Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.Amino Acids, Aromatic: Amino acids containing an aromatic side chain.Hydrocarbons, Aromatic: Organic compounds containing carbon and hydrogen in the form of an unsaturated, usually hexagonal ring structure. The compounds can be single ring, or double, triple, or multiple fused rings.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Amino Acid Substitution: The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Amino Acids, Essential: Amino acids that are not synthesized by the human body in amounts sufficient to carry out physiological functions. They are obtained from dietary foodstuffs.Amino Acid Transport Systems: Cellular proteins and protein complexes that transport amino acids across biological membranes.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Amino Acid Motifs: Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Kinetics: The rate dynamics in chemical or physical systems.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Polycyclic Compounds: Compounds consisting of two or more fused ring structures.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Amino Acids, Branched-Chain: Amino acids which have a branched carbon chain.Phenylalanine: An essential aromatic amino acid that is a precursor of MELANIN; DOPAMINE; noradrenalin (NOREPINEPHRINE), and THYROXINE.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Peptide Fragments: Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Leucine: An essential branched-chain amino acid important for hemoglobin formation.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Amino Acids, SulfurBacterial Proteins: Proteins found in any species of bacterium.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Peptides: Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.Molecular Weight: The sum of the weight of all the atoms in a molecule.Tryptophan: An essential amino acid that is necessary for normal growth in infants and for NITROGEN balance in adults. It is a precursor of INDOLE ALKALOIDS in plants. It is a precursor of SEROTONIN (hence its use as an antidepressant and sleep aid). It can be a precursor to NIACIN, albeit inefficiently, in mammals.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Protein Structure, Secondary: The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.Genes, Bacterial: The functional hereditary units of BACTERIA.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Chromatography, High Pressure Liquid: Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Alanine: A non-essential amino acid that occurs in high levels in its free state in plasma. It is produced from pyruvate by transamination. It is involved in sugar and acid metabolism, increases IMMUNITY, and provides energy for muscle tissue, BRAIN, and the CENTRAL NERVOUS SYSTEM.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Lysine: An essential amino acid. It is often added to animal feed.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Isoleucine: An essential branched-chain aliphatic amino acid found in many proteins. It is an isomer of LEUCINE. It is important in hemoglobin synthesis and regulation of blood sugar and energy levels.Biodegradation, Environmental: Elimination of ENVIRONMENTAL POLLUTANTS; PESTICIDES and other waste using living organisms, usually involving intervention of environmental or sanitation engineers.Amino Acid Transport Systems, Basic: Amino acid transporter systems capable of transporting basic amino acids (AMINO ACIDS, BASIC).Molecular Structure: The location of the atoms, groups or ions relative to one another in a molecule, as well as the number, type and location of covalent bonds.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Magnetic Resonance Spectroscopy: Spectroscopic method of measuring the magnetic moment of elementary particles such as atomic nuclei, protons or electrons. It is employed in clinical applications such as NMR Tomography (MAGNETIC RESONANCE IMAGING).Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Pyrenes: A group of condensed ring hydrocarbons.Cattle: Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.Amino Acids, Basic: Amino acids with side chains that are positively charged at physiological pH.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Glycine: A non-essential amino acid. It is found primarily in gelatin and silk fibroin and used therapeutically as a nutrient. It is also a fast inhibitory neurotransmitter.Codon: A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).Catalysis: The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.Tyrosine: A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).Trypsin: A serine endopeptidase that is formed from TRYPSINOGEN in the pancreas. It is converted into its active form by ENTEROPEPTIDASE in the small intestine. It catalyzes hydrolysis of the carboxyl group of either arginine or lysine. EC 3.4.21.4.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Arginine: An essential amino acid that is physiologically active in the L-form.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Glutamine: A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.Cyanogen Bromide: Cyanogen bromide (CNBr). A compound used in molecular biology to digest some proteins and as a coupling reagent for phosphoroamidate or pyrophosphate internucleotide bonds in DNA duplexes.Valine: A branched-chain essential amino acid that has stimulant activity. It promotes muscle growth and tissue repair. It is a precursor in the penicillin biosynthetic pathway.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Nitrogen: An element with the atomic symbol N, atomic number 7, and atomic weight [14.00643; 14.00728]. Nitrogen exists as a diatomic gas and makes up about 78% of the earth's atmosphere by volume. It is a constituent of proteins and nucleic acids and found in all living cells.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Methionine: A sulfur-containing essential L-amino acid that is important in many body functions.Point Mutation: A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.Aspartic Acid: One of the non-essential amino acids commonly occurring in the L-form. It is found in animals and plants, especially in sugar cane and sugar beets. It may be a neurotransmitter.Stereoisomerism: The phenomenon whereby compounds whose molecules have the same number and kind of atoms and the same atomic arrangement, but differ in their spatial relationships. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 5th ed)Amino Acids, DiaminoAmines: A group of compounds derived from ammonia by substituting organic radicals for the hydrogens. (From Grant & Hackh's Chemical Dictionary, 5th ed)Sequence Analysis: A multistage process that includes the determination of a sequence (protein, carbohydrate, etc.), its fragmentation and analysis, and the interpretation of the resulting sequence information.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Proline: A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.Gene Library: A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Cysteine: A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.HydrocarbonsExcitatory Amino Acids: Endogenous amino acids released by neurons as excitatory neurotransmitters. Glutamic acid is the most common excitatory neurotransmitter in the brain. Aspartic acid has been regarded as an excitatory transmitter for many years, but the extent of its role as a transmitter is unclear.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Benzo(a)pyrene: A potent mutagen and carcinogen. It is a public health concern because of its possible effects on industrial workers, as an environmental pollutant, an as a component of tobacco smoke.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Crystallography, X-Ray: The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Oxidation-Reduction: A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).Circular Dichroism: A change from planar to elliptic polarization when an initially plane-polarized light wave traverses an optically active medium. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Macromolecular Substances: Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.Amino Acid Transport System A: A sodium-dependent neutral amino acid transporter that accounts for most of the sodium-dependent neutral amino acid uptake by mammalian cells. The preferred substrates for this transporter system include ALANINE; SERINE; and GLUTAMINE.Amino Acids, Neutral: Amino acids with uncharged R groups or side chains.Multigene Family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)Hydrolysis: The process of cleaving a chemical compound by the addition of a molecule of water.Hydrogen-Ion Concentration: The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Transaminases: A subclass of enzymes of the transferase class that catalyze the transfer of an amino group from a donor (generally an amino acid) to an acceptor (generally a 2-keto acid). Most of these enzymes are pyridoxyl phosphate proteins. (Dorland, 28th ed) EC 2.6.1.Plant Proteins: Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Viral Proteins: Proteins found in any species of virus.Chromatography, Gel: Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.Mass Spectrometry: An analytical method used in determining the identity of a chemical based on its mass using mass analyzers/mass spectrometers.Sequence Analysis, Protein: A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.Shikimic Acid: A tri-hydroxy cyclohexene carboxylic acid important in biosynthesis of so many compounds that the shikimate pathway is named after it.Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Amino Acids, Cyclic: A class of amino acids characterized by a closed ring structure.Threonine: An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.Chemistry: A basic science concerned with the composition, structure, and properties of matter; and the reactions that occur between substances and the associated energy exchange.Chromatography, Ion Exchange: Separation technique in which the stationary phase consists of ion exchange resins. The resins contain loosely held small ions that easily exchange places with other small ions of like charge present in solutions washed over the resins.Enzyme Stability: The extent to which an enzyme retains its structural conformation or its activity when subjected to storage, isolation, and purification or various other physical or chemical manipulations, including proteolytic enzymes and heat.Swine: Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).Chymotrypsin: A serine endopeptidase secreted by the pancreas as its zymogen, CHYMOTRYPSINOGEN and carried in the pancreatic juice to the duodenum where it is activated by TRYPSIN. It selectively cleaves aromatic amino acids on the carboxyl side.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.DNA Adducts: The products of chemical reactions that result in the addition of extraneous chemical groups to DNA.Chemical Phenomena: The composition, conformation, and properties of atoms and molecules, and their reaction and interaction processes.Benzene DerivativesCarbon Isotopes: Stable carbon atoms that have the same atomic number as the element carbon, but differ in atomic weight. C-13 is a stable carbon isotope.COS Cells: CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Epitopes: Sites on an antigen that interact with specific antibodies.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Pseudomonas: A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.Models, Chemical: Theoretical representations that simulate the behavior or activity of chemical processes or phenomena; includes the use of mathematical equations, computers, and other electronic equipment.Endopeptidases: A subclass of PEPTIDE HYDROLASES that catalyze the internal cleavage of PEPTIDES or PROTEINS.Serine: A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.Dietary Proteins: Proteins obtained from foods. They are the main source of the ESSENTIAL AMINO ACIDS.Repetitive Sequences, Amino Acid: A sequential pattern of amino acids occurring more than once in the same protein sequence.Receptors, Amino Acid: Cell surface proteins that bind amino acids and trigger changes which influence the behavior of cells. Glutamate receptors are the most common receptors for fast excitatory synaptic transmission in the vertebrate central nervous system, and GAMMA-AMINOBUTYRIC ACID and glycine receptors are the most common receptors for fast inhibition.Chickens: Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.Catalytic Domain: The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.Protein Sorting Signals: Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Fungal Proteins: Proteins found in any species of fungus.Oxygenases: Oxidases that specifically introduce DIOXYGEN-derived oxygen atoms into a variety of organic molecules.Histidine: An essential amino acid that is required for the production of HISTAMINE.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Protein PrecursorsCulture Media: Any liquid or solid preparation made specifically for the growth, storage, or transport of microorganisms or other types of cells. The variety of media that exist allow for the culturing of specific microorganisms and cell types, such as differential media, selective media, test media, and defined media. Solid media consist of liquid media that have been solidified with an agent such as AGAR or GELATIN.Protein Processing, Post-Translational: Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.Glutamic Acid: A non-essential amino acid naturally occurring in the L-form. Glutamic acid is the most common excitatory neurotransmitter in the CENTRAL NERVOUS SYSTEM.Peptide Mapping: Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.Pseudomonas putida: A species of gram-negative, aerobic bacteria isolated from soil and water as well as clinical specimens. Occasionally it is an opportunistic pathogen.Oligopeptides: Peptides composed of between two and twelve amino acids.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Aminoisobutyric Acids: A group of compounds that are derivatives of the amino acid 2-amino-2-methylpropanoic acid.Protein Folding: Processes involved in the formation of TERTIARY PROTEIN STRUCTURE.Isoenzymes: Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Amino Acyl-tRNA Synthetases: A subclass of enzymes that aminoacylate AMINO ACID-SPECIFIC TRANSFER RNA with their corresponding AMINO ACIDS.Hydrophobic and Hydrophilic Interactions: The thermodynamic interaction between a substance and WATER.Dioxygenases: Non-heme iron-containing enzymes that incorporate two atoms of OXYGEN into the substrate. They are important in biosynthesis of FLAVONOIDS; GIBBERELLINS; and HYOSCYAMINE; and for degradation of AROMATIC HYDROCARBONS.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Soil Pollutants: Substances which pollute the soil. Use for soil pollutants in general or for which there is no specific heading.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.PhenanthrenesGenetic Variation: Genotypic differences observed among individuals in a population.Carbohydrates: The largest class of organic compounds, including STARCH; GLYCOGEN; CELLULOSE; POLYSACCHARIDES; and simple MONOSACCHARIDES. Carbohydrates are composed of carbon, hydrogen, and oxygen in a ratio of Cn(H2O)n.Sequence Homology: The degree of similarity between sequences. Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species.Ligands: A molecule that binds to another molecule, used especially to refer to a small molecule that binds specifically to a larger molecule, e.g., an antigen binding to an antibody, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme. Ligands are also molecules that donate or accept a pair of electrons to form a coordinate covalent bond with the central metal atom of a coordination complex. (From Dorland, 27th ed)Large Neutral Amino Acid-Transporter 1: A CD98 antigen light chain that when heterodimerized with CD98 antigen heavy chain (ANTIGENS, CD98 HEAVY CHAIN) forms a protein that mediates sodium-independent L-type amino acid transport.Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Genes, Fungal: The functional hereditary units of FUNGI.Benzoates: Derivatives of BENZOIC ACID. Included under this heading are a broad variety of acid forms, salts, esters, and amides that contain the carboxybenzene structure.Thermodynamics: A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Cystine: A covalently linked dimeric nonessential amino acid formed by the oxidation of CYSTEINE. Two molecules of cysteine are joined together by a disulfide bridge to form cystine.Molecular Conformation: The characteristic three-dimensional shape of a molecule.Dimerization: The process by which two molecules of the same chemical composition form a condensation product or polymer.Oxidoreductases: The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)Gas Chromatography-Mass Spectrometry: A microanalytical technique combining mass spectrometry and gas chromatography for the qualitative as well as quantitative determinations of compounds.Asparagine: A non-essential amino acid that is involved in the metabolic control of cell functions in nerve and brain tissue. It is biosynthesized from ASPARTIC ACID and AMMONIA by asparagine synthetase. (From Concise Encyclopedia Biochemistry and Molecular Biology, 3rd ed)Phenol: An antiseptic and disinfectant aromatic alcohol.Solubility: The ability of a substance to be dissolved, i.e. to form a solution with another substance. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)Serine Endopeptidases: Any member of the group of ENDOPEPTIDASES containing at the active site a serine residue involved in catalysis.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Toluene: A widely used industrial solvent.Plants: Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.Glutathione Transferase: A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.Carcinogens: Substances that increase the risk of NEOPLASMS in humans or animals. Both genotoxic chemicals, which affect DNA directly, and nongenotoxic chemicals, which induce neoplasms by other mechanism, are included.Tissue Distribution: Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.Mutation, Missense: A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.

A fast method for predicting amino acid mutations that lead to unfolding. (1/210)

Amino acid mutation(s) that cause(s) partial or total unfolding of a protein can lead to disease states and failure to produce mutants. It is therefore very useful to be able to predict which mutations can retain the conformation of a wild-type protein and which mutations will lead to local or global unfolding of the protein. We have developed a fast and reasonably accurate method based on a backbone-dependent side-chain rotamer library to predict the (folded or unfolded) conformation of a protein upon mutation. This method has been tested on proteins whose wild-type 3D structures are known and whose mutant conformations have been experimentally characterized to be folded or unfolded. Furthermore, for the cases studied here, the predicted partially folded or denatured mutant conformation correlate with a decrease in the stability of the mutant relative to the wild-type protein. The key advantage of our method is that it is very fast and predicts locally or globally unfolded states fairly accurately. Hence, it may prove to be useful in designing site-directed mutagenesis, X-ray crystallography and drug design experiments as well as in free energy simulations by helping to ascertain whether a mutation will alter or retain the wild-type conformation.  (+info)

Bicarbonate enhances peroxidase activity of Cu,Zn-superoxide dismutase. Role of carbonate anion radical and scavenging of carbonate anion radical by metalloporphyrin antioxidant enzyme mimetics. (2/210)

Much evidence exists for the increased peroxidase activity of copper, zinc superoxide dismutase (SOD1) in oxidant-induced diseases. In this study, we measured the peroxidase activity of SOD1 by monitoring the oxidation of dichlorodihydrofluorescein (DCFH) to dichlorofluorescein (DCF). Bicarbonate dramatically enhanced DCFH oxidation to DCF in a SOD1/H(2)O(2)/DCFH system. Peroxidase activity could be measured at a lower H(2)O(2) concentration ( approximately 1 microm). We propose that DCFH oxidation to DCF is a sensitive index for measuring the peroxidase activity of SOD1 and familial amyotrophic lateral sclerosis SOD1 mutants and that the carbonate radical anion (CO(3)) is responsible for oxidation of DCFH to DCF in the SOD1/H(2)O(2)/bicarbonate system. Bicarbonate enhanced H(2)O(2)-dependent oxidation of DCFH to DCF by spinal cord extracts of transgenic mice expressing SOD1(G93A). The SOD1/H(2)O(2)/HCO(3)(-)-dependent oxidation was mimicked by photolysis of an inorganic cobalt carbonato complex that generates CO(3). Metalloporphyrin antioxidants that are usually considered as SOD1 mimetic or peroxynitrite dismutase effectively scavenged the CO(3) radical. Implications of this reaction as a plausible protective mechanism in inflammatory cellular damage induced by peroxynitrite are discussed.  (+info)

A possible role for pi-stacking in the self-assembly of amyloid fibrils. (3/210)

Amyloid fibril formation is assumed to be the molecular basis for a variety of diseases of unrelated origin. Despite its fundamental clinical importance, the mechanism of amyloid formation is not fully understood. When we analyzed a variety of short functional fragments from unrelated amyloid-forming proteins, a remarkable occurrence of aromatic residues was observed. The finding of aromatic residues in diverse fragments raises the possibility that pi-pi interactions may play a significant role in the molecular recognition and self-assembly processes that lead to amyloid formation. This is in line with the well-known central role of pi-stacking interactions in self-assembly processes in the fields of chemistry and biochemistry. We speculate that the stacking interactions may provide energetic contribution as well as order and directionality in the self-assembly of amyloid structures. Experimental data regarding amyloid formation and inhibition by short peptide analogs also support our hypothesis. The pi-stacking hypothesis suggests a new approach to understanding the self-assembly mechanism that governs amyloid formation and indicates possible ways to control this process.  (+info)

Exploring the active site of plant glutaredoxin by site-directed mutagenesis. (4/210)

Six mutants (Y26A, C27S, Y29F, Y29P, C30S and Y26W/Y29P) have been engineered in order to explore the active site of poplar glutaredoxin (Grx) (Y26CPYC30). The cysteinic mutants indicate that Cys 27 is the primary nucleophile. Phe is a good substitute for Tyr 29, but the Y29P mutant was inactive. The Y26A mutation caused a moderate loss of activity. The YCPPC and WCPPC mutations did not improve the reactivity of Grx with the chloroplastic NADP-malate dehydrogenase, a well known target of thioredoxins (Trxs). The results are discussed in relation with the known biochemical properties of Grx and Trx.  (+info)

Charged amino acids conserved in the aromatic acid/H+ symporter family of permeases are required for 4-hydroxybenzoate transport by PcaK from Pseudomonas putida. (5/210)

Charged amino acids in the predicted transmembrane portion of PcaK, a permease from Pseudomonas putida that transports 4-hydroxybenzoate (4-HBA), were required for 4-HBA transport, and they were also required for P. putida to have a chemotactic response to 4-HBA. An essential amino acid motif (DGXD) containing aspartate residues is located in the first transmembrane segment of PcaK and is conserved in the aromatic acid/H+ symporter family of the major facilitator superfamily of transporters.  (+info)

Aromatic-aromatic interactions in and around alpha-helices. (6/210)

To understand the role of aromatic-aromatic interactions in imparting specificity to the folding process, the geometries of four aromatic residues with different sequence spacing, located in alpha-helices or five residues from helical ends, interacting with each other have been elucidated. The geometry is found to depend on the sequence difference. Specific interactions (C-H...pi and N-H...pi) which result from this geometry may cause a given pair of residues (such as Phe-His) with a particular sequence difference to occur more than expected. The most conspicuous residue in an aromatic pair in the context of helix stability is His, which is found at the last (C1) position or the two positions (Ncap and Ccap) immediately flanking the helix. An alpha-helix and a contiguous 3(10)-helix or two helices separated by a non-helical residue can have interacting aromatic pairs, the geometry of interaction and the relative orientation between the helices being rather fixed. Short helices can also have interacting residues from either side.  (+info)

The ARO4 gene of Candida albicans encodes a tyrosine-sensitive DAHP synthase: evolution, functional conservation and phenotype of Aro3p-, Aro4p-deficient mutants. (7/210)

The enzyme 3-deoxy-D-arabinoheptulosonate-7-phosphate (DAHP) synthase catalyses the first step in aromatic amino acid biosynthesis in prokaryotes, plants and fungi. Cells of Saccharomyces cerevisiae contain two catalytically redundant DAHP synthases, encoded by the genes ARO3 and ARO4, whose activities are feedback-inhibited by phenylalanine and tyrosine, respectively. ARO3/4 gene transcription is controlled by GCN4. The authors previously cloned an ARO3 gene orthologue from Candida albicans and found that: (1) it can complement an aro3 aro4 double mutation in S. cerevisiae, an effect inhibited by excess phenylalanine, and (2) a homozygous aro3-deletion mutant of C. albicans is phenotypically Aro(+), suggesting the existence of another isozyme(s). They now report the identification and functional characterization of the C. albicans orthologue of S. cerevisiae Aro4p. The two Aro4p enzymes share 68% amino acid identity. Phylogenetic analysis places the fungal DAHP synthases in a cluster separate from prokaryotic orthologues and suggests that ARO3 and ARO4 arose from a single gene via a gene duplication event early in fungal evolution. C. albicans ARO4 mRNA is elevated upon amino acid starvation, consistent with the presence of three putative Gcn4p-responsive elements (GCREs) in the gene promoter sequence. C. albicans ARO4 complements an aro3 aro4 double mutation in S. cerevisiae, an effect inhibited by excess tyrosine. The authors engineered Deltaaro3/Deltaaro3 Deltaaro4/MET3p::ARO4 cells of C. albicans (with one wild-type copy of ARO4 placed under control of the repressible MET3 promoter) and found that they fail to grow in the absence of aromatic amino acids when ARO4 expression is repressed, and that this growth defect can be partially rescued by aromatic amino acids and certain aromatic amino acid pathway intermediates. It is concluded that, like S. cerevisiae, C. albicans contains two DAHP synthases required for the first step in the aromatic amino acid biosynthetic pathway.  (+info)

Refined molecular hinge between allosteric and catalytic domain determines allosteric regulation and stability of fungal chorismate mutase. (8/210)

The yeast chorismate mutase is regulated by tyrosine as feedback inhibitor and tryptophan as crosspathway activator. The monomer consists of a catalytic and a regulatory domain covalently linked by the loop L220s (212-226), which functions as a molecular hinge. Two monomers form the active dimeric enzyme stabilized by hydrophobic interactions in the vicinity of loop L220s. The role of loop L220s and its environment for enzyme regulation, dimerization, and stability was analyzed. Substitution of yeast loop L220s in place of the homologous loop from the corresponding and similarly regulated Aspergillus enzyme (and the reverse substitution) changed tyrosine inhibition to activation. Yeast loop L220s substituted into the Aspergillus enzyme resulted in a tryptophan-inhibitable enzyme. Monomeric yeast chorismate mutases could be generated by substituting two hydrophobic residues in and near the hinge region. The resulting Thr-212-->Asp-Phe-28-->Asp enzyme was as stable as wild type, but lost allosteric regulation and showed reduced catalytic activity. These results underline the crucial role of this molecular hinge for inhibition, activation, quaternary structure, and stability of yeast chorismate mutase.  (+info)

Yersinia pestis, the causative agent of plague, poses a serious health threat to rodents and human beings. TyrR is a transcriptional regulator that controls the metabolism of aromatic amino acids in Escherichia coli. In this paper, TyrR played an important role in Y. pestis virulence. Inactivation of tyrR did not seem to affect the in vitro growth of this organism, but resulted in at least 10,000-fold attenuation compared with the wild-type (WT) strain upon subcutaneous infection to mice. In addition, loads of tyrR mutant within mice livers and spleens significantly decreased compared with the WT strain. Transcriptome analysis revealed that TyrR, directly or indirectly, regulated 29 genes encoded on Y. pestis chromosome or plasmids under in vitro growth condition. Similar to the regulatory function of this protein in E. coli, five aromatic-pathway genes (aroF-tyrA, aroP, aroL, and tyrP) were significantly reduced upon deletion of the tyrR gene. Two genes (glnL and glnG) that encode sensory histidine
How is Aromatic Amino Acids abbreviated? AAA stands for Aromatic Amino Acids. AAA is defined as Aromatic Amino Acids somewhat frequently.
The inner membrane protein YddG of Escherichia coli is a homologue of the known amino acid exporters RhtA and YdeD. It was found that the yddG gene overexpression conferred resistance upon E. coli cells to the inhibiting concentrations of l-phenylalanine and aromatic amino acid analogues, dl-p-fluor …
The present disclosure relates to engineered microorganisms that produce amino acids and amino acid intermediates. In particular, the disclosure relates to recombinant nucleic acids encoding operons that increase production of aromatic amino acids and the aromatic amino acid intermediate shikimate; microorganisms with increased production of aromatic amino acids and the aromatic amino acid intermediate shikimate; and methods related to the production of aromatic amino acids, the aromatic amino acid intermediate shikimate, and commodity chemicals derived therefrom.
Klebsiella aerogenes utilized aromatic amino acids as sole sources of nitrogen but not as sole sources of carbon. K. aerogenes abstracted the alpha-amino group of these compounds by transamination and excreted the arylpyruvate portions into the medium. When tryptophan was utilized as the sole source …
Ion channels are proteins that traverse the cell membrane and form gated pores that open and close in response to various stimuli. In order to experimentally probe aspects of ion channel functionality, we performed subtle structure function studies using the in vivo nonsense suppression method, which allows for the incorporation of synthetically accessible unnatural amino acids and hydroxy acids into an ion channel at a site of interest. Fluorinated aromatic amino acids are good probes for a cation-π interaction because fluorine substituents reduce the binding affinity of the aromatic for a cation in a linear, step-wise fashion. In collaboration with Professor Richard Horn at the Thomas Jefferson University, we substituted a series of fluorinated phenylalanines for important tyrosines in the Shaker B K+ channel and experimentally determined that TEA was binding to the residues through a cation-π interaction. We also determined that Ca2+ binds to and blocks the NaV1.4 channel through a ...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
We investigated 1060 possible anion-pi interactions in a data set of 41 superoxide dismutase active centers. Our observations indicate that majority of the aromatic residues are capable to form anion-pi interactions, mainly by long-range contacts, and that there is preference of Trp over other aromatic residues in these interactions. Furthermore, 68% of total predicted interactions in the dataset are multiple anion-pi interactions. Anion-pi interactions are distance and orientation dependent. We analyzed the energy contribution resulting from anion-pi interactions using ab initio calculations. The results showed that, while most of their interaction energies lay in the range from -0 to -4 kcal mol(-1), those energies can be up to -9 kcal mol(-1) and about 34% of interactions were found to be repulsive. Majority of the suggested anion-pi interacting residues in ternary complexes are metal-assisted. Stabilization centers for these proteins showed that all the six residues found in predic...ted ...
Enzymes are biological catalysts that are essential to life: they are largely very efficient and exquisitely specialised to their substrate. They are, however, predicted to have evolved from simple promiscuous catalysts (able to catalyse multiple reactions on multiple substrates). The goal of this thesis was to explore the multiple models of evolution with three model enzymes. In a complementary model for enzyme evolution, it is hypothesised that some ancient enzymes may have exhibited higher catalytic rates than their extant descendants. This model was investigated through the reconstruction of core bacterial enzymes AroA (aromatic amino acid biosynthesis) and MurA (peptidoglycan biosynthesis), from the common ancestor of modern Streptoccocci species. The ~300 million year old ancestral enzyme conformed to the model, with 20-fold higher activity than MurA enzymes in modern Streptococci. Several models for enzyme evolution, both primordial and contemporary, require a multifunctional precursor ...
The low affinity aromatic amino acid (Tyr, Trp, Phe) transporter, TAT1 (T-type amino acid transporter), MCT10, Slc16a10. Also transports N-methyl amino acids and thyroid hormones. Essential for aromatic amino acid homeostasis in various tissues of mice (Mariotta et al. 2012). MCT10 is 58% identical to MCT8. Both transporters mediate T3 transport, but while MCT8 also transports rT3 and T4, these compounds are not efficiently transported by MCT10. A few amino acyl residue substitutions in the human orthologue broadens the substrate specificity of this porter (Johannes et al. 2016 ...
ABCC10 is an efflux pump that confers multidrug resistance to cells by extruding a variety of natural and nucleosides analogues using energy from ATP hydrolysis. The objective of this project is to understand the detailed relationship between ATP hydrolysis and drug transport for ABCC10 and how ABCC10s ATPase activity is regulated. For this study, we mutated aromatic residues to polar residues in the Nucleotide Binding Domains (NBDs) of ABCC10 to determine how these residues are involved in the transport of ABCC10 substrates. Prior, structural analyses of several bacterial ABC-transporters indicated that aromatic amino acid residues in NBDs are needed for ATP binding and ATP hydrolysis. In these studies, substitution of these aromatic residues completely abolished ATP-dependent transport. Prior work on ABCC1 has shown that substitutions such as W (tryptophan) to C (cytidine) or Y (tyrosine) to C (cytidine) decreased ABCC1s affinity for ATP, and ATP-dependent LTC4 transport activities. ...
Program: needle # Rundate: Mon 8 Mar 2010 06:21:36 # Commandline: needle # -asequence dna-align/BSNT_00855.1.24716.seq # -bsequence dna-align/BPUM_0575___yddG.2.24716.seq # -gapopen 10 # -gapextend 0.5 # -outfile dna-align/BSNT_00855-BPUM_0575___yddG.aln # Align_format: srspair # Report_file: dna-align/BSNT_00855-BPUM_0575___yddG.aln ######################################## #======================================= # # Aligned_sequences: 2 # 1: BSNT_00855 # 2: BPUM_0575___yddG # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 2865 # Identity: 1502/2865 (52.4%) # Similarity: 1502/2865 (52.4%) # Gaps: 906/2865 (31.6%) # Score: 3388.0 # # #======================================= BSNT_00855 1 ATGAAGAA---AAAAAGAATTCTAATTGTGTCGGCTATCGTGTTGCTGTT 47 ,,,,,,,, ,,,...,,,..,,,.,.,.,..,,,.,.,,,.,,.,,., BPUM_0575___y 1 ATGAAGAAGAGAAACTTAATAATAACTTTCTTAGCTCTAGTGATGTTGGT 50 BSNT_00855 48 TTTAACTGTCGCTTCAGCTGTAACAGTATTTTCGGCTGAT---------G 88 ,, ,,, ,,,,,,,..,..,,,..,,,,,, , BPUM_0575___y 51 ...
Autori: Breunig, H.J.; Haddad, N.; Lork, E.; Mehring, M.; Mügge, C.; Nolde, C.; Rat, C.I.; Schürmann. Editorial: Organometallics, 28, p.1202-, 2009.. Rezumat:. Cuvinte cheie: Bismuth, m-Terphenyl, X-ray structure. URL: http://dx.doi.org/10.1021/om800934c. ...
you can put all atoms in the aromatic groups in separate charge groups, but that will make the simulation slightly slower. Further, putting all of the atoms in each aromatic side chain into their own charge group could slightly change the equilibrium properties of a peptide or protein since aromatic residues would then be more strongly attracting near the cutoff distance than they are when assigned the regular charge groups of a force field. Most force fields (except GROMOS) have probably been parametrized without charge groups. Therefore having smaller charge groups is always more accurate, unless you have a buffer region, which is now possible in 4.0. (This all assumes that you use PME and not cut-off or reaction-field for electrostatics). However, this is probably not a serious issue.. One might try ...
Acids, Amino Acids, Aromatic Amino Acids, Association, Behavior, Bilirubin, Collagen, Concentration, Jaundice, Methods, Nature, Tissues
CH-π aromatic interactions are ubiquitous in nature and are capable of regulating important chemical and biochemical processes. Solvation and aromatic substituent effects are known to perturb the CH-π aromatic interactions. However, the nature by which the two factors influence one another is relatively unexplored. Here we demonstrate experimentally that there is a quantitative correlation between substituent effects in CH-π interactions and the hydrogen-bond acceptor constant of the solvating molecule. The CH-π interaction energies were measured by the conformational study of a series of aryl-substituted molecular balances in which the conformational preferences depended on the relative strengths of the methyl and aryl CH-π interactions in the folded and unfolded states, respectively ...
A team led by scientists at the Scripps Research Institute have now succeeded in solving the X-ray crystallographic structure of murine Pgp, a result that they hope will help chemists to design more effective drugs. The 3.8Å structure of the apo protein revealed an internal cavity of ca 6000Å3, with a 30Å separation of the two nucleotide-binding domains. Two additional structures with bound inhibitors showed that hydrophobic and aromatic amino acids form distinct drug-binding sites which are capable of stereo-recognition. The apo and drug-bound Pgp structures are open to the cytoplasm and the inner leaflet of the lipid bilayer for drug entry, representing initial stages of the transport cycle. The overall structure of Pgp is very similar to that of the bacterial protein, MsbA, which transports lipids out of bacteria, suggesting that Pgp may work in a similar way. In the bacterial transporter, binding of ATP changes the accessibility of the carrier from cytoplasmic (inward) facing to ...
ex1 Increase chi1 rotamer sampling for buried* residues +/- 1 standard deviation - RECOMMENDED -ex1_aro Increase chi1 rotamer sampling for buried* aromatic** residues +/- 1 standard deviation -ex2 Increase chi2 rotamer sampling for buried* residues +/- 1 standard deviation - RECOMMENDED -ex2_aro Increase chi2 rotamer sampling for buried* aromatic** residues +/- 1 standard deviation -ex3 Increase chi3 rotamer sampling for buried* residues +/- 1 standard deviation -ex4 Increase chi4 rotamer sampling for buried* residues +/- 1 standard deviation -ex1:level ,int, Increase chi1 sampling for buried* residues to the given sampling level*** -ex1_aro:level ,int, Increase chi1 sampling for buried* aromatic residues to the given sampling level -ex2:level ,int, Increase chi1 sampling for buried* residues to the given sampling level -ex2_aro:level ,int, Increase chi1 sampling for buried* aromatic residues to the given sampling level -ex3:level ,int, Increase chi1 sampling for buried* residues to the given ...
Looking for ARO Retaining Ring (42CJ31)? Graingers got your back. Price:$9.65. Easy ordering & convenient delivery. Log-in or register for your pricing.
To understand the cation-π interaction in aromatic amino acids and peptides, the binding of M+ (where M+ = Li+, Na+, and K+) to phenylalanine (Phe) is studied at the best level of density functional theory reported so far. The different modes of M+ binding show the same order of binding affinity (Li+ > Na+ > K+), in the approximate ratio of 2.2:1.5:1.0. The most stable binding mode is one in which the M+ is stabilized by a tridentate interaction between the cation and the carbonyl oxygen (O=C), amino nitrogen (-NH2), and aromatic π ring; the absolute Li+, Na+, and K+ affinities are estimated theoretically to be 275, 201, and 141 kJ mol-1, respectively. Factors affecting the relative stabilities of various M +-Phe binding modes and conformers have been identified, with ion-dipole interaction playing an important role. We found that the trend of π and non-π cation bonding distances (Na+-π > Na +-N > Na+-O and K+ -π > K +-N > K+-O) in our theoretical Na+/K +-Phe structures ...
Biosynthesis of the aromatic amino acids tryptophan, tyrosine, and phenylalanine proceeds via a common pathway to chorismate, at which point the pathway branches (CITS:[Jones][1943992]). One branch proceeds to tryptophan, and the other to tyrosine and phenylalanine (CITS:[Jones]). The series of reactions to chorismate, called the shikimate pathway, and the series of reactions from chorismate to tryptophan have been found to be common to all eukaryotes and prokaryotes studied thus far (as reported in (CITS:[1943992])). In contrast, there appears to be two separate routes from chorismate to tyrosine and phenylalanine, only one of which has been found in S. cerevisiae (CITS:[1943992]). Aromatic amino acid biosynthesis in S. cerevisiae is controlled by a combination of feedback inhibition, activation of enzyme activity, and regulation of enzyme synthesis (CITS:[Jones][1943992]). The first step in the tryptophan branch is feedback inhibited by tryptophan, and the first step in the ...
The expression of plant shikimate kinase (SK; EC 2.7.1.71), an intermediate step in the shikimate pathway to aromatic amino acid biosynthesis, is induced under specific conditions of environmental stress and developmental requirements in an isoform-specific manner. Despite their important physiological role, experimental structures of plant SKs have not been determined and the biochemical nature of plant SK regulation is unknown. The Arabidopsis thaliana genome encodes two SKs, AtSK1 and AtSK2. We demonstrate that AtSK2 is highly unstable and becomes inactivated at 37 degrees C whereas the heat-induced isoform, AtSK1, is thermostable and fully active under identical conditions at this temperature. We determined the crystal structure of AtSK2, the first SK structure from the plant kingdom, and conducted biophysical characterizations of both AtSK1 and AtSK2 towards understanding this mechanism of thermal regulation. The crystal structure of AtSK2 is generally conserved with bacterial SKs with the ...
The present invention is directed to a polypeptide that binds to the androgen receptor, the polypeptide comprising the amino acid sequence Ar-X-X-Z-Ar, or Ser-β-Ar- X-Δ-Ψ-Ar; or Ser-β-Ar-Δ-X-Ψ-Ar; or Ser-X-Ar-X-X-Ψ-Ar; wherein Ar is an aromatic amino acid; X is any amino acid; and Z is a hydrophobic amino acid (Ψ) or an aromatic amino acid (Ar), β is a basic amino acid; and A is an acidic amino acid. The present invention is also directed to methods of analyzing the surface conformation of a protein using one or more of the above polypeptide sequences; methods of identifying modulators of protein function using one or more of the above polypeptide sequences; and pharmaceutical compositions comprising a pharmaceutically acceptable carrier and one or more of the above polypeptide sequences.
Close The Infona portal uses cookies, i.e. strings of text saved by a browser on the users device. The portal can access those files and use them to remember the users data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser. ...
Thank you for your interest in spreading the word about Science.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Sep 30, 2019· Chymotrypsin is a digestive enzyme belonging to a super family of enzymes called serine proteases. It uses an active serine residue to perform hydrolysis on the C-terminus of the aromatic amino acids of other proteins. Chymotrypsin is a protease enzyme that cleaves on the C-terminal phenylalanine (F), tryptophan (W), and tyrosine (Y) on peptide ...
The enzyme plays a key role in an alternative pathway of the biosynthesis of 3-dehydroquinate (DHQ), which is involved in the canonical pathway for the biosynthesis of aromatic amino acids. The enzyme can also catalyse the reaction of EC 4.1.2.13, fructose-bisphosphate aldolase ...
An essential aromatic amino acid that is a precursor of melanin; dopamine; noradrenalin (norepinephrine), and thyroxine. [PubChem]
Alternative selectivity to alkyl bonded phases, recommended for aromatic groups. Compatible with highly aqueous mobile phases to facilitate the retention and separation of polar compounds.
Correct Answer: D.. Aromatic compounds follow four rules: (1) They are conjugated-there needs to one "p" orbital from each atom in the ring, so each atom must be either sp2 or sp hybridized; 2) They are cyclic: linear systems are not aromatic; 3) They are planar: there is good overlap/interaction between p orbitals; 4) they follow the The Huckel Rule-4n+2 pi electrons in the cyclic conjugated pi system (n = 0, 1, 2, 3 etc ...
JP Morgan reiterated its Neutral rating on Aeropostale (NYSE: ARO) and reduced its price target from $14.00 to $13.00. JP Morgan commented, [A]lthough ARO ...
Looking for ARO Manual AirControl,3-Way,2-Position,5/32 (4LB53)? Graingers got your back. Price:$72.75. Easy ordering & convenient delivery. Log-in or register for your pricing.
Un pasionat de design a realizat un concept interesant de ARO. Chiar daca aceasta companie auto romaneasca nu mai exista de ani buni, fiind adusa la faliment de guvernul Nastase, pasionati si iubitori
Todas medidas e marcas de pneus nacionais e importados para moto aro 14. Enviamos para todo Brasil, consulte! GUAPOR PNEUS LONDRINA (43) 3032-1921.
Todas medidas e marcas de pneus nacionais e importados para moto aro 21. Enviamos para todo Brasil, consulte! GUAPOR PNEUS LONDRINA (43) 3032-1921.
Živjo sem novi lastnik aro-ta letnik 88 1,4 bencin. Kako(v kater polžaj ročko) se vklopi 4 pogon ,reduktor,in kaj se vklaplja na kolesih.? Je pa to aro 10. ...
Ofertas de Pneu Aro 17 225 45 incríveis, entrega rápida e garantida é no Shoptime. Aproveite para comprar no conforto da sua casa! Produtos em oferta no Shoptime, 24h com vocês.
The transamination of aromatic l-amino acids (5-hydroxytryptophan, tryptophan, tyrosine, phenylalanine and kynurenine) was shown to be catalysed by enzyme preparations from rat small intestine. On the basis of the partial purification and characterization of these aromatic amino acid transaminases, it is suggested that rat small intestine contains several kinds of aromatic amino acid transaminases.. ...
0050] The hydroprocessed aviation biofuel or other hydroprocessed biofuel fraction(s) as described above, also advantageously share a number of important characteristics with their petroleum derived counterpart components. In terms of energy content, these fractions may have a lower heating value generally from about 42 MJ/kg (18,100 BTU/lb) to about 46 MJ/kg (19,800 BTU/lb) and typically from about 43 MJ/kg (18,500 BTU/lb) to about 45 MJ/kg (19,400 BTU/lb). While these hydroprocessed biofuel fractions can meet various standards required of their petroleum derived counterparts, their carbon footprint is greatly reduced according to U.S. government GHG emission accounting practices, in which emissions associated with the combustion of biomass derived fuels are not reported in the GHG emission value based on LCA, as discussed above. According to particular embodiments of the invention, in which the hydroprocessed biofuel or other hydroprocessed biofuel fraction(s) is derived completely from ...
Researches at Prof. Gad Galili s lab elicited a significant increase in the direct products of the shikimate pathway and in the aromatic amino acid Phenylalanine. A central regulator in the shikimate pathway is the first committed enzyme of the pathway; 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase (DAHPS). The bacterial DAHPS is feedback inhibited by a separate amino acid. At the core of this technology is the dominant isoform that is the AroG gene which is under the regulation of Phenylalanine and responsible for 80% of the total DAHPS activity.. By expressing a mutant bacterial AroG gene encoding a feedback insensitive DAHPS in transgenic Arabidopsis plants, researchers achieved increased levels of the shikimate direct metabolites, products and aromatic amino acids. Detailed analysis revealed that while no metabolite exhibited decreased levels in the transgenic plants, the levels of shikimate intermediate metabolites, phenylalanine, tryptophan, and a verity of secondary metabolites ...
Description: The chemical reactions and pathways resulting in the formation of phenylalanine and tyrosine from other compounds, including chorismate, via the intermediate prephenate.. ...
Here, we investigate the strengths of R-X···π interactions, involving both chlorine and bromine, in model systems derived from protein-ligand complexes found in the PDB. We find that the strengths of these interactions can vary significantly, with binding energies ranging from −2.01 to −3.60 kcal/mol. Symmetry adapted perturbation theory (SAPT) analysis shows that, as would be expected, dispersion plays the largest role in stabilizing these R-X···π interactions, generally accounting for about 50% to 80% of attraction. R-Br···π interactions are, for the most part, found to be stronger than R-Cl···π interactions, although the relative geometries of the interacting pair and the halogens chemical environment can also have a strong impact. The two factors that have the strongest impact on the strength of these R-X···π interactions is the distance between the halogen and the phenyl plane as well as the size of the halogen σ-hole.
Cation-π interaction is a non-covalent binding force that plays a significant role in protein stability and drug-receptor interactions. In this work, we have investigated the structural role of cation-π interactions in sugar-binding proteins (SBPs). We observed 212 cation-π interactions in 53 proteins out of 59 SBPs in dataset. There is an average one energetically significant cation-π interaction for every 66 residues in SBPs. In addition, Arg is highly preferred to form cation-π interactions, and the average energy of Arg-Trp is high among six pairs. Long-range interactions are predominant in the analyzed cation-π interactions. Comparatively, all interaction pairs favor to accommodate in strand conformations. The analysis of solvent accessible area indicates that most of the aromatic residues are found on buried or partially buried whereas cationic residues were found mostly on the exposed regions of protein. The cation-π interactions forming residues were found that around 43% of cation-π
Carbohydrate - receptor interactions are an integral part of biological events. They play an important role in many cellular processes, such as cell-cell adhesion, cell differentiation and in-cell signaling. Carbohydrates can interact with a receptor by using several types of intermolecular interactions. One of the most important is the interaction of a carbohydrates apolar part with aromatic amino acid residues, known as dispersion interaction or CH/π interaction. In the study presented here, we attempted for the first time to quantify how the CH/π interaction contributes to a more general carbohydrate - protein interaction. We used a combined experimental approach, creating single and double point mutants with high level computational methods, and applied both to Ralstonia solanacearum (RSL) lectin complexes with α-l-Me-fucoside. Experimentally measured binding affinities were compared with computed carbohydrate-aromatic amino acid residue interaction energies. Experimental binding affinities for
To paraphrase, occasionally a protein is valuable in and of by itself, and at other periods it is effective for the person amino acids that it consists of. You can find ongoing debates about the best way to evaluate the wellness Positive aspects affiliated with the amino acid information of proteins. These debates fall under the heading of "protein good quality," and you may find out more relating to this difficulty inside our amino acids profile . However, regardless of the certain approach thats taken to protein top quality, we feel that it is useful to take in proteins which are loaded in a variety of diverse amino acids. One example is, we feel that sulfur-made up of amino acids Have got a Distinctive price all their own individual, in the same way as branched-chain amino acids or aromatic amino acids. The best way to get a wealthy range of amino acids from every one of these scaled-down amino acid subgroups is usually to often take pleasure in a variety of foods. A lot more especially, we ...
If you have a question about this talk, please contact Lingtao Kong.. Aromatic oligomers constitute a distinct and promising class of synthetic foldamers - oligomers that adopt stable folded conformations. Single helical structures are, to a large extent, predictable, show unprecedented conformational stability, and represent convenient building blocks to elaborate synthetic, very large (protein-sized) folded architectures. This lecture will give an overview of our current efforts to design abiotic tertiary structures based on aromatic scaffolds,[1] to prepare and select (as opposed to design) aromatic foldamer-peptide hybrid architectures,[2,3] and to use aromatic foldamers to recognize sizeable protein surfaces.[4,5]. References:. [1] S. De et al., Designing cooperatively folded abiotic uni- and multimolecular helix bundles, Nat. Chem. 2018, 10, 51. [2] J. M. Rogers, S. Kwon et al. Ribosomal synthesis and folding of peptide-helical aromatic foldamer hybrids, Nat. Chem. 2018, 10, 405. [3] M. ...
A fuel composition comprising a major amount of a normally liquid fuel and a minor amount of at least one compound of the general formula ##STR1## wherein each Ar is independently an aromatic group having from 4 to about 30 carbon atoms and from 0 to 3 optional substituents selected from the group consisting of amino, hydroxy- or alkyl- polyoxyalkyl, nitro, aminoalkyl, carboxy or combinations of two or more of said optional substituents, each R is independently a hydrocarbyl group, R1 is H or a hydrocarbyl group, R2 and R3 are each, independently, H or a hydrocarbyl group, R4 is a monovalent terminating group, each m is independently 0 or an integer ranging from 1 to about 10, x ranges from 0 to about 8, and each Z is independently OH, lower alkoxy, (OR5)b OR6 or O- wherein each R5 is independently a divalent hydrocarbyl group, R6 is H or hydrocarbyl and b is a number ranging from 1 to about 30 and c ranges from 1 to about 3, y is a number ranging from 1 to about 10 and wherein the sum m+c does not
Azapeptide analogues of growth hormone releasing peptide-6 (GHRP-6) exhibit promising affinity, selectivity, and modulator activity on the cluster of differentiation 36 receptor (CD36). For example, [A(1), azaF(4)]- and [azaY(4)]-GHRP-6 (1a and 2b) were previously shown to bind selectively to CD36 and exhibited respectively significant antiangiogenic and slight angiogenic activities in a microvascular sprouting assay using choroid explants. The influences of the 1- and 4-position residues on the affinity, anti-inflammatory, and antiangiogenic activity of these azapeptides have now been studied in detail by the synthesis and analysis of a set of 25 analogues featuring Ala(1) or His(1) and a variety of aromatic side chains at the aza-amino acid residue in the 4-position ...
Porat Y, Abramowitz A, Gazit E. Inhibition of amyloid fibril formation by polyphenols: structural similarity and aromatic interactions as a common inhibition mechanism ...
Hughes, ME; Abruzzi, KC; Allada, R; Anafi, R; Arpat, AB; Asher, G; Baldi, P; de Bekker, C; Bell-Pedersen, D; Blau, J; Brown, S; Ceriani, MF; Chen, Z; Chiu, JC; Cox, J; Crowell, AM; DeBruyne, JP; Dijk, D-J; DiTacchio, L; Doyle, FJ; Duffield, GE; Dunlap, JC; Eckel-Mahan, K; Esser, KA; FitzGerald, GA; Forger, DB; Francey, LJ; Fu, Y-H; Gachon, F; Gatfield, D; de Goede, P; Golden, SS; Green, C; Harer, J; Harmer, S; Haspel, J; Hastings, MH; Herzel, H; Herzog, ED; Hoffmann, C; Hong, C; Hughey, JJ; Hurley, JM; de la Iglesia, HO; Johnson, C; Kay, SA; Koike, N; Kornacker, K; Kramer, A; Lamia, K; Leise, T; Lewis, SA; Li, J; Li, X; Liu, AC; Loros, JJ; Martino, TA; Menet, JS; Merrow, M; Millar, AJ; Mockler, T; Naef, F; Nagoshi, E; Nitabach, MN; Olmedo, M; Nusinow, DA; Ptáček, LJ; Rand, D; Reddy, AB; Robles, MS; Roenneberg, T; Rosbash, M; Ruben, MD; Rund, SSC; Sancar, A; Sassone-Corsi, P; Sehgal, A; Sherrill-Mix, S; Skene, DJ; Storch, K-F; Takahashi, JS; Ueda, HR; Wang, H; Weitz, C; Westermark, PO; Wijnen, ...
Sprenger GA (2007). "Aromatic Amino Acids". Amino Acid Biosynthesis: Pathways, Regulation and Metabolic Engineering (1st ed.). ... In excessive quantities, supplementation can interfere with the production of serotonin and other aromatic amino acids as well ... which naturally produces aromatic amino acids like phenylalanine. The quantity of L-phenylalanine produced commercially has ... The corresponding enzymes in for those compounds are the aromatic amino acid hydroxylase family and nitric oxide synthase. ...
diamond (microscopic). amino acids. polycyclic aromatic hydrocarbons. The ferromagnesian minerals are isolated and show no ... For instance, amino acids have been detected. This is a very important fact in the ongoing search for the origin of life. CI ...
"Aromatic L-amino acid decarboxylase deficiency: diagnostic methodology" (PDF). Clinical Chemistry. 38 (12): 2405-10. PMID ... L-DOPA (/ˌɛlˈdoʊpə/), also known as levodopa (/ˌlɛvoʊˈdoʊpə/) or L-3,4-dihydroxyphenylalanine is an amino acid that is made and ... it is converted into dopamine by the enzyme aromatic L-amino acid decarboxylase, also known as DOPA decarboxylase. Pyridoxal ... Dopamine is formed by the decarboxylation of L-DOPA by aromatic L-amino acid decarboxylase (AADC). ...
The Dakin-West reaction is a chemical reaction that transforms an amino-acid into a keto-amide using an acid anhydride and a ... Dakin, Henry Drysdale; West, Randolph (1928). "Some Aromatic Derivatives of Substituted Acetylaminoacetones". The Journal of ... Modern variations on the Dakin-West reaction permit many enolizable carboxylic acids - not merely amino acids - to be converted ... With some acids, this reaction can take place even in the absence of an α-amino group. This reaction should not be confused ...
Metabolism of Aromatic Amino Acids and Amines. Methods in Enzymology. 142. pp. 139-42. doi:10.1016/S0076-6879(87)42021-1. ISBN ... It has been demonstrated that treatment with nitisinone can reduce urinary levels of homogentisic acid in alkaptonuria patients ... for patients with Tyrosinemia type 1 as it prevents the formation of maleylacetoacetic acid and fumarylacetoacetic acid, which ...
Herrmann, K.; Entus, R. (2001). "Shikimate Pathway: Aromatic Amino Acids and Beyond". Encyclopedia of Life Sciences. doi: ... each of which sensitive to one of the amino acids produced in the shikimate pathway. In a study of DAHP synthase sensitive to ... which is responsible for the biosynthesis of the amino acids phenylalanine, tyrosine, and tryptophan. Since it is the first ... 2-keto-3-deoxy-D-arabino-heptonic acid 7-phosphate synthetase, 3-deoxy-D-arabino-2-heptulosonic acid 7-phosphate synthetase, 3- ...
... meaning that they must obtain these essential amino acids through their diet. Aromatic Amino acids include Phenylalanine, ... The aromatic amino acids produced by the shikimate acid pathway are used by higher plants as protein building blocks and as ... The shikimate pathway was determined to be a major biosynthetic route for the production of aromatic amino acids through the ... The shikimate pathway is a biosynthetic pathway that allows plants, fungi, and bacteria to produce aromatic amino acids. ...
Schulz AR, Oliner L (1967). "The possible role of thyroid aromatic amino acid decarboxylase in thyroxine biosynthesis". Life ... LOVENBERG W, WEISSBACH H, UDENFRIEND S (1962). "Aromatic L-amino acid decarboxylase". J. Biol. Chem. 237: 89-93. PMID 14466899 ... aromatic L-amino acid decarboxylase, and L-phenylalanine carboxy-lyase. This enzyme participates in phenylalanine metabolism. ...
Fitzpatrick PF (2000). "The aromatic amino acid hydroxylases". Adv. Enzymol. Relat. Areas Mol. Biol. Advances in Enzymology - ...
PAH is one of three members of the biopterin-dependent aromatic amino acid hydroxylases, a class of monooxygenase that uses ... Flatmark T, Stevens RC (Aug 1999). "Structural Insight into the Aromatic Amino Acid Hydroxylases and Their Disease-Related ... PAH is unusual among the aromatic amino acid hydroxylases for its involvement in catabolism; tyrosine and tryptophan ... Fitzpatrick PF (Dec 2003). "Mechanism of aromatic amino acid hydroxylation". Biochemistry. 42 (48): 14083-91. doi:10.1021/ ...
3.0 3.1 Nonprotein amino acids from spark discharges and their comparison with the Murchison Meteorite amino acids. Kvenvolden ... Aromatic hydrocarbons. 3319. Fullerenes. ,100. Carboxylic acids. ,300. Hydrocarboxylic acids. 15. Purines and pyrimidines. 1.3 ... Murchison contains over 15 amino acids.[3] All the amino acids found in the Murchison meteorite have been synthesised in ... Phosphonic acids. 2. Research in 2005 showed that an amino acid like L-proline is capable of catalyzing the formation of chiral ...
... amino acids) In Dumas' laboratory, he studied potato essence. In fact, from a single impure sample of one liter belonging to ... but this time to cuminic acid. Their interest in benzoic compounds led to the discovery of numerous aromatic compounds ... after having been treated with CO2 under high pressure and with sulfuric acid, forms salicylic acid. It was later, when he was ... The technique he used to obtain this acid was repeated many times by other scientists who also wished to obtain it, before ...
CYP19A1 Aromatic L-amino acid decarboxylase deficiency; 608643; DDC Arrhythmogenic right ventricular dysplasia 1; 107970; TGFB3 ... FREM1 Bile acid malabsorption, primary; 613291; SLC10A2 Bile acid synthesis defect, congenital, 2; 235555; AKR1D1 Bile acid ... SBDS Sialic acid storage disorder, infantile; 269920; SLC17A5 Sialidosis, type I; 256550; NEU1 Sialidosis, type II; 256550; ... SLC7A7 Lysosomal acid phosphatase deficiency; 200950; ACP2 Lysyl hydroxylase 3 deficiency; 612394; PLOD3 Machado-Joseph disease ...
... is a synthetic aromatic amino acid. It is a chiral molecule and thus has two potential configurations, as (R)- and (S ... Owen DR, Wood DM, Archer JR, Dargan PI (2016). "Phenibut (4-amino-3-phenyl-butyric acid): Availability, prevalence of use, ... As such, its chemical name is β-phenyl-γ-aminobutyric acid, which can be abbreviated as β-phenyl-GABA. The presence of the ... Phenibut is structurally related to the neurotransmitter γ-aminobutyric acid (GABA), and hence is a GABA analogue. It is ...
... s originate from the aromatic amino acids tyrosine, tryptophan, and phenylalanine. They tend to absorb ultraviolet-B ...
Before vancomycin is assembled through NRPS, the amino acids are first modified. L-tyrosine is modified to become the β- ... Figure 2: Linear heptapeptide, which consists of modified aromatic rings. Nonribosomal peptide synthesis occurs through ... In the A domain, the specific amino acid is activated by converting into an aminoacyl adenylate enzyme complex attached to a ... One mechanism of resistance to vancomycin involves the alteration to the terminal amino acid residues of the NAM/NAG-peptide ...
Levodopa is a prodrug for dopamine, which reduces Parkinson symptoms; carbidopa and benserazide are aromatic L-amino acid ... It melts at 143 to 146 °C (289 to 295 °F), is practically insoluble in water and acids but soluble in 0.1 M aqueous sodium ... hydroxylation by CYP3A4 and CYP2A6 with subsequent oxidation to a carboxylic acid, and possibly a minor path with reduction to ... in 0.1 M hydrochloric acid / ethanol). Its chemical name is 3,4-dihydroxy-4'-methyl-5-nitrobenzophenone. A synthesis of ...
The amino-group makes this compound a weak base, capable of reacting with acids to form salts. One common salt of N- ... Chemically, N-methylphenyethanolamine is an aromatic compound, an amine, and an alcohol. ... The amino-ketone was reduced with lithium aluminum hydride to the corresponding amino-alcohol, and the N-benzyl group finally ... α-amino acid chlorides. Application to the preparation of β-arylalkylamines and 3-substituted 1,2,3,4-tetrahydroisoquinolines ...
Inborn errors of metabolism Imidazole Aromatic amino acids Imaeda M, Wada Y (1998). "Urocanic aciduria (urocanase deficiency ... The amino acid histidine, when catalyzed by the enzyme histidase, forms urocanic acid. Disruptions in this pathway, caused by a ... In urocanic aciduria, increased urocanic acid in the urine indicates a deficiency of the enzyme urocanase. With normal to only ... This results in reduced levels of skin and serum urocanic acid, the primary indicator of insufficient histidase activity. ...
... which ultimately blocks the production of aromatic amino acids, and, without aromatic amino acids, plants cannot survive. ... This reaction is part of the shikimate pathway which is involved in the biosynthesis of aromatic amino acids. 3-Dehydroquinate ... The shikimate pathway is responsible for producing the precursors for aromatic amino acids, which are essential to our diets ... Only plants, bacteria, and microbial eukaryotes are capable of producing aromatic amino acids. The pathway ultimately converts ...
Maeda H, Dudareva N (2012). "The shikimate pathway and aromatic amino Acid biosynthesis in plants". Annual Review of Plant ... and like all amino acids, exists in different ionic states depending on pH. Both the phosphonic acid and carboxylic acid ... an essential precursor for the amino acids mentioned above. These amino acids are used in protein synthesis and to produce ... It inhibits a plant enzyme involved in the synthesis of three aromatic amino acids: tyrosine, tryptophan, and phenylalanine. ...
"EC 4.1.1.28 - Aromatic-L-amino-acid decarboxylase (Homo sapiens)". BRENDA. Technische Universität Braunschweig. July 2016. ... meta-Tyramine is produced in humans via aromatic amino acid decarboxylase-mediated metabolism of meta-tyrosine. meta-Tyramine ...
Eventually this results in organism death from lack of aromatic amino acids the organism requires to survive. A version of the ... Maeda H, Dudareva N (2012). "The shikimate pathway and aromatic amino Acid biosynthesis in plants". Annual Review of Plant ... Jaworski EK (1972). "Mode of action of N-phosphonomethyl-glycine: inhibition of aromatic amino acid biosynthesis". J Agric Food ... EPSP synthase participates in the biosynthesis of the aromatic amino acids phenylalanine, tyrosine and tryptophan via the ...
aromatic amino acid family metabolic process. • response to lipopolysaccharide. • cerebral cortex development. • response to ... Like the other aromatic amino acid hydroxylases (AAAHs), tyrosine hydroxylase use the cofactor tetrahydrobiopterin (BH4) under ... functional domains and evolution of aromatic amino acid hydroxylases". Proceedings of the National Academy of Sciences of the ... together the three make up a family of homologous aromatic amino acid hydroxylases.[23][24] ...
β-peptides are composed of amino acids containing an additional CH 2 unit between the amine and carboxylic acid. They are more ... Aedamers that fold in aqueous solutions driven by hydrophobic and aromatic stacking interactions. Aromatic Oligomide Foldamers ... Using a heteroligopeptide consisting of α-amino acids and cis-β-aminocyclopropanecarboxulic acids (cis-β-ACCs) they found the ... The amino acids of these peptides only differ by one (β), two (γ) or three (δ) methylene carbons, yet the structural changes ...
... fatty acids, and amino acids in most vertebrates, including humans. Ketone bodies are elevated in the blood (ketosis) after ... Aromatic ketones can be prepared in the Friedel-Crafts acylation,[12] the related Houben-Hoesch reaction,[13] and the Fries ... Acid/base properties of ketonesEdit. Ketones are far more acidic (pKa ≈ 20) than a regular alkane (pKa ≈ 50). This difference ... Acids as weak as pyridinium cation (as found in pyridinium tosylate) with a pKa of 5.2 are able to serve as catalysts in this ...
Aromatic l-amino acid decarboxylase (AADC) deficiency is an inherited disorder that affects the way signals are passed between ... medlineplus.gov/genetics/condition/aromatic-l-amino-acid-decarboxylase-deficiency/ Aromatic l-amino acid decarboxylase ... Aromatic l-amino acid decarboxylase (AADC) deficiency is an inherited disorder that affects the way signals are passed between ... Aromatic L-amino acid decarboxylase enzyme activity in deficient patients and heterozygotes. Mol Genet Metab. 2007 Apr;90(4): ...
Cross-references: Aromatic-L-amino-acid decarboxylase (IPR010977). The following external resources were found for this entry: ...
An aromatic L-amino acid decarboxylase inhibitor (synonyms: DOPA decarboxylase inhibitor, DDCI and AAADI) is a medication which ... inhibits the synthesis of dopamine by the enzyme aromatic L-amino acid decarboxylase (AADC, AAAD, or DOPA decarboxylase). ... Retrieved from "https://en.wikipedia.org/w/index.php?title=Aromatic_L-amino_acid_decarboxylase_inhibitor&oldid=907336753" ...
... animals have lost these costly metabolic pathways for aromatic amino acids synthesis and must instead obtain the amino acids ... Herbicides and antibiotics take advantage of this by inhibiting enzymes involved in aromatic amino acid synthesis, thereby ... All plants and micro-organisms synthesize their own aromatic amino acids to make proteins. However, ... Kynurenic acid, a kynurenine, produced along the tryptophan-kynurenine pathway, is an antagonist at excitatory amino acid ...
... animals have lost these costly metabolic pathways for aromatic amino acids synthesis and must instead obtain the amino acids ... All plants and micro-organisms synthesize their own aromatic amino acids to make proteins (Braus, 1991; Tzin and Galili, 2010 ... Herbicides take advantage of this by inhibiting enzymes involved in aromatic amino acid synthesis, thereby making them toxic to ... aromatic amino acids serve as precursors for the synthesis of many biologically/neurologically active compounds that are ...
Hyland K, Clayton PT (1990), Aromatic L-amino acid decarboxylase deficiency in twins. J Inherit Metab Dis 13: 301-304.Google ... Chang YT, Mues G, McPherson JD, Bedell J, Marsh JL, Hyland K (1998) Mutations in the human aromatic L-amino acid decarboxylase ... Jahng JW, Wessel TC, Houpt TA, Son JH, Joh TH (1996) Alternate promoters in the rat aromatic L-amino acid decarboxylase gene ... Abeling NG, van Gennip AH, Barth PG, van Cruchten A, Westra M, Wijburg FA (1998) Aromatic L-amino acid decarboxylase deficiency ...
Aromatic-L-amino-acid decarboxylase was isolated from pig kidney by ammonium sulfate fractionation, DEAE chromatography, and ... Purification and characterisation of tyrosine decarboxylase and aromatic-L-amino-acid decarboxylase.. Børresen T1, Klausen NK, ... Microbial tyrosine decarboxylase (EC 4.1.1.25) and mammalian aromatic-L-amino-acid decarboxylase (EC 4.1.1.28) catalyse the ... tyrosine decarboxylase eluted at pH 4.3 and aromatic-L-amino-acid decarboxylase at pH 5.0. Isoelectric focusing of tyrosine ...
... and clinical studies in all areas of amino acids. ... Journal of Amino Acids is a peer-reviewed, Open Access journal ... Separation of Aromatic Amino Acids on Reversed-Phase Columns. Figure 2 shows a chromatogram of a standard solution of amino ... For the determination of the concentration of the respective amino acids, the ratio of the peak areas of the amino acid and the ... This means that "total amino acid analysis" has no closed mass balance and some assumptions about the sequence or amino acid ...
... and clinical studies in all areas of amino acids. ... Journal of Amino Acids is a peer-reviewed, Open Access journal ... Y. Li, A.-G. Tang, and S. Mu, "HPLC-FLD determination of serum aromatic amino acids: application in chronic kidney disease ... Protein Quantification by Derivatization-Free High-Performance Liquid Chromatography of Aromatic Amino Acids. Almut Hesse and ... I. Molnar-Perl, Quantitation of Amino Acids and Amines by Chromatography-Methods and Protocols, 2005. ...
An aromatic amino acid (AAA) is an amino acid that includes an aromatic ring. Examples include: Among 20 standard amino acids: ... Aromatic amino acids are able to absorb light due to their conjugated double bonds. This characteristic of aromatic amino acids ... Animals obtain aromatic amino acids from their diet, but all plants and micro-organisms must synthesize their aromatic amino ... These aromatic amino acids are the derivatives of many secondary metabolites, all essential to a plants biological functions, ...
... an aromatic-amino-acid transaminase (EC 2.6.1.57) is an enzyme that catalyzes the chemical reaction an aromatic amino acid + 2- ... an aromatic oxo acid + L-glutamate Thus, the two substrates of this enzyme are aromatic amino acid and 2-oxoglutarate, whereas ... Other names in common use include aromatic amino acid aminotransferase, aromatic aminotransferase, and ArAT. This enzyme ... Mavrides C, Orr W (1975). "Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli". J. Biol. ...
... aromatic L-amino acid decarboxylase) ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, ... Mouse Aromatic-L-amino-acid decarboxylase, DDC ELISA Kit *Detection Target: dopa decarboxylase (aromatic L-amino acid ... Your search returned 67 dopa decarboxylase (aromatic L-amino acid decarboxylase) ELISA ELISA Kit across 2 suppliers. ... dopa decarboxylase (aromatic L-amino acid decarboxylase) ELISA Kits. dopa decarboxylase (aromatic L-amino acid decarboxylase) ...
Action of Carboxypeptidase Toward Peptides Containing Unnatural Aromatic Amino Acids Message Subject. (Your Name) has forwarded ...
Aromatic L-amino acid decarboxylase (AADC or AAAD), also known as DOPA decarboxylase (DDC), tryptophan decarboxylase, and 5- ... Pons R, Ford B, Chiriboga CA, Clayton PT, Hinton V, Hyland K, Sharma R, De Vivo DC (Apr 2004). "Aromatic L-amino acid ... Aromatic-L-Amino-Acid+Decarboxylases at the US National Library of Medicine Medical Subject Headings (MeSH) ... Aromatic L-amino acid decarboxylase inhibitor, a class of anti-Parkinson drugs ...
Background Aromatic l-amino acid decarboxylase (AADC) deficiency is a disorder of biogenic amine metabolism resulting in ... References to electronic databases: Aromatic l-amino acid decarboxylase deficiency: OMIM #608643. Aromatic l-amino acid ... Aromatic l-amino acid decarboxylase deficiency: unusual neonatal presentation and additional findings in organic acid analysis ... Aromatic l-amino acid decarboxylase (AADC) deficiency is a disorder of biogenic amine metabolism resulting in generalized ...
... aromatic amino acid aminotransferase produced phenylpyruvic acid (PPA) from l-Phe in isolated petal protoplasts. We have cloned ... Functional characterization of aromatic amino acid aminotransferase involved in 2-phenylethanol biosynthesis in isolated rose ... of aromatic amino acid aminotransferase families based on rose EST database and homology regions. The RyAAATs enzymes were ... dependent aromatic amino acid decarboxylase (AADC) and phenylacetaldehyde reductase (PAR). We here report that Rosa Yves ...
K. aerogenes abstracted the alpha-amino group of these compounds by transamination and excreted the arylpyruvate portions into ... Klebsiella aerogenes utilized aromatic amino acids as sole sources of nitrogen but not as sole sources of carbon. ... Klebsiella aerogenes utilized aromatic amino acids as sole sources of nitrogen but not as sole sources of carbon. K. aerogenes ... Tryptophan metabolism in Klebsiella aerogenes: regulation of the utilization of aromatic amino acids as sources of nitrogen J ...
... coli cells to the inhibiting concentrations of l-phenylalanine and aromatic amino acid analogues, dl-p-fluor … ... The inner membrane protein YddG of Escherichia coli is a homologue of the known amino acid exporters RhtA and YdeD. It was ... YddG from Escherichia coli promotes export of aromatic amino acids FEMS Microbiol Lett. 2007 Oct;275(2):312-8. doi: 10.1111/j. ... On the other hand, the inactivation of yddG decreased the aromatic amino acid accumulation by these strains. The cells of the E ...
... showing immunoreactivity to aromatic L-amino acid decarboxylase (AADC), which catalyzes the convers ... Aromatic-L-Amino-Acid Decarboxylases / analysis*. Cats / anatomy & histology*. Dopamine / metabolism. Female. Immunoenzyme ... 0/Nerve Tissue Proteins; 50-67-9/Serotonin; EC 4.1.1.28/Aromatic-L-Amino-Acid Decarboxylases ... showing immunoreactivity to aromatic L-amino acid decarboxylase (AADC), which catalyzes the conversion of L-3, 4- ...
The neurochemical consequences of aromatic L-amino acid decarboxylase deficiency Author: Allen, G. F. G. ISNI: 0000 0004 2729 ... Aromatic L-amino acid decarboxylase (AADC) catalyses the conversion of 5-hydroxytryptophan (5-HTP) and L-3,4- ...
AAA stands for Aromatic Amino Acids. AAA is defined as Aromatic Amino Acids somewhat frequently. ... Aromatic amino acids (AAA) [1] are amino acids that include an aromatic ring. Examples include: Among 20 standard amino acids: ... Aromatic amino acids are relatively nonpolar. To different degrees, all aromatic amino acids absorb ultraviolet light. Tyrosine ... Ultra- Violet Absorption Spectra of Aromatic Amino-Acids. 199 The nitrogen content of the d-l-phenylalanine was 8.68 per cent. ...
Aromatic amino acid transaminase in rat intestine. Jun Nakamura, Tomoo Noguchi, Ryo Kido ... Aromatic amino acid transaminase in rat intestine Message Subject (Your Name) has forwarded a page to you from Biochemical ... The transamination of aromatic l-amino acids (5-hydroxytryptophan, tryptophan, tyrosine, phenylalanine and kynurenine) was ... On the basis of the partial purification and characterization of these aromatic amino acid transaminases, it is suggested that ...
Gene Therapy for Aromatic l-Amino Acid Decarboxylase Deficiency. By Wuh-Liang Hwu, Shin-ichi Muramatsu, Sheng-Hong Tseng, Kai- ... Gene Therapy for Aromatic l-Amino Acid Decarboxylase Deficiency. By Wuh-Liang Hwu, Shin-ichi Muramatsu, Sheng-Hong Tseng, Kai- ... Gene Therapy for Aromatic l-Amino Acid Decarboxylase Deficiency Message Subject. (Your Name) has forwarded a page to you from ... Aromatic l-amino acid decarboxylase (AADC) is required for the synthesis of the neurotransmitters dopamine and serotonin. ...
Gene Therapy for Aromatic l-Amino Acid Decarboxylase Deficiency. By Wuh-Liang Hwu, Shin-ichi Muramatsu, Sheng-Hong Tseng, Kai- ... Gene Therapy for Aromatic l-Amino Acid Decarboxylase Deficiency. By Wuh-Liang Hwu, Shin-ichi Muramatsu, Sheng-Hong Tseng, Kai- ... Gene Therapy for Aromatic l-Amino Acid Decarboxylase Deficiency Message Subject. (Your Name) has forwarded a page to you from ... Patients with aromatic l-amino acid decarboxylase (AADC) deficiency cannot produce the neurotransmitter dopamine from its ...
To delineate the clinical and genetic features of two pedigrees affected with aromatic L-amino acid decarboxylase (AADC) ... Determining Total Aromatic Amino Acid Requirements in Pregnant Women. Phenylalanine and tyrosine are aromatic amino acids that ... Aromatic Amino Acid Decarboxylase Inhibitors. Compounds and drugs that block or inhibit the enzymatic action of AROMATIC AMINO ... Aromatic-l-amino-acid Decarboxylases. An enzyme group with broad specificity. The enzymes decarboxylate a range of aromatic ...
  • Spectral properties of trifluoroacetic acid acetonitrile gradient systems for separation of picomole quantities of peptides by reversed phase high performance liquid chromatography," Journal of Chromatography , vol. 347, no. 1, pp. 83-88, 1985. (hindawi.com)
  • We quantified the amount of each aromatic amino acid synthesized intracellularly and transported to extracellular medium by high performance liquid chromatography. (purdue.edu)
  • The concentrations of amino acids in CSF and serum were determined by high performance liquid chromatography. (biomedcentral.com)
  • Swelling tests of AAm/MA hydrogel were made in buffer solutions and amino acid solutions at various pH at 37 degrees C. The pH values are ionization of alpha-carboxyl groups (pK(1)'), alpha-amino groups (pK(2)') and, isoelectric points (pI) of amino acids. (cumhuriyet.edu.tr)
  • The alpha-amino group of the substrate displaces the lysine epsilon-amino group, in the process forming a new aldimine with the substrate. (ebi.ac.uk)
  • Spectrophotometric titrations have been performed in order to determine the stability constants of inclusion complexation of some aliphatic amino acids with four structurally related organoselenium-modified β-cyclodextrins: mono(6-phenylseleno- 6-deoxy)-β-cyclodextrin (1a), mono[6-(p-methoxyphenylseleno)- 6-deoxy]-β-cyclodextrin (1b), mono(2-phenylseleno- 2-deoxy)-β-cyclodextrin (2a), and mono[2-(p-methoxyphenylseleno)- 2-deoxy]-β-cyclodextrin (2b). (ntu.edu.sg)
  • Currently, heterotrophic microorganisms are fed require an organic source of carbon to produce amino acids, photosynthetic bacteria are investigated. (purdue.edu)
  • Product Description Amino Acid organic fertilizer A new type of organic nitrogen fertilizer it s efficient and green fertilizer and made from residue of monosodium glutamate after pressing through using advanced production equipment to granulate it under high temperature It provides organic matter. (sinochemnutrition.com)
  • The more than 130 contributions reflect the importance of inorganic chemicals as finished products (e.g., fertilizers, lime and limestone), high-tech materials (e.g., glass ceramics, metallic glasses), and basic products for the organic chemical industry, such as mineral acids, oxidizing agents and halogens. (wiley.com)
  • An Introduction to Organic Reactions and Their Mechanisms: Acids and Bases 4. (worldcat.org)
  • We constantly believe that one's character decides products' high quality, the details decides products' high-quality ,together with the REALISTIC,EFFICIENT AND INNOVATIVE crew spirit for Aromatic Amino Acids , aromatic amino acids , main amino acids , Thanks for taking your worthwhile time to go to us and stay up for have a nice cooperation along with you. (sinochemnutrition.com)
  • The aim of this study was to assess the effects of albumin dialysis on hepatic encephalopathy and circulating levels of amino acids in severe alcoholic hepatitis. (biomedcentral.com)
  • However, the mechanisms responsible for this improvement, and their relationship with circulating levels of amino acids, are poorly identified. (biomedcentral.com)
  • Therefore, the aim of the current study was to assess the effect of albumin dialysis on hepatic encephalopathy and on the circulating levels of amino acids and ammonia in patients with severe liver failure. (biomedcentral.com)
  • C. Meinert and U. J. Meierhenrich, "Derivatization and multidimensional gas-chromatographic resolution of α -alkyl and α -dialkyl amino acid enantiomers," ChemPlusChem , vol. 79, no. 6, pp. 781-785, 2014. (hindawi.com)
  • Are there examples of PTMs that add different chemical groups (and mass) to different amino acids? (stackexchange.com)
  • Importantly, you can also find milligram amounts for 18 different amino acids in all 100 of our food profiles by clicking on the in-depth nutritional profile link toward the end of each food profile. (whfoods.org)
  • This means that "total amino acid analysis" has no closed mass balance and some assumptions about the sequence or amino acid composition have to be made. (hindawi.com)