OrganismsChemicals and DrugsPhenomena and ProcessesInformation Science
AmidohydrolasesUreohydrolasesAllantoinDatabases, ProteinInternetUser-Computer InterfaceSoftwareProteinsPolyunsaturated AlkamidesEndocannabinoidsReceptors, CannabinoidArachidonic AcidsPhenylmethylsulfonyl FluorideCannabinoidsDiuronHerbicidesLinuronPhenylurea CompoundsComamonadaceaeMethylurea CompoundsGlutamineMethionyl AminopeptidasesAmino Acid SequenceProlineAminoacyltransferasesMolecular Sequence DataGlutamate-Ammonia LigaseGTP CyclohydrolaseRiboflavinEncyclopedias as TopicAmidinesBiopterinPterinsAminohydrolasesPimelic AcidsDiaminopimelic AcidMedlinePlusLysineCarbonSarcinaPenicillinsPseudomonas aeruginosaPenicillin GBacillus megateriumHydrocarbons
Amidohydrolases
Ureohydrolases
Allantoin
A urea hydantoin that is found in URINE and PLANTS and is used in dermatological preparations.
Databases, Protein
Databases containing information about PROTEINS such as AMINO ACID SEQUENCE; PROTEIN CONFORMATION; and other properties.
Internet
A loose confederation of computer communication networks around the world. The networks that make up the Internet are connected through several backbone networks. The Internet grew out of the US Government ARPAnet project and was designed to facilitate information exchange.
User-Computer Interface
The portion of an interactive computer program that issues messages to and receives commands from a user.
Software
Sequential operating programs and data which instruct the functioning of a digital computer.
Proteins
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
Polyunsaturated Alkamides
Amides composed of unsaturated aliphatic FATTY ACIDS linked with AMINES by an amide bond. They are most prominent in ASTERACEAE; PIPERACEAE; and RUTACEAE; and also found in ARISTOLOCHIACEAE; BRASSICACEAE; CONVOLVULACEAE; EUPHORBIACEAE; MENISPERMACEAE; POACEAE; and SOLANACEAE. They are recognized by their pungent taste and for causing numbing and salivation.
Endocannabinoids
Fatty acid derivatives that have specificity for CANNABINOID RECEPTORS. They are structurally distinct from CANNABINOIDS and were originally discovered as a group of endogenous CANNABINOID RECEPTOR AGONISTS.
Receptors, Cannabinoid
A class of G-protein-coupled receptors that are specific for CANNABINOIDS such as those derived from CANNABIS. They also bind a structurally distinct class of endogenous factors referred to as ENDOCANNABINOIDS. The receptor class may play a role in modulating the release of signaling molecules such as NEUROTRANSMITTERS and CYTOKINES.
Arachidonic Acids
Phenylmethylsulfonyl Fluoride
An enzyme inhibitor that inactivates IRC-50 arvin, subtilisin, and the fatty acid synthetase complex.
Cannabinoids
Compounds having the cannabinoid structure. They were originally extracted from Cannabis sativa L. The most pharmacologically active constituents are TETRAHYDROCANNABINOL; CANNABINOL; and CANNABIDIOL.
Diuron
A pre-emergent herbicide.
Herbicides
Pesticides used to destroy unwanted vegetation, especially various types of weeds, grasses (POACEAE), and woody plants. Some plants develop HERBICIDE RESISTANCE.
Linuron
A selective pre- and post-emergence herbicide. (From Merck Index, 11th ed)
Phenylurea Compounds
Compounds that include the amino-N-phenylamide structure.
Comamonadaceae
A family of gram-negative aerobic bacteria in the class BETA PROTEOBACTERIA, encompassing the acidovorans rRNA complex. Some species are pathogenic for PLANTS.
Methylurea Compounds
Urea compounds which are substituted with one or more methyl groups.
Glutamine
A non-essential amino acid present abundantly throughout the body and is involved in many metabolic processes. It is synthesized from GLUTAMIC ACID and AMMONIA. It is the principal carrier of NITROGEN in the body and is an important energy source for many cells.
Methionyl Aminopeptidases
Aminopeptidases that remove METHIONINE from the amino-terminus of a peptide chain, such as the initiator METHIONINE found on nascent peptide chains.
Amino Acid Sequence
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Proline
A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.
Aminoacyltransferases
Enzymes that catalyze the transfer of an aminoacyl group from donor to acceptor resulting in the formation of an ester or amide linkage. EC 2.3.2.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Glutamate-Ammonia Ligase
An enzyme that catalyzes the conversion of ATP, L-glutamate, and NH3 to ADP, orthophosphate, and L-glutamine. It also acts more slowly on 4-methylene-L-glutamate. (From Enzyme Nomenclature, 1992) EC 6.3.1.2.
GTP Cyclohydrolase
(GTP cyclohydrolase I) or GTP 7,8-8,9-dihydrolase (pyrophosphate-forming) (GTP cyclohydrolase II). An enzyme group that hydrolyzes the imidazole ring of GTP, releasing carbon-8 as formate. Two C-N bonds are hydrolyzed and the pentase unit is isomerized. This is the first step in the synthesis of folic acid from GTP. EC 3.5.4.16 (GTP cyclohydrolase I) and EC 3.5.4.25 (GTP cyclohydrolase II).
Riboflavin
Nutritional factor found in milk, eggs, malted barley, liver, kidney, heart, and leafy vegetables. The richest natural source is yeast. It occurs in the free form only in the retina of the eye, in whey, and in urine; its principal forms in tissues and cells are as FLAVIN MONONUCLEOTIDE and FLAVIN-ADENINE DINUCLEOTIDE.
Encyclopedias as Topic
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Amidines
Biopterin
A natural product that has been considered as a growth factor for some insects.
Pterins
Compounds based on 2-amino-4-hydroxypteridine.
Aminohydrolases
Pimelic Acids
A group of compounds that are derivatives of heptanedioic acid with the general formula R-C7H11O4.
Diaminopimelic Acid
MedlinePlus
NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.
Lysine
An essential amino acid. It is often added to animal feed.
Carbon
A nonmetallic element with atomic symbol C, atomic number 6, and atomic weight [12.0096; 12.0116]. It may occur as several different allotropes including DIAMOND; CHARCOAL; and GRAPHITE; and as SOOT from incompletely burned fuel.
Sarcina
A genus of gram-positive, anaerobic bacteria whose organisms divide in three perpendicular planes and occur in packets of eight or more cells. It has been isolated from soil, grains, and clinical specimens.
Penicillins
A group of antibiotics that contain 6-aminopenicillanic acid with a side chain attached to the 6-amino group. The penicillin nucleus is the chief structural requirement for biological activity. The side-chain structure determines many of the antibacterial and pharmacological characteristics. (Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th ed, p1065)
Pseudomonas aeruginosa
A species of gram-negative, aerobic, rod-shaped bacteria commonly isolated from clinical specimens (wound, burn, and urinary tract infections). It is also found widely distributed in soil and water. P. aeruginosa is a major agent of nosocomial infection.
Penicillin G
A penicillin derivative commonly used in the form of its sodium or potassium salts in the treatment of a variety of infections. It is effective against most gram-positive bacteria and against gram-negative cocci. It has also been used as an experimental convulsant because of its actions on GAMMA-AMINOBUTYRIC ACID mediated synaptic transmission.
Bacillus megaterium
A species of bacteria whose spores vary from round to elongate. It is a common soil saprophyte.
Hydrocarbons

Reduced pyrazinamidase activity and the natural resistance of Mycobacterium kansasii to the antituberculosis drug pyrazinamide. (1/2620)

Pyrazinamide (PZA), an analog of nicotinamide, is a prodrug that requires conversion to the bactericidal compound pyrazinoic acid (POA) by the bacterial pyrazinamidase (PZase) activity of nicotinamidase to show activity against Mycobacterium tuberculosis. Mutations leading to a loss of PZase activity cause PZA resistance in M. tuberculosis. M. kansasii is naturally resistant to PZA and has reduced PZase activity along with an apparently detectable nicotinamidase activity. The role of the reduction in PZase activity in the natural PZA resistance of M. kansasii is unknown. The MICs of PZA and POA for M. kansasii were determined to be 500 and 125 micrograms/ml, respectively. Using [14C]PZA and [14C]nicotinamide, we found that M. kansasii had about 5-fold-less PZase activity and about 25-fold-less nicotinamidase activity than M. tuberculosis. The M. kansasii pncA gene was cloned on a 1.8-kb BamHI DNA fragment, using M. avium pncA probe. Sequence analysis showed that the M. kansasii pncA gene encoded a protein with homology to its counterparts from M. tuberculosis (69.9%), M. avium (65.6%), and Escherichia coli (28.5%). Transformation of naturally PZA-resistant M. bovis BCG with M. kansasii pncA conferred partial PZA susceptibility. Transformation of M. kansasii with M. avium pncA caused functional expression of PZase and high-level susceptibility to PZA, indicating that the natural PZA resistance in M. kansasii results from a reduced PZase activity. Like M. tuberculosis, M. kansasii accumulated POA in the cells at an acidic pH; however, due to its highly active POA efflux pump, the naturally PZA-resistant species M. smegmatis did not. These findings suggest the existence of a weak POA efflux mechanism in M. kansasii.  (+info)

Thermostability reinforcement through a combination of thermostability-related mutations of N-carbamyl-D-amino acid amidohydrolase. (2/2620)

For the improvement of N-carbamyl-D-amino acid amidohydrolase (DCase), which can be used for the industrial production of D-amino acids, the stability of DCase from Agrobacterium sp. KNK712 was improved through various combinations of thermostability-related mutations. The thermostable temperature (defined as the temperature on heat treatment for 10 min that caused a decrease in the DCase activity of 50%) of the enzyme which had three amino acids, H57Y, P203E, and V236A, replaced was increased by about 19 degrees C. The mutant DCase, designated as 455M, was purified and its enzymatic properties were studied. The enzyme had highly increased stability against not only temperature but also pH, the optimal temperature of the enzyme being about 75 degrees C. The substrate specificity of the enzyme for various N-carbamyl-D-amino acids was changed little in comparison with that of the native enzyme. Enzymochemical parameters were also measured.  (+info)

Insertion analysis of putative functional elements in the promoter region of the Aspergillus oryzae Taka-amylase A gene (amyB) using a heterologous Aspergillus nidulans amdS-lacZ fusion gene system. (3/2620)

Expression of the Taka-amylase A gene (amyB) of Aspergillus oryzae is induced by starch or maltose. The A. oryzae amyB gene promoter contains three highly conserved sequences, designated Regions I, II, and III, compared with promoter regions of the A. oryzae glaA encoding glucoamylase and the agdA encoding alpha-glucosidase. To identify the function of these sequences within the amyB promoter, various fragments containing conserved sequences in the amyB promoter were introduced into the upstream region of the heterologous A. nidulans amdS gene (encoding acetamidase) fused to the Escherichia coli lacZ gene as a reporter. Introduction of the sequence between -290 to -233 (the number indicates the distance in base pairs from the translation initiation point (+1)) containing Region III significantly increased the expression of the lacZ reporter gene in the presence of maltose. The sequence between -377 to -290 containing Region I also increased the lacZ activity, but its maltose inducibility was less than that of Region III. The sequence between -233 to -181 containing Region II had no effect on the expression. These results indicated that Region III is most likely involved in the maltose induction of the amyB gene expression.  (+info)

Human biotinidase isn't just for recycling biotin. (4/2620)

For years, the major role of biotin has been as the coenzyme for four carboxylases in humans. Although there has been evidence that biotin might have other functions, none has been firmly established. The discovery that human serum biotinidase has biotinyl-transferase activity, in addition to biotinidase hydrolase activity, presents new possibilities for the role of biotinidase in biotin metabolism. Specific transfer of biotin to histones by biotinidase provides a possible explanation for why biotin is found in the nucleus and the nature of its role in the regulation of protein transcription. Future studies will help to determine the functions of biotinidase in biotin metabolism and in disease states.  (+info)

IAR3 encodes an auxin conjugate hydrolase from Arabidopsis. (5/2620)

Amide-linked conjugates of indole-3-acetic acid (IAA) are putative storage or inactivation forms of the growth hormone auxin. Here, we describe the Arabidopsis iar3 mutant that displays reduced sensitivity to IAA-Ala. IAR3 is a member of a family of Arabidopsis genes related to the previously isolated ILR1 gene, which encodes an IAA-amino acid hydrolase selective for IAA-Leu and IAA-Phe. IAR3 and the very similar ILL5 gene are closely linked on chromosome 1 and comprise a subfamily of the six Arabidopsis IAA-conjugate hydrolases. The purified IAR3 enzyme hydrolyzes IAA-Ala in vitro. iar 3 ilr1 double mutants are more resistant than either single mutant to IAA-amino acid conjugates, and plants overexpressing IAR3 or ILR1 are more sensitive than is the wild type to certain IAA-amino acid conjugates, reflecting the overlapping substrate specificities of the corresponding enzymes. The IAR3 gene is expressed most strongly in roots, stems, and flowers, suggesting roles for IAA-conjugate hydrolysis in those tissues.  (+info)

Characterization of a novel rat brain glycosylphosphatidylinositol-anchored protein (Kilon), a member of the IgLON cell adhesion molecule family. (6/2620)

In the central nervous system, many cell adhesion molecules are known to participate in the establishment and remodeling of the neural circuit. Some of the cell adhesion molecules are known to be anchored to the membrane by the glycosylphosphatidylinositol (GPI) inserted to their C termini, and many GPI-anchored proteins are known to be localized in a Triton-insoluble membrane fraction of low density or so-called "raft." In this study, we surveyed the GPI-anchored proteins in the Triton-insoluble low density fraction from 2-week-old rat brain by solubilization with phosphatidylinositol-specific phospholipase C. By Western blotting and partial peptide sequencing after the deglycosylation with peptide N-glycosidase F, the presence of Thy-1, F3/contactin, and T-cadherin was shown. In addition, one of the major proteins, having an apparent molecular mass of 36 kDa after the peptide N-glycosidase F digestion, was found to be a novel protein. The result of cDNA cloning showed that the protein is an immunoglobulin superfamily member with three C2 domains and has six putative glycosylation sites. Since this protein shows high sequence similarity to IgLON family members including LAMP, OBCAM, neurotrimin, CEPU-1, AvGP50, and GP55, we termed this protein Kilon (a kindred of IgLON). Kilon-specific monoclonal antibodies were produced, and Western blotting analysis showed that expression of Kilon is restricted to brain, and Kilon has an apparent molecular mass of 46 kDa in SDS-polyacrylamide gel electrophoresis in its expressed form. In brain, the expression of Kilon is already detected in E16 stage, and its level gradually increases during development. Kilon immunostaining was observed in the cerebral cortex and hippocampus, in which the strongly stained puncta were observed on dendrites and soma of pyramidal neurons.  (+info)

Evidence for the existence of an unfolding intermediate state for aminoacylase during denaturation in guanidine solutions. (7/2620)

The equilibrium unfolding of pig kidney aminoacylase in guanidinium chloride (GdmCl) solutions was studied by following the fluorescence and circular dichroism (CD). At low concentrations of GdmCl, less than 1.0 M, the fluorescence intensity decreased with a slight red shift of the emission maximum (from 335 to 340 nm). An unfolding intermediate was observed in low concentrations of denaturant (between 1.2 and 1.6 M GdmCl). This intermediate was characterized by a decreased fluorescence emission intensity, a red-shifted emission maximum, and increased binding of the fluorescence probe 1-anilino-8-naphthalenesulfonate. No significant changes of the secondary structure were indicated by CD measurement. This conformation state is similar to a molten globule state which may exist in the pathway of protein folding. Further changes in the fluorescence properties occurred at higher concentrations of GdmCl, more than 1.6 M, with a decrease in emission intensity and a significant red shift of the emission maximum from 340 to 354 nm. In this stage, the secondary structure was completely broken. A study of apo-enzyme (Zn2+-free enzyme) produced similar results. However, comparison of the changes of the fluorescence emission spectra of native (Holo-) enzyme with Zn2+-free (Apo-) enzyme at low GdmCl concentrations showed that the structure of the Holo-enzyme was more stable than that of the Apo-enzyme.  (+info)

Processing of the fibrillin-1 carboxyl-terminal domain. (8/2620)

To investigate the processing and general properties of the fibrillin-1 carboxyl-terminal domain, three protein expression constructs have been developed as follows: one without the domain, one with the domain, and one with a mutation near the putative proteolytic processing site. The constructs have been expressed in two eukaryotic model systems, baculoviral and CHO-K1. Post-translational modifications that normally occur in fibrillin-1, including glycosylation, signal peptide cleavage, and carboxyl-terminal processing, occur in the three constructs in both cell systems. Amino-terminal sequencing of secreted protein revealed leader sequence processing at two sites, a primary site between Gly-24/Ala-25 and a secondary site of Ala-27/Asn-28. Processing of the carboxyl-terminal domain could be observed by migration differences in SDS-polyacrylamide gel electrophoresis and was evident in both mammalian and insect cells. Immunological identification by Western blotting confirmed the loss of the expected region. The failure of both cell systems to process the mutant construct shows that the multi-basic sequence is the site of proteolytic processing. Cleavage of the fibrillin-1 carboxyl-terminal domain occurred intracellularly in CHO-K1 cells in an early secretory pathway compartment as demonstrated by studies with secretion blocking agents. This finding, taken with the multi-basic nature of the cleavage site and observed calcium sensitivity of cleavage, suggests that the processing enzyme is a secretory pathway resident furin-like protease.  (+info)

6DY2 | GUINEA PIG N-ACYLETHANOLAMINE-HYDROLYZING ACID AMIDASE (NAAA) COVALENTLY BOUND TO BETA-LACTAM INHIBITOR ARN726 | 6DY2 B ...6DY2 | GUINEA PIG N-ACYLETHANOLAMINE-HYDROLYZING ACID AMIDASE (NAAA) COVALENTLY BOUND TO BETA-LACTAM INHIBITOR ARN726 | 6DY2 B ...
cansSAR 3D Structure of 6DY2_B | GUINEA PIG N-ACYLETHANOLAMINE-HYDROLYZING ACID AMIDASE (NAAA) COVALENTLY BOUND TO BETA-LACTAM INHIBITOR ARN726 | 6DY2
https://corona-2.cansar.icr.ac.uk/structure/6DY2/3d/6DY2_B
ASAHL/N-acylethanolamine-hydrolyzing Acid Amidase Antibody (AF4886): Novus BiologicalsASAHL/N-acylethanolamine-hydrolyzing Acid Amidase Antibody (AF4886): Novus Biologicals
Goat Polyclonal Anti-ASAHL/N-acylethanolamine-hydrolyzing Acid Amidase Antibody. Validated: WB, IP. Tested Reactivity: Mouse. 100% Guaranteed.
https://www.novusbio.com/products/asahl-n-acylethanolamine-hydrolyzing-acid-amidase-antibody_af4886
Vascular endothelial-specific dimethylarginine dimethylaminohydrolase-1- deficient mice reveal that vascular endothelium plays...Vascular endothelial-specific dimethylarginine dimethylaminohydrolase-1- deficient mice reveal that vascular endothelium plays...
Hu X, Xu X, Zhu G, Atzler D, Kimoto M, Chen J, Schwedhelm E, Lüneburg N, Böger RH, Zhang P, et al. Vascular endothelial-specific dimethylarginine dimethylaminohydrolase-1- deficient mice reveal that vascular endothelium plays an important role in removing asymmetric dimethylarginine. Circulation [Internet]. 2009;(22):2222-2229.
http://scholar.pku.edu.cn/lxhu/publications/vascular-endothelial-specific-dimethylarginine-dimethylaminohydrolase-1-deficient
N-acylethanolamine-hydrolyzing acid amidaseN-acylethanolamine-hydrolyzing acid amidase
MALDI-TOF MS analysis of the human NAAA zymogen (47.7 kDa) treated with peptide-N-glycosidase F (PNGase F) identified 4 glycosylation sites, and acid cleavage of the zymogen into alpha- and beta-subunits (14.6 and 33.3 kDa) activated the enzyme ...
https://pharos.nih.gov/idg/targets/Q02083
Sphingolipid Ceramide N-Deacylase | SCDase | Sphingolipid HydrolysisSphingolipid Ceramide N-Deacylase | SCDase | Sphingolipid Hydrolysis
Sphingolipid ceramide N-deacylase (SCDase) is derived from Pseudomonas and hydrolyzes the N-acyl linkage between fatty acids and sphingosine bases in ceramides of various sphingolipids. The enzyme also catalyzes the reverse reaction and possesses transacylation activity. SCDase acts on various acidic and neutral glycosphingolipids and sphingomyelin; however, it exhibits low activity with ceramides.. ...
http://www.clontech.com/CA/Products/Glycobiology/Glycobiology_Enzymes_and_Reagents/SCDase
Sphingolipid Ceramide N-Deacylase | SCDase | Sphingolipid HydrolysisSphingolipid Ceramide N-Deacylase | SCDase | Sphingolipid Hydrolysis
Sphingolipid ceramide N-deacylase (SCDase) is derived from Pseudomonas and hydrolyzes the N-acyl linkage between fatty acids and sphingosine bases in ceramides of various sphingolipids. The enzyme also catalyzes the reverse reaction and possesses transacylation activity. SCDase acts on various acidic and neutral glycosphingolipids and sphingomyelin; however, it exhibits low activity with ceramides.. ...
http://www.clontech.com/US/Products/Glycobiology/Glycobiology_Enzymes_and_Reagents/SCDase
Localization of the endocannabinoid-degrading enzyme fatty acid amide hydrolase in rat dorsal root ganglion cells and its...Localization of the endocannabinoid-degrading enzyme fatty acid amide hydrolase in rat dorsal root ganglion cells and its...
Fatty acid amide hydrolase (FAAH) is a degradative enzyme for a group of endogenous signaling lipids that includes anandamide (AEA). AEA acts as an endocannabinoid and an endovanilloid by activating cannabinoid and vanilloid type 1 transient receptor potential (TRPV1) receptors, respectively, on dorsal root ganglion (DRG) sensory neurons. Inhibition of FAAH activity increases AEA concentrations in nervous tissue and reduces sensory hypersensitivity in animal pain models. Using immunohistochemistry, Western blotting, and reverse transcription-PCR, we demonstrate the location of the FAAH in adult rat DRG, sciatic nerve, and spinal cord. In naive rats, FAAH immunoreactivity localized to the soma of 32.7 +/- 0.8% of neurons in L4 and L5 DRG. These were small-sized (mean soma area, 395.96 +/- 5.6 mum(2)) and predominantly colabeled with peripherin and isolectin B4 markers of unmyelinated C-fiber neurons; 68% colabeled with antibodies to TRPV1 (marker of nociceptive DRG neurons), and ...
https://vivo.scripps.edu/display/endnote229578
Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in failing hearts<...Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in failing hearts<...
TY - JOUR. T1 - Dimethylarginine dimethylaminohydrolase and endothelial dysfunction in failing hearts. AU - Chen, Yingjie. AU - Li, Yunfang. AU - Zhang, Ping. AU - Traverse, Jay H.. AU - Hou, Mingxiao. AU - Xu, Xin. AU - Kimoto, Masumi. AU - Bache, Robert J. PY - 2005/11/1. Y1 - 2005/11/1. N2 - Congestive heart failure (CHF) is associated with impaired endothelium-dependent nitric oxide (NO)-mediated vasodilation (endothelial dysfunction). We hypothesized that coronary endothelial dysfunction in CHF may be due in part to decreased dimethylarginine dimethylaminohydrolase (DDAH), the enzyme that degrades endogenous inhibitors of NO synthase (NOS), including asymmetric dimethylarginine. Coronary blood flow and the endothelium-dependent vasodilator response to acetylcholine were studied in dogs in which CHF was produced by rapid ventricular pacing for 4 wk. Coronary flow and myocardial O2 consumption at rest and during treadmill exercise were decreased after development of CHF, and the vasodilator ...
https://experts.umn.edu/en/publications/dimethylarginine-dimethylaminohydrolase-and-endothelial-dysfuncti
Fatty Acid Amide Hydrolase Inhibitors - Progress and Potential by Ish K. Khanna and Christopher W. AlexanderFatty Acid Amide Hydrolase Inhibitors - Progress and Potential by Ish K. Khanna and Christopher W. Alexander
Fatty acid amide hydrolase (FAAH) is responsible for hydrolysis of endocannabinoid, anandamide (AEA), and N-acyl ethanolamines such as palmitoylethanolamine (PEA) and N-oleoylethanolamide (OEA). Genetic deletion or pharmacological inactivation of FAAH shows site-specific elevation of AEA that plays a role in the modulation of pain and other neurodegenerative disorders. The review elaborates recent progress and current status of diverse structural classes of reversible and irreversible FAAH inhibitors. The discussion also addresses ligand-enzyme active site interactions and mechanism of enzyme inactivation, emerging approaches to novel FAAH inhibitors, and ongoing efforts to address gaps in therapeutic utility of FAAH inhibitors.
http://digitalcommons.kennesaw.edu/facpubs/1603/
The fatty acid amide hydrolase inhibitor URB597 exerts anti-inflammatory effects in hippocampus of aged rats and restores an...The fatty acid amide hydrolase inhibitor URB597 exerts anti-inflammatory effects in hippocampus of aged rats and restores an...
Several factors contribute to the deterioration in synaptic plasticity which accompanies age and one of these is neuroinflammation. This is characterized by increased microglial activation associated with increased production of proinflammatory cytokines like interleukin-1β (IL-1β). In aged rats these neuroinflammatory changes are associated with a decreased ability of animals to sustain long-term potentiation (LTP) in the dentate gyrus. Importantly, treatment of aged rats with agents which possess anti-inflammatory properties to decrease microglial activation, improves LTP. It is known that endocannabinoids, such as anandamide (AEA), have anti-inflammatory properties and therefore have the potential to decrease the age-related microglial activation. However, endocannabinoids are extremely labile and are hydrolyzed quickly after production. Here we investigated the possibility that inhibiting the degradation of endocannabinoids with the fatty acid amide hydrolase (FAAH) inhibitor, URB597, could
https://jneuroinflammation.biomedcentral.com/articles/10.1186/1742-2094-9-79/email/correspondent/c1/new
Activation of TRPA1 Channels by the Fatty Acid Amide Hydrolase Inhibitor 3 -Carbamoylbiphenyl-3-yl - Semantic ScholarActivation of TRPA1 Channels by the Fatty Acid Amide Hydrolase Inhibitor 3 -Carbamoylbiphenyl-3-yl - Semantic Scholar
As a member of the transient receptor potential (TRP) ion channel superfamily, the ligand-gated ion channel TRPA1 has been implicated in nociceptive function and pain states. The endogenous ligands that activate TRPA1 remain unknown. However, various agonists have been identified, including environmental irritants (e.g., acrolein) and ingredients of pungent natural products [e.g., allyl isothiocyanate (ITC), cinnamaldehyde, allicin, and gingerol]. In general, these agents are either highly reactive, nonselective, or not potent or efficacious, significantly limiting their utilities in the study of TRPA1 channel properties and biological functions. In a search for novel TRPA1 agonists, we identified 3 -carbamoylbiphenyl-3-yl cyclohexylcarbamate (URB597), a potent and systemically active inhibitor of fatty acid amide hydrolase (FAAH). This enzyme is responsible for anandamide degradation and therefore has been pursued as an antinociceptive and antiepileptic drug target. Using Ca influx assays and patch
https://www.semanticscholar.org/paper/Activation-of-TRPA1-Channels-by-the-Fatty-Acid-Ami-URB-Niforatos/34daea035a7f36c9691fd6b0a832da900fc24d32
Fatty Acid Amide Hydrolase in Prostate Cancer: Association with Disease Severity and Outcome, CB1 Receptor Expression and...Fatty Acid Amide Hydrolase in Prostate Cancer: Association with Disease Severity and Outcome, CB1 Receptor Expression and...
Background Recent data have indicated that there may be a dysregulation of endocannabinoid metabolism in cancer. Here we have investigated the expression of the endocannabinoid metabolising enzyme fatty acid amide hydrolase (FAAH) in a well characterised tissue microarray from patients diagnosed with prostate cancer at transurethral resection for voiding problems. Methodology/Principal Findings FAAH immunoreactivity (FAAH-IR) was assessed in formalin-fixed paraffin-embedded non-malignant and tumour cores from 412 patients with prostate cancer. CB1 receptor immunoreactivity (CB1IR) scores were available for this dataset. FAAH-IR was seen in epithelial cells and blood vessel walls but not in the stroma. Tumour epithelial FAAH-IR was positively correlated with the disease severity at diagnosis (Gleason score, tumour stage, % of the specimen that contained tumour) for cases with mid-range CB1IR scores, but not for those with high CB1IR scores. For the 281 cases who only received palliative therapy at the
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0012275
Lanopepden camsylate | CAS#1441390-28-8 | peptide deformylase inhibitor| MedKooLanopepden camsylate | CAS#1441390-28-8 | peptide deformylase inhibitor| MedKoo
Lanopepden, also known as GSK-1322322 or GSK-322, is a potent and selective peptide deformylase inhibitor with good in vitro activity against bacteria associated with community-acquired pneumonia and skin infections. GSK1322322 had bactericidal activity against S. pneumoniae, H. influenzae, S. pyogenes, and S. aureus, demonstrating a ≥ 3-log(10) decrease in the number of CFU/ml at 4× MIC within 24 h in 29 of the 33 strains tested. GSK1322322 represents a valuable alternative therapy for the treatment of infectious diseases caused by drug-resistant pathogens.
https://medkoo.com/products/34393
Fatty Acid Amide Hydrolase | Metabolic Enzyme|Neuronal Signaling| CSNpharmFatty Acid Amide Hydrolase | Metabolic Enzyme|Neuronal Signaling| CSNpharm
FAAH (fatty acid amide hydrolase) is an integral membrane enzyme that degrades the fatty acid amide family of signaling lipids, including the endocannabinoid anandamide. Genetic or pharmacological inactivation of FAAH leads to analgesic, anti-inflammatory, anxiolytic, and antidepressant phenotypes in rodents without showing the undesirable side effects observed with direct cannabinoid receptor agonists, indicating that FAAH may represent an attractive therapeutic target for treatment of pain, inflammation, and other central nervous system disorders.
https://www.csnpharm.com/faah.html
N(G),N(G)-dimethylarginine dimethylaminohydrolase 1N(G),N(G)-dimethylarginine dimethylaminohydrolase 1
This gene belongs to the dimethylarginine dimethylaminohydrolase (DDAH) gene family. The encoded enzyme plays a role in nitric oxide generation by regulating cellular concentrations of methylarginines, which in turn inhibit nitric oxide synthase activity. [provided by RefSeq, Jul 2008 ...
https://pharos.nih.gov/idg/targets/O94760
Fatty acid amide hydrolase ablation promotes ectopic lipid storage and insulin resistance due to centrally mediated...Fatty acid amide hydrolase ablation promotes ectopic lipid storage and insulin resistance due to centrally mediated...
Fatty acid amide hydrolase (FAAH) knockout mice are prone to excess energy storage and adiposity, whereas mutations in FAAH are associated with obesity in humans. However, the molecular mechanism by which FAAH affects energy expenditure (EE) remains unknown. Here we show that reduced energy expenditure in FAAH(-/-) mice could be attributed to decreased circulating triiodothyronine and thyroxine concentrations secondary to reduced mRNA expression of both pituitary thyroid-stimulating hormone and hypothalamic thyrotropin-releasing hormone. These reductions in the hypothalamic-pituitary-thyroid axis were associated with activation of hypothalamic peroxisome proliferating-activated receptor γ (PPARγ), and increased hypothalamic deiodinase 2 expression. Infusion of NAEs (anandamide and palmitoylethanolamide) recapitulated increases in PPARγ-mediated decreases in EE. FAAH(-/-) mice were also prone to diet-induced hepatic insulin resistance, which could be attributed to increased hepatic ...
https://vivo.scripps.edu/display/enote390397
科研成果 by Type: 期刊论文 | 胡新立科研成果 by Type: 期刊论文 | 胡新立
Hu X, Atzler D, Xu X, Zhang P, Guo H, Lu Z, Fassett J, Schwedhelm E, Böger RH, Bache RJ, et al. Dimethylarginine dimethylaminohydrolase-1 is the critical enzyme for degrading the cardiovascular risk factor asymmetrical dimethylarginine. Arteriosclerosis, Thrombosis, and Vascular Biology [Internet]. 2011;(7):1540-1546. 访问链接 SCI被引用次数：52 ...
http://scholar.pku.edu.cn/lxhu/publications/type/%E6%9C%9F%E5%88%8A%E8%AE%BA%E6%96%87
PDF peptide deformylase, mitochondrial [Homo sapiens (human)] - Gene - NCBIPDF peptide deformylase, mitochondrial [Homo sapiens (human)] - Gene - NCBI
Protein synthesis proceeds after formylation of methionine by methionyl-tRNA formyl transferase (FMT) and transfer of the charged initiator f-met tRNA to the ribosome. In eubacteria and eukaryotic organelles the product of this gene, peptide deformylase (PDF), removes the formyl group from the initiating methionine of nascent peptides. In eubacteria, deformylation of nascent peptides is required for subsequent cleavage of initiating methionines by methionine aminopeptidase. The discovery that a natural inhibitor of PDF, actinonin, acts as an antimicrobial agent in some bacteria has spurred intensive research into the design of bacterial-specific PDF inhibitors. In human cells, only mitochondrial proteins have N-formylation of initiating methionines. Protein inhibitors of PDF or siRNAs of PDF block the growth of cancer cell lines but have no effect on normal cell growth. In humans, PDF function may therefore be restricted to rapidly growing cells. [provided by RefSeq, Nov 2008 ...
https://www.ncbi.nlm.nih.gov/gene/64146
OPUS 4 | SearchOPUS 4 | Search
Abstract Study Objective Long‐term intake of proton pump inhibitors (PPIs) might increase the risk of cardiovascular events. One suggested mechanism is that PPIs inhibit the enzyme dimethylarginine dimethylaminohydrolase (DDAH) and thereby block the degradation of endothelial asymmetrical dimethylarginine (ADMA). Excess ADMA in turn leads to impaired endothelial nitric oxide (NO) generation. So far, this mechanism has only been established in human cell cultures. Previous studies that examined this pathway in human populations measured circulating ADMA and found no association with PPI use and excess plasma ADMA. But in a recent study, plasma ADMA was not correlated with intracellular ADMA. We therefore focused on changes in plasma citrulline as an indicator for potential DDAH inhibition. Design We analyzed the association between regular daily PPI intake and flow‐mediated dilation (FMD) of the brachial artery as well as plasma concentrations of citrulline, arginine, ADMA, and symmetric ...
https://epub.ub.uni-greifswald.de/solrsearch/index/search/searchtype/authorsearch/author/%22Amann%2C+Ute%22/rows/20
OPUS 4 | SearchOPUS 4 | Search
Abstract Study Objective Long‐term intake of proton pump inhibitors (PPIs) might increase the risk of cardiovascular events. One suggested mechanism is that PPIs inhibit the enzyme dimethylarginine dimethylaminohydrolase (DDAH) and thereby block the degradation of endothelial asymmetrical dimethylarginine (ADMA). Excess ADMA in turn leads to impaired endothelial nitric oxide (NO) generation. So far, this mechanism has only been established in human cell cultures. Previous studies that examined this pathway in human populations measured circulating ADMA and found no association with PPI use and excess plasma ADMA. But in a recent study, plasma ADMA was not correlated with intracellular ADMA. We therefore focused on changes in plasma citrulline as an indicator for potential DDAH inhibition. Design We analyzed the association between regular daily PPI intake and flow‐mediated dilation (FMD) of the brachial artery as well as plasma concentrations of citrulline, arginine, ADMA, and symmetric ...
https://epub.ub.uni-greifswald.de/solrsearch/index/search/searchtype/authorsearch/author/%22Amann%2C+Ute%22/start/0/rows/10/subjectfq/flow%E2%80%90mediated+dilation/author_facetfq/Linseisen%2C+Jakob
The endocannabinoid system : drug targets, lead compounds, and potential therapeutic applications.The endocannabinoid system : drug targets, lead compounds, and potential therapeutic applications.
Amides/chemistry/pharmacology, Amidohydrolases/antagonists & inhibitors/chemistry/metabolism, Amines/chemistry/pharmacology, Animals, Arachidonic Acids/metabolism, Binding Sites, Drug Design, Endocannabinoids/*chemistry/*metabolism/pharmacology, Esters/chemistry/pharmacology, Ethers/chemistry/pharmacology, Glycerides/metabolism, Humans, Ligands, Monoacylglycerol Lipases/metabolism, Polyunsaturated Alkamides, Receptors; Cannabinoid/chemistry/drug effects ...
http://umu.diva-portal.org/smash/record.jsf?faces-redirect=true&language=sv&searchType=SIMPLE&query=&af=%5B%5D&aq=%5B%5B%5D%5D&aq2=%5B%5B%5D%5D&aqe=%5B%5D&pid=diva2%3A145545&noOfRows=50&sortOrder=author_sort_asc&sortOrder2=title_sort_asc&onlyFullText=false&sf=all
Specific Lowering of Asymmetric Dimethylarginine by Pharmacological Dimethylarginine Dimethylaminohydrolase Improves...Specific Lowering of Asymmetric Dimethylarginine by Pharmacological Dimethylarginine Dimethylaminohydrolase Improves...
Thank you for sharing this Journal of Pharmacology and Experimental Therapeutics article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
https://jpet.aspetjournals.org/content/376/2/181.full
Recent Process in the Inhibitors of UDP-3-O-(R-3-hydroxyacyl)-Nacetylglucosamine Deacetylase (LpxC) Against Gram-Negative...Recent Process in the Inhibitors of UDP-3-O-(R-3-hydroxyacyl)-Nacetylglucosamine Deacetylase (LpxC) Against Gram-Negative...
Title:Recent Process in the Inhibitors of UDP-3-O-(R-3-hydroxyacyl)-Nacetylglucosamine Deacetylase (LpxC) Against Gram-Negative Bacteria. VOLUME: 18 ISSUE: 4. Author(s):Fang Liu and Shutao Ma*. Affiliation:Department of Medicinal Chemistry, Key Laboratory of Chemical Biology (Ministry of Education), School of Pharmaceutical Sciences, Shandong University, 44 West Culture Road, Jinan 250012, Department of Medicinal Chemistry, Key Laboratory of Chemical Biology (Ministry of Education), School of Pharmaceutical Sciences, Shandong University, 44 West Culture Road, Jinan 250012. Keywords:Anti-bacterial agent, biosynthesis, UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine deacetylase (LpxC), LpxC inhibitors, Gram-negative bacterial, lipid A biosynthesis.. Abstract:Infections caused by pathogenic bacteria are a major health concern throughout the world. There is a great need to develop novel antibacterial agents with new mechanisms of action. Lipopolysaccharides (LPS) are the main component of the ...
https://www.eurekaselect.com/146246/article
DDAH2 - N(G),N(G)-dimethylarginine dimethylaminohydrolase 2 - Homo sapiens (Human) - DDAH2 gene & proteinDDAH2 - N(G),N(G)-dimethylarginine dimethylaminohydrolase 2 - Homo sapiens (Human) - DDAH2 gene & protein
Hydrolyzes N(G),N(G)-dimethyl-L-arginine (ADMA) and N(G)-monomethyl-L-arginine (MMA) which act as inhibitors of NOS. Has therefore a role in the regulation of nitric oxide generation.
http://www.uniprot.org/uniprot/O95865
Dimethylarginine dimethylaminohydrolase activity modulates ADMA levels, VEGF expression, and cell phenotype - UCL DiscoveryDimethylarginine dimethylaminohydrolase activity modulates ADMA levels, VEGF expression, and cell phenotype - UCL Discovery
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
http://discovery.ucl.ac.uk/31250/
Bile Salt Hydrolase, Chinaîn Hilberên Hîdrolase ya Siltanê Bile, Hilberîner, Bazirgan - Hunan Nanbeiwang Teknolojiya Biyolojîk...Bile Salt Hydrolase, Chinaîn Hilberên Hîdrolase ya Siltanê Bile, Hilberîner, Bazirgan - Hunan Nanbeiwang Teknolojiya Biyolojîk...
Place of Origin:ChinaBrand Name:Hunan Nanbeiwang Biological Technology Co.,LtdModel Number:11Description:Bile salt hydrolase is an intracellular enzyme encoded by the bsh gene. It is not sensitive to oxygen and is s...
https://www.hnnanbeiwang.com/ku/Biocatalyst/bile-salt-hydrolase
Urease from Bacteria, Recombinant(EC 3.5.1.5) - Creative EnzymesUrease from Bacteria, Recombinant(EC 3.5.1.5) - Creative Enzymes
Ureases, functionally, belong to the superfamily of amidohydrolases and phosphotriesterases. It is an enzyme that catalyzes the hydrolysis of urea into carbon dioxide and
https://www.creative-enzymes.com/product/Urease-From-Bacteria-Recombinant_3211.html
Author: VAN DER KAMP, MARC W. - PubAg Search ResultsAuthor: VAN DER KAMP, MARC W. - PubAg Search Results
Creatininase catalyzes the conversion of creatinine (a biosensor for kidney function) to creatine via a two-step mechanism: water addition followed by ring opening. Water addition is common to other known cyclic amidohydrolases, but the precise mechanism for ring opening is still under debate. The proton donor in this step is either His178 or a water molecule bound to one of the metal ions, and th ...
https://pubag.nal.usda.gov/?per_page=100&q=%22VAN+DER+KAMP%2C+MARC+W.%22&search_field=author
Synthesis and antibacterial activity of peptide deformylase inhibitors. - PubMed - NCBISynthesis and antibacterial activity of peptide deformylase inhibitors. - PubMed - NCBI
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
https://www.ncbi.nlm.nih.gov/pubmed/10758004?dopt=Abstract
Dylan Kim | In Vitro Activities of Peptide Deformylase InhibitorsDylan Kim | In Vitro Activities of Peptide Deformylase Inhibitors
MicroRNA (miRNA) disorder is associated with a variety of human being illnesses, including malignancy. miR-671-5p lead in a change from epithelial-to-mesenchymal changeover (EMT) to mesenchymal-to-epithelial changeover (MET) phenotypes in MDA-MB-231 breasts malignancy cells and caused S-phase police arrest. Furthermore, miR-671-5p sensitive breasts malignancy cells to cisplatin, 5-fluorouracil (5-FU) and epirubicin publicity. Host cell reactivation (HCR) assays demonstrated that miR-671-5p decreases DNA restoration ability in post-drug revealed breasts malignancy cells. cDNA microarray data exposed that differentially indicated genetics when miR-671-5p was transfected are linked with cell growth, breach, cell routine, and EMT. These data suggest that miR-671-5p features as a growth suppressor miRNA in breasts cancer tumor by straight concentrating on FOXM1. Therefore, miR-671-5p might serve as a new therapeutic focus on for breasts cancer tumor administration. (DCIS), and culminates in the ...
http://johnmaciel.com/author/info/
In Vitro Activities of Peptide Deformylase InhibitorsIn Vitro Activities of Peptide Deformylase Inhibitors
MicroRNA (miRNA) disorder is associated with a variety of human being illnesses, including malignancy. miR-671-5p lead in a change from epithelial-to-mesenchymal changeover (EMT) to mesenchymal-to-epithelial changeover (MET) phenotypes in MDA-MB-231 breasts malignancy cells and caused S-phase police arrest. Furthermore, miR-671-5p sensitive breasts malignancy cells to cisplatin, 5-fluorouracil (5-FU) and epirubicin publicity. Host cell reactivation (HCR) assays demonstrated that miR-671-5p decreases DNA restoration ability in post-drug revealed breasts malignancy cells. cDNA microarray data exposed that differentially indicated genetics when miR-671-5p was transfected are linked with cell growth, breach, cell routine, and EMT. These data suggest that miR-671-5p features as a growth suppressor miRNA in breasts cancer tumor by straight concentrating on FOXM1. Therefore, miR-671-5p might serve as a new therapeutic focus on for breasts cancer tumor administration. (DCIS), and culminates in the ...
http://johnmaciel.com
Functional Characterization of Plant Fatty Acid Amide Hydrolases - Digital LibraryFunctional Characterization of Plant Fatty Acid Amide Hydrolases - Digital Library
Fatty acid amide hydrolase (FAAH) terminates the endocannabinoid signaling pathway that regulates numerous neurobehavioral processes in animals by hydrolyzing a class of lipid mediators, N-acylethanolamines (NAEs). Recent identification of an Arabidopsis FAAH homologue (AtFAAH) and several studies, especially those using AtFAAH overexpressing and knock-out lines suggest that a FAAH-mediated pathway exists in plants for the metabolism of endogenous NAEs. Here, I provide evidence to support this concept by identifying candidate FAAH cDNA sequences in diverse plant species. NAE amidohydrolase assays confirmed that several of the proteins encoded by these cDNAs indeed catalyzed the hydrolysis of NAEs in vitro. Kinetic parameters, inhibition properties, and substrate specificities of the plant FAAH enzymes were very similar to those of mammalian FAAH. Five amino acid residues determined to be important for catalysis by rat FAAH were absolutely conserved within the plant FAAH sequences. Site-directed mutation
https://digital.library.unt.edu/ark:/67531/metadc33177/
Dimethylarginine Dimethylaminohydrolase Regulates Nitric Oxide Synthesis | CirculationDimethylarginine Dimethylaminohydrolase Regulates Nitric Oxide Synthesis | Circulation
In the DDAH transgenic animals, we observed a 10% increase in basal heart rate. The increase in heart rate may reflect a heightened sympathetic tone, activated in response to the reduction in vascular resistance. The increase in heart rate is balanced by a 10% reduction in stroke volume, so that cardiac output does not change. The reduction in stroke volume may be attributable to the shortened time for diastolic filling of the heart. Increased compliance of the venous bed, secondary to increased venous NOS activity, may also contribute to the reduction in diastolic filling.. Alternatively, the increase in heart rate may be compensating for a reduction in ventricular contractility. NO at submillimolar levels is known to reduce myocardial contractility.36-38 In patients with heart failure, activation of inducible NOS can have significant effects on left ventricular systolic and diastolic function.39,40 However, the effect of the constitutive forms of NOS on ventricular function are much more ...
http://circ.ahajournals.org/content/108/24/3042
Infection Is Associated with Impaired Hepatic Dimethylarginine Dimethylaminohydrolase Activity and Disruption of Nitric Oxide...Infection Is Associated with Impaired Hepatic Dimethylarginine Dimethylaminohydrolase Activity and Disruption of Nitric Oxide...
1. World Health Organization. World malaria report 2014 [Internet]. 2014. Available: http://apps.who.int/iris/bitstream/10665/144852/2/9789241564830_eng.pdf?ua=1. 2. Murray CJ, Rosenfeld LC, Lim SS, Andrews KG, Foreman KJ, Haring D, et al. Global malaria mortality between 1980 and 2010: a systematic analysis. The Lancet. 2012;379: 413-431. doi: 10.1016/S0140-6736(12)60034-8. 3. Dondorp AM, Fanello CI, Hendriksen IC, Gomes E, Seni A, Chhaganlal KD, et al. Artesunate versus quinine in the treatment of severe falciparum malaria in African children (AQUAMAT): an open-label, randomised trial. Lancet. 2010;376: 1647-57. doi: 10.1016/S0140-6736(10)61924-1 21062666. 4. Yeo TW, Lampah DA, Gitawati R, Tjitra E, Kenangalem E, McNeil YR, et al. Impaired nitric oxide bioavailability and L-arginine reversible endothelial dysfunction in adults with falciparum malaria. J Exp Med. 2007;204: 2693-704. 17954570. 5. Anstey NM, Weinberg JB, Hassanali MY, Mwaikambo ED, Manyenga D, Misukonis MA, et al. Nitric oxide in ...
https://www.prolekare.cz/casopisy/plos-pathogens/2015-9/infection-is-associated-with-impaired-hepatic-dimethylarginine-dimethylaminohydrolase-activity-and-disruption-of-nitric-oxide-synthase-inhibitor-substrate-homeostasis-55949
The Role of Dimethylarginine Dimethylaminohydrolase in Idiopathic Pulmonary Fibrosis | Science Translational MedicineThe Role of Dimethylarginine Dimethylaminohydrolase in Idiopathic Pulmonary Fibrosis | Science Translational Medicine
Thank you for your interest in spreading the word about Science Translational Medicine.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
http://stm.sciencemag.org/content/3/87/87ra53.full
B. smithii RAPc8 amidase - SBRUB. smithii RAPc8 amidase - SBRU
Amidases catalyse the hydrolysis of amides to the corresponding carboxylic acid and ammonia. They exist in all kingdoms of the living world but have been most extensively characterised amongst the bacteria.. A number of studies of amidase classification (10.1016/S0167-4838(96)00145-8)(10.1046/j.1365-2672.2001.01378.x)(10.1186/gb-2001-2-1-reviews0001) have revealed that the bacterial aliphatic amidases (broadly classed as acylamide amidohydrolase, EC 3.5.1.4) are made up of two types.. The first group, the nitrilase-related family, includes the aliphatic amidases, hydrolysing only short-chain aliphatic amides (10.1046/j.1365-2672.2001.01378.x). The enzymes are typically homohexamers of approximately 230kDa, and contain a Cys166 residue (Pseudomonas aeruginosa amidase numbering), conserved across both nitrilase and amidase. This residue is believed to act as the catalytic nucleophile. The amidases from P. aeruginosa (10.1016/0014-5793(87)80163-1)(10.1016/j.ijbiomac.2003.08.002[c/ite], Rhodococcus ...
http://sbru.salamanderthemes.net/research-projects/b-smithii-rapc8-amidase/
Discovery of potent, non-carbonyl inhibitors of fatty acid amide hydrolase (FAAH)Discovery of potent, non-carbonyl inhibitors of fatty acid amide hydrolase (FAAH)
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
https://www.growkudos.com/publications/10.1039%25252Fc2md20146a/reader
Inactivation of fatty acid amide hydrolase exacerbates experimental fibrosis by enhanced endocannabinoid-mediated activation of...Inactivation of fatty acid amide hydrolase exacerbates experimental fibrosis by enhanced endocannabinoid-mediated activation of...
TrendTerms displays relevant terms of the abstract of this publication and related documents on a map. The terms and their relations were extracted from ZORA using word statistics. Their timelines are taken from ZORA as well. The bubble size of a term is proportional to the number of documents where the term occurs. Red, orange, yellow and green colors are used for terms that occur in the current document; red indicates high interlinkedness of a term with other terms, orange, yellow and green decreasing interlinkedness. Blue is used for terms that have a relation with the terms in this document, but occur in other documents ...
https://www.zora.uzh.ch/id/eprint/72613/
Fatty Acid Amide HydrolaseFatty Acid Amide Hydrolase
Angiotensin-converting enzyme inhibitors (ACEIs) are the main reason behind angioedema (AE) induced by medications. painful and asymmetrical. There is certainly neither pruritus nor urticaria. A localized love from the intestines can 1159824-67-5 manufacture be done but it generally affects the facial skin the tongue and all of those other 1159824-67-5 manufacture ear nasal area and …Read More. ...
http://researchhunt.com/category/fatty-acid-amide-hydrolase/page/2/
Orexin1 Receptors | PARP inhibitor BMN-673 targeting of the mutant p53-PARP-MCM chromatin axisOrexin1 Receptors | PARP inhibitor BMN-673 targeting of the mutant p53-PARP-MCM chromatin axis
Supplementary MaterialsAdditional file 1: Document Contains Information about Bacterial Strain Origins, as well as Data about Neutrophil Reactive Oxygen Species Assays and Bile Deconjugation Profiles. DPC 6426 was assessed for bile salt hydrolase activity and specificity. The microbe was compared against several other enteric strains of the same varieties, as well as a verified bile sodium hydrolase-active stress, APC 2587. Outcomes Quantitative bile sodium hydrolase assays uncovered that enzymatic ingredients from APC 2587 and DPC 6426 demonstrate the best activity in vitro. Bile acidity profiling of porcine and murine bile pursuing incubation with DPC 6426 verified a choice Solenopsin for hydrolysis of glyco-conjugated bile acids. Furthermore, the purified secretome and exopolysaccharide of DPC 6426 were investigated for immunomodulatory capabilities using RAW264.7 macrophages. Gene appearance data uncovered that both fractions activated boosts in interleukin-6 and interleukin-10 gene ...
http://bmn-673.com/category/orexin1-receptors/
Discovery of PF-04457845: A Highly Potent, Orally Bioavailable, and Selective Urea FAAH Inhibitor - PubMedDiscovery of PF-04457845: A Highly Potent, Orally Bioavailable, and Selective Urea FAAH Inhibitor - PubMed
Fatty acid amide hydrolase (FAAH) is an integral membrane serine hydrolase that degrades the fatty acid amide family of signaling lipids, including the endocannabinoid anandamide. Genetic or pharmacological inactivation of FAAH leads to analgesic and anti-inflammatory phenotypes in rodents without s …
https://pubmed.ncbi.nlm.nih.gov/21666860/
Assessment of the direct effects of DDAH I on tumour angiogenesis in vivo.Assessment of the direct effects of DDAH I on tumour angiogenesis in vivo.
Nitric oxide (NO) has been strongly implicated in glioma progression and angiogenesis. The endogenous inhibitors of NO synthesis, asymmetric dimethylarginine (ADMA) and N-monomethyl-L-arginine (L-NMMA), are metabolized by dimethylarginine dimethylaminohydrolase (DDAH), and hence, DDAH is an intracellular factor that regulates NO. However, DDAH may also have an NO-independent action. We aimed to investigate whether DDAH I has any direct role in tumour vascular development and growth independent of its NO-mediated effects, in order to establish the future potential of DDAH inhibition as an anti-angiogenic treatment strategy. A clone of rat C6 glioma cells deficient in NO production expressing a pTet Off regulatable element was identified and engineered to overexpress DDAH I in the absence of doxycycline. Xenografts derived from these cells were propagated in the presence or absence of doxycycline and susceptibility magnetic resonance imaging used to assess functional vasculature in vivo. ...
https://repository.icr.ac.uk/handle/internal/2595
Crystallization and Structure of a Plant Peptide Deformylase by Robert L. Houtz, David W. Rodgers et al.Crystallization and Structure of a Plant Peptide Deformylase by Robert L. Houtz, David W. Rodgers et al.
This invention relates to the crystal structure of a plant peptide deformylase polypeptide and methods of using the structure to design compounds that modulate the activity of the polypeptide.
https://uknowledge.uky.edu/biochem_patents/3/
Metabolism of asymmetric dimethylarginines is regulated in the lung developmentally and with pulmonary hypertension induced by...Metabolism of asymmetric dimethylarginines is regulated in the lung developmentally and with pulmonary hypertension induced by...
BACKGROUND Nitric oxide (NO) plays an important part in lowering pulmonary vascular resistance after birth, and in persistent pulmonary hypertension of the newborn (PPHN), NO-mediated dilation is dysfunctional. The endogenous NO synthase inhibitor asymmetric dimethylarginine (ADMA) circulates in plasma, and its concentrations are elevated in certain cardiovascular diseases, including pulmonary hypertension. ADMA is metabolized by the enzyme dimethylarginine dimethylaminohydrolase (DDAH), the activity of which regulates ADMA concentrations and provides a mechanism for modulating NO synthase in vivo. We investigated the changes in expression and activity of the 2 isoforms of DDAH in lungs from newborn piglets both during normal development and in PPHN. METHODS AND RESULTS Using Western blotting, we showed that DDAHI expression did not change in the normal developing lung; however, DDAHII increased after birth and reached a peak at 1 day. This was reflected in an increase in total DDAH activity according
https://www.semanticscholar.org/paper/Metabolism-of-asymmetric-dimethylarginines-is-regu-Arrigoni-Vallance/74611773c3ba9297c156b631e871167fe32983b2
The association of dimethylarginine dimethylaminohydrolase 1 gene polymorphism with type 2 diabetes: a cohort study |...The association of dimethylarginine dimethylaminohydrolase 1 gene polymorphism with type 2 diabetes: a cohort study |...
In this study, SNP rs1241321 in DDAH1 was found to be associated with a higher risk of type 2 diabetes independently of the plasma ADMA level. In addition, individuals with an AA genotype at rs1241321 appeared to be more insulin-sensitive when compared with AG/GG individuals. Over a median follow-up period of 28.2 months, AA genotype at rs1241321 was associated with better long-term clinical outcome in diabetic subgroup. In contrast, some SNPs of DDAH1, especially the rs1498373, might influence the plasma level of ADMA. However, with the exception of rs1241321, none of these SNPs or the plasma ADMA level was associated with type 2 diabetes, suggesting that the interaction of DDAH1 variants with type 2 diabetes may not be directly related to its enzymatic activity, i.e. not just simply mediated by the plasma ADMA level. We also identified a common haplotype H5 (GGCAGC) that was associated with reduced risk of type 2 diabetes.. It is well recognized that type 2 diabetes and its metabolic ...
https://cardiab.biomedcentral.com/articles/10.1186/1475-2840-10-16
Germination-specific N-acetylmuramoyl-L-alanine amidase elisa and antibodyGermination-specific N-acetylmuramoyl-L-alanine amidase elisa and antibody
Shop Germination-specific N-acetylmuramoyl-L-alanine amidase ELISA Kit, Recombinant Protein and Germination-specific N-acetylmuramoyl-L-alanine amidase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
https://www.mybiosource.com/protein_family.php?root=germination-specific-n-acetylmuramoyl-l-alanine-amidase
Zinc in the structure of Crystal Structure Of Mutant R322A of Beta-Alanine Synthase From Saccharomyces Kluyveri (pdb 2v8v)Zinc in the structure of Crystal Structure Of Mutant R322A of Beta-Alanine Synthase From Saccharomyces Kluyveri (pdb 2v8v)
Mono- and Stereopictres of 5.0 Angstrom coordination sphere of Zinc atom in PDB 2v8v: Crystal Structure Of Mutant R322A of Beta-Alanine Synthase From Saccharomyces Kluyveri
http://zinc.atomistry.com/pdb2v8v.html
Aspartoacylase deficiency legal definition of Aspartoacylase deficiencyAspartoacylase deficiency legal definition of Aspartoacylase deficiency
Definition of Aspartoacylase deficiency in the Legal Dictionary - by Free online English dictionary and encyclopedia. What is Aspartoacylase deficiency? Meaning of Aspartoacylase deficiency as a legal term. What does Aspartoacylase deficiency mean in law?
http://legal-dictionary.thefreedictionary.com/Aspartoacylase+deficiency
Domain combinations for Peptide deformylase superfamily in Mycoplasma penetrans HF-2Domain combinations for Peptide deformylase superfamily in Mycoplasma penetrans HF-2
Domain combinations containing the Peptide deformylase superfamily in Mycoplasma penetrans HF-2. Domain architectures illustrate each occurrence of the Peptide deformylase superfamily.
http://supfam.org/SUPERFAMILY/cgi-bin/allcombs.cgi?genome=me
Role of arginine residues of D-aminoacylase from Alcaligenes x...Role of arginine residues of D-aminoacylase from Alcaligenes x...
Role of arginine residues of D-aminoacylase from Alcaligenes xylosoxydans subsp. xylosoxydans A-6.: To investigate the role of arginine in the folding of d-amin
https://www.mysciencework.com/publication/show/role-arginine-residues-d-aminoacylase-from-alcaligenes-xylosoxydans-subsp-xylosoxydans-6-3201f3a2
Fegley, D., Gaetani, S., Duranti, A., Tontini, A., Mor, M. and Tarzia, G. (2005) Characterization of the fatty acid amide...Fegley, D., Gaetani, S., Duranti, A., Tontini, A., Mor, M. and Tarzia, G. (2005) Characterization of the fatty acid amide...
Fegley, D., Gaetani, S., Duranti, A., Tontini, A., Mor, M. and Tarzia, G. (2005) Characterization of the fatty acid amide hydrolase inhibitor cyclohexyl carbamic acid 3- carbamoyl-biphenyl-3-yl ester (URB597), effects on anandamide and oleoylethanolamide deactivation. Journal of Pharmacology & Experimental Therapeutics, 313, 352-358. doi10.1124/jpet.104.078980
http://www.scirp.org/reference/ReferencesPapers.aspx?ReferenceID=577096
Biomolecules | Free Full-Text | Tackling Critical Catalytic Residues in Helicobacter pylori L-AsparaginaseBiomolecules | Free Full-Text | Tackling Critical Catalytic Residues in Helicobacter pylori L-Asparaginase
Bacterial asparaginases (amidohydrolases, EC 3.5.1.1) are important enzymes in cancer therapy, especially for Acute Lymphoblastic Leukemia. They are tetrameric enzymes able to catalyze the deamination of L-ASN and, to a variable extent, of L-GLN, on which leukemia cells are dependent for survival. In contrast to other known L-asparaginases, Helicobacter pylori CCUG 17874 type II enzyme (HpASNase) is cooperative and has a low affinity towards L-GLN. In this study, some critical amino acids forming the active site of HpASNase (T16, T95 and E289) have been tackled by rational engineering in the attempt to better define their role in catalysis and to achieve a deeper understanding of the peculiar cooperative behavior of this enzyme. Mutations T16E, T95D and T95H led to a complete loss of enzymatic activity. Mutation E289A dramatically reduced the catalytic activity of the enzyme, but increased its thermostability. Interestingly, E289 belongs to a loop that is very variable in L-asparaginases from the
http://www.mdpi.com/2218-273X/5/2/306
Novel amidases of two Aminobacter sp. strains: Biotransformation experiments and elucidation of gene sequences | AMB Express |...Novel amidases of two Aminobacter sp. strains: Biotransformation experiments and elucidation of gene sequences | AMB Express |...
The amidase activities of two Aminobacter sp. strains (DSM24754 and DSM24755) towards the aryl-substituted substrates phenylhydantoin, indolylmethyl hydantoin, D,L-6-phenyl-5,6-dihydrouracil (PheDU) and para-chloro-D,L-6-phenyl-5,6-dihydrouracil were compared. Both strains showed hydantoinase and dihydropyrimidinase activity by hydrolyzing all substrates to the corresponding N-carbamoyl-α- or N-carbamoyl-β-amino acids. However, carbamoylase activity and thus a further degradation of these products to α- and β-amino acids was not detected. Additionally, the genes coding for a dihydropyrimidinase and a carbamoylase of Aminobacter sp. DSM24754 were elucidated. For Aminobacter sp. DSM24755 a dihydropyrimidinase gene flanked by two genes coding for putative ABC transporter proteins was detected. The deduced amino acid sequences of both dihydropyrimidinases are highly similar to the well-studied dihydropyrimidinase of Sinorhizobium meliloti CECT4114. The latter enzyme is reported to accept substituted
https://amb-express.springeropen.com/articles/10.1186/2191-0855-2-33/email/correspondent/c1/new
Novel amidases of two Aminobacter sp. strains: Biotransformation experiments and elucidation of gene sequences | AMB Express |...Novel amidases of two Aminobacter sp. strains: Biotransformation experiments and elucidation of gene sequences | AMB Express |...
The amidase activities of two Aminobacter sp. strains (DSM24754 and DSM24755) towards the aryl-substituted substrates phenylhydantoin, indolylmethyl hydantoin, D,L-6-phenyl-5,6-dihydrouracil (PheDU) and para-chloro-D,L-6-phenyl-5,6-dihydrouracil were compared. Both strains showed hydantoinase and dihydropyrimidinase activity by hydrolyzing all substrates to the corresponding N-carbamoyl-α- or N-carbamoyl-β-amino acids. However, carbamoylase activity and thus a further degradation of these products to α- and β-amino acids was not detected. Additionally, the genes coding for a dihydropyrimidinase and a carbamoylase of Aminobacter sp. DSM24754 were elucidated. For Aminobacter sp. DSM24755 a dihydropyrimidinase gene flanked by two genes coding for putative ABC transporter proteins was detected. The deduced amino acid sequences of both dihydropyrimidinases are highly similar to the well-studied dihydropyrimidinase of Sinorhizobium meliloti CECT4114. The latter enzyme is reported to accept substituted
https://amb-express.springeropen.com/articles/10.1186/2191-0855-2-33/metrics
FAAH inhibitor 1 (Benzothiazole analog 3) | FAAH Inhibitor | MedChemExpressFAAH inhibitor 1 (Benzothiazole analog 3) | FAAH Inhibitor | MedChemExpress
FAAH inhibitor 1 (Benzothiazole analog 3) is a potent fatty acid amide hydrolase (FAAH) inhibitor with an IC50 of 18±8 nM. - Mechanism of Action & Protocol.
https://www.medchemexpress.com/faah-inhibitor-1.html
Expression studies of Bacillus licheniformis chitin deacetylase in E. coli Rosetta cells<...Expression studies of Bacillus licheniformis chitin deacetylase in E. coli Rosetta cells<...
TY - JOUR. T1 - Expression studies of Bacillus licheniformis chitin deacetylase in E. coli Rosetta cells. AU - Raval, Ritu. AU - Simsa, Robin. AU - Raval, Keyur. PY - 2017/11/1. Y1 - 2017/11/1. N2 - Chitin, the biopolymer of the N-acetylglucosamine, is the most abundant biopolymer on the planet after cellulose. However owing to its crystalline nature, its deacetylated derivative; chitosan is industrially more potent. This conversion on an enzymatic scale can be made using chitin deacetylase. The metagenomics library constructed from the soil exposed to chitin and chitosan yielded chitin modifying enzymes, one of them being chitin deacetylase (CDA) utilized for the present study. The gene was amplified and expressed using the pET 22b vector in E. coli Rosetta cells. The effect of two additives; chitin and glycerol on the CDA activity were studied. The inclusion of glycerol in the medium improved the biomass by 50% from the initial value of 1.25 g/l to 2.5 g/l. The activity of CDA increased from ...
https://manipal.pure.elsevier.com/en/publications/expression-studies-of-bacillus-licheniformis-chitin-deacetylase-i
Inserting a Mutation into the Putative Clostridium difficile Bile Salt Hydrolase-Encoding GeneInserting a Mutation into the Putative Clostridium difficile Bile Salt Hydrolase-Encoding Gene
Clostridium difficile is a Gram-positive, anaerobic, spore-forming bacterium that causes infections in the gastrointestinal tract. The mechanisms by which C. difficile is able to germinate in such a toxic environment are not fully understood. However, our lab and others have shown that certain bile components have the capacity to induce C. difficile spore germination and affect growth of C. difficile cells. Interestingly, C. difficile encodes a bile salt hydrolase (cholylglycine hydrolase), but it is unknown how this affects the bacteriums ability to grow in the presence of bile acids. This research project is centered around the goal of inserting a mutation into the C. difficile bile salt hydrolase. This will be completed using the TargeTron Gene Knockout System, which inserts group II introns into a specific DNA location, and allelic-coupled exchange. Successful completion of this project would allow further investigation into the relationship between C. difficiles bile salt hydrolase ...
http://oaktrust.library.tamu.edu/handle/1969.1/157640
Chloramphenicol and Ampicillin-Induced Changes in Rat Hepatic Esterase and Amidase Activities | Bioscience Reports | Portland...Chloramphenicol and Ampicillin-Induced Changes in Rat Hepatic Esterase and Amidase Activities | Bioscience Reports | Portland...
The influence of ampicillin and chloramphenicol administered intraperitoneallysingly or in combination on the protein content and the activities of hepaticsterase and amidase have been investigated in rats. The results have beencompared to the effects of phenobarbitone (inducer) andp-nitrophenyl-phosphate (inhibitor) of hepatic hydrolases.. Ampicillin pretreatment reduced protein level and amidase activity by3.5% each but caused a significant increase (8.1%) in total esteraseactivity compared to controls. Chloramphenicol treatment caused an overalldecrease in protein level, esterase and amidase activities respectively by11%, 11%, and 35% over controls.. Combined administration of both drugs resulted in a decrease in protein,esterase and amidase activities by 11.5%, 12.5%, and 41.2% respectively,thus mimicking the effects obtained with chloramphenicol alone.. The changes induced by administration of the drugs particularly incombination on the constituent enzymes of rat hepatic hydrolases may ...
https://portlandpress.com/bioscirep/article-abstract/20/1/13/54280/Chloramphenicol-and-Ampicillin-Induced-Changes-in?redirectedFrom=fulltext
Amide Utilization in Aspergillus nidulans: Evidence for a Third Amidase Enzyme | Microbiology SocietyAmide Utilization in Aspergillus nidulans: Evidence for a Third Amidase Enzyme | Microbiology Society
Summary: A mutation in a gene designated gmdA has been found to lead to loss of ability of Aspergillus nidulans to use benzamide, phenylacetamide and several other amides as sole nitrogen sources for growth. The gmdAI lesion results in low levels of an enzyme, called the general amidase, which has activity for a wide range of amide substrates. This enzyme is repressed by certain nitrogen-containing metabolites, including ammonium, but is probably not regulated by induction or by carbon catabolite repression. Evidence is presented for the general amidase being distinct from the previously characterized acetamidase and formamidase enzymes. The data also indicate that there is a fourth amidase capable of the hydrolysis of valeramide and hexanamide.
https://www.microbiologyresearch.org/content/journal/micro/10.1099/00221287-91-1-99
Publications - Professor Anthony GordonPublications - Professor Anthony Gordon
AB - BackgroundDimethylarginine dimethylaminohydrolase 2 (DDAH2) regulates the synthesis of nitric oxide (NO) through the metabolism of the endogenous inhibitor of nitric oxide synthase, asymmetric dimethylarginine (ADMA). Pilot studies have associated the rs805305 SNP of DDAH2 with ADMA concentrations in sepsis. This study explored the impact of the rs805305 polymorphism on DDAH activity and outcome in septic shock.MethodsWe undertook a secondary analysis of data and samples collected during the Vasopressin versus noradrenaline as initial therapy in septic shock (VANISH) trial. Plasma and DNA samples isolated from 286 patients recruited into the VANISH trial were analysed. Concentrations of L-Arginine and the methylarginines ADMA and symmetric dimethylarginine (SDMA) were determined from plasma samples. Whole blood and buffy-coat samples were genotyped for polymorphisms of DDAH2. Clinical data collected during the study were used to explore the relationship between circulating methylarginines, ...
https://www.imperial.ac.uk/people/anthony.gordon/?respub-action=citation.html&id=1052766&noscript=noscript
Unscramble acetanilid | Words unscrambled from letters acetanilid | Scrabble Word acetanilid | Words Made with the Letters...Unscramble acetanilid | Words unscrambled from letters acetanilid | Scrabble Word acetanilid | Words Made with the Letters...
Unscramble acetanilid, Unscramble letters acetanilid, Point value for acetanilid, Word Decoder for acetanilid, Word generator using the letters acetanilid, Word Solver acetanilid, Possible Scrabble words with acetanilid, Anagram of acetanilid
http://www.allscrabblewords.com/word-description/acetanilid
RCSB PDB - 1N5N: Crystal Structure of Peptide Deformylase from Pseudomonas aeruginosa Literature Report PageRCSB PDB - 1N5N: Crystal Structure of Peptide Deformylase from Pseudomonas aeruginosa Literature Report Page
1N5N: Structure analysis of peptide deformylases from streptococcus pneumoniae,staphylococcus aureus, thermotoga maritima, and pseudomonas aeruginosa: snapshots of the oxygen sensitivity of peptide deformylase
http://www.rcsb.org/pdb/explore/litView.do?structureId=1N5N
RCSB PDB - 1LME: Crystal Structure of Peptide Deformylase from Thermotoga maritima Literature Report PageRCSB PDB - 1LME: Crystal Structure of Peptide Deformylase from Thermotoga maritima Literature Report Page
1LME: Structure analysis of peptide deformylases from streptococcus pneumoniae,staphylococcus aureus, thermotoga maritima, and pseudomonas aeruginosa: snapshots of the oxygen sensitivity of peptide deformylase
http://www.rcsb.org/pdb/explore/litView.do?structureId=1LME
Pesquisa | Portal Regional da BVSPesquisa | Portal Regional da BVS
Fatty acid amide hydrolase (FAAH) is a key enzyme in the endocannabinoid system. N-(3,4-Dimethylisoxazol-5-yl)piperazine-4-[4-(2-fluoro-4-[11C]methylphenyl)thiazol-2-yl]-1-carboxamide ([11C]DFMC) was developed as an irreversible-type positron emission tomography (PET) tracer for FAAH. Here, we attempted to noninvasively estimate rate constant k3 (rate of transfer to the specifically-bound compartment) as a direct index for FAAH in the rat brain. First, the two-tissue compartment model analysis including three parameters [K1-k3, two-tissue compartment model for the irreversible-type radiotracer (2TCMi)] in PET study with [11C]DFMC was conducted, which provided 0.21 ± 0.04 ml·cm-3·min-1 of the net uptake value (Ki), an indirect index for FAAH, in the FAAH-richest region (the cingulate cortex). Subsequently, to noninvasively estimate Ki value, the reference model analysis (Patlak graphical analysis reference model) was tried using a time-activity curve of the spinal cord. In that result, the ...
https://pesquisa.bvsalud.org/portal/?lang=pt&q=mh:%22Carbamatos/farmacologia%22
Analgesic trial ends in death | Australian Doctor GroupAnalgesic trial ends in death | Australian Doctor Group
A MAN has died and five others remain in hospital in France after a phase I trial of a novel analgesic took a tragic turn.The Rennes University Hospital announced the death in a statement.The man, who developed brain damage, was among six male volunteers aged between 28 and 49 hospitalised last week after volunteering to take the compound, one of a new class - fatty acid amide hydrolase (FAAH) inhibitors - being investigated by pharmaceutical companies. French health authorities have said three of the hospitalised volunteers face possible brain damage. Man developed brain damage after taking experimental compound.
https://www.ausdoc.com.au/specialist-update/analgesic-trial-ends-death
Rabbit polyclonal to PNLIPRP3 | Syntheses, Structures and Antibiotic Activities of LpxC InhibitorsRabbit polyclonal to PNLIPRP3 | Syntheses, Structures and Antibiotic Activities of LpxC Inhibitors
Key points Retinal cells use vanilloid transient receptor potential (TRP) channels to integrate light\evoked alerts with ambient mechanised, temperature and chemical information. excitability the percentage of RGCs that exhibit it continues to be unclear. Furthermore, TRPV1s response to endocannabinoids (eCBs), the putative endogenous retinal activators, is certainly unknown, as may be the potential modulation Tedizolid by cannabinoid receptors (CBRs). The Tedizolid thickness of TRPV1\expressing RGCs in the Ai9:reporter mouse peaked in the middle\peripheral retina. TRPV1 agonists including capsaicin (Cover) as well as the eCBs anandamide and hybridizationFSKforskolinINLinner nuclear layerIPLinner plexiform layeririmmunoreactiveKOknockoutNADA was placed into Exon 15 of (TRPV1Cre; Jackson Lab 017769; Club Harbor, Me personally, USA). This relative line was crossed to B6.Cg\locus (Madisen [B6.Cg\Tg([B6.Cg\Tg(usage of food and water. An Tedizolid abstract formulated with a portion of the work was ...
https://clarkfrancis.com/tag/rabbit-polyclonal-to-pnliprp3/
EC 3.5.1.88EC 3.5.1.88
Accepted name: peptide deformylase. Reaction: formyl-L-methionyl peptide + H2O = formate + methionyl peptide. Systematic name: formyl-L-methionyl peptide amidohydrolase. Comments: Requires Fe(II). Also requires at least a dipeptide for an efficient rate of reaction. N-terminal L-methionine is a prerequisite for activity but the enzyme has broad specificity at other positions. Differs in substrate specifity from EC 3.5.1.27 (N-formylmethionylaminoacyl-tRNA deformylase) and EC 3.5.1.31 (formylmethionine deformylase).. Links to other databases: BRENDA, EXPASY, KEGG, Metacyc, PDB, CAS registry number: 369636-51-1. References:. 1. Adams, J.M. On the release of the formyl group from nascent protein. J. Mol. Biol. 33 (1968) 571-589. [PMID: 4973445]. 2. Mazel, D., Pochet, S. and Marliere, P. Genetic characterization of polypeptide deformylase, a distinctive enzyme of eubacterial translation. EMBO J. 13 (1994) 914-923. [PMID: 8112305]. 3. Chan, M.K., Gong, W., Rajagopalan, P.T.R., Hao, B., Tsai, C.M. and ...
http://www.sbcs.qmul.ac.uk/iubmb/enzyme/EC3/5/1/88.html
NDST2 overexpression lysate - LY418535 | acris-antibodies.comNDST2 overexpression lysate - LY418535 | acris-antibodies.com
NDST2 overexpression lysate, 0.1 mg. Transient overexpression lysate of N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 (NDST2)
https://www.acris-antibodies.com/lysates/ndst2-overexpression-lysate-ly418535.htm
Rabbit Polyclonal to GABRA6. | Syntheses, Structures and Antibiotic Activities of LpxC InhibitorsRabbit Polyclonal to GABRA6. | Syntheses, Structures and Antibiotic Activities of LpxC Inhibitors
A42 peptide aggregation and deposition is an important component of the neuropathology of Alzheimers disease (AD). Amyloid precursor protein(Swedish mutation)/presenilin 1 deltaE9 mutation, ELISPOT- Enzyme-linked immunosorbent spot, nm-nanometer, SPSS-Statistical Package for the Social Sciences 1. Introduction Alzheimers disease (AD) is the most common cause of dementia and its pathogenesis has been associated with the accumulation, aggregation and deposition of amyloid beta (A) peptides in cerebral cortex, hippocampus and other subcortical structures [1,2]. A is derived from a larger beta-amyloid precursor protein [3,4] (APP) that is preferentially expressed in higher levels in central nervous system [5,6]. The aggregated form of A42 has been identified as a major component of senile plaques of AD brain [7C9], and thus, a major target of therapy for AD. A42 peptide vaccination has been shown to reduce the amyloid burden in brain and improve the cognitive function in transgenic mouse models as ...
https://clarkfrancis.com/tag/rabbit-polyclonal-to-gabra6/
Amidase - WikipediaAmidase - Wikipedia
In enzymology, an amidase (EC 3.5.1.4, acylamidase, acylase (misleading), amidohydrolase (ambiguous), deaminase (ambiguous), fatty acylamidase, N-acetylaminohydrolase (ambiguous)) is an enzyme that catalyzes the hydrolysis of an amide: Thus, the two substrates of this enzyme are monocarboxylic acid amide and H2O, whereas its two products are monocarboxylate and NH3. This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically in linear amides. The systematic name of this enzyme class is acylamide amidohydrolase. Other names in common use include acylamidase, acylase, amidohydrolase, deaminase, fatty acylamidase, and N-acetylaminohydrolase. This enzyme participates in 6 metabolic pathways: urea cycle and metabolism of amino groups, phenylalanine metabolism, tryptophan metabolism, cyanoamino acid metabolism, benzoate degradation via coa ligation, and styrene degradation. Amidases contain a conserved stretch of approximately 130 amino ...
https://en.wikipedia.org/wiki/Amidase
ADMA(Asymmetrical Dimethylarginine) ELISA Kit - ADMA(Asymmetrical Dimethylarginine) ELISA Kit Exporter, Importer, Manufacturer,...ADMA(Asymmetrical Dimethylarginine) ELISA Kit - ADMA(Asymmetrical Dimethylarginine) ELISA Kit Exporter, Importer, Manufacturer,...
SR GROUP - Exporter, Importer, Manufacturer, Distributor, Supplier, Trading Company of ADMA(Asymmetrical Dimethylarginine) ELISA Kit based in Delhi, India
https://www.srgroupchemical.com/adma-asymmetrical-dimethylarginine-elisa-kit-4412020.html
RCSB PDB - 7D6Z: Molecular model of the cryo-EM structure of 70S ribosome in complex with peptide deformylase and trigger factorRCSB PDB - 7D6Z: Molecular model of the cryo-EM structure of 70S ribosome in complex with peptide deformylase and trigger factor
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
https://bioinformatics.sdsc.edu/structure/7D6Z
Asymmetric Dimethylarginine, L-Arginine, and Endothelial Dysfunction in Essential Hypertension | JACC: Journal of the American...Asymmetric Dimethylarginine, L-Arginine, and Endothelial Dysfunction in Essential Hypertension | JACC: Journal of the American...
The main finding in this study is that in essential hypertensives the endogenous inhibitor of e-NOS ADMA is inversely related to endothelial function as measured by the peak hemodynamic response to ACh. Such relationship occurs in a range of ADMA values within the boundaries of the normal range. A companion, unexpected, finding in this study is that circulating L-arginine is directly related to plasma ADMA and, like plasma ADMA, it is inversely related to endothelial function.. The importance of ADMA as an endogenous inhibitor of e-NOS is now well established (26-28). Elegant studies in healthy volunteers convincingly demonstrated that intravenous ADMA infusion at a dose resulting in pathophysiological concentrations augments peripheral and renovascular resistance and arterial pressure (22). High plasma ADMA concentration was observed in the presence of traditional or emerging cardiovascular risk factors (e.g., hyperhomocysteinemia) (18-21,29), inducing endothelial dysfunction in some of these ...
http://www.onlinejacc.org/content/46/3/518
Glycoproteomic Analysis of Prostate Cancer Tissues by SWATH Mass Spectrometry Discovers N-acylethanolamine Acid Amidase and...Glycoproteomic Analysis of Prostate Cancer Tissues by SWATH Mass Spectrometry Discovers N-acylethanolamine Acid Amidase and...
The identification of biomarkers indicating the level of aggressiveness of prostate cancer (PCa) will address the urgent clinical need to minimize the general overtreatment of patients with non-aggressive PCa, who account for the majority of PCa cases.
https://www.jpt.com/literature/glycoproteomic-analysis-of-prostate-cancer-tissues-by-swath-mass-spectrometry-discovers-n-acylethanolamine-acid-amidase-and-protein-tyrosine-kinase-7-as-signatures-for-tumor-aggressiveness?breadcrumbPath=1306&cHash=ff2af35bc9c30221dba94c82e76c3e69
Plus itPlus it
A recent study identified FAAH as a critical molecule involved in mood control in humans, showing that carriers of an FAAH gene mutation with reduced enzyme activity had both decreased threat-related brain reactivity and reduced anxiety (Hariri et al., 2009). These findings are particularly relevant because they allow generalizing to humans the results of the existing literature on the antianxiety effects of reduced FAAH activity in rodents. Both genetic and pharmacological inactivation of FAAH, in fact, exerts anxiolytic and antidepressant actions in rodents (Kathuria et al., 2003; Gobbi et al., 2005; Patel and Hillard, 2006; Bortolato et al., 2007; Hill et al., 2007; Naidu et al., 2007; Cippitelli et al., 2008; Moreira et al., 2008; Rubino et al., 2008; Scherma et al., 2008; Haller et al., 2009; Micale et al., 2009, and does not cause sedation, hypothermia, hyperphagia, or abuse potential (Fegley et al., 2005; Gobbi et al., 2005; Lichtman and Martin, 2005), which are important side effects of ...
http://molpharm.aspetjournals.org/content/78/2/260
Amidases(AMD): synthesis of chiral carboxylic acids and amides,Enzyme,Syncozymes (Shanghai) CoAmidases(AMD): synthesis of chiral carboxylic acids and amides,Enzyme,Syncozymes (Shanghai) Co
Amidases(AMD): synthesis of chiral carboxylic acids and amides,Enzyme,Produ cts,Syncozymes (Shanghai) Co.,Ltd.,Amidases(AMD): synthesis of chiral carboxylic acids and amidesEnzymesProduct CodeSpecificationEnzyme PowderES-AMD-101~ ES-AMD-11818 items*5
http://en.syncozymes.com/product_detail/productId=43.html
Plasma concentrations of asymmetric dimethylarginine are increased in patients with type 2 diabetes mellitusPlasma concentrations of asymmetric dimethylarginine are increased in patients with type 2 diabetes mellitus
Plasma concentrations of asymmetric dimethylarginine are increased in patients with type 2 diabetes mellitus Academic Article Article ...
http://vivo.med.cornell.edu/display/pubid0035889591
Acetic Acid AmideAcetic Acid Amide
China Acetic Acid Amide manufacturers - Select 2018 high quality Acetic Acid Amide products in best price from certified Chinese C Acid manufacturers, Amino Acid Powder suppliers, wholesalers and factory on Made-in-China.com
http://www.made-in-china.com/products-search/hot-china-products/Acetic_Acid_Amide.html
EMBOSS: featcopyEMBOSS: featcopy
gff-version 3 ##sequence-region PAAMIR 1 2167 #!Date 2008-07-11 #!Type DNA #!Source-version EMBOSS 6.0.0 PAAMIR EMBL databank_entry 1 2167 0.000 + . ID=PAAMIR.1;db_xref=taxon:287;organism=Pseudomonas aeruginosa;strain=PAC;isolate=PAC 1;map=38 min PAAMIR EMBL CDS 1289 1879 0.000 + 0 ID=PAAMIR.2;db_xref=SWISS-PROT:P10932;note=aliphatic amidase regulator, positive regulator of amiE;transl_table=11;gene=amiR;protein_id=CAA32023.1;translation=MSANSLLGSLRELQVLVLNPPGEVSDALVLQLIRIGCSVRQCWPPPEAFDVPVDVVFTSIFQNGHHDEIAALLAAGTPRTTLVALVEYESPAVLSQIIELECHGVITQPLDAHRVLPVLVSARRISEEMAKLKQKTEQLQDRIAGQARINQAKVLLMQRHGWDEREAHQHLSREAMKRREPILKIAQELLGNEPSA PAAMIR EMBL CDS 135 1292 0.000 + 0 ID=PAAMIR.3;db_xref=SWISS-PROT:P27017;note=negative regulator of ...
http://emboss.sourceforge.net/apps/release/6.2/emboss/apps/featcopy.html
EMBOSS: sixpackEMBOSS: sixpack
X13776 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation G T A G R A S A R S P P A G R R E L H D F1 V P L A E H L L D H H Q P G D G N C T I F2 Y R W P S I C S I T T S R A T G T A R S F3 1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgat 60 ----:----,----:----,----:----,----:----,----:----,----:----, 1 ccatggcgaccggctcgtagacgagctagtggtggtcggcccgctgcccttgacgtgcta 60 P V A P R A D A R D G G A P R R S S C S F6 X Y R Q G L M Q E I V V L R A V P V A R F5 T G S A S C R S S * W W G P S P F Q V I F4 L P G E P G A R A G S L R T A L S D S H F1 Y L A S L E H E R V R F V R R * A T V T F2 T W R A W S T S G F A S Y G A E R Q S Q F3 61 ctacctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcac 120 ----:----,----:----,----:----,----:----,----:----,----:----, 61 gatggaccgctcggacctcgtgctcgcccaagcgaagcatgccgcgactcgctgtcagtg 120 R G P S G P A R A P E S R V A S L S L * F6 D V Q R A Q L V L P N A E Y P A S R C D F5 * R A L R S C S R T R K T R R Q A V T V F4 R R G N G W D R T R S ...
http://home.cc.umanitoba.ca/~psgendb/local/doc/emboss/programs/html/sixpack.html
Computational Complexity: Amir Pnueli (1941-2009)Computational Complexity: Amir Pnueli (1941-2009)
Im trying to recall Amirs funniest lines. Some dont translate, some require too much background. But I thought of a few that may illustrate Amirs special humor. When a student of his was called to military reserve duty whenever his oral exam for the completion of his MSc was scheduled, (temporal logic) until he found a note from Amir saying you had your oral exam in absentia and you passed with flying colors. Or when I interchanged N and M in a paper, on which, upon proof reading, Amir wrote a note even for N=M when I claimed I proved something for any N. Or... after long arguments with me that the past operators in temporal logic are not needed, he gave a lecture in which he basically admitted they were useful, with slides whose titles were Admitting the Past and Why Should We be Ashamed of the Past that I felt were for me. And the list goes on ...
https://blog.computationalcomplexity.org/2009/11/amir-pnueli-1941-2009.html
PATCH v2 0/5] Nested overlay testsPATCH v2 0/5] Nested overlay tests
PATCH v2 3/5] overlay: test file handles with nested overlay over non-samefs lower 2019-12-30 14:14 [PATCH v2 0/5] Nested overlay tests Amir Goldstein 2019-12-30 14:14 ` [PATCH v2 1/5] overlay: create the overlay/nested test group Amir Goldstein 2019-12-30 14:14 ` [PATCH v2 2/5] overlay: test file handles with nested overlay over samefs lower Amir Goldstein @ 2019-12-30 14:14 ` Amir Goldstein 2019-12-30 14:14 ` [PATCH v2 4/5] overlay: test constant ino with nested overlay over samefs lower Amir Goldstein 2019-12-30 14:14 ` [PATCH v2 5/5] overlay: test constant ino with nested overlay over non-samefs lower Amir Goldstein 4 siblings, 0 replies; 9+ messages in thread From: Amir Goldstein @ 2019-12-30 14:14 UTC (permalink / raw) To: Eryu Guan; +Cc: Miklos Szeredi, Jeff Layton, linux-unionfs, fstests This is a variant of overlay file handles test for an overlayfs that is nested over another lower overlayfs on non-samefs. Signed-off-by: Amir Goldstein ,[email protected], --- tests/overlay/069 , 313 ...
https://lore.kernel.org/linux-unionfs/[email protected]om/T/
1228362-74-0 | 5-Methyl-4-nitro-2H-pyrazole-3-carboxylic acid amide | MolCore1228362-74-0 | 5-Methyl-4-nitro-2H-pyrazole-3-carboxylic acid amide | MolCore
MolCore offers CAS No.1228362-74-0, 5-Methyl-4-nitro-2H-pyrazole-3-carboxylic acid amide for your research needs.Find product specific information including MFCD11845721,1228362-74-0 MSDS,Price,Custom Synthesis.
https://www.molcore.com/product/1228362-74-0
Sotrastaurin | FAAH inhibitors in the limelightSotrastaurin | FAAH inhibitors in the limelight
Supplementary Materialssupplement. and is thought to be initiated by the release of circulating tumor cells (CTCs) from the primary tumor.1 Enumeration of CTCs present in the peripheral blood of metastatic malignancy patients has been shown to have prognostic utility Il17a in prostate, breast, and colorectal cancers.2 Molecular characterization of CTCs may provide a less invasive means of obtaining information from your patients main tumor, helping to guideline treatment and monitoring of disease development.3 Additionally, since CTCs have already been proven to contain hereditary materials shed from metastatic and principal tumors, they offer a unique possibility to understand the natural systems underlying metastasis.4 However the existence of CTCs was confirmed a lot more than a century ago,5 the isolation and subsequent profiling of CTCs continues to be a challenge because of the low variety of CTCs within the bloodstream (only 1 CTC per 1 109 hematological cells) and their physical and ...
https://cambio-red.net/tag/sotrastaurin/
Dictamnine IC50 | FAAH inhibitors in the limelightDictamnine IC50 | FAAH inhibitors in the limelight
Although there were significant advances in the treatment of heart failure in recent decades, like the introduction of -blockers and antagonists from the reninCangiotensinCaldosterone system, this devastating disease still carries tremendous morbidity and mortality under western culture. -adrenergic as well as the angiotensin II type 1 receptors. We also high light key conditions that have to be dealt with to improve the probability of Rabbit Polyclonal to HCK (phospho-Tyr521) achievement of book therapies aimed against these goals. strong course=kwd-title Keywords: center failing, G protein-coupled receptor, signaling, cardiac, healing target Introduction Center failure (HF) is certainly a complicated pathophysiological symptoms that comes from an initial defect in the power from the center to fill up and/or eject bloodstream sufficiently. The scientific manifestations of HF derive from the principal myocardial insult (mostly coronary artery disease, hypertension, or hereditary factors) as ...
https://cambio-red.net/tag/dictamnine-ic50/
NWMN RS14730 - AureoWikiNWMN RS14730 - AureoWiki
Cell structureCell envelopeBiosynthesis and degradation of surface polysaccharides and lipopolysaccharidespoly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB (TIGR03938; EC 3.5.1.-; HMM-score: 110.6) ...
http://aureowiki.med.uni-greifswald.de/NWMN_RS14730
Dr Amir Shirzadi | OU people profilesDr Amir Shirzadi | OU people profiles
Dr Amir Shirzadi, Senior Lecturer in Materials Engineering, Faculty of Science, Technology, Engineering & Mathematics, The Open University
http://www.open.ac.uk/people/as25978
Protocols and Video Articles Authored by Amir SegevProtocols and Video Articles Authored by Amir Segev
Amir Segev is the author of this article in the Journal of Visualized Experiments: Whole-cell Patch-clamp Recordings in Brain Slices
https://www.jove.com/author/Amir_Segev
Dr. Amir Gerges, DO - Prescott, AZ - Nephrology | Healthgrades.comDr. Amir Gerges, DO - Prescott, AZ - Nephrology | Healthgrades.com
Visit Healthgrades for information on Dr. Amir Gerges, DO Find Phone & Address information, medical practice history, affiliated hospitals and more.
https://www.healthgrades.com/physician/dr-amir-gerges-g9dcd
GTP cyclohydrolase IIGTP cyclohydrolase II
Thus, the two substrates of this enzyme are GTP and H2O, whereas its 3 products are formate, 2,5-diamino-6-hydroxy-4-(5-phosphoribosylamino)pyrimidine, and diphosphate.. This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically in cyclic amidines. The systematic name of this enzyme class is GTP 7,8-8,9-dihydrolase (diphosphate-forming). Other names in common use include guanosine triphosphate cyclohydrolase II, and GTP-8-formylhydrolase. This enzyme participates in riboflavin metabolism.. ...
https://en.wikipedia.org/wiki/GTP_cyclohydrolase_II
Succinyl-diaminopimelate desuccinylaseSuccinyl-diaminopimelate desuccinylase
The systematic name of this enzyme class is N-succinyl-LL-2,6-diaminoheptanedioate amidohydrolase. This enzyme is also called N ...
https://en.wikipedia.org/wiki/Succinyl-diaminopimelate_desuccinylase
HDAC4HDAC4
Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class II of the histone deacetylase/acuc/apha family. It possesses histone deacetylase activity and represses transcription when tethered to a promoter. This protein does not bind DNA directly but through transcription factors MEF2C and MEF2D. It seems to interact in a multiprotein complex with RbAp48 and HDAC3.[7] Furthermore, HDAC4 is required for TGFbeta1-induced myofibroblastic differentiation.[8] ...
https://en.wikipedia.org/wiki/HDAC4
Adenozilkobinamidna hidrolazaAdenozilkobinamidna hidrolaza
Woodson, J.D. and Escalante-Semerena, J.C. (2004). "CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 ...
https://sh.wikipedia.org/wiki/Adenozilkobinamid_hidrolaza
Multiregionalno podrijetlo modernih ljudi - WikipedijaMultiregionalno podrijetlo modernih ljudi - Wikipedija
"Population Genetic Analysis of the N-Acylsphingosine Amidohydrolase Gene Associated With Mental Activity in Humans". Genetics ...
https://hr.wikipedia.org/wiki/Multiregionalno_podrijetlo_modernih_ljudi
Multiregional origin of modern humansMultiregional origin of modern humans
"Population Genetic Analysis of the N-Acylsphingosine Amidohydrolase Gene Associated With Mental Activity in Humans" (Free full ...
https://en.m.wikipedia.org/wiki/Multiregional_origin_of_modern_humans
N-acetylglucosamine-6-phosphate deacetylaseN-acetylglucosamine-6-phosphate deacetylase
Amidohydrolases are a type of hydrolase that acts upon amide bonds. All members of the amidohydrolase family employ a TIM ... Amidohydrolase enzymes can bind one, two, or three metal atoms in the active site. These metals can include Zn2+, Co2+, Fe2+, ... The systematic name of this enzyme class is N-acetyl-D-glucosamine-6-phosphate amidohydrolase. Other names in common use ... Liu A, Huo L (2014-08-15), John Wiley & Sons Ltd (ed.), "Amidohydrolase Superfamily", eLS, John Wiley & Sons, Ltd, doi:10.1002/ ...
https://en.wikipedia.org/wiki/N-acetylglucosamine-6-phosphate_deacetylase
Allantoate deiminaseAllantoate deiminase
Vogels GD (February 1966). "Reversible activation of allantoate amidohydrolase by acid-pretreatment and other properties of the ... This enzyme is also called allantoate amidohydrolase. This enzyme participates in purine metabolism. ...
https://en.wikipedia.org/wiki/Allantoate_deiminase
N-(long-chain-acyl)ethanolamine deacylaseN-(long-chain-acyl)ethanolamine deacylase
The systematic name of this enzyme class is N-(long-chain-acyl)ethanolamine amidohydrolase. Other names in common use include N ... Schmid PC, Zuzarte-Augustin ML, Schmid HH (1985). "Properties of rat liver N-acylethanolamine amidohydrolase". J. Biol. Chem. ...
https://en.wikipedia.org/wiki/N-(long-chain-acyl)ethanolamine_deacylase
CHAP domainCHAP domain
The domain is named after the acronym cysteine, histidine-dependent amidohydrolases/peptidases. Many of these proteins are ... L-glutamate-specific amidohydrolases". Trends Biochem. Sci. 28 (5): 230-4. doi:10.1016/s0968-0004(03)00062-8. PMID 12765833. ...
https://en.wikipedia.org/wiki/CHAP_domain
N-carbamoyl-D-amino acid hydrolaseN-carbamoyl-D-amino acid hydrolase
Ogawa J, Shimizu S, Yamada H (1993). "N-carbamoyl-D-amino acid amidohydrolase from Comamonas sp. E222c purification and ...
https://en.wikipedia.org/wiki/N-carbamoyl-D-amino_acid_hydrolase
CreatininaseCreatininase
... is a member of the urease-related amidohydrolases, the family of hydrolases, those acting on carbon-nitrogen bonds ... Cite journal requires ,journal= (help) Yamamoto K, Oka M, Kikuchi T, Emi S (1995). "Cloning of the creatinine amidohydrolase ... The systematic name of this enzyme class is creatinine amidohydrolase. This enzyme is also called creatinine hydrolase. This ... PDB: 3NO4​; Joint Center for Structural Genomics (2010). "Crystal structure of a creatinine amidohydrolase (Npun_F1913) from ...
https://en.wikipedia.org/wiki/Creatininase
N4-(beta-N-acetylglucosaminyl)-L-asparaginaseN4-(beta-N-acetylglucosaminyl)-L-asparaginase
L-asparagine amidohydrolase) is an enzyme with systematic name N4-(beta-N-acetyl-D-glucosaminyl)-L-asparagine amidohydrolase. ... Mahadevan S, Tappel AL (October 1967). "Beta-aspartylglucosylamine amido hydrolase of rat liver and kidney". The Journal of ... Tarentino AL, Maley F (March 1969). "The purification and properties of a beta-aspartyl N-acetylglucosylamine amidohydrolase ... "Purification and properties of 4-L-aspartylglycosylamine amidohydrolase from hog kidney". Biochimica et Biophysica Acta (BBA ...
https://en.wikipedia.org/wiki/N4-(beta-N-acetylglucosaminyl)-L-asparaginase
Glutathionylspermidine amidaseGlutathionylspermidine amidase
This enzyme is also called glutathionylspermidine amidohydrolase (spermidine-forming). This enzyme participates in glutathione ...
https://en.wikipedia.org/wiki/Glutathionylspermidine_amidase
N-formylglutamate deformylaseN-formylglutamate deformylase
The systematic name of this enzyme class is N-formyl-L-glutamate amidohydrolase. Other names in common use include beta-citryl- ... Hu L, Mulfinger LM, Phillips AT (1987). "Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida ... beta-citryl-L-glutamate amidohydrolase, beta-citryl-L-glutamate amidase, beta-citrylglutamate amidase, and beta-citryl-L- ...
https://en.wikipedia.org/wiki/N-formylglutamate_deformylase
ASAH1ASAH1
"Entrez Gene: ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1". Zhou J, Tawk M, Tiziano FD, Veillet J, Bayes M, ...
https://en.wikipedia.org/wiki/ASAH1
BarbituraseBarbiturase
... (EC 3.5.2.1) is a zinc-containing amidohydrolase. Its systemic name is barbiturate amidohydrolase (3-oxo-3- ... Although grouped into the naturally existing amidohydrolases, it demonstrates more homology with cyanuric acid amidohydrolase. ... Unlike other zinc containing amidohydrolases, the zinc binding motif of barbiturase is found on the carboxylic acid terminus, ... Soong CL, Ogawa J, Sakuradani E, Shimizu S (March 2002). "Barbiturase, a novel zinc-containing amidohydrolase involved in ...
https://en.wikipedia.org/wiki/Barbiturase
ASAHLASAHL
"Entrez Gene: ASAHL N-acylsphingosine amidohydrolase (acid ceramidase)-like". Human NAAA genome location and NAAA gene details ...
https://en.wikipedia.org/wiki/ASAHL
UreaseUrease
Holm L, Sander C (1997). "An evolutionary treasure: unification of a broad set of amidohydrolases related to urease". Proteins ... Ureases (EC 3.5.1.5), functionally, belong to the superfamily of amidohydrolases and phosphotriesterases. Ureases are found in ...
https://en.wikipedia.org/wiki/Urease
D-glutaminaseD-glutaminase
The systematic name of this enzyme class is D-glutamine amidohydrolase. This enzyme participates in d-glutamine and d-glutamate ... Domnas A, Catimo EC (1965). "The behavior of amidohydrolases and L-glutamate in synchronized populations of Blastocladiella ...
https://en.wikipedia.org/wiki/D-glutaminase
ASAH2ASAH2
"Entrez Gene: ASAH2 N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2". Human ASAH2 genome location and ASAH2 gene ...
https://en.wikipedia.org/wiki/ASAH2
PentanamidasePentanamidase
The systematic name of this enzyme class is pentanamide amidohydrolase. This enzyme is also called valeramidase. Friedrich CG, ...
https://en.wikipedia.org/wiki/Pentanamidase
AmidaseAmidase
The systematic name of this enzyme class is acylamide amidohydrolase. Other names in common use include acylamidase, acylase, ... In enzymology, an amidase (EC 3.5.1.4, acylamidase, acylase (misleading), amidohydrolase (ambiguous), deaminase (ambiguous), ... amidohydrolase, deaminase, fatty acylamidase, and N-acetylaminohydrolase. This enzyme participates in 6 metabolic pathways: ...
https://en.wikipedia.org/wiki/Amidase
Nicotinamide-nucleotide amidaseNicotinamide-nucleotide amidase
The systematic name of this enzyme class is nicotinamide-D-ribonucleotide amidohydrolase. Other names in common use include NMN ... Imai T (January 1973). "Purification and properties of nicotinamide mononucleotide amidohydrolase from Azotobacter vinelandii ... deamidase, nicotinamide mononucleotide deamidase, and nicotinamide mononucleotide amidohydrolase. This enzyme participates in ...
https://en.wikipedia.org/wiki/Nicotinamide-nucleotide_amidase
Chenodeoxycholoyltaurine hydrolaseChenodeoxycholoyltaurine hydrolase
The systematic name of this enzyme class is chenodeoxycholoyltaurine amidohydrolase. This enzyme participates in bile acid ...
https://en.wikipedia.org/wiki/Chenodeoxycholoyltaurine_hydrolase
Penicillin amidasePenicillin amidase
The systematic name of this enzyme class is penicillin amidohydrolase. Other names in common use include penicillin acylase, ...
https://en.wikipedia.org/wiki/Penicillin_amidase
Acylagmatine amidaseAcylagmatine amidase
The systematic name of this enzyme class is benzoylagmatine amidohydrolase. Other names in common use include acylagmatine ... hydrolysis of bleomycin B2 by a Fusarium acylagmatine amidohydrolase". The Journal of Antibiotics. 26 (2): 117-9. doi:10.7164/ ... amidohydrolase, and acylagmatine deacylase. Umezawa H, Takahashi Y, Fujii A, Saino T, Shirai T (February 1973). "Letter: ...
https://en.wikipedia.org/wiki/Acylagmatine_amidase
MimosinaseMimosinase
The systematic name of this enzyme class is mimosine amidohydrolase. Tangendjaja B, Lowry JB, Wills RH (1986). "Isolation of a ...
https://en.wikipedia.org/wiki/Mimosinase
FormamidaseFormamidase
The systematic name of this enzyme class is formamide amidohydrolase. This enzyme participates in glyoxylate and dicarboxylate ...
https://en.wikipedia.org/wiki/Formamidase
N-acetylmuramoyl-L-alanine amidaseN-acetylmuramoyl-L-alanine amidase
The systematic name of this enzyme class is peptidoglycan amidohydrolase. Other names in common use include acetylmuramyl-L- ...
https://en.wikipedia.org/wiki/N-acetylmuramoyl-L-alanine_amidase
Amidohydrolase - WikipediaAmidohydrolase - Wikipedia
Amidohydrolases (or amidases) are a type of hydrolase that acts upon amide bonds. They are categorized under EC number EC 3.5.1 ... Biology portal Aminohydrolases Amidohydrolases at the US National Library of Medicine Medical Subject Headings (MeSH) ... Amidohydrolase Overview from the EFI[permanent dead link] v t e. ... Beta-lactamase Histone deacetylase Urease The amidohydrolase ...
https://en.wikipedia.org/wiki/Amidohydrolase
Maleamate amidohydrolase - WikipediaMaleamate amidohydrolase - Wikipedia
Maleamate amidohydrolase (EC 3.5.1.107, NicF) is an enzyme with systematic name maleamate amidohydrolase. This enzyme catalyses ... Maleamate+amidohydrolase at the US National Library of Medicine Medical Subject Headings (MeSH) Biology portal. ...
https://en.wikipedia.org/wiki/Maleamate_amidohydrolase
Amidohydrolase dictionary definition | amidohydrolase definedAmidohydrolase dictionary definition | amidohydrolase defined
... plural amidohydrolases) 1. Any of a class of hydrolases that act upon amide bonds. ... ... amidohydrolase. Noun (countable and uncountable, plural amidohydrolases). *Any of a class of hydrolases that act upon amide ... How would you define amidohydrolase? Add your definition here.. Please enable JavaScript to view the comments powered by Disqus ...
http://www.yourdictionary.com/amidohydrolase
creatinine amidohydrolase (creatininase) protein [Rhizobium etli CFN 4 - Protein - NCBIcreatinine amidohydrolase (creatininase) protein [Rhizobium etli CFN 4 - Protein - NCBI
creatinine amidohydrolase (creatininase) protein [Rhizobium etli CFN 42]. * Record removed. The sequence YP_471106 is 100% ...
https://www.ncbi.nlm.nih.gov/protein/86359214
AMDHD1 amidohydrolase domain containing 1 [Homo sapiens (human)] - Gene - NCBIAMDHD1 amidohydrolase domain containing 1 [Homo sapiens (human)] - Gene - NCBI
AMDHD1 amidohydrolase domain containing 1 [Homo sapiens] AMDHD1 amidohydrolase domain containing 1 [Homo sapiens]. Gene ID: ... amidohydrolase domain containing 1provided by HGNC. Primary source. HGNC:HGNC:28577 See related. Ensembl:ENSG00000139344 Gene ... AMDHD1 amidohydrolase domain containing 1 [ Homo sapiens (human) ] Gene ID: 144193, updated on 24-Nov-2020 ... HutI; Imidazolonepropionase or related amidohydrolase [Secondary metabolites biosynthesis, transport and catabolism]. cd01296. ...
https://www.ncbi.nlm.nih.gov/gene/144193
RCSB PDB - Protein Feature View - Allantoate amidohydrolase - P77425 (ALLC ECOLI)RCSB PDB - Protein Feature View - Allantoate amidohydrolase - P77425 (ALLC ECOLI)
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
http://www.rcsb.org/pdb/protein/P77425
RCSB PDB - 3NUR: Crystal structure of a putative amidohydrolase from Staphylococcus aureusRCSB PDB - 3NUR: Crystal structure of a putative amidohydrolase from Staphylococcus aureus
Amidohydrolase. A. 357. Staphylococcus aureus. Mutation(s): 0 Gene Names: SAOG_01574, SAV2580. EC: 3.5.1. ... Crystal structure of a putative amidohydrolase from Staphylococcus aureus. Qiu, W., Lam, R., Romanov, V., Lam, K., Soloveychik ... Crystal structure of a putative amidohydrolase from Staphylococcus aureus. *DOI: 10.2210/pdb3NUR/pdb ...
https://www.rcsb.org/structure/3nur
Distribution of anandamide amidohydrolase in rat tissues with special reference to small intestineDistribution of anandamide amidohydrolase in rat tissues with special reference to small intestine
... is hydrolyzed by an amidohydrolase and its biological activity is lost. Previously, we partially purified the enzyme from ... Distribution of anandamide amidohydrolase in rat tissues with special reference to small intestine Biochim Biophys Acta. 1997 ... Anandamide (arachidonylethanolamide), an endogenous ligand for cannabinoid receptors, is hydrolyzed by an amidohydrolase and ...
https://pubmed.ncbi.nlm.nih.gov/9295166/?dopt=Abstract
WDYHV1 - Protein N-terminal glutamine amidohydrolase - Homo sapiens (Human) - WDYHV1 gene & proteinWDYHV1 - Protein N-terminal glutamine amidohydrolase - Homo sapiens (Human) - WDYHV1 gene & protein
Protein N-terminal glutamine amidohydrolase (EC:3.5.1.122By similarity. Manual assertion inferred from sequence similarity toi ... "Crystal structure of human protein N-terminal glutamine amidohydrolase, an initial component of the N-end rule pathway.". Park ... sp,Q96HA8,NTAQ1_HUMAN Protein N-terminal glutamine amidohydrolase OS=Homo sapiens OX=9606 GN=WDYHV1 PE=1 SV=2 ...
https://www.uniprot.org/uniprot/Q96HA8
Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida. | Journal of BacteriologyPurification and properties of formylglutamate amidohydrolase from Pseudomonas putida. | Journal of Bacteriology
Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida.. L Hu, L M Mulfinger, A T Phillips ... Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida. Message Subject (Your Name) has ...
https://jb.asm.org/content/169/10/4696/article-info
Plants | Free Full-Text | Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to...Plants | Free Full-Text | Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to...
Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis by Beatriz ... "Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis." Plants 3, ... Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis. Plants 2014 ... Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis. Plants. 2014 ...
https://www.mdpi.com/2223-7747/3/3/324
cbiZ - Adenosylcobinamide amidohydrolase - Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1) - cbiZ gene &...cbiZ - Adenosylcobinamide amidohydrolase - Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1) - cbiZ gene &...
Adenosylcobinamide amidohydrolaseAdd BLAST. 231. Proteomic databases. PaxDb, a database of protein abundance averages across ... "CbiZ, an amidohydrolase enzyme required for salvaging the coenzyme B12 precursor cobinamide in archaea.". Woodson J.D., ... Adenosylcobinamide amidohydrolase (EC:3.5.1.90*Search proteins in UniProtKB for this EC number. ... sp,Q9HPK9,CBIZ_HALSA Adenosylcobinamide amidohydrolase OS=Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1) OX= ...
https://www.uniprot.org/uniprot/Q9HPK9
Target Selection and Annotation for the Structural Genomics of the Amidohydrolase and Enolase SuperfamiliesTarget Selection and Annotation for the Structural Genomics of the Amidohydrolase and Enolase Superfamilies
... we use the amidohydrolase and enolase superfamilies as model systems; members of these superfamilies share a common TIM barrel ... Target Selection and Annotation for the Structural Genomics of the Amidohydrolase and Enolase Superfamilies J Struct Funct ... To study the substrate specificity of enzymes, we use the amidohydrolase and enolase superfamilies as model systems; members of ... To date, 20 unique amidohydrolase and 41 unique enolase structures have been determined, increasing the fraction of sequences ...
https://pubmed.ncbi.nlm.nih.gov/19219566/
AMDHD1 (amidohydrolase domain containing 1) - KOMP (Knockout Mouse Project)AMDHD1 (amidohydrolase domain containing 1) - KOMP (Knockout Mouse Project)
amidohydrolase domain containing 1. Synonyms: 1300019J08Rik. Gene nomenclature, locus information, and GO, OMIM, and PMID ...
https://www.komp.org/geneinfo.php?geneid=23203
Frontiers | Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the...Frontiers | Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the...
In the final reaction, N-carbamoylputrescine is hydrolyzed to putrescine by N-carbamoylputrescine amidohydrolase (CPA, EC 3.5. ... In the final reaction, N-carbamoylputrescine is hydrolyzed to putrescine by N-carbamoylputrescine amidohydrolase (CPA, EC 3.5. ... 2000). Crystal structure of N-carbamyl-D-amino acid amidohydrolase with a novel catalytic framework common to amidohydrolases. ... N-carbamoylputrescine amidohydrolase enzymes belong to nitrilases, and more precisely, to C-N hydrolases breaking non-peptide ...
https://www.frontiersin.org/articles/10.3389/fpls.2016.00350/full
Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup | Biochemical JournalCharacterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup | Biochemical Journal
Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup. Jeevan L. Khurana, ... Sequence analysis showed that these enzymes belong to the metal-dependent amidohydrolase superfamily, although they contain a ... Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup ... Characterization of the phenylurea hydrolases A and B: founding members of a novel amidohydrolase subgroup ...
http://www.biochemj.org/content/418/2/431
ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ...ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ...
By fusing GPB to the CHAP (cysteine, histidine-dependent amidohydrolase/peptidase) catalytic domain of the PlyC lysin, we ... ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ... ClyJ Is a Novel Pneumococcal Chimeric Lysin with a Cysteine- and Histidine-Dependent Amidohydrolase/Peptidase Catalytic Domain ... CHAP, cysteine, histidine-dependent amidohydrolases/peptidases; PlyCA CHAP, the CHAP domain from PlyCA (amino acids 314 to 465 ...
https://aac.asm.org/content/63/4/e02043-18
Allantoate amidohydrolase elisa and antibodyAllantoate amidohydrolase elisa and antibody
Recombinant Protein and Allantoate amidohydrolase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody ... Allantoate amidohydrolase. Allantoate amidohydrolase ELISA Kit. Allantoate amidohydrolase Recombinant. Allantoate ... Below are the list of possible Allantoate amidohydrolase products. If you cannot find the target and/or product is not ... Also known as Allantoate amidohydrolase (Allantoate deiminase).. Escherichia coli is able to utilize allantoin as a sole ...
https://www.mybiosource.com/protein_family.php?root=allantoate-amidohydrolase
Protein N-terminal glutamine amidohydrolaseProtein N-terminal glutamine amidohydrolase
Crystal structure of human protein N-terminal glutamine amidohydrolase, an initial component of the N-end rule pathway.. ...
https://pharos.nih.gov/idg/targets/Q96HA8
Substrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosaSubstrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosa
... Krämer, Andreas; Herzer, Jan ... all three putative acetylpolyamine amidohydrolases (APAHs) from P. aeruginosa have been expressed in enzymatic active form. The ...
https://publikationen.bibliothek.kit.edu/1000062791
N-acylsphingosine amidohydrolase 1 - Target Profiles - BCIQN-acylsphingosine amidohydrolase 1 - Target Profiles - BCIQ
For the biopharma industry investment, business development and competitive intelligence professionals who require information to support financing, partnering and licensing activities, BCIQ provides accurate information and context to support profitable and strategic decision making. Unlike other intelligence solutions, BCIQ exclusively supports the unique needs of the biopharma industry and provides in-depth, integrated analysis and context on clinical, strategic, financial, regulatory and policy issues.
https://profiles.biocentury.com/targets/n-acylsphingosine_amidohydrolase_1_
Q2RGM7 | Moth 2120 | Cyanuric acid amidohydrolase | Druggability | CancerQ2RGM7 | Moth 2120 | Cyanuric acid amidohydrolase | Druggability | Cancer
Cyanuric acid amidohydrolase - Also known as CAH_MOOTA, Moth_2120. Responsible for the hydrolysis of cyanuric acid, an ...
https://corona-2.cansar.icr.ac.uk/target/Q2RGM7/synopsis
Creatinine amidohydrolase, 150 units/mg solid, 250 U - JuniperLifeSciencesCreatinine amidohydrolase, 150 units/mg solid, 250 U - JuniperLifeSciences
It is a cyclic amidohydrolase catalysing the reversible conversion of creatinine to creatine. Each monomer contains a binuclear ... Home / PRODUCTS / MP Biologicals / Life Sciences / Creatinine amidohydrolase, 150 units/mg solid, 250 U. ...
https://www.juniperlifesciences.com/store/mpbio/life-sciences/creatinine-amidohydrolase-150-units-mg-solid-250-u/
GTP cyclohydrolase II - WikipediaGTP cyclohydrolase II - Wikipedia
Thus, the two substrates of this enzyme are GTP and H2O, whereas its 3 products are formate, 2,5-diamino-6-hydroxy-4-(5-phosphoribosylamino)pyrimidine, and diphosphate.. This enzyme belongs to the family of hydrolases, those acting on carbon-nitrogen bonds other than peptide bonds, specifically in cyclic amidines. The systematic name of this enzyme class is GTP 7,8-8,9-dihydrolase (diphosphate-forming). Other names in common use include guanosine triphosphate cyclohydrolase II, and GTP-8-formylhydrolase. This enzyme participates in riboflavin metabolism.. ...
https://en.wikipedia.org/wiki/GTP_cyclohydrolase_II
Succinyl-diaminopimelate desuccinylase - WikipediaSuccinyl-diaminopimelate desuccinylase - Wikipedia
The systematic name of this enzyme class is N-succinyl-LL-2,6-diaminoheptanedioate amidohydrolase. This enzyme is also called N ...
https://en.wikipedia.org/wiki/Succinyl-diaminopimelate_desuccinylase
NAVER Academic | Penicillin amidohydrolase productivity of locally isolated bacterial speciesNAVER Academic | Penicillin amidohydrolase productivity of locally isolated bacterial species
Penicillin amidohydrolase productivity of four locally isolated bacterial species is described. Organisms were identified ... Penicillin amidohydrolase productivity of locally isolated bacterial species. Author. Z. A. Mahmood, D. Shaikh, S. M. S. Zoha. ... Penicillin amidohydrolase productivity of four locally isolated bacterial species is described. Organisms were identified ...
http://academic.naver.com/article.naver?doc_id=34670096
Substrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosa | BMC Biochemistry | Full TextSubstrate specificity and function of acetylpolyamine amidohydrolases from Pseudomonas aeruginosa | BMC Biochemistry | Full Text
... all three putative acetylpolyamine amidohydrolases (APAHs) from P. aeruginosa have been expressed in enzymatic active form. The ... A new amidohydrolase from Bordetella or Alcaligenes strain FB188 with similarities to histone deacetylases. J Bacteriol. 2004; ... a Multiple Sequence Alignment of PA0321, PA1409 and PA3774 from P. aeruginosa, acetylpolyamine amidohydrolase APAH from M. ... 1a). Based on their sequence, PA0321 and PA1409 form a cluster with the verified functional acetylpolyamine amidohydrolase APAH ...
https://bmcbiochem.biomedcentral.com/articles/10.1186/s12858-016-0063-z
Gentaur Molecular :EIAab \ ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa \ E2259pGentaur Molecular :EIAab \ ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa \ E2259p
N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa \ E2259p for more molecular products just contact us ... Product name : ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa ... E2259p ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa Ask technical file . ... We have also other products like : ELISA kit ACY1,ACY-1,Aminoacylase-1,N-acyl-L-amino-acid amidohydrolase,Pig,Sus scrofa. ...
http://www.antibody-antibodies.com/product2766120-search-ELISA_kit__ACY1,ACY_1,Aminoacylase_1,N_acyl_L_amino_acid_amidohydrolase,Pig,Sus_scrofa.html
Structure and catalytic mechanism of LigI: Insight into the amidohydrolase enzymes of cog3618 and lignin degradation<...Structure and catalytic mechanism of LigI: Insight into the amidohydrolase enzymes of cog3618 and lignin degradation<...
This protein is a member of the amidohydrolase superfamily of enzymes. The protein was expressed in Escherichia coli and then ... This protein is a member of the amidohydrolase superfamily of enzymes. The protein was expressed in Escherichia coli and then ... This protein is a member of the amidohydrolase superfamily of enzymes. The protein was expressed in Escherichia coli and then ... This protein is a member of the amidohydrolase superfamily of enzymes. The protein was expressed in Escherichia coli and then ...
https://einstein.pure.elsevier.com/en/publications/structure-and-catalytic-mechanism-of-ligi-insight-into-the-amidoh-2
ASAH2 Gene - GeneCards | ASAH2 Protein | ASAH2 AntibodyASAH2 Gene - GeneCards | ASAH2 Protein | ASAH2 Antibody
N-Acylsphingosine Amidohydrolase 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - ... ASAH2 (N-Acylsphingosine Amidohydrolase 2) is a Protein Coding gene. Diseases associated with ASAH2 include Sphingolipidosis ... View all R&D Systems ASAH2 (ASAH2/N-acylsphingosine Amidohydrolase-2) Proteins and Enzymes*Recombinant Human ASAH2 Protein, CF ... View all 3 R&D Systems ASAH2 (ASAH2/N-acylsphingosine Amidohydrolase-2) Primary Antibodies*Human ASAH2/N-acylsphingosine ...
https://www.genecards.org/cgi-bin/carddisp.pl?gene=ASAH2&keywords=GH10J050375&prefilter=genomic_location
SuperfamilyGlutamine amidohydrolaseHydrolaseHistidine-dependentGenePutativeEnzymeAmidaseAllantoateMaleamate amidohydrolasePseudomonasCreatinineFunctionallySubstrateCharacterizationBiologicalMEDLINEEnzymesPrimary
Superfamily9
  • We present case studies of proteins related to uronate isomerase (an amidohydrolase superfamily member) and mandelate racemase (an enolase superfamily member), to illustrate how this structure-focused approach can be used to generate hypotheses about sequence-structure-function relationships. (nih.gov)
  • Sequence analysis showed that these enzymes belong to the metal-dependent amidohydrolase superfamily, although they contain a hitherto unreported Asn-X-His metal-binding motif and appear to form a novel sub-group within this superfamily. (biochemj.org)
  • Examples include: Beta-lactamase Histone deacetylase Urease The amidohydrolase superfamily is a large protein family of more than 20,000 members with diverse chemistry and physiologic roles. (wikipedia.org)
  • This protein is a member of the amidohydrolase superfamily of enzymes. (elsevier.com)
  • This is the first enzyme from the amidohydrolase superfamily that does not require a divalent metal ion for catalytic activity. (elsevier.com)
  • Structural Determinants for Substrate Selectivity in Guanine Deaminase Enzymes of the Amidohydrolase Superfamily. (anl.gov)
  • Here, we report the crystal structures of and guanine deaminase enzymes (EcGuaD and Gud1, respectively), both members of the amidohydrolase superfamily. (anl.gov)
  • These proteins are members of the amidohydrolase superfamily and are currently misannotated in NCBI as catalyzing the hydrolysis of L-Xaa-L-Pro dipeptides. (elsevier.com)
  • GLI, a member of the functionally diverse amidohydrolase superfamily, is a homologue of LigI that catalyzes the hydrolysis of 2-pyrone-4,6-dicarboxylate in lignin degradation. (illinois.edu)
Glutamine amidohydrolase1
  • Crystal structure of human protein N-terminal glutamine amidohydrolase, an initial component of the N-end rule pathway. (nih.gov)
Hydrolase1
  • Amidohydrolases (or amidases) are a type of hydrolase that acts upon amide bonds. (wikipedia.org)
Histidine-dependent3
  • By fusing GPB to the CHAP (cysteine, histidine-dependent amidohydrolase/peptidase) catalytic domain of the PlyC lysin, we constructed a novel chimeric lysin, ClyJ, with improved activity to the pneumococcal Cpl-1 lysin. (asm.org)
  • Inhibitor studies predicted the presence of an active-site cysteine, and bioinformatic analysis revealed a cysteine, histidine-dependent amidohydrolase/peptidase domain within PlyCA. (pnas.org)
  • Cysteine/histidine-dependent amidohydrolase/peptidase (CHAP) and amidase are shown lytic activity against methicillin-resistant Staphylococcus aureus (MRSA). (indybedbugpros.com)
Gene3
  • ASAH2 (N-Acylsphingosine Amidohydrolase 2) is a Protein Coding gene. (genecards.org)
  • Gene Ontology (GO) annotations related to this gene include N-acylsphingosine amidohydrolase activity . (genecards.org)
  • Acetylpolyamine amidohydrolase from Mycoplana ramosa: gene cloning and characterization of the metal-substituted enzyme. (pseudomonas.com)
Putative1
  • Results: To elucidate the role of acetylpolyamines and their enzymatic deacetylation in more detail, all three putative acetylpolyamine amidohydrolases (APAHs) from P. aeruginosa have been expressed in enzymatic active form. (kit.edu)
Enzyme5
  • Here, we describe a collaboration between the Enzyme Specificity Consortium (ENSPEC) and the New York SGX Research Center for Structural Genomics (NYSGXRC) that aims to maximize the structural coverage of the amidohydrolase and enolase superfamilies. (nih.gov)
  • Maleamate amidohydrolase (EC 3.5.1.107, NicF) is an enzyme with systematic name maleamate amidohydrolase. (wikipedia.org)
  • The systematic name of this enzyme class is N-succinyl-LL-2,6-diaminoheptanedioate amidohydrolase . (wikipedia.org)
  • Schnackerz KD, Dobritzsch D. Amidohydrolases of the reductive pyrimidine catabolic pathway purification, characterization, structure, reaction mechanisms and enzyme deficiency. (medlineplus.gov)
  • 2 . The electrode strip of claim 1 wherein said enzyme is selected from the group consisting of glucose oxidase, lactate oxidase, cholesterol oxidase, and creatinine amidohydrolase. (google.com)
Amidase1
Allantoate3
  • Below are the list of possible Allantoate amidohydrolase products. (mybiosource.com)
  • Also known as Allantoate amidohydrolase (Allantoate deiminase). (mybiosource.com)
  • Similar nitrate-dependent senescence phenotypes were evident in the older leaves of allantoinase ( Ataln ) and allantoate amidohydrolase ( Ataah ) mutants, which also are impaired in purine catabolism. (plantphysiol.org)
Maleamate amidohydrolase1
  • The fifth step of this catabolic pathway involves hydrolytic deamidation of maleamate into maleate by maleamate amidohydrolase, NicF. (wooster.edu)
Pseudomonas1
  • Purification and properties of formylglutamate amidohydrolase from Pseudomonas putida. (asm.org)
Creatinine1
  • It is a cyclic amidohydrolase catalysing the reversible conversion of creatinine to creatine. (juniperlifesciences.com)
Functionally3
  • The functionally related amidohydrolases, including D-hydantoinases, dihydropyrimidinases, allantoinases and dihydro-orotases, share a similar catalytic function of acting on the cyclic amide ring. (kaist.ac.kr)
  • As a particular sequence, one aspartic acid and four histidine residues are found to be rigidly conserved in the functionally related amidohydrolases. (kaist.ac.kr)
  • On the basis of the similar catalytic function and existence of the rigidly conserved sequence, we propose a close evolutionary relationship among the functionally related amidohydrolases, including D-hydantoinase, dihydropyrimidinase, allantoinase and dihydroorotase. (kaist.ac.kr)
Substrate2
  • Despite the availability of several crystal structures, the molecular determinants of substrate orientation and mechanism remain to be elucidated for the amidohydrolase family of guanine deaminase enzymes. (anl.gov)
  • Overall, this work details key structural features of substrate recognition and catalysis of the amidohydrolase family of guanine deaminase enzymes in support of our long-term goal to engineer these enzymes with altered activity and substrate specificity. (anl.gov)
Characterization1
  • Sánchez-Parra B, Frerigmann H, Alonso M-MP, Loba VC, Jost R, Hentrich M, Pollmann S. Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis. (mdpi.com)
Biological1
  • Anandamide (arachidonylethanolamide), an endogenous ligand for cannabinoid receptors, is hydrolyzed by an amidohydrolase and its biological activity is lost. (nih.gov)
MEDLINE1
  • Search Medline for phenylurea AND amidohydrolase . (ethz.ch)
Enzymes2
  • As one of the primary enzymes in the system, fatty acid amidohydrolase (FAAH) works to break down anandamide. (royalqueenseeds.ru)
  • A key gap in this docking approach has been the reliance on modeling noncovalent fit between a substrate and an enzyme using modifications of methods first developed for inhibitor discovery.22?26 Whereas this has proven effective for metalloenzymes such as those in the amidohydrolase and enolase superfamilies many enzymes proceed through a covalent intermediate that does not lend itself readily to noncovalent modeling. (livingseas.org)
Primary1
  • A hydrolytic mechanism for a Mn2+ dependent amidohydrolases that disfavour Zn2+ as the primary catalytically active site metal proposed here is supported by these likely cases of convergent evolution. (uio.no)