AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation Science
Alu ElementsRepetitive Sequences, Nucleic AcidLong Interspersed Nucleotide ElementsShort Interspersed Nucleotide ElementsDNA Transposable ElementsGenome, HumanBase SequenceMolecular Sequence DataPrimatesRetroelementsStrepsirhiniSequence Homology, Nucleic AcidExons3' Flanking RegionHominidaeResponse ElementsCercopithecidaeIntronsRNA EditingPromoter Regions, GeneticPan troglodytesEnhancer Elements, GeneticEvolution, MolecularTranscription, GeneticDNARNA Polymerase IIIMutagenesis, InsertionalGenes, Neurofibromatosis 1Gorilla gorillaRegulatory Sequences, Nucleic AcidGene ConversionInosineSequence AlignmentGene Expression RegulationPolymerase Chain ReactionSequence Analysis, DNAChromosome BreakageConsensus SequencePhylogenyCpG IslandsHeLa CellsGenetic VariationCloning, MolecularTerminal Repeat SequencesRNA, MessengerRestriction MappingChromosome MappingBinding SitesGene RearrangementComputational BiologyTrace Elements
Alu Elements: The Alu sequence family (named for the restriction endonuclease cleavage enzyme Alu I) is the most highly repeated interspersed repeat element in humans (over a million copies). It is derived from the 7SL RNA component of the SIGNAL RECOGNITION PARTICLE and contains an RNA polymerase III promoter. Transposition of this element into coding and regulatory regions of genes is responsible for many heritable diseases.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Long Interspersed Nucleotide Elements: Highly repeated sequences, 6K-8K base pairs in length, which contain RNA polymerase II promoters. They also have an open reading frame that is related to the reverse transcriptase of retroviruses but they do not contain LTRs (long terminal repeats). Copies of the LINE 1 (L1) family form about 15% of the human genome. The jockey elements of Drosophila are LINEs.Short Interspersed Nucleotide Elements: Highly repeated sequences, 100-300 bases long, which contain RNA polymerase III promoters. The primate Alu (ALU ELEMENTS) and the rodent B1 SINEs are derived from 7SL RNA, the RNA component of the signal recognition particle. Most other SINEs are derived from tRNAs including the MIRs (mammalian-wide interspersed repeats).DNA Transposable Elements: Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.Genome, Human: The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.PrimatesRetroelements: Elements that are transcribed into RNA, reverse-transcribed into DNA and then inserted into a new site in the genome. Long terminal repeats (LTRs) similar to those from retroviruses are contained in retrotransposons and retrovirus-like elements. Retroposons, such as LONG INTERSPERSED NUCLEOTIDE ELEMENTS and SHORT INTERSPERSED NUCLEOTIDE ELEMENTS do not contain LTRs.Strepsirhini: A suborder of PRIMATES consisting of the following five families: CHEIROGALEIDAE; Daubentoniidae; Indriidae; LEMURIDAE; and LORISIDAE.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.3' Flanking Region: The region of DNA which borders the 3' end of a transcription unit and where a variety of regulatory sequences are located.Hominidae: Family of the suborder HAPLORHINI (Anthropoidea) comprising bipedal primate MAMMALS. It includes modern man (HOMO SAPIENS) and the great apes: gorillas (GORILLA GORILLA), chimpanzees (PAN PANISCUS and PAN TROGLODYTES), and orangutans (PONGO PYGMAEUS).Response Elements: Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions.Cercopithecidae: The family of Old World monkeys and baboons consisting of two subfamilies: CERCOPITHECINAE and COLOBINAE. They are found in Africa and part of Asia.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.RNA Editing: A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Pan troglodytes: The common chimpanzee, a species of the genus Pan, family HOMINIDAE. It lives in Africa, primarily in the tropical rainforests. There are a number of recognized subspecies.Enhancer Elements, Genetic: Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.Evolution, Molecular: The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).RNA Polymerase III: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.Mutagenesis, Insertional: Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.Genes, Neurofibromatosis 1: Tumor suppressor genes located on the long arm of human chromosome 17 in the region 17q11.2. Mutation of these genes is thought to cause NEUROFIBROMATOSIS 1, Watson syndrome, and LEOPARD syndrome.Gorilla gorilla: This single species of Gorilla, which is a member of the HOMINIDAE family, is the largest and most powerful of the PRIMATES. It is distributed in isolated scattered populations throughout forests of equatorial Africa.Regulatory Sequences, Nucleic Acid: Nucleic acid sequences involved in regulating the expression of genes.Gene Conversion: The asymmetrical segregation of genes during replication which leads to the production of non-reciprocal recombinant strands and the apparent conversion of one allele into another. Thus, e.g., the meiotic products of an Aa individual may be AAAa or aaaA instead of AAaa, i.e., the A allele has been converted into the a allele or vice versa.Inosine: A purine nucleoside that has hypoxanthine linked by the N9 nitrogen to the C1 carbon of ribose. It is an intermediate in the degradation of purines and purine nucleosides to uric acid and in pathways of purine salvage. It also occurs in the anticodon of certain transfer RNA molecules. (Dorland, 28th ed)Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Chromosome Breakage: A type of chromosomal aberration involving DNA BREAKS. Chromosome breakage can result in CHROMOSOMAL TRANSLOCATION; CHROMOSOME INVERSION; or SEQUENCE DELETION.Consensus Sequence: A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.CpG Islands: Areas of increased density of the dinucleotide sequence cytosine--phosphate diester--guanine. They form stretches of DNA several hundred to several thousand base pairs long. In humans there are about 45,000 CpG islands, mostly found at the 5' ends of genes. They are unmethylated except for those on the inactive X chromosome and some associated with imprinted genes.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Genetic Variation: Genotypic differences observed among individuals in a population.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Terminal Repeat Sequences: Nucleotide sequences repeated on both the 5' and 3' ends of a sequence under consideration. For example, the hallmarks of a transposon are that it is flanked by inverted repeats on each end and the inverted repeats are flanked by direct repeats. The Delta element of Ty retrotransposons and LTRs (long terminal repeats) are examples of this concept.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Gene Rearrangement: The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.Computational Biology: A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.Trace Elements: A group of chemical elements that are needed in minute quantities for the proper growth, development, and physiology of an organism. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)

Hereditary desmoid disease in a family with a germline Alu I repeat mutation of the APC gene. (1/466)

Two families with autosomal dominantly inherited desmoid tumors have recently been shown to have germline mutations at the 3' end of the APC gene. We subsequently identified an Amish family with autosomal dominantly inherited desmoid tumors. Genetic analysis performed on one family member, a 47-year-old man with multiple desmoid tumors and no colon polyps, revealed a protein truncating mutation in the middle of the APC gene. The truncating mutation is the result of a 337-bp insertion of an Alu I sequence into codon 1526 of the APC gene. The presence of a poly(A) tail at the 3' end of the insertion suggests that the Alu I sequence was inserted by a retrotranspositional event. Germline insertions of Alu I sequences have occasionally been reported to cause other genetic diseases including type I neurofibromatosis, hereditary site-specific breast cancer (BRCA2), and hemophilia B. However, this is the first report of a germline mutation of the APC gene resulting from an Alu I insertion.  (+info)

A novel human DNA-binding protein with sequence similarity to a subfamily of redox proteins which is able to repress RNA-polymerase-III-driven transcription of the Alu-family retroposons in vitro. (2/466)

In this study we identified a novel protein which may contribute to the transcriptional inactivity of Alu retroposons in vivo. A human cDNA clone encoding this protein (ACR1) was isolated from a human expression library using South-western screening with an Alu subfragment, implicated in the regulation of Alu in vitro transcription and interacting with a HeLa nuclear protein down-regulated in adenovirus-infected cells. Bacterially expressed ACR1 is demonstrated to inhibit RNA polymerase III (Pol III)-dependent Alu transcription in vitro but showed no repression of transcription of a tRNA gene or of a reporter gene under control of a Pol II promoter. ACR1 mRNA is also found to be down-regulated in adenovirus-infected HeLa cells, consistent with a possible repressor function of the protein in vivo. ACR1 is mainly (but not exclusively) located in cytoplasm and appears to be a member of a weakly characterized redox protein family having a central, highly conserved sequence motif, PGAFTPXCXXXXLP. One member of the family identified earlier as peroxisomal membrane protein (PMP)20 is known to interact in a sequence-specific manner with a yeast homolog of mammalian cyclosporin-A-binding protein cyclophilin, and mammalian cyclophilin A (an abundant ubiquitously expressed protein) is known to interact with human transcriptional repressor YY1, which is a major sequence-specific Alu-binding protein in human cells. It appears, therefore, that transcriptional silencing of Alu in vivo is a result of complex interactions of many proteins which bind to its Pol III promoter.  (+info)

Translational control of specific genes during differentiation of HL-60 cells. (3/466)

Eukaryotic gene expression can be regulated through selective translation of specific mRNA species. Nevertheless, the limited number of known examples hampers the identification of common mechanisms that regulate translation of specific groups of genes in mammalian cells. We developed a method to identify translationally regulated genes. This method was used to examine the regulation of protein synthesis in HL-60 cells undergoing monocytic differentiation. A partial screening of cellular mRNAs identified five mRNAs whose translation was specifically inhibited and five others that were activated as was indicated by their mobilization onto polysomes. The specifically inhibited mRNAs encoded ribosomal proteins, identified as members of the 5'-terminal oligopyrimidine tract mRNA family. Most of the activated transcripts represented uncharacterized genes. The most actively mobilized transcript (termed TA-40) was an untranslated 1.3-kilobase polyadenylated RNA with unusual structural features, including two Alu-like elements. Following differentiation, a significant change in the cytoplasmic distribution of Alu-containing mRNAs was observed, namely, the enhancement of Alu-containing mRNAs in the polysomes. Our findings support the notion that protein synthesis is regulated during differentiation of HL-60 cells by both global and gene-specific mechanisms and that Alu-like sequences within cytoplasmic mRNAs are involved in such specific regulation.  (+info)

Human-specific insertion/deletion polymorphisms in Indian populations and their possible evolutionary implications. (4/466)

DNA samples from 396 unrelated individuals belonging to 14 ethnic populations of India, inhabiting various geographical locations and occupying various positions in the socio-cultural hierarchy, were analysed in respect of 8 human-specific polymorphic insertion/deletion loci. All loci, except Alu CD4, were found to be highly polymorphic in all populations. The levels of average heterozygosities were found to be very high in all populations and, in most populations, also higher than those predicted by the island model of population structure. The coefficient of gene differentiation among Indian populations was found to be higher than populations in most other global regions, except Africa. These results are discussed in the light of two possible scenarios of evolution of Indian populations in the broader context of human evolution.  (+info)

Y chromosomal polymorphisms reveal founding lineages in the Finns and the Saami. (5/466)

Y chromosomal polymorphisms were studied in 502 males from 16 Eurasian ethnic groups including the Finns, Saami (Inari Lake area and Skolt Saami), Karelians, Mari, Mokshas, Erzas, Hungarians (Budapest area and Csangos), Khanty, Mansi, Yakuts, Koryaks, Nivkhs, Mongolians, and Latvians. The samples were analysed for polymorphisms in the Y chromosome specific Alu insertion (YAP) and six microsatellites (DYS19, DYS389-I and II, DYS390, DYS392, DYS393). The populations were also screened for the recently described Tat polymorphism. The incidence of YAP+ type was highest in the Csangos and in other Hungarians (37.5% and 17.5%, respectively). In the Karelians and the Latvians it was present at approximately the same level as commonly found in other European populations, whilst absent in our further samples of Eurasian populations, including the Finns and the Saami. Aside from the Hungarians, the C allele of the Tat polymorphism was common in all the Finno-Ugric speaking populations (from 8.2% to 63.2%), with highest incidence in the Ob-Ugrian Khanty. The C allele was also found in the Latvians (29.4%). The haplotypes found associated with the Tat C allele showed consistently lower density than those associated with the T allele, indicating that the T allele is the original form. The computation of the age of the Tat C suggested that the mutation might be a relatively recent event giving a maximum likelihood estimate of 4440 years (95% confidence interval about 3140-6200 years). The distribution patterns of the 222 haplotypes found varied considerably among the populations. In the Finns a majority of the haplotypes could be assigned to two distinct groups, one of which harboured the C allele of the Tat polymorphism, indicating dichotomous primary source of genetic variation among Finnish males. The presence of a bottleneck or founding effect in the male lineages of some of the populations, namely in the Finns and the Saami, would appear to be one likely interpretation for these findings.  (+info)

Molecular analysis of an unstable genomic region at chromosome band 11q23 reveals a disruption of the gene encoding the alpha2 subunit of platelet-activating factor acetylhydrolase (Pafah1a2) in human lymphoma. (6/466)

A region of 150 kb has been analysed around a previously isolated, lymphoma associated, translocation breakpoint located at chromosome band 11q23. This balanced and reciprocal translocation, t(11;14)(q32;q23), has been shown to result in the fusion between chromosome 11 specific sequence and the switch gamma4 region of the IGH locus. The LPC gene, encoding a novel proprotein convertase belonging to the furin family, has been identified in this region. In order to characterize further the region surrounding the translocation, we have determined the detailed structure of LPC. Here we show that LPC consists of at least 16 exons covering 25 kb, and that there is a partial duplication, involving mobile genetic elements and containing LPC exons 13-17 in a tail-tail configuration at 65 kb downstream. Since the chromosomal breakpoint lay between these two structures, the intervening region was further analysed and shown to contain at least two unrelated genes. The previously known SM22 gene was localized close to the 3' tail of LPC. Furthermore, we identified the gene encoding the alpha2 subunit of platelet-activating factor acetylhydrolase (Pafah1a2) at the chromosomal breakpoint. The position of another previously identified breakpoint was also located to within the first intron of this gene. Altogether, our results give evidence of a genomic instability of this area of 11q23 and show that Pafah1a2 and not LPC is the gene disrupted by the translocation, suggesting that deregulated Pafah1a2 may have a role in lymphomagenesis.  (+info)

Concerted evolution of the tandem array encoding primate U2 snRNA (the RNU2 locus) is accompanied by dramatic remodeling of the junctions with flanking chromosomal sequences. (7/466)

The genes encoding primate U2 snRNA are organized as a nearly perfect tandem array (the RNU2 locus) that has been evolving concertedly for >35 Myr since the divergence of baboons and humans. Thus the repeat units of the tandem array are essentially identical within each species, but differ between species. Homogeneity is maintained because any change in one repeat unit is purged from the array or fixed in all other repeats. Intriguingly, the cytological location of RNU2 has remained unchanged despite concerted evolution of the tandem array. We had found previously that junction sequences between the U2 tandem array and flanking DNA were subject to remodeling over a region of 200-300 bp during the past 5 Myr in the hominid lineage. Here we show that the junctions between the U2 tandem array and flanking DNA have undergone dramatic rearrangements over a region of 1 to >10 kbp in the 35 Myr since divergence of the Old World Monkey and hominid lineages. We argue that these rearrangements reflect the high level of genetic activity required to sustain concerted evolution, and propose a model to explain why maintenance of homogeneity within a tandemly repeated multigene family would lead to junctional diversity.  (+info)

Expressed sequence tag (EST) phenotyping of HT-29 cells: cloning of ser/thr protein kinase EMK1, kinesin KIF3B, and of transcripts that include Alu repeated elements. (8/466)

To study the mechanisms that control epithelial commitment and differentiation we have used undifferentiated HT-29 colon cancer cells and a subpopulation of mucus secreting cells obtained by selection of HT-29 cells in 10-6 M methotrexate (M6 cells) as experimental models. We isolated cDNAs encoding transcripts overexpressed in early confluent M6 cells regarding steady-state levels in HT-29 cells by subtractive hybridisation. Fifty-one cDNA clones, corresponding to 34 independent transcripts, were isolated, partially sequenced by their 5' end, and classified into four groups according to their identity: transcripts that included a repeated sequence of the Alu family (10 clones, among them those encoding ribonucleoprotein RNP-L and E-cadherin), transcripts encoded by the mitochondrial genome (nine clones), transcripts encoding components of the protein synthesis machinery (23 clones, including the human ribosomal protein L38 not previously cloned in humans) and nine additional cDNAs that could not be classified in the previous groups. These last included ferritin, cytokeratin 18, translationally controlled human tumour protein (TCHTP), mt-aldehyde dehydrogenase, as well as unknown transcripts (three clones), and the human homologues of the molecular motor kinesin KIF3B and of the ser/thr protein kinase EMK1. Spot dot and Northern blot analyses showed that ser/thr protein kinase EMK1 was differentially expressed in M6 cells when compared with parental HT-29 cells. Steady-state levels of EMK1 were higher in proliferating, preconfluent, M6 and HT-29 cells than in 2 days post confluence (dpc) and 8dpc M6 and HT-29 cells. Transcripts that included an Alu repeat were also shown to be differentially expressed and accumulated in differentiating M6 cells when analysed by Northern blot. The significance of the transcripts cloned is discussed in the context of the commitment and differentiation of the M6 cells to the mucus secreting lineage of epithelial cells.  (+info)

Alu elements shape the primate transcriptome by cis-regulation of RNA editing | Genome Biology | Full TextAlu elements shape the primate transcriptome by cis-regulation of RNA editing | Genome Biology | Full Text
In this study we demonstrated that Alu repetitive elements can function as inducers of A-to-I editing in adjacent sequences, affecting the expressed proteome. Alu repeats are primate specific and vary also in abundance within primates. Our observation therefore points to a human- or primate-specific phenomenon that cannot be explained by the sequence at the site of editing.. It has previously been speculated by Li and co-workers that non-Alu A/I editing sites are dependent on nearby edited Alu sequences in the human transcriptome [20]. Their theory was based on the fact the two classes of editing are often found within close proximity in the same transcripts. We were able to confirm their hypothesis, and show that editing in non-repetitive elements often depends on nearby repetitive Alu elements. Our previous analysis showed that induction of site-selective editing at the I/M site of Gabra-3 by a long intronic hairpin structure is independent of editing, and instead depends on the ...
MIEN1 is tightly regulated by SINE Alu methylation in its promoter<...MIEN1 is tightly regulated by SINE Alu methylation in its promoter<...
TY - JOUR. T1 - MIEN1 is tightly regulated by SINE Alu methylation in its promoter. AU - Rajendiran, Smrithi. AU - Gibbs, Lee D.. AU - Van Treuren, Timothy. AU - Klinkebiel, David L.. AU - Vishwanatha, Jamboor K.. PY - 2016/1/1. Y1 - 2016/1/1. N2 - Migration and invasion enhancer 1 (MIEN1) is a novel gene involved in prostate cancer progression by enhancing prostate cancer cell migration and invasion. DNA methylation, an important epigenetic regulation, is one of the most widely altered mechanisms in prostate cancer. This phenomenon frames the basis to study the DNA methylation patterns in the promoter region of MIEN1. Bisulfite pyrosequencing demonstrates the MIEN1 promoter contains a short interspersed nuclear Alu element (SINE Alu) repeat sequence. Validation of methylation inhibition on MIEN1 was performed using nucleoside analogs and non-nucleoside inhibitors and resulted in an increase in both MIEN1 RNA and protein in normal cells. MIEN1 mRNA and protein increases upon inhibition of ...
Do Alu repeats drive the evolution of the primate transcriptome? | Genome Biology | Full TextDo Alu repeats drive the evolution of the primate transcriptome? | Genome Biology | Full Text
Repetitive elements constitute 45% of the human genome [1]. With more than 1 million copies (about 10% of the human genome), Alu sequences are the most prevalent repetitive elements [2]. Alus began to spread at the base of the primate lineage about 65 million years ago [3] and inserted at high rates until about 30 million years ago, after which Alu insertion rate was markedly reduced. This translates to 85% of Alus being common to all monkeys [4]. Because they are primate specific, Alus have been proposed to be major players in shaping the primate genome and transcriptome. However, little is known about the impact they have on genome structure and function. Although they are considered genetic junk by some authors [5], others have proposed that they are functionally important [1, 6-8]. In a few instances they have been found to have inserted into coding regions of genes, becoming part of the protein coding message [9, 10]. Similarly, newly inserted Alu elements may trigger genomic responses ...
The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region<...The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region<...
TY - JOUR. T1 - The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region. AU - Trujillo, Miguel A.. AU - Sakagashira, Michiko. AU - Eberhardt, Norman L.. PY - 2006/10/9. Y1 - 2006/10/9. N2 - Alu family sequences are middle repetitive short interspersed elements (SINEs) dispersed throughout vertebrate genomes that can modulate gene transcription. The human (h) GH locus contains 44 complete and four partial Alu elements. An Sx Alu repeat lies in close proximity to the hGH-1 and hGH-2 genes in the 3′-flanking region. Deletion of the Sx Alu repeat in reporter constructs containing hGH-1 3′-flanking sequences increased reporter activity in transfected pituitary GC cells, suggesting this region contained a repressor element. Analysis of multiple deletion fragments from the 3′-flanking region of the hGH-1 gene revealed a strong orientation- and position-independent silencing activity mapping between nucleotides 2158 and 2572 encompassing the Sx ...
Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene | BMC Molecular Biology | Full TextBiased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene | BMC Molecular Biology | Full Text
Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding
lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements | Coffee and Sci(ence)lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements | Coffee and Sci(ence)
lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements Chenguang Gong & Lynne E. Maquat Nature 470, 284-288 (10 February 2011) doi:10.1038/nature09701Staufen 1 (STAU1)-mediated messenger RNA decay (SMD) involves the degradation of translationally active mRNAs whose 3′-untranslated regions (3′ UTRs) bind to STAU1, a protein that binds to double-stranded RNA1. Earlier…
Scientists Discover Gene Regulation Mechanism Unique to Primates - Healthcanal.com : Healthcanal.comScientists Discover Gene Regulation Mechanism Unique to Primates - Healthcanal.com : Healthcanal.com
The newly identified mechanism involves Alu elements, repetitive DNA elements that spread throughout the genome as primates evolved. While scientists have known about the existence of Alu elements for many years, their function, if any, was largely unknown.. Maquat discovered that Alu elements team up with molecules called long noncoding RNAs (lncRNAs) to regulate protein production. They do this by ensuring messenger RNAs (mRNAs), which take genetic instructions from DNA and use it to create proteins, stay on track and create the right number of proteins. If left unchecked, protein production can spiral out of control, leading to the proliferation or multiplication of cells, which is characteristic of diseases such as cancer.. "Previously, no one knew what Alu elements and long noncoding RNAs did, whether they were junk or if they had any purpose. Now, weve shown that they actually have important roles in regulating protein production," said Maquat, the J. Lowell Orbison Chair, professor of ...
Exclusive: Dark Horses Berserk Manga Release Has 1.2 Million Copies in Print - News - Anime News NetworkExclusive: Dark Horse's Berserk Manga Release Has 1.2 Million Copies in Print - News - Anime News Network
Dark Horse Comics told ANN on Monday that it has sold 1.2 million copies of Kentarou Miuras Berserk manga. As of 2015, the series had more than 27 million...
Modern Warfare 3 sells 6.5 million copies on first day - AfterDawnModern Warfare 3 sells 6.5 million copies on first day - AfterDawn
Activision has announced this weekend that Modern Warfare 3 sold 6.5 million copies in its first 24 hours of availability. Making that massive number even more impressive ...
Cuphead surpasses five million copies sold, now 20% off - Nintendo EverythingCuphead surpasses five million copies sold, now 20% off - Nintendo Everything
Cuphead is celebrating its second anniversary today. As part of that, the game is seeing a 20 percent discount during the next week.. Studio MDHR has also announced that Cuhead has surpassed five million copies sold. The title debuted on Switch earlier this year and has been a strong seller on the platform.. Source. ...
Jerzy Jurka - 1950-2014 | Mobile DNA | Full TextJerzy Jurka - 1950-2014 | Mobile DNA | Full Text
The passing of Dr. Jerzy Jurka (Jurek to his friends) represents a heartfelt loss to his many friends in the Mobile DNA field. The whole field of Mobile DNA has lost the scientific efforts of a brilliant colleague and for many of us an esteemed friend. The accompanying biography provides an outstanding outline of his life and career, so I will focus primarily on his impact to the field of Mobile DNA.. Jureks first publication related to Mobile DNA was the discovery of an Alu element in an alpha globin gene in the late 1980s while working with Temple Smith. Jurek was one of the pioneers of well-trained bioinformatics experts to focus his expertise on mobile elements, with one of the early and important findings of subfamilies in the Alu elements. Through the years, his ability to handle large genomic datasets led him to a number of important discoveries, including a bioinformatic prediction of the target site for SINEs and LINEs, the discovery of several new families and clades of mobile ...
PBP96.SEQPBP96.SEQ
ID PBP96 preliminary; circular DNA; SYN; 4600 BP. XX AC ATCC77084; XX DT 01-JUL-1993 (Rel. 7, Created) DT 01-JUL-1995 (Rel. 12, Last updated, Version 1) XX DE Saccharomyces/E.coli plasmid vector pBP96 - incomplete. XX KW cloning vector. XX OS Cloning vector OC Artificial sequences; Cloning vehicles. XX RN [1] RC plasmid from pBluescript series & HIS3 gene RC pBP96 from BLUR8 & plasmid RC pBP97 from BLUR8 & plasmid RC pBP90 from HIS3 gene & pL1.1A, LINE RA Pavan W.J., Reeves R.H.; RT "Integrative selection of human chromosome-specific yeast RT artificial chromosomes"; RL Proc. Natl. Acad. Sci. U.S.A. 88:7788-7791(1991). XX RN [2] RC from pBP62 RC from pYAC3 RC from pYAC4 RC from pYAC55 RC from pJS97 RC from pJS98 RC from pYACneo RC from pYAC-RC RC from pCGS966 RC from pBP81 RC from pBP100 series RC pBP90 from human LINE repeats RC pBP96 from human Alu repeats RC pBP97 from human Alu repeats RC pBP47 from human Alu repeats & HIS3 & SV40 promoter & neo RA Reeves R.H., Pavan W.J., Hieter P.; RT ...
Answers - The Most Trusted Place for Answering Lifes QuestionsAnswers - The Most Trusted Place for Answering Life's Questions
The fact that roughly half of the human genome is made up of TEs, with a significant portion of them being L1 and Alu retrotransposons, raises an important question: What do a…ll these jumping genes do, besides jump? Much of what a transposon does depends on where it lands. Landing inside a gene can result in a mutation, as was discovered when insertions of L1 into the factor VIII gene caused hemophilia (Kazazian et al., 1988). Similarly, a few years later, researchers found L1 in the APC genes in colon cancer cells but not in the APC genes in healthy cells in the same individuals. This confirms that L1 transposes in somatic cells in mammals, and that this element might play a causal role in disease development (Miki et al., 1992). (MORE) ...
Update: Death Note Author Arrested on Weapons Offence | ComiPressUpdate: Death Note Author Arrested on Weapons Offence | ComiPress
In response to Death Note/Hikaru no Go artist Takeshi Obatas recent arrest, Shueisha, his publisher, has announced that, until they can verify the details of the incident, they are not considering any actions such as pulling his work from stores.. Of Obatas work, Hikaru no Go (story: Yumi Hotta) has sold approximately 10 million copies over the span of 23 volumes, while Death Note (story: Tsugumi Ohba) has sold approximately 20 million copies over a span of 12 volumes. Publicists for Shueisha commented, "we are currently verifying the factual details of this incident, and are not considering pulling titles from circulation or any such action at this time.". Death Note was adapted into a live-action movie by Nihon TV (NTV), the first part of which was released in Japan in June and became a smash-hit, drawing an audience of over 2 million people. The movie was released in Hong Kong as well, and the sequel, which concludes the story, is slated for a November release. An anime adaptation is also ...
Charlie Hebdos next edition to go out in 1 million copies - Haaretz - Israel News | Haaretz.comCharlie Hebdo's next edition to go out in 1 million copies - Haaretz - Israel News | Haaretz.com
French media outlets help to publish newest issue of satirical magazine, after an attack on its offices killed eight of its staff, four others.
ALU Parity Predictor and CheckerALU Parity Predictor and Checker
This is a parity predictor and carry checker for the Arithmetic Logic Unit ALU of a data processor. The carry generation within ALU is checked by perfo...
PPT - Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes PowerPoint Presentation - ID:322233PPT - Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes PowerPoint Presentation - ID:322233
Kendra Baughman York Marahrens Lab UCLA. Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes. Overview. Goal Background Prior Studies Strategy Results Remaining Tasks Future Directions. Goal. Slideshow 322233 by hamilton
Uralic etymology : List with all referencesUralic etymology : List with all references
Akkadian: (?) alu (elu) a fine breed of sheep [CAD a1 374], [AHw. 39] (rendered as ālu, jālu). // Extensively commented in the discussion section of the article in [CAD] as well as in [Steinkeller 52]. According to Steinkeller, the earliest attestations of UDU.A.LUM are in Sum. lexicals lists from Abū Salābīh̊ and Ebla. Later on, the term is common in economic texts from Ur III, early OB, Mari and Qatna. Both CAD and Steinkeller assume its identity with aslu, a literary term for ram, lamb found mostly in later texts. Since the phonetic development alu > aslu (or vice versa) is difficult, one tends to agree with Steinkeller that A.LUM is "an abbreivated/defective Akkadogram" to be read aslumx. If this assumption is correct, Akk. alu does not exist and does not form part of the present root ("Once UDU A.LUM is reclassified as aslu, then the lemma alu ... simply disappears" [Steinkeller 66]). // As for the forms a-lu, e-lu appearing as "true" Akkadian words (not logograms) in MA sources, ...
Vostermans Companies | Vostermans Ventilation and Vostermans Alu FoundriesVostermans Companies | Vostermans Ventilation and Vostermans Alu Foundries
Vostermans Companies is parent company of a multinational enterprise, executed by Vostermans Ventilation and Vostermans Alu Foundries.
BME103:T930 Group 12 - OpenWetWareBME103:T930 Group 12 - OpenWetWare
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5 AACTCTTACACTGCATACAT 3, and the forward primer would be 3 TGGTATAAGACATTCCTGT 5. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers wont bind to the gene ...
Difference between revisions of BME103:T930 Group 12 - OpenWetWareDifference between revisions of "BME103:T930 Group 12" - OpenWetWare
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5 AACTCTTACACTGCATACAT 3, and the forward primer would be 3 TGGTATAAGACATTCCTGT 5. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers wont bind to the gene ...
thefreshmexthefreshmex
Later, when People released a commemorative issue about the singer, few at the magazine thought it would sell. Publishers were shocked when the issue sold one million copies, and then its entire run within a matter of weeks. Editor Betty Cortina called it "unheard of," and it was credited with sparking the start of Spanish-language magazines like People en Español and Latina. The singer also arguably paved the way for future Latino artists, including Jennifer Lopez, who, in the film about Selenas life, became the first Latina to earn $1 million for a film role ...
PJ Lynch Gallery: May 2011PJ Lynch Gallery: May 2011
PJ Lynch on drawing, painting and illustration with particular reference to his own work. PJ Lynch is an award winning illustrator whose books have sold more than two million copies worldwide.
PJ Lynch Gallery: PJ Lynch Across the Atlantic TourPJ Lynch Gallery: PJ Lynch "Across the Atlantic Tour"
PJ Lynch on drawing, painting and illustration with particular reference to his own work. PJ Lynch is an award winning illustrator whose books have sold more than two million copies worldwide.
Fingerprints of the Gods - Graham Hancock Official WebsiteFingerprints of the Gods - Graham Hancock Official Website
Fingerprints of the Gods has been translated into 27 languages and is estimated to have sold more than three million copies around the world.
Manics Greatest Hits Tour / In Depth // Drowned In SoundManics Greatest Hits Tour / In Depth // Drowned In Sound
We all know the classic Manics quote, right? About how they were going to make the greatest debut album ever, sell 18 million copies, then split u...
Lame Adventure 455: Fifty Shades of Estrogen | Lame AdventuresLame Adventure 455: Fifty Shades of Estrogen | Lame Adventures
Last Friday, the thirteenth, I celebrated Valentines Day early, when my dear friend, the cinemaniac, Milton, treated me to the movie adaptation of E.L. James blockbuster novel, Fifty Shades of Grey. Neither of us had read these books, which have sold over 100 million copies and have been translated into 52 languages. Friends have declared…
Journal of Clinical Bioinformatics | ArticlesJournal of Clinical Bioinformatics | Articles
AluScan combines inter-Alu PCR using multiple Alu-based primers with opposite orientations and next-generation sequencing to capture a huge number of Alu-proximal genomic sequences for investigation. Its requirem... Authors: Jian-Feng Yang, Xiao-Fan Ding, Lei Chen, Wai-Kin Mat, Michelle Zhi Xu, Jin-Fei Chen, Jian-Min Wang, Lin Xu, Wai-Sang Poon, Ava Kwong, Gilberto Ka-Kit Leung, Tze-Ching Tan, Chi-Hung Yu, Yue-Bin Ke, Xin-Yun Xu, Xiao-Yan Ke…. ...
Journal of Clinical Bioinformatics | ArticlesJournal of Clinical Bioinformatics | Articles
AluScan combines inter-Alu PCR using multiple Alu-based primers with opposite orientations and next-generation sequencing to capture a huge number of Alu-proximal genomic sequences for investigation. Its requirem... Authors: Jian-Feng Yang, Xiao-Fan Ding, Lei Chen, Wai-Kin Mat, Michelle Zhi Xu, Jin-Fei Chen, Jian-Min Wang, Lin Xu, Wai-Sang Poon, Ava Kwong, Gilberto Ka-Kit Leung, Tze-Ching Tan, Chi-Hung Yu, Yue-Bin Ke, Xin-Yun Xu, Xiao-Yan Ke…. ...
Round LED Linear Pendant - Model Alu Round 38 [Profile Only] | Wired4Signs USARound LED Linear Pendant - Model Alu Round 38 [Profile Only] | Wired4Signs USA
It is a high quality, rigid and a very solid round profile made of anodized aluminum designed to be used with LED light sources. Thanks to a suitably designed shape, the profile can be safely used for high power LED strips (36W/m). The shape guara...
DESIFOODBYTES: Alu Paneer ParataDESIFOODBYTES: Alu Paneer Parata
As I had a small portion of paneer left over in the fridge, I combined it with some potato and used it up to make this delicious parata. As of any Parata, this is also very soft, wholesome and filling ...
Mountainbike Shop - MTB Cross - Alu MountainbikeMountainbike Shop - MTB Cross - Alu Mountainbike
MTB Cross Fahrräder günstig im Mountainbike Shop von bikester.at kaufen. Hier klicken und sich vom Großen Angebot an Cross Mountainbikes überzeugen!
Evolution of the NANOG pseudogene family in the human and chimpanzee genomes | BMC Evolutionary Biology | Full TextEvolution of the NANOG pseudogene family in the human and chimpanzee genomes | BMC Evolutionary Biology | Full Text
The entire functional NANOG gene (according to our sequencing data) and NANOGP1 are present in both the human and chimpanzee genome assemblies at orthologous chromosomal positions. In the 3 UTR of the NANOG gene, there is an Alu element, which is missing from NANOGP1 in both genomes. Therefore, the NANOGP1 unprocessed pseudogene arose through duplication of the chromosomal region containing NANOG before the human-chimpanzee (H/C) divergence and before insertion of the Alu element into the NANOG gene. Because the same Alu element is present in both the human and chimpanzee NANOG genes, its insertion must also have preceded the H/C divergence. The processed pseudogenes NANOGP2, NANOGP3, NANOGP4, NANOGP5, NANOGP6, NANOGP7, NANOGP9, and NANOGP10 lack this Alu element. They thus likely arose before its insertion and, therefore, also predate the H/C divergence. The presence of the NANOGP11 pseudogene fragment in both the human and chimpanzee genomes likewise shows that its origin preceded H/C ...
Partial NSD1 deletions cause 5% of Sotos syndrome and are readily identifiable by multiplex ligation dependent probe...Partial NSD1 deletions cause 5% of Sotos syndrome and are readily identifiable by multiplex ligation dependent probe...
Our data show that partial deletions of one or more NSD1 exons are a novel cause of Sotos syndrome and are readily identifiable by MLPA. Furthermore, MLPA is a robust method for detecting 5q35 microdeletions which occur in around 10% of non-Japanese Sotos cases and are the commonest cause of Sotos syndrome in Japan.4,21. Each of the eight partial gene deletions we identified was unique. Alu mediated recombination was the likely cause in at least four cases, similar to other conditions with partial deletions.17NSD1 is enriched for Alu elements with a density of 40.2% compared with 10.6% for the genome generally.22 In particular, intron 2-the largest intron in NSD1-contains 115 Alu repeats and the sequence 5′ to NSD1 is also highly enriched with Alu elements. This probably explains why the most frequent partial deletion in our series encompassed exons 1-2. Despite the high density of Alu repeats in NSD1, two of six cases in which we defined the exact deletion breakpoints were not mediated by ...
Interaction of rice and human SRP19 polypeptides with signal recognition particle RNA, Plant Molecular Biology | 10.1023/A...Interaction of rice and human SRP19 polypeptides with signal recognition particle RNA, Plant Molecular Biology | 10.1023/A...
Read "Interaction of rice and human SRP19 polypeptides with signal recognition particle RNA, Plant Molecular Biology" on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
GigaDB Dataset - DOI 10.5524/100318 - Supporting data for Population-wide Sampling of Retrotransposon Insertion Polymorphisms...GigaDB Dataset - DOI 10.5524/100318 - Supporting data for 'Population-wide Sampling of Retrotransposon Insertion Polymorphisms...
Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population.|br| Herein, we present a novel and efficient computational tool named Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high depth whole-genome sequencing (WGS) data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean 68× depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed
Molecular Vision: Two novel PRPF31 premessenger ribonucleic acid processing factor 31 homolog mutations including a complex...Molecular Vision: Two novel PRPF31 premessenger ribonucleic acid processing factor 31 homolog mutations including a complex...
In this study, we identified one novel deletion and one novel complex genomic rearrangement in two Chinese families with adRP and characterized the breakpoints of the genomic rearrangement. To date, eight large deletions, ranging from 5 kb to 112 kb, have been identified in PRPF31 [10-13]. Similar to all characterized large deletions of PRPF31, both breakpoints of the large deletion in family RP24 are located in the Alu regions; this suggests that the mechanism underlying this complex structural rearrangement may involve homologous recombination between Alu repeats. Alu repeats are short, interspersed nuclear elements that account for 10% of the sequenced region of the human genome; however, these repeats account for 26.3% of chromosome 19, which is the most Alu-rich chromosome [21]. This is why genomic arrangements are prevalent round the PRPF31 gene. Of the eight reported large deletions, only one is an insertion-deletion complex genomic DNA rearrangement, which includes an 110 bp deletion and ...
Yvonne Perry: The Natural Fat-Loss PharmacyYvonne Perry: The Natural Fat-Loss Pharmacy
While at Rodale, Gottlieb was the creator and supervising editor of the mega-selling The Doctors Book of Home Remedies (16 million copies sold), and was the spokesperson in a commercial for the book that was broadcast 50,000 times and generated sales of 2 million copies. He has appeared as an expert on natural remedies on Good Morning America, CNN, and many other national TV and radio shows. His articles on health and healing have appeared in many magazines and periodicals, including Prevention, Readers Digest, Health, Runners World, Mens Health, New Beauty, Natural Health, Self, Alternative Medicine, Bottom Line Personal and Bottom Line Health ...
Databases available for BLAST searchDatabases available for BLAST search
Translations of select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. It is available by anonymous FTP from ncbi.nlm.nih.gov (under the /pub/jmc/alu directory). See "Alu alert" by Claverie and Makalowski, Nature vol. 371, page 752 (1994) . ...
Tài liệu Interspersing Humans chọn lọc - TaiLieu.VNTài liệu Interspersing Humans chọn lọc - TaiLieu.VN
Alu transposons are found only in primate genomes and have accumulated in large numbers since primates diverged from other mammals. Human chromosomes contain more than one million Alu copies, equaling about 10% of the genome by mass. This accumulation was made possible by a transposition mechanism that reverse transcribes Alu mRNAs into mobile DNA copies. Another transposon, the long interspersed element (LINE) L1, supplies a specialized reverse transcriptase enzyme needed for Alu to jump. Hence, Alu and L1 exist in a sort of molecular symbiosis. ...
cxlxmxrx: Y alu polymorphism as a quiltcxlxmxrx: Y alu polymorphism as a quilt
I suppose this is a good follow-up to the post on Grays Anatomy. (The study of genetics is the new study of anatomy, right?) The image above is a quilt that is designed to show a YAP genomic sequence: "the Y alu polymorphism sequence of an Italian male is encoded in this quilt. The quilt is made of shot silk, which reflects light differently depending on the orientation of the weave and the viewer." The quilt is by Beverly St. Clair, a psychiatrist who is also a quilter, and more explanation of her method and how to read the quilt can be found on her website ...
ALU ALU FOIL / ALUMINIUM COLD FORMING BLISTER FOIL - FlexiPackALU ALU FOIL / ALUMINIUM COLD FORMING BLISTER FOIL - FlexiPack
[vc_column pofo_column_animation_style=none width=1/1 mobile_alignment=xs-text-justify mobile_display=xs-display-inline-block][pofo_section_heading
Bike of Montaña LYNX RACE ALU 3.0 - BH BikesBike of Montaña LYNX RACE ALU 3.0 - BH Bikes
Buy the BH LYNX RACE ALU 3.0 bike online in the official BH store. Complete information about its features, geometrics,technology and tests in magazines in the BH Bikes Store EN
took into account | real sensationtook into account | real sensation
The talented and mega-popular singer Prince has released hundreds of musical compositions and almost forty studio albums, 100 million copies of his records have been sold in the world. All this gave him a certain creative freedom, he could afford unpredictable actions, outrageous and eccentricity. And once he just wanted to change his stage name for a complex graphic symbol. He worked for hours in his home studio, and then, going out to thousands of fans on the stage, he enveloped them with his magic. At first he drove the audience into a frenzy, after which he forced him to listen carefully to the lyric song. This was the secret of its popularity and magic, fueled by an incredible performance. Continue reading →. ...
Employee Orientation | The Hub | The Table GroupEmployee Orientation | The Hub | The Table Group
Patrick Lencioni is founder and president of The Table Group, a firm dedicated to providing organizations with ideas, products and services that improve teamwork, clarity and employee engagement. Pats passion for organizations and teams is reflected in his writing, speaking and executive consulting. He is the author of several best-selling business books with over five million copies sold. Prior to founding his firm, he worked as a corporate executive for Sybase, Oracle and Bain & Company.. ...
IS ANESTHESIA A CUSHY SPECIALTY? - The anesthesia consultantIS ANESTHESIA A CUSHY SPECIALTY? - The anesthesia consultant
Is anesthesia worthy of the House of Gods assessment that its a cushy medical specialty? My answer, after thirty years of anesthesia practice: it depends.
Product DetailProduct Detail
Join David Burns, MD, anxiety and depression expert and author of the NY Times Best-seller Feeling Good, which has sold more than five million copies worldwide. Research indicates that most, if not all, current treatments for depression and anxiety are barely more effective than placebos...
Turtle Mama*~: January 2014Turtle Mama*~: January 2014
Lets be honest. Lara Bars are expensive. Its only been on the rare occasion that Ive eaten one and everytime I do, I think "I could have just made that!". There are currently 1.3 million copy cat recipes out there for Lara Bars (okay, maybe that number is inaccurate.) I figured I should contribute at least one more ...
Garth Brooks Net Worth 2020<...Garth Brooks Net Worth 2020<...
Garth Brooks is a famous country singer as well as a songwriter. He is very well-known worldwide and is among the highest selling artists with his albums having been sold in over 160 million copies. (more&hell... ...
Bending Alu Tube to Tight Radius?Bending Alu Tube to Tight Radius?
Got a thing on the agenda here.. Bending aluminum tube of the 6061 variety, OD 30 mm with a 5 mm wall, 90 degree bend... with a radius of two inches.
Role of repitive sequences - Biology-OnlineRole of repitive sequences - Biology-Online
There are also various self replicating genetic elements that exist in huge numbers in the human genome alu alone numbers about 500,000 compared to about 30,000 protein coding genes. About 45% of the human genome is composed of these elements. These elements can play many roles in the human including disrupting genes, promoting certain types of mutation and they can be co-opted to play a role in gene expression, although most seem to have no effect on the host ...
Proteins that control genesProteins that control genes
Of course, these proteins are ultimately a encoded by some genes, so the DNA code would still be the ultimate arbiter, but now it seems that the key may not be in the gene alone but also in those proteins that control its behavior, which in turn are generated by other "master genes". ...
Bioinformatics Nerds : 2016Bioinformatics Nerds : 2016
Claim 2: Reddit user Aceofspades25 [4] has addressed Tomkins claim that the low frequency of telomere motif repeats indicates that the fusion of 2 chimp chromosomes did not occur to product the human chromosome 2. These motifs are "TTAGGG" joined to a series of repeats of the motif "CCCTAA". While the frequency of these repeated motifs may be lower than expected on initial examination, he believes that it is not surprising. He cites, Carl Zimmer, a popular science writer and blogger, who focuses on the study of evolution and parasites. He has written several books on the topic and is a science writer for The New York Times, Discover, and National Geographic. Zimmer states "The ends of chromosomes are very vulnerable places. If they simply dangle loosely, DNA-cutting enzymes can nibble away at them, destroying the genes they encounter. The dangling end of one chromosome can also get attached to the dangling end of another, fusing chromosomes together. We are mostly protected from such changes ...
May 2015 | Archive By Month | SearchBusinessAnalyticsMay 2015 | Archive By Month | SearchBusinessAnalytics
Hospitals are under pressure to cut costs and to restore patients to good health without readmissions. Predictive analytics can help, but providers need a solid plan for using their data. Continue Reading ...
Retrotransposon markerRetrotransposon marker
MutationMutation
C10orf76C10orf76
PseudogenePseudogene
Jerzy JurkaJerzy Jurka
HSD17B1HSD17B1
Exon shufflingExon shuffling
Fengs classificationFeng's classification
BC200 lncRNABC200 lncRNA
Evolution of biological complexityEvolution of biological complexity
Genome survey sequenceGenome survey sequence
Andrea AlùAndrea Alù
Signal recognition particle RNASignal recognition particle RNA
ProopiomelanocortinProopiomelanocortin
Gene polymorphismGene polymorphism
Japanese AmericansJapanese Americans
Mosaic (genetics)Mosaic (genetics)
PCK2PCK2
Lipoprotein lipaseLipoprotein lipase
RetrotransposonRetrotransposon
AmpliconAmplicon
C1-inhibitorC1-inhibitor
Noncoding DNANoncoding DNA
Genomic organizationGenomic organization
Haplogroup DEHaplogroup DE
ChIA-PETChIA-PET
Sex hormone-binding globulinSex hormone-binding globulin
BCL2L13BCL2L13
ECHS1ECHS1
7400 series7400 series
Evolution of biological complexityEvolution of biological complexity
KhatKhat
Mosaic (genetics)Mosaic (genetics)
Lenghe dravìdiche an piemontèis, lenciclopedìa lìbera e a gràtisLenghe dravìdiche an piemontèis, l'enciclopedìa lìbera e a gràtis
Negative-index metamaterialNegative-index metamaterial
망막색소상피세포 - 위키백과, 우리 모두의 백과사전망막색소상피세포 - 위키백과, 우리 모두의 백과사전
Japanese AmericansJapanese Americans
UkrainiansUkrainians
CPU cacheCPU cache
MicrosatelliteMicrosatellite
Long non-coding RNALong non-coding RNA
Transposable elementTransposable element
Xenoma, a enciclopedia libreXenoma, a enciclopedia libre
Sex hormone-binding globulinSex hormone-binding globulin
Майкл Стюарт Браун - УикипедияМайкл Стюарт Браун - Уикипедия
İlham Şahmuradov - Vikipediyaİlham Şahmuradov - Vikipediya
MutationMutation
Transposable elementTransposable element
ComputerComputer
AluminiumAluminium
ADN non codificante, a enciclopedia libreADN non codificante, a enciclopedia libre
TelomereTelomere
SRYSRY
Yam (vegetable)Yam (vegetable)
Cthulhu Mythos deitiesCthulhu Mythos deities
Exon shufflingExon shuffling
PDP-8PDP-8
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation Science
Alu ElementsRepetitive Sequences, Nucleic AcidLong Interspersed Nucleotide ElementsShort Interspersed Nucleotide ElementsDNA Transposable ElementsGenome, HumanBase SequenceMolecular Sequence DataPrimatesRetroelementsStrepsirhiniSequence Homology, Nucleic AcidExons3' Flanking RegionHominidaeResponse ElementsCercopithecidaeIntronsRNA EditingPromoter Regions, GeneticPan troglodytesEnhancer Elements, GeneticEvolution, MolecularTranscription, GeneticDNARNA Polymerase IIIMutagenesis, InsertionalGenes, Neurofibromatosis 1Gorilla gorillaRegulatory Sequences, Nucleic AcidGene ConversionInosineSequence AlignmentGene Expression RegulationPolymerase Chain ReactionSequence Analysis, DNAChromosome BreakageConsensus SequencePhylogenyCpG IslandsHeLa CellsGenetic VariationCloning, MolecularTerminal Repeat SequencesRNA, MessengerRestriction MappingChromosome MappingBinding SitesGene RearrangementComputational BiologyTrace Elements
Alu elements shape the primate transcriptome by cis-regulation of RNA editing | Genome Biology | Full TextAlu elements shape the primate transcriptome by cis-regulation of RNA editing | Genome Biology | Full Text
PPT - Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes PowerPoint Presentation - ID:322233PPT - Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes PowerPoint Presentation - ID:322233
The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region<...The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region<...
Scientists Discover Gene Regulation Mechanism Unique to Primates - Healthcanal.com : Healthcanal.comScientists Discover Gene Regulation Mechanism Unique to Primates - Healthcanal.com : Healthcanal.com
MIEN1 is tightly regulated by SINE Alu methylation in its promoter<...MIEN1 is tightly regulated by SINE Alu methylation in its promoter<...
Round LED Linear Pendant - Model Alu Round 38 [Profile Only] | Wired4Signs USARound LED Linear Pendant - Model Alu Round 38 [Profile Only] | Wired4Signs USA
Answers - The Most Trusted Place for Answering Lifes QuestionsAnswers - The Most Trusted Place for Answering Life's Questions
Alu element - WikipediaAlu element - Wikipedia
The Contribution of Alu Elements to Mutagenic DNA Double-Strand Break Repair | proLékaře.czThe Contribution of Alu Elements to Mutagenic DNA Double-Strand Break Repair | proLékaře.cz
Evolution of Alu elements in long non-coding RNA and mRNAEvolution of Alu elements in long non-coding RNA and mRNA
Alu elements in primates are preferentially lost from areas of high GC content [PeerJ]Alu elements in primates are preferentially lost from areas of high GC content [PeerJ]
Model for dual relationship between Alu elements and mi | Open-iModel for dual relationship between Alu elements and mi | Open-i
Alu-mediated inactivation of the human CMP- N-acetylneuraminic acid hydroxylase gene | PNASAlu-mediated inactivation of the human CMP- N-acetylneuraminic acid hydroxylase gene | PNAS
Conformational polymorphysm of G-rich fragments of DNA Alu-repeats. I. Noncanonical structures | SpringerLinkConformational polymorphysm of G-rich fragments of DNA Alu-repeats. I. Noncanonical structures | SpringerLink
A tissue-specific decrease in the pre-mRNA level of L1- and alu-containing alleles of human genes]A tissue-specific decrease in the pre-mRNA level of L1- and alu-containing alleles of human genes]
Gene transcriptions/Boxes/GCs - WikiversityGene transcriptions/Boxes/GCs - Wikiversity
Organization, Evolutionary Conservation, Expression and Unusual Alu Density of the Human Gene for Pigment Epithelium-Derived...Organization, Evolutionary Conservation, Expression and Unusual Alu Density of the Human Gene for Pigment Epithelium-Derived...
nature.com searchnature.com search
Exercise 5: Detection of a Human Alu Element by PCR - PDFExercise 5: Detection of a Human Alu Element by PCR - PDF
CiteSeerX - Citation Query TranspoGene and microTranspoGene: transposed elements influence on the transcriptome of seven...CiteSeerX - Citation Query TranspoGene and microTranspoGene: transposed elements influence on the transcriptome of seven...
nature.com searchnature.com search
DICER1 deficit induces Alu RNA toxicity in age-related macular degeneration. - PubMed - NCBIDICER1 deficit induces Alu RNA toxicity in age-related macular degeneration. - PubMed - NCBI
Retrotransposon marker - WikipediaRetrotransposon marker - Wikipedia
The contribution of Alu exons to the human proteome | Genome Biology | Full TextThe contribution of Alu exons to the human proteome | Genome Biology | Full Text
A SINE in the genome of the cephalochordate amphioxus is an Alu element | Holland, LindaA SINE in the genome of the cephalochordate amphioxus is an Alu element | Holland, Linda
Genomic Disorders | SpringerLinkGenomic Disorders | SpringerLink
Publications | Michael BrudnoPublications | Michael Brudno
Search Results | PORTSearch Results | PORT
Phys.org - molecular fossils(... continued page 2)Phys.org - molecular fossils(... continued page 2)
Imitating greatness: 16-bit Hack ALU design - Alpha - Survival Single Player - Alpha - Archive - Minecraft Forum - Minecraft...Imitating greatness: 16-bit Hack ALU design - Alpha - Survival Single Player - Alpha - Archive - Minecraft Forum - Minecraft...
Distributions of Transposable Elements Reveal Hazardous Zones in Mammalian IntronsDistributions of Transposable Elements Reveal Hazardous Zones in Mammalian Introns
Splicing repression allows the gradual emergence of new Alu-exons in primate evolution | eLifeSplicing repression allows the gradual emergence of new Alu-exons in primate evolution | eLife
Dynamic Alu Methylation during Normal Development, Aging, and TumorigenesisDynamic Alu Methylation during Normal Development, Aging, and Tumorigenesis
Localization of signal recognition particle RNA in the nucleolus of mammalian cells | PNASLocalization of signal recognition particle RNA in the nucleolus of mammalian cells | PNAS
A chromatin remodelling complex that loads cohesin onto human chromosomesA chromatin remodelling complex that loads cohesin onto human chromosomes
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation Science
Alu ElementsRepetitive Sequences, Nucleic AcidLong Interspersed Nucleotide ElementsShort Interspersed Nucleotide ElementsDNA Transposable ElementsGenome, HumanBase SequenceMolecular Sequence DataPrimatesRetroelementsStrepsirhiniSequence Homology, Nucleic AcidExons3' Flanking RegionHominidaeResponse ElementsCercopithecidaeIntronsRNA EditingPromoter Regions, GeneticPan troglodytesEnhancer Elements, GeneticEvolution, MolecularTranscription, GeneticDNARNA Polymerase IIIMutagenesis, InsertionalGenes, Neurofibromatosis 1Gorilla gorillaRegulatory Sequences, Nucleic AcidGene ConversionInosineSequence AlignmentGene Expression RegulationPolymerase Chain ReactionSequence Analysis, DNAChromosome BreakageConsensus SequencePhylogenyCpG IslandsHeLa CellsGenetic VariationCloning, MolecularTerminal Repeat SequencesRNA, MessengerRestriction MappingChromosome MappingBinding SitesGene RearrangementComputational BiologyTrace Elements
RepetitiveSequencesPrimate-specificSequenceGenesNucleotidesProteinGeneSignificantlyLargelyPreviouslyHighDiscreteHumanFoundImportantProvided the definitiRepeatsRNAsSINEsRetrotransposonsGenomesIntronRecombinationTranscriptsExonsRepetitive elementsEncodeAntisenseTranspositionHumansMRNAsTranscriptomeMethylationExonizationEvolutionaryConsensusSubfamiliesInduces accumulationInduce RPE degenerationUTRsPreferentiallyPolyA tailTransposable elementMRNASplice sitesDeletionDeletionsKnockdownTranscriptionGeneticsAluSCompriseEndonucleaseMammalianRolesLINE13'UTRAbsence
Repetitive3
Sequences1
  • Deletion of the Sx Alu repeat in reporter constructs containing hGH-1 3′-flanking sequences increased reporter activity in transfected pituitary GC cells, suggesting this region contained a repressor element. (elsevier.com)
Primate-specific2
Sequence3
  • These results indicate that this cis -acting structural element, downstream of the sequence required for A-to-I catalysis, increases the local concentration of the editing enzyme by attracting ADAR, thus enabling editing in the vicinity. (biomedcentral.com)
  • Adjacent inverted Alu repeats can pair and form long stable stem-loop structures, which are favorable editing substrates, and are also potentially highly abundant in humans (there are 228,607 inverted Alu pairs within 1 kb in genes from the NCBI Reference Sequence (RefSeq) database). (biomedcentral.com)
  • Bisulfite pyrosequencing demonstrates the MIEN1 promoter contains a short interspersed nuclear Alu element (SINE Alu) repeat sequence. (unthsc.edu)
Genes1
  • An Sx Alu repeat lies in close proximity to the hGH-1 and hGH-2 genes in the 3′-flanking region. (elsevier.com)
Nucleotides2
  • We show that inverted Alu repeats, expressed in the primate brain, can induce site-selective editing in cis on sites located several hundred nucleotides from the Alu elements. (biomedcentral.com)
  • Analysis of multiple deletion fragments from the 3′-flanking region of the hGH-1 gene revealed a strong orientation- and position-independent silencing activity mapping between nucleotides 2158 and 2572 encompassing the Sx Alu repeat. (elsevier.com)
Protein2
  • Maquat discovered that Alu elements team up with molecules called long noncoding RNAs (lncRNAs) to regulate protein production. (healthcanal.com)
  • Specifically, long noncoding RNAs and Alu elements recruit the protein Staufen-1 to bind to numerous mRNAs. (healthcanal.com)
Gene2
  • Trujillo, MA, Sakagashira, M & Eberhardt, NL 2006, ' The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region ', Molecular Endocrinology , vol. 20, no. 10, pp. 2559-2575. (elsevier.com)
  • These results suggest the MIEN1 promoter has a SINE Alu region that is hypermethylated in normal cells leading to repression of the gene. (unthsc.edu)
Significantly1
  • Furthermore, a computational analysis, based on available RNA-seq data, finds that site-selective editing occurs significantly closer to edited Alu elements than expected. (biomedcentral.com)
Largely2
  • RNA editing by adenosine to inosine deamination is a widespread phenomenon, particularly frequent in the human transcriptome, largely due to the presence of inverted Alu repeats and their ability to form double-stranded structures - a requisite for ADAR editing. (biomedcentral.com)
  • While scientists have known about the existence of Alu elements for many years, their function, if any, was largely unknown. (healthcanal.com)
Previously1
  • Previously, no one knew what Alu elements and long noncoding RNAs did, whether they were junk or if they had any purpose. (healthcanal.com)
High1
  • id":516028235842,"title":"Round LED Linear Pendant - Model Alu Round 38 [Profile Only]","handle":"round-led-linear-pendant-model-ro38-profile-only","description":"\u003cp\u003eIt is a high quality, rigid and a very solid round profile made of anodized aluminum designed to be used with LED light sources. (wired4signsusa.com)
Discrete1
  • Refined mapping revealed that the silencer was a complex element comprising four discrete entities, including a core repressor domain (CRD), an antisilencer domain (ASE) that contains elements mediating the orientation-independent silencer activity, and two domains flanking the CRD/ASE that modulate silencer activity in a CRD-dependent manner. (elsevier.com)
Human1
  • The human (h) GH locus contains 44 complete and four partial Alu elements. (elsevier.com)
Found1
  • Maquat and the study's first author, Chenguang Gong, a graduate student in the Department of Biochemistry and Biophysics at the Medical Center, found that long noncoding RNAs and Alu elements work together to trigger a process known as SMD (Staufen 1-mediated mRNA decay). (healthcanal.com)
Important1
  • Although this editing inducer element (IE) is hyper-edited, mutational analysis shows that it is the double-stranded structure rather than editing that is important for the distal editing induction. (biomedcentral.com)
Provided the definiti1
Repeats19
RNAs15
SINEs7
Retrotransposons10
Genomes12
  • Mutagenic NHEJ repair involving divergent Alu elements may represent a common repair event in primate genomes. (prolekare.cz)
  • Alu elements of different kinds occur in large numbers in primate genomes. (wikiversity.org)
  • Alu elements are major contributors to lineage-specific new exons in primate and human genomes. (biomedcentral.com)
  • 2010. Endogenous non-retroviral RNA virus elements in mammalian genomes. (scienceblogs.com)
  • Mammalian transposable elements have been restructuring their host genomes for millions of years, to both deleterious and advantageous effects. (bioscience.org)
  • Transposable elements (TEs) represent a variable but often sizeable fraction of genomes (e.g. (biomedcentral.com)
  • Evolutionists have generally assumed that Alu elements arose through being copied and spliced throughout various animals' genomes. (icr.org)
  • Mobile, or transposable, elements are prevalent in the genomes of all plants and animals. (sciencemag.org)
  • This study highlights the importance of noncoding RNA and transposable elements in the regulation of gene expression and in the evolution of gene expression networks in mammalian genomes," said coauthor Manuel Ares, professor of molecular, cell, and developmental biology at UC Santa Cruz. (eurekalert.org)
  • How natural selection acts to limit the proliferation of transposable elements (TEs) in genomes has been of interest to evolutionary biologists for many years. (genetics.org)
  • DICER1 deficit induces Alu RNA toxicity in age-related macular degeneration ,' Nature 17 March 2011) now points to one likely cause of AMD, and in the process provides a chilling example of what can happen when the parasitic Alu elements in our genomes (see the previous post for an introduction) are left unrestrained. (blogspot.com)
  • There is, in fact, some scientific disagreement about functions of various elements in genomes, but it's not the crude standoff that ID apologists depict, and it has very little to do with 'Darwinism. (blogspot.com)
Intron5
Recombination5
Transcripts5
Exons14
  • Alternative splicing of Alu exons--two arms are better than one. (psu.edu)
  • Recent studies indicate that some Alu exons have high transcript inclusion levels or tissue-specific splicing profiles, and may play important regulatory roles in modulating mRNA degradation or translational efficiency. (biomedcentral.com)
  • However, the contribution of Alu exons to the human proteome remains unclear and controversial. (biomedcentral.com)
  • The prevailing view is that exons derived from young repetitive elements, such as Alu elements, are restricted to regulatory functions and have not had adequate evolutionary time to be incorporated into stable, functional proteins. (biomedcentral.com)
  • We adopt a proteotranscriptomics approach to systematically assess the contribution of Alu exons to the human proteome. (biomedcentral.com)
  • Using RNA sequencing, ribosome profiling, and proteomics data from human tissues and cell lines, we provide evidence for the translational activities of Alu exons and the presence of Alu exon derived peptides in human proteins. (biomedcentral.com)
  • Together, these data have established the regulatory roles of Alu exons in multiple aspects of RNA metabolism including translation and degradation. (biomedcentral.com)
  • They identified numerous instances of 'in-frame' Alu exons in the coding region of human mRNAs that are predicted to add Alu -derived peptides to the protein products. (biomedcentral.com)
  • Here, we assess the interplay of splicing repression by hnRNPC and nonsense-mediated mRNA decay (NMD) in the quality control and evolution of new Alu-exons. (elifesciences.org)
  • Once the 3' splice site at ancient Alu-exons reaches a stable phase, splicing repression by hnRNPC decreases, but the exons generally remain sensitive to NMD. (elifesciences.org)
  • Thus, it is important to understand the protective molecular mechanisms imposing constraints on the emergence and expression of Alu-exons. (elifesciences.org)
  • Thus, the U-tract:hnRNPC interaction is crucial to prevent the splicing machinery from accessing cryptic splice sites at Alu-exons. (elifesciences.org)
  • Comparative meta-analysis with the 80 other CNV cases from 12 publications describing STK11 mutations in patients with PJS revealed the participation of specific Alu elements in all deletions of exons 2-3 so far described. (cdc.gov)
  • a) Alu exonization: a hypothetical gene constituted of three exons (light grey, white and dark grey boxes) is shown with its splicing pattern (dashed lines above gene). (els.net)
Repetitive elements5
Encode2
  • Alu elements do not encode for protein products. (wikipedia.org)
  • In the case of the RNA editing enzyme ADARB1, which contains an Alu exon peptide in its catalytic domain, RNA sequencing analyses of A-to-I editing demonstrate that both the Alu exon skipping and inclusion isoforms encode active enzymes. (biomedcentral.com)
Antisense3
Transposition1
Humans5
  • Several Alu subfamilies are known to be actively transposing and it is thought that a new insertion occurs approximately every 20 births in humans ( Cordaux & Batzer, 2009 ). (peerj.com)
  • Alu RNA is increased in the RPE of humans with GA, and this pathogenic RNA induces human RPE cytotoxicity and RPE degeneration in mice. (nih.gov)
  • Shown is Alu an active SINE in humans. (nih.gov)
  • These elements are not present in humans, and essentially all are defective, so the source of their RT in trans remains unknown. (sciencemag.org)
  • RPE cells from mouse or humans were transfected with in vitro transcribed Alu RNA or a plasmid encoding an Alu element. (arvojournals.org)
MRNAs3
  • Here, we report that human mRNAs containing inverted Alu elements are present in the mammalian cytoplasm. (iu.edu)
  • Thus, we have defined unexpected roles for Alu elements, lncRNAs and mRNAs. (rochester.edu)
  • In other studies, we have found that STAU1 (and probably STAU2) binding to 3'UTR inverted Alu elements competes with binding of the largely nuclear paraspeckle protein p54nrb and largely cytoplasmic protein kinase R (PKR) to mediate, respectively, the nuclear export and cytoplasmic translation of a number of mRNAs that contain these elements. (rochester.edu)
Transcriptome1
Methylation2
  • However, the maintenance and methylation status of each CpG site within Alu elements ( Alu ) and its methylation status have not well characterized. (beds.ac.uk)
  • A high correlation coefficient of methylation was observed between Alu clones and CpG site J (0.963), A (0.950), H (0.946), D (0.945). (beds.ac.uk)
Exonization4
Evolutionary5
  • The most common target site coincides with the evolutionary most conserved part of Alu. (nih.gov)
  • Thus, a dual relationship exists between an evolutionary young miRNA cluster and their Alu targets that may have evolved in the same time window. (nih.gov)
  • Because many of the Alu elements within C19MC are evolutionary old (AluJ and AluS), expansion of the cluster may have occurred at an early wave of expansion of the Alu elements. (nih.gov)
  • The target sites are relatively unspecific so that the chance of an independent integration of exactly the same element into one specific site in different taxa is not large and may even be negligible over evolutionary time scales. (wikipedia.org)
  • The so-called 'junk' DNAs that have perplexed creationists and evolutionary scientists alike may be the very elements that can explain the mechanisms by which God is at work in His creation now and in the past. (creation.com)
Consensus1
Subfamilies1
  • In 1988, Jerzy Jurka and Temple Smith discovered that Alu elements were split in two major subfamilies known as AluJ (named after Jurka) and AluS (named after Smith), and other Alu subfamilies were also independently discovered by several groups. (wikipedia.org)
Induces accumulation1
Induce RPE degeneration2
UTRs1
Preferentially1
PolyA tail1
Transposable element1
  • Altering Genomic Integrity: Heavy Metal Exposure Promotes Transposable Element-Mediated Damage. (nih.gov)
MRNA3
  • Here, I describe the evolution of Alu elements in lncRNA and mRNA. (labroots.com)
  • We showed for the first time a tissue-specific decrease in the pre-mRNA content of the gene allele bearing L1 or Alu inserts relative to the other allele of the same gene lacking the retroelement. (nih.gov)
  • A cis-acting element in the 3'-untranslated region of human TNF-alpha mRNA renders splicing dependent on the activation of protein kinase PKR. (semanticscholar.org)
Splice sites1
Deletion4
  • citation needed]This is because insertion of an Alu element occurs only 100 - 200 times per million years, and no known mechanism of deletion of one has been found. (wikipedia.org)
  • Here we present a novel 7001 bps deletion of STK11 gene fragment, in which we identified the presence of breakpoints (BPs) within the Alu elements. (cdc.gov)
  • Mutations may also result from insertion or deletion of segments of DNA due to mobile genetic elements . (wikipedia.org)
  • Analysis of multiple deletion fragments from the 3′-flanking region of the hGH-1 gene revealed a strong orientation- and position-independent silencing activity mapping between nucleotides 2158 and 2572 encompassing the Sx Alu repeat. (elsevier.com)
Deletions2
  • We use a new reporter assay to show that repair of DSBs results in Alu-mediated deletions that resolve through several distinct repair pathways. (prolekare.cz)
  • A number of different pathways can give rise to these Alu/Alu deletions, including single-strand annealing (SSA) repair that may predominate when there are high levels of homology, and mechanisms such as microhomology-mediated end joining (MMEJ) where the microhomology happens to be 'in register' between the two Alu elements, allowing formation of a single chimeric Alu element [ 7 ]. (prolekare.cz)
Knockdown1
Transcription6
Genetics2
  • In genetics, presence or lack thereof of a recently inserted Alu element may be a good property to consider when studying human evolution. (wikipedia.org)
  • Alu elements in ANRIL non-coding RNA at chromosome 9p21 modulate atherogenic cell functions through trans -regulation of gene networks," PLoS Genetics , vol. 9, no. 7, Article ID e1003588, 2013. (hindawi.com)
AluS3
Comprise1
Endonuclease2
Mammalian1
Roles1
  • It is suggested that Alu elements have played potentially important roles in genotypic and phenotypic evolution in the hominid lineage. (pnas.org)
LINE11
3'UTR2
Absence2
  • The formation of noncanonical structures in Alu bcl2 dsDNA and their absence in the case of Alu-PQS have been shown using DMS-footprinting and atomic force microscopy (AFM). (springer.com)
  • The size of the amplification product(s) will depend upon the presence or absence of the Alu insertion at the TPA-25 locus on each copy of chromosome 8. (docplayer.net)
PPT - Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes PowerPoint Presentation - ID:322233
PPT - Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes PowerPoint Presentation - ID:322233 (slideserve.com)
Alu elements shape the primate transcriptome by cis-regulation of RNA editing | Genome Biology | Full Text
Alu elements shape the primate transcriptome by cis-regulation of RNA editing | Genome Biology | Full Text (genomebiology.biomedcentral.com)
The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region<...
The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region<... (mayoclinic.pure.elsevier.com)
Jerzy Jurka - 1950-2014 | Mobile DNA | Full Text
Jerzy Jurka - 1950-2014 | Mobile DNA | Full Text (mobilednajournal.biomedcentral.com)
Round LED Linear Pendant - Model Alu Round 38 [Profile Only] | Wired4Signs USA
Round LED Linear Pendant - Model Alu Round 38 [Profile Only] | Wired4Signs USA (wired4signsusa.com)
CiteSeerX - Citation Query TranspoGene and microTranspoGene: transposed elements influence on the transcriptome of seven...
CiteSeerX - Citation Query TranspoGene and microTranspoGene: transposed elements influence on the transcriptome of seven... (citeseer.ist.psu.edu)
A-to-I editing of coding and non-coding RNAs by ADARs | Nature Reviews Molecular Cell Biology
A-to-I editing of coding and non-coding RNAs by ADARs | Nature Reviews Molecular Cell Biology (nature.com)
Genomic Disorders | SpringerLink
Genomic Disorders | SpringerLink (link.springer.com)
Distributions of Transposable Elements Reveal Hazardous Zones in Mammalian Introns
Distributions of Transposable Elements Reveal Hazardous Zones in Mammalian Introns (journals.plos.org)
5th Annual Early Age Onset Colorectal Cancer - Session VI - English
5th Annual Early Age Onset Colorectal Cancer - Session VI - English (slideshare.net)
Hominidae
Hominidae (tolweb.org)
Frontiers | Sequence Determinants for Nuclear Retention and Cytoplasmic Export of mRNAs and lncRNAs | Genetics
Frontiers | Sequence Determinants for Nuclear Retention and Cytoplasmic Export of mRNAs and lncRNAs | Genetics (frontiersin.org)
A-to-I RNA editing - immune protector and transcriptome diversifier | Nature Reviews Genetics
A-to-I RNA editing - immune protector and transcriptome diversifier | Nature Reviews Genetics (nature.com)
Plus it
Plus it (care.diabetesjournals.org)
'Junk' DNA: evolutionary discards or God's tools? - creation...
'Junk' DNA: evolutionary discards or God's tools? - creation... (creation.com)
Publications
Publications (cgen.com)
Genomic landscape of oxidative DNA damage and repair reveals regioselective protection from mutagenesis | SpringerLink
Genomic landscape of oxidative DNA damage and repair reveals regioselective protection from mutagenesis | SpringerLink (link.springer.com)
Transposable element - Wikipedia
Transposable element - Wikipedia (en.wikipedia.org)
Molecular roles and function of circular RNAs in eukaryotic cells | SpringerLink
Molecular roles and function of circular RNAs in eukaryotic cells | SpringerLink (link.springer.com)
Workshop on Branching Processes and Their Applications | SpringerLink
Workshop on Branching Processes and Their Applications | SpringerLink (link.springer.com)
What'sNEW in Cosmic Ancestry, Oct-Dec 2014. by Brig Klyce
What'sNEW in Cosmic Ancestry, Oct-Dec 2014. by Brig Klyce (panspermia.org)
Bioinformatic Methods to Discover Cis-regulatory Elements in mRNAs | SpringerLink
Bioinformatic Methods to Discover Cis-regulatory Elements in mRNAs | SpringerLink (link.springer.com)
Frontiers | Viral Impact in Autoimmune Diseases: Expanding the X Chromosome-Nucleolus Nexus Hypothesis | Immunology
Frontiers | Viral Impact in Autoimmune Diseases: Expanding the "X Chromosome-Nucleolus Nexus" Hypothesis | Immunology (frontiersin.org)
Mutation - Wikipedia
Mutation - Wikipedia (en.m.wikipedia.org)
ASCOT identifies key regulators of neuronal subtype-specific splicing | Nature Communications
ASCOT identifies key regulators of neuronal subtype-specific splicing | Nature Communications (nature.com)
Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans | Nature Communications
Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans | Nature Communications (nature.com)
The Genomic Challenge to the Social Construction of Race - Lee Shiao, Bode, Beyer, Selving | Race (Human Categorization) |...
The Genomic Challenge to the Social Construction of Race - Lee Shiao, Bode, Beyer, Selving | Race (Human Categorization) |... (scribd.com)
Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants | BMC Genomics ...
Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants | BMC Genomics ... (bmcgenomics.biomedcentral.com)
Introduction | SpringerLink
Introduction | SpringerLink (link.springer.com)
Study finds convergent evolution of gene regulation in humans and mice | EurekAlert! Science News
Study finds convergent evolution of gene regulation in humans and mice | EurekAlert! Science News (eurekalert.org)
Nucleic Acids Research Studies on Alu Genotyping, Stress Response Histones, Undocumented Small RNAs | GenomeWeb
Nucleic Acids Research Studies on Alu Genotyping, Stress Response Histones, Undocumented Small RNAs | GenomeWeb (genomeweb.com)
Repeat DNA Function Negates Classic Evolutionary Argument | The Institute for Creation Research
Repeat DNA Function Negates Classic Evolutionary Argument | The Institute for Creation Research (icr.org)
Evolutionarily recent groups of transposable elements in the human genome | SpringerLink
Evolutionarily recent groups of transposable elements in the human genome | SpringerLink (link.springer.com)
Evolutionary Emergence of Genes Through Retrotransposition
Evolutionary Emergence of Genes Through Retrotransposition (els.net)