A group of enzymes including those oxidizing primary monoamines, diamines, and histamine. They are copper proteins, and, as their action depends on a carbonyl group, they are sensitive to inhibition by semicarbazide.
A heavy metal trace element with the atomic symbol Cu, atomic number 29, and atomic weight 63.55.
A group of compounds derived from ammonia by substituting organic radicals for the hydrogens. (From Grant & Hackh's Chemical Dictionary, 5th ed)
Enzymes catalyzing the dehydrogenation of secondary amines, introducing a C=N double bond as the primary reaction. In some cases this is later hydrolyzed.
A beta-hydroxylated derivative of phenylalanine. The D-form of dihydroxyphenylalanine has less physiologic activity than the L-form and is commonly used experimentally to determine whether the pharmacological effects of LEVODOPA are stereospecific.
An enzyme that catalyzes the oxidative deamination of naturally occurring monoamines. It is a flavin-containing enzyme that is localized in mitochondrial membranes, whether in nerve terminals, the liver, or other organs. Monoamine oxidase is important in regulating the metabolic degradation of catecholamines and serotonin in neural or target tissues. Hepatic monoamine oxidase has a crucial defensive role in inactivating circulating monoamines or those, such as tyramine, that originate in the gut and are absorbed into the portal circulation. (From Goodman and Gilman's, The Pharmacological Basis of Therapeutics, 8th ed, p415) EC 1.4.3.4.
A flavoprotein enzyme that catalyzes the univalent reduction of OXYGEN using NADPH as an electron donor to create SUPEROXIDE ANION. The enzyme is dependent on a variety of CYTOCHROMES. Defects in the production of superoxide ions by enzymes such as NADPH oxidase result in GRANULOMATOUS DISEASE, CHRONIC.
Diazo derivatives of aniline, used as a reagent for sugars, ketones, and aldehydes. (Dorland, 28th ed)
An enzyme oxidizing peptidyl-lysyl-peptide in the presence of water & molecular oxygen to yield peptidyl-allysyl-peptide plus ammonia & hydrogen peroxide. EC 1.4.3.13.
Toluenes in which one hydrogen of the methyl group is substituted by an amino group. Permitted are any substituents on the benzene ring or the amino group.
A genus of asporogenous bacteria isolated from soil that displays a distinctive rod-coccus growth cycle.
A sulfate salt of copper. It is a potent emetic and is used as an antidote for poisoning by phosphorus. It also can be used to prevent the growth of algae.
A pyrrolo-quinoline having two adjacent keto-groups at the 4 and 5 positions and three acidic carboxyl groups. It is a coenzyme of some DEHYDROGENASES.
A group of naturally occurring amines derived by enzymatic decarboxylation of the natural amino acids. Many have powerful physiological effects (e.g., histamine, serotonin, epinephrine, tyramine). Those derived from aromatic amino acids, and also their synthetic analogs (e.g., amphetamine), are of use in pharmacology.
A plant genus of the FABACEAE family known for the seeds used as food.
An aspect of monoamine oxidase, EC 1.4.3.4. Catalyzes the oxidation of benzylamine to form benzaldehyde, ammonia and hydrogen peroxide.
A chemically heterogeneous group of drugs that have in common the ability to block oxidative deamination of naturally occurring monoamines. (From Gilman, et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed, p414)
An iron-molybdenum flavoprotein containing FLAVIN-ADENINE DINUCLEOTIDE that oxidizes hypoxanthine, some other purines and pterins, and aldehydes. Deficiency of the enzyme, an autosomal recessive trait, causes xanthinuria.
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
Yeast-like ascomycetous fungi of the family Saccharomycetaceae, order SACCHAROMYCETALES isolated from exuded tree sap.
Reagent used as an intermediate in the manufacture of beta-alanine and pantothenic acid.
An indirect sympathomimetic. Tyramine does not directly activate adrenergic receptors, but it can serve as a substrate for adrenergic uptake systems and monoamine oxidase so it prolongs the actions of adrenergic transmitters. It also provokes transmitter release from adrenergic terminals. Tyramine may be a neurotransmitter in some invertebrate nervous systems.
A propylamine formed from the cyclization of the side chain of amphetamine. This monoamine oxidase inhibitor is effective in the treatment of major depression, dysthymic disorder, and atypical depression. It also is useful in panic and phobic disorders. (From AMA Drug Evaluations Annual, 1994, p311)
A group of compounds that are derivatives of beta- aminoethylbenzene which is structurally and pharmacologically related to amphetamine. (From Merck Index, 11th ed)
The removal of an amino group (NH2) from a chemical compound.
Organic chemicals which have two amino groups in an aliphatic chain.
An aldehyde oxidoreductase expressed predominantly in the LIVER; LUNGS; and KIDNEY. It catalyzes the oxidation of a variety of organic aldehydes and N-heterocyclic compounds to CARBOXYLIC ACIDS, and also oxidizes quinoline and pyridine derivatives. The enzyme utilizes molybdenum cofactor and FAD as cofactors.
Small molecules that are required for the catalytic function of ENZYMES. Many VITAMINS are coenzymes.
The rate dynamics in chemical or physical systems.
An enzyme of the oxidoreductase class that catalyzes the conversion of beta-D-glucose and oxygen to D-glucono-1,5-lactone and peroxide. It is a flavoprotein, highly specific for beta-D-glucose. The enzyme is produced by Penicillium notatum and other fungi and has antibacterial activity in the presence of glucose and oxygen. It is used to estimate glucose concentration in blood or urine samples through the formation of colored dyes by the hydrogen peroxide produced in the reaction. (From Enzyme Nomenclature, 1992) EC 1.1.3.4.
The art or process of comparing photometrically the relative intensities of the light in different parts of the spectrum.
Enzymes catalyzing the dehydrogenation of or oxidation of compounds containing primary amines.
Possesses an unusual and selective cytotoxicity for VASCULAR SMOOTH MUSCLE cells in dogs and rats. Useful for experiments dealing with arterial injury, myocardial fibrosis or cardiac decompensation.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
Proteins that have one or more tightly bound metal ions forming part of their structure. (Dorland, 28th ed)
The large family of plants characterized by pods. Some are edible and some cause LATHYRISM or FAVISM and other forms of poisoning. Other species yield useful materials like gums from ACACIA and various LECTINS like PHYTOHEMAGGLUTININS from PHASEOLUS. Many of them harbor NITROGEN FIXATION bacteria on their roots. Many but not all species of "beans" belong to this family.
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
Plants whose roots, leaves, seeds, bark, or other constituent parts possess therapeutic, tonic, purgative, curative or other pharmacologic attributes, when administered to man or animals.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
An enzyme that converts ascorbic acid to dehydroascorbic acid. EC 1.10.3.3.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A class of enzymes that catalyze oxidation-reduction reactions of amino acids.
A polyamine formed from putrescine. It is found in almost all tissues in association with nucleic acids. It is found as a cation at all pH values, and is thought to help stabilize some membranes and nucleic acid structures. It is a precursor of spermine.
Analysis of the intensity of Raman scattering of monochromatic light as a function of frequency of the scattered light.
A strong oxidizing agent used in aqueous solution as a ripening agent, bleach, and topical anti-infective. It is relatively unstable and solutions deteriorate over time unless stabilized by the addition of acetanilide or similar organic materials.
A technique applicable to the wide variety of substances which exhibit paramagnetism because of the magnetic moments of unpaired electrons. The spectra are useful for detection and identification, for determination of electron structure, for study of interactions between molecules, and for measurement of nuclear spins and moments. (From McGraw-Hill Encyclopedia of Science and Technology, 7th edition) Electron nuclear double resonance (ENDOR) spectroscopy is a variant of the technique which can give enhanced resolution. Electron spin resonance analysis can now be used in vivo, including imaging applications such as MAGNETIC RESONANCE IMAGING.
Compounds containing polymethylene bis-trimethylammonium cations. Members of this group frequently act as ganglionic blockers and neuromuscular depolarizing agents.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
An enzyme that oxidizes galactose in the presence of molecular oxygen to D-galacto-hexodialdose. It is a copper protein. EC 1.1.3.9.
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
A toxic diamine formed by putrefaction from the decarboxylation of arginine and ornithine.
Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.
Organic compounds containing a carbonyl group in the form -CHO.
A family of iminourea derivatives. The parent compound has been isolated from mushrooms, corn germ, rice hulls, mussels, earthworms, and turnip juice. Derivatives may have antiviral and antifungal properties.
The measurement of the amplitude of the components of a complex waveform throughout the frequency range of the waveform. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
An enzyme that catalyzes the conversion of urate and unidentified products. It is a copper protein. The initial products decompose to form allantoin. EC 1.7.3.3.
A biogenic polyamine formed from spermidine. It is found in a wide variety of organisms and tissues and is an essential growth factor in some bacteria. It is found as a polycation at all pH values. Spermine is associated with nucleic acids, particularly in viruses, and is thought to stabilize the helical structure.
The protein components of enzyme complexes (HOLOENZYMES). An apoenzyme is the holoenzyme minus any cofactors (ENZYME COFACTORS) or prosthetic groups required for the enzymatic function.
A rare autosomal recessive disease characterized by the deposition of copper in the BRAIN; LIVER; CORNEA; and other organs. It is caused by defects in the ATP7B gene encoding copper-transporting ATPase 2 (EC 3.6.3.4), also known as the Wilson disease protein. The overload of copper inevitably leads to progressive liver and neurological dysfunction such as LIVER CIRRHOSIS; TREMOR; ATAXIA and intellectual deterioration. Hepatic dysfunction may precede neurologic dysfunction by several years.
A plant genus in the family FABACEAE known for LATHYRISM poisoning.
An inherited disorder of copper metabolism transmitted as an X-linked trait and characterized by the infantile onset of HYPOTHERMIA, feeding difficulties, hypotonia, SEIZURES, bony deformities, pili torti (twisted hair), and severely impaired intellectual development. Defective copper transport across plasma and endoplasmic reticulum membranes results in copper being unavailable for the synthesis of several copper containing enzymes, including PROTEIN-LYSINE 6-OXIDASE; CERULOPLASMIN; and SUPEROXIDE DISMUTASE. Pathologic changes include defects in arterial elastin, neuronal loss, and gliosis. (From Menkes, Textbook of Child Neurology, 5th ed, p125)
A metallic element of atomic number 30 and atomic weight 65.38. It is a necessary trace element in the diet, forming an essential part of many enzymes, and playing an important role in protein synthesis and in cell division. Zinc deficiency is associated with ANEMIA, short stature, HYPOGONADISM, impaired WOUND HEALING, and geophagia. It is known by the symbol Zn.
A variable annual leguminous vine (Pisum sativum) that is cultivated for its rounded smooth or wrinkled edible protein-rich seeds, the seed of the pea, and the immature pods with their included seeds. (From Webster's New Collegiate Dictionary, 1973)
An enzyme that catalyzes the first and rate-determining steps of peroxisomal beta-oxidation of fatty acids. It acts on COENZYME A derivatives of fatty acids with chain lengths from 8 to 18, using FLAVIN-ADENINE DINUCLEOTIDE as a cofactor.
A group of oxidoreductases that act on NADH or NADPH. In general, enzymes using NADH or NADPH to reduce a substrate are classified according to the reverse reaction, in which NAD+ or NADP+ is formally regarded as an acceptor. This subclass includes only those enzymes in which some other redox carrier is the acceptor. (Enzyme Nomenclature, 1992, p100) EC 1.6.
An imperfect fungus causing smut or black mold of several fruits, vegetables, etc.
Enzymes that catalyse the removal of methyl groups from LYSINE or ARGININE residues found on HISTONES. Many histone demethylases generally function through an oxidoreductive mechanism.
An element with atomic symbol O, atomic number 8, and atomic weight [15.99903; 15.99977]. It is the most abundant element on earth and essential for respiration.
INDOLES which have two keto groups forming QUINONES like structures of the indole aromatic ring.
Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.
An enzyme of the oxidoreductase class that catalyzes the reaction between catechol and oxygen to yield benzoquinone and water. It is a complex of copper-containing proteins that acts also on a variety of substituted catechols. EC 1.10.3.1.
An enzyme that catalyzes the oxidation of cholesterol in the presence of molecular oxygen to 4-cholesten-3-one and hydrogen peroxide. The enzyme is not specific for cholesterol, but will also oxidize other 3-hydroxysteroids. EC 1.1.3.6.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
An enzyme that catalyzes the oxidative deamination of L-amino acids to KETO ACIDS with the generation of AMMONIA and HYDROGEN PEROXIDE. L-amino acid oxidase is widely distributed in and is thought to contribute to the toxicity of SNAKE VENOMS.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Highly reactive compounds produced when oxygen is reduced by a single electron. In biological systems, they may be generated during the normal catalytic function of a number of enzymes and during the oxidation of hemoglobin to METHEMOGLOBIN. In living organisms, SUPEROXIDE DISMUTASE protects the cell from the deleterious effects of superoxides.
... via extensive crosslinking by members of the lysyl oxidase and lysyl oxidase like family of copper-dependent amine oxidases ... and Marfan's syndrome have been associated with defects in copper metabolism and lysyl oxidase or defects in the microfibril ( ... Maintenance of crosslinked elastin is carried out by a number of proteins including lysyl oxidase-like 1 protein. Mature ... Lucero HA, Kagan HM (October 2006). "Lysyl oxidase: an oxidative enzyme and effector of cell function". Cellular and Molecular ...
For example, copper amine oxidase, catalyzes the oxidative deamination of polyamines, especially putrescine, and releases the ... NADPH oxidase, oxalate oxidase, peroxidases, and flavin containing amine oxidases.[9] ... "Molecular cloning and heterologous expression of pea seedling copper amine oxidase". Bioscience, Biotechnology, and ... Other enzymes thought to play a role in ROS production include xanthine oxidase, ...
... encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in ... Csiszar K (2001). "Lysyl oxidases: a novel multifunctional amine oxidase family". Prog. Nucleic Acid Res. Mol. Biol. Progress ... A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting ... Jung ST, Kim MS, Seo JY, Kim HC, Kim Y (2004). "Purification of enzymatically active human lysyl oxidase and lysyl oxidase-like ...
D-amino acid oxidase. *Amine oxidase (Copper-containing (Lysyl. *Diamine. *Primary-amine)) (Flavin-containing (Monoamine))) ... Glycine oxidase (EC 1.4.3.19) is an enzyme with systematic name glycine:oxygen oxidoreductase (deaminating).[1][2] This enzyme ... Glycine+oxidase at the US National Library of Medicine Medical Subject Headings (MeSH) ... Nishiya Y, Imanaka T (November 1998). "Purification and characterization of a novel glycine oxidase from Bacillus subtilis". ...
A. Glucose oxidase G. l. u. c. o. s. e. +. O. 2. →. O. x. i. d. a. t. i. o. n. g. l. u. c. o. s. e. o. x. i. d. a. s. e. D- ... 1. Alkaline copper reduction Folin-Wu method C. u. 2. +. +. P. h. o. s. p. h. o. m. o. l. y. b. d. i. c. a. c. i. d. →. O. x. i ... Uses aromatic amines and hot acetic acid. *Forms Glycosylamine and Schiff's base which is emerald green in color ... The two most common employed enzymes are glucose oxidase and hexokinase.[28] Average blood glucose concentrations can also be ...
Copper and an aromatic amine. As used by fumigators to detect hydrogen cyanide, copper(II) salt and an aromatic amine such as ... which competes with cytochrome oxidase for the cyanide ion. Cyanmethemoglobin is formed and the cytochrome oxidase enzyme is ... Copper(I) cyanide is poorly soluble. By sequestering the copper(I) the copper(II) is rendered a stronger oxidant. The copper, ... The copper, in a cyanide-facilitated oxidation, converts the amine into a colored compound. ...
HOCl can also react with organic amines, forming N-chloroamines. Reactivity of HClO with biomoleculesEdit. This article relies ... The presence of light or transition metal oxides of copper, nickel, or cobalt accelerates the exothermic decomposition into ... Later studies[38] revealed that Ubiquinol oxidase activity ceases first, and the still-active cytochromes reduce the remaining ... damage to Escherichia coli ubiquinol oxidase". Biochemistry. 28 (7): 3031-6. doi:10.1021/bi00433a044. PMID 2545243.. ...
... the amine becomes quaternized to give betaine, a natural product: H. 3N+. CH. 2COO−. + 3 CH3I → (CH. 3). 3N+. CH. 2COO−. + 3 HI ... Casari, B. M.; Mahmoudkhani, A. H.; Langer, V. (2004). "A Redetermination of cis-Aquabis(glycinato-κ2N,O)copper(II)". Acta ... In the third pathway of its degradation, glycine is converted to glyoxylate by D-amino acid oxidase. Glyoxylate is then ... The amine undergoes the expected reactions. With acid chlorides, one obtains the amidocarboxylic acid, such as hippuric acid[23 ...
Uses copper prosthetic groups instead of iron heme groups and is blue in color when oxygenated. Hemerythrin Some marine ... it does not compete with oxygen for the iron-binding positions but is bound to the amine groups of the protein chains attached ... they are under intense oxidative stress caused by the production of hydrogen peroxide via autoxidation and/or monoamine oxidase ...
There is a risk that polyphenol oxidase (PPO) degrades the phenolic content of the sample therefore there is a need to use PPO ... by replacement of an aromatic amine by an hydroxyl group with water and sodium bisulfide in the Bucherer reaction ... assays or inhibition of copper-catalyzed in vitro human low-density lipoprotein oxidation.[50] ...
Copper required component of many redox enzymes, including cytochrome c oxidase. *Chromium required for sugar metabolism ... In 1912 Casimir Funk coined the term vitamin to label a vital factor in the diet: from the words "vital" and "amine," because ... In 1925 Hart discovered that iron absorption requires trace amounts of copper. In 1927 Adolf Otto Reinhold Windaus synthesized ... Dietary reference intakes for vitamin A, vitamin K, arsenic, boron, chromium, copper, iodine, iron, manganese, molybdenum, ...
The hardening of the cuticle is due to the presence of a polyphenol oxidase.[46] In crustaceans, there is a second oxidase ... The biphenyl/biaryl substructure of polyphenols, here as prepared by synthetic chemists using the copper-mediated Ullmann ... related to their high molecular weights and profusion of phenolic substructures-precipitation of proteins and particular amine- ... Polyphenol oxidase (PPO) is an enzyme that catalyses the oxidation of o-diphenols to produce o-quinones. It is the rapid ...
... (I) forms a variety of weak complexes with alkenes and carbon monoxide, especially in the presence of amine ligands.[60] ... Cytochrome c oxidase is the protein that binds the O2 between a copper and an iron; the protein transfers 8 electrons to the O2 ... Many other oxyanions form complexes; these include copper(II) acetate, copper(II) nitrate, and copper(II) carbonate. Copper(II ... 340 μg of copper for 1-3 years old, 440 μg of copper for 4-8 years old, 700 μg of copper for 9-13 years old, 890 μg of copper ...
Copper required component of many redox enzymes, including cytochrome c oxidase Main article: Copper in health ... In 1912, Casimir Funk coined the term vitamin, a vital factor in the diet, from the words "vital" and "amine," because these ... In 1925, Hart discovered that trace amounts of copper are necessary for iron absorption. In 1927, Adolf Otto Reinhold Windaus ...
People with the rare genetic disorder xanthinuria lack sufficient xanthine oxidase and cannot convert xanthine to uric acid. ... In contrast to other, more potent stimulants like sympathomimetic amines, xanthines mainly act to oppose the actions of the ... Xanthine is subsequently converted to uric acid by the action of the xanthine oxidase enzyme. ...
Lindemann L, Hoener MC (May 2005). "A renaissance in trace amines inspired by a novel GPCR family". Trends Pharmacol. Sci. 26 ( ... Proline oxidase. *Pyrroline-5-carboxylate reductase. *1-Pyrroline-5-carboxylate dehydrogenase/ALDH4A1 ... Biosynthetic pathways for catecholamines and trace amines in the human brain[9][10][11] ... Broadley KJ (March 2010). "The vascular effects of trace amines and amphetamines". Pharmacol. Ther. 125 (3): 363-375. doi: ...
... also binds to other molecules such as myoglobin and mitochondrial cytochrome oxidase. Exposures to carbon ... Copper(I) oxide (Cu2O). *Dicarbon monoxide (C2O). *Dichlorine monoxide (Cl2O) ... Biogenic amines: Monoamines: 6-OHM. *Dopamine. *Epinephrine (adrenaline). *NAS (normelatonin). *Norepinephrine (noradrenaline) ...
Glaser P, Villani G, Papa S, Capitanio N (1994). „The proton pump of heme-copper oxidases". Cell Biol. Int. 18 (5): 345-355. ... Poznato je da je slepo crevo važno u fetusnom životu pošto ono sadrži endokrine ćelije koje otpuštaju biogene amine i poptidne ... Rumbley J, Gennis RB, Garcia-Horsman JA, Barquera B, Ma J (1994). „The superfamily of heme-copper respiratory oxidases". J. ... Cancer and age related colonic crypt deficiencies in cytochrome c oxidase I". World J Gastrointest Oncol. 2 (12): 429-42. PMC ...
Several metals, such as copper(II) and iron(III) complexes affect this reaction.[citation needed] Alternatively, disulfide ... unless a sulfhydryl oxidase is present.[10] ...
Copper is ubiquitous and daily requirement is low making acquired copper deficiency very rare. Copper deficiency can manifest ... Broadley, KJ (March 2010). "The vascular effects of trace amines and amphetamines". Pharmacology & Therapeutics. 125 (3): 363- ... prenatal iron deficiency disrupts emotional behavior and polymorphisms that reduce the expression of monoamine oxidase interact ... Copper is important for the function of many enzymes in the brain. Notably, dopamine β-mono-oxygenase is affected by copper ...
... amine oxidase A, aldehyde dehydrogenase 1A3 and membrane copper amine oxidase. Nutaratat P, Srisuk N, Arunrattiyakorn P, ... Indole-3-acetaldehyde is a substrate for retina-specific copper amine oxidase, aldehyde dehydrogenase X (mitochondrial), amine ... oxidase B, amiloride-sensitive amine oxidase, aldehyde dehydrogenase (mitochondrial), fatty aldehyde dehydrogenase, 4- ...
High levels of catecholamines can also be caused by monoamine oxidase A (MAO-A) deficiency, known as Brunner syndrome. As MAO-A ... Lindemann L, Hoener MC (May 2005). "A renaissance in trace amines inspired by a novel GPCR family". Trends in Pharmacological ... The enzyme dopamine hydroxylase requires copper as a cofactor (not shown in the diagram) and DOPA decarboxylase requires PLP ( ... They can be degraded either by methylation by catechol-O-methyltransferases (COMT) or by deamination by monoamine oxidases (MAO ...
It is used by copper amine oxidases which contain a tyrosine residue near the active site. This residue catalyses its own ...
... amine oxidase (flavin-containing) EC 1.4.3.5: pyridoxamine-phosphate oxidase EC 1.4.3.6: amine oxidase (copper-containing) EC ... glycine oxidase EC 1.4.3.20: L-lysine 6-oxidase EC 1.4.3.21: primary-amine oxidase EC 1.4.3.22: diamine oxidase EC 1.4.3.23: 7- ... malate oxidase EC 1.1.3.4: glucose oxidase EC 1.1.3.5: hexose oxidase EC 1.1.3.6: cholesterol oxidase EC 1.1.3.7: aryl-alcohol ... L-gulonolactone oxidase EC 1.1.3.9: galactose oxidase EC 1.1.3.10: pyranose oxidase EC 1.1.3.11: L-sorbose oxidase EC 1.1.3.12 ...
The copper amine oxidases occur as mushroom-shaped homodimers of 70-95 kDa, each monomer containing a copper ion and a ... There are two classes of amine oxidases: flavin-containing (EC:1.4.3.4) and copper-containing (EC:1.4.3.6). Copper-containing ... Copper-containing amine oxidases are found in bacteria, fungi, plants and animals. In prokaryotes, the enzyme enables various ... Copper amine oxidase-like, N-terminal domain superfamily (IPR036582). Short name: Mao_N_sf ...
amine oxidase (copper-containing) (EC 1.4.3.6) - yeast (Pichia angusta) (fragmen... amine oxidase (copper-containing) (EC 1.4. ... amine oxidase (copper-containing) (EC 1.4.3.6) - yeast (Pichia angusta) (fragment). PIR: A38081 ...
Description: METHYLAMINE OXIDASE protein , Length: 655 No structure alignment results are available for 1A2V.A, 1A2V.B, 1A2V.C ... Crystallographic study of yeast copper amine oxidase. ... COPPER AMINE OXIDASE FROM HANSENULA POLYMORPHA. Display Files * ...
IPR000269 Copper amine oxidase. IPR015798 Copper amine oxidase, catalytic domain. IPR036460 Copper amine oxidase, catalytic ... IPR015800 Copper amine oxidase, N2-terminal. IPR015802 Copper amine oxidase, N3-terminal ...
IPR000269 Cu_amine_oxidase. IPR015798 Cu_amine_oxidase_C. IPR036460 Cu_amine_oxidase_C_sf. IPR016182 Cu_amine_oxidase_N-reg. ... IPR000269 Cu_amine_oxidase. IPR015798 Cu_amine_oxidase_C. IPR036460 Cu_amine_oxidase_C_sf. IPR016182 Cu_amine_oxidase_N-reg. ... PS01164 COPPER_AMINE_OXID_1, 1 hit. PS01165 COPPER_AMINE_OXID_2, 1 hit. ... PS01164 COPPER_AMINE_OXID_1, 1 hit. PS01165 COPPER_AMINE_OXID_2, 1 hit. ...
Find Copper Amine Oxidases and Monooxygenases research area related information and Copper Amine Oxidases and Monooxygenases ...
Copper amine oxidases (CAOs) have been proposed to be involved in the metabolism of xenobiotic and biogenic amines. The ... Article Copper distributed by Atx1 is available to copper amine oxidase 1 in schizosaccharomyces pombe. ... Copper distributed by Atx1 is available to copper amine oxidase .... Copper distributed by Atx1 is available to copper amine ... No comments were found for Copper distributed by Atx1 is available to copper amine oxidase 1 in schizosaccharomyces pombe. Be ...
Crystal structures of the copper-containing amine oxidase from Arthrobacter globiformis in the holo and apo forms: implications ... Amine oxidase N-terminal region Amine oxidase N-terminal region Copper amine oxidase, domains 1 and 2 Arthrobacter globiformis ... Amine oxidase N-terminal region Amine oxidase N-terminal region Copper amine oxidase, domains 1 and 2 Arthrobacter globiformis ... Amine oxidase catalytic domain Amine oxidase catalytic domain Copper amine oxidase, domain 3 Arthrobacter globiformis [TaxId: ...
Copper amine oxidase (CuAO; EC 1.4.3.6) catalyzes the oxidative deamination of various biological active amines with the ... cell wall oxalate oxidases (Lane, 1994), peroxidases (Bolwell et al., 1995), and FAD and copper-containing amine oxidase (Allan ... Copper Amine Oxidase Expression in Defense Responses to Wounding and Ascochyta rabiei Invasion Giuseppina Rea, Ouissal Metoui, ... 1997) Inhibition of copper amine oxidase by haloamines: a killer product mechanism. Biochemistry 36:2595-2602. ...
... the copper amine oxidases (CuAOs) and the flavin adenine dinucleotide (FAD)-dependent polyamine oxidases (PAOs). These enzymes ... the copper amine oxidases (CuAOs) and the flavin adenine dinucleotide (FAD)-dependent polyamine oxidases (PAOs). These enzymes ... Plant polyamines are catabolized by two classes of amine oxidases, ... Plant polyamines are catabolized by two classes of amine oxidases, ...
Copper-Containing)) (ABP1) Protein. Species: Pig (Porcine). Source: Escherichia coli (E. coli). Order product ABIN6303857. ... Amine Oxidase, Copper Containing 2 (Retina-Specific) Proteins * Amine Oxidase, Copper Containing 3 (Vascular Adhesion Protein 1 ... Amine Oxidase (Copper-Containing)) (ABP1) Protein Amiloride Binding Protein 1 (Amine Oxidase (Copper-Containing)) (ABP1) ... Amiloride Binding Protein 1 (Amine Oxidase (Copper-Containing)) (ABP1) show synonyms for this antigen * ABP ...
"Involvement of copper amine oxidase (CuAO)-dependent hydrogen peroxide synthesis in ethylene-induced stomatal closure in Vicia ... Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants ... Involvement of copper amine oxidase (CuAO)-dependent hydrogen peroxide synthesis in... Song, X.; She, X.; Yue, M.; Liu, Y.; ... Inhibition of copper amine oxidase by haloamines: a killer product mechanism. Medda, R; Padiglia, A; Pedersen, JZ; Agrò, AF; ...
The role of protein crystallography in defining the mechanisms of biogenesis and catalysis in copper amine oxidase. ... The role of protein crystallography in defining the mechanisms of biogenesis and catalysis in copper amine oxidase. Together ...
Copper Containing 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene ... Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and ... AOC2 (Amine Oxidase, Copper Containing 2) is a Protein Coding gene. Diseases associated with AOC2 include Median Neuropathy and ... Characterization of AOC2 gene encoding a copper-binding amine oxidase expressed specifically in retina. (PMID: 14585497) Zhang ...
MAOA preferentially oxidizes biogenic amines such as 5-hydroxytryptamine (5-HT), norepinephrine and epinephrine (By similarity ... of biogenic and xenobiotic amines and has important functions in the metabolism of neuroactive and vasoactive amines in the ... Some cofactors are inorganic, such as the metal atoms zinc, iron, and copper in various oxidation states. Others, such as most ... IPR002937, Amino_oxidase. IPR036188, FAD/NAD-bd_sf. IPR001613, Flavin_amine_oxidase. ...
Copper. approved, investigational. yes. cofactor. Details. DB01171. Moclobemide. approved, investigational. unknown. antagonist ... Monoamine oxidase type B. Gene Name. MAOB. Organism. Human. Amino acid sequence. ,lcl,BSEQ0004309,Amine oxidase [flavin- ... Primary amine oxidase activity. Specific Function. Catalyzes the oxidative deamination of biogenic and xenobiotic amines and ... lcl,BSEQ0016709,Amine oxidase [flavin-containing] B (MAOB) ATGAGCAACAAATGCGACGTGGTCGTGGTGGGGGGCGGCATCTCAGGTATGGCAGCAGCC ...
keywords = "Amines, Copper amine oxidase, GABA, Oxidase, Retina, Retinal ganglion cells",. author = "Qiang Zhang and Yukihiko ... amine oxidase gene (RAO, gene symbol: AOC2), a member of the copper-binding amine oxidase super family. AOC2 shares sequence ... amine oxidase gene (RAO, gene symbol: AOC2), a member of the copper-binding amine oxidase super family. AOC2 shares sequence ... amine oxidase gene (RAO, gene symbol: AOC2), a member of the copper-binding amine oxidase super family. AOC2 shares sequence ...
... and Stereopictres of 5.0 Angstrom coordination sphere of Copper atom in PDB 1lvn: Crystal Structure of E. Coli Amine Oxidase ... Copper in the structure of Crystal Structure of E. Coli Amine Oxidase Complexed With Tranylcypromine (pdb 1lvn). ... The binding sites of Copper atom in the structure of Crystal Structure of E. Coli Amine Oxidase Complexed With Tranylcypromine ... Copper. Isotopes. Energy. Production. Application. Physical Properties. Chemical Properties. Cuprous Compounds. Complex Copper ...
Developmental, hormone- and stress-modulated expression profiles of four members of the Arabidopsis copper-amine oxidase gene ... The Ns group of 4 was removed with PhSH/Cs2CO3 to afford amine 5. Finally, deprotection of the Boc moiety of 5 with SOCl2 ... Polyamines such as putrescine and spermidine are small cationic amines present in all organisms that regulate various cellular ... Kan, T. & Fukuyama, T. Ns strategies: a highly versatile synthetic method for amines. Chem. Commun. 21, 353-359 (2004). ...
Human copper-containing amine oxidases in drug design and development (2020) Molecules ...
Copper amine oxidase, catalytic domain. The name of this superfamily has been modified since the most recent official CATH+ ...
Substrate Schiff-Base Analogue of Copper Amine Oxidase From Arthrobacter Globiformis Formed with 4-Hydroxybenzylhydrazine ... Copper Binding Sites List in 2e2u Copper binding site 1 out of 2 in the Substrate Schiff-Base Analogue of Copper Amine Oxidase ... Copper Binding Sites List in 2e2u Copper binding site 2 out of 2 in the Substrate Schiff-Base Analogue of Copper Amine Oxidase ... Copper ». PDB 1x9r-2ahl ». 2e2u ». Copper in PDB 2e2u: Substrate Schiff-Base Analogue of Copper Amine Oxidase From Arthrobacter ...
keywords = "Copper-amine oxidase, Crystallization, Escherichia coli, Monoamine oxidase, X-ray crystallography", ... Crystallization and preliminary X-ray analysis of copper amine oxidase from escherichia coli K-12. Journal of Molecular Biology ... Crystallization and preliminary X-ray analysis of copper amine oxidase from escherichia coli K-12. In: Journal of Molecular ... Crystallization and preliminary X-ray analysis of copper amine oxidase from escherichia coli K-12. / Roh, Jung Hyeob; Suzuki, ...
keywords = "Copper-amine oxidase, Crystallization, Escherichia coli, Monoamine oxidase, X-ray crystallography", ... フィンガープリント Crystallization and preliminary X-ray analysis of copper amine oxidase from escherichia coli K-12 の研究トピックを掘り下げます。これら ... Crystallization and preliminary X-ray analysis of copper amine oxidase from escherichia coli K-12. Journal of Molecular Biology ... Crystallization and preliminary X-ray analysis of copper amine oxidase from escherichia coli K-12. / Roh, Jung Hyeob; Suzuki
Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants / REA G; DE PINTO ... Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants. ... Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants ... polyamine oxidase (MPAO) or pea (Pisum sativum) copper amine oxidase (PCuAO), two extracellular and H2O2-producing enzymes. ...
"Active Site Rearrangement of the 2-Hydrazinopyridine Adduct in Escherichia coli Amine Oxidase to an Azo Copper(II) Chelate Form ... "Active Site Rearrangement of the 2-Hydrazinopyridine Adduct in Escherichia coli Amine Oxidase to an Azo Copper(II) Chelate Form ...
Expression and functional analysis of the lysine decarboxylase and copper amine oxidase genes from the endophytic fungus ...
5.1.3.3 Monoamine Oxidase 368. 5.1.3.4 Copper Amine Oxidases 371. 5.1.4 Miscellaneous 371 ... Biocatalytic applications of redox enzymes such as dehydrogenases, oxygenases, oxidases, and peroxidases ...
... or FAD-dependent amine oxidases (PAOs), respectively. Both enzymes have long been considered to be apoplastic proteins. However ... are oxidatively deaminated at their primary or secondary amino-groups by copper-containing amine oxidases (CuAOs) ... Cooperation of copper amine oxidase and flavin-containing polyamine oxidase. Plant Signal Behav. 2008, 3: 204-206. 10.4161/psb. ... Ectopic expression of maize polyamine oxidase and pea copper amine oxidase in the cell wall of tobacco plants. Plant Physiol. ...
Copper amine oxidase, catalytic domain (IPR015798) Pfam signature: PF01179 Dihydroorotate dehydrogenase domain (IPR005720) Pfam ... Cytochrome c oxidase subunit I (IPR000883) Pfam signature: PF00115 Cytochrome c oxidase subunit II-like C-terminal (IPR002429) ... Copper fist DNA-binding domain (IPR001083) Pfam signature: PF00649 CRAL-TRIO lipid binding domain (IPR001251) Pfam signature: ... Cytochrome c oxidase subunit III-like (IPR000298) Pfam signature: PF00510 Papillomavirus E2, C-terminal (IPR000427) Pfam ...
  • SSAO has even been renamed primary amine oxidase to signify that it is better defined by its substrates (endogenous or exogenous) rather than by its inhibitor(s) [46]. (thefreedictionary.com)
  • Nevertheless, our comparative study clearly indicated that none of the tested phenolic compounds directly inhibited primary amine oxidase , also named SSAO/VAP-1. (thefreedictionary.com)
  • Human semicarbazide-sensitive amine oxidase (SSAO) is a homodimeric copper-containing monoamine oxidase that occurs in both a membrane-bound and a soluble form. (diva-portal.org)
  • It is a first-in-class, mechanism-based inhibitor of Semicarbazide-Sensitive Amine Oxidase (SSAO), also known as Vascular Adhesion Protein-1 (VAP-1), or Amine Oxidase Copper Containing 3 (AOC3), PXS-4728 and provides greater than 90% inhibition of its target enzyme for 24 hours after a single oral dose. (pharmaxis.com.au)
  • This gene encodes a member of the semicarbazide-sensitive amine oxidase family. (origene.com)
  • Crystallization of a truncated soluble human semicarbazide-sensitive amine oxidase. (diva-portal.org)
  • it is now known to contain two distinct enzyme activities, and thus has been replaced by two enzymes: EC 1.4.3.21 (primary-amine oxidase) and EC 1.4.3.22 (diamine oxidase). (thefreedictionary.com)
  • TABLE 5: Serum concentrations of D-lactate and diamine oxidase in piglets. (thefreedictionary.com)
  • Diamine oxidase as a marker of intestinal mucosal injury and the effect of soluble dietary fiber on gastrointestinal tract toxicity after intravenous 5-fluorouracil treatment in rats. (thefreedictionary.com)
  • The importance of human intestinal diamine oxidase in the oxidation of histamine and/or putrescine. (thefreedictionary.com)
  • Diamine oxidase polymorphisms have been associated with inflammatory intestinal diseases, including food allergies, whereas low enzyme activity caused by HNMT polymorphisms has been associated with asthma (Maintz L. (thefreedictionary.com)
  • When there is an overgrowth of harmful organisms, the intestinal microvilli that make diamine oxidase are compromised, affecting histamine degradation and causing us to be more sensitive to histamine. (thefreedictionary.com)
  • Plasma diamine oxidase activity is a useful biomarker for evaluating gastrointestinal tract toxicities during chemotherapy with oral fluorouracil anti-cancer drugs in patients with gastric cancer. (thefreedictionary.com)
  • Purification and characterization of diamine oxidase from clover leaves. (thefreedictionary.com)
  • Amperometric biosensor for diamine using diamine oxidase purified from porcine kidney. (thefreedictionary.com)
  • Hill, M. J. (1971) Diamine oxidase (Pea seedling). (springer.com)
  • Infectious complications, intestinal mucosal integrity as measured by serum diamine oxidase (DAO) activity, and fecal flora and organic acid concentrations were compared between synbiotic treatment (n = 32) and control (n = 29) groups. (curehunter.com)
  • 15. Suresh, M. R. & Adiga, P. R. Diamine oxidase of Lathyrus sativus seedlings. (kirj.ee)
  • 16. Peč, P. & Frebort, I. 1,4-Diamino-2-butyne as the mechanism-based pea diamine oxidase inhibitor. (kirj.ee)
  • 21. Srivastava, S. K. & Prakash, V. Purification and properties of pea cotyledon and embryo diamine oxidase. (kirj.ee)
  • Amine oxidases (AO) are enzymes that catalyse the oxidation of a wide range of biogenic amines including many neurotransmitters, histamine and xenobiotic amines. (ebi.ac.uk)
  • It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. (genecards.org)
  • A group of enzymes that oxidize primary monoamines but have little or no activity toward diamines, such as histamine, or toward secondary and tertiary amines. (cathdb.info)
  • The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. (genecards.org)
  • AOC2 (Amine Oxidase, Copper Containing 2) is a Protein Coding gene. (genecards.org)
  • AOC2 shares sequence identity with the human kidney amine oxidase gene (KAO, gene symbol: AOC1) and the vascular adhesion protein-1 gene (VAP-1, gene symbol: AOC3). (elsevier.com)
  • Frieden, E. & Hsieh, H. S. (1976) Ceruloplasmin: The copper transport protein with essential oxidase activity. (springer.com)
  • Maintenance of crosslinked elastin is carried out by a number of proteins including lysyl oxidase-like 1 protein. (wikipedia.org)
  • Vascular adhesion protein-1 (VAP-1) is a copper amine oxidase with a topaquinone co-factor. (rndsystems.com)
  • The encoded protein is localized to the cell surface, has adhesive properties as well as monoamine oxidase activity, and may be involved in leukocyte trafficking. (origene.com)
  • TYRP1, Tyrosinase-related protein 1 Group 3: Copper amine oxidase 1. (thefreedictionary.com)
  • Using the Protein Data Bank , we located the protein 1OAC , otherwise known as copper amine oxidase of E. coli . (bioquest.org)
  • We now have identified AOC3 (amine oxidase, copper containing 3), a surface monoamine oxidase, as a new marker of myofibroblasts by showing that it is the target protein of the myofibroblast-reacting mAb PR2D3. (pnas.org)
  • The detailed computational investigation of the canine lysyl oxidase protein was analyzed in silico with respect to its physicochemical properties, secondary and tertiary structure predictions and functional analysis using standard bioinformatic tools. (springer.com)
  • Lysyl oxidase is a flexible protein with an average molecular weight of around 46 kDa, unstable, hydrophilic, and extracellular (secretory) in nature. (springer.com)
  • The phylogenetic relationship of canine lysyl oxidase with a vast range of mammalian species indicates that the protein was very well conserved throughout the course of evolution. (springer.com)
  • In prokaryotes, the enzyme enables various amine substrates to be used as sources of carbon and nitrogen [ PMID: 9048544 , PMID: 9405045 ]. (ebi.ac.uk)
  • Visualization of dioxygen bound to copper during enzyme catalysis. (ebi.ac.uk)
  • Here, by means of stomatal bioassay, the analysis of enzyme activity and using laser-scanning confocal microscopy based on the H2O2-sensitive probe 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA), the roles of copper amine oxidase (CuAO) in ethylene-induced H2O2 production in guard cells and stomatal closure in Vicia faba L. were investigated. (deepdyve.com)
  • Our results demonstrated that the copper-binding motif and the enzyme active site of AOC1 and AOC3 were both conserved in mouse AOC2. (elsevier.com)
  • Histaminase is an enzyme of the family of the amine oxidases. (freepatentsonline.com)
  • Enzyme assays were conducted once in every 7 days for 28 days, for activities of phenol oxidase, peroxidase, beta-glucosidase, beta-xylosidase, and cellobiohydrolase. (biomedsearch.com)
  • The aim of the present study was to extract and purify amine oxidase from pea seedlings, to determine the activity and selectivity of the purified enzyme towards different amine substrates with a Clark-type oxygen sensor, and to examine the possible application of the enzyme as a bioselective element in amine biosensors. (thefreedictionary.com)
  • Lysyl oxidase homolog 1 , also known as LOXL1 , is an enzyme which in humans is encoded by the LOXL1 gene . (wikipedia.org)
  • We also found an example of copper sparing in the N assimilation pathway: the replacement of copper amine oxidase by a flavin-dependent backup enzyme. (plantcell.org)
  • We identified the surface enzyme AOC3 (amine oxidase, copper containing 3) as a new marker of myofibroblasts and as a result have discovered additional highly distinctive markers for myofibroblasts, including the transcription factor NKX2-3. (pnas.org)
  • The copper-dependent amine oxidase activity of this enzyme functions in the crosslinking of collagens and elastin, while the propeptide may play a role in tumor suppression. (nih.gov)
  • The specific activity and selectivity of the enzyme were studied with an oxygen sensor by following the kinetics of the amine oxidation reaction, catalysed by the enzyme. (kirj.ee)
  • Lysyl oxidase is an extracellular regulatory enzyme with an imperative role in interlinking of collagen and elastin by oxidizing lysine residues. (springer.com)
  • Lysyl oxidase enzyme family contains a catalytic domain and a cytokine receptor-like domain at their C termini. (springer.com)
  • 1. an oxidoreductase containing copper, and perhaps pyridoxal phosphate, and carrying out the same reaction as amine oxidase (flavin-containing). (thefreedictionary.com)
  • 2. an oxidoreductase containing flavin and oxidizing amines with the aid of O 2 and water to aldehydes or ketones with the release of NH 3 and H 2 O 2 . (thefreedictionary.com)
  • Crystal structure of a quinoenzyme: copper amine oxidase of Escherichia coli at 2 A resolution. (ebi.ac.uk)
  • Catalytic mechanism of the quinoenzyme amine oxidase from Escherichia coli: exploring the reductive half-reaction. (ebi.ac.uk)
  • Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. (elsevier.com)
  • To test the feasibility of altering polyamine levels by influencing their catabolic pathway, we obtained transgenic tobacco (Nicotiana tabacum) plants constitutively expressing either maize (Zea mays) polyamine oxidase (MPAO) or pea (Pisum sativum) copper amine oxidase (PCuAO), two extracellular and H2O2-producing enzymes. (uniroma3.it)
  • Two amine oxidases from Aspergillus niger AKU 3302 contain topa quinone as the cofactor: unusual cofactor link to the glutamyl residue occurs only at one of the enzymes. (sigmaaldrich.com)
  • The impact of copper deficiency on the expression of several O 2 -dependent enzymes included steps in lipid modification pathways. (plantcell.org)
  • Nevertheless, when nutritional supply is limited, organisms are unable to synthesize the full complement of copper-containing enzymes. (plantcell.org)
  • 1. Jalkanen, S. & Salmi, M. Cell surface monoamine oxidases: enzymes in search of function. (kirj.ee)
  • Lysyl oxidase, a copper-dependent amine oxidase belongs to the oxido reductase family of enzymes and is secreted in the extracellular space [ 1 ]. (springer.com)
  • There are two classes of amine oxidases: flavin-containing ( EC:1.4.3.4 ) and copper-containing ( EC:1.4.3.6 ). (ebi.ac.uk)
  • Plant polyamines are catabolized by two classes of amine oxidases, the copper amine oxidases (CuAOs) and the flavin adenine dinucleotide (FAD)-dependent polyamine oxidases (PAOs). (frontiersin.org)
  • The copper amine oxidases occur as mushroom-shaped homodimers of 70-95 kDa, each monomer containing a copper ion and a covalently bound redox cofactor, topaquinone (TPQ). (ebi.ac.uk)
  • Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. (genecards.org)
  • 2001) Structure of a quinohemoprotein amine dehydrogenase with an uncommon redox cofactor and highly unusual crosslinking. (els.net)
  • DuBois JL and Klinman JP (2006) Role of a strictly conserved active site tyrosine in cofactor genesis in the copper amine oxidase from Hansenula polymorpha. (els.net)
  • Amine oxidases (EC 1.4.3.6) from Aspergillus niger, AO-I (2 x 75 kDa) and AO-II (80 kDa), were examined to determine the cofactor structure. (sigmaaldrich.com)
  • An active site, cofactor-containing peptide has been obtained in high yield from bovine serum amine oxidase. (sciencemag.org)
  • This result indicates that, contrary to previous proposals, pyrroloquinoline quinone is not the active site cofactor in mammalian copper amine oxidases. (sciencemag.org)
  • 1OAC has a single copper ion and a covalently bonded cofactor. (bioquest.org)
  • Copper is an essential nutrient for all forms of aerobic life because of its role as a redox cofactor, especially in reactions involving oxygen chemistry, such as electron transfer during respiration and photosynthesis, neutralization of superoxide, and oxygenation of organic molecules. (plantcell.org)
  • Catalytic domain has a copper-binding motif and a unique lysyl-tyrosylquinone (LTQ) cofactor. (springer.com)
  • Catalytic Regulation Conducted By the Substrate Schiff Base and Conserved Aspartic Acid Residue in Bacterial Copper Amine Oxidase Reaction To Be Published . (atomistry.com)
  • Wounding chickpea ( Cicer arietinum ) internodes or cotyledons resulted in an increase in the steady-state level of copper amine oxidase (CuAO) expression both locally and systemically. (plantphysiol.org)
  • In plants, polyamines are oxidatively deaminated by copper- and flavin-containing odixases (CuAO and PAO) leading to the generation of H2O2 and 4-aminobutanal (ABAL) which can be converted to 4-aminobutyric acid (GABA). (wikipathways.org)
  • This entry represents a domain superfamily found at the N-terminal of certain copper amine oxidases, as well as in related proteins such as cell wall hydrolase and N-acetylmuramoyl-L-alanine amidase. (ebi.ac.uk)
  • To evaluate the impact of the R141L and G153D variations on the amine oxidase activity of LOXL1, we generated four different haplotypes of LOXL1 with R141L and G153D and assessed the amine oxidase activity of the LOXL1 variant proteins. (molvis.org)
  • The amine oxidase activities of the LOXL1 variant proteins were assessed using peroxidase-coupled fluorometric assays. (molvis.org)
  • We have previously shown that each of the LOX-like proteins functions as an amine oxidase [ 4 - 7 ], but functional differences of these LOX family proteins have not been clearly determined. (molvis.org)
  • Proteomic and immunoblot analyses captured 25% of the corresponding proteins, whose abundance was also dependent on copper nutrition, validating transcriptional regulation as a major control mechanism for copper signaling in Chlamydomonas . (plantcell.org)
  • Forty percent of the targets are previously uncharacterized proteins, indicating considerable potential for new discovery in the biology of copper. (plantcell.org)
  • This gene encodes a member of the lysyl oxidase family of proteins. (nih.gov)
  • The catalytic domain is the largest of the 3-4 domains found in copper amine oxidases, and consists of a beta sandwich of 18 strands in two sheets. (ebi.ac.uk)
  • We have previously cloned a human, retina-specific, amine oxidase gene (RAO, gene symbol: AOC2), a member of the copper-binding amine oxidase super family. (elsevier.com)
  • The LOX gene family consists of five paralogs ( LOX , LOXL1 , LOXL2 , LOXL3 , and LOXL4 ) in humans, each containing a copper-binding motif, lysyl-tyrosyl-quinone (LTQ) residues, and a cytokine receptor-like (CRL) domain in the highly conserved COOH-terminus. (molvis.org)
  • They are copper quinoproteins (2,4,5-trihydroxyphenylalanine quinone) and, unlike EC 1.4.3.4, are sensitive to inhibition by carbonyl-group reagents, such as semicarbazide. (cathdb.info)
  • EC 1.4.3.6 ) catalyzes the oxidative deamination of various biological active amines with the production of the corresponding aminoaldehydes, H 2 O 2 , and NH 3 ( Smith, 1985 ). (plantphysiol.org)
  • Catalyzes the oxidative deamination of biogenic and xenobiotic amines and has important functions in the metabolism of neuroactive and vasoactive amines in the central nervous system and peripheral tissues. (uniprot.org)
  • 3,4-Dihydroxyphenylacetaldehyde (DOPAL) is a metabolite of the monoamine oxidase-catalyzed oxidative deamination of dopamine. (hmdb.ca)
  • Expression and characterization of a Drosophila lysyl oxidase. (els.net)
  • This parameter A was used for the characterization of amine oxidase activity. (thefreedictionary.com)
  • Crystal structures of the copper-containing amine oxidase from Arthrobacter globiformis in the holo and apo forms: implications for the biogenesis of topaquinone. (ebi.ac.uk)
  • Belongs to the copper/topaquinone oxidase family. (abcam.com)
  • Topaquinone (TPQ) is generated by copper-dependent autoxidation of a specific tyrosyl residue. (abcam.com)
  • However, there were no significant differences in amine oxidase activity between the LOXL1 haplotype variants toward the tested substrates. (molvis.org)
  • Our RNA-Seq data simulation and analysis pipeline validated a 2-fold cutoff and 10 RPKM (reads per kilobase of mappable length per million mapped reads) (~1 mRNA per cell) to reveal 63 CRR1 targets plus another 86 copper-responsive genes. (plantcell.org)
  • Lysyl oxidase genes are a family of LOX paralogs suggesting diverse functions due to the different regulation of the LOX family. (springer.com)
  • 20. McGowan, R. E. & Muir, R. M. Purification and properties of amine oxidase from epicotyls of Pisum sativum . (kirj.ee)
  • The prototypic member of the family is essential to the biogenesis of connective tissue, encoding an extracellular copper-dependent amine oxidase that catalyses the first step in the formation of crosslinks in collagens and elastin . (wikipedia.org)
  • LOX is a copper-dependent amine oxidase that catalyzes cross-linking of collagens and elastins within the extracellular matrix. (childrensmrc.org)
  • Lysyl oxidase regulates breast cancer cell migration and adhesion through a hydrogen peroxide-mediated mechanism. (childrensmrc.org)
  • The molecular weight of pea seedlings amine oxidase (PSAO) has been found to be between 150 and 180 kDa [2, 7]. (thefreedictionary.com)
  • Amine oxidase (EC 1.4.3.6) was purified from pea ( Pisum sativum ) seedlings with the aim of characterizing its catalytic properties. (kirj.ee)
  • 13. Kenten, R. H. & Mann, P. J. G. The oxidation of amines by extracts of pea seedlings. (kirj.ee)
  • 14. Matsuda, H. & Suzuki, Y. Some properties of the amine oxidase in Vicia faba seedlings. (kirj.ee)
  • The copper ion is coordinated with three histidine residues and two water molecules in a distorted square pyramidal geometry, and has a dual function in catalysis and TPQ biogenesis. (ebi.ac.uk)
  • Site-directed mutagenesis identified three histidine residues within the C-terminal region of Cao1 that are necessary for amine oxidase activity. (environmental-expert.com)
  • Chan, W. Y. & Rennert, O. M. (1980b) The role of copper in iron metabolism. (springer.com)
  • Chan, W. Y. & Rennert, O. M. (1981) Prenatal and postnatal diagnosis of diseases of copper metabolism. (springer.com)
  • Sass-Kortsak, A. & Bearn, A. G. (1978) Hereditary disorders of copper metabolism. (springer.com)
  • Buschke-Ollendorff syndrome, Menkes disease, pseudoxanthoma elasticum, and Marfan's syndrome have been associated with defects in copper metabolism and lysyl oxidase or defects in the microfibril (defects in fibrillin, or fibullin for example). (wikipedia.org)
  • Boehringer acquired the compound, an oral inhibitor of amine oxidase, copper containing 3, in 2015 from Pharmaxis. (biospace.com)
  • The structures of complexes of the copper-containing amine oxidase from A. globiformis with benzylhydrazine and tranylcypromine have been refined at 1.86 and 1.65 Å resolution, respectively. (iucr.org)
  • Polyamines (PAs) are oxidatively deaminated at their primary or secondary amino-groups by copper-containing amine oxidases (CuAOs) or FAD-dependent amine oxidases (PAOs), respectively. (beds.ac.uk)
  • The requirement for copper is absolute for their activity. (environmental-expert.com)
  • Under copper-limiting conditions, disruption of ctr4+, ctr5+, and cuf1+ produced a defect in amine oxidase activity, indicating that a functionally active Cao1 requires Ctr4/5-mediated copper transport and the transcription factor Cuf1. (environmental-expert.com)
  • Likewise, atx1 null cells exhibited substantially decreased levels of amine oxidase activity. (environmental-expert.com)
  • Residual amine oxidase activity in cells lacking atx1+ can be restored to normal levels by returning an atx1+ allele, underscoring the critical importance of the presence of Atx1 in cells. (environmental-expert.com)
  • All of the haplotype variants of LOXL1 (141R-153G, 141R-153D, 141L-153G, and 141L-153D) showed β-aminopropionitrile-inhibitable amine oxidase activity toward elastin, type I collagen, and cadaverine, indicating that each LOXL1 variant functions as an amine oxidase. (molvis.org)
  • The R141L and G153D variations in the NH 2 -terminal region of LOXL1 do not affect the amine oxidase activity of LOXL1. (molvis.org)
  • Cytochrome oxidase activity, however, was greatly reduced in some cells and almost normal in others. (springer.com)
  • Amine oxidase activity was only slightly reduced when compared to that of normal. (springer.com)
  • We found no activity for phenol oxidase and peroxidase, but the greatest activities for cellulases on the seventh day. (biomedsearch.com)
  • The amine oxidase preparation was stable at -18[degrees]C and there was no detectable loss of activity in 6 months at this temperature. (thefreedictionary.com)
  • A highly conserved amino acid sequence at the C-terminus end appears to be sufficient for amine oxidase activity, suggesting that each family member may retain this function. (wikipedia.org)
  • a very low or zero activity was registered towards other studied amines. (kirj.ee)
  • ROS are produced by cell wall-associated peroxidases, apoplastic diamine and polyamine oxidases, plasma membrane (PM) NADPH oxidase, and oxidases and peroxidases in mitochondria, chloroplasts, and peroxisomes ( Mahalingam and Fedoroff, 2003 ). (plantphysiol.org)
  • Quantitative lipid profiles indicated increased polyunsaturation of fatty acids on thylakoid membrane digalactosyldiglycerides, indicating a global impact of copper deficiency on the photosynthetic apparatus. (plantcell.org)
  • Discovery of a putative plastid copper chaperone and a membrane protease in the thylakoid suggest a mechanism for blocking copper utilization in the chloroplast. (plantcell.org)
  • Following deposition onto microfibrils tropoelastin is insolubilized via extensive crosslinking by members of the lysyl oxidase and lysyl oxidase like family of copper-dependent amine oxidases into amorphous elastin, a highly resilient, insoluble polymer that is metabolically stable over a human lifespan. (wikipedia.org)
  • Synthetic models of the inactive copper(II)-tyrosinate and active copper(II)-tyrosyl radical forms of galactose and glyoxal oxidases," Journal of the American Chemical Society , vol. 119, no. 35, pp. 8217-8227, 1997. (hindawi.com)
  • Cultured fibroblasts from patients with Wilson's disease showed moderately reduced succinate dehydrogenase and cytochrome oxidase activities. (springer.com)
  • Butcher, R. G., Diengdoh, J. V. & Chayen, J. (1964) A study of the histochemical demonstration of cytochrome oxidase. (springer.com)
  • The surface chemistry of the prepared AC was modified by introducing or blocking certain functional groups, and the role of the different functional groups involved in the copper uptake was investigated. (environmental-expert.com)
  • 10. Buffoni, F. & Ignesti, G. The copper-containing amine oxidases: Biochemical aspects and functional role. (kirj.ee)
  • 2020. Mutation of Arabidopsis copper-containing amine oxidase gene AtCuAOδ alters polyamines, reduces gibberellin content and affects development . (cardiff.ac.uk)