins.Molecular Weight: The sum of the weight of all the atoms in a molecule.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.PeptidoglycanDeoxy SugarsLipopolysaccharides: Lipid-containing polysaccharides which are endotoxins and important group-specific antigens. They are often derived from the cell wall of gram-negative bacteria and induce immunoglobulin secretion. The lipopolysaccharide molecule consists of three parts: LIPID A, core polysaccharide, and O-specific chains (O ANTIGENS). When derived from Escherichia coli, lipopolysaccharides serve as polyclonal B-cell mitogens commonly used in laboratory immunology. (From Dorland, 28th ed)Amino Acids, Essential: Amino acids that are not synthesized by the human body in amounts sufficient to carry out physiological functions. They are obtained from dietary foodstuffs.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Chromatography, High Pressure Liquid: Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.Glycosaminoglycans: Heteropolysaccharides which contain an N-acetylated hexosamine in a characteristic repeating disaccharide unit. The repeating structure of each disaccharide involves alternate 1,4- and 1,3-linkages consisting of either N-acetylglucosamine or N-acetylgalactosamine.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Amino Acid Transport Systems: Cellular proteins and protein complexes that transport amino acids across biological membranes.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Culture Media: Any liquid or solid preparation made specifically for the growth, storage, or transport of microorganisms or other types of cells. The variety of media that exist allow for the culturing of specific microorganisms and cell types, such as differential media, selective media, test media, and defined media. Solid media consist of liquid media that have been solidified with an agent such as AGAR or GELATIN.Aminoglycosides: Glycosylated compounds in which there is an amino substituent on the glycoside. Some of them are clinically important ANTIBIOTICS.Chromatography, Thin Layer: Chromatography on thin layers of adsorbents rather than in columns. The adsorbent can be alumina, silica gel, silicates, charcoals, or cellulose. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Daunorubicin: A very toxic anthracycline aminoglycoside antineoplastic isolated from Streptomyces peucetius and others, used in treatment of LEUKEMIA and other NEOPLASMS.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Lipid A: Lipid A is the biologically active component of lipopolysaccharides. It shows strong endotoxic activity and exhibits immunogenic properties.Amino Acid Motifs: Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.Pseudomonas aeruginosa: A species of gram-negative, aerobic, rod-shaped bacteria commonly isolated from clinical specimens (wound, burn, and urinary tract infections). It is also found widely distributed in soil and water. P. aeruginosa is a major agent of nosocomial infection.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Dietary Sucrose: Sucrose present in the diet. It is added to food and drinks as a sweetener.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Phosphoenolpyruvate Sugar Phosphotransferase System: The bacterial sugar phosphotransferase system (PTS) that catalyzes the transfer of the phosphoryl group from phosphoenolpyruvate to its sugar substrates (the PTS sugars) concomitant with the translocation of these sugars across the bacterial membrane. The phosphorylation of a given sugar requires four proteins, two general proteins, Enzyme I and HPr and a pair of sugar-specific proteins designated as the Enzyme II complex. The PTS has also been implicated in the induction of synthesis of some catabolic enzyme systems required for the utilization of sugars that are not substrates of the PTS as well as the regulation of the activity of ADENYLYL CYCLASES. EC 2.7.1.-.Sucrose: A nonreducing disaccharide composed of GLUCOSE and FRUCTOSE linked via their anomeric carbons. It is obtained commercially from SUGARCANE, sugar beet (BETA VULGARIS), and other plants and used extensively as a food and a sweetener.Bacteria: One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Fructose: A monosaccharide in sweet fruits and honey that is soluble in water, alcohol, or ether. It is used as a preservative and an intravenous infusion in parenteral feeding.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Recombinant Proteins: Proteins prepared by recombinant DNA technology.Amino Acids, Aromatic: Amino acids containing an aromatic side chain.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Peptide Fragments: Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Amino Acids, SulfurProtein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Leucine: An essential branched-chain amino acid important for hemoglobin formation.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Anti-Bacterial Agents: Substances that reduce the growth or reproduction of BACTERIA.Sugar AcidsAntigens, Bacterial: Substances elaborated by bacteria that have antigenic activity.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Genes, Bacterial: The functional hereditary units of BACTERIA.Peptides: Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.XyloseGlycosylation: The chemical or biochemical addition of carbohydrate or glycosyl groups to other chemicals, especially peptides or proteins. Glycosyl transferases are used in this biochemical reaction.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Sugar PhosphatesSaccharum: A plant genus of the family POACEAE widely cultivated in the tropics for the sweet cane that is processed into sugar.Alanine: A non-essential amino acid that occurs in high levels in its free state in plasma. It is produced from pyruvate by transamination. It is involved in sugar and acid metabolism, increases IMMUNITY, and provides energy for muscle tissue, BRAIN, and the CENTRAL NERVOUS SYSTEM.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Protein Structure, Secondary: The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.

Differential expression of alpha2-6 sialylated polylactosamine structures by human B and T cells. (1/534)

We found that human peripheral B and T cells differed in the surface expression of alpha2-6 sialylated type 2 chain glycans. In contrast to B cells, T cells expressed only sialoglycans with repeated N-acetyllactosamine (Galss1-4GlcNAc) disaccharides. This finding was based on the specificity of the monoclonal antibodies HB6, HB9 (CD24), HD66 (CDw76), FB21, and CRIS4 (CDw76) with the alpha2-6 sialylated model gangliosides IV6NeuAcnLc4Cer (2-6 SPG), VI6NeuAcnLc6Cer (2-6 SnHC), VIII6NeuAcnLc8Cer (2-6 SnOC), and X6NeuAcnLc10Cer (2-6 SnDC). We found that, in addition to their common requirement of an alpha2-6 bound terminal sialic acid for binding, the antibodies displayed preferences for the length of the carbohydrate backbones. Some of them bound mainly to 2-6 SPG with one N-acetyllactosamine (LacNAc) unit (HB9, HD66); others preferentially to 2-6 SnHC and 2-6 SnOC, with two and three LacNAc units, respectively (HB6 and FB21); and one of them exclusively to very polar alpha2-6 sialylated type 2 chain antigens (CRIS4) such as to 2-6 SnOC and even more polar gangliosides with three and more LacNAc units. These specificities could be correlated with the cellular binding of the antibodies as follows: whereas all antibodies bound to human CD 19 positive peripheral B cells, their reactivity with CD3 positive T cells was either nearly lacking (HD66, HB9), intermediate (about 65%: HB6, FB21) or strongly positive (CRIS4, 95%). Thus, the binding of the antibodies to 2-6 sialylated glycans with multiple lactosamine units appeared to determine their binding to T-cells.  (+info)

Enzymatic synthesis of alpha3'sialylated and multiply alpha3fucosylated biantennary polylactosamines. A bivalent [sialyl diLex]-saccharide inhibited lymphocyte-endothelium adhesion organ-selectively. (2/534)

Multifucosylated sialo-polylactosamines are known to be high affinity ligands for E-selectin. PSGL-1, the physiological ligand of P-selectin, is decorated in HL-60 cells by a sialylated and triply fucosylated polylactosamine that is believed to be of functional importance. Mimicking some of these saccharide structures, we have synthesized enzymatically a bivalent [sialyl diLex]-glycan, Neu5Acalpha2-3'Lexbeta1-3'Lexbeta1-3'(Neu5Acalpha2-3'Lexbeta1-3Lexbe ta1-6')LN [where Neu5Ac is N-acetylneuraminic acid, Lex is the trisaccharide Galbeta1-4(Fucalpha1-3)GlcNAc and LN is the disaccharide Galbeta1-4GlcNAc]. Several structurally related, novel polylactosamine glycans were also constructed. The inhibitory effects of these glycans on two L-selectin-dependent, lymphocyte-to-endothelium adhesion processes of rats were analysed in ex-vivo Stamper-Woodruff binding assays. The IC50 value of the bivalent [sialyl diLex]-glycan at lymph node high endothelium was 50 nm, but at the capillaries of rejecting cardiac allografts it was only 5 nm. At both adhesion sites, the inhibition was completely dependent on the presence of fucose units on the sialylated LN units of the inhibitor saccharide. These data show that the bivalent [sialyl diLex]-glycan is a high affinity ligand for L-selectin, and may reduce extravasation of lymphocytes at sites of inflammation in vivo without severely endangering the normal recirculation of lymphocytes via lymph nodes.  (+info)

Molecular cloning of a novel alpha2,3-sialyltransferase (ST3Gal VI) that sialylates type II lactosamine structures on glycoproteins and glycolipids. (3/534)

A novel member of the human CMP-NeuAc:beta-galactoside alpha2, 3-sialyltransferase (ST) subfamily, designated ST3Gal VI, was identified based on BLAST analysis of expressed sequence tags, and a cDNA clone was isolated from a human melanoma line library. The sequence of ST3Gal VI encoded a type II membrane protein with 2 amino acids of cytoplasmic domain, 32 amino acids of transmembrane region, and a large catalytic domain with 297 amino acids; and showed homology to previously cloned ST3Gal III, ST3Gal IV, and ST3Gal V at 34, 38, and 33%, respectively. Extracts from L cells transfected with ST3Gal VI cDNA in a expression vector and a fusion protein with protein A showed an enzyme activity of alpha2, 3-sialyltransferase toward Galbeta1,4GlcNAc structure on glycoproteins and glycolipids. In contrast to ST3Gal III and ST3Gal IV, this enzyme exhibited restricted substrate specificity, i.e. it utilized Galbeta1,4GlcNAc on glycoproteins, and neolactotetraosylceramide and neolactohexaosylceramide, but not lactotetraosylceramide, lactosylceramide, or asialo-GM1. Consequently, these data indicated that this enzyme is involved in the synthesis of sialyl-paragloboside, a precursor of sialyl-Lewis X determinant.  (+info)

Isolation and characterization of linear polylactosamines containing one and two site-specifically positioned Lewis x determinants: WGA agarose chromatography in fractionation of mixtures generated by random, partial enzymatic alpha3-fucosylation of pure polylactosamines. (4/534)

We report that isomeric monofucosylhexasaccharides, Galbeta1-4GlcNAcbeta1-3Galbeta1-4GlcNAcbeta1- 3Galbeta1-4(Fucalpha1-3) GlcNAc, Galbeta1-4GlcNAcbeta1-3Galbeta1-4(Fucalpha1-3) GlcNAcbeta1-3Galbeta1-4 GlcNAc and Galbeta1-4(Fucalpha1-3)GlcNAcbeta1-3Galbeta1- 4GlcNAcbeta1-3Galbeta1-4 GlcNAc, and bifucosylhexasaccharides Galbeta1-4GlcNAcbeta1-3Galbeta1-4(Fucalpha1-3) GlcNAcbeta1-3Galbeta1-4(Fucalpha1-3)GlcNAc, Galbeta1-4(Fucalpha1-3)GlcNAcbeta1-3Galbeta1- 4GlcNAcbeta1-3Galbeta1-4 (Fucalpha1-3)GlcNAc and Galbeta1-4(Fucalpha1-3)GlcNAcbeta1-3Galbeta1-4( Fucalpha1-3)GlcNAcbeta1-3Galbeta1-4GlcNAc can be isolated in pure form from reaction mixtures of the linear hexasaccharide Galbeta1-4GlcNAcbeta1-3Galbeta1-4GlcNAcbeta1- 3Galbeta1-4GlcNAc with GDP-fucose and alpha1,3-fucosyltransferases of human milk. The pure isomers were characterized in several ways;1H-NMR spectroscopy, for instance, revealed distinct resonances associated with the Lewis x group [Galbeta1-4(Fucalpha1-3)GlcNAc] located at the proximal, middle, and distal positions of the polylactosamine chain. Chromatography on immobilized wheat germ agglutinin was crucial in the separation process used; the isomers carrying the fucose at the reducing end GlcNAc possessed particularly low affinities for the lectin. Isomeric monofucosyl derivatives of the pentasaccharides GlcNAcbeta1-3Galbeta1-4GlcNAcbeta1-3Galbeta1- 4Gl cNAc and Galalpha1-3Galbeta1-4GlcNAcbeta1-3Galbeta1-4G lcN Ac and the tetrasaccharide Galbeta1-4GlcNAcbeta1-3Galbeta1-4GlcNAc were also obtained in pure form, implying that the methods used are widely applicable. The isomeric Lewis x glycans proved to be recognized in highly variable binding modes by polylactosamine-metabolizing enzymes, e.g., the midchain beta1,6-GlcNAc transferase (Leppanen et al., Biochemistry, 36, 13729-13735, 1997).  (+info)

Characterization of the substrate specificity of alpha1,3galactosyltransferase utilizing modified N-acetyllactosamine disaccharides. (5/534)

alpha1,3galactosyltransferase (alpha1,3GalT) catalyzes the synthesis of a range of glycoconjugates containing the Galalpha1,3Gal epitope which is recognized by the naturally occurring human antibody, anti-Gal. This enzyme may be a useful synthetic tool to produce a range of compounds to further investigate the binding site of anti-Gal and other proteins with a Galalpha1,3Gal binding site. Thus, the enzyme has been probed with a series of type 2 disaccharide-C8(Galbeta1-4GlcNAc-C8) analogs. The enzyme tolerated acceptors with modifications at C2 and C3 of the N-acetylglucosamine residue, producing a family of compounds with a nonreducing alpha1,3 linked galactose. Compounds that did not serve as acceptors were evaluated as inhibitors. Interestingly, the type 1 disaccharide-C8, Galbeta1-3GlcNAc-C8, was a good inhibitor of the enzyme (Ki = 270 microM vs. Km = 190 microM for Galbeta1-4GlcNAc-C8). A potential photoprobe, based on a modified type 2 disaccharide (octyl 3-amino-3-deoxy-3-N-(2-diazo-3, 3, 3-trifluoropropionyl-beta-D-galactopyranosyl-(1, 4)-2-acetamindo-2-deoxy-beta-D-glycopyranoside, (DTFP-LacNAc-C8)), was evaluated as an inhibitor of alpha1,3GalT. alpha1,3GalT bound DTFP-LacNAc-C8 with an affinity (Ki = 300 microM) similar to that displayed by the enzyme for LacNAc-C8. Additional studies were done to determine the enzyme's ability to transfer a range of sugars from UDP-sugar donors. The results of these experiments demonstrated that alpha1,3GalT has a strict specificity for UDP-Gal. Finally, inactivation studies with various amino acid modifiers were done to obtain information on the importance of different types of amino acids for alpha1,3GalT activity.  (+info)

Effects of egg-adaptation on the receptor-binding properties of human influenza A and B viruses. (6/534)

Propagation of human influenza viruses in embryonated chicken eggs (CE) results in the selection of variants with amino acid substitutions near the receptor-binding site of the hemagglutinin (HA) molecule. To evaluate the mechanisms by which these substitutions enable human virus growth in CE, we studied the binding of 10 human influenza A (H1N1, H3N2) and B strains, isolated and propagated solely in MDCK cells, and of their egg-adapted counterparts to preparations of cellular membranes, gangliosides, sialylglycoproteins, and sialyloligosaccharides. All egg-adapted variants differed from nonadapted strains by increased binding to the plasma membranes of chorio-allantoic (CAM) cells of CE and by the ability to bind to CAM gangliosides. In addition, there was no decrease in affinity for inhibitors within allantoic fluid. These findings indicate that growth of human influenza viruses in CE is restricted because of their inefficient binding to receptors on CAM cells and that gangliosides can play an important role in virus binding and/or penetration. The effects of the egg-adaptation substitutions on the receptor-binding properties of the viruses include (i) enhancement of virus binding to the terminal Sia(alpha2-3)Gal determinant (substitutions in HA positions 190, 225 of H1N1 strains and in position 186 of H3N2 strains); (ii) a decrease of steric interference with more distant parts of the Sia(alpha2-3Gal)-containing receptors (a loss of glycosylation sites in positions 163 of H1 HA and 187 of type B HA); and (iii) enhanced ionic interactions with the negatively charged molecules due to charged substitutions at the tip of the HA [187, 189, 190 (H1), and 145, 156 (H3)]. Concomitantly with enhanced binding to Sia(alpha2-3)Gal-terminated receptors, all egg-adapted variants decreased their affinity for equine macroglobulin, a glycoprotein bearing terminal 6'-sialyl(N-acetyllactosamine)-moieties.  (+info)

Lipid A modifications characteristic of Salmonella typhimurium are induced by NH4VO3 in Escherichia coli K12. Detection of 4-amino-4-deoxy-L-arabinose, phosphoethanolamine and palmitate. (7/534)

Two-thirds of the lipid A in wild-type Escherichia coli K12 is a hexa-acylated disaccharide of glucosamine in which monophosphate groups are attached at positions 1 and 4'. The remaining lipid A contains a monophosphate substituent at position 4' and a pyrophosphate moiety at position 1. The biosynthesis of the 1-pyrophosphate unit is unknown. Its presence is associated with lipid A translocation to the outer membrane (Zhou, Z., White, K. A., Polissi, A., Georgopoulos, C., and Raetz, C. R. H. (1998) J. Biol. Chem. 273, 12466-12475). To determine if a phosphatase regulates the amount of the lipid A 1-pyrophosphate, we grew cells in broth containing nonspecific phosphatase inhibitors. Na2WO4 and sodium fluoride increased the relative amount of the 1-pyrophosphate slightly. Remarkably, NH4VO3-treated cells generated almost no 1-pyrophosphate, but made six major new lipid A derivatives (EV1 to EV6). Matrix-assisted laser desorption ionization/time of flight mass spectrometry of purified EV1 to EV6 indicated that these compounds were lipid A species substituted singly or in combination with palmitoyl, phosphoethanolamine, and/or aminodeoxypentose residues. The aminodeoxypentose residue was released by incubation in chloroform/methanol (4:1, v/v) at 25 degrees C, and was characterized by 1H NMR spectroscopy. The chemical shifts and vicinal coupling constants of the two anomers of the aminodeoxypentose released from EV3 closely resembled those of synthetic 4-amino-4-deoxy-L-arabinose. NH4VO3-induced lipid A modification did not require the PhoP/PhoQ two-component regulatory system, and also occurred in E. coli msbB or htrB mutants. The lipid A variants that accumulate in NH4VO3-treated E. coli K12 are the same as many of those normally found in untreated Salmonella typhimurium and Salmonella minnesota, demonstrating that E. coli K12 has latent enzyme systems for synthesizing these important derivatives.  (+info)

Role of lactosyl glycan sequences in inhibiting enteropathogenic Escherichia coli attachment. (8/534)

Previously, we found that asialo-lactosamine sequences served as receptors for enteropathogenic Escherichia coli (EPEC) binding to Chinese hamster ovary (CHO) cells. In the present report, we have extended these earlier results by examining the ability of lactosamine- or fucosylated lactosamine-bovine serum albumin (BSA) glycoconjugates to inhibit EPEC, strain E2348/69, binding to HEp-2 cells. We found that, consistent with our previous findings with CHO cells, N-acetyllactosamine-BSA was the most effective inhibitor of EPEC localized adherence to HEp-2 cells, with Lewis X-BSA being the next best inhibitor. Further investigation revealed that coincubating EPEC E2348/69 with these BSA glycoconjugates alone caused a decrease in the expression of the bundle-forming pilus structural subunit (BfpA) and intimin by the bacteria. BfpA and intimin expression were reduced to the greatest extent by N-acetyllactosamine-BSA and Lewis X-BSA, respectively. These results suggest that the glycoconjugate inhibition of EPEC binding to HEp-2 cells might be achieved, wholly or in part, by an active mechanism that is distinct from simple competitive antagonism of receptor-adhesin interactions.  (+info)

FIGURE 1. In vivo Ab production after the intranasal immunization with saline, HSA or sugar-conjugated HSA in BALB/c (A-D) and C57BL/6 (E and F) mice. Serum samples were taken after prime (▦), boost (□), and challenge (▪) as described in Materials and Methods. Ab of IgG (A and E), IgM, IgA, and IgG subclasses (B) specific for HSA were measured by indirect ELISA and estimated by endpoint titer. IgE titers specific for HSA (C and F) and the volume of serum total IgE (D) were determined by sandwich ELISA. Levels of HSA-specific IgE were presented as the absorbance at 450 nm from duplicate wells of 1/4 serum dilution. Results show the mean ± SEM of four individual serum per group. Data are representative of three (A-D) and two (E and F) separate experiments.. ...
α-1,6-mannosyltransferase (EC 2.4.1.-); α-1,4-N-acetylglucosaminyltransferase (EC 2.4.1.-); α-1,4-N-acetylgalactosaminyltransferase (EC 2.4.1.-); GDP-Man: inositol-phosphorylceramide transferase (EC 2.4.1.-); UDP-Gal: β-galactoside α-1,4-galactosyltransferase (EC 2.4.1.-); UDP-Gal: lactose/N-acetyl-lactosamine α-1,4-galactosyltransferase (EC 2.4.1.- ...
α-1,6-mannosyltransferase (EC 2.4.1.-); α-1,4-N-acetylglucosaminyltransferase (EC 2.4.1.-); α-1,4-N-acetylgalactosaminyltransferase (EC 2.4.1.-); GDP-Man: inositol-phosphorylceramide transferase (EC 2.4.1.-); UDP-Gal: β-galactoside α-1,4-galactosyltransferase (EC 2.4.1.-); UDP-Gal: lactose/N-acetyl-lactosamine α-1,4-galactosyltransferase (EC 2.4.1.- ...
A - Tilt: 3° - Segments: 1( 28- 47), 2( 105- 126), 3( 135- 153), 4( 158- 175), 5( 186- 203), 6( 205- 221), 7( 233- 250), 8( 282- 304), 9( 321- 337), 10( 343- 358), 11( 369- 389), 12( 406- 427), 13( 434- 453 ...
Looking for online definition of Amino sugars metabolism in the Medical Dictionary? Amino sugars metabolism explanation free. What is Amino sugars metabolism? Meaning of Amino sugars metabolism medical term. What does Amino sugars metabolism mean?
The use of small carbohydrates that stabilize proteins from misfolding is important from pharmaceutical point of view. We have investigated the role of small isomeric amino sugars on the in vitro aggregation of insulin amyloid. Using mass spectrometry, we screened 6 isomeric aminosugars for their role on inhibition of insulin amyloid formation and the results were compared with transmission electron microscopy imaging. We found that three N-acetylamino sugars promote insulin fibril formation. Among three isomeric aminosugars studied, only galactosamine showed few fibrils whereas other two isomers showed enhanced fibrils. The results demonstrated here may contribute to future designing of small amine derivatised galactose sugars as amyloid inhibitors and understanding their action ...
Catalyzes the conversion of UDP-4-keto-arabinose (UDP-Ara4O) to UDP-4-amino-4-deoxy-L-arabinose (UDP-L-Ara4N). The modified arabinose is attached to lipid A and is required for resistance to polymyxin and cationic antimicrobial peptides.
Glucosamine sulfate is a naturally occurring amino sugar. Amino sugars are key constituents of larger compounds called glucosaminoglycans and glycoproteins, whi
The group of 17 opportunistic pathogens linked to severe infections in cystic fibrosis and other immunocompromised conditions has been known as the Burkholderia cepacia complex.[1] The inner Kdo residue of Burkholderia lipopolysaccharide (LPS), which is highly conserved across the genus, is flanked by 4-amino-4-deoxy-L-arabinose units (Ara4N).[2] Furthermore, the binding of Ara4N to the phosphate groups of lipid A has been purported as one of the reasons for hindered interaction with cationic agents and consequently, to induce antibiotic resistance.[3] We set out to synthesize a series of tenable Ara4N transferase (ArnT) inhibitors with the prospect of impeding the biosynthetic pathway towards activated Ara4N species.[4] By the same token, we intend to inhibit the transfer of Ara4N residues both to Burkholderia LPS core and lipid A in vitro. Our synthetic endeavours en route to C-glycosidic derivatives mimicking either the transition state of glycosyl transfer or ArnT natural substrate will be ...
Chemo-enzymatic modification of poly-N-acetyllactosamine (LacNAc) oligomers and N,N-diacetyllactosamine (LacDiNAc) based on galactose oxidase treatment
Gelatinase B (MMP-9) and galectin-3 are widely known to participate in tumor cell invasion and metastasis. Glycans derived from MMP-9 expressed in MCF-7 breast cancer and THP-1 myeloid leukemia cells were compared with those from MMP-9 expressed in natural neutrophils. The many O-linked glycans of neutrophil gelatinase B presented a cluster of mainly galactosylated core II structures, 46% of which were ligands for galectin-3; 11% contained two to three N-acetyllactosamine repeating units that are high-affinity ligands for the lectin. The glycan epitopes thus provide MMP-9 with both high-affinity and (presumably) high-avidity interactions with galectin-3. In contrast, the O-glycans released from MMP-9 expressed in MCF-7 and THP-1 cells were predominantly sialylated core I structures. Only 10% of MCF-7 and THP-1 gelatinase B O-glycans were ligands for galectin-3 and contained only a maximum single N-acetyllactosamine repeat. Consistent with the glycan analysis, surface plasmon resonance binding ...
New amino sugars which are glucopyranosyl and oligoglucosidyl derivatives of 4,6-bisdesoxy-4-(4,5,6-trihydroxy-3-hydroxymethylcyclohex-2-en-1-ylamino)-α-D-glucopyranose inhibit glycoside hydrolases of the digestive tract. The compounds, of which O-{4,6-bisdesoxy-4-[1S-(1,4,6/5)-4,5,6-trihydroxy-3-hydroxymethylcyclohex-2-en-1-ylamino]-α-D-glucopyranosyl}-(1→4)-O-α-D-glucopyranosyl-(1→4)-D-glucopyranose is a representative embodiment, demonstrate both saccharase and amylase inhibiting properties.
Information for Muramic acid 1114-41-6 including Muramic acid CAS NO 1114-41-6, Muramic acid Suppliers, Muramic acid Manufacturers, related products of Muramic acid.
Bifunctional enzyme that catalyzes the oxidative decarboxylation of UDP-glucuronic acid (UDP-GlcUA) to UDP-4-keto-arabinose (UDP-Ara4O) and the addition of a formyl group to UDP-4-amino-4-deoxy-L-arabinose (UDP-L-Ara4N) to form UDP-L-4-formamido-arabinose (UDP-L-Ara4FN). The modified arabinose is attached to lipid A and is required for resistance to polymyxin and cationic antimicrobial peptides ...
Bifunctional enzyme that catalyzes the oxidative decarboxylation of UDP-glucuronic acid (UDP-GlcUA) to UDP-4-keto-arabinose (UDP-Ara4O) and the addition of a formyl group to UDP-4-amino-4-deoxy-L-arabinose (UDP-L-Ara4N) to form UDP-L-4-formamido-arabinose (UDP-L-Ara4FN). The modified arabinose is attached to lipid A and is required for resistance to polymyxin and cationic antimicrobial peptides ...
1MDZ: Structural studies of Salmonella typhimurium ArnB (PmrH) aminotransferase: A 4-amino-4-deoxy-L-arabinose lipopolysaccharide modifying enzyme
UDP-4-amino-4-deoxy-L-arabinose formyltransferase / UDP-glucuronic acid dehydrogenase (UDP-4-keto-hexauronic acid decarboxylating) [EC:2.1.2.13 1.1.1.305 ...
Enzymatic Protein Deglycosylation Kit: The E-DEGLY Kit contains all the enzymes and reagents needed to completely remove all N-linked and simple O-linked carbohydrates from glycoproteins, as well as cleave complex core O-linked carbohydrates including those containing polylactosamine.
1GX4: Structural Basis of Ordered Binding of Donor and Acceptor Substrates to the Retaining Glycosyltransferase, Alpha -1,3 Galactosyltransferase
Support your muscles, joints and ligaments with Glucosamine HCI. Essential for the health of connective tissues, blood vessels and cartilage, glucosamine is a naturally occurring amino sugar which can be hard to obtain through diet alone. This formula helps support your health, with a salt-free capsule that
|p|The amino sugar Glucosamine consists of glucose combined with the amino acid Glutamine. It is an important component of the mucopolysaccharides, which provide structure to bone, cartilage and other body tissues. Several studies have shown that besides
NATURAJOINT SUPERIOR GLUCOSAMINE HCL FOR PROVISION OF HEALTHY, FLEXIBLE JOINTS Pure human pharmaceutical grade 99.9% soluble, with a measured amount of maganese ascorbate to aid digestion and absorption. Gl;ucoasmine is an amino sugar used to build tendons, ligaments, cartilage and synovial fluid (joint oil). It stim
China Sulfo Series catalog of P-Toluene Sulfonyl Chloride (PTSC), O/P-Toluene Sulfonamide (OPTSA) provided by China manufacturer - Heze Kingvolt Chemical Co., Ltd., page1.
... ! Chloromycetin is a broad spectrum antibiotic originally isolated from Streptomyces venezuelae. Chloromycetin is rapidly absorbed from the gastrointestinal tract when given by mouth and widely distributed throughout most body tissues and fluids.
refined sugar ( Page 3 ) 제조업체 주소록 - EC21에는 세계곳곳에서 등록한 3,000,000개의 refined sugar 수입업체, 수출업체, 제조업체, 공급업체, 도매업체, 유통업체, 무역회사, 셀러 등이 있습니다. EC21을 통해 쉽게 거래선을 발굴 하세요.
German Research Foundation; SCHA 1693/1-1. Functional specialization of proinflammatory dendritic cells in Psoriasis. Psoriasis is a common chronic inflammatory skin disease in which dendritic cells (DC) are thought to orchestrate the pathogenic Th17/Th1-dominated immune response. Our studies demonstrate the functional specialization of slan (6-sulfo LacNAc+) DC as an important proinflammatory DC subtype in psoriasis. Previously, we identified slanDC and reported on their proinflammatory function. In the meanwhile slanDC have also been described in other chronic inflammatory diseases such as lupus erythematosus, Crohns disease and multiple sclerosis. Skin lesion from psoriasis patients contain increased numbers of activated slanDC expressing the key proinflammatory molecules TNF-a, IL-23 and iNOS. Complexes of autologous nucleic acids and the antimicrobial peptide LL37 (Cathelicidin) triggering Toll-like receptors (TLR) are regarded as important stimuli for cell activation in psoriasis. For ...
Catalyzes the conversion of UDP-4-keto-arabinose (UDP-Ara4O) to UDP-4-amino-4-deoxy-L-arabinose (UDP-L-Ara4N). The modified arabinose is attached to lipid A and is required for resistance to polymyxin and cationic antimicrobial peptides.
Keratan sulfate (KS) is a glycosaminoglycan (GAG) type consisted of a sulfated poly-N-acetyl lactosamine chain. Besides acting as a constitutive molecule of the extracellular matrices, this GAG also plays a role as a hydrating and signaling agent in
The amino sugar Glucosamine consists of glucose combined with the amino acid Glutamine. It is an important component of the mucopolysaccharides, which provide structure to bone, cartilage and other body tissues. Several studies have shown that besides stimulating the production of cartilage, glucosamine helps to reduce
Organic compounds that have a tetrahydronaphthacenedione ring structure attached by a glycosidic linkage to the amino sugar daunosamine ...
cytochrome P450 [cytochrome P450 hydroxylase PiKC] GTGCGCCGTACCCAGCAGGGAACGACCGCTTCTCCCCCGGTACTCGACCTCGGGGCCCTG GGGCAGGATTTCGCGGCCGATCCGTATCCGACGTACGCGAGACTGCGTGCCGAGGGTCCG GCCCACCGGGTGCGCACCCCCGAGGGGGACGAGGTGTGGCTGGTCGTCGGCTACGACCGG GCGCGGGCGGTCCTCGCCGATCCCCGGTTCAGCAAGGACTGGCGCAACTCCACGACTCCC CTGACCGAGGCCGAGGCCGCGCTCAACCACAACATGCTGGAGTCCGACCCGCCGCGGCAC ACCCGGCTGCGCAAGCTGGTGGCCCGTGAGTTCACCATGCGCCGGGTCGAGTTGCTGCGG CCCCGGGTCCAGGAGATCGTCGACGGGCTCGTGGACGCCATGCTGGCGGCGCCCGACGGC CGCGCCGATCTGATGGAGTCCCTGGCCTGGCCGCTGCCGATCACCGTGATCTCCGAACTC CTCGGCGTGCCCGAGCCGGACCGCGCCGCCTTCCGCGTCTGGACCGACGCCTTCGTCTTC CCGGACGATCCCGCCCAGGCCCAGACCGCCATGGCCGAGATGAGCGGCTATCTCTCCCGG CTCATCGACTCCAAGCGCGGGCAGGACGGCGAGGACCTGCTCAGCGCGCTCGTGCGGACC AGCGACGAGGACGGCTCCCGGCTGACCTCCGAGGAGCTGCTCGGTATGGCCCACATCCTG CTCGTCGCGGGGCACGAGACCACGGTCAATCTGATCGCCAACGGCATGTACGCGCTGCTC TCGCACCCCGACCAGCTGGCCGCCCTGCGGGCCGACATGACGCTCTTGGACGGCGCGGTG GAGGAGATGTTGCGCTACGAGGGCCCGGTGGAATCCGCGACCTACCGCTTCCCGGTCGAG ...
By Nancy Appleton, Ph.D. Author of Lick The Sugar Habit and Lick The Sugar Habit Sugar Counter. Sugar can suppress the immune system. Sugar upsets the mineral relationships in the body.
pressure or other symptoms? These all can be signs of a sugar problem. We have evolved from early man having digestive mechanisms to digest ...
Define sugar: a sweet crystallizable material that consists wholly or essentially of sucrose, is colorless or white when pure… - sugar in a sentence
Join SugarDaddyForMe.com and find the perfect sugar daddy in Gisela, AZ. Connect today on the largest sugar daddy dating site with over 4M+ singles online.
Hersheys Sugar Free Twizzlers are sugar free with 20% fewer calories. However, they contain about the same level of fat as their regular counterparts.
New API has been added to telepathy-gabble and telepathy-salut to support the work on the collaboration framework, which results in needing 0.9.16 for tp-gabble and 0.3.13 for tp-salut. One of the goals of the collaboration refactoring was dropping functionality in sugar that has been implemented in telepathy-mission-control, so Sugar now depends on tp-mission-control 5.4.3. ...
You may query a listing of Alcohol Policy Changes based on Topic, Jurisdiction, and/or Year by selecting items from the "View Policy Changes" menu. Multiple items may be selected from each menu of options. Once you select an item(s), a list of corresponding Policy Changes will display.. Additionally, you may view a count of changes by Year, Jurisdiction, or Topic by selecting the corresponding option.. ...
Many monoclonal antibodies that react with the lacto-N-fucopentaose III (LNF III) antigenic determinant, Gal beta 1-4(Fuc alpha 1-3)GlcNAc beta 1-3Gal beta 1-4Glc, have been described recently. The terminal trisaccharide of this determinant, fucosyllactosamine, is present on glycolipids and glycoproteins and on the surface of granulocytes, monocytes, and other cells. To study the structural and genetic diversity of these antibodies, syngeneic anti-idiotypic monoclonal antibodies were produced in BALB/c mice against PMN 6, a monoclonal antibody directed against this sequence. Anti-idiotypic antibodies 6B1 and 6C4 reacted with 50% of a panel of 20 anti-LNF III monoclonal antibodies, whereas 6A3 reacted strongly only with PMN 6. This indicates that the determinants recognized by 6C4 and 6B1 represent major cross-reactive idiotopes of this family of antibodies. The binding of idiotypic antibodies to a glycolipid bearing this antigenic determinant was completely inhibited by the three anti-idiotypic ...
Glucosamine is a compound known as an aminosugar, and is naturally concentrated in human connective tissue and joint synovial fluid. Several forms of glucosamine are available. However, glucosamine sulfate appears to have superior absorption and effectiveness.. The sulfur portion of the compound also has nutritional value since the body can use it to produce disulfate bonds that further contribute to the strength and integrity of connective tissue. In fact, recent studies have shown that glucosamine sulfate supplementation may be as effective as nonsteroidal anti-inflammatory drugs (NSAIDs) for relief of arthritis pain and inflammation.. Chondroitin sulfate (CS) is a mucopolysaccharide and natural constituent of cartilage, connective tissue and bone. Clinical research has shown that when taken as a nutritional supplement, CS can provide several important compounds vital to healthy connective tissue. CS has been shown to produce positive results in a variety of joint complaints, and has gained ...
Indre Arna is a settlement in Arna borough in Bergen, Norway. While Indre Arna is relatively far from most of the city by road, an 8-minute train journey through Ulriken connects Indre Arna to the city centre. On January 1, 2008, the Indre Arna urban settlement, as defined by Statistics Norway, had a population of 6198. The urban settlement covered a land area of 3.80 square kilometres, and had a population density of 1631 per square kilometre.[1] Arna Church is located in the village. ...
Our previous observations that human CD8 TIL increased their secretion of IFN-γ after ex vivo treatment with disaccharide LacNAc prompted us to test GCS-100, a polymeric galectin ligand approved for clinical trials. The results reported here indicate that GCS-100 is as efficient as LacNAc in boosting TIL to be cytotoxic and to secrete different cytokines, not only CD8+ but also CD4+ TIL. This effect was obtained at concentrations (5 μg/mL) much lower than those used to induce apoptosis of tumor cells (,100 μg/mL), the activity that prompted its administration to cancer patients (30).. Why do galectin-3 ligands improve human TIL function? Our working hypothesis is that TILs have been stimulated by antigen recently and that activation could modify the expression of enzymes of the N-glycosylation pathway and change the structure of N-glycans exposed at the cell surface, as shown for murine T cells (45). We surmise that the recently activated TILs, compared with resting T cells, harbor a set of ...
Cathy Davey Health. Buy Now Foods Glucosamine & M.S.M, 180 Caps, 750/250 Mg. Glucosamine & MSM combines the nutritive benefits of two potent dietary supplements. Glucosamine is an amino sugar derived from the chitin of shellfish tha
glucosamine。相關商品比價搜尋,Natural Farm自然牧場 紐西蘭頂級天然零食 天然羊肉捲 150g x 2入【藥神網】跑天下錠.含Glucosamine軟骨素,鯊魚軟骨、碳酸鈣和D3於一錠【藥神網】港香蘭 骨天樂膠囊.含Glucosamine葡萄糖胺[玉山最低比價網] COSCO KS GLUCOSAMINE PLUS MSM KS 萄萄糖胺 +MSM 240粒 _C637595 $596
How to Sift Powdered Sugar. Powdered sugar absorbs moisture from the air, forming hardened lumps that can affect the texture of your baking projects. Sifting removes these lumps and makes the sugar fluffier by adding air. Any fine mesh...
Join SugarDaddyForMe.com and find the perfect sugar daddy in Llano Quemado, NM. Connect today on the largest sugar daddy dating site with over 4M+ singles online.
Sugar can be hard to say no to, especially if youre stressed, tired, or around it during the holidays. Use these tips to stop eating sugar.
There are no clinical studies that clearly demonstrate that there are any known side effects to using glucosamine found in Synflex.
ေဆးပညာအခ်က္အလက္မ်ားကို Hello Sayarwon တြင္ရွာေဖြႏုိင္ျပီး၊ Glucosamine (ဂလူကိုဆာမင္း) , ၏ ေဆးညႊန္းမ်ား၊ ေဘးထြက္ဆိုးက်ိဳးမ်ားႏွင့္သတိေပးခ်က္မ်ားရွာေဖြႏုိင္ပါသည္။
Dongguan Bai-tong Hardware Machinery Factory হল সেরা আইভিসি সম্পূরক, Glucosamine সম্পূরক এবং ভিটামিন সি সাপ্লাইমেন্ট সরবরাহকারী, আমরা ভাল মানের পণ্য হয়েছে.
Kornfeld S; Glaser L (1962). "The synthesis of thymidine-linked sugars. V. Thymidine diphosphate-amino sugars". J. Biol. Chem. ... This enzyme participates in aminosugars metabolism. As of late 2007, two structures have been solved for this class of enzymes ...
... caramelization of sugars, and the Maillard reaction of amino acids. Raised to a high enough temperature, meat blackens from ...
Amino sugar Glucosamine. ...
"Amino-Acids and Sugars in Rectal Feeding". Br Med J. 1 (2739): 1361-7. doi:10.1136/bmj.1.2739.1361. JSTOR 25302025. PMC 2299894 ...
They have sugar chains (glycans) added to conserved amino acid residues.[4][21] In other words, antibodies are glycoproteins.[4 ... which is found as a terminal sugar on glycosylated cell surface proteins, and generated in response to production of this sugar ... α and γ contain approximately 450 amino acids, whereas μ and ε have approximately 550 amino acids.[2] ... The approximate length of a light chain is 211 to 217 amino acids.[2] Each antibody contains two light chains that are always ...
This enzyme participates in amino sugars metabolism and glycan biosynthesis. As of late 2007, 10 structures have been solved ... diphospho-N-acetyl-2-amino-2-deoxyglucose 3-enolpyruvyltransferase, phosphopyruvate-uridine diphosphoacetylglucosamine ...
"Award Abstract #1213845 Enhancing the NMR Characterization of Amino Sugars". National Science Foundation. Archived from the ...
The produced nectar is rich in sugars and amino acids. Their function may be to attract ants (or other organisms) for ...
... is an amino sugar acid. In terms of chemical composition, it is the ether of lactic acid and glucosamine. It ...
Products of digestion (sugars, amino acids, and fatty acids) are absorbed into the bloodstream here. The suspensory muscle of ... Proteins are degraded into small peptides and amino acids before absorption.[19] Chemical breakdown begins in the stomach and ... Aminopeptidase and dipeptidase free the end amino acid products.. *Lipids (fats) are degraded into fatty acids and glycerol. ... Some carbohydrates are degraded into simple sugars, or monosaccharides (e.g., glucose). Pancreatic amylase breaks down some ...
The plant roots secrete amino acids and sugars into the rhizosphere. The rhizobia move toward the roots and attach to the root ... Bradyrhizobium betae was isolated from tumor-like root deformations on sugar beets; they have an unknown symbiotic status. ...
... is an amino sugar derived from glucose. It is often used as an excipient in pharmaceuticals and in conjunction with ...
... such as sugars or amino acids, must enter the cell, and certain products of metabolism must leave the cell. Such molecules can ... The penultimate sugar is galactose and the terminal sugar is sialic acid, as the sugar backbone is modified in the Golgi ... amino acids and sugars). Some eukaryotic cells also have cell walls, but none that are made of peptidoglycan. The outer ... amino acids, nucleic acids, carbohydrates, proteins, and ions) from diffusing across the membrane, but generally allows for the ...
"A classification of nucleotide-diphospho-sugar glycosyltransferases based on amino acid sequence similarities". Biochem. J. 326 ... A classification of glycosyltransferases using nucleotide diphospho-sugar, nucleotide monophospho-sugar and sugar phosphates ( ... These enzymes catalyse the transfer of sugar moieties from activated donor molecules to specific acceptor molecules, forming ...
The caterpillars produce a sweet-tasting liquid containing sugars and amino acids. In return, the ants provide the caterpillars ...
... homochirality is a common property of amino acids and sugars; almost all biologically produced chiral amino acids are L-chiral ... "How did protein amino acids get left-handed while sugars got right-handed?" (PDF). Term Paper for Physics 569*. Retrieved June ... A high asymmetric amplification of the enantiomeric excess of sugars are also present in the amino acid catalyzed asymmetric ... L-amino acids during recrystallization: a hypothesis accounting for the origin of L-amino acids in the biosphere". Chem. Comm ...
Substances like sugars and amino acids decompose readily and are considered labile. Cellulose and hemicellulose, which are ... and include sugars, amino acids and mineral nutrients. Leaching is more important in wet environments, and much less important ...
Organic substances such as sugars and protein components (amino acids) were synthesised. These molecules "accumulated till the ... These further combined with oxygen and ammonia to produce hydroxy- and amino-derivatives, such as carbohydrates and proteins. ... Miller, Stanley L. (1953). "A Production of Amino Acids Under Possible Primitive Earth Conditions". Science. 117 (3046): 528-9 ... such as amino acids. This provided direct experimental support for the second point of the "soup" theory, and it is around the ...
It is usually composed of amino acids, fats, sugars, vitamins, and minerals. This diet, however, lacks whole or partial protein ... The elemental diet consists of a mixture of essential amino acids with non-essential amino acids. 90% of the energy from the ... However, due to the diet's consisting of fully broken down amino acids, the digestive loading is shifted from the gut to the ... The elemental diet provides a high nitrogen source for patients from amino acids and acts as a medical bypass. Because the diet ...
Teplyakov A, Obmolova G, Badet-Denisot MA, Badet B (1999). "The mechanism of sugar phosphate isomerization by glucosamine 6- ... This enzyme participates in glutamate metabolism and aminosugars metabolism. As of late 2007, 12 structures have been solved ...
In 1912, he undertook studies of the reaction between amino acids and sugars. This work is considered one of his major ...
... are amino sugars created by adding an amine group to a hexose. Examples include: Fructosamine (based upon fructose ...
The Chemistry and Biology of Compounds Containing Amino Sugars. Academic Press. ISBN 1-4832-5764-9. Wei, Shaopeng; Zhang, ...
The amino acids and sugars presumably help to decrease the ice content colligatively; however, they probably also have a direct ... During winter, their haemolymph contains low molecular weight cryoprotectants such as amino acids, especially proline (up to ...
The Chemistry and Biology of Compounds Containing Amino Sugars. Academic Press. ISBN 1-4832-5764-9. Type strain of Streptomyces ...
Many sugars are ketones, known collectively as ketoses. The best known ketose is fructose, which exists as a cyclic hemiketal, ... and amino acids in most vertebrates, including humans. Ketone bodies are elevated in the blood (ketosis) after fasting, ... Representative ketones, from the left: acetone, a common solvent; oxaloacetate, an intermediate in the metabolism of sugars; ... Acetoacetate is an intermediate in the Krebs cycle which releases energy from sugars and carbohydrates.[22] ...
J:188842 Bergfeld AK, et al., Metabolism of vertebrate amino sugars with N-glycolyl groups: elucidating the intracellular fate ...
Glucosamine sulphate is an amino sugar formed from glucose and the amino acid glutamine. Normally made by the digestive process ... S-adenosylmethionine (SAM) is formed in the body by the amino acid methionine and adenosyl-triphosphate (ATP). SAM has been ...
where So is the initial reducing sugar concentration (g L-1), S is the final reducing sugar concentration (g L-1) until the ... Gene inactivation in Lactococcus lactis branched-chain amino acid biosynthesis. Journal of Bacteriology 175:4383-4390. [ Links ... 1998) obtained 86 g L-1 lactic acid with an initial sugar concentration of 180 g L-1. Serna and Rodriguez (2007) obtained 40.5 ... Gluconacetobacter diazotrophicus, a sugarcane endosymbiont, produces a bacteriocin against Xanthomonas albilineans, a sugar ...
It also helps regulate blood sugar levels, stimulates wound healing and produces growth hormones.9 ... Unlike nonessential amino acids, essential amino acids cant be made by your body and must be obtained through your diet. ... What Are Essential Amino Acids?. Amino acids are organic compounds composed of nitrogen, carbon, hydrogen and oxygen, along ... Conditionally Essential Amino Acids. There are several nonessential amino acids that are classified as conditionally essential. ...
New amino sugars which are glucopyranosyl and oligoglucosidyl derivatives of 4,6-bisdesoxy-4-(4,5,6-trihydroxy-3- ... Amino sugar compound. US4273765 *. Feb 9, 1979. Jun 16, 1981. Hoffmann-La Roche Inc.. Amino sugar derivatives containing ... They form a series of which the amino sugar derivative [C19 H33 O13 N] is to be regarded as the initial member; i.e. R is a ... Amino-sugar derivatives, process for their preparation and pharmaceutical composition thereof. US4197292 *. Feb 2, 1979. Apr 8 ...
SUGARS containing an amino group. GLYCOSYLATION of other compounds with these amino sugars results in AMINOGLYCOSIDES.. *Drugs ...
In chemistry, an amino sugar (or more technically a 2-amino-2-deoxysugar) is a sugar molecule in which a hydroxyl group has ... More than 60 amino sugars are known, with one of the most abundant being N-Acetyl-d-glucosamine, which is the main component of ... Amino Sugars at the US National Library of Medicine Medical Subject Headings (MeSH). ... This can be achieved using azides with subsequent reduction yielding the amino sugar. One advantage of introducing azide moiety ...
This amino acid-sugar conjugate was prepared by solution synthesis in analogy to the natural fructosyl-amino acids. Furthermore ... Risseeuw MD, Overhand M, Fleet GW, Simone MI (2007) A compendium of sugar amino acids (SAA): scaffolds, peptide- and glyco- ... Gruner SAW, Locardi E, Lohof E, Kessler H (2002) Carbohydrate-based mimetics in drug design: sugar amino acids and carbohydrate ... Lac-l-TTA, a novel lactose-based amino acid-sugar conjugate for anti-metastatic applications. ...
... one each for sugars, neutral amino acids, basic amino acids, and Na+ are joined together, as in a mosaic. ... Transport of Sugars and Amino Acids in the Intestine: Evidence for a Common Carrier ... Transport of Sugars and Amino Acids in the Intestine: Evidence for a Common Carrier ... Transport of Sugars and Amino Acids in the Intestine: Evidence for a Common Carrier ...
SUGARS containing an amino group. GLYCOSYLATION of other compounds with these amino sugars results in AMINOGLYCOSIDES. ... "Amino Sugars" by people in this website by year, and whether "Amino Sugars" was a major or minor topic of these publications. ... "Amino Sugars" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject ... Below are the most recent publications written about "Amino Sugars" by people in Profiles. ...
What is Amino sugars metabolism? Meaning of Amino sugars metabolism medical term. What does Amino sugars metabolism mean? ... Looking for online definition of Amino sugars metabolism in the Medical Dictionary? Amino sugars metabolism explanation free. ... amino sugar. (redirected from Amino sugars metabolism). Also found in: Encyclopedia. amino sugar. a MONOSACCHARIDE in which an ... Amino sugars metabolism , definition of Amino sugars metabolism by Medical dictionary https://medical-dictionary. ...
Proline and serine are the predominant amino acids. High content of essential amino acids, minerals and the sugar mannitol ... free amino acids and sugars. Palynological analysis showed that the predominant pollen was monofloral from Senna sp. species ( ... Proline and serine are the predominant amino acids. High content of essential amino acids, minerals and the sugar mannitol ... Identification of Sugar, Amino Acids and Minerals from the Pollen of Jandaíra Stingless Bees (Melipona subnitida) ...
Excretion by the Malpighian Tubules of the Stick Insect, Dixippus Morosus (Orthoptera, Phasmidae): Amino Acids, Sugars and Urea ... Excretion by the Malpighian Tubules of the Stick Insect, Dixippus Morosus (Orthoptera, Phasmidae): Amino Acids, Sugars and Urea ... Excretion by the Malpighian Tubules of the Stick Insect, Dixippus Morosus (Orthoptera, Phasmidae): Amino Acids, Sugars and Urea ... Excretion by the Malpighian Tubules of the Stick Insect, Dixippus Morosus (Orthoptera, Phasmidae): Amino Acids, Sugars and Urea ...
Amino Acid and Sugar Transport in Cells Permissively Infected with Simian Virus 40. Michael S. Miller, Lester Kwock and Donald ... Amino Acid and Sugar Transport in Cells Permissively Infected with Simian Virus 40 ... Amino Acid and Sugar Transport in Cells Permissively Infected with Simian Virus 40 ... Amino Acid and Sugar Transport in Cells Permissively Infected with Simian Virus 40 ...
Here, we have examined the effect of leptin on sugar and amino acids absorption in the human model of intestina ... Studies in rodents have shown that leptin controls sugars and glutamine entry in the enterocytes by regulating membrane ... Here, we have examined the effect of leptin on sugar and amino acids absorption in the human model of intestinal cells Caco-2 ... Previous Document: Amino acids downregulate the expression of several autophagy-related genes in rainbow trout myoblast.... ...
... sugars and amino acids Aleksandra Marsh1, Rachael E. H. Miles1, Grazia Rovelli. 1, Alexander G. Cowling1, Lucy Nandy2, Cari S. ... The chemical compounds studied include dicarboxylic acids, amino acids, sugars and polyols. These data provide a comprehensive ... Abstract. Hygroscopicity data for 36 organic compounds, including amino acids, organic acids, alcohols and sugars, are ... Similarly, amino acid hygroscopicity is under-predicted by UNIFAC predictions, a consequence of the original data used in the ...
... and methionine on the measurement of reducing sugars using a ... This study evaluated the interference of the amino acids ... Amino acids interference on the quantification of reducing sugars by the 3,5-dinitrosalicylic acid assay mislead carbohydrase ... The amino acids valine, glutamic acid, and phenylalanine did not affect the DNS reaction, while methionine decreased the color ... This study evaluated the interference of the amino acids tryptophan, cysteine, histidine, tyrosine, hydroxyproline, leucine, ...
... amino acid C) enzyme - protein D) RNA - nucleic acid and find homework help for other Science questions at eNotes ... Which of the following pairs are NOT related?A) sugar - carbohydrate B) DNA - amino acid C) enzyme - protein D) RNA - nucleic ... amino acids joint by peptide bond and prepare protein. so my answer is B) that means DNA is not related to amino acid. ... Sugars are a type of carbohydrate, enzymes are a type of protein, and RNA is a type of nucleic acid. Answer B is correct ...
Exploring the conformational and biological versatility of beta-turn-modified gramicidin S by using sugar amino acid homologues ... Exploring the conformational and biological versatility of beta-turn-modified gramicidin S by using sugar amino acid homologues ...
Amino Acid and Sugar Catabolism in the Marine Bacterium Phaeobacter inhibens DSM 17395 from an Energetic Viewpoint. Daniel ... Amino Acid and Sugar Catabolism in the Marine Bacterium Phaeobacter inhibens DSM 17395 from an Energetic Viewpoint ... Amino Acid and Sugar Catabolism in the Marine Bacterium Phaeobacter inhibens DSM 17395 from an Energetic Viewpoint ... Amino Acid and Sugar Catabolism in the Marine Bacterium Phaeobacter inhibens DSM 17395 from an Energetic Viewpoint ...
Amino sugar and nucleotide sugar metabolism - Escherichia coli O104:H4 2009EL-2071 (EAEC) ... M00549 Nucleotide sugar biosynthesis, glucose => UDP-glucose * M00554 Nucleotide sugar biosynthesis, galactose => UDP-galactose ...
... groups in sugar chains on their ionization and fragmentation, cycloamyloses (cycl ... To elucidate the influence of amino (-NH2) and acetamide (-NHCOCH3, -NAc) ... In sugar chains with amino sugar (HexNH2), the sodium cations can coordinate to any sugars and glycosyl bonds are likely to ... Protons localize at the amino group in sugar chains, and the product ions include the protonated amino sugar. The mobile ...
... not added sugar in details, quantity how high or low Arginine, Arg or R, α-amino acid nutrient content it has. ... α-amino acid is present in Pears, dried, sulfured, stewed, ... sulfured-stew-no-added-sugar/arginine-r-arg-alpha-amino-acid. ... There is g amount of Arginine, Arg or R, α-amino acid in amount of Pears, dried, sulfured, stewed, not added sugar. Determine, ... Amount of Arginine, Arg or R, α-amino acid in Pears, dried, sulfured, stewed, not added sugar. Back to products complete ...
Scientists surprised to find that amino acids, not sugar, supply most building blocks for tumor cells. *amino acids ... Branched-chain amino acids in metabolic signalling and insulin resistance. Branched-chain amino acids (BCAAs) are important ... Instead, the largest contributors to cell mass were amino acids, which make up proteins. As a group, amino acids (excluding ... medicalxpress.com/news/2016-03-scientists-amino-acids-sugar-blocks.html ...
Stereospecificity of multiple receptor sites in a labellar sugar receptor of the fleshfly for amino acids and small peptides.. ... Stereospecificity of multiple receptor sites in a labellar sugar receptor of the fleshfly for amino acids and small peptides. ... sites in the sugar receptor. The effect of small peptides on the sugar receptor was examined systematically. Their ... and N-methylation of the alpha-amino group of L-phenylalanine result in extremely decreased responses of the labellar sugar ...
  • A significantly higher anticancer effect of Lac-L-TTA with respect to the fructose analogue emerged from our study suggesting that the anti-metastatic potential of fructosyl-amino acids can be enhanced by increasing the polarity of the compounds, for example by introducing disaccharide moieties in place of fructose. (springer.com)
  • Rates of transport for the sugars glucose and fructose and the amino acids (AAs) aspartate, leucine, lysine, and proline were measured throughout the intestine (only proline and glucose in the frogs) by an in vitro everted-sleeve method. (nih.gov)
  • Results showed that most types of spectral analyses had relatively high potential for predicting the starch-related parameters and medium potential for predicting the concentration of the reducing sugars fructose and glucose. (forskningsdatabasen.dk)
  • The higher content of the sugar comes form fructose what is stated on the ingredients but not added to the sugar value in the nutrition table. (supplementlabtest.com)
  • Fructose, also called levulose or "fruit sugar", is shown here in the chain and ring forms. (scientificpsychic.com)
  • Total sugar content did not influence reproductive success and we found positive selection on fructose content. (springer.com)
  • He endorsed Armstrong's proposal to classify sugars into aldoses and ketoses, and proposed the name fructose for laevulose, because he found that the sign of optical rotation was not a suitable criterion for grouping sugars into families. (qmul.ac.uk)
  • Fourteen different substrates (five sugars and nine amino acids) and their degradation pathways were assessed for energetic efficiencies based on catabolic ATP yields, calculated from net formed ATP and reducing equivalents. (asm.org)
  • We compared the degradation behaviour of amino sugars (ASs) and amino acids (AAs) during sedimentation in two lakes. (lib4ri.ch)
  • With zero carbs, zero calories, and absolutely zero sugar, our XTEND® Hydration & Recovery Drink is a better-tasting, better-for-you sports drink. (bcaabar.com)
  • ZERO SUGAR, ZERO CALORIES, ZERO CARBS: Every can of XTEND Carbonated includes 7g of BCAAs at the research-backed 2:1:1 ratio with 3.5g of leucine and 1.75g each of isoleucine and valine, and 1g Citrulline Malate to support muscle growth, recovery, and replenishment of electrolytes. (bcaabar.com)
  • Xtend® HydraSport™ can help you keep your electrolyte balance whilst promoting muscle growth and recovery, without sugar, carbs, or calories. (paperfabulous.com)
  • CLEAN HYDRATION, CLEAN ELECTROLYTES: XTEND Hydrasport has zero sugar, zero calories, and nil carbs. (paperfabulous.com)
  • Every can is powered by 7 grams of branched-chain amino acids (BCAAs), which have been clinically shown to support muscle repair and recovery, plus hydrating electrolytes and additional performance ingredients to help you refuel, repair, and recover. (bcaabar.com)
  • Built with science, innovation, and clinically studied ingredients, our products do more than deliver a sugar rush or simply replace nutrients lost in sweat. (bcaabar.com)
  • THE OFFICIAL RECOVERY BRAND OF CHAMPIONS: For over 10 years, XTEND has been making the best recovery products in the world, more than delivering a sugar rush or simply replacing nutrients lost in sweat. (bcaabar.com)
  • The new enzyme technology reduces acrylamide formation by converting free asparagine into another naturally occurring amino acid, aspartic acid that cannot contribute to acrylamide formation. (novozymes.com)
  • 16. Jámbor A, Molnar Perl I. Quantitation of amino acids in plasma by high performance liquid chromatography: simultaneous deproteinization and derivatization with 9-fluorenylmethyloxycarbonyl chloride. (innovareacademics.in)
  • It isn't necessarily about how the Warburg effect helps cells put glucose into cell mass, but more about why does glucose -to-lactate conversion help cells use amino acids to build more cells . (syromonoed.com)
  • Although cells consume glucose and the amino acid glutamine at very high rates, the researchers found that those two molecules contribute little to the mass of new cells-glucose accounts for 10 to 15 percent of the carbon found in the cells, while glutamine contributes about 10 percent of the carbon. (syromonoed.com)
  • As a group, amino acids (excluding glutamine) contribute the majority of the carbon atoms found in new cells and 20 to 40 percent of the total mass. (syromonoed.com)
  • AIM: Studies in rodents have shown that leptin controls sugars and glutamine entry in the enterocytes by regulating membrane transporters. (biomedsearch.com)
  • Here, we have examined the effect of leptin on sugar and amino acids absorption in the human model of intestinal cells Caco-2 and investigated the transporters involved. (biomedsearch.com)
  • Uptake of 20 μM glutamine and 0.1 mM phenylalanine was also inhibited by leptin, indicating sensitivity to the hormone of the Na(+) -dependent neutral amino acid transporters ASCT2 and B(0) AT1. (biomedsearch.com)
  • CONCLUSION: These data show in human intestinal cells that leptin can rapidly control the activity of physiologically relevant transporters for rich-energy molecules, i.e D-glucose (SGLT1) and amino acids (ASCT2, B(0) AT1 and PAT1). (biomedsearch.com)
  • In contrast, the sugar transporters of the cat were unresponsive to varying carbohydrate levels, and long-term feeding of a high-carbohydrate diet caused down-regulation of sugar transport in frogs. (nih.gov)
  • In this work, a new type of amino sugar derivative tagged as amino sugar similar to N-acetyl-glucosamine, commonly used in medical field as medicine to treat osteoarthritis has been synthesized. (upm.edu.my)
  • With Zero Sugar and 5 grams of recovery and strength building BCAAs, this is actually the ultimate pre-workout & publish workout sports drink powder. (paperfabulous.com)
  • We found the best affordable Scivation XTEND Energy BCAA Powder Knockout Fruit Punch 125mg Caffeine Sugar Free Pre Workout Muscle Recovery Drink with Amino Acids 7g BCAAs for Men Women 30 Servings Packaging May Vary you can buy at website Amazon.com. (wildfoods.info)
  • If you have been looking for a cheap bcaa powder reviews, this Scivation XTEND Energy BCAA Powder Knockout Fruit Punch 125mg Caffeine Sugar Free Pre Workout Muscle Recovery Drink with Amino Acids 7g BCAAs for Men Women 30 Servings Packaging May Vary is the best choice for you. (wildfoods.info)
  • Sodium cation (Na + ) attachment is independent from amino group and exerts no influence on their fragmentation patterns in amino group except for mono- and disaccharide fragment ions because there is the possibility of the reducing end effect. (springer.com)
  • These basic studies made possible the identification and quantification of the flavonoid, carboxylic-/amino acid and sugar constituents of citrus fruit juices and albedos, without any extraction/enrichment procedure. (elsevier.com)
  • His work is currently supported (2014-2017) by a National Institutes of Health (NIGMS) grant entitled: "Construction and Union of 2-Amino Sugar Building Blocks. (barnard.edu)
  • Amazon is currently offering Morning Liquid Vitamins by MaryRuth's (Raspberry) Vegan Multivitamin A B C D3 E Trace Minerals & Amino Acids Paleo - Gluten Free - 0 Sugar - 32oz for just $33.94. (mojosavings.com)
  • D-Galactose, L-arginine, and their respective actively transported analogs are partially competitive inhibitors of the active transport of neutral amino acids in the small intestine of hamsters. (sciencemag.org)
  • Neutral sugar chains have no charge-center, thus, their ionizations in MALDI and ESI are achieved by proton or alkali metal cation attachment. (springer.com)
  • Syntheses of N-methylated amino acids by chemical and biocatalytic approaches are known, but often show incomplete stereoselectivity, low yields or expensive co-factor regeneration. (uni-bielefeld.de)
  • The monograph covers its application -- from natural products to synthetic pharmaceuticals -- detailing complex syntheses using the amino group as templates and modern techniques focussing on the introduction of the amino group. (wiley.com)
  • We found the best affordable Honey Badger Vegan Keto Pre Workout Peach Mango Natural Paleo Sugar Free Plant-Based Energy Supplement Nootropics Amino Acids Nitric Oxide Sucralose Free Non-Habit Forming 30 Servings you can buy at website Amazon.com. (wildfoods.info)
  • If you have been looking for a cheap pre workout powder reviews, this Honey Badger Vegan Keto Pre Workout Peach Mango Natural Paleo Sugar Free Plant-Based Energy Supplement Nootropics Amino Acids Nitric Oxide Sucralose Free Non-Habit Forming 30 Servings will meet your requirements. (wildfoods.info)
  • Buy 1 AllMax Nutrition Amino:Cuts - 30 Servings, Get 1 50% OFF! (a1supplements.com)