AnatomyOrganismsDiseasesChemicals and DrugsPsychiatry and PsychologyPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaInformation ScienceHealth CareGeographicals
Rectal FistulaFranceAlveolataCoral ReefsSphagnopsidaMarine BiologyDinoflagellidaDecanoatesOceans and SeasCaenorhabditis elegansGeologic SedimentsTidal WavesEukaryotaAnthozoaEcosystemGiardia lambliaEuglenozoaGiardiaEuglenidaGiardiasisEuglenozoa InfectionsIntestinal Diseases, ParasiticMitochondriaVoltage-Gated Sodium ChannelsSmellOlfaction DisordersTemplates, GeneticJointsOdorsOlfactory PerceptionKnee JointTaste DisordersOlfactory PathwaysEncyclopedias as TopicPlasmodium falciparumPlasmodiumMalariaMedlinePlusAnnexinsPlasmodium vivaxMalaria, FalciparumPlasmodium bergheiConsumer Health InformationTrombiculidaePhthirapteraEsocidaeArguloidaAcariMitesArgasidaeMite InfestationsTicksVarroidaeIndonesiaTrichomonas vaginalisHydrogenaseTrichomonas VaginitisTrichomonasMalaysiaTrichomonas InfectionsSuccinate-CoA Ligases
Rectal Fistula: An abnormal anatomical passage connecting the RECTUM to the outside, with an orifice at the site of drainage.France: A country in western Europe bordered by the Atlantic Ocean, the English Channel, the Mediterranean Sea, and the countries of Belgium, Germany, Italy, Spain, Switzerland, the principalities of Andorra and Monaco, and by the duchy of Luxembourg. Its capital is Paris.Alveolata: A group of three related eukaryotic phyla whose members possess an alveolar membrane system, consisting of flattened membrane-bound sacs lying beneath the outer cell membrane.Coral Reefs: Marine ridges composed of living CORALS, coral skeletons, calcareous algae, and other organisms, mixed with minerals and organic matter. They are found most commonly in tropical waters and support other animal and plant life.Sphagnopsida: A class of BRYOPHYTA which is best known for Sphagnum forming PEAT bogs.Marine Biology: The study of the origin, structure, development, growth, function, genetics, and reproduction of organisms which inhabit the OCEANS AND SEAS.Dinoflagellida: Flagellate EUKARYOTES, found mainly in the oceans. They are characterized by the presence of transverse and longitudinal flagella which propel the organisms in a rotating manner through the water. Dinoflagellida were formerly members of the class Phytomastigophorea under the old five kingdom paradigm.Decanoates: Salts and esters of the 10-carbon monocarboxylic acid-decanoic acid.Oceans and Seas: A great expanse of continuous bodies of salt water which together cover more than 70 percent of the earth's surface. Seas may be partially or entirely enclosed by land, and are smaller than the five oceans (Atlantic, Pacific, Indian, Arctic, and Antarctic).Caenorhabditis elegans: A species of nematode that is widely used in biological, biochemical, and genetic studies.Geologic Sediments: A mass of organic or inorganic solid fragmented material, or the solid fragment itself, that comes from the weathering of rock and is carried by, suspended in, or dropped by air, water, or ice. It refers also to a mass that is accumulated by any other natural agent and that forms in layers on the earth's surface, such as sand, gravel, silt, mud, fill, or loess. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1689)Tidal Waves: Water waves caused by the gravitational interactions between the EARTH; MOON; and SUN.Eukaryota: One of the three domains of life (the others being BACTERIA and ARCHAEA), also called Eukarya. These are organisms whose cells are enclosed in membranes and possess a nucleus. They comprise almost all multicellular and many unicellular organisms, and are traditionally divided into groups (sometimes called kingdoms) including ANIMALS; PLANTS; FUNGI; and various algae and other taxa that were previously part of the old kingdom Protista.Anthozoa: A class in the phylum CNIDARIA, comprised mostly of corals and anemones. All members occur only as polyps; the medusa stage is completely absent.Ecosystem: A functional system which includes the organisms of a natural community together with their environment. (McGraw Hill Dictionary of Scientific and Technical Terms, 4th ed)Giardia lamblia: A species of parasitic EUKARYOTES that attaches itself to the intestinal mucosa and feeds on mucous secretions. The organism is roughly pear-shaped and motility is somewhat erratic, with a slow oscillation about the long axis.Euglenozoa: A large group of flagellated EUKARYOTES found in both free-living and parasitic forms. The flagella are present in pairs and contain unique paraxonemal rods.Giardia: A genus of flagellate intestinal EUKARYOTES parasitic in various vertebrates, including humans. Characteristics include the presence of four pairs of flagella arising from a complicated system of axonemes and cysts that are ellipsoidal to ovoidal in shape.Euglenida: A phylum of unicellular flagellates of ancient eukaryotic lineage with unclear taxonomy. They lack a CELL WALL but are covered by a proteinaceous flexible coat, the pellicle, that allows the cell to change shape. Historically some authorities considered them to be an order of protozoa and others classed them as ALGAE (some members have CHLOROPLASTS and some don't).Giardiasis: An infection of the SMALL INTESTINE caused by the flagellated protozoan GIARDIA LAMBLIA. It is spread via contaminated food and water and by direct person-to-person contact.Euglenozoa Infections: Infections with the protozoa of the phylum EUGLENOZOA.Intestinal Diseases, Parasitic: Infections of the INTESTINES with PARASITES, commonly involving PARASITIC WORMS. Infections with roundworms (NEMATODE INFECTIONS) and tapeworms (CESTODE INFECTIONS) are also known as HELMINTHIASIS.Mitochondria: Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)Voltage-Gated Sodium Channels: A family of membrane proteins that selectively conduct SODIUM ions due to changes in the TRANSMEMBRANE POTENTIAL DIFFERENCE. They typically have a multimeric structure with a core alpha subunit that defines the sodium channel subtype and several beta subunits that modulate sodium channel activity.Smell: The ability to detect scents or odors, such as the function of OLFACTORY RECEPTOR NEURONS.Olfaction Disorders: Loss of or impaired ability to smell. This may be caused by OLFACTORY NERVE DISEASES; PARANASAL SINUS DISEASES; viral RESPIRATORY TRACT INFECTIONS; CRANIOCEREBRAL TRAUMA; SMOKING; and other conditions.Templates, Genetic: Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.Joints: Also known as articulations, these are points of connection between the ends of certain separate bones, or where the borders of other bones are juxtaposed.Odors: The volatile portions of substances perceptible by the sense of smell. (Grant & Hackh's Chemical Dictionary, 5th ed)Olfactory Perception: The process by which the nature and meaning of olfactory stimuli, such as odors, are recognized and interpreted by the brain.Knee Joint: A synovial hinge connection formed between the bones of the FEMUR; TIBIA; and PATELLA.Taste Disorders: Conditions characterized by an alteration in gustatory function or perception. Taste disorders are frequently associated with OLFACTION DISORDERS. Additional potential etiologies include METABOLIC DISEASES; DRUG TOXICITY; and taste pathway disorders (e.g., TASTE BUD diseases; FACIAL NERVE DISEASES; GLOSSOPHARYNGEAL NERVE DISEASES; and BRAIN STEM diseases).Olfactory Pathways: Set of nerve fibers conducting impulses from olfactory receptors to the cerebral cortex. It includes the OLFACTORY NERVE; OLFACTORY BULB; OLFACTORY TRACT; OLFACTORY TUBERCLE; ANTERIOR PERFORATED SUBSTANCE; and OLFACTORY CORTEX.Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Plasmodium falciparum: A species of protozoa that is the causal agent of falciparum malaria (MALARIA, FALCIPARUM). It is most prevalent in the tropics and subtropics.Plasmodium: A genus of protozoa that comprise the malaria parasites of mammals. Four species infect humans (although occasional infections with primate malarias may occur). These are PLASMODIUM FALCIPARUM; PLASMODIUM MALARIAE; PLASMODIUM OVALE, and PLASMODIUM VIVAX. Species causing infection in vertebrates other than man include: PLASMODIUM BERGHEI; PLASMODIUM CHABAUDI; P. vinckei, and PLASMODIUM YOELII in rodents; P. brasilianum, PLASMODIUM CYNOMOLGI; and PLASMODIUM KNOWLESI in monkeys; and PLASMODIUM GALLINACEUM in chickens.Malaria: A protozoan disease caused in humans by four species of the PLASMODIUM genus: PLASMODIUM FALCIPARUM; PLASMODIUM VIVAX; PLASMODIUM OVALE; and PLASMODIUM MALARIAE; and transmitted by the bite of an infected female mosquito of the genus ANOPHELES. Malaria is endemic in parts of Asia, Africa, Central and South America, Oceania, and certain Caribbean islands. It is characterized by extreme exhaustion associated with paroxysms of high FEVER; SWEATING; shaking CHILLS; and ANEMIA. Malaria in ANIMALS is caused by other species of plasmodia.MedlinePlus: NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.Annexins: Family of calcium- and phospholipid-binding proteins which are structurally related and exhibit immunological cross-reactivity. Each member contains four homologous 70-kDa repeats. The annexins are differentially distributed in vertebrate tissues (and lower eukaryotes) and appear to be involved in MEMBRANE FUSION and SIGNAL TRANSDUCTION.Plasmodium vivax: A protozoan parasite that causes vivax malaria (MALARIA, VIVAX). This species is found almost everywhere malaria is endemic and is the only one that has a range extending into the temperate regions.Malaria, Falciparum: Malaria caused by PLASMODIUM FALCIPARUM. This is the severest form of malaria and is associated with the highest levels of parasites in the blood. This disease is characterized by irregularly recurring febrile paroxysms that in extreme cases occur with acute cerebral, renal, or gastrointestinal manifestations.Plasmodium berghei: A protozoan parasite of rodents transmitted by the mosquito Anopheles dureni.Consumer Health Information: Information intended for potential users of medical and healthcare services. There is an emphasis on self-care and preventive approaches as well as information for community-wide dissemination and use.Trombiculidae: Family of MITES in the superfamily Trombiculoidea, suborder Prostigmata, which attack humans and other vertebrates, causing DERMATITIS and severe allergic reactions. Chiggers, red bugs, and harvest mites commonly refer to the larval stage of Trombiculid mites, the only parasitic stage of the mite's life cycle.Phthiraptera: An order of small, wingless parasitic insects, commonly known as lice. The suborders include ANOPLURA (sucking lice); AMBLYCERA; ISCHNOCERA; and Rhynchophthirina (elephant and warthog lice).Esocidae: A family of freshwater fish of the order ESOCIFORMES, comprising the pikes, inhabiting the waters of the Northern Hemisphere. There is one genus, Esox, with five species: northern pike, grass pickerel, chain pickerel, muskellunge, and Amur pike.Arguloida: An order of CRUSTACEA that are parasitic on freshwater fish.Acari: A large, subclass of arachnids comprising the MITES and TICKS, including parasites of plants, animals, and humans, as well as several important disease vectors.Mites: Any arthropod of the subclass ACARI except the TICKS. They are minute animals related to the spiders, usually having transparent or semitransparent bodies. They may be parasitic on humans and domestic animals, producing various irritations of the skin (MITE INFESTATIONS). Many mite species are important to human and veterinary medicine as both parasite and vector. Mites also infest plants.Argasidae: A family of softbacked TICKS, in the subclass ACARI. Genera include ARGAS and ORNITHODOROS among others.Mite Infestations: Infestations with arthropods of the subclass ACARI, superorder Acariformes.Ticks: Blood-sucking acarid parasites of the order Ixodida comprising two families: the softbacked ticks (ARGASIDAE) and hardbacked ticks (IXODIDAE). Ticks are larger than their relatives, the MITES. They penetrate the skin of their host by means of highly specialized, hooked mouth parts and feed on its blood. Ticks attack all groups of terrestrial vertebrates. In humans they are responsible for many TICK-BORNE DISEASES, including the transmission of ROCKY MOUNTAIN SPOTTED FEVER; TULAREMIA; BABESIOSIS; AFRICAN SWINE FEVER; and RELAPSING FEVER. (From Barnes, Invertebrate Zoology, 5th ed, pp543-44)Varroidae: A family of MITES in the subclass ACARI. It includes the single genus Varroa.Indonesia: A republic stretching from the Indian Ocean east to New Guinea, comprising six main islands: Java, Sumatra, Bali, Kalimantan (the Indonesian portion of the island of Borneo), Sulawesi (formerly known as the Celebes) and Irian Jaya (the western part of New Guinea). Its capital is Djakarta. The ethnic groups living there are largely Chinese, Arab, Eurasian, Indian, and Pakistani; 85% of the peoples are of the Islamic faith.Trichomonas vaginalis: A species of TRICHOMONAS that produces a refractory vaginal discharge in females, as well as bladder and urethral infections in males.Hydrogenase: An enzyme found in bacteria. It catalyzes the reduction of FERREDOXIN and other substances in the presence of molecular hydrogen and is involved in the electron transport of bacterial photosynthesis.Trichomonas Vaginitis: Inflammation of the vagina, marked by a purulent discharge. This disease is caused by the protozoan TRICHOMONAS VAGINALIS.Trichomonas: A genus of parasitic flagellate EUKARYOTES distinguished by the presence of four anterior flagella, an undulating membrane, and a trailing flagellum.Malaysia: A parliamentary democracy with a constitutional monarch in southeast Asia, consisting of 11 states (West Malaysia) on the Malay Peninsula and two states (East Malaysia) on the island of BORNEO. It is also called the Federation of Malaysia. Its capital is Kuala Lumpur. Before 1963 it was the Union of Malaya. It reorganized in 1948 as the Federation of Malaya, becoming independent from British Malaya in 1957 and becoming Malaysia in 1963 as a federation of Malaya, Sabah, Sarawak, and Singapore (which seceded in 1965). The form Malay- probably derives from the Tamil malay, mountain, with reference to its geography. (From Webster's New Geographical Dictionary, 1988, p715 & Room, Brewer's Dictionary of Names, 1992, p329)Trichomonas Infections: Infections in birds and mammals produced by various species of Trichomonas.Succinate-CoA Ligases: Enzymes that catalyze the first step leading to the oxidation of succinic acid by the reversible formation of succinyl-CoA from succinate and CoA with the concomitant cleavage of ATP to ADP (EC 6.2.1.5) or GTP to GDP (EC 6.2.1.4) and orthophosphate. Itaconate can act instead of succinate and ITP instead of GTP.EC 6.2.1.-.

Kingdoms Protozoa and Chromista and the eozoan root of the eukaryotic tree. (1/52)

 (+info)

High-level congruence of Myrionecta rubra prey and Dinophysis species plastid identities as revealed by genetic analyses of isolates from Japanese coastal waters. (2/52)

 (+info)

Diversity in a hidden world: potential and limitation of next-generation sequencing for surveys of molecular diversity of eukaryotic microorganisms. (3/52)

 (+info)

The Alveolate Perkinsus marinus: biological insights from EST gene discovery. (4/52)

 (+info)

Telomeres and telomerase activity in scleractinian corals and Symbiodinium spp. (5/52)

Telomeres are the repetitive sequences of DNA and associated proteins that cap the ends of eukaryotic chromosomes and play an essential role in maintaining chromosome stability. Compromised telomeres can lead to cell cycle arrest, senescence, apoptosis, or genetic instability, whereas maintenance of telomeres can endow cells with the capacity for indefinite self-renewal. Telomere integrity is maintained in most cells by the activity of telomerase, a ribonucleoprotein that can catalyze the addition of repeat sequences onto chromosome ends. Using the telomeric repeat amplification protocol (TRAP) assay, we detected telomerase activity in host nuclear extracts prepared from two scleractinian corals, Madracis auretenra and Madracis decactis, and also in cultured Symbiodinium, the symbiotic algae that live within corals. Sequencing the TRAP reaction products indicated that the telomeric DNA repeat sequence was TTAGGG for coral and TTTAGGG for Symbiodinium. Using this sequence information, we estimated telomere lengths by terminal restriction fragment (TRF) analysis to be greater than 19 kb for several species of coral and their associated Symbiodinium. Maintenance of coral telomeres by telomerase activity may be a mechanism that confers continuous growth and reproductive plasticity to these long-lived organisms.  (+info)

Parallel analyses of Alexandrium catenella cell concentrations and shellfish toxicity in the Puget Sound. (6/52)

 (+info)

Transcriptome analysis reveals nuclear-encoded proteins for the maintenance of temporary plastids in the dinoflagellate Dinophysis acuminata. (7/52)

 (+info)

Biogenesis of the inner membrane complex is dependent on vesicular transport by the alveolate specific GTPase Rab11B. (8/52)

 (+info)

AnatomyOrganismsDiseasesChemicals and DrugsPsychiatry and PsychologyPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaInformation ScienceHealth CareGeographicals
Rectal FistulaFranceAlveolataCoral ReefsSphagnopsidaMarine BiologyDinoflagellidaDecanoatesOceans and SeasCaenorhabditis elegansGeologic SedimentsTidal WavesEukaryotaAnthozoaEcosystemGiardia lambliaEuglenozoaGiardiaEuglenidaGiardiasisEuglenozoa InfectionsIntestinal Diseases, ParasiticMitochondriaVoltage-Gated Sodium ChannelsSmellOlfaction DisordersTemplates, GeneticJointsOdorsOlfactory PerceptionKnee JointTaste DisordersOlfactory PathwaysEncyclopedias as TopicPlasmodium falciparumPlasmodiumMalariaMedlinePlusAnnexinsPlasmodium vivaxMalaria, FalciparumPlasmodium bergheiConsumer Health InformationTrombiculidaePhthirapteraEsocidaeArguloidaAcariMitesArgasidaeMite InfestationsTicksVarroidaeIndonesiaTrichomonas vaginalisHydrogenaseTrichomonas VaginitisTrichomonasMalaysiaTrichomonas InfectionsSuccinate-CoA Ligases

*Kermia alveolata

... is a species of sea snail, a marine gastropod mollusk in the family Raphitomidae. Kermia alveolata ( ...

*Engina alveolata

... is a species of sea snail, a marine gastropod mollusk in the family Pisaniidae. Engina alveolata (Kiener, 1836 ...

*Sabellaria alveolata

S. alveolata is an annelid (ringed worm) that lives in small tubes it constructs from cemented coarse sand and/or shell ... Sabellaria alveolata, (also known as the honeycomb worm), is a reef-forming polychaete. It is distributed around the ... "Sabellaria alveolata (Linnaeus, 1767)". World Polychaeta database. World Register of Marine Species. Retrieved December 6, 2011 ... Moffat A (1999). "Action plan for Sabellaria alveolata reefs". United Kingdom Biodiversity Action Plan. Retrieved 2009-08-05. ...

*Hastulopsis alveolata

... is a species of sea snail, a marine gastropod mollusk in the family Terebridae, the auger snails. ... Hastulopsis alveolata (Hinds, 1844). Retrieved through: World Register of Marine Species on 7 April 2010.. ...

*Holoaerenica alveolata

... is a species of beetle in the family Cerambycidae. It was described by Martins in 1984. Bezark, Larry G ...

*Myzozoa

Alveolata, Myzozoa)". Eur. J. Protistol. 44 (1): 55-70. doi:10.1016/j.ejop.2007.08.004. PMID 17936600. "Alveolates". Retrieved ... Myzozoa is a grouping of specific phyla within Alveolata, that either feed through myzocytosis, or were ancestrally capable of ... However, the taxonomic term Myzozoa specifically excludes ciliates which are rather under the higher taxonomic rank Alveolata. ... Alveolata): insights into the phagotrophic ancestry of apicomplexans". J. Eukaryot. Microbiol. 50 (5): 334-40. doi:10.1111/j. ...

*List of Pleurothallis species

Pleurothallis altoserrana (Brazil - São Paulo). Pleurothallis alvaroi (Colombia). Pleurothallis alveolata (Ecuador). ...

*Hastulopsis

... alveolata (Hinds, 1844). Retrieved through: World Register of Marine Species on 13 April 2010. Hastulopsis amoena ( ... Species within the genus Hastulopsis include: Hastulopsis alveolata (Hinds, 1844) Hastulopsis amoena (Deshayes, 1859) ... synonym of Hastulopsis alveolata (Hinds, 1844) Hastulopsis gotoensis (E.A. Smith, 1961): synonym of Hastulopsis gotoensis (E.A ...

*Engina

... alveolata (Kiener, 1836). Retrieved through: World Register of Marine Species on 17 April 2010. Engina bonasia Martens, ... synonym of Engina alveolata (Kiener, 1836) Engina schrammi Crosse, 1863: synonym of Muricopsis schrammi (Crosse, 1863) Engina ... synonym of Engina alveolata (Kiener, 1836) Engina incarnata (Deshayes, 1834): synonym of Pollia incarnata (Deshayes, 1830) ... 1860 Engina alveolata (Kiener, 1836) Engina androyensis Fraussen, Monnier & Rosado, 2015 Engina armillata (Reeve, 1846) Engina ...

*Kermia

... alveolata (Dautzenberg, 1912). Retrieved through: World Register of Marine Species on 14 April 2010. Kermia aniani Kay, ... Kermia alveolata (Dautzenberg, 1912) Kermia aniani Kay, 1979 Kermia apicalis (Montrouzier in Souverbie, 1861) Kermia benhami ...

*Ornithocercus

... is a genus of Alveolata. It includes the species Ornithocercus steini. Mijares, A. J.; Sevcik; Barboza; Saavedra ...

*Vladimir Shevyakov

Über die karyokinetische Kerntheilung der Euglypha alveolata. "Morphologische Jahrbuch" 13, ss. 193-258 (1888) Man wünscht eine ...

*Goodyera

15: 327 (1918). Goodyera alveolata Pradhan, Indian Orchids: Guide Identif. & Cult. 2: 691 (1979). Goodyera amoena Schltr., ...

*Karyorelictea

Alveolata, Ciliophora)". Zoologica Scripta. 38 (6): 651-662. doi:10.1111/j.1463-6409.2009.00395.x. Xu, Yuan; Li, Jiamei; Song, ... Alveolata)". Scientific Reports. 6 (1). doi:10.1038/srep24874. ISSN 2045-2322. PMC 4850378 . PMID 27126745. Foissner, Wilhelm ( ...

*Sabellaria

The type species is Sabellaria alveolata (Linnaeus, 1767). These worms are sedentary and build tubes in which to live from sand ... 1906 Sabellaria alveolata (Linnaeus, 1767) Sabellaria bella (Grube, 1870) Sabellaria bellani Kirtley, 1994 Sabellaria bellis ...

*Fungus

Ellobiopsis, now in Alveolata, was considered a chytrid. The bacteria were also included in fungi in some classifications, as ...

*Alveolate

Alveolata comprises around 9 major and minor groups, which are very diverse in form, and are known to be related by various ... The Alveolata consist of Myzozoa, Ciliates, and Colponemids. In other words, the term Myzozoa, meaning "to siphon the contents ... Cavalier-Smith introduced the formal name Alveolata in 1991, although at the time he actually considered the grouping to be a ... Alveolata Cavalier-Smith 1991 [Alveolatobiontes] Phylum Ciliophora Doflein 1901 stat. n. Copeland 1956 [Ciliata Perty 1852; ...

*Bulbine

... alveolata S.A.Hammer Bulbine angustifolia Poelln. Bulbine annua (L.) Willd. Bulbine asphodeloides (L.) Spreng. Bulbine ...

*Mixotrophic dinoflagellate

Alveolata)" (PDF). CICIMAR Océanides. 27 (1): 65-140. Archived from the original (PDF) on 2013-11-27. Ruggiero; et al. (2015 ...

*Noctilucales

Gómez F (2012). "A checklist and classification of living dinoflagellates (Dinoflagellata, Alveolata)" (PDF). CICIMAR Océanides ...

*Halvaria

A phylogenomic analysis published in 2016 casts doubt on Halvaria, suggesting that Alveolata is the sister group to Rhizaria ( ... Halvaria is a grouping that includes Alveolata and Heterokonta (Stramenopiles). Analyses in 2007 and 2008 agree that the ... "Reducing long-branch effects in multi-protein data uncovers a close relationship between Alveolata and Rhizaria". Molecular ... Stramenopiles and the Alveolata are related, forming a reduced chromalveolate clade. They group together with the Rhizaria ( ...

*Joyeuxella

... is a genus of parasitic Alveolata of the phylum Apicomplexa. There is one species in this genus - Joyeuxella ...

*Perkinsus marinus

P. marinus is a protozoan of the protist superphylum Alveolata, the alveolates. Its phylum, Perkinsozoa, is a relatively new ...

*Babesia motasi

... is a species belonging to Alveolata and the family Babesiidae. In sheep causes babesiosis disease, called "sheep ...

*Armophorea

Da Silva Paiva, T; Do Nascimento Borges, B; Da Silva-Neto, I. D. (2013). "Phylogenetic study of Class Armophorea (Alveolata, ...
Identification of Plant-like Galactolipids in Chromera velia, a Photosynthetic Relative of Malaria Parasites* - Semantic Scholar  Identification of Plant-like Galactolipids in Chromera velia, a Photosynthetic Relative of Malaria Parasites* - Semantic Scholar
Apicomplexa are protist parasites that include Plasmodium spp., the causative agents of malaria, and Toxoplasma gondii, responsible for toxoplasmosis. Most Apicomplexa possess a relict plastid, the apicoplast, which was acquired by secondary endosymbiosis of a red alga. Despite being nonphotosynthetic, the apicoplast is otherwise metabolically similar to algal and plant plastids and is essential for parasite survival. Previous studies of Toxoplasma gondii identified membrane lipids with some structural features of plastid galactolipids, the major plastid lipid class. However, direct evidence for the plant-like enzymes responsible for galactolipid synthesis in Apicomplexan parasites has not been obtained. Chromera velia is an Apicomplexan relative recently discovered in Australian corals. C. velia retains a photosynthetic plastid, providing a unique model to study the evolution of the apicoplast. Here, we report the unambiguous presence of plant-like monogalactosyldiacylglycerol and
https://www.semanticscholar.org/paper/Identification-of-Plant-like-Galactolipids-in-Chro-Bott%C3%A9-Yamaryo-Bott%C3%A9/a75dc17c9c6b79857db584990a01fbffa835c5da
Chromera velia - Wikipedia  Chromera velia - Wikipedia
One potentially important contribution of research on C. velia, besides its position as a missing link between parasitic and algal species, is its potential in studies aimed at finding new antimalarial drugs or clarifying the function of existing antimalarial drugs . Many drugs that have been in clinical use for a long time affect functions in the apicoplast in Plasmodium cells.[27][28] The essential biological function of the apicoplast is solely the production of isoprenoids and their derivatives,[29] without which the parasites cannot live.[29]. C. velia could serve as a convenient model target for the development of antimalarial drugs, since it effectively contains the original apicoplast, as it were, and since its nuclear genome closely resembles that of the ancestral proto-parasites. In the laboratory setting, working with apicomplexan parasites can be difficult, hazardous and expensive, because they must be infected into live host cells (in tissue culture) to remain viable. Chromera ...
https://en.wikipedia.org/wiki/Chromera_velia
AQUASYMBIO | Parasites and endosymbioses  AQUASYMBIO | Parasites and endosymbioses
Chromera velia is an autotrophic protist isolated from stony corals. C. velia possesses a chloroplast thought to be most closely related to the apicoplasts of non-photosynthetic apicomplexa. . The ventral side of the flagellated C. velia cell has two grooves extending from the anterior flagella insertion point with a ridge rising towards the anterior apex of the cell. The anterior flagellum is shorter than the posterior flagellum and possesses a distinct, small curved appendage. The insertion point of the anterior flagellum is partly enclosed by a flap extending from the cell. The posterior flagellum is approximately four times the length of the cell and possesses mastigonemes. ...
http://aquasymbio.fr/en/chromera-velia
MarLIN - The Marine Life Information Network - Sabellaria alveolata on variable salinity sublittoral mixed sediment  MarLIN - The Marine Life Information Network - Sabellaria alveolata on variable salinity sublittoral mixed sediment
Empirical evidence to assess the likely recovery rate of Sabellaria alveolata reefs from impacts is limited and significant information gaps regarding recovery rates, stability and persistence of Sabellaria alveolata reefs were identified for the biotope LS.LBR.Sab.Salv. No evidence was found regarding recovery of subtidal Sabellaria reefs on sediment and the resilience assessments are based on evidence for intertidal or shallow subtidal reefs on rock. Although the recovery mechanisms and life-history information should be applicable, the more limited extent of subtidal biotopes may restrict larval supply and the biotope will be more affected by sediment and water column conditions.. Studies carried out on reefs of Sabellaria alveolata within the low inter-tidal suggest that areas of small, surficial damage within reefs may be rapidly repaired by the tube building activities of adult worms. Vorberg (2000) found that trawl impressions made by a light trawl in Sabellaria alveolata reefs ...
http://www.marlin.ac.uk/habitats/detail/1012/sabellaria_alveolata_on_variable_salinity_sublittoral_mixed_sediment
WoRMS - World Register of Marine Species - Terebra alveolata Hinds, 1844  WoRMS - World Register of Marine Species - Terebra alveolata Hinds, 1844
Citation: Terryn, Y. (2012). Terebra alveolata Hinds, 1844. In: MolluscaBase (2017). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=447400 on 2017-10-16 ...
http://www.marinespecies.org/aphia.php?p=taxdetails&id=447400
African Register of Marine Species (AfReMaS) - Alveolata  African Register of Marine Species (AfReMaS) - Alveolata
Citation: AfReMaS (2011). Alveolata. Accessed through: Odido, M.; Appeltans, W.; BelHassen, M.; Mussai, P.; Nsiangango, S.E.; Vandepitte, L.; Wambiji, N.; Zamouri, N. Jiddou, A.M. (Eds) (2017). African Register of Marine Species at http://www.marinespecies.org/afremas./aphia.php?p=taxdetails&id=536209 on 2017-09-19 ...
http://www.marinespecies.org/afremas/aphia.php?p=taxdetails&id=536209
Named Entity Browser, 509 BC  Named Entity Browser, 509 BC
J 240; LR 347; Grisar, Geschichte Rorns i. 48-50). A little north of this site, in the villa Casali, were found other ruins and an inscribed basis of L,. Valerius Poplicola Maximus, consul in 232 or 253 A.D. (CIL vi. 1532; cf. 1531 ; Pros. iii. 376. 121). (2) on the Palatine, said to have been presented by the state to M. Valerius Volusus Maximus, dictator in 494 B.C. (Val. Ant. ap. Asc. in Pison. 52; JRS 1914, 208). (3) in summa Velia, the house in which P. Valerius Publicola, consul in 509 B.C., lived until he was forced to tear it down because it seemed too much like a stronghold, and to build again infra Veliam (Liv. ii. 7; Cic. de rep. ii. 53; Plut. Popl. o ; Dionys. v. 19; Val. Max. iv. I. 1). This site was afterwards occupied by the temple of Vica Pota (Liv. loc. cit.). According to a variant tradition, a house sub Veliis (Asc. in Pison. 52, ubi aedes Victoriae=Vicae Potae), or in Velia (Cic. de Har. resp. 16), was given to Valerius as a special honour (cf. Plin. NH xxxvi. ...
http://www.perseus.tufts.edu/hopper/nebrowser?id=-509&query=Perseus:text:1999.04.0054
QIAGEN - Sample to Insight  QIAGEN - Sample to Insight
Pyrosequencing assays consist of PCR primers and sequencing primers designed for use with PyroMark systems. PyroMark CpG Assays for human, mouse and rat gene sequences are available in convenient tube or 96-well formats. User-designed assays can be ordered through PyroMark Custom Assays ...
https://www.qiagen.com/gb/shop/genes-and-pathways/technology-portals/browse-products/pyrosequencing/
Revision of the Oriental subgenus Velia (Haldwania) Tamanini, 1955 (Heteroptera: Veliidae), with descriptions of four new...  Revision of the Oriental subgenus Velia (Haldwania) Tamanini, 1955 (Heteroptera: Veliidae), with descriptions of four new...
The Oriental subgenus Haldwania of the genus Velia is revised. It includes five previously described species, Velia (H.) championi Tamanini 1955 from northwestern India; V. (H.) steelei Tamanini, 1955 from northeastern India; V. (H.) sinensis Andersen, 1981 from Sichuan, China; V. (H.) tomokunii Polhemus & Polhemus, 1998 from Nepal; V. (H.) tonkina Polhemus & Polhemus, 2003 from northern Vietnam; and four species new to science: V. (H.) anderseni sp.n. from Bengal, India; V. (H.) longiconnexiva sp.n. from Guizhou, China; V. (H.) yunnana sp.n. from Yunnan, China; V. (H.) laticaudata sp.n. from northern Vietnam. Detailed diagnoses of known species and illustrations of all species are given. Diagnostic characteristics for species identification are discussed. A key to species of Haldwania and a map illustrating their distribution are given.
http://booksandjournals.brillonline.com/content/journals/10.1163/187631209x433760
Delimitation of the Thoracosphaeraceae (Dinophyceae), Including the Calcareous Dinoflagellates, Based on Large Amounts of...  Delimitation of the Thoracosphaeraceae (Dinophyceae), Including the Calcareous Dinoflagellates, Based on Large Amounts of...
The phylogenetic relationships of the Dinophyceae (Alveolata) are not sufficiently resolved at present. The Thoracosphaeraceae (Peridiniales) are the only group of the Alveolata that include members with calcareous coccoid stages; this trait is considered apomorphic. Although the coccoid stage appar- ently is not calcareous, Bysmatrum has been assigned to the Thoracosphaeraceae based on thecal morphology. We tested the monophyly of the Thoracosphaeraceae using large sets of ribosomal RNA sequence data of the Alveolata including the Dinophyceae. Phylogenetic analyses were performed using Maximum Likelihood and Bayesian approaches. The Thoracosphaeraceae were monophyletic, but included also a number of non-calcareous dinophytes (such as Pentapharsodinium and Pfiesteria) and even parasites (such as Duboscquodinium and Tintinnophagus). Bysmatrum had an isolated and uncertain phylogenetic position outside the Thoracosphaeraceae. The phylogenetic relationships among calcareous dinophytes appear ...
http://epic.awi.de/24787/
Alveolata - Wikipedia  Alveolata - Wikipedia
Os alveolados (Alveolata) são um grupo taxonómico pertencente aos protistas. A sua classificação é complexa e varia muito consoante os taxonomistas. David J. Patterson (1999), em The Diversity of Eukaryotes divide-os em Ciliophoras (protozoário muito comum, com filas de cílios); Apicomplexa (protozoário parasita sem estruturas de locomoção, excepto nos gâmetas); Dinoflagelados (principalmente flagelados marinhos, alguns dos quais apresentam cloroplastos). CAVALIER_SMITH, Thomas; CHAO, E. E. Chao. Protalveolate phylogeny and systematics and the origins of Sporozoa and dinoflagellates (phylum Myzozoa nom. nov.), Europ. J. Protistol. 40, pp. 185-212 (2004). CAVALIER_SMITH, Thomas. Protist phylogeny and the high-level classification of Protozoa, Europ. J. Protistol. 39, 338-348 (2003). Commons ...
https://pt.wikipedia.org/wiki/Alveolata
Characterization And Sequence Homologies Of The Dna Of Xenosomes And R by Velia Estela Figueroa-Desoto  "Characterization And Sequence Homologies Of The Dna Of Xenosomes And R" by Velia Estela Figueroa-Desoto
http://access.library.miami.edu/login?url=http://gateway.proquest.com/openurl?url_ver=Z39.88-2004&rft_val_fmt=info:ofi/fmt:kev:mtx:dissertation&res_dat=xri:pqdiss&rft_dat=xri:pqdiss:7921751. ...
http://scholarlyrepository.miami.edu/dissertations/1054/
ITIS Standard Report Page: Chelidonichthys obscurus  ITIS Standard Report Page: Chelidonichthys obscurus
Hosted by the USGS Core Science Analytics and Synthesis. Page designed through the cooperative efforts of interagency ITIS Teams. Point of Contact: [email protected]
https://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=643891
Perkinsus - Wikipedia  Perkinsus - Wikipedia
Perkinsus é um género de protistas do filo Perkinsozoa. O género foi criado em 1978 para melhor classificar a sua espécie-tipo, Perkinsus marinus, anteriormente conhecia como Dermocystidium marinum. São protozoários parasitas que infectam moluscos, sendo que alguns deles podem causar doenças e morte em massa nas povoações de moluscos. P. marinus é o mais conhecido, causador de uma doença chamada perkinsose, ou dermo, em ostras cultivadas e silvestres. Em 2004 havia seis espécies válidas dentro do género. Desde então foram descritas pelo menos mais duas. As espécies do género e os seus hóspedes comuns incluem os seguintes exemplares: Perkinsus andrewsi parasita da ameixa-báltica Macoma balthica. Perkinsus beihaiensis parasita das ostras Crassostrea hongkongensis e Crassostrea ariakensis. Perkinsus chesapeaki encontrado na amêijoa Mya arenaria. Perkinsus honshuensis encontrado na amêijoa de Manila Venerupis philippinarum. Perkinsus marinus parasita da ostra atlântica ...
https://pt.wikipedia.org/wiki/Perkinsus
Perkinsus marinus (Mackin et al.) Levine ATCC ® 50771™  Perkinsus marinus (Mackin et al.) Levine ATCC ® 50771™
Perkinsus marinus ATCC ® 50771™ Designation: LA9-8 [LA-9-8] Isolation: clone derived from strain LA9 (ATCC 50770), which came from eastern oyster, Crassostrea virginica, Louisiana Gulf Coast
https://www.atcc.org/en/Products/Cells_and_Microorganisms/Protozoa/Parasitic_Protozoa/50771.aspx
Perkinsus marinus (Mackin et al.) Levine ATCC ® 50765™  Perkinsus marinus (Mackin et al.) Levine ATCC ® 50765™
Perkinsus marinus ATCC ® 50765™ Designation: L4B [LA-3] Isolation: eastern oyster, Crassostrea virginica, Tambour Bay, LA, Gulf Coast
https://www.atcc.org/en/Products/All/50765.aspx
MarLIN - The Marine Life Information Network - Honeycomb worm (Sabellaria alveolata)  MarLIN - The Marine Life Information Network - Honeycomb worm (Sabellaria alveolata)
Size refers to individual worms. It is typically gregarious forming colonies of sheets, hummocks or reefs. In Cornwall, their tubes are up to 20 cm in length and around 5 mm in diameter at the external opening. Each tube has an additional porch over the opening. In northern France, the tubes were reported to grow in length at 12 cm/year.. This species appears to be favoured by elevated winter temperatures associated with cooling water discharges (Bamber & Irving, 1997) but growth is inhibited below 5 C. Communities associated with Sabellaria alveolata are not particularly remarkable being species poor on young dense reef and up to 38 species on older reefs. Honeycomb worm aggregations that bind together mobile cobbles increase heterogeneity. ...
http://www.marlin.ac.uk/species/detail/1129
to love ru momo velia deviluke naked nipples photoshop pussy tail transparent png uncensored vector trace | #84781 | yande.re  to love ru momo velia deviluke naked nipples photoshop pussy tail transparent png uncensored vector trace | #84781 | yande.re
This user name doesnt exist. If you want to create a new account, just verify your password and log in. This user name exists. If you want to create a new account, please choose a different name. Enter the current email address you have registered in your profile. Youll get an email containing your new password. You have no email address in your profile, so you cant have your password reset. Password reset. Check your email in a few minutes That account does not exist. The email address specified is not registered with this account. Delivery to this email address has failed. ...
https://yande.re/post/show/84781
UniProt: C5M0K1 PERM5  UniProt: C5M0K1 PERM5
ID C5M0K1_PERM5 Unreviewed; 343 AA. AC C5M0K1; DT 28-JUL-2009, integrated into UniProtKB/TrEMBL. DT 28-JUL-2009, sequence version 1. DT 07-JUN-2017, entry version 25. DE RecName: Full=V-type proton ATPase subunit a {ECO:0000256,RuleBase:RU361189}; DE Flags: Fragment; GN ORFNames=Pmar_PMAR001829 {ECO:0000313,EMBL:EEQ97491.1}; OS Perkinsus marinus (strain ATCC 50983 / TXsc). OC Eukaryota; Alveolata; Perkinsea; Perkinsida; Perkinsidae; Perkinsus. OX NCBI_TaxID=423536 {ECO:0000313,Proteomes:UP000007800}; RN [1] {ECO:0000313,EMBL:EEQ97491.1, ECO:0000313,Proteomes:UP000007800} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=ATCC 50983 / TXsc {ECO:0000313,Proteomes:UP000007800}; RA El-Sayed N., Caler E., Inman J., Amedeo P., Hass B., Wortman J.; RL Submitted (JUL-2008) to the EMBL/GenBank/DDBJ databases. CC -!- FUNCTION: Essential component of the vacuolar proton pump (V- CC ATPase), a multimeric enzyme that catalyzes the translocation of CC protons across the membranes. Required for ...
http://www.genome.jp/dbget-bin/www_bget?uniprot:C5M0K1_PERM5
Harmful algae found in Northport waters | Newsday  Harmful algae found in Northport waters | Newsday
Researchers studying the waters of Northport Harbor say theyve found a type of harmful algae in the water never seen before at these levels in New York. The algae, Dinophysis acuminata, produces a to
https://www.newsday.com/long-island/suffolk/harmful-algae-found-in-northport-waters-1.2819326
Huber and Suhner Type SK Torque Wrench 1.30 Nm for 8.0mm (74Z-0-0-174) from Solid Signal  Huber and Suhner Type SK Torque Wrench 1.30 Nm for 8.0mm (74Z-0-0-174) from Solid Signal
Huber and Suhner Type SK Torque Wrench 1.30 Nm for 8.0mm (74Z-0-0-174) HUBER & SUHNER Type-N with a 19mm opening. Variant Torque Wrench 1 Newton-meter. The Huber Suhner 74Z-0-0-174 steel torque wrench is designed for use on SK series connectors. It has a torque of 1.30 Newton-meters (11.51 inch-pounds) and an opening of 8mm (.315
https://www.solidsignal.com/pview.asp?p=74z-0-0-174
Samuel Ball Platner, Thomas Ashby, A Topographical Dictionary of Ancient Rome, SACRA URBS, TEMPLUM , SERAPIS, AEDES , ...  Samuel Ball Platner, Thomas Ashby, A Topographical Dictionary of Ancient Rome, SACRA URBS, TEMPLUM , SERAPIS, AEDES , ...
the artificial pond constructed by Nero within the DOMUS AUREA (q.v.), in the low ground between the Velia, the Esquiline, and the Caelian, where the Colosseum was afterwards built (Suet. Nero 31 :stagnum maris instar, circumsaeptum aedificiis ad urbium speciem; Mart. de spect. ii. 5-6: hic ubi conspicui venerabilis amphitheatri / erigitur moles, stagna Neronis erant).. ...
http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A1999.04.0054%3Aalphabetic+letter%3DS%3Aentry+group%3D3%3Aentry%3Dstagnum-neronis
Brownes Point Maine Oysters - Browne Trading Species Spotlight  Browne's Point Maine Oysters - Browne Trading Species Spotlight
(Crassostrea virginica): FARM RAISED For many years, Browne Trading has had the privilege of selling premium Eastern Oysters from our home state of Maine.
https://www.brownetrading.com/species-spotlight/brownes-point-maine-oysters/
Adel leptandra virginica dilution 1000 ch: buy adel leptandra virginica dilution 1000 ch 10 ml dilution pack online at best...  Adel leptandra virginica dilution 1000 ch: buy adel leptandra virginica dilution 1000 ch 10 ml dilution pack online at best...
Buy adel leptandra virginica dilution 1000 ch 10 ml dilution pack online at discounted price. visit 1mg.com to know price, benefits and product information of adel leptandra virginica dilution 1000 ch.
https://www.1mg.com/otc/adel-leptandra-virginica-dilution-1000-ch-otc332761
The effects of co-varying diel-cycling hypoxia and pH on disease susceptibility, growth, and feeding in Crassostrea virginica  The effects of co-varying diel-cycling hypoxia and pH on disease susceptibility, growth, and feeding in Crassostrea virginica
Diel-cycling hypoxia and pH co-occur in shallow waters world-wide. Eutrophication tends to increase the occurrence and severity of diel cycles. We used laboratory experiments to investigate effects of diel-cycling DO and pH on acquisition and progression of infections by Perkinsus marinus, the protistan parasite which causes Dermo disease, as well as hemocyte activity, growth, and feeding in the eastern oyster, Crassostrea virginica, an important estuarine species. Diel-cycling DO increased P. marinus infection and cycling DO and pH stimulated hemocyte activity and reduced oyster growth. However, ambient environmental conditions and oyster age modulated some of these effects. Co-varying DO and pH cycles sometimes had less severe effects than either cycle independently. Oysters may acclimate to, or compensate for, effects of cycling conditions on growth. Variation in magnitude and spatial extent of cycling conditions is an important consideration when choosing restoration sites, as severe cycling ...
http://drum.lib.umd.edu/handle/1903/16226
Microorganisms | Free Full-Text | Biology of the Marine Heterotrophic Dinoflagellate Oxyrrhis marina: Current Status and...  Microorganisms | Free Full-Text | Biology of the Marine Heterotrophic Dinoflagellate Oxyrrhis marina: Current Status and...
Heterotrophic dinoflagellates are prevalent protists in marine environments, which play an important role in the carbon cycling and energy flow in the marine planktonic community. Oxyrrhis marina (Dinophyceae), a widespread heterotrophic dinoflagellate, is a model species used for a broad range of ecological, biogeographic, and evolutionary studies. Despite the increasing research effort on this species, there lacks a synthesis of the existing data and a coherent picture of this organism. Here we reviewed the literature to provide an overview of what is known regarding the biology of O. marina, and identify areas where further studies are needed. As an early branch of the dinoflagellate lineage, O. marina shares similarity with typical dinoflagellates in permanent condensed chromosomes, less abundant nucleosome proteins compared to other eukaryotes, multiple gene copies, the occurrence of trans-splicing in nucleus-encoded mRNAs, highly fragmented mitochondrial genome, and disuse of ATG as a start codon
http://mdpi.com/2076-2607/1/1/33/htm
EpigenDx | DNA Methylation and Pyrosequencing Service Laboratory  EpigenDx | DNA Methylation and Pyrosequencing Service Laboratory
Provider of DNA methylation analysis services. We are experts in CpG methylation, Pyrosequencing assay design, and epigenomic applications.
https://epigendx.com/public/d/website-sitemap/search-references
EpigenDx | DNA Methylation and Pyrosequencing Service Laboratory  EpigenDx | DNA Methylation and Pyrosequencing Service Laboratory
Provider of DNA methylation analysis services. We are experts in CpG methylation, Pyrosequencing assay design, and epigenomic applications.
https://epigendx.com/d/website-sitemap
New dinoflagellate species Protoperidinium haizhouense sp. nov. (Peridiniales, Dinophyceae), its cyst-theca relationship and...  New dinoflagellate species Protoperidinium haizhouense sp. nov. (Peridiniales, Dinophyceae), its cyst-theca relationship and...
The number of cingular plates has been used to differentiate Protoperidinium from Peridinium and related genera. Protoperidinium is characterized by the presence of three cingular plates plus a transitional plate (3C+t). However, many Protoperidinium species have been described that exhibit different cingular plate tabulations. How these species should be classified within the genus remains unclear. To address this question, the phylogenetic relationship of four Protoperidinium species, with three or four cingular plates and lacking a transitional plate, were examined in relationship to other Protoperidinium species. These four species were germinated from cysts deposited in surface sediments collected from the East China Sea, the Bohai Sea and the Yellow Sea. Three of the isolated species, P. tricingulatum, P. americanum and P. parthenopes, were described previously. The fourth is here described as P. haizhouense sp. nov. with the plate formula Po, X, 4′, 3a, 7′′, 3C, 6S, 5′′′, ...
http://onlinelibrary.wiley.com/doi/10.1111/pre.12041/full
CAZy - Eukaryota  CAZy - Eukaryota
Lineage: cellular organisms; Eukaryota; Alveolata; Apicomplexa; Aconoidasida; Haemosporida; Plasmodiidae; Plasmodium; Plasmodium (Vinckeia ...
http://www.cazy.org/e6687.html
CAZy - Eukaryota  CAZy - Eukaryota
Lineage: cellular organisms; Eukaryota; Alveolata; Apicomplexa; Aconoidasida; Haemosporida; Plasmodiidae; Plasmodium; Plasmodium (Vinckeia ...
http://www.cazy.org/e6739.html
A qPCR and multiplex pyrosequencing assay combined with automated data processing for rapid and unambiguous detection of ESBL...  A qPCR and multiplex pyrosequencing assay combined with automated data processing for rapid and unambiguous detection of ESBL...
Rapid and specific detection of extended-spectrum β-lactamase-producing (ESBL) bacteria is crucial both for timely antibiotic therapy when treating infected patients as well as for appropriate infection control measures aimed at curbing the spread of ESBL-producing isolates. Whereas a variety of phenotypic methods are currently available for ESBL detection, they remain time consuming and sometimes difficult to interpret while being also affected by a lack of sensitivity and specificity. Considering the longer turnaround time (TAT) of susceptibility testing and culture results, DNA-based ESBL identification would be a valuable surrogate for phenotypic-based methods. Putative ESBL-positive Enterobacteriaceae isolates (n = 330) from clinical specimen were prospectively collected in Bulgaria, Romania and Democratic Republic of Congo and tested in this study. All isolates were assessed for ESBL-production by the E-test method and those giving undetermined ESBL status were re-tested using the ...
https://dial.uclouvain.be/pr/boreal/object/boreal:171342
PLOS Pathogens: A Unique Protein Phosphatase with Kelch-Like Domains (PPKL) in Plasmodium Modulates Ookinete Differentiation,...  PLOS Pathogens: A Unique Protein Phosphatase with Kelch-Like Domains (PPKL) in Plasmodium Modulates Ookinete Differentiation,...
Author Summary Malaria parasites are single-celled organisms, which alternate their life-cycle between vertebrate and mosquito hosts. In the mosquito, the malaria parasite undergoes sexual development, whereby a male and female gamete fuse to form a zygote. This zygote then elongates into an invasive stage, termed an ookinete, which can glide to and penetrate the mosquitos gut wall in order to form a cyst (called an oocyst). Protein phosphorylation is known to play a vital role during this process; however, the role of Plasmodium kinases (which phosphorylate proteins) during zygote/ookinete maturation is better understood than the completely uncharacterised plasmodial phosphatases (which dephosphorylate proteins). Using a malaria parasite which infects mice, Plasmodium berghei, we show that a unique protein phosphatase containing kelch-like domains (called PPKL) plays a vital role in ookinete maturation and motility. Deleting this gene produces ookinetes whose shape is grossly abnormal, resulting in
http://journals.plos.org/plospathogens/article/comments?id=10.1371/journal.ppat.1002948&imageURI=info:doi/10.1371/journal.ppat.1002948.g003
Life Cycles  Life Cycles
Anderson, D. M. & Wall, D. 1978. Potential importance of benthic cysts of Gonyaulax tamarensis and G. excavata in initiating toxic dinoflagellate blooms. J. Phycol. 14:224-234.. Barlow, S. B. & Triemer, R. E. 1988. Alternate life history stages in Amphidinium klebsii (Dinophyceae, Pyrrophyta). Phycologia 27:413-420.. Coats, D. W., Tyler, M. A. & Anderson, D. M. 1984. Sexual processes in the life cycle of Gymnodinium uncatenum (Dinophyceae): a morphogenetic overview. J. Phycol. 20: 351-361.. Figueroa, R. I. & Bravo, I. 2005a. A study of the sexual reproduction and determination of mating type of Gymnodinium nolleri (Dinophyceae) in culture. J. Phycol. 41:74-83.. Figueroa, R. I. & Bravo, I. 2005b. Sexual reproduction and two different encystment strategies of Lingulodinium polyedrum (Dinophyceae) in culture. J. Phycol. 41:370-79.. Figueroa, R. I., Bravo, I., Garc s, E. & Ramilo, I. 2006a. Nuclear features and effect of nutrients on Gymnodinium catenatum (Dinophyceae) sexual stages. J. Phycol. ...
http://www.tolweb.org/notes/?note_id=5512
Fowler, Velia  Fowler, Velia
Actin Dynamics: Roles in Cell and Tissue Morphogenesis in Development. Our laboratory studies the role of actin dynamics in regulating assembly and function of the diverse cytoskeletal structures that contribute to cell and tissue morphogenesis during embryonic development. Current research focuses on tropomodulins (Tmods), a conserved family of actin pointed end-capping proteins that block association and dissociation at slow-growing (pointed) ends of actin filaments. Tmods also bind tropomyosins (TMs), which cooperate with Tmods to tightly cap actin pointed ends, regulating actin filament lengths and stability in the spectrin-based membrane skeleton of non-muscle cells and in the contractile myofibrils of skeletal and cardiac muscle. Differences among Tmod family members in expression patterns, TM isoform binding, and actin monomer and polymer regulation suggest unique functions for each of the four vertebrate Tmods. Recent studies of mouse knockouts further implicate key requirements for ...
https://vivo.scripps.edu/display/FowlerVelia
Phylogenetic inference in Rafflesiales: the influence of rate heterogeneity and horizontal gene transfer | BMC Evolutionary...  Phylogenetic inference in Rafflesiales: the influence of rate heterogeneity and horizontal gene transfer | BMC Evolutionary...
Determining the photosynthetic relatives of Rafflesiales has long presented a challenge owing to the extreme reduction and/or modification of morphological structures that have accompanied the evolution of this lineage [3, 11]. Molecular phylogenetic approaches, although providing great promise in resolving such questions, also come with their own set of challenges that includes losses of some genes, substitution rate increases in other genes, and horizontal gene transfer. Examples of the first process can be seen in chloroplast genes such as rbcL that are typically used to infer phylogenetic relationships among angiosperms but have not yet been amplified from any Rafflesiales and are presumed lost [5]. Increased substitution rates in the normally conservative plastid rDNA has been demonstrated in these holoparasites [4, 12]. Similarly, accelerated rates in mitochondrial SSU rDNA, typically very conservative in many photosynthetic angiosperms, occur in Rafflesia and Cytinus [13]. Despite these ...
https://bmcevolbiol.biomedcentral.com/articles/10.1186/1471-2148-4-40
Rosids  Rosids
Barkman, T. J., S.-H. Lim, K. M. Salleh, and J. Nais. 2004. Mitochondrial DNA sequences reveal the photosynthetic relatives of Rafflesia, the worlds largest flower. Proceedings of the National Academy of Sciences (USA) 101(3):787-792.. Endress, P. K. and S. Stumpf. 1991. The diversity of stamen structures in Lower Rosidae (Rosales, Fabales, Proteales, Sapindales). Botanical Journal of the Linnean Society 107:217-293.. Hilu, K. W., T. Borsch, K. M ller, D. E. Soltis, P. S. Soltis, V. Savolainen, M. W. Chase, M. P. Powell, L. A. Alice, R. Evans, H. Sauquet, C. Neinhuis, T. A. B. Slotta, J. G. Rohwer, C. S. Campbell, and L. W. Chatrou. 2003. Angiosperm phylogeny based on matK sequence information. American Journal of Botany 90(12):1758-1776.. Hufford, L. 1992. Rosidae and their relationships to other nonmagnoliid dicotyledons: a phylogenetic analysis using morphological and chemical data. Annals of the Missouri Botanical Garden 79:218-248.. Savolainen, V., M. W. Chase, S. B. Hoot, C. M. Morton, ...
http://www.tolweb.org/Rosids/20701
Browsing Galveston Bay Information Collection by Subject variance analysis  Browsing Galveston Bay Information Collection by Subject "variance analysis"
The protozoan oyster parasite Perkinsus marinus causes extensive mortality in eastern oyster (Crassostrea virginica) populations during summer and fall across much of the oysters distribution. Despite more than 40 yr of ...
http://repositories.tdl.org/tamug-ir/handle/1969.3/1/browse?type=subject&value=variance+analysis
Oysters: VIMS Journal Articles | Virginia Institute of Marine Science  Oysters: VIMS Journal Articles | Virginia Institute of Marine Science
Chu, F.-L. E., E. D. Lund, et al. 2006. Effects of triclosan on the oyster parasite, Perkinsus marinus and its host, the eastern oyster, Crassostrea virginica: A comparison at different temperatures. 98 Annual Meeting National Shellfisheries Association, Monterey, CA (USA), 26-30 Mar 2006. Journal of Shellfish Research 25(2): 719 ...
http://www.vims.edu/research/topics/oysters/ja_archive/index.php
Presence of plasmid-R in isolated bacteria of oyster (Crassostrea virginica), during its process of collection, distribution,...  Presence of plasmid-R in isolated bacteria of oyster (Crassostrea virginica), during its process of collection, distribution,...
The aim of the present study is to determine presence of Plasmid-R in isolated bacteria of C. virginica, during its process of collection, distribution, commercialization, and consumption in Alvarado, Veracruz lagoon.
http://www.fisheriesjournal.com/archives/?year=2016&vol=4&issue=4&part=F&ArticleId=871
A perspecitive on the distribution of biogenic reefs and SACs  A perspecitive on the distribution of biogenic reefs and SACs
A Perspective on Biogenic Reefs and SACs The distribution of major examples of biogenic reefs is given by species in Table 3 and Figure 2, both within cSACs and pSACs, and elsewhere. No currently proposed SACs were selected specifically on the basis that they contain biogenic reefs. However, biogenic reefs are sub-features of other Annex I features such as reefs , estuaries or large shallow inlets and bays . In some cases biogenic reefs are specifically mentioned as reasons why a site is a particularly good example of an Annex 1 habitat e.g. Mytilus in Morecambe Bay, Modiolus in Strangford Lough, Lleyn Peninsula and the Sarnau and Loch Maddy; Sabellaria alveolata in the Solway Firth and Morecambe Bay. There are candidate SACs selected on the basis of the presence of reefs which do have substantial areas of Modiolus reef (Lochs Duich, Long and Alsh, Lleyn Peninsula and the Sarnau), Sabellaria alveolata reef (Lleyn Peninsula and the Sarnau); and probably Sabellaria spinulosa reef (Lleyn Peninsula ...
http://www.ukmarinesac.org.uk/communities/biogenic-reefs/br2_2.htm
BIOETYMOLOGY : ORIGIN IN BIOMEDICAL TERMS: taxonomy  BIOETYMOLOGY : ORIGIN IN BIOMEDICAL TERMS: taxonomy
Coined:The first attempt for describing and naming organisms is began by ancient philosopher Aristotle (384-322BC) who tried to classify animal species in his work : The History of Animals. In parallel his pupill Theophrastus (c.371-c.287 BC) wrote about plant classification (Historia Plantarum). During the 1700s Swedish botanist, physician and zoologist Carl Linnaeus (1707 -1778) simplified the classification system of living organisms by imparting a two-part naming system, called binomial nomenclature, to make identification easier. American plant ecologist Robert Harding Whittaker (1920-1980) in 1969 proposed 5 kingdoms: Plantae, Animalia, Fungi, Protista and Monera. Prof Thomas Cavalier-Smith (1942- ) proposed a new Kingdom of Chromista in the system of 6 kingdoms: Plantae (eukaryotic characterised by cell wall) , Animalia (eukaryotic characterised by cells without cell wall), Fungi (eukaryotic characterised by cells without cell wall), Chromista (eukaryotic algae), Protozoa (unicellular ...
http://bioetymology.blogspot.com/2011/05/taxonomy.html
Gyrodinium estuariale  Gyrodinium estuariale
Gardiner, W. E., Rushing, A. E. & Dawes, C. J. 1989. Ultrastructural observations of Gyrodinium estuariale (Dinophyceae) (Note). J. Phycol. 25: 178-183.. Hulburt, E. M. 1957. The taxonomy of unarmored Dinophyceae of shallow embayments on Cape Cod, Massachusetts. Biological Bulletin. 112: 196-219.. Steidinger, K. A. & Tangen, K. 1996. Dinoflagellates. In: Tomas, C. R. (ed.) Identifying marine diatoms and dinoflagellates. Academic Press, Inc., San Diego, p. 387-584.. Throndsen, J. 1969. Flagellates of Norwegian coastal waters. Nytt Mag. Bot. 16: 161-216.. ...
http://www.smhi.se/oceanografi/oce_info_data/plankton_checklist/dinoflagellates/gyrodinium_estuariale.htm
Bosnia out as Nigeria end win drought  Bosnia out as Nigeria end win drought
CUIABA, Brazil - Bosnia-Hercegovinas maiden appearance at a World Cup finals ended in disappointment as Peter Odemwingies goal condemned them to a 1-0 defeat by African champions Nigeria in Cuiaba and ensured they could not qualify for the second roun
http://www.nationmultimedia.com/breakingnews/Bosnia-out-as-Nigeria-end-win-drought-30236828.html
Monophyly of the species of Hepatozoon (Adeleorina: Hepatozoidae) parasitizing (African) anurans, with the description of three...  Monophyly of the species of Hepatozoon (Adeleorina: Hepatozoidae) parasitizing (African) anurans, with the description of three...
Monophyly of the species of Hepatozoon (Adeleorina: Hepatozoidae) parasitizing (African) anurans, with the description of three new species from hyperoliid frogs in South Africa - Edward C. Netherlands, Courtney A. Cook, Louis H. Du Preez, Maarten P.M. Vanhove, Luc Brendonck, Nico J. Smit
https://www.cambridge.org/core/journals/parasitology/article/monophyly-of-the-species-of-hepatozoon-adeleorina-hepatozoidae-parasitizing-african-anurans-with-the-description-of-three-new-species-from-hyperoliid-frogs-in-south-africa/7981355ED0B0DE567067F00EDD5C1582
Modeling the MSX Parasite in Eastern Oyster (Crassostrea virginica) Po by Eric N. Powell, John M. Klinck et al.  "Modeling the MSX Parasite in Eastern Oyster (Crassostrea virginica) Po" by Eric N. Powell, John M. Klinck et al.
A model of transmission for Haplosporidium nelsoni, the disease agent for MSX disease, is developed and applied to sites in Delaware Bay and Chesapeake Bay. The environmental factors that force the oyster population- H. nelsoni model are salinity, temperature, food, and total suspended solids. The simulated development of MSX disease was verified using 3 time series of disease prevalence and intensity: 1960 to 1970 and 1980 to 1990 for Delaware Bay, and 1980 to 1994 for Chesapeake Bay, and for a series of sites covering the salinity gradient in each bay. Additional simulations consider the implications of assumptions made in development of the model for constraining the mode of transmission of H. nelsoni disease in oyster populations. Transmission of H. nelsoni includes non-local factors that exert a paramount influence on the transmission process. Key environmental forcing factors of season, salinity, and winter temperature exert a direct control on the transmission process, either by controlling the
http://digitalcommons.odu.edu/ccpo_pubs/76/
Intracolonial variation in toxicity in scleractinian corals - UQ eSpace  Intracolonial variation in toxicity in scleractinian corals - UQ eSpace
Single colonies of the scleractinian corals Lobophyllia corymbosa, Favites abdita, Favia matthaii, Favia stelligera, Platygyra daedalea, Leptoria phrygia, Cyphastrea serailia, Hydnophora exesa and Astreopora myriophthalma were permanently marked with buoys on the reef flat at Heron Island, Great Barrier Reef. Portions of colonies were removed up to seven times at intervals of two or three months. Aqueous extracts of the colony portions were assayed using six bioassay regimes namely, toxicity to mice, toxicity to a coral and a hydroid, cytolytic activity on sheep erythrocytes and sea urchin ova and for antimicrobial activity on eight bacterial species. The incidence of one type of bioactivity in an extract was not correlated with the incidence of any other type of activity in that extract. Although each coral colony provided extracts that affected at least two of the bioassay systems, different activity profiles were obtained from successive extracts of each colony. Thus there is a temporal ...
https://espace.library.uq.edu.au/view/UQ:393566
A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit...  A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit...
Background Massively parallel pyrosequencing of amplicons from the V6 hypervariable regions of small-subunit (SSU) ribosomal RNA (rRNA) genes is commonly used to assess diversity and richness in bacterial and archaeal populations. Recent advances in pyrosequencing technology provide read lengths of up to 240 nucleotides. Amplicon pyrosequencing can now be applied to longer variable regions of the SSU rRNA gene including the V9 region in eukaryotes. Methodology/Principal Findings We present a protocol for the amplicon pyrosequencing of V9 regions for eukaryotic environmental samples for biodiversity inventories and species richness estimation. The International Census of Marine Microbes (ICoMM) and the Microbial Inventory Research Across Diverse Aquatic Long Term Ecological Research Sites (MIRADA-LTERs) projects are already employing this protocol for tag sequencing of eukaryotic samples in a wide diversity of both marine and freshwater environments. Conclusions/Significance Massively parallel
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0006372
Polymorphism in Nucleotide Sequence of Mitochondrial Intergenic Region in Scleractinian Coral (Galaxea fascicularis) on...  Polymorphism in Nucleotide Sequence of Mitochondrial Intergenic Region in Scleractinian Coral (Galaxea fascicularis) on...
Article Polymorphism in Nucleotide Sequence of Mitochondrial Intergenic Region in Scleractinian Coral (Galaxea fascicularis). A region of 826 bp that is unlikely to code for a protein, ribosomal RNA, or transfer RNA was identified between the cytochr...
https://www.environmental-expert.com/articles/polymorphism-in-nucleotide-sequence-of-mitochondrial-intergenic-region-in-scleractinian-coral-galaxe-5353
Evolutionary analysis of orthologous cDNA sequences from cultured and symbiotic dinoflagellate symbionts of reef-building...  Evolutionary analysis of orthologous cDNA sequences from cultured and symbiotic dinoflagellate symbionts of reef-building...
Dinoflagellates are ubiquitous marine and freshwater protists. The endosymbiotic relationship between dinoflagellates of the genus Symbiodinium (also known as zooxanthellae) and corals forms the basis of coral reefs. We constructed and analyzed a cDNA library from a cultured Symbiodinium species clade A (CassKB8). The majority of annotated ESTs from the Symbiodinium sp. CassKB8 library cover metabolic genes. Most of those belong to either carbohydrate or energy metabolism. In addition, components of extracellular signal transduction pathways and genes that play a role in cell-cell communication were identified. In a subsequent analysis, we determined all orthologous cDNA sequences between this library (1,484 unique sequences) and a library from a Symbiodinium species clade C (C3) (3,336 unique sequences) that was isolated directly from its symbiotic host. A set of 115 orthologs were identified between Symbiodinium sp. CassKB8 and Symbiodinium sp. C3. These orthologs were subdivided into three ...
https://researchonline.jcu.edu.au/11298/
X-Cell arginine supplement  X-Cell arginine supplement
http://www.lifeplusvitamins.com/discovery.htm. OMEGOLD - Special DHA - EPA Omega 3 Fatty Acid Fish Oil. OmeGold sets itself apart by including a specialized mix of essential plant oils, which are potent fat-soluble antioxidants. Each softgel capsule contains a precise blend of DHA and EPA omega-3 fatty acids combined with vitamin D and an exclusive proprietary blend of antioxidant-rich essential oils.. Research has shown that DHA is a critical component of the brain. In fact, one quarter of all brain lipids are comprised of DHA. OmeGold is full of the critically important omega-3 fatty acid that has been shown to positively affect cognitive function. The omega-3 fatty acids in OmeGold also help support cardiac health. Supportive but not conclusive research shows that consumption of EPA and DHA omega-3 fatty acids may reduce the risk of coronary heart disease. Higher levels of DHA in the blood may support already normal levels of C reactive protein, a marker of inflammation and an indicator of ...
http://www.lifeplusvitamins.com/wordpress/tag/x-cell-arginine-supplement/
Alcoholism and Drug Abuse Treatment Centers in Maryland : -- X-Cell Inc  Alcoholism and Drug Abuse Treatment Centers in Maryland : -- X-Cell Inc
19 Seasonal Travel RN Jobs - L&D / Mother-Baby / Postpartum Cumberland, MD, USA The Travel Nurse Season is here and it shows For the past 5 years, thousands of Nurses just like you have utilized the sites of HealthCare Employment Network to explore a career as a Traveling ...... Apply Now>> ...
http://www.healthcarehiring.com/alcoholism-drug-abuse-treatment/maryland/575/
Checklist of Mediterranean free-living dinoflagellates on Environmental XPRT  Checklist of Mediterranean free-living dinoflagellates on Environmental XPRT
Article Checklist of Mediterranean free-living dinoflagellates. An annotated checklist of free-living dinoflagellates (Dinophyceae) of the Black Sea, based on literature records, is reported and compared to the Mediterranean Sea and world oceans. Tox...
https://www.environmental-expert.com/articles/checklist-of-mediterranean-free-living-dinoflagellates-15666
UniProt: B6KJX9 TOXGV  UniProt: B6KJX9 TOXGV
ID B6KJX9_TOXGV Unreviewed; 909 AA. AC B6KJX9; A0A0F7V4B0; A0A0N5E8W8; B9Q4L4; S8GK16; DT 16-DEC-2008, integrated into UniProtKB/TrEMBL. DT 16-DEC-2008, sequence version 1. DT 15-FEB-2017, entry version 42. DE RecName: Full=V-type proton ATPase subunit a {ECO:0000256,RuleBase:RU361189}; GN ORFNames=BN1205_022810 {ECO:0000313,EMBL:CEL74960.1}, TGVEG_232830 GN {ECO:0000313,EMBL:ESS35787.1}; OS Toxoplasma gondii (strain ATCC 50861 / VEG). OC Eukaryota; Alveolata; Apicomplexa; Conoidasida; Coccidia; OC Eucoccidiorida; Eimeriorina; Sarcocystidae; Toxoplasma. OX NCBI_TaxID=432359 {ECO:0000313,EMBL:ESS35787.1, ECO:0000313,Proteomes:UP000002226}; RN [1] {ECO:0000313,EMBL:ESS35787.1} RP NUCLEOTIDE SEQUENCE. RC STRAIN=VEG {ECO:0000313,EMBL:ESS35787.1}; RG NIH - Zebrafish Gene Collection (ZGC) project; RL Submitted (MAR-2007) to the EMBL/GenBank/DDBJ databases. RN [2] {ECO:0000313,Proteomes:UP000002226} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=ATCC 50861 / VEG ...
http://www.genome.jp/dbget-bin/www_bget?uniprot:B6KJX9_TOXGV
Joshs microlife - Identification and Classification  Josh's microlife - Identification and Classification
For the over-all classification I have followed the six-kingdom system by Thomas Cavalier-Smith, who has played a major part in developing our current understanding of large-scale relationships, and in my opinion does the best job presenting them in a framework that is useful for discussing the groups in question. An overview giving classes for most algae and protozoans appears in "Unravelling the Algae" (2007) eds. Brodie and Lewis. However, the kingdoms Chromista and Protozoa were also substantially changed in Cavalier-Smith (2010), removing one of the main differences remaining from the phylogeny determined by other authors. For ciliates I have mainly taken the classes and orders from "The Ciliated Protozoa" 3rd ed. (2008) by Lynn, except for the litostomes which follow Vďačný et al. (2011). For the Amoebozoa I have followed the updated classification from Smirnov et al. (2011). For animals many groups are been more or less stable, given in detail in for instance "Synopsis and ...
http://microlife.parvarium.com/classification.html
Introduction to the Sagenista  Introduction to the Sagenista
The Sagenista is a group of basal chromists. They are all heterotrophic and basically unicellular, though some live in loosely associated colonies. The group has no characters that unite it, and so the group is generally believed to be paraphyleitc, though the details of relationships are not yet known. Sagenista includes two major groups of organisms, including one that has been classified with the fungi, and one that has only recently been recognized. The first group are the Bicoecea, a small collection of poorly studied unicells. Some of these have been known for more than a century, while others have only recently been described. One of the more exciting recent discoveries is the species Cafeteria roenbergensis. This species is actually quite common, and feeds indiscriminantly on whatever it can find (and hence its name). A second group, the Labyrinthulomycota, or slime nets, have traditionally been grouped with the slime molds, but are now believed to be part of the Chromista. The slime ...
http://www.ucmp.berkeley.edu/chromista/sagenista.html
Stem cells clinics - Page 2  Stem cells clinics - Page 2
Hi, I would like to know more about these clinics: 1. X-cell center in Germany. 2. EmCell in Ukraine. 3. Puhua in Beijing. 4. Nu Tech Mediworld in India. 5. Any other clinic, worldwide. Did anyone have had a stem cell treatment in any of those clinics and can give his/her expression ?
http://stemcellpioneers.com/showthread.php?4148-Stem-cells-clinics&s=1769be5689fe7ad12d2126de4bf3642f&p=26693
Bioaccumulation of Dissolved Arsenic in the Oyster Crassostrea virginica: A Radiotracer Study  Bioaccumulation of Dissolved Arsenic in the Oyster Crassostrea virginica: A Radiotracer Study
International Atomic Energy Agency, Marine Environment Laboratories, Principality of Monaco. In the framework of a program focusing on marine resource protection and management in the Caribbean, the objective of this work was to characterize As bioaccumulation in the common edible oyster Crassostrea virginica. Dissolved As (stable As + 73As as a tracer) was taken up according to saturation kinetics for all tested exposure concentrations (2-10 mg l-1), and steady-state was reached rapidly within ~1 week. A slight decrease in uptake efficiency was observed for the higher concentration tested. Whole-body depuration kinetics showed that 73As was lost according to double exponential depuration kinetics that were characterized by short-lived biological half-lives (Tb1/2s) of 0.5-0.9 d and by long-lived Tb1/2l of 8-16 d. No significant difference in 73As retention was found among different initial exposure concentrations of As. Overall, our results indicate that C. virginica bioaccumulates As ...
http://www.environmentalindicatorsjournal.net/Journal/DisplayArticle/tabid/57/ArticleId/72/Bioaccumulation-of-Dissolved-Arsenic-in-the-Oyster-Crassostrea-virginica-A-Radiotracer-Study.aspx
Light modification by symbiotic corals | Proceedings of the Royal Society of London B: Biological Sciences  Light modification by symbiotic corals | Proceedings of the Royal Society of London B: Biological Sciences
Corals living on deeper reefs inhabit an environment characterized by low light intensities and limited spectral composition of the incident irradiance [6,21]. While responses of zooxanthellate corals to low irradiances are relatively well studied [12,36], the effects of the spectral composition of light on their photobiology are far from being understood. In corals, the typical acclimatory response to low light is an increase in symbiont pigmentation and/or numbers [12,27,36], causing a higher optical thickness of the tissue. Our data suggest the maximized absorption of the blue-green light prevalent at greater depths could come at the cost of poor tissue penetration of these wavelengths. This results in a paradox, where corals acclimation strategies to maximize absorption decrease the tissue penetration of the blue-dominated irradiance at depth and may consequently limit their capacity to sustain symbiont photosynthesis in deeper tissue areas. The chlorophyll emission cross sections reveal ...
http://rspb.royalsocietypublishing.org/content/284/1858/20170320
Shellfish Toxicity: Background, Pathophysiology, Epidemiology  Shellfish Toxicity: Background, Pathophysiology, Epidemiology
Infectious agents cause most shellfish-associated illness. Hepatitis A, Norwalk virus, Vibrio parahaemolyticus, and Vibrio vulnificus all have been transmitted through shellfish ingestion.
https://emedicine.medscape.com/article/818505-overview
Chromalveolata - Wikipedia  Chromalveolata - Wikipedia
Chromalveolata es un supergrupo de organismos eucariotas propuesto por Adl et al. en 2005[1]​ como una modificación de Chromista, que a su vez propuso Thomas Cavalier-Smith en 1981.[2]​ Fue considerado uno de los seis clados principales de Eukarya, pero actualmente es considerado polifilético y ha sido reemplazado por el supergrupo SAR (=Harosa).[3]​[4]​ Chromalveolata fue propuesto para englobar a a una línea de organismos eucariotas que llegaron a ser fotosintéticos a través de la endosimbiosis secundaria con un alga roja. De acuerdo con la definición de 2005 comprende a los grupos Heterokontophyta, Haptophyta, Cryptophyta (subgrupo Chromista s.s.) y Ciliophora, Apicomplexa y Dinoflagellata (subgrupo Alveolata). El supergrupo SAR añade a los anteriores el grupo Rhizaria y excluye a Haptophyta y Cryptophyta. De acuerdo con estudios filogenéticos recientes, los grupos de Chromalveolata junto con Rhizaria se relacionarían de la siguiente forma (Burki 2007,[5]​ 2012,[6]​ ...
https://es.wikipedia.org/wiki/Chromalveolata
Protists I - Protists with Modified Mitochondria, Kingdoms Euglenozoa and Alveolata - BIOL110SUMMERTEST - Confluence  Protists I - Protists with Modified Mitochondria, Kingdoms Euglenozoa and Alveolata - BIOL110SUMMERTEST - Confluence
Introduction and Learning Objectives Figure 1. Giardia lamblia, a protistan intestinal parasite.(Click to enlarge) This tutorial will introduce protists, which are relatively simple eukaryotic organisms (such as Giardia lamblia, Figure 1). The taxonomy o
https://wikispaces.psu.edu/display/BIOLSUMMERTEST/Protists+I+-+Protists+with+Modified+Mitochondria%2C+Kingdoms+Euglenozoa+and+Alveolata
Filtration Capabilities of The Eastern Oyster and Soft-Shell Clam  Filtration Capabilities of The Eastern Oyster and Soft-Shell Clam
Article for grades 6 through 12 This young naturalist looked to oyster restoration projects, which have gained popularity in recent years as a means of improving water quality, for her investigation.
https://www.amnh.org/learn-teach/young-naturalist-awards/winning-essays2/2008-winning-essays/filtration-capabilities-of-the-eastern-oyster-and-soft-shell-clam
Leiomodin-3 dysfunction results in thin filament disorganization and nemaline myopathy. | Sigma-Aldrich  Leiomodin-3 dysfunction results in thin filament disorganization and nemaline myopathy. | Sigma-Aldrich
Sigma-Aldrich offers abstracts and full-text articles by [Michaela Yuen, Sarah A Sandaradura, James J Dowling, Alla S Kostyukova, Natalia Moroz, Kate G Quinlan, Vilma-Lotta Lehtokari, Gianina Ravenscroft, Emily J Todd, Ozge Ceyhan-Birsoy, David S Gokhin, Jérome Maluenda, Monkol Lek, Flora Nolent, Christopher T Pappas, Stefanie M Novak, Adele DAmico, Edoardo Malfatti, Brett P Thomas, Stacey B Gabriel, Namrata Gupta, Mark J Daly, Biljana Ilkovski, Peter J Houweling, Ann E Davidson, Lindsay C Swanson, Catherine A Brownstein, Vandana A Gupta, Livija Medne, Patrick Shannon, Nicole Martin, David P Bick, Anders Flisberg, Eva Holmberg, Peter Van den Bergh, Pablo Lapunzina, Leigh B Waddell, Darcée D Sloboda, Enrico Bertini, David Chitayat, William R Telfer, Annie Laquerrière, Carol C Gregorio, Coen A C Ottenheijm, Carsten G Bönnemann, Katarina Pelin, Alan H Beggs, Yukiko K Hayashi, Norma B Romero, Nigel G Laing, Ichizo Nishino, Carina Wallgren-Pettersson, Judith Melki, Velia M Fowler, Daniel G MacArthur,
https://www.sigmaaldrich.com/catalog/papers/25250574
Apicomplexan | definition of apicomplexan by Medical dictionary  Apicomplexan | definition of apicomplexan by Medical dictionary
Looking for online definition of apicomplexan in the Medical Dictionary? apicomplexan explanation free. What is apicomplexan? Meaning of apicomplexan medical term. What does apicomplexan mean?
http://medical-dictionary.thefreedictionary.com/apicomplexan
Cyanobacterial Genes Transmitted to the Nucleus Before Divergence of Red Algae in the Chromista | SpringerLink  Cyanobacterial Genes Transmitted to the Nucleus Before Divergence of Red Algae in the Chromista | SpringerLink
The plastids of red algae, green plants, and glaucophytes may have originated directly from a cyanobacterium-like prokaryote via primary endosymbiosis. In contrast, the plastids of other lineages of e
https://link.springer.com/article/10.1007%2Fs00239-003-2611-1
Life Plus X-Cell  Life Plus X-Cell
Nitric oxide keeps arteries relaxed for healthy blood pressure, preventing hypertension.. L-arginine helps support healthy cholesterol levels.. L-arginine can help boost lean muscle mass and even preserve bone density by promoting the production of Human Growth Hormone (HGH). HGH can help reduce fat and thus can help lead to weight loss and better weight management.. Because arginine can help keep arteries relaxed it can provide better flow to the sphincter muscles, thus aiding and even possibly preventing hemorrhoids.. Arginine enhances memory function, particularly long-term memory, and may help prevent the age related problems of memory loss like dementia.. Did you know L-arginine improves the communication of cells between the nerves and the brain. This constitutes a whole variety of benefits.. L-arginine has excellent anticoagulant properties which can reduce blood clotting thus lowering the risk of heart attack and stroke.. L-arginine has been shown to help wounds heal more quickly and aid ...
http://www.lifeplusvitamins.com/wordpress/tag/life-plus-x-cell/
Gayana Bot. - vol.68 issue1  Gayana Bot. - vol.68 issue1
First record of Lingulodinium polyedrum (Dinophyceae) resting cysts in coastal sediments from the Inner Sea of Chiloé, Los Lagos Region, southern Chile (~41°-43°S) ...
http://www.scielo.cl/scielo.php?script=sci_issuetoc&pid=0717-664320110001&lng=en&nrm=iso
Difference between revisions of Queensland - Wikitravel  Difference between revisions of "Queensland" - Wikitravel
| region14name=The Great Barrier Reef | region14color=#a1ddf7 | region14items= | region14description=One of the 7 natural wonders of the world it is composed of more than 2,900 reefs and 900 islands which are home to unique coral species and wildlife.
https://wikitravel.org/wiki/en/index.php?title=Queensland&curid=106&diff=2516100&oldid=2504035
Sarah Connor - French Kissing (music video) - [a6c05dffc]  Sarah Connor - French Kissing (music video) - [a6c05dffc]
Music video by Sarah Connor performing French Kissing. (C) 2001 X-cell Records, a division of Universal Music GmbHSarah Lewe (born June 13, 1980), bet...
http://www.totallyfuzzy.net/ourtube/sarah-connor/french-kissing-video_a6c05dffc.html
HAN 2g193 - Rps15 - Hemiselmis andersenii (Cryptophyte alga) - HAN 2g193 gene & protein  HAN 2g193 - Rps15 - Hemiselmis andersenii (Cryptophyte alga) - HAN 2g193 gene & protein
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
https://www.uniprot.org/uniprot/A9BKL6
Hamamelis Virginica - Health Library  Hamamelis Virginica - Health Library
Click here to toggle editing of individual sections of the page (if possible). Watch headings for an edit link when available ...
http://healthlibrary.wikidot.com/hamamelis-virginica
Rubra 00300 : CDS information --- DoBISCUIT  Rubra 00300 : CDS information --- DoBISCUIT
putative ligase [putative acid AMP ligase] ATGGATCTCGGTCAGGCTCAGACCAGGAAGAGTCTCGTGAACCGCACCTCAGCCCGGTAT ACCGACCACGTTTCCGCCGACCAGCGCCAGGCCTGGGCCGCCGCGGGCCACTACCCGGGC CAGGACCTGTACTCCCTGTTCCGTGGCCACGTCCAGCGCACGCCTCAGGCGCCGGCCGTG CTGGACGCCGAGGGTACGGTCAGCTACGGCGAACTGGACCAGGCAGCCCGGCGCCTGGCC GCGGGACTGGTGCAGCTCGGCATCGTCCCCGGCGACGTCGTGGCGGTCCAGCTGCCCAAC GCCCGTCTCGCGTGTGCCGTCGACCTCGCCGTCGCCGCGGTGGGCGCCGTCGTGCTGCCG TTTCCGCTCGGCCGGGGCGACCGGGACGCGGTCAGCCTGCTACGCCGCTCCGAGGCGGTC GCGGTGATCACCGTCGCCGATCATCACGGCTATCCCTGCGCCGAGCGGATCCGGAAACAC GCCGACGCCCTGCCGATGCTGCGTGCCGTCATCGTCGCCGGGGACGGTGCCGCCAAGACG CCGGACTGCGTGCCGATCGAGGCCCTGGCCGCCGCCACCGCCGACGAGTTCGTGCCGCGG GAATCCGACCCCGACGCACCGGCACGGATCCTGGTCACCTCCGGGTCCGAGGCGGAACCG AAGATGGTCCTGTACTCGCACAACGCGCTGGCCGGTGGCCGCGGTGCCATGATGGCCGGC CTGCACCGAGGTTCCCCGGCCACGATGCGCAACCTCTTCCTCGTCCCGCTGGCGTCGGCC TTCGGCTCCAGCGGGACGCCGGTCACCCTCGCGACCCTGGGCGGAACCCTCGTGCTGAGG CCGTCCTTCGACGCTGCCGGGACGCTGCGGACCATCGCCGAAACCCGGCCCACCCACCTG ...
http://www.bio.nite.go.jp/pks/feature/view/Rubra_00300
Accumulation, transformation and breakdown of DSP toxins from the toxic dinoflagellate Dinophysis acuta in blue mussels,...  Accumulation, transformation and breakdown of DSP toxins from the toxic dinoflagellate Dinophysis acuta in blue mussels,...
Okadaic acid (OA), dinophysistoxins (DTX) and pectenotoxins (PTX) produced by the dinoflagellates Dinophysis spp. can accumulate in shellfish and cause diarrhetic shellfish poisoning upon human consumption. Shellfish toxicity is a result of algal abundance and toxicity as well as accumulation and depuration kinetics in mussels. We mass-cultured Dinophysis acuta containing OA, DTX-1b and PTX-2 and fed it to the blue mussel, Mytilus edulis under controlled laboratory conditions for a week to study toxin accumulation and transformation. Contents of OA and DTX-1b in mussels increased linearly with incubation time, and the net toxin accumulation was 66% and 71% for OA and DTX-1b, respectively. Large proportions (≈50%) of both these toxins were transformed to fatty acid esters. Most PTX-2 was transformed to PTX-2 seco-acid and net accumulation was initially high, but decreased progressively throughout the experiment, likely due to esterification and loss of detectability. We also quantified ...
http://epic.awi.de/40510/
DFO - Juvenile Disease of Eastern Oysters  DFO - Juvenile Disease of Eastern Oysters
Barber, B.J., R.B. Carnegie and C.V. Davis. 1996. Effect of timing of seed deployment on growth and mortality of oysters, Crassostrea virginica, affected by Juvenile Oyster Disease (JOD). Journal of the World Aquaculture Society 27: 443-448.. Barber, B.J., C.V. Davis and M.A. Crosby. 1998. Cultured oysters, Crassostrea virginica, genetically selected for fast growth in the Damariscotta River, Maine, are resistant to mortality caused by Juvenile Oyster Disease (JOD). Journal of Shellfish Research 17: 1171-1175.. Barber, B., C. Davis and R. Hawes. 1998. Genetic selection of oysters for fast growth and disease resistance in Maine. Abstracts of the First Annual Northeast Aquaculture Conference and Exposition, Rockport, Maine, USA, November 18-19, 1998. pp. 78-79 (Abstract). Barber, B.J., C.V. Davis, R.B. Carnegie and K.J. Boettcher. 2000. Management of Juvenile Oyster Disease (JOD) in Maine. Journal of Shellfish Research 19: 641. (Abstract).. Boardman, C.L., A.P. Maloy and K.J. Boettcher. 2008. ...
http://www.dfo-mpo.gc.ca/science/aah-saa/diseases-maladies/jdeoy-eng.html
INSTITUT ZA OCEANOGRAFIJU I RIBARSTVO SPLIT - Laboratory of Plankton and Shellfish toxicity  INSTITUT ZA OCEANOGRAFIJU I RIBARSTVO SPLIT - Laboratory of Plankton and Shellfish toxicity
At the Institute of Oceanography and Fisheries, planktonology research has a long tradition, dating since the very beginnings of the Institute activities. Working in the lab combines research in ecology and phytoplankton and zooplankton taxology, and researching primary production processes. Taxonomy research is mostly focused on microzooplankton, mezozooplankton and microphytoplankton, while in the ecological research most of the attention is on the research of phytoplankton and zooplankton community changes created under the influence of anthropogenic activities and climate changes. In this research of great help is long-term data (phytoplankton, zooplankton, primary production, chlorophyll / a /), which represent a special value of this laboratory and the Institute itself.. ...
http://www.izor.hr/web/guest/plankton_uvod
Using a constraint-based regression method for relative quantification of somatic mutations in pyrosequencing signals: a case...  Using a constraint-based regression method for relative quantification of somatic mutations in pyrosequencing signals: a case...
Pyrosequencing Allele Quantification (AQ) is a cost-effective DNA sequencing method that can be used for detecting somatic mutations in formalin-fixed paraffin-embedded (FFPE) samples. The method displays a low turnaround time and a high sensitivity. Pyrosequencing suffers however from two main drawbacks including (i) low specificity and (ii) difficult signal interpretation when multiple mutations are reported in a hotspot genomic region. Using a constraint-based regression method, the new AdvISER-PYRO-SMQ algorithm was developed in the current study and implemented into an R package. As a proof-of-concept, AdvISER-PYRO-SMQ was used to identify a set of 9 distinct point mutations affecting codon 61 of the NRAS oncogene. In parallel, a pyrosequencing assay using the Qiagen software and its AQ module was used to assess selectively the presence of a single point mutation (NRAS $$c.182A|G$$
https://almob.biomedcentral.com/articles/10.1186/s13015-016-0086-4/tables/3
Inter Research » MEPS » v337 » p303-309  Inter Research » MEPS » v337 » p303-309
ABSTRACT: We examined the possibility that dinoflagellates belonging to genus Dinophysis acquire plastids from certain species of cryptophytes. We measured the abundance of cryptophytes over a 3 yr period in Okkirai Bay, northern Japan by fluorescent in situ hybridization (FISH), using an oligonucleotide probe that specifically binds to the Dinophysis plastid small subunit ribosomal RNA. A high density of FISH-probed cryptophytes always occurred prior to peak occurrences of D. fortii, although the density of FISH-probed cryptophytes did not correlate well with the density of D. fortii. Although further investigation is needed, monitoring of these cryptophyte species may be useful for predicting Dinophysis growth and subsequent outbreaks of diarrheic shellfish poisoning. ...
http://www.int-res.com/abstracts/meps/v337/p303-309/
Great Barrier Reef draft strategic assessment released - ABC Rural - ABC News  Great Barrier Reef draft strategic assessment released - ABC Rural - ABC News
Federal Environment Minister Greg Hunt has released the draft strategic assessment for the Great Barrier Reef World Heritage Area for public comment.
http://www.abc.net.au/news/rural/2013-11-01/barrier-reef-assesment-released/5063718
Last chance! Visitors flock to see Great Barrier Reef before it vanishes. - CSMonitor.com  Last chance! Visitors flock to see Great Barrier Reef before it vanishes. - CSMonitor.com
In a show of last chance tourism, many visits to the Great Barrier Reef are largely driven by a desire to see the site before it is lost.
https://www.csmonitor.com/Environment/2016/0913/Last-chance
Sex in the reef: How to tell coral species apart  Sex in the reef: How to tell coral species apart
Reef-building corals may live for several decades or centuries, so these immortal hybrid lines accumulate over time. They vary in appearance, depending on which species provided its egg and mitochondrion to the hybridization event. This is why corals seem to diversify without actually increasing the number of species on the reef.. Coral spawning a natural phenomenon when multiple coral species release their gametes at the same moment is triggered by specific environmental conditions including high water temperatures, the tidal and the lunar phase. Often, other critters join the action and spawn as well. Branching corals like elkhorn and staghorn tend to spawn for about one hour between the fourth and sixth night after the full moon.. Little pink colored balls consisting of both sperm and eggs held together by mucus detach from the corals and float towards the surface where they fall apart because of the water movement. When the sperm and eggs are released they meet with either sperm or eggs ...
http://www.genomenewsnetwork.org/articles/06_02/sex_reef.shtml
Parasite of the Day: June 24 - Zaops ostreum  Parasite of the Day: June 24 - Zaops ostreum
How many kind of food can you name comes with its own side dish? Well, the eastern oyster (Crassostrea virginica) should be on that list. This week. weve already seen how a trematode infection can improve the taste of oysters, but it seems that oyster also comes with another gastronomic treat in the form of the pea crab Zaops ostreum. Pea crabs (family Pinnotheridae) are small soft bodied crabs which live inside a variety of marine invertebrates, with most species living in bivalves. Zaops ostreum infect the oyster as a tiny first stage larvae, and grow to maturity within the bivalves mantle cavity, feeding upon food-laden mucus strings produced by its hosts filtering action. It is a true parasite in that it causes harm to its host. Not only does it steal food from the oyster, it also forms an obstruction within the body cavity and erode the gill tissue. From a culinary perspective, there are many serving suggestions available for pea crabs - they can be served raw, deep fried, or sautéed, ...
http://dailyparasite.blogspot.com/2010/06/june-24-zaops-ostreum.html
FA125/FA125: Introduction to Infectious Diseases in Hard Clams  FA125/FA125: Introduction to Infectious Diseases in Hard Clams
There was no evidence of QPX in cultured clams from the three areas that were examined as part of this study. While QPX has never been identified in Florida clams, there is concern that it could be introduced to the state. Consequently, imported clams and oysters must be tested and proven free of the QPX agent before entry into Florida, as per Florida Department of Agriculture and Consumer Services Division of Aquaculture best management practices.. Perkinsus was identified in clams from all three study sites tested during this study. With the exception of one animal collected in the Southwest Florida area, all Perkinsus positive clams were collected during the summer sampling period. In total, 23% of the clams collected at Gulf Jackson, 7% from Indian River, and 67% from southwest Florida were affected. When Perkinsus is seen in clams, it is indicative of an adjacent population of infected oysters. Oysters are susceptible to infection by P. marinus, and there are many strains varying in ...
http://edis.ifas.ufl.edu/fa125
Veterinary Pest Genomics Center | Ag Data Commons  Veterinary Pest Genomics Center | Ag Data Commons
The bacterial 16S tag-encoded FLX-titanium amplicon pyrosequencing (bTEFAP) method was used to carry out the classification analysis of bacterial flora in adult female and male horn flies and horn fly eggs. The bTEFAP method identified 16S rDNA sequences in our samples which allowed the identification of various prokaryotic taxa associated with the life stage examined. This is the first comprehensive report of bacterial flora associated with the horn fly using a culture-independent method. Several rumen, environmental, symbiotic and pathogenic bacteria associated with the horn fly were identified and quantified. This is the first report of the presence of Wolbachia in horn flies of USA origin and is the first report of the presence of Rikenella in an obligatory blood feeding insect ...
https://data.nal.usda.gov/veterinary-pest-genomics-center/field_nal_author%253Afield_nal_author_name/p%C3%A9rez%20de%20le%C3%B3n%2C%20adalberto%20a%252E/field_nal_author%3Afield_nal_author_name/wang%2C%20ju/field_tags/bacteria-602/field_tags/np104-3088?sort_by=changed
Veterinary Pest Genomics Center | Ag Data Commons  Veterinary Pest Genomics Center | Ag Data Commons
The bacterial 16S tag-encoded FLX-titanium amplicon pyrosequencing (bTEFAP) method was used to carry out the classification analysis of bacterial flora in adult female and male horn flies and horn fly eggs. The bTEFAP method identified 16S rDNA sequences in our samples which allowed the identification of various prokaryotic taxa associated with the life stage examined. This is the first comprehensive report of bacterial flora associated with the horn fly using a culture-independent method. Several rumen, environmental, symbiotic and pathogenic bacteria associated with the horn fly were identified and quantified. This is the first report of the presence of Wolbachia in horn flies of USA origin and is the first report of the presence of Rikenella in an obligatory blood feeding insect ...
https://data.nal.usda.gov/veterinary-pest-genomics-center/field_adc_hierarchy/genomics-genetics-20/field_nal_author%3Afield_nal_author_name/guerrero%2C%20felix%20d%252E/field_tags/bacteria-602/field_tags/microbiome-1059?sort_by=changed
Great Barrier Reef at a crossroads - InvestSMART  Great Barrier Reef at a crossroads - InvestSMART
Australias most iconic environmental asset needs protection from a slew of new developments, a UN report has warned, but the biggest threat lurks in the distance.
https://www.investsmart.com.au/investment-news/great-barrier-reef-at-a-crossroads/93490
Chile president will root for WCup team in Brazil  Chile president will root for WCup team in Brazil
Chile President Michelle Bachelet said on Tuesday that she will travel to the city of Cuiaba in Brazil to support her countrys World Cup team when it plays against Australia on June 13. Chile has one of the strongest lineups in its soccer history, including world-class players like Juventus midfielder
https://sports.yahoo.com/news/chile-president-root-wcup-team-170444465--sow.html
Differences in the gonadal cycles of adult and yearling blue grouse dendragapus obscurus fuliginosus  Differences in the gonadal cycles of adult and yearling blue grouse dendragapus obscurus fuliginosus
Hannon S.J.; Simard B.R.; Zwickel F.C.; Bendell J.F., 1979: Differences in the gonadal cycles of adult and yearling blue grouse dendragapus obscurus fuliginosus
https://eurekamag.com/research/005/151/005151293.php
Polity.org.za | News | Legislation | Notices and Regulations  Polity.org.za | News | Legislation | Notices and Regulations
Polity.org.za offers a unique take on news, with a focus on political, legal, economic and social issues in South Africa and Africa, as well as international affairs. Polity strives to provide our readers reliable and objective reporting on important issu
http://www.polity.org.za/page/mining-and-energy-notices/page:34
10 Best Self Catering & Holiday Homes in Great Barrier Reef (with prices) - 2017 - Book Apartments in Great Barrier Reef,...  10 Best Self Catering & Holiday Homes in Great Barrier Reef (with prices) - 2017 - Book Apartments in Great Barrier Reef,...
Book the perfect trip with 1,172 Great Barrier Reef villas and apartments. Read 2,138 reviews from TripAdvisor to make your Great Barrier Reef holidays truly unforgettable.
https://www.tripadvisor.ie/VacationRentals-g255074-Reviews-Great_Barrier_Reef_Queensland-Vacation_Rentals.html
Great Barrier Reef  Great Barrier Reef
... Cruise Reef Experience. Cairns ONLY all-inclusive Great Barrier Reef tour! NUMBER ONE for scuba diving, snorkelling, glass boat tour
https://divetables.com.au/tour/1-day/great-barrier-reef/
Booking Great Barrier Reef Budget Cruise - Queensland Backpackers  Booking Great Barrier Reef Budget Cruise - Queensland Backpackers
Great Barrier Reef budget cruise, full day to the Outer Great Barrier Reef, 2 locations snorkel & scuba dive & then experience the thrill of boomnetting
https://queenslandbackpackers.net.au/book/great-barrier-reef-budget-cruise/compass-cruises-reef-day-tour/
Lace Coral Great Barrier Reef Stock Photo  Lace Coral Great Barrier Reef Stock Photo
Stock Photo of Lace Coral Great Barrier Reef. High Quality Lace Coral Images and Gloss Prints are available from Oceanwide Images Stock Photo Library.
http://www.oceanwideimages.com/Large-Image.asp?pID=7851&cID=325&rp=categories.asp%3FcID%3D325%26p%3D1
The Great Barrier Reef isnt listed as in danger - but its still in big trouble | Kevins Walk on the Wild Side  The Great Barrier Reef isn't listed as 'in danger' - but it's still in big trouble | Kevin's Walk on the Wild Side
James Watson, The University of Queensland and Martine Maron, The University of Queensland In a somewhat surprising decision, UNESCO ruled this week that the Great Barrier Reef - one of the Earths great natural wonders - should not be listed as
https://kevinswildside.wordpress.com/2017/07/11/the-great-barrier-reef-isnt-listed-as-in-danger-but-its-still-in-big-trouble/
harbour of Hamilton Island, Whitsunday Islands, Great Barrier Reef,...  harbour of Hamilton Island, Whitsunday Islands, Great Barrier Reef,...
Photographie: harbour of Hamilton Island, Whitsunday Islands, Great Barrier Reef, Queensland Author: Egmont Strigl Date: 2006-02-09 DOWNLOAD
https://www.tradebit.com/filedetail.php/2454800v1655253-harbour-of-hamilton-island-whitsunday-islands-great
Variegated Lizardfish Great Barrier Reef Stock Photo  Variegated Lizardfish Great Barrier Reef Stock Photo
Stock Photo of Variegated Lizardfish Great Barrier Reef. High Quality Variegated Lizardfish Images and Gloss Prints are available from Oceanwide Images Stock Photo Library.
http://www.oceanwideimages.com/Large-Image.asp?pID=8273&cID=647&rp=categories.asp%3FcID%3D647%26p%3D1
knb-lter-mcr.15  knb-lter-mcr.15
These data consist of sample collection locations and conditions only, not the results of sequencing. These data were an initial collection of an expected time series which was not repeated. Clade data derived from the sample collection described here are archived on GeoSymbio. Coral are symbiotic with photosynthetic dinoflagellates from the genus Symbiodinium. There are eight divergent clades (A-H) within the genus which each contain many genetic varieties. Different types of Symbiodinium have been shown to affect the growth rate and thermal tolerance of the coral. The diversity and population structure of Symbiodinium on a reef and how it changes over time is therefore critical to the stability and resilience of coral reefs. Our research conducted through the MCR LTER project aims at defining the population structure of Symbiodinium present in the corals of Moorea and documenting changes over time.. ...
http://mcr.lternet.edu/cgi-bin/showDataset.cgi?docid=knb-lter-mcr.15
SWISSPROT: Q8IAZ0 PLAF7  SWISSPROT: Q8IAZ0 PLAF7
ID Q8IAZ0_PLAF7 Unreviewed; 1182 AA. AC Q8IAZ0; DT 01-MAR-2003, integrated into UniProtKB/TrEMBL. DT 01-MAR-2003, sequence version 1. DT 08-MAY-2019, entry version 89. DE SubName: Full=FAD-dependent monooxygenase, putative {ECO:0000313,EMBL:CAD51220.1}; DE EC=1.14.13.8 {ECO:0000313,EMBL:CAD51220.1}; GN ORFNames=PF3D7_0815300 {ECO:0000313,EMBL:CAD51220.1}; OS Plasmodium falciparum (isolate 3D7). OC Eukaryota; Alveolata; Apicomplexa; Aconoidasida; Haemosporida; OC Plasmodiidae; Plasmodium; Plasmodium (Laverania). OX NCBI_TaxID=36329 {ECO:0000313,EMBL:CAD51220.1, ECO:0000313,Proteomes:UP000001450}; RN [1] {ECO:0000313,Proteomes:UP000001450} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=Isolate 3D7 {ECO:0000313,Proteomes:UP000001450}; RX PubMed=12368864; DOI=10.1038/nature01097; RA Gardner M.J., Hall N., Fung E., White O., Berriman M., Hyman R.W., RA Carlton J.M., Pain A., Nelson K.E., Bowman S., Paulsen I.T., James K., RA Eisen J.A., Rutherford K., Salzberg S.L., Craig A., Kyes S., RA ...
http://pbil.univ-lyon1.fr/cgi-bin/acnuc-search-ac?query=Q8IAZ0&db=SWISSPROT
Amoebophrya ceratii  Amoebophrya ceratii
Cachon, J. 1964. Contribution a létude des Péridinies parasites. Cytologie, cycles évolutifs. Ann. Sci. Nat., 12 ser. 6: 1-158.. Cachon, J. & Cachon, M. 1987. Parasitic dinoflagellates. In Taylor, F. J. R. (Ed.). Biology of dinoflagellates. Blackwell, New York. pp. 571-610. Coats, D. W., Adam, E. J., Gallegos, C. L. & Hedrick, S. 1996. Parasitism of photosynthetic dinoflagellates in a shallow subestuary of Chesapeake Bay, USA. Aquat. Microb. Ecol. 11: 1-9.. Fritz, L. & Nass, M. 1992. Development of the endoparasitic dinoflagellate Amoebophrya ceratii within host dinoflagellate species. J. Phycol. 28: 312-320.. Taylor, F. J. R. 1968. Parasitism of the toxin-producing dinoflagellate Gonyaulax catenella by the endoparasitic dinoflagellate Amoebophrya ceratii. J. Fish. Res. Bd. Can. 25: 2241-2245.. ...
http://www.smhi.se/oceanografi/oce_info_data/plankton_checklist/dinoflagellates/amoebophrya_ceratii.htm
Bioinformatics Leipzig - Publications  Bioinformatics Leipzig - Publications
Mitochondria are membrane-enclosed organelles present in most eukaryotic cells that generate most of the cell's adenosine triphosphate (ATP) supply. Derived from a proteobacterial ancestor, mitochondria harbour their own, drastically reduced genome. Starting from a prokaryote-like ancestral state encoding a complete ribosomal ribonucleic acid (rRNA) operon, a complete set of transfer RNAs (tRNAs) required for translation, and key enzymes of the respiratory chain as well as some ribosomal proteins, the mitogenome has been dramatically restructured and further reduced in many of the eukaryotic lineages. The loss and transfer to the nucleus of mitochondrial genes is a common trend in most phyla, in particular in Metazoa and Alveolata. In extreme, phylogenetically dispersed cases, often associated with parasitic or anaerobic life styles, mitochondria have been transformed to the so-called mitosomes or hydrogenosomes devoid of their own genetic material. Ancestrally a single circular ...
http://www.bioinf.uni-leipzig.de/publications/13-010
Student Wins Trip To The Great Barrier Reef Through goa Partnership - B&T  Student Wins Trip To The Great Barrier Reef Through goa Partnership - B&T
A new wave of reef enthusiasts have been showing their support in a big way to help keep the Great Barrier Reef great through a partnership involving the Great Barrier Reef Foundation and Queensland outdoor media company goa.. One lucky Brisbane student, Gabriella Brancatini, has won the trip of a lifetime to the Great Barrier Reef with Richard Fitzpatrick, the marine biologist and Emmy Award-winning ocean cinematographer behind the camera for David Attenboroughs The Reef series.. Minister for the Great Barrier Reef, Steven Miles, congratulated Brancatini on winning the trip after she completed an online reef scientist quiz at the World Science Festival Brisbane.. "What a fabulous experience this will be for Gabriella who is in her first year at university studying agribusiness and sustainable agriculture," he said.. "She will gain a direct insight into the health of the reef and how we are all working together to ensure it continues to be a worldwide icon.". Stunning reef imagery was shared ...
http://www.bandt.com.au/media/student-wins-trip-great-barrier-reef-goa-partnership
AnatomyOrganismsDiseasesChemicals and DrugsPsychiatry and PsychologyPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaInformation ScienceHealth CareGeographicals
Rectal FistulaFranceAlveolataCoral ReefsSphagnopsidaMarine BiologyDinoflagellidaDecanoatesOceans and SeasCaenorhabditis elegansGeologic SedimentsTidal WavesEukaryotaAnthozoaEcosystemGiardia lambliaEuglenozoaGiardiaEuglenidaGiardiasisEuglenozoa InfectionsIntestinal Diseases, ParasiticMitochondriaVoltage-Gated Sodium ChannelsSmellOlfaction DisordersTemplates, GeneticJointsOdorsOlfactory PerceptionKnee JointTaste DisordersOlfactory PathwaysEncyclopedias as TopicPlasmodium falciparumPlasmodiumMalariaMedlinePlusAnnexinsPlasmodium vivaxMalaria, FalciparumPlasmodium bergheiConsumer Health InformationTrombiculidaePhthirapteraEsocidaeArguloidaAcariMitesArgasidaeMite InfestationsTicksVarroidaeIndonesiaTrichomonas vaginalisHydrogenaseTrichomonas VaginitisTrichomonasMalaysiaTrichomonas InfectionsSuccinate-CoA Ligases

Comparative gene expression in toxic versus non-toxic strains of the marine dinoflagellate Alexandrium minutumComparative gene expression in toxic versus non-toxic strains of the marine dinoflagellate Alexandrium minutum

The transcriptome of the novel dinoflagellate Oxyrrhis marina (Alveolata: Dinophyceae): response to salinity examined by 454 ...
more infohttps://pub.uni-bielefeld.de/publication/1785504

Category:Eucalyptus subg. Alveolata - Wikimedia CommonsCategory:Eucalyptus subg. Alveolata - Wikimedia Commons

Retrieved from "https://commons.wikimedia.org/w/index.php?title=Category:Eucalyptus_subg._Alveolata&oldid=246162604" ...
more infohttps://commons.wikimedia.org/wiki/Category:Eucalyptus_subg._Alveolata

Kermia alveolata - WikipediaKermia alveolata - Wikipedia

Kermia alveolata is a species of sea snail, a marine gastropod mollusk in the family Raphitomidae. Kermia alveolata ( ...
more infohttps://en.wikipedia.org/wiki/Kermia_alveolata

Engina alveolata - WikipediaEngina alveolata - Wikipedia

Engina alveolata is a species of sea snail, a marine gastropod mollusk in the family Pisaniidae. Engina alveolata (Kiener, 1836 ...
more infohttps://en.wikipedia.org/wiki/Engina_alveolata

MarLIN - The Marine Life Information Network - Honeycomb worm (Sabellaria alveolata) MarLIN - The Marine Life Information Network - Honeycomb worm (Sabellaria alveolata)

Sabellaria alveolata reefs are well represented in candidate SACs. Sabellaria alveolata does not have its own Species Action ... Sabellaria alveolata larva about seven and a half weeks old. Dorsal view.. Photographer: Douglas P. Wilson Copyright: Journal ... Sabellaria alveolata Honeycomb worm. In Tyler-Walters H. and Hiscock K. (eds) Marine Life Information Network: Biology and ... Sabellaria alveolata reef at Dunraven, Southerndown, south Wales.. Photographer: Judith Oakley Copyright: Judith Oakley ...
more infohttp://www.marlin.ac.uk/species/detail/1129

MarLIN - The Marine Life Information Network - Sabellaria alveolata on variable salinity sublittoral mixed sediment MarLIN - The Marine Life Information Network - Sabellaria alveolata on variable salinity sublittoral mixed sediment

Sabellaria alveolata on variable salinity sublittoral mixed sediment. Sabellaria alveolata on variable salinity sublittoral ... Sabellaria alveolata on variable salinity sublittoral mixed sediment. JNCC 2015. SS.SBR.PoR.SalvMx. Sabellaria alveolata on ... Sabellaria alveolata reefs. Habitat Action Plan. In UK Biodiversity Group. Tranche 2 Action Plans. English Nature for the UK ... A quantitative survey of the associated flora and fauna of Sabellaria alveolata (L.) reefs at Criccieth, North Wales. MSc ...
more infohttp://www.marlin.ac.uk/habitats/detail/1012/sabellaria_alveolata_on_variable_salinity_sublittoral_mixed_sediment

Frontiers | Evolutionary Trends of Perkinsozoa (Alveolata) Characters Based on Observations of Two New Genera of Parasitoids of...Frontiers | Evolutionary Trends of Perkinsozoa (Alveolata) Characters Based on Observations of Two New Genera of Parasitoids of...

... allowing the inference of the evolutionary framework of these Alveolata members. ... The two latter belong to the Alveolata lineage. Main groups composing Alveolata are ciliates and a clade named Myzozoa. The ... Alveolata, Perkinsozoa), a parasitoid of dinoflagellates. Eur. J. Protistol. 58, 9-25. doi: 10.1016/j.ejop.2016.11.006 ... Garcés, E., Alacid, E., Bravo, I., Fraga, S., and Figueroa, R. I. (2013). Parvilucifera sinerae (Alveolata, Myzozoa) is a ...
more infohttps://www.frontiersin.org/articles/10.3389/fmicb.2017.01594/full

The transcriptome of the novel dinoflagellate Oxyrrhis marina (Alveolata: Dinophyceae): response to salinity examined by 454...The transcriptome of the novel dinoflagellate Oxyrrhis marina (Alveolata: Dinophyceae): response to salinity examined by 454...

The transcriptome of the novel dinoflagellate Oxyrrhis marina (Alveolata: Dinophyceae): response to salinity examined by 454 ... Alveolata: Dinophyceae). Protist. 2010, 161: 212-21. 10.1016/j.protis.2009.11.003.View ArticlePubMedGoogle Scholar. ...
more infohttps://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-12-519

DIGITAL.CSIC: Infection development and kinetics of Parvilucifera sinerae Figueroa & Garces 2008 (Perkinsozoa, Alveolata) in...DIGITAL.CSIC: Infection development and kinetics of Parvilucifera sinerae Figueroa & Garces 2008 (Perkinsozoa, Alveolata) in...

Infection development and kinetics of Parvilucifera sinerae Figueroa & Garces 2008 (Perkinsozoa, Alveolata) in the marine toxic ...
more infohttps://digital.csic.es/handle/10261/127749

Protists I - Kingdoms Archaezoa, Euglenozoa, Alveolata, and Slime Molds - Biol110LeapTopper - ConfluenceProtists I - Kingdoms Archaezoa, Euglenozoa, Alveolata, and Slime Molds - Biol110LeapTopper - Confluence

Introduction to Kingdom Alveolata. The kingdom Alveolata is another diverse group. It includes some of the most familiar and ... Kingdom Alveolata: Apicomplexans. Apicomplexans are parasites, specialized for living and reproducing within the tissues of ... Kingdom Alveolata: Dinoflagellates. Dinoflagellates typically possess distinct shapes due to frames of cellulose within their ... Members of Kingdom Alveolata are even more diverse. They include the dinoflagellates that are involved in such diverse ...
more infohttps://wikispaces.psu.edu/display/Bio110Leap/Protists+I+-+Kingdoms+Archaezoa%2C+Euglenozoa%2C+Alveolata%2C+and+Slime+Molds

Protists I - Protists with Modified Mitochondria, Kingdoms Euglenozoa and Alveolata - BIOL110SUMMERTEST - ConfluenceProtists I - Protists with Modified Mitochondria, Kingdoms Euglenozoa and Alveolata - BIOL110SUMMERTEST - Confluence

Introduction to Kingdom Alveolata. The kingdom Alveolata is another diverse group. It includes some of the most familiar and ... Kingdom Alveolata: Dinoflagellates. Dinoflagellates usually have distinct shapes due to frames of cellulose within their cell ... Kingdom Alveolata: Apicomplexans. Apicomplexans are parasites, specialized for living and reproducing within the tissues of ... Members of Kingdom Alveolata are even more diverse. They include the dinoflagellates that are involved in such diverse ...
more infohttps://wikispaces.psu.edu/display/BIOLSUMMERTEST/Protists+I+-+Protists+with+Modified+Mitochondria%2C+Kingdoms+Euglenozoa+and+Alveolata

The All-Data-Based Evolutionary Hypothesis of Ciliated Protists with a Revised Classification of the Phylum Ciliophora ...The All-Data-Based Evolutionary Hypothesis of Ciliated Protists with a Revised Classification of the Phylum Ciliophora ...

Alveolata). Sci. Rep. 6, 24874; doi: 10.1038/srep24874 (2016). ...
more infohttps://nhm.openrepository.com/handle/10141/610783

AlveolatesAlveolates

Alveolata. Authored by Brian S. Leander. The TEXT of this page is licensed under the Creative Commons Attribution-NonCommercial ... Alveolata. Brian S. Leander Click on an image to view larger version & data in a new window ... The Alveolata is a monophyletic group of primarily single-celled eukaryotes that have adopted extremely diverse modes of ... The Alveolata forms a sister group to two major clades of photosynthetic eukaryotes, namely the (ochrophyte) stramenopiles and ...
more infohttp://tolweb.org/Alveolates

AlveolatesAlveolates

Alveolata. Authored by Brian S. Leander. The TEXT of this page is licensed under the Creative Commons Attribution-NonCommercial ... Alveolata. Brian S. Leander Click on an image to view larger version & data in a new window ... The Alveolata is a monophyletic group of primarily single-celled eukaryotes that have adopted extremely diverse modes of ... The Alveolata forms a sister group to two major clades of photosynthetic eukaryotes, namely the (ochrophyte) stramenopiles and ...
more infohttp://www.tolweb.org/Alveolates/2379

Structural Biochemistry/Genome Analysis/Sequenced Genomes - Wikibooks, open books for an open worldStructural Biochemistry/Genome Analysis/Sequenced Genomes - Wikibooks, open books for an open world

Alveolata[edit]. Alveolata are a group of protists which includes the Ciliophora, Apicomplexa and Dinoflagellata. Members of ...
more infohttps://en.wikibooks.org/wiki/Structural_Biochemistry/Genome_Analysis/Sequenced_Genomes

Biological Diversity 3Biological Diversity 3

Kingdom Alveolata , Back to Top. The kingdom Alveolata was only recently recognized. The synapomorphy of this clade is the ... Kingdom Archaezoa , Kingdom Euglenozoa , Kingdom Alveolata , Algae , Kingdom Stramenopila. Kingdom Rhodophyta , Slime Molds , ...
more infohttp://www2.estrellamountain.edu/faculty/farabee/biobk/BioBookDiversity_3.html

Plasmodium knowlesi - WikipediaPlasmodium knowlesi - Wikipedia

Eukaryota: SAR: Alveolata. .mw-parser-output .nobold{font-weight:normal}. Domain. Archaea. Bacteria. Eukaryota. (Supergroup. ...
more infohttps://en.wikipedia.org/wiki/Plasmodium_knowlesi

Eimeriorina - WikipediaEimeriorina - Wikipedia

Eukaryota: SAR: Alveolata. .mw-parser-output .nobold{font-weight:normal}. Domain. Archaea. Bacteria. Eukaryota. (Supergroup. ...
more infohttps://en.wikipedia.org/wiki/Eimeriorina

GSPATT00029592001 hypothetical protein [Paramecium tetraurelia strain d4-2] - Gene - NCBIGSPATT00029592001 hypothetical protein [Paramecium tetraurelia strain d4-2] - Gene - NCBI

Eukaryota; Alveolata; Ciliophora; Intramacronucleata; Oligohymenophorea; Peniculida; Parameciidae; Paramecium. Genomic context ...
more infohttps://www.ncbi.nlm.nih.gov/gene/?term=GSPATT00029592001

Eukaryota (classification phylogénétique) - WikipédiaEukaryota (classification phylogénétique) - Wikipédia

Eukaryota -- Alveolata -- Amoebozoa -- Archaeplastida -- Chromista -- Excavata -- Metazoa -- Mycota -- Rhizaria. *Le vivant ( ... o Alveolata │ ├─o Ciliophora │ └─o │ ├─o Dinoflagellata │ └─o Apicomplexa └─o ├─o Stramenopiles │ ├─o Opalinata │ └─o │ ├─o ... o infra-règne des Alveolata │ │ ├─o super-embranchement des Miozoa │ │ │ ├─o embranchement des Dinozoa │ │ │ │ ├─o sous- ... o Alveolata ├─o Ciliata └─o ├─o Apicomplexa └─o Dinoflagellata ...
more infohttps://fr.wikipedia.org/wiki/Eukaryota_

Bacterial community associated with Pfiesteria-like dinoflagellate cultures. - PubMed - NCBIBacterial community associated with Pfiesteria-like dinoflagellate cultures. - PubMed - NCBI

Dinoflagellates (Eukaryota; Alveolata; Dinophyceae) are single-cell eukaryotic microorganisms implicated in many toxic ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/11472503?dopt=Abstract

Kentucky Fossil Corals, Plates 1-10Kentucky Fossil Corals, Plates 1-10

COLUMNARIA ALVEOLATA. Hudson River Group.. 3. Portion of the upper surface of a corallum found in Nelson county. Collection of ... COLUMNARIA ALVEOLATA. Hudson River Group.. 2. Longitudinal section of a corallum found near Fisherville, Jefferson county. ...
more infohttp://www.uky.edu/OtherOrgs/KPS/fossilcorals/pages/plates1-10.htm

Template:Joint navs - 维基百科，自由的百科全书Template:Joint navs - 维基百科，自由的百科全书

Alveolata. *Amoebozoa（英语：Template:Amoebozoa）. *Excavata. *Protist（英语：Template:Protist structures） ...
more infohttps://zh.wikipedia.org/wiki/Template:Joint_navs

Plasmodium (släkte) - WikipediaPlasmodium (släkte) - Wikipedia

Plasmodium är ett släkte protister som sprids med myggor till olika värddjur. Här återfinns bland annat de arter som hos människan ger upphov till malaria.. Plasmodierna sprids genom blodsugande myggor.. ...
more infohttps://sv.wikipedia.org/wiki/Plasmodium_

Ancestral Colonial Choanoflagellate by Javier Mendoza Diek on PreziAncestral Colonial Choanoflagellate by Javier Mendoza Diek on Prezi

Alveolata. All members have cilia and a membrane sac called an alveoulus. Euglenozoa. Characterized by the presence of one ot ...
more infohttps://prezi.com/jngq_19hsymc/ancestral-colonial-choanoflagellate/
AnatomyOrganismsDiseasesChemicals and DrugsPsychiatry and PsychologyPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaInformation ScienceHealth CareGeographicals
Rectal FistulaFranceAlveolataCoral ReefsSphagnopsidaMarine BiologyDinoflagellidaDecanoatesOceans and SeasCaenorhabditis elegansGeologic SedimentsTidal WavesEukaryotaAnthozoaEcosystemGiardia lambliaEuglenozoaGiardiaEuglenidaGiardiasisEuglenozoa InfectionsIntestinal Diseases, ParasiticMitochondriaVoltage-Gated Sodium ChannelsSmellOlfaction DisordersTemplates, GeneticJointsOdorsOlfactory PerceptionKnee JointTaste DisordersOlfactory PathwaysEncyclopedias as TopicPlasmodium falciparumPlasmodiumMalariaMedlinePlusAnnexinsPlasmodium vivaxMalaria, FalciparumPlasmodium bergheiConsumer Health InformationTrombiculidaePhthirapteraEsocidaeArguloidaAcariMitesArgasidaeMite InfestationsTicksVarroidaeIndonesiaTrichomonas vaginalisHydrogenaseTrichomonas VaginitisTrichomonasMalaysiaTrichomonas InfectionsSuccinate-CoA Ligases
SabellariaPerkinsozoaLineageSpeciesGroupDinophyceaeReefsEcologicalEnvironmental

Sabellaria16

search

Perkinsozoa2

search
  • Evolutionary Trends of Perkinsozoa (Alveolata) Characters Based on Observations of Two New Genera of Parasitoids of dinoflagellates, Dinovorax gen. nov. and Snorkelia gen. nov. (frontiersin.org)
  • The morphological features and phylogenetic position of these parasitoids represent ancestral characters for the Perkinsozoa phylum, and also for Dinozoa clade, allowing the inference of the evolutionary framework of these Alveolata members. (frontiersin.org)

Lineage1

search

Species1

search

Group1

search
  • The Alveolata is a monophyletic group of primarily single-celled eukaryotes that have adopted extremely diverse modes of nutrition, such as predation, photoautotrophy and intracellular parasitism. (tolweb.org)

Dinophyceae1

search

Reefs2

search
  • abellaria alveolata is a gregarious polychaete that uses sand particles to build three-dimensional structures known as reefs, fixed atop rocks or built on soft sediments. (ifremer.fr)
  • Our first set of results highlight the importance of S. alveolata reefs as benthic primary production enhancers via their physical structure and their biological activity. (ifremer.fr)

Ecological1

search
  • The results obtained using beta diversity indices emphasize the importance of recruitment in structuring the reef's macrofauna and - paradoxically - the ecological value of S. alveolata degraded forms as biodiversity and recruitment promoters. (ifremer.fr)

Environmental1

search
  • At both seasons, S. alveolata biomass and sediment principal mode were the environmental parameters which best differentiated the engineered, associated and control sediment assemblages. (ifremer.fr)