UreohydrolasesAllantoin: A urea hydantoin that is found in URINE and PLANTS and is used in dermatological preparations.Databases, Protein: Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.Internet: A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.User-Computer Interface: The portion of an interactive computer program that issues messages to and receives commands from a user.Software: Sequential operating programs and data which instruct the functioning of a digital computer.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Sequence Analysis, Protein: A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.AmidohydrolasesComputational Biology: A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.Diuron: A pre-emergent herbicide.Herbicides: Pesticides used to destroy unwanted vegetation, especially various types of weeds, grasses (POACEAE), and woody plants. Some plants develop HERBICIDE RESISTANCE.Linuron: A selective pre- and post-emergence herbicide. (From Merck Index, 11th ed)Phenylurea Compounds: Compounds that include the amino-N-phenylamide structure.Comamonadaceae: A family of gram-negative aerobic bacteria in the class BETA PROTEOBACTERIA, encompassing the acidovorans rRNA complex. Some species are pathogenic for PLANTS.Methylurea Compounds: Urea compounds which are substituted with one or more methyl groups.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Hydrolases: Any member of the class of enzymes that catalyze the cleavage of the substrate and the addition of water to the resulting molecules, e.g., ESTERASES, glycosidases (GLYCOSIDE HYDROLASES), lipases, NUCLEOTIDASES, peptidases (PEPTIDE HYDROLASES), and phosphatases (PHOSPHORIC MONOESTER HYDROLASES). EC 3.Glutamine: A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.Methionyl Aminopeptidases: Aminopeptidases that remove METHIONINE from the amino-terminus of a peptide chain, such as the initiator METHIONINE found on nascent peptide chains.Proline: A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.Aminoacyltransferases: Enzymes that catalyze the transfer of an aminoacyl group from donor to acceptor resulting in the formation of an ester or amide linkage. EC 2.3.2.Glutamate-Ammonia Ligase: An enzyme that catalyzes the conversion of ATP, L-glutamate, and NH3 to ADP, orthophosphate, and L-glutamine. It also acts more slowly on 4-methylene-L-glutamate. (From Enzyme Nomenclature, 1992) EC 6.3.1.2.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.RNA, Transfer, Arg: A transfer RNA which is specific for carrying arginine to sites on the ribosomes in preparation for protein synthesis.Pseudomonas aeruginosa: A species of gram-negative, aerobic, rod-shaped bacteria commonly isolated from clinical specimens (wound, burn, and urinary tract infections). It is also found widely distributed in soil and water. P. aeruginosa is a major agent of nosocomial infection.PolyaminesAminohydrolasesTrifluoroacetic Acid: A very strong halogenated derivative of acetic acid. It is used in acid catalyzed reactions, especially those where an ester is cleaved in peptide synthesis.Fluoroacetates: Derivatives of acetic acid with one or more fluorines attached. They are almost odorless, difficult to detect chemically, and very stable. The acid itself, as well as the derivatives that are broken down in the body to the acid, are highly toxic substances, behaving as convulsant poisons with a delayed action. (From Miall's Dictionary of Chemistry, 5th ed)Oxidoreductases Acting on CH-NH Group Donors: Enzymes catalyzing the dehydrogenation of secondary amines, introducing a C=N double bond as the primary reaction. In some cases this is later hydrolyzed.Pseudomonas Infections: Infections with bacteria of the genus PSEUDOMONAS.Hydroxamic Acids: A class of weak acids with the general formula R-CONHOH.Sarcina: A genus of gram-positive, anaerobic bacteria whose organisms divide in three perpendicular planes and occur in packets of eight or more cells. It has been isolated from soil, grains, and clinical specimens.Penicillins: A group of antibiotics that contain 6-aminopenicillanic acid with a side chain attached to the 6-amino group. The penicillin nucleus is the chief structural requirement for biological activity. The side-chain structure determines many of the antibacterial and pharmacological characteristics. (Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed, p1065)Penicillin G: A penicillin derivative commonly used in the form of its sodium or potassium salts in the treatment of a variety of infections. It is effective against most gram-positive bacteria and against gram-negative cocci. It has also been used as an experimental convulsant because of its actions on GAMMA-AMINOBUTYRIC ACID mediated synaptic transmission.Bacillus megaterium: A species of bacteria whose spores vary from round to elongate. It is a common soil saprophyte.HydrocarbonsPenicillin V: A broad-spectrum penicillin antibiotic used orally in the treatment of mild to moderate infections by susceptible gram-positive organisms.Efficiency: Ratio of output to effort, or the ratio of effort produced to energy expended.Penicillin Resistance: Nonsusceptibility of an organism to the action of penicillins.GTP Cyclohydrolase: (GTP cyclohydrolase I) or GTP 7,8-8,9-dihydrolase (pyrophosphate-forming) (GTP cyclohydrolase II). An enzyme group that hydrolyzes the imidazole ring of GTP, releasing carbon-8 as formate. Two C-N bonds are hydrolyzed and the pentase unit is isomerized. This is the first step in the synthesis of folic acid from GTP. EC 3.5.4.16 (GTP cyclohydrolase I) and EC 3.5.4.25 (GTP cyclohydrolase II).Riboflavin: Nutritional factor found in milk, eggs, malted barley, liver, kidney, heart, and leafy vegetables. The richest natural source is yeast. It occurs in the free form only in the retina of the eye, in whey, and in urine; its principal forms in tissues and cells are as FLAVIN MONONUCLEOTIDE and FLAVIN-ADENINE DINUCLEOTIDE.Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)AmidinesBiopterin: A natural product that has been considered as a growth factor for some insects.Pterins: Compounds based on 2-amino-4-hydroxypteridine.Pteridines: Compounds based on pyrazino[2,3-d]pyrimidine which is a pyrimidine fused to a pyrazine, containing four NITROGEN atoms.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Methenyltetrahydrofolate Cyclohydrolase: An aminohydrolase that catalyzes the hydrolysis of 5,10-methenyltetrahydrofolate to 10-formyltetrahydrofolate. In most higher eucaryotic organisms this enzyme also includes METHYLENETETRAHYDROFOLATE DEHYDROGENASE (NADP) and FORMATE-TETRAHYDROFOLATE LIGASE activities.

Reduced pyrazinamidase activity and the natural resistance of Mycobacterium kansasii to the antituberculosis drug pyrazinamide. (1/2620)

Pyrazinamide (PZA), an analog of nicotinamide, is a prodrug that requires conversion to the bactericidal compound pyrazinoic acid (POA) by the bacterial pyrazinamidase (PZase) activity of nicotinamidase to show activity against Mycobacterium tuberculosis. Mutations leading to a loss of PZase activity cause PZA resistance in M. tuberculosis. M. kansasii is naturally resistant to PZA and has reduced PZase activity along with an apparently detectable nicotinamidase activity. The role of the reduction in PZase activity in the natural PZA resistance of M. kansasii is unknown. The MICs of PZA and POA for M. kansasii were determined to be 500 and 125 micrograms/ml, respectively. Using [14C]PZA and [14C]nicotinamide, we found that M. kansasii had about 5-fold-less PZase activity and about 25-fold-less nicotinamidase activity than M. tuberculosis. The M. kansasii pncA gene was cloned on a 1.8-kb BamHI DNA fragment, using M. avium pncA probe. Sequence analysis showed that the M. kansasii pncA gene encoded a protein with homology to its counterparts from M. tuberculosis (69.9%), M. avium (65.6%), and Escherichia coli (28.5%). Transformation of naturally PZA-resistant M. bovis BCG with M. kansasii pncA conferred partial PZA susceptibility. Transformation of M. kansasii with M. avium pncA caused functional expression of PZase and high-level susceptibility to PZA, indicating that the natural PZA resistance in M. kansasii results from a reduced PZase activity. Like M. tuberculosis, M. kansasii accumulated POA in the cells at an acidic pH; however, due to its highly active POA efflux pump, the naturally PZA-resistant species M. smegmatis did not. These findings suggest the existence of a weak POA efflux mechanism in M. kansasii.  (+info)

Thermostability reinforcement through a combination of thermostability-related mutations of N-carbamyl-D-amino acid amidohydrolase. (2/2620)

For the improvement of N-carbamyl-D-amino acid amidohydrolase (DCase), which can be used for the industrial production of D-amino acids, the stability of DCase from Agrobacterium sp. KNK712 was improved through various combinations of thermostability-related mutations. The thermostable temperature (defined as the temperature on heat treatment for 10 min that caused a decrease in the DCase activity of 50%) of the enzyme which had three amino acids, H57Y, P203E, and V236A, replaced was increased by about 19 degrees C. The mutant DCase, designated as 455M, was purified and its enzymatic properties were studied. The enzyme had highly increased stability against not only temperature but also pH, the optimal temperature of the enzyme being about 75 degrees C. The substrate specificity of the enzyme for various N-carbamyl-D-amino acids was changed little in comparison with that of the native enzyme. Enzymochemical parameters were also measured.  (+info)

Insertion analysis of putative functional elements in the promoter region of the Aspergillus oryzae Taka-amylase A gene (amyB) using a heterologous Aspergillus nidulans amdS-lacZ fusion gene system. (3/2620)

Expression of the Taka-amylase A gene (amyB) of Aspergillus oryzae is induced by starch or maltose. The A. oryzae amyB gene promoter contains three highly conserved sequences, designated Regions I, II, and III, compared with promoter regions of the A. oryzae glaA encoding glucoamylase and the agdA encoding alpha-glucosidase. To identify the function of these sequences within the amyB promoter, various fragments containing conserved sequences in the amyB promoter were introduced into the upstream region of the heterologous A. nidulans amdS gene (encoding acetamidase) fused to the Escherichia coli lacZ gene as a reporter. Introduction of the sequence between -290 to -233 (the number indicates the distance in base pairs from the translation initiation point (+1)) containing Region III significantly increased the expression of the lacZ reporter gene in the presence of maltose. The sequence between -377 to -290 containing Region I also increased the lacZ activity, but its maltose inducibility was less than that of Region III. The sequence between -233 to -181 containing Region II had no effect on the expression. These results indicated that Region III is most likely involved in the maltose induction of the amyB gene expression.  (+info)

Human biotinidase isn't just for recycling biotin. (4/2620)

For years, the major role of biotin has been as the coenzyme for four carboxylases in humans. Although there has been evidence that biotin might have other functions, none has been firmly established. The discovery that human serum biotinidase has biotinyl-transferase activity, in addition to biotinidase hydrolase activity, presents new possibilities for the role of biotinidase in biotin metabolism. Specific transfer of biotin to histones by biotinidase provides a possible explanation for why biotin is found in the nucleus and the nature of its role in the regulation of protein transcription. Future studies will help to determine the functions of biotinidase in biotin metabolism and in disease states.  (+info)

IAR3 encodes an auxin conjugate hydrolase from Arabidopsis. (5/2620)

Amide-linked conjugates of indole-3-acetic acid (IAA) are putative storage or inactivation forms of the growth hormone auxin. Here, we describe the Arabidopsis iar3 mutant that displays reduced sensitivity to IAA-Ala. IAR3 is a member of a family of Arabidopsis genes related to the previously isolated ILR1 gene, which encodes an IAA-amino acid hydrolase selective for IAA-Leu and IAA-Phe. IAR3 and the very similar ILL5 gene are closely linked on chromosome 1 and comprise a subfamily of the six Arabidopsis IAA-conjugate hydrolases. The purified IAR3 enzyme hydrolyzes IAA-Ala in vitro. iar 3 ilr1 double mutants are more resistant than either single mutant to IAA-amino acid conjugates, and plants overexpressing IAR3 or ILR1 are more sensitive than is the wild type to certain IAA-amino acid conjugates, reflecting the overlapping substrate specificities of the corresponding enzymes. The IAR3 gene is expressed most strongly in roots, stems, and flowers, suggesting roles for IAA-conjugate hydrolysis in those tissues.  (+info)

Characterization of a novel rat brain glycosylphosphatidylinositol-anchored protein (Kilon), a member of the IgLON cell adhesion molecule family. (6/2620)

In the central nervous system, many cell adhesion molecules are known to participate in the establishment and remodeling of the neural circuit. Some of the cell adhesion molecules are known to be anchored to the membrane by the glycosylphosphatidylinositol (GPI) inserted to their C termini, and many GPI-anchored proteins are known to be localized in a Triton-insoluble membrane fraction of low density or so-called "raft." In this study, we surveyed the GPI-anchored proteins in the Triton-insoluble low density fraction from 2-week-old rat brain by solubilization with phosphatidylinositol-specific phospholipase C. By Western blotting and partial peptide sequencing after the deglycosylation with peptide N-glycosidase F, the presence of Thy-1, F3/contactin, and T-cadherin was shown. In addition, one of the major proteins, having an apparent molecular mass of 36 kDa after the peptide N-glycosidase F digestion, was found to be a novel protein. The result of cDNA cloning showed that the protein is an immunoglobulin superfamily member with three C2 domains and has six putative glycosylation sites. Since this protein shows high sequence similarity to IgLON family members including LAMP, OBCAM, neurotrimin, CEPU-1, AvGP50, and GP55, we termed this protein Kilon (a kindred of IgLON). Kilon-specific monoclonal antibodies were produced, and Western blotting analysis showed that expression of Kilon is restricted to brain, and Kilon has an apparent molecular mass of 46 kDa in SDS-polyacrylamide gel electrophoresis in its expressed form. In brain, the expression of Kilon is already detected in E16 stage, and its level gradually increases during development. Kilon immunostaining was observed in the cerebral cortex and hippocampus, in which the strongly stained puncta were observed on dendrites and soma of pyramidal neurons.  (+info)

Evidence for the existence of an unfolding intermediate state for aminoacylase during denaturation in guanidine solutions. (7/2620)

The equilibrium unfolding of pig kidney aminoacylase in guanidinium chloride (GdmCl) solutions was studied by following the fluorescence and circular dichroism (CD). At low concentrations of GdmCl, less than 1.0 M, the fluorescence intensity decreased with a slight red shift of the emission maximum (from 335 to 340 nm). An unfolding intermediate was observed in low concentrations of denaturant (between 1.2 and 1.6 M GdmCl). This intermediate was characterized by a decreased fluorescence emission intensity, a red-shifted emission maximum, and increased binding of the fluorescence probe 1-anilino-8-naphthalenesulfonate. No significant changes of the secondary structure were indicated by CD measurement. This conformation state is similar to a molten globule state which may exist in the pathway of protein folding. Further changes in the fluorescence properties occurred at higher concentrations of GdmCl, more than 1.6 M, with a decrease in emission intensity and a significant red shift of the emission maximum from 340 to 354 nm. In this stage, the secondary structure was completely broken. A study of apo-enzyme (Zn2+-free enzyme) produced similar results. However, comparison of the changes of the fluorescence emission spectra of native (Holo-) enzyme with Zn2+-free (Apo-) enzyme at low GdmCl concentrations showed that the structure of the Holo-enzyme was more stable than that of the Apo-enzyme.  (+info)

Processing of the fibrillin-1 carboxyl-terminal domain. (8/2620)

To investigate the processing and general properties of the fibrillin-1 carboxyl-terminal domain, three protein expression constructs have been developed as follows: one without the domain, one with the domain, and one with a mutation near the putative proteolytic processing site. The constructs have been expressed in two eukaryotic model systems, baculoviral and CHO-K1. Post-translational modifications that normally occur in fibrillin-1, including glycosylation, signal peptide cleavage, and carboxyl-terminal processing, occur in the three constructs in both cell systems. Amino-terminal sequencing of secreted protein revealed leader sequence processing at two sites, a primary site between Gly-24/Ala-25 and a secondary site of Ala-27/Asn-28. Processing of the carboxyl-terminal domain could be observed by migration differences in SDS-polyacrylamide gel electrophoresis and was evident in both mammalian and insect cells. Immunological identification by Western blotting confirmed the loss of the expected region. The failure of both cell systems to process the mutant construct shows that the multi-basic sequence is the site of proteolytic processing. Cleavage of the fibrillin-1 carboxyl-terminal domain occurred intracellularly in CHO-K1 cells in an early secretory pathway compartment as demonstrated by studies with secretion blocking agents. This finding, taken with the multi-basic nature of the cleavage site and observed calcium sensitivity of cleavage, suggests that the processing enzyme is a secretory pathway resident furin-like protease.  (+info)

*Amidohydrolase

Amidohydrolases (or amidases) are a type of hydrolase that acts upon amide bonds. They are categorized under EC number EC 3.5.1 ... Aminohydrolases Amidohydrolases at the US National Library of Medicine Medical Subject Headings (MeSH) CRISP Thesaurus 00000306 ... dead link] Amidohydrolase Overview from the EFI[permanent dead link] Molecular and Cellular Biology portal. ... and 3.5.2. Examples include: Beta-lactamase Histone deacetylase Urease The amidohydrolase superfamily is a large protein family ...

*Biuret amidohydrolase

In enzymology, a biuret amidohydrolase (EC 3.5.1.84) is an enzyme that catalyzes the chemical reaction biuret + H2O ⇌ {\ ... The systematic name of this enzyme class is biuret amidohydrolase. This enzyme participates in atrazine degradation. Cook AM, ...

*Maleamate amidohydrolase

... (EC 3.5.1.107, NicF) is an enzyme with systematic name maleamate amidohydrolase. This enzyme catalyses ... CS1 maint: Multiple names: authors list (link) Maleamate amidohydrolase at the US National Library of Medicine Medical Subject ...

*Cyanuric acid amidohydrolase

In enzymology, a cyanuric acid amidohydrolase (EC 3.5.2.15) is an enzyme that catalyzes the chemical reaction cyanuric acid + ... The systematic name of this enzyme class is cyanuric acid amidohydrolase. This enzyme participates in atrazine degradation. ... "Cloning and comparison of the DNA encoding ammelide aminohydrolase and cyanuric acid amidohydrolase from three s-triazine- ...

*Peroxyureidoacrylate/ureidoacrylate amidohydrolase

... (EC 3.5.1.110, RutB) is an enzyme with systematic name (Z)-3-ureidoacrylate ... Peroxyureidoacrylate/ureidoacrylate amidohydrolase at the US National Library of Medicine Medical Subject Headings (MeSH) ... peracid amidohydrolase. This enzyme catalyses the following chemical reaction sequences: (Z)-3-ureidoacrylate peracid + H2O ⇌ ( ...

*N-(long-chain-acyl)ethanolamine deacylase

The systematic name of this enzyme class is N-(long-chain-acyl)ethanolamine amidohydrolase. Other names in common use include N ... Schmid PC, Zuzarte-Augustin ML, Schmid HH (1985). "Properties of rat liver N-acylethanolamine amidohydrolase". J. Biol. Chem. ...

*CHAP domain

The domain is named after the acronym cysteine, histidine-dependent amidohydrolases/peptidases. Many of these proteins are ... L-glutamate-specific amidohydrolases". Trends Biochem. Sci. 28 (5): 230-4. doi:10.1016/s0968-0004(03)00062-8. PMID 12765833. ...

*N-carbamoyl-D-amino acid hydrolase

Ogawa J, Shimizu S, Yamada H (1993). "N-carbamoyl-D-amino acid amidohydrolase from Comamonas sp. E222c purification and ...

*Creatininase

Yamamoto K, Oka M, Kikuchi T, Emi S (1995). "Cloning of the creatinine amidohydrolase gene from Pseudomonas sp. PS-7". Biosci. ... Creatininase is a member of the urease-related amidohydrolases, the family of hydrolases, those acting on carbon-nitrogen bonds ... The systematic name of this enzyme class is creatinine amidohydrolase. This enzyme is also called creatinine hydrolase. This ... PDB: 3NO4​; Joint Center for Structural Genomics (2010). "Crystal structure of a creatinine amidohydrolase (Npun_F1913) from ...

*N4-(beta-N-acetylglucosaminyl)-L-asparaginase

L-asparagine amidohydrolase) is an enzyme with systematic name N4-(beta-N-acetyl-D-glucosaminyl)-L-asparagine amidohydrolase. ... Mahadevan, S.; Tappel, A.L. (1967). "β-Aspartylglucosylamine amido hydrolase of rat liver and kidney". J. Biol. Chem. 242 (20 ... Tarentino, A.L.; Maley, F. (1969). "The purification and properties of a β-aspartyl N-acetylglucosylamine amidohydrolase from ... "Purification and properties of 4-L-aspartylglycosylamine amidohydrolase from hog kidney". Biochim. Biophys. Acta. 258 (2): 600- ...

*Glutathionylspermidine amidase

This enzyme is also called glutathionylspermidine amidohydrolase (spermidine-forming). This enzyme participates in glutathione ...

*N-formylglutamate deformylase

The systematic name of this enzyme class is N-formyl-L-glutamate amidohydrolase. Other names in common use include beta-citryl- ... Hu L, Mulfinger LM, Phillips AT (1987). "Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida ... beta-citryl-L-glutamate amidohydrolase, beta-citryl-L-glutamate amidase, beta-citrylglutamate amidase, and beta-citryl-L- ...

*Acylagmatine amidase

The systematic name of this enzyme class is benzoylagmatine amidohydrolase. Other names in common use include acylagmatine ... Hydrolysis of bleomycin B2 by a Fusarium acylagmatine amidohydrolase". J. Antibiot. 26 (2): 117-119. doi:10.7164/antibiotics. ... amidohydrolase, and acylagmatine deacylase. Takita T; Takahashi, Y; Fujii, A; Saino, T; Shirai, T (1974). "Preparation of ...

*ASAH1

"Entrez Gene: ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1". Zhou, J.; Tawk, M.; Tiziano, F. D.; Veillet, J.; ...

*Barbiturase

... (EC 3.5.2.1) is a zinc containing amidohydrolase. Its systemic name is barbiturate amidohydrolase (3-oxo-3- ... Although grouped into the naturally existing amidohydrolases, it demonstrates more homology with cyanuric acid amidohydrolase. ... Unlike other zinc containing amidohydrolases, the zinc binding motif of barbiturase is found on the carboxylic acid terminus, ... Soong, C.L.; Ogawa, J.; Sakuradani, E.; Shimizu, S. (2002). "Barbiturase, a novel zinc-containing amidohydrolase involved in ...

*ASAHL

"Entrez Gene: ASAHL N-acylsphingosine amidohydrolase (acid ceramidase)-like". Human NAAA genome location and NAAA gene details ...

*Urease

... s (EC 3.5.1.5), functionally, belong to the superfamily of amidohydrolases and phosphotriesterases. It is an enzyme that ... unification of a broad set of amidohydrolases related to urease". Proteins. 28 (1): 72-82. doi:10.1002/(SICI)1097-0134(199705) ...

*D-glutaminase

The systematic name of this enzyme class is D-glutamine amidohydrolase. This enzyme participates in d-glutamine and d-glutamate ... Domnas A; Catimo EC (1965). "The behavior of amidohydrolases and L-glutamate in synchronized populations of Blastocladiella ...

*ASAH2

"Entrez Gene: ASAH2 N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2". Human ASAH2 genome location and ASAH2 gene ...

*Pentanamidase

The systematic name of this enzyme class is pentanamide amidohydrolase. This enzyme is also called valeramidase. Friedich CG; ...

*Amidase

The systematic name of this enzyme class is acylamide amidohydrolase. Other names in common use include acylamidase, acylase, ... In enzymology, an amidase (EC 3.5.1.4, acylamidase, acylase (misleading), amidohydrolase (ambiguous), deaminase (ambiguous), ... amidohydrolase, deaminase, fatty acylamidase, and N-acetylaminohydrolase. This enzyme participates in 6 metabolic pathways: ...

*Nicotinamide-nucleotide amidase

The systematic name of this enzyme class is nicotinamide-D-ribonucleotide amidohydrolase. Other names in common use include NMN ... Imai T (January 1973). "Purification and properties of nicotinamide mononucleotide amidohydrolase from Azotobacter vinelandii ... deamidase, nicotinamide mononucleotide deamidase, and nicotinamide mononucleotide amidohydrolase. This enzyme participates in ...

*Chenodeoxycholoyltaurine hydrolase

The systematic name of this enzyme class is chenodeoxycholoyltaurine amidohydrolase. This enzyme participates in bile acid ...

*N-carbamoylputrescine amidase

The systematic name of this enzyme class is N-carbamoylputrescine amidohydrolase. Other names in common use include ... Yanagisawa H; Suzuki Y (1982). "Preparation and properties of N-carbamylputrescine amidohydrolase from maize shoots". ...

*Penicillin amidase

The systematic name of this enzyme class is penicillin amidohydrolase. Other names in common use include penicillin acylase, ...
The mechanism of inactivation of human enzyme N-acylethanolamine-hydrolyzing acid amidase (hNAAA), with selected inhibitors identified in a novel fluorescent based assay developed for characterization of both reversible and irreversible inhibitors, was investigated kinetically and using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). 1-Isothiocyanatopentadecane (AM9023) was found to be a potent, selective and reversible hNAAA inhibitor, while two others, 5-((biphenyl-4-yl)methyl)-N,N-dimethyl-2H-tetrazole-2-carboxamide (AM6701) and N-Benzyloxycarbonyl-L-serine β-lactone (N-Cbz-serine β-lactone), inhibited hNAAA in a covalent and irreversible manner. MS analysis of the hNAAA/covalent inhibitor complexes identified modification only of the N-terminal cysteine (Cys126) of the β-subunit, confirming a suggested mechanism of hNAAA inactivation by the β-lactone containing inhibitors. These experiments provide direct evidence of the key role of Cys126 in hNAAA
Goat Polyclonal Anti-ASAHL/N-acylethanolamine-hydrolyzing Acid Amidase Antibody. Validated: WB, IP. Tested Reactivity: Mouse. 100% Guaranteed.
Hu X, Xu X, Zhu G, Atzler D, Kimoto M, Chen J, Schwedhelm E, Lüneburg N, Böger RH, Zhang P, et al. Vascular endothelial-specific dimethylarginine dimethylaminohydrolase-1- deficient mice reveal that vascular endothelium plays an important role in removing asymmetric dimethylarginine. Circulation [Internet]. 2009;(22):2222-2229.
MALDI-TOF MS analysis of the human NAAA zymogen (47.7 kDa) treated with peptide-N-glycosidase F (PNGase F) identified 4 glycosylation sites, and acid cleavage of the zymogen into alpha- and beta-subunits (14.6 and 33.3 kDa) activated the enzyme ...
Results: To elucidate the role of acetylpolyamines and their enzymatic deacetylation in more detail, all three putative acetylpolyamine amidohydrolases (APAHs) from P. aeruginosa have been expressed in enzymatic active form. The APAHs PA0321 and PA1409 are shown to be true polyamine deacetylases, whereas PA3774 is not able to deacetylate acetylated polyamines. Every APAH can hydrolyze trifluoroacetylated lysine-derivatives, but only PA1409 and much more efficiently PA3774 can also process the plain acetylated lysine substrate. P. aeruginosa is able to utilize acetylcad ... mehraverine and acetylputrescine as a carbon source under glucose starvation. If either the PA0321 or the PA1409 but not the PA3774 gene is disrupted, the growth of P. aeruginosa is reduced and delayed. In addition, we were able to show that the APAH inhibitors SAHA and SATFMK induce biofilm formation in both PA14 and PAO1 wildtype strains ...
Sphingolipid ceramide N-deacylase (SCDase) is derived from Pseudomonas and hydrolyzes the N-acyl linkage between fatty acids and sphingosine bases in ceramides of various sphingolipids. The enzyme also catalyzes the reverse reaction and possesses transacylation activity. SCDase acts on various acidic and neutral glycosphingolipids and sphingomyelin; however, it exhibits low activity with ceramides.. ...
Sphingolipid ceramide N-deacylase (SCDase) is derived from Pseudomonas and hydrolyzes the N-acyl linkage between fatty acids and sphingosine bases in ceramides of various sphingolipids. The enzyme also catalyzes the reverse reaction and possesses transacylation activity. SCDase acts on various acidic and neutral glycosphingolipids and sphingomyelin; however, it exhibits low activity with ceramides.. ...
A method for enhancing amidohydrolase activity of Fatty Acid Amide Hydrolase (FAAH) is disclosed. The method comprising administering a phenoxyacylethanolamide that causes the enhanced activity. The enhanced activity can have numerous effects on biological organisms including, for example, enhancing the growth of certain seedlings. The subject matter disclosed herein relates to enhancers of amidohydrolase activity.
Fatty acid amide hydrolase (FAAH) is responsible for hydrolysis of endocannabinoid, anandamide (AEA), and N-acyl ethanolamines such as palmitoylethanolamine (PEA) and N-oleoylethanolamide (OEA). Genetic deletion or pharmacological inactivation of FAAH shows site-specific elevation of AEA that plays a role in the modulation of pain and other neurodegenerative disorders. The review elaborates recent progress and current status of diverse structural classes of reversible and irreversible FAAH inhibitors. The discussion also addresses ligand-enzyme active site interactions and mechanism of enzyme inactivation, emerging approaches to novel FAAH inhibitors, and ongoing efforts to address gaps in therapeutic utility of FAAH inhibitors.
As a member of the transient receptor potential (TRP) ion channel superfamily, the ligand-gated ion channel TRPA1 has been implicated in nociceptive function and pain states. The endogenous ligands that activate TRPA1 remain unknown. However, various agonists have been identified, including environmental irritants (e.g., acrolein) and ingredients of pungent natural products [e.g., allyl isothiocyanate (ITC), cinnamaldehyde, allicin, and gingerol]. In general, these agents are either highly reactive, nonselective, or not potent or efficacious, significantly limiting their utilities in the study of TRPA1 channel properties and biological functions. In a search for novel TRPA1 agonists, we identified 3 -carbamoylbiphenyl-3-yl cyclohexylcarbamate (URB597), a potent and systemically active inhibitor of fatty acid amide hydrolase (FAAH). This enzyme is responsible for anandamide degradation and therefore has been pursued as an antinociceptive and antiepileptic drug target. Using Ca influx assays and patch
Background Recent data have indicated that there may be a dysregulation of endocannabinoid metabolism in cancer. Here we have investigated the expression of the endocannabinoid metabolising enzyme fatty acid amide hydrolase (FAAH) in a well characterised tissue microarray from patients diagnosed with prostate cancer at transurethral resection for voiding problems. Methodology/Principal Findings FAAH immunoreactivity (FAAH-IR) was assessed in formalin-fixed paraffin-embedded non-malignant and tumour cores from 412 patients with prostate cancer. CB1 receptor immunoreactivity (CB1IR) scores were available for this dataset. FAAH-IR was seen in epithelial cells and blood vessel walls but not in the stroma. Tumour epithelial FAAH-IR was positively correlated with the disease severity at diagnosis (Gleason score, tumour stage, % of the specimen that contained tumour) for cases with mid-range CB1IR scores, but not for those with high CB1IR scores. For the 281 cases who only received palliative therapy at the
This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008 ...
Helicobacter pylori Polysaccharide Deacetylase 兔多克隆抗体(ab93827)可与重组片段样本反应并经WB, ELISA实验严格验证。中国75%以上现货。
Hu X, Atzler D, Xu X, Zhang P, Guo H, Lu Z, Fassett J, Schwedhelm E, Böger RH, Bache RJ, et al. Dimethylarginine dimethylaminohydrolase-1 is the critical enzyme for degrading the cardiovascular risk factor asymmetrical dimethylarginine. Arteriosclerosis, Thrombosis, and Vascular Biology [Internet]. 2011;(7):1540-1546. 访问链接 SCI被引用次数:52 ...
Although genetically modified animals represent a useful tool for proof-of-principle studies, pharmacological agents are necessary to translate these observations into novel therapeutic approaches. Thus, we undertook equivalent in vivo studies in rats using a pharmacological inhibitor of DDAH. To pharmacologically mimic the effect of a DDAH1 heterozygous knockout mouse, a DDAH1 selective inhibitor is required. We therefore screened our DDAH inhibitor, L-257,39,42 against recombinantly expressed human DDAH1 and DDAH2 proteins. These experiments demonstrated that L-257 is at least 100-fold selective for DDAH1 over DDAH2. We further identified a key amino acid residue difference at position 129, which is a glycine in DDAH1 but a threonine in DDAH2, in an otherwise highly conserved region. Mutagenesis and modeling studies revealed that L-257 was unable to inhibit the G129T mutant, suggesting this single-residue difference is a key determinant of DDAH isoform selectivity.. Using our DDAH1 selective ...
Amides/chemistry/pharmacology, Amidohydrolases/antagonists & inhibitors/chemistry/metabolism, Amines/chemistry/pharmacology, Animals, Arachidonic Acids/metabolism, Binding Sites, Drug Design, Endocannabinoids/*chemistry/*metabolism/pharmacology, Esters/chemistry/pharmacology, Ethers/chemistry/pharmacology, Glycerides/metabolism, Humans, Ligands, Monoacylglycerol Lipases/metabolism, Polyunsaturated Alkamides, Receptors; Cannabinoid/chemistry/drug effects ...
Here we demonstrate that DDAH1 caused 2 separate effects that resulted in increased NO production, HUVEC tube formation, proliferation, and migration: an increase in p-AktSer473 and a decrease in ADMA. Selective gene silencing of DDAH1 with siRNA decreased endothelial p-AktSer473, increased ADMA, decreased NO production, and decreased HUVEC proliferation and tube formation, whereas overexpression of caAkt rescued HUVEC from these changes induced by DDAH1 knockdown. Global DDAH1 KO decreased aortic p-AktSer47 content and endothelial sprouting from aortic rings, whereas overexpression of either caAkt or DDAH1 rescued endothelial sprouting. Taken together, the data demonstrate that DDAH1 enhances endothelial cell function by regulating both the endogenous NOS inhibitors and Akt activity, as summarized in Figure 7D.. The importance of DDAH in ADMA degradation and regulation of NO production has long been recognized,1,10 but the cellular distribution of DDAH1 and its physiological significance have ...
Hydrolyzes N(G),N(G)-dimethyl-L-arginine (ADMA) and N(G)-monomethyl-L-arginine (MMA) which act as inhibitors of NOS. Has therefore a role in the regulation of nitric oxide generation.
To answer this question, Robertos lab teamed up with Roberto Ciccocioppos lab at the University of Camerino, Italy, and the lab of TSRI Professor Loren Parsons, a leader in the fields of endocannabinoid signaling, stress and drug addiction who passed away in 2016.. The researchers studied rats that were genetically selected for higher alcohol drinking and also display an anxiety-like phenotype. These rats exhibit a mutation in a gene called Crhr1 that increases CRF (type 1) receptor signaling.. Using behavioral, neurochemical and electrophysiological approaches, the researchers found that increased CRF signaling led to elevated activity of the anandamide clearance enzyme fatty acid amide hydrolase (FAAH). Increased CRF was also associated with drops in anandamide levels in the central nucleus of the amygdala.. Together, increased FAAH activity and decreased anandamide signaling reduce inhibitory control of excitatory neurotransmission in this critical region, and lower the brains ability to ...
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
MicroRNA (miRNA) disorder is associated with a variety of human being illnesses, including malignancy. miR-671-5p lead in a change from epithelial-to-mesenchymal changeover (EMT) to mesenchymal-to-epithelial changeover (MET) phenotypes in MDA-MB-231 breasts malignancy cells and caused S-phase police arrest. Furthermore, miR-671-5p sensitive breasts malignancy cells to cisplatin, 5-fluorouracil (5-FU) and epirubicin publicity. Host cell reactivation (HCR) assays demonstrated that miR-671-5p decreases DNA restoration ability in post-drug revealed breasts malignancy cells. cDNA microarray data exposed that differentially indicated genetics when miR-671-5p was transfected are linked with cell growth, breach, cell routine, and EMT. These data suggest that miR-671-5p features as a growth suppressor miRNA in breasts cancer tumor by straight concentrating on FOXM1. Therefore, miR-671-5p might serve as a new therapeutic focus on for breasts cancer tumor administration. (DCIS), and culminates in the ...
MicroRNA (miRNA) disorder is associated with a variety of human being illnesses, including malignancy. miR-671-5p lead in a change from epithelial-to-mesenchymal changeover (EMT) to mesenchymal-to-epithelial changeover (MET) phenotypes in MDA-MB-231 breasts malignancy cells and caused S-phase police arrest. Furthermore, miR-671-5p sensitive breasts malignancy cells to cisplatin, 5-fluorouracil (5-FU) and epirubicin publicity. Host cell reactivation (HCR) assays demonstrated that miR-671-5p decreases DNA restoration ability in post-drug revealed breasts malignancy cells. cDNA microarray data exposed that differentially indicated genetics when miR-671-5p was transfected are linked with cell growth, breach, cell routine, and EMT. These data suggest that miR-671-5p features as a growth suppressor miRNA in breasts cancer tumor by straight concentrating on FOXM1. Therefore, miR-671-5p might serve as a new therapeutic focus on for breasts cancer tumor administration. (DCIS), and culminates in the ...
Fatty acid amide hydrolase (FAAH) terminates the endocannabinoid signaling pathway that regulates numerous neurobehavioral processes in animals by hydrolyzing a class of lipid mediators, N-acylethanolamines (NAEs). Recent identification of an Arabidopsis FAAH homologue (AtFAAH) and several studies, especially those using AtFAAH overexpressing and knock-out lines suggest that a FAAH-mediated pathway exists in plants for the metabolism of endogenous NAEs. Here, I provide evidence to support this concept by identifying candidate FAAH cDNA sequences in diverse plant species. NAE amidohydrolase assays confirmed that several of the proteins encoded by these cDNAs indeed catalyzed the hydrolysis of NAEs in vitro. Kinetic parameters, inhibition properties, and substrate specificities of the plant FAAH enzymes were very similar to those of mammalian FAAH. Five amino acid residues determined to be important for catalysis by rat FAAH were absolutely conserved within the plant FAAH sequences. Site-directed mutation
In the DDAH transgenic animals, we observed a 10% increase in basal heart rate. The increase in heart rate may reflect a heightened sympathetic tone, activated in response to the reduction in vascular resistance. The increase in heart rate is balanced by a 10% reduction in stroke volume, so that cardiac output does not change. The reduction in stroke volume may be attributable to the shortened time for diastolic filling of the heart. Increased compliance of the venous bed, secondary to increased venous NOS activity, may also contribute to the reduction in diastolic filling.. Alternatively, the increase in heart rate may be compensating for a reduction in ventricular contractility. NO at submillimolar levels is known to reduce myocardial contractility.36-38 In patients with heart failure, activation of inducible NOS can have significant effects on left ventricular systolic and diastolic function.39,40 However, the effect of the constitutive forms of NOS on ventricular function are much more ...
Thank you for your interest in spreading the word about Science Translational Medicine.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
The endogenous cannabinoid (endocannabinoid) system plays an important role in fear-conditioned analgesia (FCA) and expression and extinction of conditioned fear. The hippocampus has an established role in both pain and ...
Amidases catalyse the hydrolysis of amides to the corresponding carboxylic acid and ammonia. They exist in all kingdoms of the living world but have been most extensively characterised amongst the bacteria.. A number of studies of amidase classification (10.1016/S0167-4838(96)00145-8)(10.1046/j.1365-2672.2001.01378.x)(10.1186/gb-2001-2-1-reviews0001) have revealed that the bacterial aliphatic amidases (broadly classed as acylamide amidohydrolase, EC 3.5.1.4) are made up of two types.. The first group, the nitrilase-related family, includes the aliphatic amidases, hydrolysing only short-chain aliphatic amides (10.1046/j.1365-2672.2001.01378.x). The enzymes are typically homohexamers of approximately 230kDa, and contain a Cys166 residue (Pseudomonas aeruginosa amidase numbering), conserved across both nitrilase and amidase. This residue is believed to act as the catalytic nucleophile. The amidases from P. aeruginosa (10.1016/0014-5793(87)80163-1)(10.1016/j.ijbiomac.2003.08.002[c/ite], Rhodococcus ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
TrendTerms displays relevant terms of the abstract of this publication and related documents on a map. The terms and their relations were extracted from ZORA using word statistics. Their timelines are taken from ZORA as well. The bubble size of a term is proportional to the number of documents where the term occurs. Red, orange, yellow and green colors are used for terms that occur in the current document; red indicates high interlinkedness of a term with other terms, orange, yellow and green decreasing interlinkedness. Blue is used for terms that have a relation with the terms in this document, but occur in other documents ...
Angiotensin-converting enzyme inhibitors (ACEIs) are the main reason behind angioedema (AE) induced by medications. painful and asymmetrical. There is certainly neither pruritus nor urticaria. A localized love from the intestines can 1159824-67-5 manufacture be done but it generally affects the facial skin the tongue and all of those other 1159824-67-5 manufacture ear nasal area and …Read More. ...
This invention relates to the crystal structure of a plant peptide deformylase polypeptide and methods of using the structure to design compounds that modulate the activity of the polypeptide.
Definition of N-succinylglutamate desuccinylase with photos and pictures, translations, sample usage, and additional links for more information.
Gentaur molecular products has all kinds of products like :search , Ray Biotech \ Recombinant Human Aminoacylase-1 \ 228-10024-2 for more molecular products just contact us
Shop N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase ELISA Kit, Recombinant Protein and N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
RefSeq Summary (NM_013974): This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF070667.1, AF087894.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025083 [ECO:0000348] ##Evidence-Data-END# ...
Complete information for FAAH2 gene (Protein Coding), Fatty Acid Amide Hydrolase 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
1H70: Structural Insights Into the Hydrolysis of Cellular Nitric Oxide Synthase Inhibitors by Dimethylarginine Dimethylaminohydrolase
ENGINEERED NITRILE HYDRATASE-PRODUCING BACTERIUM WITH AMIDASE GENE KOUCKED-OUT, THE CONSTRUCTION AND THE USE THEREOF - An engineered nitrile hydratase-producing bacterium and its construction method as well as its applications, wherein the engineered nitrile hydratase-producing bacterium is a mutant strain of an original nitrile hydratase-producing bacterium strain obtained by knocking-out or inhibiting the amidase gene in the original strain. The construction method of the engineered bacterium is to block the expression of the amidase gene by inserting the large fragment of a recombinant suicide plasmid carrying an amidase gene fragment into a wild-type strain through the homologous recombination between the recombinant suicide plasmid and the amidase gene of the wild-type strain. Compared to the corresponding wild-type bacterium strain, both the cell growth and the nitrile hydratase expression of the engineered nitrile hydratase-producing bacterium according to the invention are increased. In ...
Endocannabinoid signaling lipids bind to the cannabinoid receptor and modulate behaviors such as pain and cognition. Their activity is terminated when the lipids are degraded by the integral membrane protein fatty acid amide hydrolase (FAAH). Now Bracey et al. have determined the structure of FAAH bound to an inhibitor at 2.8-angstrom resolution. The structure is similar to soluble hydrolases in the same family, but key differences allow integration into membranes and create a binding pocket for the hydrophobic substrate. The active site is near the membrane surface and has direct access both to the lipid bilayer and the cytoplasm so that signaling lipids can enter the active site from the membrane and polar amine products could exit into the cytoplasm.. M. H. Bracey, M. A. Hanson, K. R. Masuda, R. C. Stevens, B. F. Cravatt, Structural adaptations in a membrane enzyme that terminates endocannabinoid signaling. Science 298, 1793-1796 (2002). [Abstract] [Full Text] ...
1IX1: Crystal structure of peptide deformylase from Staphylococcus aureus in complex with actinonin, a naturally occurring antibacterial agent
Sigma-Aldrich offers abstracts and full-text articles by [Yuanheng Cai, Peter Trodler, Shimin Jiang, Weiwen Zhang, Yan Wu, Yinhua Lu, Sheng Yang, Weihong Jiang].
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
FAAH antibody (fatty acid amide hydrolase) for IHC-P, WB. Anti-FAAH pAb (GTX55611) is tested in Human, Mouse, Rat samples. 100% Ab-Assurance.
Removes the formyl group from the N-terminal Met of newly synthesized proteins. Requires at least a dipeptide for an efficient rate of reaction. N-terminal L-methionine is a prerequisite for activity but the enzyme has broad specificity at other positions.
Human mitochondrial peptide deformylase (PDF) has been proposed as a novel cancer therapeutic target. However, very little is known about its expression and regulation in human tissues. The purpose of this study was to characterize the expression pattern of PDF in cancerous tissues and to identify mechanisms that regulate its expression. The mRNA expression levels of PDF and methionine aminopeptidase 1D (MAP1D), an enzyme involved in a related pathway with PDF, were determined using tissue panels containing cDNA from patients with various types of cancer (breast, colon, kidney, liver, lung, ovarian, prostate, or thyroid) and human cell lines. Protein levels of PDF were also determined in 2 colon cancer patients via western blotting. Colon cancer cells were treated with inhibitors of ERK, Akt, and mTOR signaling pathways and the resulting effects on PDF and MAP1D mRNA levels were determined by qPCR for colon and lung cancer cell lines. Finally, the effects of a PDF inhibitor, actinonin, on the
Close The Infona portal uses cookies, i.e. strings of text saved by a browser on the users device. The portal can access those files and use them to remember the users data, such as their chosen settings (screen view, interface language, etc.), or their login data. By using the Infona portal the user accepts automatic saving and using this information for portal operation purposes. More information on the subject can be found in the Privacy Policy and Terms of Service. By closing this window the user confirms that they have read the information on cookie usage, and they accept the privacy policy and the way cookies are used by the portal. You can change the cookie settings in your browser. ...
A new paper out of a group in Ireland, led by Drs. Susan Joyce and Cormac Gahan, has found a link between the bacterial enzyme bile salt hydrolase (BSH) and host lipid metabolism. Prior to this study, the authors had outlined the role of BSH, an enzyme limited to species of intestinal microbiota, in gut flora survival - this enzyme is an essential reaction in the metabolism of bile acids, allowing the microbes to tolerate bile, which is crucial to the digestion of fats. BSH activity is often associated with the bacteria used as probiotics for humans and animals, and is considered to be the contributing factor for their survival in the intestines. The authors took their characterization of BSH one step further by using mice to test the effect of BSH on microbe-mediated host lipid metabolism ...
An American study published its findings on the growth-promoting effect of antibiotic growth promoters (AGPs) was correlated with the decreased activity of bile salt hydrolase (BSH), an intestinal bacteria-produced enzyme that exerts negative impact on host fat digestion and utilisation.
Gentaur molecular products has all kinds of products like :search , ARP \ Antigens DDAH1, 1-285aa, Human, His tag, E.coli, Recombinant \ 01-DDAH-1 for more molecular products just contact us
It doesnвt matter too much if a small blood clot is left in the eye, but it does matter if there cymbalat still active bleeding into the eye at the end of the operation. The always tired cymbalta Alwways 32 пAcR5b with the higher specific amidohydrolase activity (0.
This patent search tool allows you not only to search the PCT database of about 2 million International Applications but also the worldwide patent collections. This search facility features: flexible search syntax; automatic word stemming and relevance ranking; as well as graphical results.
Ok it isnt going to get much better than this. 9600GT - \0 However it is AMIR so up front its still \0 :( http://www.ncix.com/products/index.p...
Among the biological activities of the endocannabinoid anandamide (N-arachidonoylethanolamine) (AEA), growing interest has been attracted by the regulation of mammalian fertility. Recently we have shown that treatment of mouse primary Sertoli cells with FSH enhances the activity of the AEA hydrolase [fatty acid amide hydrolase (FAAH)], though the molecular details were not elucidated. Here, we investigated whether FSH was also able to affect the enzymes that synthesize AEA (N-acyltransferase and N-acyl-phosphatidylethanolamine- phospholipase D), the endogenous content of this endocannabinoid, and the level of the AEA-binding vanilloid receptor 1 (transient receptor potential channel vanilloid receptor subunit 1).Weshow thatFSHenhancedFAAH activity (up to 500% of the controls) and expression (up to 300%), leading to a marked reduction (down to15%) of AEA content. However N-acyltransferase and N-acyl-phosphatidyl- ethanolamine-phospholipase D activity, and transient receptor potential channel ...
BACKGROUND Nitric oxide (NO) plays an important part in lowering pulmonary vascular resistance after birth, and in persistent pulmonary hypertension of the newborn (PPHN), NO-mediated dilation is dysfunctional. The endogenous NO synthase inhibitor asymmetric dimethylarginine (ADMA) circulates in plasma, and its concentrations are elevated in certain cardiovascular diseases, including pulmonary hypertension. ADMA is metabolized by the enzyme dimethylarginine dimethylaminohydrolase (DDAH), the activity of which regulates ADMA concentrations and provides a mechanism for modulating NO synthase in vivo. We investigated the changes in expression and activity of the 2 isoforms of DDAH in lungs from newborn piglets both during normal development and in PPHN. METHODS AND RESULTS Using Western blotting, we showed that DDAHI expression did not change in the normal developing lung; however, DDAHII increased after birth and reached a peak at 1 day. This was reflected in an increase in total DDAH activity according
In this study, SNP rs1241321 in DDAH1 was found to be associated with a higher risk of type 2 diabetes independently of the plasma ADMA level. In addition, individuals with an AA genotype at rs1241321 appeared to be more insulin-sensitive when compared with AG/GG individuals. Over a median follow-up period of 28.2 months, AA genotype at rs1241321 was associated with better long-term clinical outcome in diabetic subgroup. In contrast, some SNPs of DDAH1, especially the rs1498373, might influence the plasma level of ADMA. However, with the exception of rs1241321, none of these SNPs or the plasma ADMA level was associated with type 2 diabetes, suggesting that the interaction of DDAH1 variants with type 2 diabetes may not be directly related to its enzymatic activity, i.e. not just simply mediated by the plasma ADMA level. We also identified a common haplotype H5 (GGCAGC) that was associated with reduced risk of type 2 diabetes.. It is well recognized that type 2 diabetes and its metabolic ...
This enzyme, along with EC 3.5.1.87 (N-carbamoyl-L-amino-acid hydrolase), EC 5.1.99.5 (hydantoin racemase) and hydantoinase, forms part of the reaction cascade known as the "hydantoinase process", which allows the total conversion of D,L-5-monosubstituted hydantoins into optically pure D- or L-amino acids [2]. It has strict stereospecificity for N-carbamoyl-D-amino acids and does not act upon the corresponding L-amino acids or on the N-formyl amino acids, N-carbamoyl-sarcosine, -citrulline, -allantoin and -ureidopropanoate, which are substrates for other amidohydrolases ...
Shop Germination-specific N-acetylmuramoyl-L-alanine amidase ELISA Kit, Recombinant Protein and Germination-specific N-acetylmuramoyl-L-alanine amidase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Mono- and Stereopictres of 5.0 Angstrom coordination sphere of Zinc atom in PDB 2v8v: Crystal Structure Of Mutant R322A of Beta-Alanine Synthase From Saccharomyces Kluyveri
Definition of Aspartoacylase deficiency in the Legal Dictionary - by Free online English dictionary and encyclopedia. What is Aspartoacylase deficiency? Meaning of Aspartoacylase deficiency as a legal term. What does Aspartoacylase deficiency mean in law?
Domain combinations containing the Peptide deformylase superfamily in Mycoplasma penetrans HF-2. Domain architectures illustrate each occurrence of the Peptide deformylase superfamily.
Role of arginine residues of D-aminoacylase from Alcaligenes xylosoxydans subsp. xylosoxydans A-6.: To investigate the role of arginine in the folding of d-amin
Fegley, D., Gaetani, S., Duranti, A., Tontini, A., Mor, M. and Tarzia, G. (2005) Characterization of the fatty acid amide hydrolase inhibitor cyclohexyl carbamic acid 3- carbamoyl-biphenyl-3-yl ester (URB597), effects on anandamide and oleoylethanolamide deactivation. Journal of Pharmacology & Experimental Therapeutics, 313, 352-358. doi10.1124/jpet.104.078980
Bacterial asparaginases (amidohydrolases, EC 3.5.1.1) are important enzymes in cancer therapy, especially for Acute Lymphoblastic Leukemia. They are tetrameric enzymes able to catalyze the deamination of L-ASN and, to a variable extent, of L-GLN, on which leukemia cells are dependent for survival. In contrast to other known L-asparaginases, Helicobacter pylori CCUG 17874 type II enzyme (HpASNase) is cooperative and has a low affinity towards L-GLN. In this study, some critical amino acids forming the active site of HpASNase (T16, T95 and E289) have been tackled by rational engineering in the attempt to better define their role in catalysis and to achieve a deeper understanding of the peculiar cooperative behavior of this enzyme. Mutations T16E, T95D and T95H led to a complete loss of enzymatic activity. Mutation E289A dramatically reduced the catalytic activity of the enzyme, but increased its thermostability. Interestingly, E289 belongs to a loop that is very variable in L-asparaginases from the
NRE 406/506- Soil Microbiology/Biochemistry. Research Interests. My interest focuses on the role of phytases, phosphatases, and amidohydrolases on the biogeochemical cycling nutrients in the environment, using and developing various analytical procedures and advanced instruments to understand mercury, arsenic and pesticides speciation in organic and inorganic production systems, use of 31-P NMR, FTIR, XANES, and EXAFS in the study of organic and inorganic phosphorus, carbon, and nitrogen in the environment, spatial distribution of nutrients, and composition, stability and interaction of humic substances in the environment, use of molecular techniques to characterize the microbial community structure and diversity of soil.. Research Activities. ...
TY - JOUR. T1 - Expression studies of Bacillus licheniformis chitin deacetylase in E. coli Rosetta cells. AU - Raval, Ritu. AU - Simsa, Robin. AU - Raval, Keyur. PY - 2017/11/1. Y1 - 2017/11/1. N2 - Chitin, the biopolymer of the N-acetylglucosamine, is the most abundant biopolymer on the planet after cellulose. However owing to its crystalline nature, its deacetylated derivative; chitosan is industrially more potent. This conversion on an enzymatic scale can be made using chitin deacetylase. The metagenomics library constructed from the soil exposed to chitin and chitosan yielded chitin modifying enzymes, one of them being chitin deacetylase (CDA) utilized for the present study. The gene was amplified and expressed using the pET 22b vector in E. coli Rosetta cells. The effect of two additives; chitin and glycerol on the CDA activity were studied. The inclusion of glycerol in the medium improved the biomass by 50% from the initial value of 1.25 g/l to 2.5 g/l. The activity of CDA increased from ...
Clostridium difficile is a Gram-positive, anaerobic, spore-forming bacterium that causes infections in the gastrointestinal tract. The mechanisms by which C. difficile is able to germinate in such a toxic environment are not fully understood. However, our lab and others have shown that certain bile components have the capacity to induce C. difficile spore germination and affect growth of C. difficile cells. Interestingly, C. difficile encodes a bile salt hydrolase (cholylglycine hydrolase), but it is unknown how this affects the bacteriums ability to grow in the presence of bile acids. This research project is centered around the goal of inserting a mutation into the C. difficile bile salt hydrolase. This will be completed using the TargeTron Gene Knockout System, which inserts group II introns into a specific DNA location, and allelic-coupled exchange. Successful completion of this project would allow further investigation into the relationship between C. difficiles bile salt hydrolase ...
Summary: A mutation in a gene designated gmdA has been found to lead to loss of ability of Aspergillus nidulans to use benzamide, phenylacetamide and several other amides as sole nitrogen sources for growth. The gmdAI lesion results in low levels of an enzyme, called the general amidase, which has activity for a wide range of amide substrates. This enzyme is repressed by certain nitrogen-containing metabolites, including ammonium, but is probably not regulated by induction or by carbon catabolite repression. Evidence is presented for the general amidase being distinct from the previously characterized acetamidase and formamidase enzymes. The data also indicate that there is a fourth amidase capable of the hydrolysis of valeramide and hexanamide.
AB - BackgroundDimethylarginine dimethylaminohydrolase 2 (DDAH2) regulates the synthesis of nitric oxide (NO) through the metabolism of the endogenous inhibitor of nitric oxide synthase, asymmetric dimethylarginine (ADMA). Pilot studies have associated the rs805305 SNP of DDAH2 with ADMA concentrations in sepsis. This study explored the impact of the rs805305 polymorphism on DDAH activity and outcome in septic shock.MethodsWe undertook a secondary analysis of data and samples collected during the Vasopressin versus noradrenaline as initial therapy in septic shock (VANISH) trial. Plasma and DNA samples isolated from 286 patients recruited into the VANISH trial were analysed. Concentrations of L-Arginine and the methylarginines ADMA and symmetric dimethylarginine (SDMA) were determined from plasma samples. Whole blood and buffy-coat samples were genotyped for polymorphisms of DDAH2. Clinical data collected during the study were used to explore the relationship between circulating methylarginines, ...
Unscramble acetanilid, Unscramble letters acetanilid, Point value for acetanilid, Word Decoder for acetanilid, Word generator using the letters acetanilid, Word Solver acetanilid, Possible Scrabble words with acetanilid, Anagram of acetanilid
Accepted name: peptide deformylase. Reaction: formyl-L-methionyl peptide + H2O = formate + methionyl peptide. Systematic name: formyl-L-methionyl peptide amidohydrolase. Comments: Requires Fe(II). Also requires at least a dipeptide for an efficient rate of reaction. N-terminal L-methionine is a prerequisite for activity but the enzyme has broad specificity at other positions. Differs in substrate specifity from EC 3.5.1.27 (N-formylmethionylaminoacyl-tRNA deformylase) and EC 3.5.1.31 (formylmethionine deformylase).. Links to other databases: BRENDA, EXPASY, KEGG, Metacyc, PDB, CAS registry number: 369636-51-1. References:. 1. Adams, J.M. On the release of the formyl group from nascent protein. J. Mol. Biol. 33 (1968) 571-589. [PMID: 4973445]. 2. Mazel, D., Pochet, S. and Marliere, P. Genetic characterization of polypeptide deformylase, a distinctive enzyme of eubacterial translation. EMBO J. 13 (1994) 914-923. [PMID: 8112305]. 3. Chan, M.K., Gong, W., Rajagopalan, P.T.R., Hao, B., Tsai, C.M. and ...
NDST2 overexpression lysate, 0.1 mg. Transient overexpression lysate of N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 (NDST2)
In enzymology, an amidase (EC 3.5.1.4, acylamidase, acylase (misleading), amidohydrolase (ambiguous), deaminase (ambiguous), fatty acylamidase, N-acetylaminohydrolase (ambiguous)) is an enzyme that catalyzes the hydrolysis of an amide: Thus, the two substrates of this enzyme are monocarboxylic acid amide and H2O, whereas its two products are monocarboxylate and NH3. This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically in linear amides. The systematic name of this enzyme class is acylamide amidohydrolase. Other names in common use include acylamidase, acylase, amidohydrolase, deaminase, fatty acylamidase, and N-acetylaminohydrolase. This enzyme participates in 6 metabolic pathways: urea cycle and metabolism of amino groups, phenylalanine metabolism, tryptophan metabolism, cyanoamino acid metabolism, benzoate degradation via coa ligation, and styrene degradation. Amidases contain a conserved stretch of approximately 130 amino ...
The main finding in this study is that in essential hypertensives the endogenous inhibitor of e-NOS ADMA is inversely related to endothelial function as measured by the peak hemodynamic response to ACh. Such relationship occurs in a range of ADMA values within the boundaries of the normal range. A companion, unexpected, finding in this study is that circulating L-arginine is directly related to plasma ADMA and, like plasma ADMA, it is inversely related to endothelial function.. The importance of ADMA as an endogenous inhibitor of e-NOS is now well established (26-28). Elegant studies in healthy volunteers convincingly demonstrated that intravenous ADMA infusion at a dose resulting in pathophysiological concentrations augments peripheral and renovascular resistance and arterial pressure (22). High plasma ADMA concentration was observed in the presence of traditional or emerging cardiovascular risk factors (e.g., hyperhomocysteinemia) (18-21,29), inducing endothelial dysfunction in some of these ...
A recent study identified FAAH as a critical molecule involved in mood control in humans, showing that carriers of an FAAH gene mutation with reduced enzyme activity had both decreased threat-related brain reactivity and reduced anxiety (Hariri et al., 2009). These findings are particularly relevant because they allow generalizing to humans the results of the existing literature on the antianxiety effects of reduced FAAH activity in rodents. Both genetic and pharmacological inactivation of FAAH, in fact, exerts anxiolytic and antidepressant actions in rodents (Kathuria et al., 2003; Gobbi et al., 2005; Patel and Hillard, 2006; Bortolato et al., 2007; Hill et al., 2007; Naidu et al., 2007; Cippitelli et al., 2008; Moreira et al., 2008; Rubino et al., 2008; Scherma et al., 2008; Haller et al., 2009; Micale et al., 2009, and does not cause sedation, hypothermia, hyperphagia, or abuse potential (Fegley et al., 2005; Gobbi et al., 2005; Lichtman and Martin, 2005), which are important side effects of ...
China Acetic Acid Amide manufacturers - Select 2018 high quality Acetic Acid Amide products in best price from certified Chinese C Acid manufacturers, Amino Acid Powder suppliers, wholesalers and factory on Made-in-China.com
gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2008-07-11 #!Type DNA #!Source-version EMBOSS 6.0.0 PAAMIR EMBL databank_entry 1 2167 0.000 + . ID="PAAMIR.1";db_xref="taxon:287";organism="Pseudomonas aeruginosa";strain="PAC";isolate="PAC 1";map="38 min" PAAMIR EMBL CDS 1289 1879 0.000 + 0 ID="PAAMIR.2";db_xref="SWISS-PROT:P10932";note="aliphatic amidase regulator, positive regulator of amiE";transl_table=11;gene="amiR";protein_id="CAA32023.1";translation="MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA" PAAMIR EMBL CDS 135 1292 0.000 + 0 ID="PAAMIR.3";db_xref="SWISS-PROT:P27017";note="negative regulator of ...
X13776 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation G T A G R A S A R S P P A G R R E L H D F1 V P L A E H L L D H H Q P G D G N C T I F2 Y R W P S I C S I T T S R A T G T A R S F3 1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat 60 ----:----,----:----,----:----,----:----,----:----,----:----, 1 ccatggcgaccggctcgtagacgagctagtggtggtcggcccgctgcccttgacgtgcta 60 P V A P R A D A R D G G A P R R S S C S F6 X Y R Q G L M Q E I V V L R A V P V A R F5 T G S A S C R S S * W W G P S P F Q V I F4 L P G E P G A R A G S L R T A L S D S H F1 Y L A S L E H E R V R F V R R * A T V T F2 T W R A W S T S G F A S Y G A E R Q S Q F3 61 ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac 120 ----:----,----:----,----:----,----:----,----:----,----:----, 61 gatggaccgctcggacctcgtgctcgcccaagcgaagcatgccgcgactcgctgtcagtg 120 R G P S G P A R A P E S R V A S L S L * F6 D V Q R A Q L V L P N A E Y P A S R C D F5 * R A L R S C S R T R K T R R Q A V T V F4 R R G N G W D R T R S ...
The D-amino acid amidase-producing bacterium was isolated from soil samples using an enrichment culture technique in medium broth containing D-phenylalanine amide as a sole source of nitrogen. The strain exhibiting the strongest activity was identifi
Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidespoly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB (TIGR03938; EC 3.5.1.-; HMM-score: 110.6) ...
View details of Acetanilide import data and shipment reports in US with product description, price, date, quantity, major us ports, countries and buyer, supplier.
Amir Segev is the author of this article in the Journal of Visualized Experiments: Whole-cell Patch-clamp Recordings in Brain Slices
Visit Healthgrades for information on Dr. Amir Gerges, DO Find Phone & Address information, medical practice history, affiliated hospitals and more.
Visit Healthgrades for information on Dr. Amir Salimpour, DDS Find Phone & Address information, medical practice history, affiliated hospitals and more.
Amir Shabbir Mian MD is a Anesthesiologist who practices in Kingwood, TX. Get a full report about this doctors background by clicking here.
Amir M Emtiazjoo MD is a Pulmonologist who practices in Gainesville, FL. Get a full report about this doctors background by clicking here.
Buy high quality rac 2-Ethenyl-4,6-dimethoxy-benzoic Acid 1-Methyl-5-oxo-9-decen-1-yl Ester-d6 1246819-89-5 from toronto research chemicals Inc.
The use of an immobilized 3,6-dioxaoctanedioic amide substrate as stationary phase is described. This stationary phase is found to be more lipophilic than the usual amino phases, but less so than C8-a...
阿拉丁试剂提供各种甲草胺标准溶液、甲草胺 ;草甲胺,2-氯-N-(2,6-二乙基苯基)-N-(甲氧甲基)乙酰胺,α-氯代-2,6-二乙基-N-甲氧甲基乙酰替苯胺,杂草锁,草不绿,拉索,2-氯-N-(2,6-二乙基苯基)-N-(甲氧甲基)乙酰胺,杂草索 ;2-Chloro-2,6-diethyl-N-(methoxymethyl)acetanilide、15972-60-8,甲草胺标准溶液 价格,甲草胺标准溶液 msds/coa,甲草胺标准溶液 性质,甲草胺标准溶液 结构式,甲草胺标准溶液 化学
23:09 Tortferngatr 1. You need proper ability descriptions on each of your mons Check 23:09 amir (Vader) where do i get those 23:09 Tortferngatr The Data...
How is 7-Aminocephalosporanic Acid (chemical) abbreviated? 7-ACA stands for 7-Aminocephalosporanic Acid (chemical). 7-ACA is defined as 7-Aminocephalosporanic Acid (chemical) frequently.
... was first described in 1931 by Myrtelle Canavan.[3]. The discovery of the gene for Canavan disease, and subsequent events, generated considerable controversy. In 1987 the Greenbergs, a family with two children affected by Canavan disease, donated tissue samples to Dr Reuben Matalon, a researcher looking for the Canavan gene. He successfully identified the gene in 1993, and developed a test for it that would enable antenatal counselling of couples at risk of having a child with Canavan disease.[4] For a while the Canavan Foundation offered free genetic testing with the test. However, in 1997, Dr Matalons employer, the Miami Childrens Hospital, patented the gene and started claiming royalties on the genetic test, forcing the Canavan Foundation to withdraw their testing. A subsequent lawsuit brought by the Canavan Foundation against the Miami Childrens Hospital was resolved with a sealed out-of-court settlement. [5] The case is sometimes cited in arguments about the ...
Anandamide (arachidonoyl ethanolamide, AEA) and 2-arachidonoyl glycerol (2-AG) exert most of their actions by binding to cannabinoid receptors. The effects of the endocannabinoids are short-lived due to rapid cellular accumulation and metabolism, for AEA, primarily by the enzymes fatty acid amide hydrolase (FAAH). This has led to the hypothesis that by inhibition of the cellular processing of AEA, beneficial effects in conditions such as pain and inflammation can be enhanced. The overall aim of the present thesis has been to examine the mechanisms involved in the cellular processing of AEA and how they can be influenced pharmacologically by both synthetic natural compounds.. Liposomes, artificial membranes, were used in paper I to study the membrane retention of AEA. The AEA retention mimicked the early properties of AEA accumulation, such as temperature-dependency and saturability.. In paper II, FAAH was blocked by a selective inhibitor, URB597, and reduced the accumulation of AEA into RBL2H3 ...
Aspartylglucosaminidase (AGA) belongs to the N-terminal nucleophile (Ntn) hydrolase superfamily characterized by an N-terminal nucleophile as the catalytic residue. Three-dimensional structures of the Ntn hydrolases reveal a common folding pattern and equivalent stereochemistry at the active site. The activation of the precursor polypeptide occurs autocatalytically, and for some amidohydrolases of prokaryotes, the precursor structure is known and activation mechanisms are suggested. In humans, the deficient AGA activity results in a lysosomal storage disease, aspartylglucosaminuria (AGU) resulting in progressive neurodegeneration. Most of the disease-causing mutations lead to defective molecular maturation of AGA, and, to understand the structure-function relationship better, in the present study, we have analysed the effects of targeted amino acid substitutions on the activation process of human AGA. We have evaluated the effect of the previously published mutations and, in addition, nine novel ...
Title: The Role of NAD+ Dependent Histone Deacetylases (sirtuins) in Ageing. VOLUME: 7 ISSUE: 11. Author(s):Johannes Trapp. Keywords:protein deacetylation, transesterification, Resveratrol, sirtuin inhibitor, Splitomicin. Abstract: Histone deacetylases (HDACs) are enzymes that are able to deacetylate lysine side chains in histones and certain non-histone proteins which leads to altered states of conformation and activity for the proteins in question. Three classes of histone deacetylases have been recognized in humans. Class I and II are zinc-dependent amidohydrolases and eleven subtypes have been discovered (HDAC1-11). Class III enzymes depend in their catalysis on NAD+ and subsequently, O-acetyl ADP ribose and nicotinamide are formed as a consequence of the acetyl transfer. Due to the homology to the yeast histone deacetylase Sir2p the NAD+-dependent deacetylases are also termed sirtuins and seven members (Sirt1-7) are known in humans. Sirtuins are found from bacteria to eukaryotes and ...
Ureases (urea amidohydrolases; EC 3.5.1.5) are enzymes that catalyze the hydrolysis reaction of urea to ammonia and carbamate, which then decomposes through a spontaneous reaction of carbon dioxide in a second molecule of ammonia. These enzymes have been isolated from a wide variety of organisms including plants, fungi and bacteria [1, 2].. The urease extracted from Canavalia ensiformis seeds is one of the landmarks in the study of enzymes. It was the first enzyme to be crystallized, demonstrating that enzymes are proteins [3]. It was also the first one to be identified as a metalloenzyme containing nickel in its active site [4].. The classical urease, called jack bean urease (JBU), is composed of a polypeptide chain of 840 amino acid residues and has a molecular mass of 90 kDa. The minimum active form is a trimer of 270 kDa and it is often found in its native form as a hexamer of 540 kDa [5, 6]. The second isoform of jack bean urease, canatoxin (CNTX), was isolated from the seed and originally ...
7-Aminocephalosporanic acid wastewater usually contains high concentrations of ammonium (NH4+-N), which is known to inhibit nitrification during biological treatment processes. Chemical precipitation is a useful technology to remove ammonium from wastewater. In this paper, the removal of ammonium from 7-aminocephalosporanic acid wastewater was studied. The optimum pH, molar ratio, and various chemical compositions of magnesium ammonium phosphate (MAP) precipitation were investigated. The results indicated that ammonium in 7-aminocephalosporanic acid wastewater could be removed at an optimum pH of 9. The Mg2+:NH4+-N:PO43−-P molar ratio was readily controlled at a ratio of 1:1:1.1 to both effectively remove ammonium and avoid creating a higher concentration of PO43−-P in the effluent. MgCl2·6H2O + 85% H3PO4 was the most efficient combination for NH4+-N removal. Furthermore, the lowest concentration of the residual PO43−-P was obtained with the same combination. Struvite precipitation could be
Pyrazinamide is a first-line drug for treating tuberculosis, but pyrazinamide resistance testing is usually too slow to guide initial therapy, so some patients receive inappropriate therapy. We therefore aimed to optimize and evaluate a rapid molecular test for tuberculosis drug resistance to pyrazinamide. Tuberculosis polymerase chain reaction single strand conformational polymorphism (PCR-SSCP) was optimized to test for mutations causing pyrazinamide resistance directly from sputum samples and Mycobacterium tuberculosis isolates. The reliability of PCR-SSCP for sputum (n=65) and Mycobacterium tuberculosis isolates (n=185) from 147 patients was compared with four tests for pyrazinamide resistance: Bactec-460 automated-culture; the Wayne biochemical test; DNA sequencing for pncA mutations; and traditional microbiological broth culture. PCR-SSCP provided interpretable results for 96% (46/48) of microscopy-positive sputum samples, 76% (13/17) of microscopy-negative sputa and 100% of Mycobacterium ...
Biotinidase deficiency is an autosomal recessive metabolic disorder in which biotin is not released from proteins in the diet during digestion or from normal protein turnover in the cell. This situation results in biotin deficiency. Biotin, also called vitamin B7, is an important water-soluble nutrient that aids in the metabolism of fats, carbohydrates, and proteins. Biotin deficiency can result in behavioral disorders, lack of coordination, learning disabilities and seizures. Biotin supplementation can alleviate and sometimes totally stop such symptoms. Signs and symptoms of a biotinidase deficiency can appear several days after birth. These include seizures, hypotonia and muscle/limb weakness, ataxia, paresis, hearing loss, optic atrophy, skin rashes (including seborrheic dermatitis and psoriasis), and alopecia. If left untreated, the disorder can rapidly lead to coma and death. Biotinidase deficiency can also appear later in life. This is referred to as "late-onset" biotinidase deficiency. ...
Endogenous TRPV4 agonists. The potent activation of TRPV4 by 4αPDD fueled the search for possible endogenous TRPV4 agonists. Endocannabinoids are a class of endogenous lipids, including amides and esters of long-chain polyunsaturated fatty acids (15, 16, 45) that activate metabotropic cannabinoid receptors. The endocannabinoid anandamide (AEA) and the metabolite 12-hydroxyeicosatetraenoic acid are potent activators of TRPV1 (27, 72, 82, 104, 105). Recently, AEA and its metabolite arachidonic acid (AA) were found to cause a robust increase in intracellular Ca2+ and activate typical whole cell currents in TRPV4-expressing cells (96). AEA and the related endocannabinoid 2-arachydonyl glycerol (2-AG) (45) are transported into the cell through the action of a membrane transporter and degraded via a lipoxygenase. AEA is hydrolyzed to AA exclusively by fatty acid amidohydrolase (FAAH) (13, 15), whereas 2-AG can also be hydrolyzed through monoacylglycerol lipase and other esterases (84). ...
The month of May is designated as Tay-Sachs and Canavan Diseases Awareness Month. Newborns with Tay-Sachs disease appear healthy at birth, but then symptoms start to occur at 6 months. The infant will start to lose motor skills and mental functions. Soon after, they become blind, deaf, mentally retarded, paralyzed, non-responsive to their environment and will eventually die by the age of 5. Tay-Sachs disease is caused by a lack of an enzyme called Hexosaminidase A (Hex A), which is needed for the body to break down the fatty waste substances that are found in the brain cells. Without Hex A, this substance accumulates abnormally and causes gradual damage until the nervous system shuts down completely and can no longer sustain life.. Newborns with Canavan disease also appear healthy at birth. However, at the ages of 3 and 9 months, subtle changes will start to occur. These changes include visual inattentiveness, inability to grasp objects, roll over, or like Tay-Sachs disease, perform motor tasks. ...
Penicillin acylase (PAC, EC 3.5.1.11) is one of the most relevant enzymes in the pharmaceutical industry. It is used in the production of 6-amino penicillanic acid (6-APA), which is subsequently used in the chemical synthesis of new lactams with greater effectiveness. PACs belong to the N-terminal nucleophile hydrolase family, whose members undergo a complex maturation process. In this process, the pre-pro-protein is synthesized and translocated to the periplasm with the concomitant removal of the signal peptide. The resulting pro-protein is then autoproteolyzed in the periplasm rendering the β-subunit. A second autoproteolysis detaches the α-subunit and uncovers the active site by elimination of a spacer peptide [1]. The precision of the maturation process is extremely relevant for the functionality of the final heterodimeric protein (α- plus β-subunits).. Industrially, the penicillin G acylase (PGA) from Escherichia coli is the enzyme of choice, whether recombinant or native. Although the ...
2-Arachidonoylglycerol plays a major role in endocannabinoid signaling, and is tightly regulated by the monoacylglycerol lipase (MAGL). Here we report the crystal structure of human MAGL. The protein crystallizes as a dimer, and despite structural homologies to haloperoxidases and esterases, it distinguishes itself by a wide and hydrophobic access to the catalytic site. An apolar helix covering the active site also gives structural insight into the amphitropic character of MAGL, and likely explains how MAGL interacts with membranes to recruit its substrate. Docking of 2-arachidonoylglycerol highlights a hydrophobic and a hydrophilic cavity that accommodate the lipid into the catalytic site. Moreover, we identified Cys201 as the crucial residue in MAGL inhibition by N-arachidonylmaleimide, a sulfhydryl-reactive compound. Beside the advance in the knowledge of endocannabinoids degradation routes, the structure of MAGL paves the way for future medicinal chemistry works aimed at the design of new ...

Substrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosaSubstrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosa

... Krämer, Andreas; Herzer, Jan ... all three putative acetylpolyamine amidohydrolases (APAHs) from P. aeruginosa have been expressed in enzymatic active form. The ...
more infohttps://publikationen.bibliothek.kit.edu/1000062791

ASAHL/N-acylethanolamine-hydrolyzing Acid Amidase Antibody (AF4886): Novus BiologicalsASAHL/N-acylethanolamine-hydrolyzing Acid Amidase Antibody (AF4886): Novus Biologicals

NAAA can be distinguished from anandamide amidohydrolase by its lack of inhibition by methyl arachidonoyl fluorophosphonate (2 ...
more infohttps://www.novusbio.com/products/asahl-n-acylethanolamine-hydrolyzing-acid-amidase-antibody_af4886

Amidohydrolase dictionary definition | amidohydrolase definedAmidohydrolase dictionary definition | amidohydrolase defined

... plural amidohydrolases) 1. Any of a class of hydrolases that act upon amide bonds. ... ... amidohydrolase. Noun (countable and uncountable, plural amidohydrolases). *Any of a class of hydrolases that act upon amide ... How would you define amidohydrolase? Add your definition here.. Please enable JavaScript to view the comments powered by Disqus ...
more infohttp://www.yourdictionary.com/amidohydrolase

creatinine amidohydrolase (creatininase) protein [Rhizobium etli CFN 4 - Protein - NCBIcreatinine amidohydrolase (creatininase) protein [Rhizobium etli CFN 4 - Protein - NCBI

creatinine amidohydrolase (creatininase) protein [Rhizobium etli CFN 42]. * Record removed. The sequence YP_471106 is 100% ...
more infohttps://www.ncbi.nlm.nih.gov/protein/86359214

RCSB PDB - Protein Feature View 









 - Allantoate amidohydrolase - P77425 (ALLC ECOLI)RCSB PDB - Protein Feature View - Allantoate amidohydrolase - P77425 (ALLC ECOLI)

The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
more infohttp://www.rcsb.org/pdb/protein/P77425

WDYHV1 - Protein N-terminal glutamine amidohydrolase - Homo sapiens (Human) - WDYHV1 gene & proteinWDYHV1 - Protein N-terminal glutamine amidohydrolase - Homo sapiens (Human) - WDYHV1 gene & protein

Protein N-terminal glutamine amidohydrolase (EC:3.5.1.122By similarity. Manual assertion inferred from sequence similarity toi ... "Crystal structure of human protein N-terminal glutamine amidohydrolase, an initial component of the N-end rule pathway.". Park ... sp,Q96HA8,NTAQ1_HUMAN Protein N-terminal glutamine amidohydrolase OS=Homo sapiens OX=9606 GN=WDYHV1 PE=1 SV=2 ...
more infohttps://www.uniprot.org/uniprot/Q96HA8

Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida. | Journal of BacteriologyPurification and properties of formylglutamate amidohydrolase from Pseudomonas putida. | Journal of Bacteriology

Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida.. L Hu, L M Mulfinger, A T Phillips ... Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida. Message Subject (Your Name) has ...
more infohttps://jb.asm.org/content/169/10/4696/article-info

Amidohydrolase - WikipediaAmidohydrolase - Wikipedia

Amidohydrolases (or amidases) are a type of hydrolase that acts upon amide bonds. They are categorized under EC number EC 3.5.1 ... Aminohydrolases Amidohydrolases at the US National Library of Medicine Medical Subject Headings (MeSH) CRISP Thesaurus 00000306 ... dead link] Amidohydrolase Overview from the EFI[permanent dead link] Molecular and Cellular Biology portal. ... and 3.5.2. Examples include: Beta-lactamase Histone deacetylase Urease The amidohydrolase superfamily is a large protein family ...
more infohttps://en.wikipedia.org/wiki/Amidohydrolase

CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea.  - PubMed - NCBICbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea. - PubMed - NCBI

CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea.. Woodson JD1, Escalante ... CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea ... CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea ... CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/14990804

Biuret amidohydrolase - WikipediaBiuret amidohydrolase - Wikipedia

In enzymology, a biuret amidohydrolase (EC 3.5.1.84) is an enzyme that catalyzes the chemical reaction biuret + H2O ⇌ {\ ... The systematic name of this enzyme class is biuret amidohydrolase. This enzyme participates in atrazine degradation. Cook AM, ...
more infohttps://en.wikipedia.org/wiki/Biuret_amidohydrolase

AMDHD1 (amidohydrolase domain containing 1) - KOMP (Knockout Mouse Project)AMDHD1 (amidohydrolase domain containing 1) - KOMP (Knockout Mouse Project)

amidohydrolase domain containing 1. Synonyms: 1300019J08Rik. Gene nomenclature, locus information, and GO, OMIM, and PMID ...
more infohttps://www.komp.org/geneinfo.php?geneid=23203

Remediated Sequence 









- 1FO6: CRYSTAL STRUCTURE ANALYSIS OF N-CARBAMoYL-D-AMINO-ACID AMIDOHYDROLASE Sequence Report PageRemediated Sequence - 1FO6: CRYSTAL STRUCTURE ANALYSIS OF N-CARBAMoYL-D-AMINO-ACID AMIDOHYDROLASE Sequence Report Page

Crystal structure and site-directed mutagenesis studies of N-carbamoyl-D-amino-acid amidohydrolase from Agrobacterium ... Chain A: N-CARBAMoYL-D-AMINO-ACID AMIDOHYDROLASE. Chain Downloadable Files. Download FASTA File. View Sequence & DSSP Image. ...
more infohttp://www.rcsb.org/pdb/explore/remediatedSequence.do?structureId=1FO6

Allantoate amidohydrolase elisa and antibodyAllantoate amidohydrolase elisa and antibody

Recombinant Protein and Allantoate amidohydrolase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody ... Allantoate amidohydrolase. Allantoate amidohydrolase ELISA Kit. Allantoate amidohydrolase Recombinant. Allantoate ... Below are the list of possible Allantoate amidohydrolase products. If you cannot find the target and/or product is not ... Also known as Allantoate amidohydrolase (Allantoate deiminase).. Escherichia coli is able to utilize allantoin as a sole ...
more infohttps://www.mybiosource.com/protein_family.php?root=allantoate-amidohydrolase

Frontiers | Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the...Frontiers | Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the...

In the final reaction, N-carbamoylputrescine is hydrolyzed to putrescine by N-carbamoylputrescine amidohydrolase (CPA, EC 3.5. ... In the final reaction, N-carbamoylputrescine is hydrolyzed to putrescine by N-carbamoylputrescine amidohydrolase (CPA, EC 3.5. ... 2000). Crystal structure of N-carbamyl-D-amino acid amidohydrolase with a novel catalytic framework common to amidohydrolases. ... N-carbamoylputrescine amidohydrolase enzymes belong to nitrilases, and more precisely, to C-N hydrolases breaking non-peptide ...
more infohttps://www.frontiersin.org/articles/10.3389/fpls.2016.00350/full

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup | Biochemical JournalCharacterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup | Biochemical Journal

Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup. Jeevan L. Khurana, ... Sequence analysis showed that these enzymes belong to the metal-dependent amidohydrolase superfamily, although they contain a ... Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup ... Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup ...
more infohttp://www.biochemj.org/content/418/2/431

ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ...ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ...

By fusing GPB to the CHAP (cysteine, histidine-dependent amidohydrolase/peptidase) catalytic domain of the PlyC lysin, we ... ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ... ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ... CHAP, cysteine, histidine-dependent amidohydrolases/peptidases; PlyCA CHAP, the CHAP domain from PlyCA (amino acids 314 to 465 ...
more infohttps://aac.asm.org/content/63/4/e02043-18

Protein N-terminal glutamine amidohydrolaseProtein N-terminal glutamine amidohydrolase

Crystal structure of human protein N-terminal glutamine amidohydrolase, an initial component of the N-end rule pathway.. ...
more infohttps://pharos.nih.gov/idg/targets/Q96HA8

NAVER Academic | Penicillin amidohydrolase productivity of locally isolated bacterial speciesNAVER Academic | Penicillin amidohydrolase productivity of locally isolated bacterial species

Penicillin amidohydrolase productivity of four locally isolated bacterial species is described. Organisms were identified ... Penicillin amidohydrolase productivity of locally isolated bacterial species. Author. Z. A. Mahmood, D. Shaikh, S. M. S. Zoha. ... Penicillin amidohydrolase productivity of four locally isolated bacterial species is described. Organisms were identified ...
more infohttp://academic.naver.com/article.naver?doc_id=34670096

Substrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosa | BMC Biochemistry | Full TextSubstrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosa | BMC Biochemistry | Full Text

... all three putative acetylpolyamine amidohydrolases (APAHs) from P. aeruginosa have been expressed in enzymatic active form. The ... A new amidohydrolase from Bordetella or Alcaligenes strain FB188 with similarities to histone deacetylases. J Bacteriol. 2004; ... a Multiple Sequence Alignment of PA0321, PA1409 and PA3774 from P. aeruginosa, acetylpolyamine amidohydrolase APAH from M. ... 1a). Based on their sequence, PA0321 and PA1409 form a cluster with the verified functional acetylpolyamine amidohydrolase APAH ...
more infohttps://bmcbiochem.biomedcentral.com/articles/10.1186/s12858-016-0063-z

Probing the role Cysteine-150 in Maleamate Amidohydrolase (NicF) catal by Nicholas Spittle"Probing the role Cysteine-150 in Maleamate Amidohydrolase (NicF) catal" by Nicholas Spittle

The fifth step of this catabolic pathway involves hydrolytic deamidation of maleamate into maleate by maleamate amidohydrolase ... The fifth step of this catabolic pathway involves hydrolytic deamidation of maleamate into maleate by maleamate amidohydrolase ... Probing the role Cysteine-150 in Maleamate Amidohydrolase (NicF) catalysis from Bordetella bronchiseptica RB50 by site-directed ...
more infohttps://openworks.wooster.edu/independentstudy/393/

Gentaur Molecular :EIAab \ ELISA kit  ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa \ E2259pGentaur Molecular :EIAab \ ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa \ E2259p

N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa \ E2259p for more molecular products just contact us ... Product name : ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa ... E2259p ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa Ask technical file . ... We have also other products like : ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa. ...
more infohttp://www.antibody-antibodies.com/product2766120-search-ELISA_kit__ACY1,ACY_1,Aminoacylase_1,N_acyl_L_amino_acid_amidohydrolase,Pig,Sus_scrofa.html

Structural investigations of N-carbamoylputrescine amidohydrolase from Medicago truncatula: insights into the ultimate step of...Structural investigations of N-carbamoylputrescine amidohydrolase from Medicago truncatula: insights into the ultimate step of...

In the final reaction, N-carbamoylputrescine is hydrolyzed to putrescine by N-carbamoylputrescine amidohydrolase (CPA, EC 3.5. ... Structural investigations of N-carbamoylputrescine amidohydrolase from Medicago truncatula: insights into the ultimate step of ...
more infohttps://core.ac.uk/display/43835530

ASAH2B Gene - GeneCards | ASA2B Protein | ASA2B AntibodyASAH2B Gene - GeneCards | ASA2B Protein | ASA2B Antibody

N-Acylsphingosine Amidohydrolase 2B, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards ... ASAH2B (N-Acylsphingosine Amidohydrolase 2B) is a Protein Coding gene. Diseases associated with ASAH2B include Alzheimer ...
more infohttps://www.genecards.org/cgi-bin/carddisp.pl?gene=ASAH2B&keywords=GH10J050739&prefilter=genomic_location

Plus itPlus it

2003a) A molecular phylogenomic analysis of the ILR1-like family of IAA amidohydrolase genes. Comp Funct Genomics 4: 584-600. ... Auxin conjugate amidohydrolases create an evolutionary paradox: if bryophytes do not have active hydrolytic regulation of auxin ... Auxin Amidohydrolase Redundancy in Plantae. Although more recently evolved tracheophytes have multiple paralogues of the auxin ... 2009) X-ray structure of ILL2, an auxin-conjugate amidohydrolase from Arabidopsis thaliana. Proteins 74: 61-71. ...
more infohttp://www.plantphysiol.org/content/177/4/1595

GTP cyclohydrolase II - WikipediaGTP cyclohydrolase II - Wikipedia

Thus, the two substrates of this enzyme are GTP and H2O, whereas its 3 products are formate, 2,5-diamino-6-hydroxy-4-(5-phosphoribosylamino)pyrimidine, and diphosphate.. This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically in cyclic amidines. The systematic name of this enzyme class is GTP 7,8-8,9-dihydrolase (diphosphate-forming). Other names in common use include guanosine triphosphate cyclohydrolase II, and GTP-8-formylhydrolase. This enzyme participates in riboflavin metabolism.. ...
more infohttps://en.wikipedia.org/wiki/GTP_cyclohydrolase_II
  • By fusing GPB to the CHAP (cysteine, histidine-dependent amidohydrolase/peptidase) catalytic domain of the PlyC lysin, we constructed a novel chimeric lysin, ClyJ, with improved activity to the pneumococcal Cpl-1 lysin. (asm.org)
  • Inhibitor studies predicted the presence of an active-site cysteine, and bioinformatic analysis revealed a cysteine, histidine-dependent amidohydrolase/peptidase domain within PlyCA. (pnas.org)
  • amidohydrolase - am·i·do·hy·dro·lase (ə me″do ) (am″ĭ do hiґdro lās) systematic name for enzymes of the hydrolase class that catalyze the cleavage of carbon nitrogen bonds in linear [EC 3.5.or cyclic [EC 3.5.amide compounds. (enacademic.com)