Amino Acid Substitution: The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.Entropy: The measure of that part of the heat or energy of a system which is not available to perform work. Entropy increases in all natural (spontaneous and irreversible) processes. (From Dorland, 28th ed)Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Computer Simulation: Computer-based representation of physical systems and phenomena such as chemical processes.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Amino Acids: Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.Kinetics: The rate dynamics in chemical or physical systems.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Thermodynamics: A rigorously mathematical analysis of energy relationships (heat, work, temperature, and equilibrium). It describes systems whose states are determined by thermal parameters, such as temperature, in addition to mechanical and electromagnetic parameters. (From Hawley's Condensed Chemical Dictionary, 12th ed)Muramidase: A basic enzyme that is present in saliva, tears, egg white, and many animal fluids. It functions as an antibacterial agent. The enzyme catalyzes the hydrolysis of 1,4-beta-linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in peptidoglycan and between N-acetyl-D-glucosamine residues in chitodextrin. EC 3.2.1.17.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Lymphomatoid Granulomatosis: An angiocentric and angiodestructive lymphoproliferative disorder primarily involving the lungs. It is caused by an Epstein-Barr virus-induced transformation of the B-cells, in a T-cell rich environment. Clinically and pathologically it resembles EXTRANODAL NK-T-CELL LYMPHOMA.Cost-Benefit Analysis: A method of comparing the cost of a program with its expected benefits in dollars (or other currency). The benefit-to-cost ratio is a measure of total return expected per unit of money spent. This analysis generally excludes consideration of factors that are not measured ultimately in economic terms. Cost effectiveness compares alternative ways to achieve a specific set of results.Zea mays: A plant species of the family POACEAE. It is a tall grass grown for its EDIBLE GRAIN, corn, used as food and animal FODDER.Genome Components: The parts of a GENOME sequence that are involved with the different functions or properties of genomes as a whole as opposed to those of individual GENES.Genes, Plant: The functional hereditary units of PLANTS.Crops, Agricultural: Cultivated plants or agricultural produce such as grain, vegetables, or fruit. (From American Heritage Dictionary, 1982)Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Alzheimer Disease: A degenerative disease of the BRAIN characterized by the insidious onset of DEMENTIA. Impairment of MEMORY, judgment, attention span, and problem solving skills are followed by severe APRAXIAS and a global loss of cognitive abilities. The condition primarily occurs after age 60, and is marked pathologically by severe cortical atrophy and the triad of SENILE PLAQUES; NEUROFIBRILLARY TANGLES; and NEUROPIL THREADS. (From Adams et al., Principles of Neurology, 6th ed, pp1049-57)Aspartic Acid Endopeptidases: A sub-subclass of endopeptidases that depend on an ASPARTIC ACID residue for their activity.Amyloid Precursor Protein Secretases: Endopeptidases that are specific for AMYLOID PROTEIN PRECURSOR. Three secretase subtypes referred to as alpha, beta, and gamma have been identified based upon the region of amyloid protein precursor they cleave.Dietary Proteins: Proteins obtained from foods. They are the main source of the ESSENTIAL AMINO ACIDS.Disulfides: Chemical groups containing the covalent disulfide bonds -S-S-. The sulfur atoms can be bound to inorganic or organic moieties.Chromatography, Ion Exchange: Separation technique in which the stationary phase consists of ion exchange resins. The resins contain loosely held small ions that easily exchange places with other small ions of like charge present in solutions washed over the resins.Amyloid beta-Protein Precursor: A single-pass type I membrane protein. It is cleaved by AMYLOID PRECURSOR PROTEIN SECRETASES to produce peptides of varying amino acid lengths. A 39-42 amino acid peptide, AMYLOID BETA-PEPTIDES is a principal component of the extracellular amyloid in SENILE PLAQUES.Salt-Tolerant Plants: Plants that can grow well in soils that have a high SALINITY.Brassicaceae: A plant family of the order Capparales, subclass Dilleniidae, class Magnoliopsida. They are mostly herbaceous plants with peppery-flavored leaves, due to gluconapin (GLUCOSINOLATES) and its hydrolysis product butenylisotrhiocyanate. The family includes many plants of economic importance that have been extensively altered and domesticated by humans. Flowers have 4 petals. Podlike fruits contain a number of seeds. Cress is a general term used for many in the Brassicacea family. Rockcress is usually ARABIS; Bittercress is usually CARDAMINE; Yellowcress is usually RORIPPA; Pennycress is usually THLASPI; Watercress refers to NASTURTIUM; or RORIPPA or TROPAEOLUM; Gardencress refers to LEPIDIUM; Indiancress refers to TROPAEOLUM.Salt-Tolerance: The ability of organisms to sense and adapt to high concentrations of salt in their growth environment.Sodium Chloride: A ubiquitous sodium salt that is commonly used to season food.Plant Roots: The usually underground portions of a plant that serve as support, store food, and through which water and mineral nutrients enter the plant. (From American Heritage Dictionary, 1982; Concise Dictionary of Biology, 1990)Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Plant Transpiration: The loss of water vapor by plants to the atmosphere. It occurs mainly from the leaves through pores (stomata) whose primary function is gas exchange. The water is replaced by a continuous column of water moving upwards from the roots within the xylem vessels. (Concise Dictionary of Biology, 1990)Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Arabidopsis Proteins: Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.

Cytochrome P450 monooxygenases and insecticide resistance in insects. (1/16550)

Cytochrome P450 monooxygenases are involved in many cases of resistance of insects to insecticides. Resistance has long been associated with an increase in monooxygenase activities and with an increase in cytochrome P450 content. However, this increase does not always account for all of the resistance. In Drosophila melanogaster, we have shown that the overproduction of cytochrome P450 can be lost by the fly without a corresponding complete loss of resistance. These results prompted the sequencing of a cytochrome P450 candidate for resistance in resistant and susceptible flies. Several mutations leading to amino-acid substitutions have been detected in the P450 gene CYP6A2 of a resistant strain. The location of these mutations in a model of the 3D structure of the CYP6A2 protein suggested that some of them may be important for enzyme activity of this molecule. This has been verified by heterologous expression of wild-type and mutated cDNA in Escherichia coli. When other resistance mechanisms are considered, relatively few genetic mutations are involved in insecticide resistance, and this has led to an optimistic view of the management of resistance. Our observations compel us to survey in more detail the genetic diversity of cytochrome P450 genes and alleles involved in resistance.  (+info)

An antiviral mechanism of nitric oxide: inhibition of a viral protease. (2/16550)

Although nitric oxide (NO) kills or inhibits the replication of a variety of intracellular pathogens, the antimicrobial mechanisms of NO are unknown. Here, we identify a viral protease as a target of NO. The life cycle of many viruses depends upon viral proteases that cleave viral polyproteins into individual polypeptides. NO inactivates the Coxsackievirus protease 3C, an enzyme necessary for the replication of Coxsackievirus. NO S-nitrosylates the cysteine residue in the active site of protease 3C, inhibiting protease activity and interrupting the viral life cycle. Substituting a serine residue for the active site cysteine renders protease 3C resistant to NO inhibition. Since cysteine proteases are critical for virulence or replication of many viruses, bacteria, and parasites, S-nitrosylation of pathogen cysteine proteases may be a general mechanism of antimicrobial host defenses.  (+info)

Functional consequences of mutations in the human alpha1A calcium channel subunit linked to familial hemiplegic migraine. (3/16550)

Mutations in alpha1A, the pore-forming subunit of P/Q-type calcium channels, are linked to several human diseases, including familial hemiplegic migraine (FHM). We introduced the four missense mutations linked to FHM into human alpha1A-2 subunits and investigated their functional consequences after expression in human embryonic kidney 293 cells. By combining single-channel and whole-cell patch-clamp recordings, we show that all four mutations affect both the biophysical properties and the density of functional channels. Mutation R192Q in the S4 segment of domain I increased the density of functional P/Q-type channels and their open probability. Mutation T666M in the pore loop of domain II decreased both the density of functional channels and their unitary conductance (from 20 to 11 pS). Mutations V714A and I1815L in the S6 segments of domains II and IV shifted the voltage range of activation toward more negative voltages, increased both the open probability and the rate of recovery from inactivation, and decreased the density of functional channels. Mutation V714A decreased the single-channel conductance to 16 pS. Strikingly, the reduction in single-channel conductance induced by mutations T666M and V714A was not observed in some patches or periods of activity, suggesting that the abnormal channel may switch on and off, perhaps depending on some unknown factor. Our data show that the FHM mutations can lead to both gain- and loss-of-function of human P/Q-type calcium channels.  (+info)

Phe161 and Arg166 variants of p-hydroxybenzoate hydroxylase. Implications for NADPH recognition and structural stability. (4/16550)

Phe161 and Arg166 of p-hydroxybenzoate hydroxylase from Pseudomonas fluorescens belong to a newly discovered sequence motif in flavoprotein hydroxylases with a putative dual function in FAD and NADPH binding [1]. To study their role in more detail, Phe161 and Arg166 were selectively changed by site-directed mutagenesis. F161A and F161G are catalytically competent enzymes having a rather poor affinity for NADPH. The catalytic properties of R166K are similar to those of the native enzyme. R166S and R166E show impaired NADPH binding and R166E has lost the ability to bind FAD. The crystal structure of substrate complexed F161A at 2.2 A is indistinguishable from the native enzyme, except for small changes at the site of mutation. The crystal structure of substrate complexed R166S at 2.0 A revealed that Arg166 is important for providing an intimate contact between the FAD binding domain and a long excursion of the substrate binding domain. It is proposed that this interaction is essential for structural stability and for the recognition of the pyrophosphate moiety of NADPH.  (+info)

Possible role for ligand binding of histidine 81 in the second transmembrane domain of the rat prostaglandin F2alpha receptor. (5/16550)

For the five principal prostanoids PGD2, PGE2, PGF2alpha, prostacyclin and thromboxane A2 eight receptors have been identified that belong to the family of G-protein-coupled receptors. They display an overall homology of merely 30%. However, single amino acids in the transmembrane domains such as an Arg in the seventh transmembrane domain are highly conserved. This Arg has been identified as part of the ligand binding pocket. It interacts with the carboxyl group of the prostanoid. The aim of the current study was to analyze the potential role in ligand binding of His-81 in the second transmembrane domain of the rat PGF2alpha receptor, which is conserved among all PGF2alpha receptors from different species. Molecular modeling suggested that this residue is located in close proximity to the ligand binding pocket Arg 291 in the 7th transmembrane domain. The His81 (H) was exchanged by site-directed mutagenesis to Gln (Q), Asp (D), Arg (R), Ala (A) and Gly (G). The receptor molecules were N-terminally extended by a Flag epitope for immunological detection. All mutant proteins were expressed at levels between 50% and 80% of the wild type construct. The H81Q and H81D receptor bound PGF2alpha with 2-fold and 25-fold lower affinity, respectively, than the wild type receptor. Membranes of cells expressing the H81R, H81A or H81G mutants did not bind significant amounts of PGF2alpha. Wild type receptor and H81Q showed a shallow pH optimum for PGF2alpha binding around pH 5.5 with almost no reduction of binding at higher pH. In contrast the H81D mutant bound PGF2alpha with a sharp optimum at pH 4.5, a pH at which the Asp side chain is partially undissociated and may serve as a hydrogen bond donor as do His and Gln at higher pH values. The data indicate that the His-81 in the second transmembrane domain of the PGF2alpha receptor in concert with Arg-291 in the seventh transmembrane domain may be involved in ligand binding, most likely not by ionic interaction with the prostaglandin's carboxyl group but rather as a hydrogen bond donor.  (+info)

The contribution of adjacent subunits to the active sites of D-3-phosphoglycerate dehydrogenase. (6/16550)

D-3-Phosphoglycerate dehydrogenase (PGDH) from Escherichia coli is allosterically inhibited by L-serine, the end product of its metabolic pathway. Previous results have shown that inhibition by serine has a large effect on Vmax and only a small or negligible effect on Km. PGDH is thus classified as a V-type allosteric enzyme. In this study, the active site of PGDH has been studied by site-directed mutagenesis to assess the role of certain residues in substrate binding and catalysis. These consist of a group of cationic residues (Arg-240, Arg-60, Arg-62, Lys-39, and Lys-141') that potentially form an electrostatic environment for the binding of the negatively charged substrate, as well as the only tryptophan residue found in PGDH and which fits into a hydrophobic pocket immediately adjacent to the active site histidine residue. Interestingly, Trp-139' and Lys-141' are part of the polypeptide chain of the subunit that is adjacent to the active site. The results of mutating these residues show that Arg-240, Arg-60, Arg-62, and Lys-141' play distinct roles in the binding of the substrate to the active site. Mutants of Trp-139' show that this residue may play a role in stabilizing the catalytic center of the enzyme. Furthermore, these mutants appear to have a significant effect on the cooperativity of serine inhibition and suggest a possible role for Trp-139' in the cooperative interactions between subunits.  (+info)

Mechanistic studies on the reductive half-reaction of NADPH-cytochrome P450 oxidoreductase. (7/16550)

Site-directed mutagenesis has been employed to study the mechanism of hydride transfer from NADPH to NADPH-cytochrome P450 oxidoreductase. Specifically, Ser457, Asp675, and Cys630 have been selected because of their proximity to the isoalloxazine ring of FAD. Substitution of Asp675 with asparagine or valine decreased cytochrome c reductase activities 17- and 677-fold, respectively, while the C630A substitution decreased enzymatic activity 49-fold. Earlier studies had shown that the S457A mutation decreased cytochrome c reductase activity 90-fold and also lowered the redox potential of the FAD semiquinone (Shen, A., and Kasper, C. B. (1996) Biochemistry 35, 9451-9459). The S457A/D675N and S457A/D675N/C630A mutants produced roughly multiplicative decreases in cytochrome c reductase activity (774- and 22000-fold, respectively) with corresponding decreases in the rates of flavin reduction. For each mutation, increases were observed in the magnitudes of the primary deuterium isotope effects with NADPD, consistent with decreased rates of hydride transfer from NADPH to FAD and an increase in the relative rate limitation of hydride transfer. Asp675 substitutions lowered the redox potential of the FAD semiquinone. In addition, the C630A substitution shifted the pKa of an ionizable group previously identified as necessary for catalysis (Sem, D. S., and Kasper, C. B. (1993) Biochemistry 32, 11539-11547) from 6.9 to 7.8. These results are consistent with a model in which Ser457, Asp675, and Cys630 stabilize the transition state for hydride transfer. Ser457 and Asp675 interact to stabilize both the transition state and the FAD semiquinone, while Cys630 interacts with the nicotinamide ring and the fully reduced FAD, functioning as a proton donor/acceptor to FAD.  (+info)

Cystic fibrosis-associated mutations at arginine 347 alter the pore architecture of CFTR. Evidence for disruption of a salt bridge. (8/16550)

Arginine 347 in the sixth transmembrane domain of cystic fibrosis transmembrane conductance regulator (CFTR) is a site of four cystic fibrosis-associated mutations. To better understand the function of Arg-347 and to learn how mutations at this site disrupt channel activity, we mutated Arg-347 to Asp, Cys, Glu, His, Leu, or Lys and examined single-channel function. Every Arg-347 mutation examined, except R347K, had a destabilizing effect on the pore, causing the channel to flutter between two conductance states. Chloride flow through the larger conductance state was similar to that of wild-type CFTR, suggesting that the residue at position 347 does not interact directly with permeating anions. We hypothesized that Arg-347 stabilizes the channel through an electrostatic interaction with an anionic residue in another transmembrane domain. To test this, we mutated anionic residues (Asp-924, Asp-993, and Glu-1104) to Arg in the context of either R347E or R347D mutations. Interestingly, the D924R mutation complemented R347D, yielding a channel that behaved like wild-type CFTR. These data suggest that Arg-347 plays an important structural role in CFTR, at least in part by forming a salt bridge with Asp-924; cystic fibrosis-associated mutations disrupt this interaction.  (+info)

*Ancestral reconstruction

On a molecular level, amino acid residues at different locations of a protein may evolve non-independently because they have a ... One may also use this substitution model as the basis for a Bayesian inference procedure, which would consider the posterior ... Pupko, T.; Pe, I.; Shamir, R.; Graur, D. (2000). "A Fast Algorithm for Joint Reconstruction of Ancestral Amino Acid Sequences ... Motivated by the development of techniques for determining the primary (amino acid) sequence of proteins by Frederick Sanger in ...

*Molecular phylogenetics

A comprehensive step-by-step protocol on constructing phylogenetic tree, including DNA/Amino Acid contiguous sequence assembly ... by dividing the number of substitutions by the number of base pairs analysed: the hope is that this measure will be independent ... for example the insertion of a section of nucleic acid in one haplotype that is not present in another). The difference between ... This is referred to as the number of substitutions (other kinds of differences between haplotypes can also occur, ...

*Nucleic acid sequence

The absence of substitutions, or the presence of only very conservative substitutions (that is, the substitution of amino acids ... ISBN 0-87969-608-7. Ng, P. C.; Henikoff, S. (2001). "Predicting Deleterious Amino Acid Substitutions". Genome Research. 11 (5 ... The sequence of nucleobases on a nucleic acid strand is translated by cell machinery into a sequence of amino acids making up a ... Each group of three bases, called a codon, corresponds to a single amino acid, and there is a specific genetic code by which ...

*Sequence alignment

The absence of substitutions, or the presence of only very conservative substitutions (that is, the substitution of amino acids ... color is often used to indicate amino acid properties to aid in judging the conservation of a given amino acid substitution. ... In typical usage, protein alignments use a substitution matrix to assign scores to amino-acid matches or mismatches, and a gap ... Ng PC; Henikoff S (May 2001). "Predicting deleterious amino acid substitutions". Genome Res. 11 (5): 863-74. doi:10.1101/gr. ...

*CORIN

The amino acid substitutions impaired corin activity. An insertion variant in exon 1 alters the cytoplasmic tail. This variant ... Human corin, a polypeptide of 1042 amino acids, consists of an N-terminal cytoplasmic domain, a transmembrane domain and an ...

*Substitution matrix

Many specialized substitution matrices have been developed that describe the amino acid substitution rates in specific ... Each amino acid is more or less likely to mutate into various other amino acids. For instance, a hydrophilic residue such as ... and you will often see the same substitution matrix expressed in different bases. One of the first amino acid substitution ... th amino acid being transformed into the j {\displaystyle j} th amino acid in a certain amount of evolutionary time. There are ...

*BLOSUM

Two major forces drive the amino-acid substitution rates away from uniformity: substitutions occur with the different ... However, these amino acids can be categorised into groups with similar physicochemical properties. Substituting an amino acid ... Substitution matrices for amino acids are more complicated and implicitly take into account everything that might affect the ... Then, they calculated a log-odds score for each of the 210 possible substitution pairs of the 20 standard amino acids. All ...

*Steven Henikoff

"Amino Acid Substitution Matrices from Protein Blocks". PNAS. 89 (22): 10915-10919. doi:10.1073/pnas.89.22.10915. PMC 50453 . ... In 1992, Steven Henikoff, together with his wife Jorja Henikoff, introduced the BLOSUM substitution matrices. The BLOSUM ...

*Phage P22 Tailspike Protein

Mitraki A, King J (Jul 1992). "Amino acid substitutions influencing intracellular protein folding pathways". FEBS Letters. 307 ... P22TSP is a homotrimeric structural protein consisting of 666 amino acids. It is noncovalently bound to the neck of the viral ... Two aspartic acids and one glutamic acid in the active site have been strongly linked to enzymatic activity. Different ...

*CS-BLAST

Similarities between amino acids or nucleotides are quantified in these substitution matrices. The substitution score ( S {\ ... mutating into amino acid b {\displaystyle b} [2]. In a large set of sequence alignments, counting the number of amino acids as ... "Discriminative Modelling of Context-specific Amino Acid Substitution Properties" BIOINFORMATICS 28.24 (2012): 3240-247. Oxford ... In predicting substitution probabilities using only the amino acid's local sequence context, you gain the advantage of not ...

*List of sequence alignment software

"Discriminative modelling of context-specific amino acid substitution probabilities". Bioinformatics. 28 (24): 3240-7. doi: ... September 1997). "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucleic Acids Research. 25 ... 1998). Biological sequence analysis: probabilistic models of proteins and nucleic acids. Cambridge, UK: Cambridge University ... Nucleic Acids Research. 34 (17): e112. doi:10.1093/nar/gkl480. PMC 1635247 . PMID 16971460. Girdea, M; Noe, L; Kucherov, G ( ...

*Julian Gough (scientist)

"Predicting the functional consequences of cancer-associated amino acid substitutions". Bioinformatics. 29 (12): 1504-10. doi: ... His research has been published in leading peer reviewed scientific journals including Nature, Science, Cell, Nucleic Acids ... 2005). "InterPro, progress and status in 2005". Nucleic Acids Research. 33 (Database issue): D201-5. doi:10.1093/nar/gki106. ... SCOP sequence searches, alignments and genome assignments". Nucleic Acids Research. 30 (1): 268-272. doi:10.1093/nar/30.1.268. ...

*Pyruvate dehydrogenase (lipoamide) alpha 1

Takakubo F, Cartwright P, Hoogenraad N, Thorburn DR, Collins F, Lithgow T, Dahl HH (Oct 1995). "An amino acid substitution in ... Structural implications of novel amino acid substitutions in E1 protein". Molecular Genetics and Metabolism. 104 (4): 507-16. ... The preliminary peptide encoded by this gene was 29 amino acids at the very start of the sequence that correspond to a typical ... The remaining 361 amino acids, starting at the N terminus with phenylalanine, represent the mature mitochondrial E1 alpha ...

*Mastoparan

"Selective amino acid substitution reduces cytotoxicity of the antimicrobial peptide mastoparan". Biochimica et Biophysica Acta ...

*Smith-Waterman algorithm

Different base substitutions or amino acid substitutions can have different scores. The substitution matrix of amino acids is ... Each base substitution or amino acid substitution is assigned a score. In general, matches are assigned positive scores, and ... A substitution matrix assigns each pair of bases or amino acids a score for match or mismatch. Usually matches get positive ... Saul B. Needleman; Christian D. Wunsch (1970). "A general method applicable to the search for similarities in the amino acid ...

*Substitution model

Since not all DNA substitution also alter the encoded amino acid, information is lost when looking at amino acids instead of ... for an amino acid sequence (there are 20 "standard" amino acids that make up proteins), you would find there are 208 parameters ... "Higher rates of amino acid substitution in rodents than in humans". Mol. Phylogenet. Evol. 1 (3): 211-4. doi:10.1016/1055-7903( ... Unlike the DNA models, amino acid models traditionally are empirical models. They were pioneered in the 1970s by Dayhoff and co ...

*Models of DNA evolution

Gu X, Li W (1992). "Higher rates of amino acid substitution in rodents than in man". Molecular Phylogenetics and Evolution. 1 ( ... for an amino acid sequence (there are 20 "standard" amino acids that make up proteins), one would find there are 209 parameters ... a codon is three bases and codes for one amino acid in a protein). There are 4 3 = 64 {\displaystyle 4^{3}=64} codons, but the ... These substitution models differ in terms of the parameters used to describe the rates at which one nucleotide replaces another ...

*Phosphoenolpyruvate carboxylase

"Greater efficiency of photosynthetic carbon fixation due to single amino-acid substitution". Nature Communications. 4 (2): 1518 ... The sequence length is about 966 amino acids. See figure 1 for a PyMOL generated structure of the enzyme's single subunit from ... It includes a conserved aspartic acid (D564) and a glutamic acid (E566) residue that non-covalently bind a divalent metal ... such as for example amino acids. PEP carboxylase is mainly subject to two levels of regulation: phosphorylation and allostery. ...

*Beta-lactamase

... such as clavulanic acid. Single amino acid substitutions at positions 104, 164, 238, and 240 produce the ESBL phenotype, but ... Amino acid substitutions in OXA enzymes can also give the ESBL phenotype. While most ESBLs have been found in E. coli, K. ... Ten variants, KPC-2 through KPC-11 are known, and they are distinguished by one or two amino acid substitutions (KPC-1 was re- ... The amino acid substitutions responsible for the extended-spectrum beta lactamase (ESBL) phenotype cluster around the active ...

*Character evolution

Character state changes can be phenotypic changes, nucleotide substitutions, or amino acid substitutions. These small changes ...

*Susan Rae Wente

8 August 1986). "Effect of amino acid substitutions on the catalytic and regulatory properties of aspartate transcarbamoylase ... Wente and her colleagues investigated the enzyme aspartate transcarbamoylase and the amino acid residues that assist in making ...

*R.EcoRII

A single amino acid substitution uncouples target recognition from cooperative DNA interaction and cleavage". J. Biol. Chem. ... Its molecular mass is 45.2 kDa, being composed of 402 amino acids. EcoRII is a bacterial Type IIE REase that interacts with two ... 2003). "A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes". Nucleic Acids ... Nucleic Acids Research. 35 (7): 2227-37. doi:10.1093/nar/gkm045. PMC 1874628 . PMID 17369272. Molecular and Cellular Biology ...

*SNP annotation

... predicting effects of amino acid substitutions on proteins". Nucleic Acids Res. 2012: W452-W457. doi:10.1093/nar/gks539. ... Ng P. C.; Henikoff S. (2003). "SIFT: predicting amino acid changes that affect protein function". Nucleic Acids Research. 31 ( ... Non-synonymous is the variant in exons that change the amino acid sequence encoded by the gene, including single base changes ... Yates, C. M.; Filippis, I.; Kelley, L. A.; Sternberg, M. J. (2014). "SuSPect: enhanced prediction of single amino acid variant ...

*Myeong-Hee Yu

Kwon, K.S.; Kim, J; shin, H.S.; Yu, M.H. (1 April 1994). "Single amino acid substitutions of alpha 1-antitrypsin that confer ... Yu and her research team have worked to discover what amino acids can suppress certain types of mutations, such as the tsf ...

*PANTHER

... this substitutions should be entered in the standard amino acid substitution format, e.g. L46P. PANTHER will use an alignment ... You must enter a protein sequence in the first box and the substitutions relative to this protein sequence in the second box; ... Jan 2012). "InterPro in 2011: new developments in the family and domain prediction database". Nucleic Acids Res. 40 (Database ... Aug 2013). "Large-scale gene function analysis with the PANTHER classification system". Nucleic Acids Res. 8 (8): 1551-66. doi: ...

*Shiladitya DasSarma

DasSarma, Shiladitya; Capes, Melinda D.; Karan, Ram; DasSarma, Priya (2013-03-11). "Amino Acid Substitutions in Cold-Adapted ...

*Protein mimetic

Phosphomimetics - An amino acid substitution or modification which mimic the effect of protein phosphorylation. Homology ( ...
Protein-protein Interactions (PPIs) play important roles in a wide variety of cellular processes, including metabolic cycles, DNA transcription and replication, and signaling cascades. High-throughput biological experiments for identifying PPIs are beginning to provide valuable information about the complexity of PPI networks, but are expensive, cumbersome, and extremely time-consuming. Hence, there is a need for accurate and robust computational methods for predicting PPIs. In this article, a sequence-based approach is proposed by combining a novel amino acid substitution matrix feature representation and Rotation Forest (RF) classifier. Given the protein sequences as input, the proposed method predicts whether or not the pair of proteins interacts. When performed on the PPI data of Saccharomyces cerevisiae, the proposed method achieved 93.74% prediction accuracy with 90.05% sensitivity at the precision of 97.08%. Extensive experiments are performed to compare our method with the existing ...
Adequate representations of protein evolution should consider how the acceptance of mutations depends on the sequence context in which they arise. However, epistatic interactions among sites in a protein result in hererogeneities in the substitution rate, both temporal and spatial, that are beyond the capabilities of current models. Here we use parallels between amino acid substitutions and chemical reaction kinetics to develop an improved theory of protein evolution. We constructed a mechanistic framework for modelling amino acid substitution rates that uses the formalisms of statistical mechanics, with principles of population genetics underlying the analysis. Theoretical analyses and computer simulations of proteins under purifying selection for thermodynamic stability show that substitution rates and the stabilization of resident amino acids (the evolutionary Stokes shift) can be predicted from biophysics and the effect of sequence entropy alone. Furthermore, we demonstrate that ...
A key element in evaluating the quality of a pairwise sequence alignment is the "substitution matrix", which assigns a score for aligning any possible pair of residues. The theory of amino acid substitution matrices is described in [1], and applied to DNA sequence comparison in [2]. In general, different substitution matrices are tailored to detecting similarities among sequences that are diverged by differing degrees [1-3]. A single matrix may nevertheless be reasonably efficient over a relatively broad range of evolutionary change [1-3]. Experimentation has shown that the BLOSUM-62 matrix [4] is among the best for detecting most weak protein similarities. For particularly long and weak alignments, the BLOSUM-45 matrix may prove superior. A detailed statistical theory for gapped alignments has not been developed, and the best gap costs to use with a given substitution matrix are determined empirically. Short alignments need to be relatively strong (i.e. have a higher percentage of matching ...
Identification of specificity determining residues in enzymes using environment specific substitution tables - Quantitative Biology > Quantitative Methods. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
article{4f763f26-2b92-4175-b9f7-0d81d4ed8a4b, abstract = {Cancer is characterized by the accumulation of large numbers of genetic variations and alterations of multiple biological phenomena. Cancer genomics has largely focused on the identification of such genetic alterations and the genes containing them, known as cancer genes. However, the non-functional somatic variations out-number functional variations and remain as a major challenge. Recurrent somatic variations are thought to be cancer drivers but they are present in only a small fraction of patients.}, articleno = {53}, author = {Niroula, Abhishek and Vihinen, Mauno}, issn = {1755-8794}, language = {eng}, number = {1}, publisher = {BioMed Central}, series = {BMC Medical Genomics}, title = {Harmful somatic amino acid substitutions affect key pathways in cancers.}, url = {http://dx.doi.org/10.1186/s12920-015-0125-x}, volume = {8}, year = {2015 ...
ABT-510: In the early 1990s, thrombospondin (TSP-1) was first recognized as an endogenously produced inhibitor of angiogenesis. Since then, thrombospondin has been shown to inhibit neovascularization and tumorigenesis in numerous mouse models. Its anti- angiogenesis properties have been localized to its N-terminal region. Although smaller fragments of this region retain some of thrombospondins anti-angiogenesis properties, researchers have discovered that specific amino acid substitutions can greatly enhance these properties. From these efforts, ABT-510, a nine-amino acid synthetic peptide has emerged as a novel anti-angiogenesis agent. The peptide is soluble and stable in water and is administered parenterally as an acetate salt in 5% dextrose solution for clinical use.. ABT-510 has been evaluated in three Phase I studies: one single-dose study in healthy volunteers and two studies in cancer patients. Doses ranging from 10 mg to 260 mg have been evaluated as IV infusions (30-minute), ...
1C5I: Hydrogen bonding and catalysis: a novel explanation for how a single amino acid substitution can change the pH optimum of a glycosidase.
Single Amino Acid Mutation related change of Binding Energy (SAAMBE) method addresses the demand for computational tools of predicting the effect of single amino acid substitution on the binding free energy of protein complexes. It is based on the fast (,, 1 minute) modified MM-PBSA protocol that is successfully tested and optimized for more than thousand experimental data points. If the usage of the server results in scientific publication, please, cite the following papers: References SAAMBE is running on Clemson Universitys Palmetto Supercomputer Cluster. If you experience problems, they may be due to Palmetto Cluster being not functional or under maintenance. Contact us at [email protected] ...
Substitution Mutations: In substitution mutations, a nitrogenous base of a triplet codon of DNA is replaced by another nitrogen base or some derivative of the nitrogen base, changing the codon. The altered codon codes for a different amino acid substitution.The substitution mutations are of two types: 1.Transitions: It is the replacement of one purine in a polynucleotide chain by another purine(A by G or G by A) or one pyrimidine by another pyrimidine(T by C or C by T) 2.Transversions:A base pair substitution involving the substitution of a purine by pyrimidine or pyrimidine by a purine is called transversion. ...
Structure-function studies of potassium channels have shown that many pore loop substitutions result in a loss of functional channel expression. Some point mutations in the pore loop disrupt subunit tetramerization (Heginbotham et al., 1997), whereas in other cases channels are delivered to the cell surface, as determined by voltage-dependent gating charge movement, but potassium ion conduction through the pore is eliminated (Perozo et al., 1993). Glutamate receptor channels appear to tolerate a larger repertoire of substitutions, possibly owing to their larger pore dimensions. Estimates of pore size at the selectivity filter based on permeation of organic cations suggest a diameter of ∼5.5 Å for NMDA receptors (Villarroel et al., 1995), 7.5-7.6 Å for both Q and R forms of kainate receptors and ∼7.8 Å for AMPA receptors (Burnashev et al., 1996). In contrast, potassium channels exhibit a narrower pore diameter of ∼3 Å (Hille, 2001). With some notable exceptions, single amino acid ...
The sessile nature of plants forces them to cope directly with environmental stresses, which include insect herbivory, pathogen attack, UV light radiation, and drought. Secondary metabolites are believed to be an important mechanism that allows plants to respond to these environmental challenges. There are more than 100,000 known plant secondary metabolites, which probably represent less than 10% of the actual total in nature (Wink, 1988). A large fraction of this diversity is derived from differential modification of common backbone structures, which requires the evolution of numerous enzymes with different product specificities. There are several mechanisms by which this can occur. First, as is the case with terpene synthases, a single protein can produce numerous products from a single substrate (Steele et al., 1998). A few amino acid substitutions can alter the ratio of products generated by a terpene synthase (Back and Chappell, 1996). The second mechanism is the use of gene duplication. In ...
ants in an amino-acid sequence can bedetermined if the In addition to identifying important genetic variants substitution is in an annotated active or binding site, for research prioritization, genotyping efforts could be affects interaction with ligands present in the crystallo- reduced by eliminating amino-acid substitutions that graphic structure, leadsto hydrophobicity or electrostatic have been deemed neutral by algorithms such as charge change in a buriedsite, destroys a disulfide bond, PolyPhen. In some cases, some genes could be removed affects the proteins solubility, inserts proline in an from further consideration if all of the variant alleles α-helix,or is incompatiblewith the profile of amino-acid were deemed to be non-functional. Because prediction substitutions observed at this site in the set of homolo- algorithms provide numerical data, it is feasible to fur- gous proteins. Mapping the amino-acid substitution tothe ther subdivide the variant alleles of a gene into those ...
118L: Energetic cost and structural consequences of burying a hydroxyl group within the core of a protein determined from AlaSer and ValThr substitutions in T4 lysozyme.
If you are a society or association member and require assistance with obtaining online access instructions please contact our Journal Customer Services team ...
Dalla Chiesa, Marta, Martensen, Pia, Simmons, Cameron, Porakishvili, Nino, Justesen, Just, Dougan, Gordon, Roitt, Ivan M., Delves, Peter J. and Lund, Torben (2001) Refocusing of B-cell responses following a single amino acid substitution in an antigen. Immunology, 103 (2). pp. 172-178. ISSN 0019-2805 ...
Lindner, B. D., Engelhart, J. U., Tverskoy, O., Appleton, A. L., Rominger, F., Peters, A., Himmel, H.-J. and Bunz, U. H. F. (2011), Stable Hexacenes through Nitrogen Substitution. Angew. Chem. Int. Ed., 50: 8588-8591. doi: 10.1002/anie.201103676 ...
Научная статья по направлению Филология бесплатно. Тема Euphemism as a substitution of an impolite expression, текст научной статьи из научного журнала Молодой ученый
Classifying and predicting amino acid substitutions are important in pharmaceutical and pathological research. We proposed a novel feature set from amino acids physicochemical properties, evolutionary profile of proteins, and protein sequence information. Large scale size of human disease-associated data were collected and processed, together with the unbiased experimental amino acid substitutions. Machine learning methods of decision tree, support vector machine, Gaussian mixture model, and random forests were used to classify neutral and deleterious substitutions, and the comparison of classification accuracy with published results showed that our feature set is superior to the existing ones.; We designed a simulated annealing bump hunting method to automatically extract interpretable rules for amino acid substitutions. Rules are consistent with current biological knowledge or provide new insights for understanding substitutions.; We also designed a Multiple Selection and Rule Voting (MS-RV) ...
Classifying and predicting amino acid substitutions are important in pharmaceutical and pathological research. We proposed a novel feature set from amino acids physicochemical properties, evolutionary profile of proteins, and protein sequence information. Large scale size of human disease-associated data were collected and processed, together with the unbiased experimental amino acid substitutions. Machine learning methods of decision tree, support vector machine, Gaussian mixture model, and random forests were used to classify neutral and deleterious substitutions, and the comparison of classification accuracy with published results showed that our feature set is superior to the existing ones.; We designed a simulated annealing bump hunting method to automatically extract interpretable rules for amino acid substitutions. Rules are consistent with current biological knowledge or provide new insights for understanding substitutions.; We also designed a Multiple Selection and Rule Voting (MS-RV) ...
Classifying and predicting amino acid substitutions are important in pharmaceutical and pathological research. We proposed a novel feature set from amino acids physicochemical properties, evolutionary profile of proteins, and protein sequence information. Large scale size of human disease-associated data were collected and processed, together with the unbiased experimental amino acid substitutions. Machine learning methods of decision tree, support vector machine, Gaussian mixture model, and random forests were used to classify neutral and deleterious substitutions, and the comparison of classification accuracy with published results showed that our feature set is superior to the existing ones.; We designed a simulated annealing bump hunting method to automatically extract interpretable rules for amino acid substitutions. Rules are consistent with current biological knowledge or provide new insights for understanding substitutions.; We also designed a Multiple Selection and Rule Voting (MS-RV) ...
... In PSI-BLAST, amino acid substitution matrices may be adjusted to compensate for biases in amino acid composition of the compared sequences. "Composition- based statistics" is the procedure of scaling all substitution scores by an analytically determined constant, while leaving the gap scores fixed ...
BioAssay record AID 198913 submitted by ChEMBL: Inhibition of HIV-1 Mutant HIV-1 RT enzymes containing the single amino acid substitution V106A.
Accumulation of somatic mutations is critical for the transition of a normal cell to become cancerous. Mutations cause amino acid substitutions that change properties of proteins. However, it has not been studied as to what extent the composition and accordingly chemical properties of the cell proteome is altered as a result of the increased mutation load in cancer. Here, we analyzed data on amino acid substitutions caused by mutations in about 2000 protein coding genes from the Cancer Cell Line Encyclopedia that contains information on nucleotide and amino acid alterations in 782 cancer cell lines, and validated the analysis with information on amino acid substitutions for the same set of proteins in the Catalogue of Somatic Mutations in Cancer (COSMIC; v78) in circa 18,000 tumor samples. We found that nonsynonymous single nucleotide substitutions in the analyzed proteome subset ultimately result in a net gain of cysteine, histidine, and tryptophan at the expense of a net loss of arginine. The
Methods: In this study, E6 and E7 gene sequences were obtained from 12 samples of Indonesian isolates, which were compared with HPV16R (prototype) and 6 standard isolates in the category of European (E), Asian (As), Asian-American (AA), African-1 (Af-1), African-2 (Af-2), and North American (NA) branch from Genbank. Bioedit v.7.0.0 was used to analyze the composition and substitution of single amino acids. Phylogenetic analysis of E6 and E7 genes and proteins was performed using Clustal X (1.81) and NJPLOT softwares. Effects of single amino acid substitutions on protein function of E6 and E7 were analysed by SNAP. ...
We have previously demonstrated that substitution of Asn for Ser at position 17 of RasH yields a dominant inhibitory protein whose expression in cells interferes with endogenous Ras function (L. A. Feig, and G. M. Cooper, Mol. Cell. Biol. 8:3235-3243, 1988). Subsequent structural studies have shown that the hydroxyl group of Ser-17 contributes to the binding of Mg2+ associated with bound nucleotide. In this report, we show that more subtle amino acid substitutions at this site that would be expected to interfere with complexing Mg2+, such as Cys or Ala, also generated dominant inhibitory mutants. In contrast, a Thr substitution that conserves a reactive hydroxyl group maintained normal Ras function. These results argue that the defect responsible for the inhibitory activity is improper coordination of Mg2+. Preferential affinity for GDP, observed in the original Asn-17 mutant, was found exclusively in inhibitory mutants. However, this binding specificity did not completely block the mutant ...
Study shows that seasonal flu escapes immunity with single amino acid substitutions. Scientists have identified a potential way to improve future flu vaccines after discovering that seasonal flu typically escapes immunity from vaccines with as little as a single amino acid substitution. Additionally, they found these single amino acid changes occur at only seven places on its surface - not the 130 places previously believed. The research was published today, 21 November, in the journal Science.. "This work is a major step forward in our understanding of the evolution of flu viruses, and could possibly enable us to predict that evolution. If we can do that, then we can make flu vaccines that would be even more effective than the current vaccine," said Professor Derek Smith from the University of Cambridge, one of the two leaders of the research, together with Professor Ron Fouchier from Erasmus Medical Center in The Netherlands.. The flu vaccine works by exposing the body to parts of inactivated ...
Dear Colleagues, I am seeking pdb files to use as paired examples of the effects of a single amino acid substitution on protein structure/function. Ideally I would like to have some examples of substitutions that alter function, and some that have little or no evident functional effect. If both types of substitutions are available for the same protein, so much the better. A good example is normal and sickle cell hemoglobin, but I would like to have somewhere between four and ten different protein examples. I need some that affect binding or enzymatic activity and are located in the binding or active site. Thanks in advance for suggestions on this topic. Frieda Frieda Reichsman, PhD Molecules in Motion Interactive Molecular Structures www.moleculesinmotion.com MyDNA Project www.bio.umass.edu/biochem/mydna ...
Ns done by the Polyphen-2 software used by the Exome Variant Server (EVS) database to predict the effect of amino acid substitution on 115103-85-0 manufacturer
http://​genetics.bwh.harvard.edu/​pph2,PolyPhen-2]] is a tool for predicting the effect of an amino acid substitution on protein structure and function, based on comparative genomics and experimentally determined protein structures. It is available as a web service, and can also be downloaded as a standalone application ...
The PPARγ2 Pro12Ala variant is protective against progression of nephropathy in people with type 2 diabetes. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
It contains the values of a, b, c and E damping parameters for amino acid substitution scores. Generally, if a residue is completely buried ( Area=0), its substitution scores will be used without changes. If it is completely exposed, its substitution scores will be multiplied by the minimal possible value of a. Between these cases the substitution scores are modulated by a smooth ("arctangent") function with a saddle point at Area=c, where the slope will be -b. The fourth parameter is reserved for development ...
[104 Pages Report] Check for Discount on United States Dura Substitution Market Report 2017 report by QYResearch Group. In this report, the United States Dura Substitution market is...
I already intuitively make some of these substitutions, like could not be reached for comment to is guilty and everybody knows it or new study to tumblr post ...
2 Substitutions 2 Recoveries / 5 Chills Items = Training All Abilities 2 Day DQ Ransei... the wartorn region of seventeen. Seventeen daimyos...
A crucial prerequisite for plant growth and survival is the maintenance of potassium uptake, especially when high sodium surrounds the root zone. The Arabidopsis HIGH-AFFINITY K+ TRANSPORTER1 (HKT1), and its homologs in other salt-sensitive dicots, contributes to salinity tolerance by removing Na+ from the transpiration stream. However, TsHKT1;2, one of three HKT1 copies in Thellungiella salsuginea, a halophytic Arabidopsis relative, acts as a K+ transporter in the presence of Na+ in yeast (Saccharomyces cerevisiae). Amino-acid sequence comparisons indicated differences between TsHKT1;2 and most other published HKT1 sequences with respect to an Asp residue (D207) in the second pore-loop domain. Two additional T. salsuginea and most other HKT1 sequences contain Asn (n) in this position. Wild-type TsHKT1;2 and altered AtHKT1 (AtHKT1N-D) complemented K+-uptake deficiency of yeast cells. Mutant hkt1-1 plants complemented with both AtHKT1N-D and TsHKT1;2 showed higher tolerance to salt stress than ...
West Nile virus (WNV) is a worldwide distributed mosquito-borne flavivirus that naturally cycles between birds and mosquitoes, although it can infect multiple vertebrate hosts including horses and humans. This virus is responsible for recurrent epidemics of febrile illness and encephalitis, and has recently become a global concern. WNV requires to transit through intracellular acidic compartments at two different steps to complete its infectious cycle. These include fusion between the viral envelope and the membrane of endosomes during viral entry, and virus maturation in the trans-Golgi network. In this study, we followed a genetic approach to study the connections between viral components and acidic pH. A WNV mutant with increased resistance to the acidotropic compound NH4Cl, which blocks organelle acidification and inhibits WNV infection, was selected. Nucleotide sequencing revealed that this mutant displayed a single amino acid substitution (Lys 3 to Glu) on the highly basic internal capsid ...
Where did the nylon-eating ability come from? Carboxylesterases are enzymes with broad substrate specificities; they can carry out a variety of reactions. Their binding pocket is large and can accommodate a lot of different substrates. They are "promiscuous" enzymes, in other words. Furthermore, the carboxylesterase reaction hydrolyzes a chemical bond similar to the one hydrolyzed by nylonase.. […]. From Kato et al. (1991):. "Our studies demonstrated that among the 47 amino acids altered between the EII and EII proteins, a single amino acid substitution at position 181 was essential for the activity of 6-aminohexanoate-dimer hydrolase [nylonase] and substitution at position 266 enhanced the effect.". So. This is not the story of a highly improbable frame-shift producing a new functional enzyme. This is the story of a pre-existing enzyme with a low level of promiscuous nylonase activity, which improved its activity toward nylon by first one, then another selectable mutation. In other words ...
The Y155H amino acid substitution in the neuraminidase gene (NA) has previously been associated with highly reduced inhibition by neuraminidase inhibitors in the seasonal H1N1 influenza A virus which circulated in humans before the 2009 pandemic. During the 2012/13 epidemic season in Spain, two A(H1N1)pdm09 viruses bearing the specific Y155H substitution in the NA were detected and isolated from two patients diagnosed with severe respiratory syndrome and pneumonia requiring admission to the intensive care unit. Contrary to what was observed in the seasonal A(H1N1) viruses, neither of the Y155H A(H1N1)pdm09 viruses described here showed a phenotype of reduced inhibition by NAIs as determined by the neuraminidase enzyme inhibition assay (MUNANA). High-throughput sequencing of the NA of both Y155H viruses showed that they were composed to >99% of H155 variants. We believe that this report can contribute to a better understanding of the biological significance of amino acid substitutions in the
Five point mutations within the amyloid beta-protein (Abeta) sequence of the APP gene are associated with hereditary diseases which are similar or identical to Alzheimers disease and encode: the A21G (Flemish), E22G (Arctic), E22K (Italian), E22Q (Dutch) and the D23N (Iowa) amino acid substitutions. Although a substantial body of data exists on the effects of these mutations on Abeta production, whether or not intra-Abeta mutations alter degradation and how this relates to their aggregation state remain unclear. Here we report that the E22G, E22Q and the D23N substitutions significantly increase fibril nucleation and extension, whereas the E22K substitution exhibits only an increased rate of extension and the A21G substitution actually causes a decrease in the extension rate. These substantial differences in aggregation together with our observation that aggregated wild type Abeta(1-40) was much less well degraded than monomeric wild type Abeta(1-40), prompted us to assess whether or not ...
Abstract: Proteomic studies of some human tissues and organs (skeletal muscles, myometrium, motor zone of the brain, prostate), and also cultivated myoblasts revealed 41 of 300 identified proteins, in which the present of certain variants of amino acids (conflicts) was recognized at several positions. Among the 93 registered amino acids conflicts, seven cases represented the results of the protein polymorphisms caused by corresponding substitution of individual amino acid. Moreover, among prostate proteins the proteomic analysis revealed two isoforms of prostate-specific antigen, formed due to alternative splicing. Thus, our results have shown, that proteomic technologies allow to specify effectively the features of primary structures and to characterize various kinds of polymorphism in many human proteins ...
Mutations leading to hemophilia A by substitution of amino acids in coagulation factor VIII may provide important clues to the structure and function of this large and enigmatic protein. To efficiently find missense mutations, hemophiliacs with mild
Lower your blood pressure with one single amino acid If you have stubborn hypertension, you might be interested in a simple and inexpensive treatment. Its a single amino acid. As you may know, amino acids are the building blocks of proteins. But many amino acids serve as raw materials for key molecules. For example, tryptophan and phenylalanine serve as raw materials for neurotransmitters. A deficiency in either of these can lead to mood disorders.
In article ,90luod$kkb$1 at mercury.hgmp.mrc.ac.uk,, James McInerney ,james.o.mcinerney at may.ie, wrote: ,I have a question about selection on genes in HIV (but probably anywhere). ,In some HIV genes there is often a great excess of replacement substitutions ,over silent substitutions. In the past we would say that this meant that ,there was a positive selection event involved. However, if there is no ,selective difference between substitutions that occur in synonymous and ,non-synonymous sites then we would see about three times as many ,substitutions that are replacement than silent. I believe such studies generally take this into account. They reckon up how many sites *could* have a synonymous or nonsynonymous (S and N from here on) substitution, and weight by how many such substitutions could occur (a fourfold degenerate site contributes more possible S substitutions than a twofold ones). So the actual statistic is the ratio of S mutations per S site and N mutations per N site. This is ...
The R633S variant has not been published as a pathogenic variant, nor has it been reported as a benign variant to our knowledge. The R633S variant is observed in 49/7604 (0.6%) alleles from individuals of East Asian background (Lek et al., 2016; 1000 Genomes Consortium et al., 2015; Exome Variant Server). This substitution occurs at a position where amino acids with similar properties to Arginine are tolerated across species. However, this variant is a semi-conservative amino acid substitution, which may impact secondary protein structure as these residues differ in some properties. In silico analysis is inconsistent in its predictions as to whether or not the variant is damaging to the protein structure/function. (less) ...
Rm1: This is the RASSL Melanocortin No. 1. The sequence is identical to hMC4R except for the L106P substitution that renders it a Gs-coupled RASSL. Rm1 has a lower basal activity than the wild-type receptor by ~ 30%. gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatgcc gcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgag caaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgcttaggg ttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattgattattg actagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccg cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattga cgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgg gtggactatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtac gccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgacct tatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatg cggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtct ccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaat ...
Downloadable! The relationship between the goods-time elasticity of substitution with consumption time as an input and the goods-time elasticity of substitution without consumption time as an input is derived analytically. Under some reasonable assumptions, the goods-time elasticity of substitution is shown to be greater if consumption time is not included as an input. An empirical example of food production for single headed households is consistent with this result and indicates the goods-time elasticity of substitution is about 60% greater when consumption time is not included as an input than when it is included.
We discovered that replacing residue D23 with a non-negatively charged amino acid leads to dramatically enhanced affinity of leptin for its receptor, D23L substitution being the most effective. The resulting D23L/L39A/D40A/F41A mutant acted as super leptin antagonist. ...
Overhauling your diet can certainly help you shed pounds, but so can making small changes in the ingredients you choose. Here are a few substitutions that will help you keep your calorie consumption in check.1. Substitute Greek yogurt for sour creamThis sw
Overhauling your diet can certainly help you shed pounds, but so can making small changes in the ingredients you choose. Here are a few substitutions that will help you keep your calorie consumption in check.1. Substitute Greek yogurt for sour creamThis sw
Overhauling your diet can certainly help you shed pounds, but so can making small changes in the ingredients you choose. Here are a few substitutions that will help you keep your calorie consumption in check.1. Substitute Greek yogurt for sour creamThis sw
Overhauling your diet can certainly help you shed pounds, but so can making small changes in the ingredients you choose. Here are a few substitutions that will help you keep your calorie consumption in check.1. Substitute Greek yogurt for sour creamThis sw
Overhauling your diet can certainly help you shed pounds, but so can making small changes in the ingredients you choose. Here are a few substitutions that will help you keep your calorie consumption in check.1. Substitute Greek yogurt for sour creamThis sw
Forgot to pick up whole-wheat flour? Have brown sugar but not white? Dont have quite enough eggs to prepare that batch of muffins you want to make today? Not to worry, EatingWells guide to substitutions for common baking ingredients will help you make adjustments so you dont have to run to the supermarket on the fly.. ...
MuscleMeds AMINO DECANATE Full Spectrum Anabolic Muscle Building Amino Acid Complex Amino Decanate Reviews have been posted.AMINO DECANATE 30 servings by MuscleMeds -Post-Training MuscleMeds - MuscleMeds: AMINO DECANATE 30 servings With DecaDrive! Profes
한국 최고의 가격 Weider 아미노 6​​000 100 캡슐 부터 eVitamins.com. 알다 Amino 6000 리뷰, 부작용, 쿠폰 및 eVitamins에서 더. 한국에 빠르고 신뢰할 수있는 운송. Amino 6000 다른 제품으로 Weider 당신의 건강 요구에.
Deoxyribonucleoside kinases catalyze the phosphorylation of deoxyribonucleosides to the corresponding deoxyribonucleoside monophosphates (dNMPs). They are the key enzymes in the salvage of deoxyribonucleosides originating from extra‐ or intracellular breakdown of DNA. Subsequently, dNMPs are phosphorylated into diphosphates (dNDPs) and triphosphates (dNTPs), which are the precursors of DNA. Deoxyribonucleoside kinases play a key role in the chemotherapeutic treatment of cancer and viral diseases, as they catalyze the first, and often rate‐limiting step of nucleoside analog activation by phosphorylation (Arnér and Eriksson, 1995). Native and genetically engineered deoxyribonucleoside kinases from different organisms are also attractive candidates for use in cancer gene therapy as suicide enzymes (Christians et al., 1999; Kokoris et al., 1999; Knecht et al., 2000a; Zheng et al., 2000). The basic concept here is to transduce cancer or virus‐infected cells with a gene encoding a ...
When inferring phylogenetic relationships, not all sites in a sequence alignment are equally informative. One recently proposed approach that takes advantage of this inequality relies on sites that contain amino acids whose replacement requires multiple substitutions. Identifying these so-called RGC_CAM substitutions (after Rare Genomic Changes as Conserved Amino acids-Multiple substitutions) requires that, first, at any given site in the amino acid sequence alignment, there must be a minimum of two different amino acids; second, each amino acid must be present in at least two taxa; and third, the amino acids must require a minimum of two nucleotide substitutions to replace each other. Although theory suggests that RGC_CAM substitutions are expected to be rare and less likely to be homoplastic, the informativeness of RGC_CAM substitutions has not been extensively evaluated in biological data sets. We investigated the quality of RGC_CAM substitutions by examining their degree of homoplasy and internode
Paulus JK, Förster K, Groth G. Direct and selective small-molecule inhibition of photosynthetic PEP carboxylase: New approach to combat C4 weeds in arable crops FEBS Letters,2014 Jun 5, 588(12):2101-6. Schlieper D, Förster K, Paulus JK, Groth G. Resolving the activation site of positive regulators in plant phosphoenolpyruvate carboxylase Molecular Plant, 2014 Feb, 7(2):437-40. Paulus JK, Niehus C, Groth G. Evolution of C4 phosphoenolpyruvate carboxylase: enhanced feedback inhibitor tolerance is determined by a single residue Molecular Plant, 2013 Nov, 6(6):1996-9. Paulus JK, Schlieper D, Groth G. Greater efficiency of photosynthetic carbon fixation due to single amino-acid substitution. Nature Communication, 2013, 4:1518 ...
Why is the changing of a single base the least serious form of mutation? Addition and deletion mutations generally produce nonfunctional proteins or no protein product at all. They are frameshift mutations. A frameshift mutation alters the reading frame of the DNA sequence and changes all the amino acids in the protein product after the point of mutation. Substitution mutations merely replace one base with another. Because the genetic code is redundant some substitutions will have no effect at all. For example the substitution of a uracil for a cytosine in the codon CCU will have no effect on the protein produced as both CCU and CCC code for proline. Substitutions that replace one amino acid with another vary widely in their effect depending on the substitution and its location in the amino acid chain.. A substitution that produces the stop codon (AUG) is the most serious as it will end an amino acid chain prematurely. Other substitutions can have severe effects if the replacement of an amino ...
We generated a panel of APLs by introducing single amino acid substitutions in a MHC class I-binding β islet cell neoself-peptide. These APLs elicited CD8+ T cell functions ranging from antagonist to superagonist activity when TCR contact residues were mutated. The relevant findings reported in this study are that i.v. injection of the superagonist APL was more effective than injection of the wild-type self-peptide in protection from autoimmune diabetes and that the APL not only promoted deletion of pathogenic CD8+ T cells, but also decreased the cytotoxicity and the migration/accumulation of persistent islet cell-specific T cells in the pancreas.. A single amino acid substitution, at an important peptide/TCR contact position, is sufficient to dramatically alter T cell responses induced by TCR engagement. Some APLs act as TCR antagonists, inhibiting antigenic peptide-induced T cell functions. In human diabetes, two in vitro studies have attempted to take advantage of antagonistic APLs to ...
teosinte glume architecture1 (tga1), a member of the SBP-box gene family of transcriptional regulators, has been identified as the gene conferring naked kernels in maize vs. encased kernels in its wild progenitor, teosinte. However, the identity of the causative polymorphism within tga1 that produces these different phenotypes has remained unknown. Using nucleotide diversity data, we show that there is a single fixed nucleotide difference between maize and teosinte in tga1, and this difference confers a Lys (teosinte allele) to Asp (maize allele) substitution. This substitution transforms TGA1 into a transcriptional repressor. While both alleles of TGA1 can bind a GTAC motif, maize-TGA1 forms more stable dimers than teosinte-TGA1. Since it is the only fixed difference between maize and teosinte, this alteration in protein function likely underlies the differences in maize and teosinte glume architecture. We previously reported a difference in TGA1 protein abundance between maize and teosinte ...
Fortunately I will be able to download the EPG Sunday morning to see if the problem is fixed, but my recording of "Click" (04:30 Sunday morning) will probably have gone AWOL. : Java > Open Source Codes > org > jboss > resource > adapter > jdbc > WrappedResultSet. Technosat t888 plus ultra biss key? Technosat T 888 Plus Software Download. Technosat HD Decoder T-786. 1 export the file to a. Two functional polymorphisms have been identified in the eNOS gene: a single nucleotide polymorphism (SNP) in position 786 of the 5 flanking region of the eNOS gene (-786T >C, rs2070744) that reduces eNOS gene promoter activity by approximately 50 per cent and a 894G >T polymorphism leading to amino acid substitution at position 298 (Glu298Asp. Looking for "SolidWorks free download" and dont want to commit to buy the full version of the popular CAD software? Here are the best answers to the question: Is there a free full version? A free full version of the CAD program Solidworks? The correct answer to the ...
The synthesis and reactions of simple derivatives of 2(3H)- and 3(2H)furanones have attracted considerable attention in recent years, primarily in connection with development of routes to antitumor agents that contain this ring as central structural unit. They also serve as useful synthetic building blocks for lactones and furans and are the precursors of a wide variety of biologically important heterocyclic systems. Although a number of syntheses of furanones were known they were in many cases limited to specific substitution pattems. The development of altemative strategies for the preparation of these heterocycles is therefore of considerable importance or continues to be a challenge.We propose to develop new and general approaches to the synthesis of furanone ring systems from simple and readily available starting materials since we were interested in examining their rich photochemistry. The photochemical reactivity of Beta,gama-unsaturated lactams and lactones is a subject of current ...
Looking for online definition of stimulus substitution in the Medical Dictionary? stimulus substitution explanation free. What is stimulus substitution? Meaning of stimulus substitution medical term. What does stimulus substitution mean?
Epithelial and endothelial cells form the external lining of outer and inner body surfaces and blood vessels of multicellular organisms. Thus, they create separate compartments each exhibiting an environment optimally adjusted to their respective function. To build up such compartments epithelial and endothelial cells have to restrict the paracellular diffusion of substances. The paracellular cleft is sealed by tight junctions (TJ). In electron microscopical images TJs appear as a network of intermembranous strands in the apical region of the lateral cell membrane of epithelial and endothelial cells. Claudins (Cld) form the structural backbone of TJs. The present study provided evidence for the first time that single amino acids of the second extracellular loop (ECL) of a claudin are essential for the paracellular tightness of epithelial cells. The effect of single amino acid substitutions of the second ECL of Cld5 were studied in cells expressing various other endogenous claudins except Cld5. ...
WHAT ARE AMINO ACIDS? Amino acids are the building blocks of protein, and are vital to understanding the Krebs Cycle. They are individual crystalline molecules that make up protein, similar to the way letters make up the alphabet. There are 20 basic amino acids that produce over 1600 substances in the body. They make up 3/4ths of the body s solid material and are found in muscle tissue, organs, blood and skin. Amino acids also make hormones, enzymes, and vitamins, and are essential for a healthy immune system and proper neurological functions. It is necessary to replace amino acids constantly to nourish the body and to repair and regenerate tissue. Amino acids are generally ingested in the food we eat, however, because of processed foods, inadequate diets, and food restrictive programs, a proper balance is rarely achieved and supplementation is advisable. This holds to be true during illness, trauma, surgery and stress. More amino acids are required than can be obtained by food alone. In the chronically
There is a great deal of scientific information on amino acid structure and biochemical functioning. However, medical professionals and health-concerned individuals are typically most interested in the amino acid function. This web site provides information on each of the 20 "primary" amino acids as well as many of the "secondary" or "minor amino acids" so that you can better understand the powerful role amino acids play in your life.. Information on amino acids is presented at three levels depending on your interest/background:. 1) General Introduction to Amino Acids ...
The score within a Blosum matrix for the corresponding wild-type to variant amino acid change. The log-odds score measures the logarithm for the ratio of the likelihood of two amino acids appearing by chance. The Blosum62 substitution matrix is used. This substitution matrix contains scores for all possible exchanges of one amino acid with another: ...
The score within a Blosum matrix for the corresponding wild-type to variant amino acid change. The log-odds score measures the logarithm for the ratio of the likelihood of two amino acids appearing by chance. The Blosum62 substitution matrix is used. This substitution matrix contains scores for all possible exchanges of one amino acid with another: ...
|.. ۞ One hBUB1 somatic mutation that led to an amino acid substitution. Where the three human syntrophin genes, most abundant in heart and skeletal muscle, differentiate as a human macrophage model. Plays an important role in CC synapse formation and in the organization of UTRN and CC acetylcholine receptors. The activity of cytochrome P450…
Olimp Anabolic Amino 9000 300 tabs | Anabolic Amino 9000 MEGA TABS® Food supplement in tablets, containing peptides and free amino acids complex. | Amino acids \ Amino essentials | Sklep Suplefit.pl
Our lab (at least Amanda and Janet) have not tried it yet. Our understanding is that it is for more substantial changes than just single amino acid changes ...
ISSUE-67: using xsi:type to assert Type Substitution http://www.w3.org/2005/06/tracker/databinding/issues/67 Raised by: Paul Downey On product: Basic Pattern from Faisel Waris which employs xsi:type to perform type substitution. ,complexType name=Part , ,sequence, ,element name=Number type=string /, ,/sequence, ,/complexType, ,complexType name=Assembly /, ,sequence, ,element name=Part type=tns:Part minOccurs=0 maxOccurs=unbounded /, ,/sequence, ,/complexType, ,element name=Assembly type=tns:Assembly /, ... This can be easily extended in an OO way as follows: ,complexType name=Part2 , ,complexContent, ,extension base=tns:Part, ,sequence, ,element name=Description type=string /, ,/sequence, ,extension, ,/complexContent, ,/complexType, At runtime we can use Type Substitution as follows: ,Assembly xmlns=… xmlns:tns=… xmlns:xsi=…, ,Part, ,Name,p1,/Name, ,/Part, ,Part xsi:Type=tns:Part2, ,Name,p2,/Name, ,Description, extended part ,/Description, ,/Part, ...
Try these animal and body-friendly substitutions for a change! Kitchen substitutions include vegan and non-vegan food replacements.
What are free form amino acids? What amino acids should vegans supplement with? What amino acids are best for the gym? These questions and more are answered...
Amino acids can be found in a range of foods and products, but, what are amino acids? Why do we need them? Find out 10 reasons to include more amino acids in your routine. Learn more at eVitamins Schweiz.
Amino Acids Nutrend BCAA Liquid 1,000ml - Branched amino acids in liquid form, muscle growth support, helps you recover after hard workout.. : 16,20 € incl. VAT. Amino Acids
amino acid: Amino acid, any of a group of organic molecules that consist of a basic amino group, an acidic carboxyl group, and a unique organic side chain.
HIV-1 reverse transcriptase and protease subtypes: Classification, amino acid mutation patterns, and prevalence in a northern California clinic-based population ...
HIV-1 reverse transcriptase and protease subtypes: Classification, amino acid mutation patterns, and prevalence in a northern California clinic-based population ...
This is a scoring matrix parameterized by the evolutionary distance, α t. Note that when t=0, p(i,i)=1 and p(i,j)=0. When t=α, p(i,i)=P(i,j)=1/4. However, this scoring matrix, isnt very useful because we dont know α t. Instead, we use the Jukes Cantor model to correct for multiple substitutions by counting the number of mismatches and then correct the distance by observing that the expected ...
Amino acids are critically important for all times to exist they usually have an necessary function in function such as the metabolism of an organism. Cole, J.,
In the search for amino acids in lunar fines, a major problem is the prevention of contamination from terrestrial sources, and the recognition of terrestrial contamination when it has occurred....
Fuelled by the power of amino acids, AminoGenesis will change the way you think about skincare. Explore the brand, with free delivery over $49, at SkinStore.
Fuelled by the power of amino acids, AminoGenesis will change the way you think about skincare. Explore the brand, with free delivery over $49, at SkinStore.
Determine the area trapped between the x-axis and the curve with parametric equations $x = t$ and $y = -t^2 + 2$.. Applying the formula for area, we get that $\int_{\alpha}^{\beta} g(t) \: f(t) \: dt$. We note that $y = g(t) = -t^2 + 2$ and $f(t) = \frac{dx}{dt} = 1$. We now need to find our limits of integration $\alpha$ and $\beta$ which we will then substitute into our equation.. First lets eliminate the parameter $t$ to get $y = -x^2 + 2$. Note that $y = 0$ when $x = \sqrt{2} = b$ or $x = -\sqrt{2} = a$.. Now to get $\alpha$ and $\beta$, plug $a$ into our parametric substitution equation to get $\alpha$, namely $t \rvert_{x = a = -\sqrt{2}} = -\sqrt{2} = \alpha$, and plug $b$ into our parametric substitution equation $t \rvert_{x = b = \sqrt{2}} = -\sqrt{2} = \beta$ to get that $\beta = \sqrt{2}$. Thus:. (4) ...
Amino Acids , Standard Amino Acids , Amino Acids - Arg , Fmoc-Arg(Pbf)-OH; C34H40N4O7S
Amino Acids , Standard Amino Acids , Amino Acids - Cys , Boc-Cys(Trt)-OH; C27H29NO4S
I just found out a few weeks ago that I am gluten sensitive and am delving into this whole new arena. A bit daunting! I need to find a good substitution f...
Neutralizing monoclonal antibodies (nMAbs) elicited against foot-and-mouth disease virus (FMDV) of serotype C were assayed with field isolates and variant FMDVs using several immunoassays. Of a total of 36 nMAbs tested, 23 recognized capsid protein VP1 and distinguished at least 13 virion conformation-independent epitopes involved in neutralization of FMDV C. Eleven epitopes of FMDV C-S8c1 have been located in segments 138-156 or 192-209 of VP1 by quantifying the reactivity of nMAbs with synthetic peptides and with nMAb-resistant mutants of FMDV C-S8c1 carrying defined amino acid substitutions. The main antigenic site of FMDV C-S8c1 (VP1 residues 138 to 150) consists of multiple (at least 10), distinguishable, overlapping epitopes. Some amino acid replacements abolished one of the epitopes, whereas other replacements affected several epitopes in this region. The conservative substitution His(146) → Arg, found in many nMAb-resistant mutants analysed, abolished the reactivity of the virus with all nMAbs
BACKGROUND: The prediction of ancestral protein sequences from multiple sequence alignments is useful for many bioinformatics analyses. Predicting ancestral sequences is not a simple procedure and relies on accurate alignments and phylogenies. Several algorithms exist based on Maximum Parsimony or Maximum Likelihood methods but many current implementations are unable to process residues with gaps, which may represent insertion/deletion (indel) events or sequence fragments.. RESULTS: Here we present a new algorithm, GASP (Gapped Ancestral Sequence Prediction), for predicting ancestral sequences from phylogenetic trees and the corresponding multiple sequence alignments. Alignments may be of any size and contain gaps. GASP first assigns the positions of gaps in the phylogeny before using a likelihood-based approach centred on amino acid substitution matrices to assign ancestral amino acids. Important outgroup information is used by first working down from the tips of the tree to the root, using ...
Escherichia coli TolA is a cytoplasmic membrane protein required for outer membrane integrity and the translocation of F-specific filamentous (Ff) bacteriophage DNA. Both phage infection and membrane integrity depend on several TolA interactions, e.g. those of the TolA C-terminal domain (TolAIII). Membrane integrity involves interaction with two host proteins and phage translocation requires direct interaction with the N-terminal domain (N1) of Ff phage protein g3p. Although cocrystallization of TolAIII and N1g3p has identified several contact points, it is still uncertain which residues are selectively involved in the different TolA functions. Thus, four different limited substitution libraries of TolA were created, targeting contacts at positions 415-420. These libraries were introduced into the tolA strain K17DE3tolA/F+ and several variants, containing complementing, multiple amino-acid substitutions, were identified. However, most randomized variants did not complement the tolA strain ...
The cytopathogenicity of vesicular stomatitis virus (VSV) has been attributed mainly to the host shut-off activity of the viral matrix (M) protein, which inhibits both nuclear transcription and nucleocytoplasmic RNA transport, thereby effectively suppressing the synthesis of type I interferon (IFN). The M protein from persistently VSV-infected cells was shown to harbour characteristic amino acid substitutions (M51R, V221F and S226R) implicated in IFN induction. This study demonstrates that infection of human fibroblasts with recombinant VSV containing the M51R substitution resulted in IFN induction, whereas neither the V221F nor the S226R substitution effected an IFN-inducing phenotype. Only when V221F was combined with S226R were the host shut-off activity of the M protein abolished and IFN induced, independently of M51R. The M33A substitution, previously implicated in VSV cytotoxicity, did not affect host shut-off activity. M-mutant VSV containing all four amino acid substitutions retained cytotoxic
The C11-13 strain from the Siberian subtype of tick-borne encephalitis virus (TBEV) was isolated from human brain using pig embryo kidney (PEK), 293, and Neuro-2a cells. Analysis of the complete viral genome of the C11-13 variants during six passages in these cells revealed that the cell-adapted C11-13 variants had multiple amino acid substitutions as compared to TBEV from human brain. Seven out of eight amino acids substitutions in the high-replicating C11-13(PEK) variant mapped to non-structural proteins; 13 out of 14 substitutions in the well-replicating C11-13(293) variant, and all four substitutions in the low-replicating C11-13(Neuro-2a) variant were also localized in non-structural proteins, predominantly in the NS2a (2), NS3 (6) and NS5 (3) proteins ...
When the coding regions of 11 genes from rodents (mouse or rat) and man are compared with those from another mammalian species (usually bovine), it is found that rodents evolve significantly faster than man. The ratio of the number of nucleotide substitutions in the rodent lineage to that in the human lineage since their divergence is 2.0 for synonymous substitutions and 1.3 for nonsynonymous substitutions. Rodents also evolve faster in the 5 and 3 untranslated regions of five different mRNAs; the ratios are 2.6 and 3.1, respectively. The numbers of nucleotide substitutions between members of the beta-globin gene family that were duplicated before the man-mouse split are also higher in mouse than in man. The difference is, again, greater for synonymous substitutions than for nonsynonymous substitutions. This tendency is more consistent with the neutralist view of molecular evolution than with the selectionist view. A simple explanation for the higher rates in rodents is that rodents have ...
Germline mutations of transcription factors (e.g. PAX5, CEBPA, GATA2, RUNX1) have been associated with an inherited susceptibility to acute leukemia. Here we report 2 unrelated kindreds harboring germline mutations in ETV6, the gene encoding the transcription factor ETS variants 6. These kindreds were primarily characterized by thrombocytopenia and acute lymphoblastic leukemia (ALL). The first kindred, identified at MSKCC and HMC, includes 9 individuals with thrombocytopenia, and 3 individuals with pre-B ALL. Sequencing a subset of common and somatically altered leukemia genes in this family identified a rare heterozygous non-synonymous missense variation (T,C) in 6 family members with thrombocytopenia and 2 with ALL. Notably, this variant did not segregate in 9 individuals in the kindred without these phenotypes. The amino acid alteration is predicted to lead to an L349P substitution within the DNA binding domain of ETV6 (L349P, NPP_001978). In silico analyses using SIFT and Polyphen assigned ...
We next compared the mutational spectrum of trunk versus nontrunk mutations to explore the relative contribution of mutational processes over time. Significant differences in mutational spectrum were observed in six tumors, which indicated that specific mutational processes were likely operative at different times during development of these tumors (Fig. 3, B and C). Of interest, two former smokers (cases 317 and 330) and the current smoker (case 324) showed significant differences between trunk and nontrunk mutation spectrum with a shift from smoking-associated C,A transversions in trunk mutations to nonsmoker-associated C,T transitions in nontrunk mutations.. Recent evidence has suggested that APOBEC activity is a major source for C,T and C,G mutations (12, 26). We therefore investigated whether there is evidence of an APOBEC mutational process in this subset of lung adenocarcinomas. On average, 28% of all mutations had a specific substitution pattern (C,T/G at TpCpW sites, where W is A or T), ...
Previously, we showed that adaptive substitutions in one of the three promoters of the bacteriophage ϕX174 improved fitness at high-temperature by decreasing transcript levels three- to four-fold. To understand how such an extreme change in gene expression might lead to an almost two-fold increase in fitness at the adaptive temperature, we focused on stages in the life cycle of the phage that occur before and after the initiation of transcription. For both the ancestral strain and two single-substitution strains with down-regulated transcription, we measured seven phenotypic components of fitness (attachment, ejection, eclipse, virion assembly, latent period, lysis rate and burst size) during a single cycle of infection at each of two temperatures. The lower temperature, 37°C, is the optimal temperature at which phages are cultivated in the lab; the higher temperature, 42°C, exerts strong selection and is the condition under which these substitutions arose in evolution experiments. We augmented this
Theory predicts that linkage between genetic loci reduces the efficiency of purifying selection. Because of the permanent linkage of all heritable genetic material, asexual lineages may be exceptionally prone to deleterious-mutation accumulation in both nuclear and organelle genes. Here, we show that the ratio of the rate of amino acid to silent substitution (Ka/Ks) in mitochondrial protein-coding genes is higher in obligately asexual lineages than in sexual lineages of the microcrustacean Daphnia pulex. Using a phylogeny-based approach to quantify the frequency of mutational-effect classes, we estimate that mitochondrial protein-coding genes in asexual lineages accumulate deleterious amino acid substitutions at four times the rate in sexual lineages. These results support the hypothesis that sexual reproduction plays a prominent role in reducing the mutational burden in populations.. ...
Amber mutations were introduced into every codon (except the initiating AUG) of the bacteriophage T4 lysozyme gene. The amber alleles were introduced into a bacteriophage P22 hybrid, called P22 e416, in which the normal P22 lysozyme gene is replaced by its T4 homologue, and which consequently depends upon T4 lysozyme for its ability to form a plaque. The resulting amber mutants were tested for plaque formation on amber suppressor strains of Salmonella typhimurium. Experiments with other hybrid phages engineered to produce different amounts of wild-type T4 lysozyme have shown that, to score as deleterious, a mutation must reduce lysozyme activity to less than 3% of that produced by wild-type P22 e416. Plating the collection of amber mutants covering 163 of the 164 codons of T4 lysozyme, on 13 suppressor strains that each insert a different amino acid substitutions at every position in the protein (except the first). Of the resulting 2015 single amino acid substitutions in T4 lysozyme, 328 were found to
Background. A previously discovered mutant of Saccharomyces cerevisiae alcohol dehydrogenase 1 (Adh1p) was shown to enable a unique NADH-dependent reduction of 5-hydroxymethylfurfural (HMF), a well-known inhibitor of yeast fermentation. In the present study, site-directed mutagenesis of both native and mutated ADH1 genes was performed in order to identify the key amino acids involved in this substrate shift, resulting in Adh1p-variants with different substrate specificities.. Results. In vitro activities of the Adh1p-variants using two furaldehydes, HMF and furfural, revealed that HMF reduction ability could be acquired after a single amino acid substitution (Y295C). The highest activity, however, was reached with the double mutation S110P Y295C. Kinetic characterization with both aldehydes and the in vivo primary substrate acetaldehyde also enabled to correlate the alterations in substrate affinity with the different amino acid substitutions.. Conclusions. We demonstrated the key role of Y295C ...
Genetic susceptibility to autoimmunity is frequently associated with specific MHC alleles. Diabetogenic MHC class II molecules, such as human HLA-DQ8 and mouse I-Ag7, typically have a small, uncharged amino acid residue at position 57 of their β chain (β57); this results in the absence of a salt bridge between β57 and Argα76, which is adjacent to the P9 pocket of the peptide-binding groove. However, the influence of Argα76 on the selection of the TCR repertoire remains unknown, particularly when the MHC molecule binds a peptide with a neutral amino acid residue at position P9. Here, we have shown that diabetogenic MHC class II molecules bound to a peptide with a neutral P9 residue primarily selected and expanded cells expressing TCRs bearing a negatively charged residue in the first segment of their complementarity determining region 3β. The crystal structure of one such TCR in complex with I-Ag7 bound to a peptide containing a neutral P9 residue revealed that a network of favorable ...
Effect of Single Amino Acid Substitution on Oxidative Modifications of the Parkinsons Disease-Related Protein, DJ-1 Mutations in the gene encoding DJ-1 have been identified in patients with familial Parkinsons disease (PD) and are thought to inactivate a neuroprotective function. Oxidation of the sulfhydryl group to a sulfinic acid on cysteine residue C106 of DJ-1 yields the "2O " form, a variant of the protein with enhanced neuroprotective function. We hypothesized that some familial mutations disrupt DJ-1 activity by interfering with conversion of the protein to the 2O form. To address this hypothesis, we developed a novel quantitative mass spectrometry approach to measure relative changes in oxidation at specific sites in mutant DJ-1 as compared with the wild-type protein. Treatment of recombinant wild-type DJ-1 with a 10-fold molar excess of H2O2 resulted in a robust oxidation of C106 to the sulfinic acid, whereas this modification was not detected in a sample of the familial PD mutant ...

Amino acid substitution matrices from protein blocks | PNASAmino acid substitution matrices from protein blocks | PNAS

Amino acid substitution matrices from protein blocks. S Henikoff and J G Henikoff ...
more infohttps://www.pnas.org/content/89/22/10915/tab-article-info

Two types of amino acid substitutions in protein evolution | SpringerLinkTwo types of amino acid substitutions in protein evolution | SpringerLink

... decreases linearly with the increase in physico-chemical differences between amino acid pairs involved in a... ... The frequency of amino acid substitutions, relative to the frequency expected by chance, ... Amino acid substitution Physico-chemical difference Conservative Low-constraint Protein evolution This is a preview of ... The frequency of amino acid substitutions, relative to the frequency expected by chance, decreases linearly with the increase ...
more infohttps://link.springer.com/article/10.1007%2FBF01732340

PLOS ONE: Predicting the Functional Effect of Amino Acid Substitutions and IndelsPLOS ONE: Predicting the Functional Effect of Amino Acid Substitutions and Indels

... tools primarily focus on studying the deleterious effects of single amino acid substitutions through examining amino acid ... and multiple amino acid substitutions. This alignment-based score measures the change in sequence similarity of a query ... score as a new metric to predict the damaging effects of variations not limited to single amino acid substitutions but also in- ... approach to predict the functional effects of protein sequence variations including single or multiple amino acid substitutions ...
more infohttps://journals.plos.org/plosone/article/figure?id=10.1371/journal.pone.0046688.g010

PLOS ONE: Predicting the Functional Effect of Amino Acid Substitutions and IndelsPLOS ONE: Predicting the Functional Effect of Amino Acid Substitutions and Indels

... tools primarily focus on studying the deleterious effects of single amino acid substitutions through examining amino acid ... and multiple amino acid substitutions. This alignment-based score measures the change in sequence similarity of a query ... score as a new metric to predict the damaging effects of variations not limited to single amino acid substitutions but also in- ... approach to predict the functional effects of protein sequence variations including single or multiple amino acid substitutions ...
more infohttps://journals.plos.org/plosone/article/figure?id=10.1371/journal.pone.0046688.g009

TNO Repository search for: subject:Amino acid substitutionTNO Repository search for: subject:'Amino acid substitution'

Amino Acid Motifs · Amino Acid Sequence · Amino Acid Substitution · Catalysis · Circular Dichroism · Cloning, Molecular · ... Amino Acid Sequence · Amino Acid Substitution · Animals · Binding Sites · Cattle · Glutamine · Lactoglobulins · Lysine · Milk ... Antibiotic agent · Amino acid substitution · Amino terminal sequence · Article · Controlled study · Drug screening · Drug ... Both cyclic and d-amino acid variants showed enhanced stability in human serum compared to C1-15 and F2,5,12W. The d-amino acid ...
more infohttps://repository.tudelft.nl/search/tno/?q=subject%3A%22Amino%20acid%20substitution%22

Feature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein DomainsFeature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein Domains

PolyPhen-2 and SIFT had significantly lower accuracies in predicting the effects of amino acid substitutions outside CFDs than ... There are more than 500 amino acid substitutions in each human genome, and bioinformatics tools irreplaceably contribute to ... Feature-Based Classification of Amino Acid Substitutions outside Conserved Functional Protein Domains. Branislava Gemovic, ... are more suitable for the classification of amino acid substitutions outside CFDs than phylogeny-based tools. ...
more infohttps://www.hindawi.com/journals/tswj/2013/948617/abs/

Figure 3: Giraffe genes and pathways exhibiting extraordinary divergence and patterns of amino acid substitutions.Figure 3: Giraffe genes and pathways exhibiting extraordinary divergence and patterns of amino acid substitutions.

a) Giraffe FGFRL1 contains seven amino acid substitutions that are unique at fixed sites in other mammals and/or are predicted ... Figure 3 : Giraffe genes and pathways exhibiting extraordinary divergence and patterns of amino acid substitutions.. From: ... The giraffe and okapi MDC1 gene exhibits a 264 amino acid deletion that removes part of the SDT region that harbours two ... The unique substitution in giraffe, G234Q, immediately adjacent to the Gpi anchor site may alter the anchor site or the rate of ...
more infohttps://www.nature.com/articles/ncomms11519/figures/3?error=cookies_not_supported&code=4bfc5263-f281-4a0c-bf67-903aacd76662

Comment on Transitions to Asexuality Result in Excess Amino Acid Substitutions | ScienceComment on "Transitions to Asexuality Result in Excess Amino Acid Substitutions" | Science

Paland and Lynch (1) demonstrated this effect in Daphnia pulex by showing that the rates of amino acid replacement substitution ... Comment on Transitions to Asexuality Result in Excess Amino Acid Substitutions Message Subject. (Your Name) has forwarded a ... A class of moderately deleterious amino acid substitutions has a higher probability of spreading to fixation in asexual ... the ratio of amino acid replacement to silent substitution in mitochondrial genes is higher in asexual lineages than in sexual ...
more infohttp://science.sciencemag.org/content/313/5792/1389.2

Evaluating the efficacy of a structure-derived amino acid substitution | AABCEvaluating the efficacy of a structure-derived amino acid substitution | AABC

Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures ... Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The ... Keywords: computational biology, protein homology, amino acid substitution matrix, protein structure ... We show that when incorporated into the homology search algorithms BLAST and PSI-blaST, the structure-based substitution ...
more infohttps://www.dovepress.com/evaluating-the-efficacy-of-a-structure-derived-amino-acid-substitution-a3236

Predicting the functional effect of amino acid substitutions and indels. | J. Craig Venter InstitutePredicting the functional effect of amino acid substitutions and indels. | J. Craig Venter Institute

... tools primarily focus on studying the deleterious effects of single amino acid substitutions through examining amino acid ... and multiple amino acid substitutions. This alignment-based score measures the change in sequence similarity of a query ... score as a new metric to predict the damaging effects of variations not limited to single amino acid substitutions but also in- ... approach to predict the functional effects of protein sequence variations including single or multiple amino acid substitutions ...
more infohttps://www.jcvi.org/publications/predicting-functional-effect-amino-acid-substitutions-and-indels

Amino-Acid Substitutions In Membrane Proteins: Applications To Homology Recognition And Comparative Modelling | SciweaversAmino-Acid Substitutions In Membrane Proteins: Applications To Homology Recognition And Comparative Modelling | Sciweavers

Amino-Acid Substitutions In Membrane Proteins: Applications To Homology Recognition And Comparative Modelling - ent, ,title,,p, ... Amino-Acid Substitutions In Membrane Proteins: Applications To Homology Recognition And Comparative Modelling. ... A novel series of compositionally biased substitution matrices for comparing Plasmodium pr... ...
more infohttp://www.sciweavers.org/publications/amino-acid-substitutions-membrane-proteins-applications-homology-recognition-and-compar

Preliminary review of D222G amino acid substitution in the haemagglutinin of pandemic influenza A (H1N1) 2009 viruses.  -...Preliminary review of D222G amino acid substitution in the haemagglutinin of pandemic influenza A (H1N1) 2009 viruses. -...

Preliminary review of D222G amino acid substitution in the haemagglutinin of pandemic influenza A (H1N1) 2009 viruses.. [ ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/20095109?dopt=Abstract

Frontiers | PASE: a novel method for functional prediction of amino acid substitutions based on physicochemical properties |...Frontiers | PASE: a novel method for functional prediction of amino acid substitutions based on physicochemical properties |...

Evaluation of PASE, using a few amino acid substitutions of known phenotypic effects and 3338 human amino acid substitutions, ... Evaluation of PASE, using a few amino acid substitutions of known phenotypic effects and 3338 human amino acid substitutions, ... Results: Here we present PASE, a novel method that predicts the effect of an amino acid substitutions based on physicochemical ... Thus, there is a strong need for efficient bioinformatics tools to predict the functional effect of amino acid substitutions. ...
more infohttps://www.frontiersin.org/articles/10.3389/fgene.2013.00021/full

Substitution of disulphide bonds to hydrophobic amino acids in BACE1Substitution of disulphide bonds to hydrophobic amino acids in BACE1

... Halvarsson, Camilla Linköping University, Department of ... BACE1, disulphide bonds substitution, hydrophobic amino acids, protein purification, refolding time National Category Medical ...
more infohttp://liu.diva-portal.org/smash/record.jsf?pid=diva2:280093

The effects of amino acid substitution on apomyoglobin stability, folding intermediates, and holoprotein expressionThe effects of amino acid substitution on apomyoglobin stability, folding intermediates, and holoprotein expression

... ... and helix propensity of the replacement amino acid. In most cases, once a range of amino acids has been correlated at a given ... "The effects of amino acid substitution on apomyoglobin stability, folding intermediates, and holoprotein expression." (2003) ... unfolding constants of the corresponding single mutants or from the amino acid properties of the substituted amino acid using ...
more infohttps://scholarship.rice.edu/handle/1911/18562

Contribution of beta-lactamase and PBP amino acid substitutions to amoxicillin/clavulanate resistance in beta-lactamase...Contribution of beta-lactamase and PBP amino acid substitutions to amoxicillin/clavulanate resistance in beta-lactamase...

Contribution of beta-lactamase and PBP amino acid substitutions to amoxicillin/clavulanate resistance in beta-lactamase- ... The TEM type beta-lactamase of the two BLPACR strains had 100% homology with the amino acid sequences of published TEM-1 beta- ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/14585854?dopt=Abstract

A Single Amino Acid Substitution in the Virus-Encoded Replicase of Tomato Mosaic Tobamovirus Alters Host SpecificityA Single Amino Acid Substitution in the Virus-Encoded Replicase of Tomato Mosaic Tobamovirus Alters Host Specificity

Introduction of a single amino acid substitution (Gln979 to Ile) into the 130- and 180-kDa proteins of tomato mosaic ... Introduction of a single amino acid substitution (Gln979 to Ile) into the 130- and 180-kDa proteins of tomato mosaic ...
more infohttps://www.apsnet.org/publications/mpmi/1997/November/Pages/10_8_1015.aspx

Distribution of non-synonymous amino acid substitutions | Open-iDistribution of non-synonymous amino acid substitutions | Open-i

Distribution of non-synonymous amino acid substitutions across Odorant Receptor (OR) domains. a The white bars represent the ... Fig3: Distribution of non-synonymous amino acid substitutions across Odorant Receptor (OR) domains. a The white bars represent ... Fig3: Distribution of non-synonymous amino acid substitutions across Odorant Receptor (OR) domains. a The white bars represent ... 3) which covered between 19.3 % and 35.8 % of the OR amino acid sequence (Mean: 30.5 %; Additional file 1: Table S6). ...
more infohttps://openi.nlm.nih.gov/detailedresult.php?img=PMC4552289_12862_2015_451_Fig3_HTML&req=4

Data from: Sequence entropy of folding and the absolute rate of amino acid substitutions - DryadData from: Sequence entropy of folding and the absolute rate of amino acid substitutions - Dryad

Data from: Sequence entropy of folding and the absolute rate of amino acid substitutions. Dryad Repository. ... Goldstein RA, Pollock DD (2017) Data from: Sequence entropy of folding and the absolute rate of amino acid substitutions. Dryad ... Here we use parallels between amino acid substitutions and chemical reaction kinetics to develop an improved theory of protein ... Goldstein RA, Pollock DD (2017) Sequence entropy of folding and the absolute rate of amino acid substitutions. Nature Ecology ...
more infohttp://datadryad.org/resource/doi:10.5061/dryad.7b8vb

A single amino acid substitution affects the substrate specificity of the seryl-tRNA synthetase homologue - Molecular...A single amino acid substitution affects the substrate specificity of the seryl-tRNA synthetase homologue - Molecular...

While aminoacyl-tRNA synthetases supply ribosome with amino ... A single amino acid substitution affects the substrate ... A single amino acid substitution affects the substrate specificity of the seryl-tRNA synthetase homologue A. Maršavelski, S. ... The detailed computational study aiming to address this unexpected substrate specificity toward the small aliphatic amino acids ... While aminoacyl-tRNA synthetases supply ribosome with amino acids for protein biosynthesis, this homologue transfers the ...
more infohttps://pubs.rsc.org/en/content/articlelanding/2014/mb/c4mb00416g

Viruses | Free Full-Text | Single Amino Acid Substitution N659D in HIV-2 Envelope Glycoprotein (Env) Impairs Viral Release and...Viruses | Free Full-Text | Single Amino Acid Substitution N659D in HIV-2 Envelope Glycoprotein (Env) Impairs Viral Release and...

We also tested a virus presenting a truncation of 109 amino acids at the C-terminal part of Env, a cytoplasmic tail partial ... Single Amino Acid Substitution N659D in HIV-2 Envelope Glycoprotein (Env) Impairs Viral Release and Hampers BST-2 Antagonism. ... "Single Amino Acid Substitution N659D in HIV-2 Envelope Glycoprotein (Env) Impairs Viral Release and Hampers BST-2 Antagonism." ... Dufrasne, F.E.; Lombard, C.; Goubau, P.; Ruelle, J. Single Amino Acid Substitution N659D in HIV-2 Envelope Glycoprotein (Env) ...
more infohttp://www.mdpi.com/1999-4915/8/10/285

RCSB PDB 









- 1LYF: DISSECTION OF HELIX CAPPING IN T4 LYSOZYME BY STRUCTURAL AND THERMODYNAMIC ANALYSIS OF SIX AMINO...RCSB PDB - 1LYF: DISSECTION OF HELIX CAPPING IN T4 LYSOZYME BY STRUCTURAL AND THERMODYNAMIC ANALYSIS OF SIX AMINO...

Dissection of helix capping in T4 lysozyme by structural and thermodynamic analysis of six amino acid substitutions at Thr 59. ... DISSECTION OF HELIX CAPPING IN T4 LYSOZYME BY STRUCTURAL AND THERMODYNAMIC ANALYSIS OF SIX AMINO ACID SUBSTITUTIONS AT THR 59. ...
more infohttp://www.rcsb.org/pdb/explore/litView.do?structureId=1LYF

Structure Cluster 









- 1LYG: DISSECTION OF HELIX CAPPING IN T4 LYSOZYME BY STRUCTURAL AND THERMODYNAMIC ANALYSIS OF SIX...Structure Cluster - 1LYG: DISSECTION OF HELIX CAPPING IN T4 LYSOZYME BY STRUCTURAL AND THERMODYNAMIC ANALYSIS OF SIX...

Dissection of helix capping in T4 lysozyme by structural and thermodynamic analysis of six amino acid substitutions at Thr 59. ... DISSECTION OF HELIX CAPPING IN T4 LYSOZYME BY STRUCTURAL AND THERMODYNAMIC ANALYSIS OF SIX AMINO ACID SUBSTITUTIONS AT THR 59. ... Acids Res. 2008 36: D419-D425 * [4] Alexandrov N., Shindyalov I. (2003). PDP: protein domain parser.. Bioinformatics 2003 Feb; ...
more infohttp://www.rcsb.org/pdb/explore/structureCluster.do?structureId=1LYG

IJMS | Free Full-Text | The Triple Amino Acid Substitution TAP-IVS in the EPSPS Gene Confers High Glyphosate Resistance to the...IJMS | Free Full-Text | The Triple Amino Acid Substitution TAP-IVS in the EPSPS Gene Confers High Glyphosate Resistance to the...

In addition, a novel triple amino acid substitution from TAP (wild type, GSH) to IVS (triple mutant, GRH) was identified in the ... The nucleotide substitutions consisted of ATA102, GTC103 and TCA106 instead of ACA102, GCG103, and CCA106, respectively. The ... "The Triple Amino Acid Substitution TAP-IVS in the EPSPS Gene Confers High Glyphosate Resistance to the Superweed Amaranthus ... The Triple Amino Acid Substitution TAP-IVS in the EPSPS Gene Confers High Glyphosate Resistance to the Superweed Amaranthus ...
more infohttps://www.mdpi.com/1422-0067/20/10/2396

Evidence that the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution in tga1 |...Evidence that the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution in tga1 |...

Evidence that the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution in tga1. ... Evidence that the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution in tga1. ... Evidence that the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution in tga1. ... Evidence that the Origin of Naked Kernels During Maize Domestication Was Caused by a Single Amino Acid Substitution in tga1 ...
more infohttp://www.genetics.org/content/early/2015/05/04/genetics.115.175752
  • The detailed computational study aiming to address this unexpected substrate specificity toward the small aliphatic amino acids revealed the A281G Bj Gly:CP ligase 1 mutant as the most promising candidate with reconstituted catalytic activity toward the larger substrates. (rsc.org)
  • It was found that the A281G substitution greatly affects the enzyme specificity and allows efficient activation of both polar and small aliphatic amino acids (serine, glycine and alanine), confirming predictions and conclusions based on molecular dynamics simulations. (rsc.org)
  • An earlier study of H1 HAs from swine influenza viruses shows that these amino acids, 190 and 225, are important for determining the receptor binding specificity ( 13 ). (asm.org)
  • Here, we introduce a versatile alignment-based score as a new metric to predict the damaging effects of variations not limited to single amino acid substitutions but also in-frame insertions, deletions, and multiple amino acid substitutions. (jcvi.org)
  • More importantly, the stabilities of multiple mutants can be predicted from the measured unfolding constants of the corresponding single mutants or from the amino acid properties of the substituted amino acid using the regression analysis performed on the single mutants. (rice.edu)
  • In addition, the potential expression levels for multiple mutants of myoglobin can be predicted from either the stabilities of the corresponding single mutants, or from the properties of the replacement amino acid, even if the stabilities have not been measured previously. (rice.edu)
  • Mutation of this single amino acid back to the avian consensus resulted in a preference for the avian receptor. (asm.org)
  • We now show that failure to recognize Friend MuLV-transformed tumor cells is based on a defect in proteasome-mediated processing of the Friend epitope which is due to a single amino acid substitution (N→D) immediately flanking the C-terminal anchor residue of the epitope. (jimmunol.org)
  • A single amino acid substitution, Q65H, in the non-structural protein 2C was found to be responsible for increased resistance to BFA. (frontiersin.org)
  • Each group of three bases, called a codon, corresponds to a single amino acid, and there is a specific genetic code by which each possible combination of three bases corresponds to a specific amino acid. (wikipedia.org)
  • We constructed a mechanistic framework for modelling amino acid substitution rates that uses the formalisms of statistical mechanics, with principles of population genetics underlying the analysis. (datadryad.org)
  • Lactic acid bacteria (LAB) employ sucrase-type enzymes to convert sucrose into homopolysaccharides consisting of either glucosyl units (glucans) or fructosyl units (fructans). (tudelft.nl)
  • The A/South Carolina/1/18 HA preferentially binds the α2,6 sialic acid (human) cellular receptor, whereas the A/New York/1/18 HA, which differs by only one amino acid, binds both the α2,6 and the α2,3 sialic acid (avian) cellular receptors. (asm.org)
  • The unique giraffe substitutions occur in the FGF-binding domain region flanking the N-terminal cysteine (asterisk) of the Ig-III loop (lower panel). (nature.com)
  • The Y155H amino acid substitution in the neuraminidase gene (NA) has previously been associated with highly reduced inhibition by neuraminidase inhibitors in the seasonal H1N1 influenza A virus which circulated in humans before the 2009 pandemic. (eurosurveillance.org)
  • However, epistatic interactions among sites in a protein result in hererogeneities in the substitution rate, both temporal and spatial, that are beyond the capabilities of current models. (datadryad.org)
  • We also tested a virus presenting a truncation of 109 amino acids at the C-terminal part of Env, a cytoplasmic tail partial deletion that is spontaneously selected in vitro. (mdpi.com)
  • The production of the acidic exopolysaccharide succinoglycan (EPS I) by Rhizobium meliloti exoP * mutants expressing an ExoP protein lacking its C-terminal cytoplasmic domain and by mutants characterized by specific amino acid substitutions in the proline-rich motif (RX 4 PX 2 PX 4 SPKX 9 IXGXMXGXG) located from positions 443 to 476 of the ExoP protein was analyzed. (asm.org)
  • ExoP consists of 786 amino acids and can be divided into an N-terminal domain (positions 1 to 481), mainly located in the periplasm, and a C-terminal cytoplasmic domain (positions 482 to 786) ( 6 ). (asm.org)
  • Substitutions at other positions in the heme pocket also have significant effects on apoglobin stability. (rice.edu)
  • Multiple regression analyses were performed correlating overall stability with the hydrophobicity, size, and helix propensity of the replacement amino acid. (rice.edu)
  • The binding depends on the interaction of HA with sialic acid-containing molecules on the surface of red blood cells. (asm.org)
  • Apart from adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U), DNA and RNA also contain bases that have been modified after the nucleic acid chain has been formed. (wikipedia.org)
  • In most cases, once a range of amino acids has been correlated at a given position, the stabilities of untested mutants can be predicted based on the hydropathy, size, and helix propensity of the substituted amino acid. (rice.edu)
  • Although there is extensive evidence for biased substitution rates in animal mtDNA, there is no consensus on whether this is entirely due to the pattern of mutation or is filtered by selection ( 2 , 3 ). (sciencemag.org)
  • The unique substitution in giraffe, G234Q, immediately adjacent to the Gpi anchor site may alter the anchor site or the rate of its formation. (nature.com)
  • The optimal MHC class I presentable peptide length is most likely generated by N-terminal trimming by ER resident ( 19 , 20 , 21 ) or cytosolic amino peptidases, as has recently been suggested for the OVA CTL epitope ( 17 , 22 ). (jimmunol.org)
  • For example, chicken lung and intestinal epithelial cells contain both types of sialic acid linkages ( 6 ). (asm.org)
  • These results suggest that feature-based methods, like ISM, are more suitable for the classification of amino acid substitutions outside CFDs than phylogeny-based tools. (hindawi.com)