The Alu sequence family (named for the restriction endonuclease cleavage enzyme Alu I) is the most highly repeated interspersed repeat element in humans (over a million copies). It is derived from the 7SL RNA component of the SIGNAL RECOGNITION PARTICLE and contains an RNA polymerase III promoter. Transposition of this element into coding and regulatory regions of genes is responsible for many heritable diseases.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Highly repeated sequences, 6K-8K base pairs in length, which contain RNA polymerase II promoters. They also have an open reading frame that is related to the reverse transcriptase of retroviruses but they do not contain LTRs (long terminal repeats). Copies of the LINE 1 (L1) family form about 15% of the human genome. The jockey elements of Drosophila are LINEs.
Highly repeated sequences, 100-300 bases long, which contain RNA polymerase III promoters. The primate Alu (ALU ELEMENTS) and the rodent B1 SINEs are derived from 7SL RNA, the RNA component of the signal recognition particle. Most other SINEs are derived from tRNAs including the MIRs (mammalian-wide interspersed repeats).
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
The complete genetic complement contained in the DNA of a set of CHROMOSOMES in a HUMAN. The length of the human genome is about 3 billion base pairs.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Elements that are transcribed into RNA, reverse-transcribed into DNA and then inserted into a new site in the genome. Long terminal repeats (LTRs) similar to those from retroviruses are contained in retrotransposons and retrovirus-like elements. Retroposons, such as LONG INTERSPERSED NUCLEOTIDE ELEMENTS and SHORT INTERSPERSED NUCLEOTIDE ELEMENTS do not contain LTRs.
A suborder of PRIMATES consisting of the following five families: CHEIROGALEIDAE; Daubentoniidae; Indriidae; LEMURIDAE; and LORISIDAE.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
The region of DNA which borders the 3' end of a transcription unit and where a variety of regulatory sequences are located.
Family of the suborder HAPLORHINI (Anthropoidea) comprising bipedal primate MAMMALS. It includes modern man (HOMO SAPIENS) and the great apes: gorillas (GORILLA GORILLA), chimpanzees (PAN PANISCUS and PAN TROGLODYTES), and orangutans (PONGO PYGMAEUS).
Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions.
The family of Old World monkeys and baboons consisting of two subfamilies: CERCOPITHECINAE and COLOBINAE. They are found in Africa and part of Asia.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
The common chimpanzee, a species of the genus Pan, family HOMINIDAE. It lives in Africa, primarily in the tropical rainforests. There are a number of recognized subspecies.
Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
Tumor suppressor genes located on the long arm of human chromosome 17 in the region 17q11.2. Mutation of these genes is thought to cause NEUROFIBROMATOSIS 1, Watson syndrome, and LEOPARD syndrome.
This single species of Gorilla, which is a member of the HOMINIDAE family, is the largest and most powerful of the PRIMATES. It is distributed in isolated scattered populations throughout forests of equatorial Africa.
Nucleic acid sequences involved in regulating the expression of genes.
The asymmetrical segregation of genes during replication which leads to the production of non-reciprocal recombinant strands and the apparent conversion of one allele into another. Thus, e.g., the meiotic products of an Aa individual may be AAAa or aaaA instead of AAaa, i.e., the A allele has been converted into the a allele or vice versa.
A purine nucleoside that has hypoxanthine linked by the N9 nitrogen to the C1 carbon of ribose. It is an intermediate in the degradation of purines and purine nucleosides to uric acid and in pathways of purine salvage. It also occurs in the anticodon of certain transfer RNA molecules. (Dorland, 28th ed)
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A type of chromosomal aberration involving DNA BREAKS. Chromosome breakage can result in CHROMOSOMAL TRANSLOCATION; CHROMOSOME INVERSION; or SEQUENCE DELETION.
A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.
The relationships of groups of organisms as reflected by their genetic makeup.
Areas of increased density of the dinucleotide sequence cytosine--phosphate diester--guanine. They form stretches of DNA several hundred to several thousand base pairs long. In humans there are about 45,000 CpG islands, mostly found at the 5' ends of genes. They are unmethylated except for those on the inactive X chromosome and some associated with imprinted genes.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Genotypic differences observed among individuals in a population.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Nucleotide sequences repeated on both the 5' and 3' ends of a sequence under consideration. For example, the hallmarks of a transposon are that it is flanked by inverted repeats on each end and the inverted repeats are flanked by direct repeats. The Delta element of Ty retrotransposons and LTRs (long terminal repeats) are examples of this concept.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
Any method used for determining the location of and relative distances between genes on a chromosome.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
A group of chemical elements that are needed in minute quantities for the proper growth, development, and physiology of an organism. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)

Hereditary desmoid disease in a family with a germline Alu I repeat mutation of the APC gene. (1/466)

Two families with autosomal dominantly inherited desmoid tumors have recently been shown to have germline mutations at the 3' end of the APC gene. We subsequently identified an Amish family with autosomal dominantly inherited desmoid tumors. Genetic analysis performed on one family member, a 47-year-old man with multiple desmoid tumors and no colon polyps, revealed a protein truncating mutation in the middle of the APC gene. The truncating mutation is the result of a 337-bp insertion of an Alu I sequence into codon 1526 of the APC gene. The presence of a poly(A) tail at the 3' end of the insertion suggests that the Alu I sequence was inserted by a retrotranspositional event. Germline insertions of Alu I sequences have occasionally been reported to cause other genetic diseases including type I neurofibromatosis, hereditary site-specific breast cancer (BRCA2), and hemophilia B. However, this is the first report of a germline mutation of the APC gene resulting from an Alu I insertion.  (+info)

A novel human DNA-binding protein with sequence similarity to a subfamily of redox proteins which is able to repress RNA-polymerase-III-driven transcription of the Alu-family retroposons in vitro. (2/466)

In this study we identified a novel protein which may contribute to the transcriptional inactivity of Alu retroposons in vivo. A human cDNA clone encoding this protein (ACR1) was isolated from a human expression library using South-western screening with an Alu subfragment, implicated in the regulation of Alu in vitro transcription and interacting with a HeLa nuclear protein down-regulated in adenovirus-infected cells. Bacterially expressed ACR1 is demonstrated to inhibit RNA polymerase III (Pol III)-dependent Alu transcription in vitro but showed no repression of transcription of a tRNA gene or of a reporter gene under control of a Pol II promoter. ACR1 mRNA is also found to be down-regulated in adenovirus-infected HeLa cells, consistent with a possible repressor function of the protein in vivo. ACR1 is mainly (but not exclusively) located in cytoplasm and appears to be a member of a weakly characterized redox protein family having a central, highly conserved sequence motif, PGAFTPXCXXXXLP. One member of the family identified earlier as peroxisomal membrane protein (PMP)20 is known to interact in a sequence-specific manner with a yeast homolog of mammalian cyclosporin-A-binding protein cyclophilin, and mammalian cyclophilin A (an abundant ubiquitously expressed protein) is known to interact with human transcriptional repressor YY1, which is a major sequence-specific Alu-binding protein in human cells. It appears, therefore, that transcriptional silencing of Alu in vivo is a result of complex interactions of many proteins which bind to its Pol III promoter.  (+info)

Translational control of specific genes during differentiation of HL-60 cells. (3/466)

Eukaryotic gene expression can be regulated through selective translation of specific mRNA species. Nevertheless, the limited number of known examples hampers the identification of common mechanisms that regulate translation of specific groups of genes in mammalian cells. We developed a method to identify translationally regulated genes. This method was used to examine the regulation of protein synthesis in HL-60 cells undergoing monocytic differentiation. A partial screening of cellular mRNAs identified five mRNAs whose translation was specifically inhibited and five others that were activated as was indicated by their mobilization onto polysomes. The specifically inhibited mRNAs encoded ribosomal proteins, identified as members of the 5'-terminal oligopyrimidine tract mRNA family. Most of the activated transcripts represented uncharacterized genes. The most actively mobilized transcript (termed TA-40) was an untranslated 1.3-kilobase polyadenylated RNA with unusual structural features, including two Alu-like elements. Following differentiation, a significant change in the cytoplasmic distribution of Alu-containing mRNAs was observed, namely, the enhancement of Alu-containing mRNAs in the polysomes. Our findings support the notion that protein synthesis is regulated during differentiation of HL-60 cells by both global and gene-specific mechanisms and that Alu-like sequences within cytoplasmic mRNAs are involved in such specific regulation.  (+info)

Human-specific insertion/deletion polymorphisms in Indian populations and their possible evolutionary implications. (4/466)

DNA samples from 396 unrelated individuals belonging to 14 ethnic populations of India, inhabiting various geographical locations and occupying various positions in the socio-cultural hierarchy, were analysed in respect of 8 human-specific polymorphic insertion/deletion loci. All loci, except Alu CD4, were found to be highly polymorphic in all populations. The levels of average heterozygosities were found to be very high in all populations and, in most populations, also higher than those predicted by the island model of population structure. The coefficient of gene differentiation among Indian populations was found to be higher than populations in most other global regions, except Africa. These results are discussed in the light of two possible scenarios of evolution of Indian populations in the broader context of human evolution.  (+info)

Y chromosomal polymorphisms reveal founding lineages in the Finns and the Saami. (5/466)

Y chromosomal polymorphisms were studied in 502 males from 16 Eurasian ethnic groups including the Finns, Saami (Inari Lake area and Skolt Saami), Karelians, Mari, Mokshas, Erzas, Hungarians (Budapest area and Csangos), Khanty, Mansi, Yakuts, Koryaks, Nivkhs, Mongolians, and Latvians. The samples were analysed for polymorphisms in the Y chromosome specific Alu insertion (YAP) and six microsatellites (DYS19, DYS389-I and II, DYS390, DYS392, DYS393). The populations were also screened for the recently described Tat polymorphism. The incidence of YAP+ type was highest in the Csangos and in other Hungarians (37.5% and 17.5%, respectively). In the Karelians and the Latvians it was present at approximately the same level as commonly found in other European populations, whilst absent in our further samples of Eurasian populations, including the Finns and the Saami. Aside from the Hungarians, the C allele of the Tat polymorphism was common in all the Finno-Ugric speaking populations (from 8.2% to 63.2%), with highest incidence in the Ob-Ugrian Khanty. The C allele was also found in the Latvians (29.4%). The haplotypes found associated with the Tat C allele showed consistently lower density than those associated with the T allele, indicating that the T allele is the original form. The computation of the age of the Tat C suggested that the mutation might be a relatively recent event giving a maximum likelihood estimate of 4440 years (95% confidence interval about 3140-6200 years). The distribution patterns of the 222 haplotypes found varied considerably among the populations. In the Finns a majority of the haplotypes could be assigned to two distinct groups, one of which harboured the C allele of the Tat polymorphism, indicating dichotomous primary source of genetic variation among Finnish males. The presence of a bottleneck or founding effect in the male lineages of some of the populations, namely in the Finns and the Saami, would appear to be one likely interpretation for these findings.  (+info)

Molecular analysis of an unstable genomic region at chromosome band 11q23 reveals a disruption of the gene encoding the alpha2 subunit of platelet-activating factor acetylhydrolase (Pafah1a2) in human lymphoma. (6/466)

A region of 150 kb has been analysed around a previously isolated, lymphoma associated, translocation breakpoint located at chromosome band 11q23. This balanced and reciprocal translocation, t(11;14)(q32;q23), has been shown to result in the fusion between chromosome 11 specific sequence and the switch gamma4 region of the IGH locus. The LPC gene, encoding a novel proprotein convertase belonging to the furin family, has been identified in this region. In order to characterize further the region surrounding the translocation, we have determined the detailed structure of LPC. Here we show that LPC consists of at least 16 exons covering 25 kb, and that there is a partial duplication, involving mobile genetic elements and containing LPC exons 13-17 in a tail-tail configuration at 65 kb downstream. Since the chromosomal breakpoint lay between these two structures, the intervening region was further analysed and shown to contain at least two unrelated genes. The previously known SM22 gene was localized close to the 3' tail of LPC. Furthermore, we identified the gene encoding the alpha2 subunit of platelet-activating factor acetylhydrolase (Pafah1a2) at the chromosomal breakpoint. The position of another previously identified breakpoint was also located to within the first intron of this gene. Altogether, our results give evidence of a genomic instability of this area of 11q23 and show that Pafah1a2 and not LPC is the gene disrupted by the translocation, suggesting that deregulated Pafah1a2 may have a role in lymphomagenesis.  (+info)

Concerted evolution of the tandem array encoding primate U2 snRNA (the RNU2 locus) is accompanied by dramatic remodeling of the junctions with flanking chromosomal sequences. (7/466)

The genes encoding primate U2 snRNA are organized as a nearly perfect tandem array (the RNU2 locus) that has been evolving concertedly for >35 Myr since the divergence of baboons and humans. Thus the repeat units of the tandem array are essentially identical within each species, but differ between species. Homogeneity is maintained because any change in one repeat unit is purged from the array or fixed in all other repeats. Intriguingly, the cytological location of RNU2 has remained unchanged despite concerted evolution of the tandem array. We had found previously that junction sequences between the U2 tandem array and flanking DNA were subject to remodeling over a region of 200-300 bp during the past 5 Myr in the hominid lineage. Here we show that the junctions between the U2 tandem array and flanking DNA have undergone dramatic rearrangements over a region of 1 to >10 kbp in the 35 Myr since divergence of the Old World Monkey and hominid lineages. We argue that these rearrangements reflect the high level of genetic activity required to sustain concerted evolution, and propose a model to explain why maintenance of homogeneity within a tandemly repeated multigene family would lead to junctional diversity.  (+info)

Expressed sequence tag (EST) phenotyping of HT-29 cells: cloning of ser/thr protein kinase EMK1, kinesin KIF3B, and of transcripts that include Alu repeated elements. (8/466)

To study the mechanisms that control epithelial commitment and differentiation we have used undifferentiated HT-29 colon cancer cells and a subpopulation of mucus secreting cells obtained by selection of HT-29 cells in 10-6 M methotrexate (M6 cells) as experimental models. We isolated cDNAs encoding transcripts overexpressed in early confluent M6 cells regarding steady-state levels in HT-29 cells by subtractive hybridisation. Fifty-one cDNA clones, corresponding to 34 independent transcripts, were isolated, partially sequenced by their 5' end, and classified into four groups according to their identity: transcripts that included a repeated sequence of the Alu family (10 clones, among them those encoding ribonucleoprotein RNP-L and E-cadherin), transcripts encoded by the mitochondrial genome (nine clones), transcripts encoding components of the protein synthesis machinery (23 clones, including the human ribosomal protein L38 not previously cloned in humans) and nine additional cDNAs that could not be classified in the previous groups. These last included ferritin, cytokeratin 18, translationally controlled human tumour protein (TCHTP), mt-aldehyde dehydrogenase, as well as unknown transcripts (three clones), and the human homologues of the molecular motor kinesin KIF3B and of the ser/thr protein kinase EMK1. Spot dot and Northern blot analyses showed that ser/thr protein kinase EMK1 was differentially expressed in M6 cells when compared with parental HT-29 cells. Steady-state levels of EMK1 were higher in proliferating, preconfluent, M6 and HT-29 cells than in 2 days post confluence (dpc) and 8dpc M6 and HT-29 cells. Transcripts that included an Alu repeat were also shown to be differentially expressed and accumulated in differentiating M6 cells when analysed by Northern blot. The significance of the transcripts cloned is discussed in the context of the commitment and differentiation of the M6 cells to the mucus secreting lineage of epithelial cells.  (+info)

Alu elements are major contributors to lineage-specific new exons in primate and human genomes. Recent studies indicate that some Alu exons have high transcript inclusion levels or tissue-specific splicing profiles, and may play important regulatory roles in modulating mRNA degradation or translational efficiency. However, the contribution of Alu exons to the human proteome remains unclear and controversial. The prevailing view is that exons derived from young repetitive elements, such as Alu elements, are restricted to regulatory functions and have not had adequate evolutionary time to be incorporated into stable, functional proteins. We adopt a proteotranscriptomics approach to systematically assess the contribution of Alu exons to the human proteome. Using RNA sequencing, ribosome profiling, and proteomics data from human tissues and cell lines, we provide evidence for the translational activities of Alu exons and the presence of Alu exon derived peptides in human proteins
In this study we demonstrated that Alu repetitive elements can function as inducers of A-to-I editing in adjacent sequences, affecting the expressed proteome. Alu repeats are primate specific and vary also in abundance within primates. Our observation therefore points to a human- or primate-specific phenomenon that cannot be explained by the sequence at the site of editing.. It has previously been speculated by Li and co-workers that non-Alu A/I editing sites are dependent on nearby edited Alu sequences in the human transcriptome [20]. Their theory was based on the fact the two classes of editing are often found within close proximity in the same transcripts. We were able to confirm their hypothesis, and show that editing in non-repetitive elements often depends on nearby repetitive Alu elements. Our previous analysis showed that induction of site-selective editing at the I/M site of Gabra-3 by a long intronic hairpin structure is independent of editing, and instead depends on the ...
TY - JOUR. T1 - MIEN1 is tightly regulated by SINE Alu methylation in its promoter. AU - Rajendiran, Smrithi. AU - Gibbs, Lee D.. AU - Van Treuren, Timothy. AU - Klinkebiel, David L.. AU - Vishwanatha, Jamboor K.. PY - 2016/1/1. Y1 - 2016/1/1. N2 - Migration and invasion enhancer 1 (MIEN1) is a novel gene involved in prostate cancer progression by enhancing prostate cancer cell migration and invasion. DNA methylation, an important epigenetic regulation, is one of the most widely altered mechanisms in prostate cancer. This phenomenon frames the basis to study the DNA methylation patterns in the promoter region of MIEN1. Bisulfite pyrosequencing demonstrates the MIEN1 promoter contains a short interspersed nuclear Alu element (SINE Alu) repeat sequence. Validation of methylation inhibition on MIEN1 was performed using nucleoside analogs and non-nucleoside inhibitors and resulted in an increase in both MIEN1 RNA and protein in normal cells. MIEN1 mRNA and protein increases upon inhibition of ...
TY - JOUR. T1 - The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region. AU - Trujillo, Miguel A.. AU - Sakagashira, Michiko. AU - Eberhardt, Norman L.. PY - 2006/10/9. Y1 - 2006/10/9. N2 - Alu family sequences are middle repetitive short interspersed elements (SINEs) dispersed throughout vertebrate genomes that can modulate gene transcription. The human (h) GH locus contains 44 complete and four partial Alu elements. An Sx Alu repeat lies in close proximity to the hGH-1 and hGH-2 genes in the 3′-flanking region. Deletion of the Sx Alu repeat in reporter constructs containing hGH-1 3′-flanking sequences increased reporter activity in transfected pituitary GC cells, suggesting this region contained a repressor element. Analysis of multiple deletion fragments from the 3′-flanking region of the hGH-1 gene revealed a strong orientation- and position-independent silencing activity mapping between nucleotides 2158 and 2572 encompassing the Sx ...
Since the discovery of the high abundance of Alu elements in the human genome the interest for the functional significance of these retrotransposons has been increasing. in genes source of PPs. In contrast the presence of other retrotransposable elements in 3UTRs does not show this PP linked overrepresentation. This research was extended to mouse and rat genomes and the results accordingly reveal overrepresentation of 3UTR-embedded B1 (Alu-like) elements in PP mother or WAY-100635 father genes. Oddly enough we also proven how the overrepresentation of 3UTR-embedded Alus is specially significant in PP mother or father genes with low germline gene manifestation level. Finally we offer data that support the hypothesis how the L1 machinery can be the machine that herpesviruses and perhaps additional large DNA infections use to fully capture sponsor genes indicated in germline or somatic cells. Completely our outcomes suggest a book part for Alu or Alu-like components inside 3UTRs as facilitators ...
Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding
lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements Chenguang Gong & Lynne E. Maquat Nature 470, 284-288 (10 February 2011) doi:10.1038/nature09701Staufen 1 (STAU1)-mediated messenger RNA decay (SMD) involves the degradation of translationally active mRNAs whose 3′-untranslated regions (3′ UTRs) bind to STAU1, a protein that binds to double-stranded RNA1. Earlier…
The newly identified mechanism involves Alu elements, repetitive DNA elements that spread throughout the genome as primates evolved. While scientists have known about the existence of Alu elements for many years, their function, if any, was largely unknown.. Maquat discovered that Alu elements team up with molecules called long noncoding RNAs (lncRNAs) to regulate protein production. They do this by ensuring messenger RNAs (mRNAs), which take genetic instructions from DNA and use it to create proteins, stay on track and create the right number of proteins. If left unchecked, protein production can spiral out of control, leading to the proliferation or multiplication of cells, which is characteristic of diseases such as cancer.. Previously, no one knew what Alu elements and long noncoding RNAs did, whether they were junk or if they had any purpose. Now, weve shown that they actually have important roles in regulating protein production, said Maquat, the J. Lowell Orbison Chair, professor of ...
Dark Horse Comics told ANN on Monday that it has sold 1.2 million copies of Kentarou Miuras Berserk manga. As of 2015, the series had more than 27 million...
Activision has announced this weekend that Modern Warfare 3 sold 6.5 million copies in its first 24 hours of availability. Making that massive number even more impressive ...
Cuphead is celebrating its second anniversary today. As part of that, the game is seeing a 20 percent discount during the next week.. Studio MDHR has also announced that Cuhead has surpassed five million copies sold. The title debuted on Switch earlier this year and has been a strong seller on the platform.. Source. ...
Transposed elements (TEs) are known to affect transcriptomes, because either new exons are generated from intronic transposed elements (this is called exonization), or the element inserts into the exon, leading to a new transcript. Several examples in the literature show that isoforms generated by an exonization are specific to a certain tissue (for example the heart muscle) or inflict a disease. Thus, exonizations can have negative effects for the transcriptome of an organism. As we aimed at detecting other tissue- or tumor-specific isoforms in human and mouse genomes which were generated through exonization of a transposed element, we designed the automated analysis pipeline SERpredict (SER = S pecific E xonized R etroelement) making use of Bayesian Statistics. With this pipeline, we found several genes in which a transposed element formed a tissue- or tumor-specific isoform. Our results show that SERpredict produces relevant results, demonstrating the importance of transposed elements in shaping both
The passing of Dr. Jerzy Jurka (Jurek to his friends) represents a heartfelt loss to his many friends in the Mobile DNA field. The whole field of Mobile DNA has lost the scientific efforts of a brilliant colleague and for many of us an esteemed friend. The accompanying biography provides an outstanding outline of his life and career, so I will focus primarily on his impact to the field of Mobile DNA.. Jureks first publication related to Mobile DNA was the discovery of an Alu element in an alpha globin gene in the late 1980s while working with Temple Smith. Jurek was one of the pioneers of well-trained bioinformatics experts to focus his expertise on mobile elements, with one of the early and important findings of subfamilies in the Alu elements. Through the years, his ability to handle large genomic datasets led him to a number of important discoveries, including a bioinformatic prediction of the target site for SINEs and LINEs, the discovery of several new families and clades of mobile ...
ID PBP96 preliminary; circular DNA; SYN; 4600 BP. XX AC ATCC77084; XX DT 01-JUL-1993 (Rel. 7, Created) DT 01-JUL-1995 (Rel. 12, Last updated, Version 1) XX DE Saccharomyces/E.coli plasmid vector pBP96 - incomplete. XX KW cloning vector. XX OS Cloning vector OC Artificial sequences; Cloning vehicles. XX RN [1] RC plasmid from pBluescript series & HIS3 gene RC pBP96 from BLUR8 & plasmid RC pBP97 from BLUR8 & plasmid RC pBP90 from HIS3 gene & pL1.1A, LINE RA Pavan W.J., Reeves R.H.; RT Integrative selection of human chromosome-specific yeast RT artificial chromosomes; RL Proc. Natl. Acad. Sci. U.S.A. 88:7788-7791(1991). XX RN [2] RC from pBP62 RC from pYAC3 RC from pYAC4 RC from pYAC55 RC from pJS97 RC from pJS98 RC from pYACneo RC from pYAC-RC RC from pCGS966 RC from pBP81 RC from pBP100 series RC pBP90 from human LINE repeats RC pBP96 from human Alu repeats RC pBP97 from human Alu repeats RC pBP47 from human Alu repeats & HIS3 & SV40 promoter & neo RA Reeves R.H., Pavan W.J., Hieter P.; RT ...
The fact that roughly half of the human genome is made up of TEs, with a significant portion of them being L1 and Alu retrotransposons, raises an important question: What do a…ll these jumping genes do, besides jump? Much of what a transposon does depends on where it lands. Landing inside a gene can result in a mutation, as was discovered when insertions of L1 into the factor VIII gene caused hemophilia (Kazazian et al., 1988). Similarly, a few years later, researchers found L1 in the APC genes in colon cancer cells but not in the APC genes in healthy cells in the same individuals. This confirms that L1 transposes in somatic cells in mammals, and that this element might play a causal role in disease development (Miki et al., 1992). (MORE) ...
In response to Death Note/Hikaru no Go artist Takeshi Obatas recent arrest, Shueisha, his publisher, has announced that, until they can verify the details of the incident, they are not considering any actions such as pulling his work from stores.. Of Obatas work, Hikaru no Go (story: Yumi Hotta) has sold approximately 10 million copies over the span of 23 volumes, while Death Note (story: Tsugumi Ohba) has sold approximately 20 million copies over a span of 12 volumes. Publicists for Shueisha commented, we are currently verifying the factual details of this incident, and are not considering pulling titles from circulation or any such action at this time.. Death Note was adapted into a live-action movie by Nihon TV (NTV), the first part of which was released in Japan in June and became a smash-hit, drawing an audience of over 2 million people. The movie was released in Hong Kong as well, and the sequel, which concludes the story, is slated for a November release. An anime adaptation is also ...
French media outlets help to publish newest issue of satirical magazine, after an attack on its offices killed eight of its staff, four others.
This is a parity predictor and carry checker for the Arithmetic Logic Unit ALU of a data processor. The carry generation within ALU is checked by perfo...
Results & Discussion. DNA sequencing of the ~11 kb and the ~1.5 kb fragments (AF320075) demonstrated the presence of two genes in close approximation to one another (Figure 1). The mouse Lim2 gene contains 5,896 base pairs from the transcriptional start site to the poly(A) signal. The mouse gene is very similar to the human LIM2 gene [15] in that it contains five exons encoding a polypeptide of 173 amino acids. The different exons in the mouse gene are each exactly the same size as those of the human gene. The total length of the mouse Lim2 gene, however, is considerably smaller than that of the human gene, which is 8,056 bp in length [15]. This difference in size is due almost entirely to the presence of Alu repeats in the human gene, there being seven separate Alu repeats in the human gene.. At least 1,500 bp of both mouse and human Lim2 upstream sequence have been obtained. Within the first 400 bp upstream from the transcriptional start site are several stretches of sequence that have very ...
Kendra Baughman York Marahrens Lab UCLA. Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes. Overview. Goal Background Prior Studies Strategy Results Remaining Tasks Future Directions. Goal. Slideshow 322233 by hamilton
Akkadian: (?) alu (elu) a fine breed of sheep [CAD a1 374], [AHw. 39] (rendered as ālu, jālu). // Extensively commented in the discussion section of the article in [CAD] as well as in [Steinkeller 52]. According to Steinkeller, the earliest attestations of UDU.A.LUM are in Sum. lexicals lists from Abū Salābīh̊ and Ebla. Later on, the term is common in economic texts from Ur III, early OB, Mari and Qatna. Both CAD and Steinkeller assume its identity with aslu, a literary term for ram, lamb found mostly in later texts. Since the phonetic development alu > aslu (or vice versa) is difficult, one tends to agree with Steinkeller that A.LUM is an abbreivated/defective Akkadogram to be read aslumx. If this assumption is correct, Akk. alu does not exist and does not form part of the present root (Once UDU A.LUM is reclassified as aslu, then the lemma alu ... simply disappears [Steinkeller 66]). // As for the forms a-lu, e-lu appearing as true Akkadian words (not logograms) in MA sources, ...
Ročaj alu 140 cm ✔ TM-Horeca.si - Je distributer široke palete izdelkov za podjetja, ki delujejo na področju prehrane, gostinstva, trgovine in čiščenja
Vostermans Companies is parent company of a multinational enterprise, executed by Vostermans Ventilation and Vostermans Alu Foundries.
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5 AACTCTTACACTGCATACAT 3, and the forward primer would be 3 TGGTATAAGACATTCCTGT 5. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers wont bind to the gene ...
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5 AACTCTTACACTGCATACAT 3, and the forward primer would be 3 TGGTATAAGACATTCCTGT 5. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers wont bind to the gene ...
In the more than fifteen years since its publication, the classic The 7 Habits of Highly Effective People has become an international phenomenon with over fifteen million copies sold. Tens of millions of people in business, government, schools, and families, and, most important, as individuals have dramatically improved their lives and organisations by applying the principles of Stephen R. Coveys classic book. The world, though, is a vastly changed place. The challenges and complexity we all face in our relationships, families, professional lives, and communities are of an entirely new order of magnitude. Being effective as individuals and organisations is no longer merely an option ? survival in todays world requires it. But in order to thrive, innovate, excel, and lead in what Covey calls the ?New Knowledge Worker Age?, we must build on and move beyond effectiveness. The call of this new era in human history is for greatness; its for fulfillment, passionate execution, and significant contribution.
Later, when People released a commemorative issue about the singer, few at the magazine thought it would sell. Publishers were shocked when the issue sold one million copies, and then its entire run within a matter of weeks. Editor Betty Cortina called it unheard of, and it was credited with sparking the start of Spanish-language magazines like People en Español and Latina. The singer also arguably paved the way for future Latino artists, including Jennifer Lopez, who, in the film about Selenas life, became the first Latina to earn $1 million for a film role ...
But a problem like that, turned out to be just another challenge for Rick, so, at the half-time break, when we were all ready for the photos to be taken, he hatched plan for the secret picture to be clandestinely taken. He arranged for someone to be sent to divert this mans attention, and we then rushed into a side room, posed for the picture, and then emerged full of smiles, before the Brentford man had discovered what we had done.. Sure enough it came out really well, it appeared on the back cover of the book and since then, Rick has continued crusading, but not just for rock music, but for his Christian faith as well, and he has done two USA tours with me to help raise funds for ASSIST Ministries (www.assistnews.net).. For the few of you who dont know anything about Rick Wakeman, this legendary keyboardist with Yes, has also produced well over 100 solo albums that have sold more than 50 million copies. By the way, I am still trying to figure out how these two legendary British rock ...
PJ Lynch on drawing, painting and illustration with particular reference to his own work. PJ Lynch is an award winning illustrator whose books have sold more than two million copies worldwide.
PJ Lynch on drawing, painting and illustration with particular reference to his own work. PJ Lynch is an award winning illustrator whose books have sold more than two million copies worldwide.
Fingerprints of the Gods has been translated into 27 languages and is estimated to have sold more than three million copies around the world.
We all know the classic Manics quote, right? About how they were going to make the greatest debut album ever, sell 18 million copies, then split u...
Last Friday, the thirteenth, I celebrated Valentines Day early, when my dear friend, the cinemaniac, Milton, treated me to the movie adaptation of E.L. James blockbuster novel, Fifty Shades of Grey. Neither of us had read these books, which have sold over 100 million copies and have been translated into 52 languages. Friends have declared…
AluScan combines inter-Alu PCR using multiple Alu-based primers with opposite orientations and next-generation sequencing to capture a huge number of Alu-proximal genomic sequences for investigation. Its requirem... Authors: Jian-Feng Yang, Xiao-Fan Ding, Lei Chen, Wai-Kin Mat, Michelle Zhi Xu, Jin-Fei Chen, Jian-Min Wang, Lin Xu, Wai-Sang Poon, Ava Kwong, Gilberto Ka-Kit Leung, Tze-Ching Tan, Chi-Hung Yu, Yue-Bin Ke, Xin-Yun Xu, Xiao-Yan Ke…. ...
AluScan combines inter-Alu PCR using multiple Alu-based primers with opposite orientations and next-generation sequencing to capture a huge number of Alu-proximal genomic sequences for investigation. Its requirem... Authors: Jian-Feng Yang, Xiao-Fan Ding, Lei Chen, Wai-Kin Mat, Michelle Zhi Xu, Jin-Fei Chen, Jian-Min Wang, Lin Xu, Wai-Sang Poon, Ava Kwong, Gilberto Ka-Kit Leung, Tze-Ching Tan, Chi-Hung Yu, Yue-Bin Ke, Xin-Yun Xu, Xiao-Yan Ke…. ...
It is a high quality, rigid and a very solid round profile made of anodized aluminum designed to be used with LED light sources. Thanks to a suitably designed shape, the profile can be safely used for high power LED strips (36W/m). The shape guara...
As I had a small portion of paneer left over in the fridge, I combined it with some potato and used it up to make this delicious parata. As of any Parata, this is also very soft, wholesome and filling ...
Note:If you are interested in our products, please leave your information, and we will have professional online marketing service for you. We will give you the feedback immediately accordding to your your needs. ...
MTB Cross Fahrräder günstig im Mountainbike Shop von bikester.at kaufen. Hier klicken und sich vom Großen Angebot an Cross Mountainbikes überzeugen!
Bahía Blanca is an urban city in a historically and geographically strategic place for the mixture of different populations in Argentina. In the present study, ten Alu elements from the X-chromosome are analysed in order to characterise the genetic composition of the city´s population, to compare it with other worldwide populations, and to explore the usefulness of X-chromosome markers for human population genetics purposes. In the Bahía Blanca sample, seven out of ten Alu insertion frequencies are polymorphic. X-chromosome Alu results in Bahía Blanca are compared with eight different populations from Africa, Europe and America. The genetic distance analysis indicates that the Bahía Blanca sample is closer to the European and North African samples (average distances 0.106 and 0.113) than to the Native American (0.163) and Sub-Saharan African samples (0.247). Genetic relationships as depicted through Multidimensional Scaling (MDS) illustrate the intermediate position of Bahía Blanca compared with
The entire functional NANOG gene (according to our sequencing data) and NANOGP1 are present in both the human and chimpanzee genome assemblies at orthologous chromosomal positions. In the 3 UTR of the NANOG gene, there is an Alu element, which is missing from NANOGP1 in both genomes. Therefore, the NANOGP1 unprocessed pseudogene arose through duplication of the chromosomal region containing NANOG before the human-chimpanzee (H/C) divergence and before insertion of the Alu element into the NANOG gene. Because the same Alu element is present in both the human and chimpanzee NANOG genes, its insertion must also have preceded the H/C divergence. The processed pseudogenes NANOGP2, NANOGP3, NANOGP4, NANOGP5, NANOGP6, NANOGP7, NANOGP9, and NANOGP10 lack this Alu element. They thus likely arose before its insertion and, therefore, also predate the H/C divergence. The presence of the NANOGP11 pseudogene fragment in both the human and chimpanzee genomes likewise shows that its origin preceded H/C ...
Mediatonics weird but lovable multiplayer game Fall Guys launched earlier this month for PS4 and PC, and immediately saw rapturous success, amassing over 8 million players on PS4 and selling over 2 million copies on Steam in a matter of days. It seems its momentum isnt slowing down, with the game crossing more significant milestones on both platforms.. Publisher Devolved Digital recently took to Twitter to confirm that Fall Guys has now sold over 7 million copies on Steam. On top of that, it has also become the most downloaded PlayStation Plus game of all time. Both of those are incredible achievements, especially given the short window from launch the game has managed them in.. Fall Guys is currently available on PS4 and PC, but the developers have expressed interesting in launching it for other platforms as well. You can read our review of the game through here.. It has also been confirmed that Season 2 of Fall Guys will be unveiled at Gamescom Opening Night Live tomorrow.. ...
Our data show that partial deletions of one or more NSD1 exons are a novel cause of Sotos syndrome and are readily identifiable by MLPA. Furthermore, MLPA is a robust method for detecting 5q35 microdeletions which occur in around 10% of non-Japanese Sotos cases and are the commonest cause of Sotos syndrome in Japan.4,21. Each of the eight partial gene deletions we identified was unique. Alu mediated recombination was the likely cause in at least four cases, similar to other conditions with partial deletions.17NSD1 is enriched for Alu elements with a density of 40.2% compared with 10.6% for the genome generally.22 In particular, intron 2-the largest intron in NSD1-contains 115 Alu repeats and the sequence 5′ to NSD1 is also highly enriched with Alu elements. This probably explains why the most frequent partial deletion in our series encompassed exons 1-2. Despite the high density of Alu repeats in NSD1, two of six cases in which we defined the exact deletion breakpoints were not mediated by ...
Read Interaction of rice and human SRP19 polypeptides with signal recognition particle RNA, Plant Molecular Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
TY - JOUR. T1 - End-to-end transcription of an Alu family repeat. A new type of polymerase-III-dependent terminator and its evolutionary implication. AU - Hess, J.. AU - Perez-Stable, C.. AU - Wu, G. J.. AU - Weir, B.. AU - Tinoco, I.. AU - Shen, C. K.J.. PY - 1985/7/5. Y1 - 1985/7/5. N2 - Four or more consecutive thymidine residues on the non-template strand and G + C-richness of flanking DNA are the two necessary characteristics of efficient RNA polymerase-III-dependent transcriptional terminators. We have identified, from the study of in vitro transcription of a human Alu family repeat, a new type of RNA polymerase-III-dependent transcriptional terminator. A 258 base-pair Alu repeat located on the 3′ side of the human α1 globin gene can be transcribed in a HeLa S-100 extract to generate three RNA species of lengths 404 to 408, 252 to 255 and 173 to 174 nucleotides, respectively. Kinetics, pulse-chase and RNA incubation experiments showed no significant internal processing of the longer ...
Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population.|br| Herein, we present a novel and efficient computational tool named Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high depth whole-genome sequencing (WGS) data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean 68× depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed
In this study, we identified one novel deletion and one novel complex genomic rearrangement in two Chinese families with adRP and characterized the breakpoints of the genomic rearrangement. To date, eight large deletions, ranging from 5 kb to 112 kb, have been identified in PRPF31 [10-13]. Similar to all characterized large deletions of PRPF31, both breakpoints of the large deletion in family RP24 are located in the Alu regions; this suggests that the mechanism underlying this complex structural rearrangement may involve homologous recombination between Alu repeats. Alu repeats are short, interspersed nuclear elements that account for 10% of the sequenced region of the human genome; however, these repeats account for 26.3% of chromosome 19, which is the most Alu-rich chromosome [21]. This is why genomic arrangements are prevalent round the PRPF31 gene. Of the eight reported large deletions, only one is an insertion-deletion complex genomic DNA rearrangement, which includes an 110 bp deletion and ...
ALU Global Focus articles are researched and written by multinational undergraduate students from African Leadership University (ALU) in Kigali, Rwanda.. ALU aims to develop 3 million ethical and entrepreneurial leaders for Africa and the world by 2035. It uses a personalized, student-driven, project-based, and mission-oriented approach to create agile, lifelong learners who can adapt to a changing world.. ...
While at Rodale, Gottlieb was the creator and supervising editor of the mega-selling The Doctors Book of Home Remedies (16 million copies sold), and was the spokesperson in a commercial for the book that was broadcast 50,000 times and generated sales of 2 million copies. He has appeared as an expert on natural remedies on Good Morning America, CNN, and many other national TV and radio shows. His articles on health and healing have appeared in many magazines and periodicals, including Prevention, Readers Digest, Health, Runners World, Mens Health, New Beauty, Natural Health, Self, Alternative Medicine, Bottom Line Personal and Bottom Line Health ...
Translations of select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. It is available by anonymous FTP from ncbi.nlm.nih.gov (under the /pub/jmc/alu directory). See Alu alert by Claverie and Makalowski, Nature vol. 371, page 752 (1994) . ...
Find reliable alu nespresso nitrogen sealing machine​ made in China from saneu.com - professional alu nespresso nitrogen sealing machine​ manufacturer and supplier. Customized service is also available in our factory. Get the price list quickly.
Alu transposons are found only in primate genomes and have accumulated in large numbers since primates diverged from other mammals. Human chromosomes contain more than one million Alu copies, equaling about 10% of the genome by mass. This accumulation was made possible by a transposition mechanism that reverse transcribes Alu mRNAs into mobile DNA copies. Another transposon, the long interspersed element (LINE) L1, supplies a specialized reverse transcriptase enzyme needed for Alu to jump. Hence, Alu and L1 exist in a sort of molecular symbiosis. ...
Quantity gains, pathway analysis was performed. This evaluation revealed expected pathways involved in cell cycle regulation, proliferation, survival, and cellular assembly too as DNA replication, recombination and repair (Tables four and five). Interestingly, both IPA and MetaCore identified lipid metabolism in their top rated eight pathways.DiscussionPrevious studies in liposarcoma have contributed significantly for the understanding of your genetics underlying WDLS, but none have evaluated these in the context on the entire genome. This perform reports the use of flow cytometry to isolate tumor cells from a WDLS prior to complete genome sequencing. Structural rearrangements potentially contributing to tumor development have been detected along with identification of prospective therapeutic targets of interest. The presence of CX3CL1 Inhibitors Related Products LOC100507498 with higher similarity to L1 retrotransposon and Alu elements inside the NAV3-SYT1-PAWR gene cluster that was prone to ...
I suppose this is a good follow-up to the post on Grays Anatomy. (The study of genetics is the new study of anatomy, right?) The image above is a quilt that is designed to show a YAP genomic sequence: the Y alu polymorphism sequence of an Italian male is encoded in this quilt. The quilt is made of shot silk, which reflects light differently depending on the orientation of the weave and the viewer. The quilt is by Beverly St. Clair, a psychiatrist who is also a quilter, and more explanation of her method and how to read the quilt can be found on her website ...
[vc_column pofo_column_animation_style=none width=1/1 mobile_alignment=xs-text-justify mobile_display=xs-display-inline-block][pofo_section_heading
Buy the BH LYNX RACE ALU 3.0 bike online in the official BH store. Complete information about its features, geometrics,technology and tests in magazines in the BH Bikes Store EN
Her books have sold nearly a million copies, and she speaks to tens of thousands annually. Now this Christian author is talking openly about her quiet battle with breast cancer.
The talented and mega-popular singer Prince has released hundreds of musical compositions and almost forty studio albums, 100 million copies of his records have been sold in the world. All this gave him a certain creative freedom, he could afford unpredictable actions, outrageous and eccentricity. And once he just wanted to change his stage name for a complex graphic symbol. He worked for hours in his home studio, and then, going out to thousands of fans on the stage, he enveloped them with his magic. At first he drove the audience into a frenzy, after which he forced him to listen carefully to the lyric song. This was the secret of its popularity and magic, fueled by an incredible performance. Continue reading →. ...
Patrick Lencioni is founder and president of The Table Group, a firm dedicated to providing organizations with ideas, products and services that improve teamwork, clarity and employee engagement. Pats passion for organizations and teams is reflected in his writing, speaking and executive consulting. He is the author of several best-selling business books with over five million copies sold. Prior to founding his firm, he worked as a corporate executive for Sybase, Oracle and Bain & Company.. ...
Speaker(s): Robert Harris , Growing up on a Nottingham council estate, Robert Harriss burning ambition to write was matched only by his deep fascination with politics. Aged 30, he became political editor of The Observer; aged 35 he published Fatherland, in which he imagines a world in which the Nazis have won the war. It sold over 3 million copies. Harris was an early and enthusiastic backer of Tony Blair, but they fell out over the Iraq war, in the wake of which he wrote The Ghost, about a man ...
Is anesthesia worthy of the House of Gods assessment that its a cushy medical specialty? My answer, after thirty years of anesthesia practice: it depends.
Join David Burns, MD, anxiety and depression expert and author of the NY Times Best-seller Feeling Good, which has sold more than five million copies worldwide. Research indicates that most, if not all, current treatments for depression and anxiety are barely more effective than placebos...
On the cover of the January 1989 issue of NME, Joe Elliott had the right to smile. Over the course of a year and a half, his band managed to smash the sales record set by their previous effort to reach an astonishing 12 millions copies shipped.
Lets be honest. Lara Bars are expensive. Its only been on the rare occasion that Ive eaten one and everytime I do, I think I could have just made that!. There are currently 1.3 million copy cat recipes out there for Lara Bars (okay, maybe that number is inaccurate.) I figured I should contribute at least one more ...
Jodi Picoult is an American writer who currently has approximately 14 million copies of her books in print worldwide, translated into 34 languages.
From one of the most beloved authors of our time-more than six million copies of his books have been sold in this country alone-a fascinating...
Garth Brooks is a famous country singer as well as a songwriter. He is very well-known worldwide and is among the highest selling artists with his albums having been sold in over 160 million copies. (more&hell... ...
RSTK = 0 required for stability (Windows). RESULTS - ALU. From Appendix 5, it is clear that the Cyrix/IBM 5x86-133 had the best ALU performance for non-overclocked CPUs, whereby the Cyrix 5x86-120 was next in-line with 8% less performance. It may be argued, however, that the AMD X5-160 is long-term stable at 160 MHz and should not be considered an overclocked CPU, thereby outperforming the Cyrix 5x86-133 by 6%, that is, by 6 Pentium points .. [Note: All referenced percent increases/decreases noted in this study are relative to the Pentium 100 reference CPU and not to the individual increases/decreases between compared CPUs. An increase of 10% can be thought of as 10 Pentium points , meaning that this increase would be similar to an upgrade from a Pentium-90 to a Pentium-100. WB refers to L1 cache in write-back mode, while WT refers to L1 cache in write-through mode. If WB/WT is not specified, refer to L1 Cache Type on the charts in Appendices 1-4. BP is for a Cyrix 5x86 series processor with ...
Got a thing on the agenda here.. Bending aluminum tube of the 6061 variety, OD 30 mm with a 5 mm wall, 90 degree bend... with a radius of two inches.
There are also various self replicating genetic elements that exist in huge numbers in the human genome alu alone numbers about 500,000 compared to about 30,000 protein coding genes. About 45% of the human genome is composed of these elements. These elements can play many roles in the human including disrupting genes, promoting certain types of mutation and they can be co-opted to play a role in gene expression, although most seem to have no effect on the host ...
Producent: AXONMODEL: T080302 kije zjazdowe XCURSION- sportowe kije do narciarstwa zjazdowego,- rurka:- materiał: stop aluminium ALU 5083,- twardy, proszkowy lakier,- pro
I ate an alu paratha with butter and felt perfectly at ease while eating. At the next table, you ate the same but worried about... ...
Of course, these proteins are ultimately a encoded by some genes, so the DNA code would still be the ultimate arbiter, but now it seems that the key may not be in the gene alone but also in those proteins that control its behavior, which in turn are generated by other master genes. ...
Claim 2: Reddit user Aceofspades25 [4] has addressed Tomkins claim that the low frequency of telomere motif repeats indicates that the fusion of 2 chimp chromosomes did not occur to product the human chromosome 2. These motifs are TTAGGG joined to a series of repeats of the motif CCCTAA. While the frequency of these repeated motifs may be lower than expected on initial examination, he believes that it is not surprising. He cites, Carl Zimmer, a popular science writer and blogger, who focuses on the study of evolution and parasites. He has written several books on the topic and is a science writer for The New York Times, Discover, and National Geographic. Zimmer states The ends of chromosomes are very vulnerable places. If they simply dangle loosely, DNA-cutting enzymes can nibble away at them, destroying the genes they encounter. The dangling end of one chromosome can also get attached to the dangling end of another, fusing chromosomes together. We are mostly protected from such changes ...
Hospitals are under pressure to cut costs and to restore patients to good health without readmissions. Predictive analytics can help, but providers need a solid plan for using their data. Continue Reading ...
October 2003). "Alu elements and hominid phylogenetics". Proc. Natl. Acad. Sci. U.S.A. 100 (22): 12787-91. doi:10.1073/pnas. ... The analysis of SINEs - Short INterspersed Elements - LINEs - Long INterspersed Elements - or truncated LTRs - Long Terminal ... The target sites are relatively unspecific so that the chance of an independent integration of exactly the same element into ... Kriegs JO, Churakov G, Kiefmann M, Jordan U, Brosius J, Schmitz J (April 2006). "Retroposed elements as archives for the ...
325 L V T T P V S P A P T T P V T P L G T T P P S S 359 An Alu element was identified in the 3`-UTR of the longest mRNA ... Häsler J, Strub K (2006). "Alu elements as regulators of gene expression". Nucleic Acids Research. 34 (19): 5491-7. doi:10.1093 ... Also, an Alu segment in the 3 prime untranslated region of the mature mRNA could serve as a potential translational regulatory ... but there is existing evidence for Alu-mediated protein translation regulation, so this cannot be ruled out in c10orf76. The N- ...
Häsler J, Strub K (November 2006). "Alu elements as regulators of gene expression". Nucleic Acids Research. 34 (19): 5491-7. ... They are usually caused by transposable elements, or errors during replication of repeating elements. Insertions in the coding ... For example, more than a million copies of the Alu sequence are present in the human genome, and these sequences have now been ... Insertions can be reversed by excision of the transposable element. Deletions remove one or more nucleotides from the DNA. Like ...
Jurka J (December 2004). "Evolutionary impact of human Alu repetitive elements". Current Opinion in Genetics & Development. 14 ... This sort of competition for regulatory elements by RNAs that are endogenous to the genome has given rise to the term ceRNA. ... Pseudogene sequences may be transcribed into RNA at low levels, due to promoter elements inherited from the ancestral gene or ... For example, somewhere between 30-44% of the human genome consists of repetitive elements such as SINEs and LINEs (see ...
... including the discovery of the major families of Alu elements. He also proposed the mechanism of Alu proliferation and ... June 2002). "Active Alu elements are passed primarily through paternal germlines". Theoretical Population Biology. 61 (4): 519- ... The Erdős Project, "Paths to Erdős" Jurka J, Smith T (July 1988). "A fundamental division in the Alu family of repeated ... In 2006 they reported a study of a new, self-synthesizing transposable element called Polinton or Maverick, which is present ...
SVA elements are present at lower levels than SINES and LINEs in humans. The starts of SVA and Alu elements are similar, ... SVA elements are the exception between the two as they share similarities with both LINEs and SINEs, containing Alu elements ... Copy and pasting Alu RNA requires the Alu's adenine-rich end and the rest of the sequence bound to a signal. The signal-bound ... The insertion rates for LINE1, Alu and SVA elements are 1/200 - 1/20, 1/20 and 1/900 respectively. The LINE1 insertion rates ...
Localization of multiple Alu sequences and putative cis-acting elements". European Journal of Biochemistry / FEBS. 209 (1): 459 ...
"Cellular inhibitors of long interspersed element 1 and Alu retrotransposition". Proceedings of the National Academy of Sciences ... LINEs are a group of genetic elements that are found in abundant quantities in eukaryotic genomes. LINE-1 is the most common ... It is composed of the read-through Helitron element and its downstream genomic regions, flanked by a random DNA site, serving ... But since the L1 element was present in neither the retrotransposed segment nor the original sequence the mobilization of the ...
"Alu elements mediate MYB gene tandem duplication in human T-ALL". Journal of Experimental Medicine. 204 (13): 3059-3066. doi: ... "An oncogenic super-enhancer formed through somatic mutation of a noncoding intergenic element". Science. 346 (6215): 1373-1377 ...
"Optical Circuits and Circuit Elements and Methods of Forming Same". Nader Engheta et al US Patent Provisional Application No. ... CS1 maint: discouraged parameter (link) "Andrea Alu' (author and co-author)". Google Scholar. March 24, 2012. Retrieved 2012-07 ... optical circuit elements, and a cloaked sensor device. From January 2009 to January 2018 Alù was an assistant professor in the ...
The Alu element is the most common SINE found in primates. It is about 350 base pairs and occupies about 11% of the human ... and Penelope-like elements (PLEs). In Dictyostelium discoideum, there is another DIRS-like elements belong to Non-LTRs. Non- ... The interspersed nuclear elements (SINEs), and endogenous retroviruses. These elements have a big potential to modify the ... Transposable elements (TEs) are sequences of DNA with a defined structure that are able to change their location in the genome ...
The 5' region of the RNA defines one domain and consists of Alu repeat elements. The other two structural domains are a central ... "BRAIN CYTOPLASMIC RNA 1; BCYRN1." "Alu elements: know the SINEs" "The Long Non-Coding RNA BC200 (BCYRN1) Is Critical for Cancer ... The 5' region (left arm) of monomeric Alu short interspersed repetitive elements (SINEs) allows for BC200 RNA transposition and ... a Neural RNA Polymerase III Product Encoded by a Monomeric Alu Element". Proceedings of the National Academy of Sciences of the ...
Alu sequences, classified as a short interspersed nuclear element, are the most abundant mobile elements in the human genome. ... Cis-regulatory elements are sequences that control the transcription of a nearby gene. Many such elements are involved in the ... Cis-elements may be located in 5' or 3' untranslated regions or within introns. Trans-regulatory elements control the ... A genetic insulator is a boundary element that plays two distinct roles in gene expression, either as an enhancer-blocking code ...
Daniel, Chammiran; Behm, Mikaela; Öhman, Marie (2015). "The role of Alu elements in the cis-regulation of RNA processing". ...
Alu elements are known as the most abundant type of transposable elements. Some studies have used Alu elements as a way to ... Alu elements are CPG-rich in a longer amount of sequence, unlike LINEs and ERVs. Alus can work as a methylation center, and the ... Distal promoter elements also frequently contain CpG islands. An example is the DNA repair gene ERCC1, where the CpG island- ... However, this is a result that is analyzed over time because older Alus elements show more CPG loss in sites of neighboring DNA ...
There are about 300 to 500 thousand copies of Alu repetitive element in human genome, which means one Alu element exists in 4 ... Alu element can be used for genome fingerprinting based on PCR, which is also called Alu PCR. There are several ways to analyze ... Alu repetitive element is member of Short Interspersed Elements (SINE) in mammalian genome. ... that is why it is called Alu repetitive element. By using special Alu sequence as target locus, specific human DNA can be ...
In eukaryotes and archaea, eight helical elements fold into the Alu and S domains, separated by a long linker region. The Alu ... The UGU(NR) motif connects helices 3 and 4 in the small (Alu) SRP domain. Fungal SRP RNAs lacking helices 3 and 4 contain the ... It is now understood that Alu DNA originated from SRP RNA by excision of the central SRP RNA-specific (S) fragment, followed by ... SRP9 and SRP14 are structurally related and form the SRP9/14 heterodimer which binds to the SRP RNA of the small (Alu) domain. ...
The ALU performs addition, subtraction, and operations such as AND or OR. Each operation of the ALU sets one or more flags in a ... A single operation code might affect many individual data paths, registers, and other elements of the processor. As integrated ... The Four-Phase Systems AL1 was an 8-bit bit slice chip containing eight registers and an ALU. It was designed by Lee Boysel in ... A minimal hypothetical microprocessor might include only an arithmetic logic unit (ALU), and a control logic section. ...
Kuehnen P, Mischke M, Wiegand S, Sers C, Horsthemke B, Lau S, Keil T, Lee YA, Grueters A, Krude H (2012). "An Alu element- ... It allows that T3 bind to the thyroid hormone receptor (TR), which then bind to thyroid hormone response elements (TREs) in the ...
For example, repetitive elements of the Alu and LINE1 families cause polymorphisms in human genome. Microsatellites are repeats ... Polymorphic repetitive elements. Active transposable elements can also cause polymorphism by inserting themselves in new ...
The most common transposable element in humans is the Alu sequence. It is approximately 300 bases long and can be found between ... Activator element (Ac) is an example of an autonomous TE, and dissociation elements (Ds) is an example of a non-autonomous TE. ... Transposable elements represent one of several types of mobile genetic elements. TEs are assigned to one of two classes ... A transposable element (TE or transposon) is a DNA sequence that can change its position within a genome, sometimes creating or ...
The ALU called sympathy strikes to defend the activists. In spite of the failure of AFL-affiliated craft unions to support the ... Yet the labor movement had demonstrated that it could not muster solidarity among its disparate elements, and the Citizens' ... As the WFM was systematically repressed and ALU locals came under pressure from the Citizens' Alliance, the AFL saw more ... The Western Labor Union became the American Labor Union (ALU) and announced its intention to organize nationwide, hoping to ...
Many retroelements such as human endogenous retrovirus (HERV) and Alu elements are located in the cluster. The region ...
The protein binds to CGG trinucleotide repeats to regulate transcription (including inhibiting Alu elements) and translation. ... Chen LS, Tassone F, Sahota P, Hagerman PJ (2004). "The (CGG)n repeat element within the 5' untranslated region of the FMR1 ...
No elements with odd atomic numbers have more than two stable isotopes; even-numbered elements have multiple stable isotopes, ... The Latin word alumen stems from the Proto-Indo-European root *alu- meaning "bitter" or "beer". British chemist Humphry Davy, ... For instance, see the November-December 2013 issue of Chemistry International: in a table of (some) elements, the element is ... with tin (element 50) having the highest number of stable isotopes of all elements, ten. The single exception is beryllium ...
Potential regulatory elements, including five GC boxes and three CCAAT boxes, lie 1819 bp upstream of the transcription start ... Another difference is the presence of Alu sequences in its introns that are absent in PCK1. PCK2 also contains an 18-residue ...
"A novel complex deletion-insertion mutation mediated by Alu repetitive elements leads to lipoprotein lipase deficiency". Mol. ...
The chromosome addition of Y Alu polymorphic element is only displayed in Japanese American men. People of Japanese descent ...
Daniel, Chammiran; Behm, Mikaela; Öhman, Marie (2015). "The role of Alu elements in the cis-regulation of RNA processing". ...
It is sour to taste and slenderly made in the manner of batan-alu. But khat is reddish with a slight blackish tinge. It is ... it also suggested that public discourse on the issue displayed elements of a moral panic.[86] Some Somali community ... believed that batan-alu is red, coolant, relieves biliousness, and is a refrigerant for the stomach and the liver. ...
Somatic mosaics are common in embryogenesis due to retrotransposition of L1 and Alu transposable elements.[11] In early ... Other endogenous factors can also lead to mosaicism including mobile elements, DNA polymerase slippage, and unbalanced ... development, DNA from undifferentiated cell types may be more susceptible to mobile element invasion due to long, un-methylated ...
lenga Kurumba, Alu. * lenga Kurumba, Jennu. * lenghe Tamil-Malayalam. * lenghe Malayalam. * lenga Aranadan ...
Alu, A.; Engheta, N. (2004). "Guided Modes in a Waveguide Filled with a Pair of Single-Negative (SNG), Double-Negative (DNG), ... The metamaterial was constructed as a periodic array of copper split ring and wire conducting elements deposited onto a circuit ... The array scatters electromagnetic radiation at wavelengths longer than the size of the element and lattice spacing. The array ... In the above sections first fabricated metamaterial was constructed with resonating elements, which exhibited one direction of ...
최근에는 Alu RNA[36], [37]라는 인간 유전체에 존재하는 전이성 유전인자(transposable element)[38]가 inflammasome[39]를 활성화시켜서, 최종적으로 세포사멸에 관여하는 카스페이즈8( ... Hasler J, Strub K, (2006). "Alu elements as regulators of gene expression". Nucleic Acids Research 34 (19): 5491-5497 ... Kim, Y; Tarallo, Y; Kerur, N; Yasuma, T; Gelfand, BD; Bastos-Carvalho, A; Hirano, Y; Yasuma, R (2014). "DICER1/Alu RNA ...
New Method Of Self-assembling Nanoscale Elements Could Transform Data Storage Industry Archived 1 March 2009 at the Wayback ... ALU). The former controls the flow of data between the CPU and memory, while the latter performs arithmetic and logical ...
"Ukrainian Music Elements". Canadian Institute of Ukrainian Studies. 2001.. *^ "Ukrainian Wandering Bards: Kobzars, Bandurysts, ... Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms ... It also has a very strong indigenous Slavic and Christian uniqueness whose elements were used among many neighboring nations.[ ... is one of the most distinctive elements of Ukraine's cultural heritage.. ...
In late 1999, Russia's Premier, Vladimir Putin, ordered military, police and security forces to enter the breakaway region of Chechnya. By early 2000, these forces occupied most of the region. High levels of fighting continued for several more years and resulted in thousands of Russian and Chechen casualties and hundreds of thousands of displaced persons. In 2005, Chechen rebel leader, Abdul-Halim Sadulayev, decreed the formation of a Caucasus Front against Russia, among Islamic believers in the North Caucasus, in an attempt to widen Chechnya's conflict with Russia. After his death, his successor, Dokka Umarov, declared continuing jihad to establish an Islamic fundamentalist Caucasus Emirate in the North Caucasus and beyond. Russia's pacification policy in Chechnya has involved setting up a pro-Moscow regional government and transferring more local security duties to this government. An important factor in Russia's apparent success in Chechnya has been reliance on pro-Moscow Chechen clans ...
PCR can be used to determine sex from a human DNA sample.[15] The loci of Alu element insertion is selected, amplified and ... "Mobile element-based assay for human gender determination". Analytical Biochemistry. 312 (1): 77-9. doi:10.1016/S0003-2697(02) ...
Level-2 caches sometimes save power by reading the tags first, so that only one data element is read from the data SRAM. ... Arithmetic logic unit (ALU). *Address generation unit (AGU). *Floating-point unit (FPU) ...
Turnpenny P, Ellard S (2005). Emery's Elements of Medical Genetics (12th ed.). London: Elsevier.. CS1 maint: Uses authors ... Almost 50% of the human genome is contained in various types of transposable elements (also called transposons, or 'jumping ...
Alu elements in humans and analogous B1 and B2 elements in mice have succeeded in becoming the most abundant mobile elements ... The abundance and distribution of Alu elements and similar repetitive elements throughout the mammalian genome may be partly ... In addition to heat shock, the expression of SINE elements (including Alu, B1, and B2 RNAs) increases during cellular stress ... The Alu RNA contains two 'arms', each of which may bind one RNAP II molecule, as well as two regulatory domains that are ...
Insertion of Alu element into the PBGD gene leads to interference with the coding region and leads to acute intermittent ... Activator element (Ac) is an example of an autonomous TE, and dissociation elements (Ds) is an example of a non-autonomous TE. ... Mustajoki S, Ahola H, Mustajoki P, Kauppinen R (June 1999). "Insertion of Alu element responsible for acute intermittent ... Transposable elements represent one of several types of mobile genetic elements. TEs are assigned to one of two classes ...
Kidwell MG, Lisch DR (2000 Mar). "Transposable elements and host genome evolution". Trends in ecology & evolution 15 (3): 95-99 ... Os elementos Alu son os SINEs máis comúns nos primates, e teñen unha loxitude de 350 pares de bases e supoñen o 11% do xenoma ... Kazazian, H. H. (12 March 2004). "Mobile Elements: Drivers of Genome Evolution". Science 303 (5664): 1626-1632. Bibcode:2004Sci ... Penelope-like elements--a new class of retroelements: distribution, function and possible evolutionary significance. Cytogenet ...
... n repeat element within an Alu sequence". The Journal of Biological Chemistry. 276 (39): 36383-90. doi:10.1074/jbc.M104681200. ... A calcium ion is needed to link the two elements of the dimer together. Also a zinc ion is used to orient an otherwise ... binding to a DR1 like cis element which then stimulate production. Competing with HNF4A at a third site on the promoter is ...
35] Duplication of seven exons in LDL receptor gene caused by Alu-Alu recombination in a subject with familial ... 36] 42 bp element from LDL receptor gene confers end-product repression by sterols when inserted into viral TK promoter. Cell. ... 25] Mutation in LDL receptor: Alu-Alu recombination deletes exons encoding transmembrane and cytoplasmic domains. Science. 1985 ... 24] The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell. 1984 Nov;39(1):27-38 ...
As such the Nalik counting system contains elements of a base five counting system however when proceeding past ten, the ... counting system uses elements of base ten.[2] The word for the number five kavitmit can be analyzed as the phrase ka vit mit. ...
Kapitonov VV, Kolchanov NA, Shahmuradov IA (1993) Evolutionary dynamics of the number of Alu repeats in Human genome. - In: " ... Shakhmuradov IA, Kolchanov NA, Solovyev VV, Ratner VA (1986) Enhancer-like structures in middle repetitive DNA elements of ... Shakhmuradov IA, Kapitonov VV, Kolchanov NA, Omelyanchuk LV (1989). Evolution of Alu repeats: Dynamics of propagation in genome ... Kapitonov VV, Kolchanov NA, Shahmuradov IA (1993) Phylogenetic analysis of Alu repeats. In: "Computer analysis of genetic ...
"Alu elements as regulators of gene expression". Nucleic Acids Research. 34 (19): 5491-7. doi:10.1093/nar/gkl706. PMC 1636486. ... They are usually caused by transposable elements, or errors during replication of repeating elements. Insertions in the coding ... Hurst GD, Werren JH (August 2001). "The role of selfish genetic elements in eukaryotic evolution". Nature Reviews Genetics. 2 ( ... Insertions can be reversed by excision of the transposable element.. *Deletions remove one or more nucleotides from the DNA. ...
Mercury (element) Thallium Lead Bismuth Polonium Astatine Radon Francium Radium Actinium Thorium Protactinium Uranium Neptunium ... Pokorny, Julius (1959). "alu- (-d-, -t-)". Indogermanisches etymologisches Wörterbuch [Indo-European etymological dictionary] ( ... No elements with odd atomic numbers have more than two stable isotopes; even-numbered elements have multiple stable isotopes, ... For instance, see the November-December 2013 issue of Chemistry International: in a table of (some) elements, the element is ...
As secuencias Alu, clasificadas como SINEs, son os elementos móbiles máis abondosos no xenoma humano. Algúns SINEs exercen un ... "Defining functional DNA elements in the human genome". PNAS 111 (17): 6131-6138. Bibcode:2014PNAS..111.6131K. PMC 4035993 ... Häsler J, Samuelsson T, Strub K; Samuelsson; Strub (July 2007). "Useful 'junk': Alu RNAs in the human transcriptome". Cell. Mol ... "InvAluable junk: the cellular impact and function of Alu and B2 RNAs". IUBMB Life 61 (8): 831-7. PMC 4049031. PMID 19621349 ...
Ellis NA, Goodfellow PJ, Pym B, et al. (1989). „The pseudoautosomal boundary in man is defined by an Alu repeat sequence ...
See esineb kahe või enama koopiana haploidses genoomis, järjestus on samane vähemalt 90% ulatuses.[8] Alu elemendid on ... epigenoomis või keskkonnas leidub kompensatoorne element.[8] Patoloogilise tagajärjega CNV-d on suurema tõenäosusega suured ( ... Tihti on CNV-d seotud identsete järjestusosadega - segmentaalsed duplikatsioonid, madala sagedusega kordused, Alu või LINE ...
In central parts of India, the yam (khamalu, suran, or chupri alu) is prepared by being finely sliced, seasoned with spices, ... Yam is an important dietary element for Nigerian and West African people. It contributes more than 200 calories per person per ... "Element Stewardship Abstract for Dioscorea bulbifera, Air potato". Nature Conservancy.. *^ a b Linus Opara (2003). "YAMS: Post ...
He is said to be of the air element opposed to Cthulhu's water element. ... The Wolf-Thing, The Stalker in the Snows, He Who Hunts, Na-girt-a-lu A ferocious and towering wolf-like humanoid with bat wings ...
Alu elements in primates form a fossil record that is relatively easy to decipher because Alu element insertion events have a ... The Alu family is a family of repetitive elements in primate genomes, including the human genome. Modern Alu elements are about ... Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. Alu elements do not ... Alu) restriction endonuclease. Alu elements are the most abundant transposable elements, containing over one million copies ...
Buy Elements 10kmah ALU Powerbank - Silver today at IWOOT. We have great prices on gifts, homeware and gadgets with FREE ... Lightweight classic design to keep you and your friends charged at the most crucial momentsThe Roam Elements Powerbank is the ...
Transposable elements colonize genomes and with time may end up being incorporated into functional regions. SINE Alu elements, ... among these Alu-derived exons. Overall, our results confirm that SINE Alu elements have contributed to the expansion of the ... Few SINEs of life: Alu elements have little evidence for biological relevance despite elevated translation. Author(s). Martinez ... All but one of the Alu elements for which we detected peptides were frame-preserving and there was proportionally seven times ...
"Alu Elements" by people in this website by year, and whether "Alu Elements" was a major or minor topic of these publications. ... "Alu Elements" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject ... The domain structure and distribution of Alu elements in long noncoding RNAs and mRNAs. RNA. 2016 Feb; 22(2):254-64. ... The Alu sequence family (named for the restriction endonuclease cleavage enzyme Alu I) is the most highly repeated interspersed ...
Generation of stable Alu/Alu recombination cell lines. To develop stable Alu/Alu recombination cell lines, all Alu/Alu ... unlike with the MLL Alu elements, we did not observe any Alu/Alu recombination events between the Alu elements in Sz15%-Ya5- ... between the Alu elements in the Alu/Alu recombination reporter cassette.. The effect of Alu element sequence divergence on DNA ... Two genomic Alu elements (Alu Sz and Sx) that have been shown to cause disease through Alu/Alu recombination within the MLL ...
Here, I describe the evolution of Alu elements in lncRNA and mRNA. Alu elements are the most abundant transposable element in ... Repetitive elements are a major component of lncRNA and their molecular functions in lncRNA are poorly understood. ...
An analysis of 103906 Alu elements across 6 human chromosomes was carried out, using the presence of orthologous Alu elements ... Alu elements are found in low GC regions and old Alus in high GC regions. The correlation between high GC regions and high ... The link between Alu subfamily age and GC region was made due to an over-simplification of the data and is incorrect. We ... These observations have been made by relying on the subfamily as a proxy for age of an element. In this study, we suggest that ...
Model for dual relationship between Alu elements and miRNAs in the C19MC cluster.During the phase of rapid extension of Alu ... which in turn can target sense Alu sequences and thus alter the fate of free Alu elements. This is of great interest as Alu is ... which in turn can target sense Alu sequences and thus alter the fate of free Alu elements. This is of great interest as Alu is ... it can be proposed that Alu expansion and growth of this cluster has occurred in parallel. Because many of the Alu elements ...
"Alu Elements" by people in this website by year, and whether "Alu Elements" was a major or minor topic of these publications. ... Insertion of an Alu Element in Thyroglobulin Gene as a Novel Cause of Congenital Hypothyroidism. Thyroid. 2020 05; 30(5):780- ... "Alu Elements" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject ... The Alu sequence family (named for the restriction endonuclease cleavage enzyme Alu I) is the most highly repeated interspersed ...
Inverted Alu elements and site-selective editing in ZFP14. (a) Top: UCSC genome browser view. Inverted Alu elements are ... Inverted Alu elements are annotated with their family and strandedness in the repetitive elements by RepeatMasker track, and ... We propose a model whereby primate-specific editing is induced by adjacent Alu elements that function as recruitment elements ... Our results indicate that inverted Alu repeat elements can act as editing inducers. These elements are often located hundreds ...
22). The Alu elements shown in Fig. 1 are represented by Hs sahAluY, Pt sahAluSq, Gg sahAluSq, and Mm sahAluSq. msAluY ... sahAluSq,. sialic acid hydroxylase AluSq;. sahAluY,. sialic acid hydroxylase AluY;. msAluY,. most similar AluY;. E-A region,. ... This finding supports the notion that Alu-related events, such as Alu insertion, Alu-Alu recombination, Alu conversion, and Alu ... there are six other Alu elements in addition to sahAluY(data not shown): one AluJb, two AluSxs, two AluSqs, and one free left ...
Polymorphic ancient Alu elements:. In addition to Alu Y elements, we also identified four polymorphic copies of older Alu S ... only the Alu Y elements were thought to be polymorphic in humans, whereas the older Alu S, Alu J, and Alu monomers were thought ... Alu Y elements, in contrast, are the youngest Alu elements in the genome and these elements remain actively mobile today (B ... As outlined above, Alu Ya5 and Alu Yb8 insertions were the most abundant Alu elements in our data sets. Carroll et al. (2001) ...
"The Alu family is a family of repetitive elements in the human genome. Modern Alu elements are about 300 base pairs long and ... "Alu elements in primates form a fossil record that is relatively easy to decipher because Alu elements insertion events have a ... Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. Alu elements do not ... The study of Alu elements thus reveals details of ancestry because individuals will only share a particular Alu element ...
Insertion of Alu elements at a PTEN hotspot in Cowden syndrome *Louise Crivelli ... Rights & permissionsfor article Insertion of ,i,Alu,/i, elements at a ,i,PTEN,/i, hotspot in Cowden syndrome . Opens in a new ...
Detection of a Human Alu Element by PCR (adapted from Dolan DNA Learning Center, Cold Spring Harbor Laboratory, NY and Science ... Alu elements are classified as SINEs, or Short INterspersed Elements. All Alu elements are approximately 300-bp in length and ... Human chromosomes contain about 1,000,000 Alu copies, which equal 10% of the total genome. An estimated different Alu elements ... containing the 300-bp Alu element) will not migrate as far from the well as the smaller TPA product (missing the 300-bp Alu ...
Because the GCNT2 locus is rich in Short INterspersed Elements (SINE repeats) and thus likely prone to genomic rearrangements, ... An Alu repeat-mediated genomic GCNT2 deletion underlies congenital cataracts and adult i blood group Hum Genet. 2012 Feb;131(2 ... The deletion is flanked by Alu repeats of the AluS family on both sides and microsatellite genotyping suggested that its ... occurrence in the two families was the product of recurrent Alu-Alu repeat-mediated nonhomologous recombinations or an old ...
Alu retrotransposons are primate-specific short interspersed elements. Using the... ... We report results of the first systematic study of conformational polymorphism of G-rich DNA fragments of Alu-repeats. ... Alu-Y). A recombinant DNA sequence bearing the Alu element of the human bcl2 gene (304 bp) and its PQS-mutant (Alu-PQS) were ... Alu retrotransposons are primate-specific short interspersed elements. Using the Alu sequence of the prooncogen bcl2 intron and ...
... transposed elements influence on the transcriptome of seven vertebrates and invertebrates ... A typical Alu element contains ...". Abstract - Cited by 13 (4 self) - Add to MetaCart Exonization of Alu elements creates ... Alu elements. Two initial data sets of exonizing and nonexonizing intronic Alu elements (exonic and intronic data sets) in the ... Background: Alu elements are the most abundant retrotransposable elements comprising ~11 % of the human genome. Many studies ...
Alu-mediated deletion of SOX10 regulatory elements in Waardenburg syndrome type 4 *Nadége Bondurand ... Rights & permissionsfor article ,i,Alu,/i,-mediated deletion of ,i,SOX10,/i, regulatory elements in Waardenburg syndrome type 4 ...
They include the evolutionarily youngest element groups Ta-L1, AluYa5, and AluYb8, many inserts of which are polymorphous in ... Despite the data on the ability of L1 and Alu eleme … ... LINE1 and Alu retroelements occupy approximately 17 and 13% of ... Despite the data on the ability of L1 and Alu elements to cause various modifications of the genome, the effects of these ... heterozygous with respect to intronic inserts of L1 and Alu elements. We showed for the first time a tissue-specific decrease ...
We analyzed Alu elements retrieved from the GenBank database and identified two new Alu subfamilies, Alu Yb9 and Alu Yc2, and ... GenBank database searches for Alu Y elements that perfectly match the consensus sequence brought several Alu Y elements to our ... like the Alu element that generated the majority (,90%) of the Alu elements currently present in the genome today. For those ... We were able to analyze 28 out of the 56 Yb9 elements, 97 out of 176 Yc1 elements, and 8 out of 17 Yc2 Alu elements, using this ...
A SINE in the genome of the cephalochordate amphioxus is an Alu element. International Journal of Biological Sciences. 2.(2):61 ... A SINE in the genome of the cephalochordate amphioxus is an Alu element. ... Conserved noncoding elements in the most distant genera of cephalochordates: The Goldilocks principle ...
Alu Elements Prescott Deininger. Pages 21-34 * The Impact of LINE-1 Retro transposition on the Human Genome ...
TFIIIC Binding to Alu Elements Controls Gene Expression via Chromatin Looping and Histone Acetylation. ... TFIIIC Binding to Alu Elements Controls Gene Expression via Chromatin Looping and Histone Acetylation. Authors:. *Ferrari R., ... TFIIIC Binding to Alu Elements Controls Gene Expression via Chromatin Looping and Histone Acetylation ... Here, we report regulatory mechanisms unveiling a central role of Alu elements (AEs) and RNA polymerase III transcription ...
... newly positioned telomere acquired by recombination between this 16p Alu element and a closely related subtelomeric Alu element ... remote regulatory element controlling alpha-globin expression. The chromosomal breakpoint lies in an Alu family repeat located ... newly positioned telomere acquired by recombination between this 16p Alu element and a closely related subtelomeric Alu element ... Chromosomal stabilisation by a subtelomeric rearrangement involving two closely related Alu elements. ...
Passive Conservation of Noncoding Elements in 200 KB of Orthologous Human, Mouse and Dog DNA. Edward M Rubin, Chris Meyers, ... Detecting Alu insertions from high-throughput sequencing data. Matei David, Harun Mustafa, Michael Brudno ... Assembly and characterization of novel Alu inserts detected from next-generation sequencing data. Harun Mustafa, Matei David, ... Computational analysis of candidate intron regulatory elements for tissue-specific alternative pre-mRNA splicing. Michael ...
... promoter of Alu elements is not sufficient to drive transcription and very few Alu elements of the genome are able to ... The total number of copies of B1 B2 B4 and ID elements in mouse (1.4 millions) surpasses that of human Alu elements [7]. Both ... Nevertheless rodent genomes possess other SINEs named B1 elements which are Alu-like elements with a monomeric structure and a ... Apart from these Pol III-transcribed free Alu RNAs Alu elements integrated inside genes. ...
In the present article, I discuss how intronic mutations acting at Alu elements enable formation of new exons. I review the ... the mechanism that represses such a major inclusion of Alu exons and instead enables a gradual evolution of Alu elements into ... the mechanism that represses such a major inclusion of Alu exons and instead enables a gradual evolution of Alu elements into ... The advance of high-throughput sequencing enabled rapid progress in mapping the functional elements in our genome. ...
Author Summary Sequences derived from transposable elements (TEs) are major constituents of mammalian genomes and are found ... Alu elements Is the Subject Area "Alu elements" applicable to this article? Yes. No. ... Transposable elements Is the Subject Area "Transposable elements" applicable to this article? Yes. No. ...
... flanking region is dominated by a dense cluster of Alu repeats consisting of 8 complete and 3 partial Alu elements. A partial ... Englander, E. and Howard, B.H. (1995) Nucleosome positioning by human Alu elements in chromatin. J. Biol. Chem. 270, 10091- ... Certainly, the most striking and unique feature of the first 5 kb of 5-flanking region is the dense cluster of Alu elements ... As with the more classical elements discussed above, it will be interesting to determine if any of the elements embedded in the ...
  • The discovery of Alu subfamilies led to the hypothesis of master/source genes, and provided the definitive link between transposable elements (active elements) and interspersed repetitive DNA (mutated copies of active elements). (wikipedia.org)
  • Evidence for co-evolution between human microRNAs and Alu-repeats. (nih.gov)
  • This paper connects Alu repeats, the most abundant repetitive elements in the human genome and microRNAs, small RNAs that alter gene expression at the post-transcriptional level. (nih.gov)
  • Base-pair complementarity could be demonstrated between the seed sequence of a subset of human microRNAs and Alu repeats that are integrated parallel (sense) in mRNAs. (nih.gov)
  • This model includes on one hand the fact that 3p-miRNAs of C19MC are enriched in number and production quantity and on the other hand that gene duplication events leading to growth of the cluster was facilitated by minus strand Alu repeats. (nih.gov)
  • Because a similar cluster is found in other primates [16], [24], which share Alu repeats with humans, it can be proposed that Alu expansion and growth of this cluster has occurred in parallel. (nih.gov)
  • Alu repeats as transcriptional regulatory platforms in macrophage responses to M. tuberculosis infection. (uchicago.edu)
  • RNA editing by adenosine to inosine deamination is a widespread phenomenon, particularly frequent in the human transcriptome, largely due to the presence of inverted Alu repeats and their ability to form double-stranded structures - a requisite for ADAR editing. (biomedcentral.com)
  • While several hundred thousand editing sites have been identified within these primate-specific repeats, the function of Alu-editing has yet to be elucidated. (biomedcentral.com)
  • We show that inverted Alu repeats, expressed in the primate brain, can induce site-selective editing in cis on sites located several hundred nucleotides from the Alu elements. (biomedcentral.com)
  • Adjacent inverted Alu repeats can pair and form long stable stem-loop structures, which are favorable editing substrates, and are also potentially highly abundant in humans (there are 228,607 inverted Alu pairs within 1 kb in genes from the NCBI Reference Sequence (RefSeq) database). (biomedcentral.com)
  • GC-rich genomic sequences [include those] such as Alu repeats. (wikiversity.org)
  • the decay of methylated CpG dinucleotides into TpG dinucleotides would also tend to increase the pair-wise divergence between Alu repeats over time, thereby decreasing the recombination between elements. (wikiversity.org)
  • The deletion is flanked by Alu repeats of the AluS family on both sides and microsatellite genotyping suggested that its occurrence in the two families was the product of recurrent Alu-Alu repeat-mediated nonhomologous recombinations or an old founder effect. (nih.gov)
  • Because the GCNT2 locus is rich in Short INterspersed Elements (SINE repeats) and thus likely prone to genomic rearrangements, microdeletions or microduplications at this locus might cause a larger than currently anticipated fraction of apparently isolated autosomal-recessive cataracts. (nih.gov)
  • Conformational polymorphysm of G-rich fragments of DNA Alu-repeats. (springer.com)
  • We report results of the first systematic study of conformational polymorphism of G-rich DNA fragments of Alu-repeats. (springer.com)
  • We suggest that the dynamic study of the spatial organization of Alu repeats may provide insight into the mechanisms of genomic rearrangements responsible for the development of many oncological and neurodegenerative diseases. (springer.com)
  • We find that the human MYB locus is flanked by 257-bp Alu repeats and that the duplication is mediated somatically by homologous recombination between the flanking Alu elements on sister chromatids. (umassmed.edu)
  • The immediate 5'-flanking region is dominated by a dense cluster of Alu repeats in which are embedded several promoter consensus sequences. (molvis.org)
  • We report , for the first time , that mRNAs containing Alu repeats at 3' UTR has a significantly high correlation with processed pseudogenes , suggesting a possibility that Alu containing mRNAs have a high tendency to become processed pseudogenes . (bvsalud.org)
  • Therefore, we propose Alu repeats as a new and important factor in the generation of pseudogenes . (bvsalud.org)
  • The analysis of SINEs - Short INterspersed Elements - LINEs - Long INterspersed Elements - or truncated LTRs - Long Terminal Repeats - as molecular cladistic markers represents a particularly interesting complement to DNA sequence and morphological data. (wikipedia.org)
  • Transposable elements (TEs) along with simple sequence repeats (SSRs) are prevalent in eukaryotic genome, especially in mammals. (frontiersin.org)
  • The SVA element consists of a region derived from a SINE‐R element and an Alu ‐like region separated by a variable number of tandem repeats ( VNTR ). (els.net)
  • The HERV element consists of three genes ( gag , pol and env ) surrounded by long terminal repeats ( LTR ). (els.net)
  • While their role is not fully understood, they are believed to control gene expression at a post-transcriptional level by means of the nuclear retention of mRNA containing in their 3'-UTR inverted repeats of Alu sequences (IRAlu). (elifesciences.org)
  • Alu elements are the most abundant transposable elements, containing over one million copies dispersed throughout the human genome. (wikipedia.org)
  • Alu elements are highly conserved within primate genomes and originated in the genome of an ancestor of Supraprimates. (wikipedia.org)
  • The Alu family is a family of repetitive elements in primate genomes, including the human genome. (wikipedia.org)
  • There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. (wikipedia.org)
  • Finally, the AluY elements are the youngest of the three and have the greatest disposition to move along the human genome. (wikipedia.org)
  • SINE Alu elements, which appeared in the primate lineage, are ubiquitous in the human genome and more than a thousand overlap annotated coding exons. (mit.edu)
  • Substrates for these homologous and homeologous events include Alu elements, which are approximately 300 bp elements that comprise ~11% of the human genome. (prolekare.cz)
  • However, with more diverged Alu elements, like those typically found in the human genome, repair of DSBs appears to use the Alu/Alu homeology to direct non-homologous end joining in the general vicinity of the Alu elements. (prolekare.cz)
  • One way in which chromosomal rearrangements occur in DSB repair is the use of non-allelic recombination between repetitive elements (reviewed in [ 2 ]), which comprise a large portion of the human genome [ 3 ]. (prolekare.cz)
  • Alu elements have amplified over the past 65 million years and occupy about 11% of the human genome, with well over one million copies [ 3 ]. (prolekare.cz)
  • Despite this level of sequence divergence, Alu elements represent a major source of sequence homology in the human genome and contribute to genomic instability that arises from mutagenic recombination between these elements [ 4 , 5 ]. (prolekare.cz)
  • Alu elements are the most abundant transposable element in the human genome (more than 1 million copies) and their composition and evolution within lncRNA and mRNA differ significantly. (labroots.com)
  • Transposable elements are found abundantly in non-coding DNA and the Alu family of SINE transposons accounts for approximately 10% of the total DNA in the human genome ( Cordaux & Batzer, 2009 ). (peerj.com)
  • However, most Alu sequences in the genome are members of abundant, formerly active, subfamilies that are now transpositionally inert. (peerj.com)
  • As the number of duplicated miRNA genes in the cluster grew, growth rates of Alu declined, preventing catastrophic destruction of germline genome information by Alu. (nih.gov)
  • The repetitive retrotransposable Alu elements, each spanning approximately 300 nucleotides, are abundantly interspersed throughout the primate genome and are present in approximately 75% of all human genes, mostly within introns and untranslated regions (UTRs). (biomedcentral.com)
  • We have found that, although a region containing a 92-bp exon and an Alu Sq element in the hydroxylase gene is intact in all nonhuman primates examined, the same region in the human genome is replaced by an Alu Y element that was disseminated at least one million years ago. (pnas.org)
  • Transposons and transposon-like repetitive elements collectively occupy 44% of the human genome sequence. (genetics.org)
  • The oldest L1 elements in the genome have accumulated deleterious mutations that render them inactive. (genetics.org)
  • In fact, Alu elements are the most abundant transposable elements in the human genome. (wikiversity.org)
  • Alu elements in primates form a fossil record that is relatively easy to decipher because Alu elements insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. (wikiversity.org)
  • Human chromosomes contain about 1,000,000 Alu copies, which equal 10% of the total genome. (docplayer.net)
  • An estimated different Alu elements are found scattered across the human genome. (docplayer.net)
  • Using the Alu sequence of the prooncogen bcl2 intron and the consensus AluS x sequence as representative examples, we have determined characteristic Alu sites that are capable of adopting G-quadruplex (GQ) conformations (i.e., potential quadruplex sites-PQSAlu), and demonstrated by bioinformatics methods that these sites are Alu-specific in the human genome. (springer.com)
  • LINE1 and Alu retroelements occupy approximately 17 and 13% of the human genome, respectively. (nih.gov)
  • Despite the data on the ability of L1 and Alu elements to cause various modifications of the genome, the effects of these retroelements on gene expression have yet not been studied. (nih.gov)
  • Genomic database mining has been a very useful aid in the identification and retrieval of recently integrated Alu elements from the human genome. (genetics.org)
  • Some members of each of the three subfamilies have inserted in the human genome so recently that about a one-third of the analyzed elements are polymorphic for the presence/absence of the Alu repeat in diverse human populations. (genetics.org)
  • Three previously classified Alu Y elements linked with disease belong to the Yc1 subfamily, supporting the retroposition potential of this subfamily and demonstrating that the Alu Y subfamily currently has a very low amplification rate in the human genome. (genetics.org)
  • ALU elements have been accumulating in the human genome throughout primate evolution, reaching a copy number of over a million per genome. (genetics.org)
  • The vast majority of the Alu elements present in the human genome inserted before the radiation of extant humans and are therefore observed in all individuals in the human population. (genetics.org)
  • Several of these new subfamilies appear to originate from an Alu element that fortuitously inserted into a favorable region of the genome capable of supporting Alu retroposition. (genetics.org)
  • How repetitive elements, epigenetic modifications, and architectural proteins interact ensuring proper genome expression remains poorly understood. (humantechnopole.it)
  • Here, we report regulatory mechanisms unveiling a central role of Alu elements (AEs) and RNA polymerase III transcription factor C (TFIIIC) in structurally and functionally modulating the genome via chromatin looping and histone acetylation. (humantechnopole.it)
  • Since the discovery of the high abundance of Alu elements in the human genome the interest for the functional significance of these retrotransposons has been increasing. (thetechnoant.info)
  • Alu methylation is correlated with the overall level of DNA methylation and recombination activity of the genome. (beds.ac.uk)
  • This information is useful for understanding natural status of Alu in the genome and helpful for developing an optimal assay to quantify Alu hypomethylation. (beds.ac.uk)
  • Most Alu CpG sites are deaminated in the genome. (beds.ac.uk)
  • A transposable element ( TE, transposon , or jumping gene ) is a DNA sequence that can change its position within a genome , sometimes creating or reversing mutations and altering the cell's genetic identity and genome size . (wikipedia.org)
  • Transposable elements make up a large fraction of the genome and are responsible for much of the mass of DNA in a eukaryotic cell . (wikipedia.org)
  • Although TEs are selfish genetic elements , many are important in genome function and evolution. (wikipedia.org)
  • The active transposable elements (TEs) composed primarily of three mobile element lineages LINE-1, Alu, and SVA comprise approximately 30% of the mass of the human genome. (nih.gov)
  • Class I elements, also known as retroelements, mobilize using an RNA intermediate that gets reverse transcribed to generate a new copy in the genome. (nih.gov)
  • Surveying TE elements genome-wide and in larger populations is providing novel insights into their functional impact and evolutionary dynamics. (biomedcentral.com)
  • We used formaldehyde assisted isolation of regulatory elements (FAIRE) to map genome-wide chromatin conformations. (wiley.com)
  • Han K., Lee J., Meyer T., Wang J. , Sen S.K., Sirkanta D., Liang P. and Batzer M.A. (2007) Alu recombination-mediated structural deletions in the chimpanzee genome. (buffalo.edu)
  • Alu elements infiltrated the ancestral primate genome about 65 million years ago. (phys.org)
  • Contrary to the observed results in the genomes of cattle, sheep, horse, and pig, no endogenous retrovirus-K (ERVK) elements were found in the camel genome. (frontiersin.org)
  • Elements like RTE-BovB belonging to LINEs family in cattle and sheep genomes are dramatically higher than genome of dromedary. (frontiersin.org)
  • However, LINE1 (L1) and LINE2 (L2) elements cover higher percentage of LINE family in dromedary genome compared to genome of cattle. (frontiersin.org)
  • Retrotransposed elements account for ~45% of the human genome ( Deininger and Batzer, 2002 ). (elifesciences.org)
  • In biology , a mutation is the permanent alteration of the nucleotide sequence of the genome of an organism , virus , or extrachromosomal DNA or other genetic elements. (wikipedia.org)
  • [22] For example, more than a million copies of the Alu sequence are present in the human genome , and these sequences have now been recruited to perform functions such as regulating gene expression . (wikipedia.org)
  • Bisulfite-PCR pyrosequencing was used to quantitate DNA methylation in long interspersed nuclear element-1 ( LINE-1 ) and Alu I repetitive elements as a surrogate of genome-wide methylation and examine gene-specific methylation of MAGE-1 and p15 . (aacrjournals.org)
  • The investigation was designed to evaluate ( a ) DNA methylation changes in Alu I and long interspersed nuclear element-1 ( LINE-1 ) repetitive elements as a surrogate of genome-wide methylation, ( b ) promoter methylation of p15 and MAGE-1 , and ( c ) changes in allele-specific methylation of H19 to detect LOI. (aacrjournals.org)
  • Mobile elements within genomes have driven genome evolution in diverse ways. (sciencemag.org)
  • Now mobile elements are becoming useful tools for learning more about genome evolution and gene function. (sciencemag.org)
  • If, as many believe, the origins of life are in an "RNA world" followed by reverse transcription into DNA, then mobile elements could have been very early participants in genome formation ( 4 ). (sciencemag.org)
  • But how have genes benefited from the genome shaping of mobile elements? (sciencemag.org)
  • Mobile elements are DNA sequences that have the ability to integrate into the genome at a new site within their cell of origin ( 5 ). (sciencemag.org)
  • With over one million copies, Alu elements are the most abundant repetitive elements in the human genome. (iu.edu)
  • In the human genome, the major SINE family is made of so-called "Alu elements. (eurekalert.org)
  • There are more than 1 million copies of Alu, comprising more than 10 percent of human DNA, scattered throughout the genome, and some of them are likely still able to jump to new locations. (eurekalert.org)
  • In this example, the downstream sequence contains a gene which intron is being spliced out (dashed lines) before transcript integration into the genome by retrotransposition, resulting in the duplication of the L1 element and an intronless version of the original gene. (els.net)
  • Here we investigate the large-scale features of Alu and LINE1 spatial arrangement in the human genome by studying the size distribution of interrepeat distances. (mendeley.com)
  • The newly identified mechanism involves Alu elements, repetitive DNA elements that spread throughout the genome as primates evolved. (eurekalert.org)
  • Alu elements" comprise about one tenth of the human genome, which roughly equals three hundred million DNA base pairs. (icr.org)
  • When the distribution of Alu sequences in one organism's genome closely matches the distribution in another, evolutionists have assumed that the two organisms recently shared a common ancestor. (icr.org)
  • This observation indicates that most of the Alu sequences in our genome underwent duplication and transposition [i.e., they were copied and distributed] before the divergence of the human and chimpanzee lineages. (icr.org)
  • Since the presence and positioning of Alu elements are vital for proper protein production, then they must have been an integrated part of each creature's genome from the beginning, although some of them may certainly have been copied and moved since. (icr.org)
  • When it was discovered that more than half of the human genome consists of (remnants of) mobile elements, McClintock's ideas were revived and further developed by Roy Britten and Eric Davidson. (creation.com)
  • Recombination between Alu elements can occur through completely identical (homologous) Alu sequences, but most events involve Alu elements with approximately 20% mismatch relative to one another (homeologous), which reflects the average sequence divergence of proximal elements. (prolekare.cz)
  • These properties, of some Alu sequences, are unlikely to be neutral in their selective effects. (peerj.com)
  • In this model, homology sites of Alu sequences helped duplicating a gene cassette encoding miRNAs, which in turn can target sense Alu sequences and thus alter the fate of free Alu elements. (nih.gov)
  • Third, we used a simple algorithm to identify specific sequences that determine splice site selection within specific Alu exons. (psu.edu)
  • Finally, by inserting identical exons within different sequences, we demonstrated the importance of flanking genomic sequences in determining whether an Alu exon will undergo exonization. (psu.edu)
  • This query yielded 744 exonized Alu sequences that overlap with EST sequences. (psu.edu)
  • Since a typical Alu is 300 nt in length, we next filtered out all Alus shorter than 250 nt, leaving 459 sequences. (psu.edu)
  • Even though it represents 6 13% of human genomic DNA , Alu sequences are rarely found in coding regions. (bvsalud.org)
  • From the results of 427 Alu bisulfite clone sequences, we found that only 27.2% of CpG sites within Alu elements were preserved (4.6 of 17 analyzed CpGs, A ~ Q) and that 86.6% of remaining-CpGs were methylated. (beds.ac.uk)
  • As a result, Horie and Honda christened their newfound sequences as EBLNs (or "endogenous Borna-like N" elements). (scienceblogs.com)
  • There are several types of non-autonomous elements (Short Interspersed Elements: SINEs, SVAs and processed pseudogenes) that vary regarding their sequences composition and length. (nih.gov)
  • In these introns there are large numbers of transposable elements and repeated sequences which promote recombination of nonhomologous genes. (wikipedia.org)
  • Our data indicate that Alu elements have contributed to the acquisition of novel protein sequences during primate and human evolution. (biomedcentral.com)
  • The InDeL targeted in this study is characterized by a 288 bp Alu element insertion (I). We used DHPLC at nondenaturating conditions to analyze the PCR product with a flow through the chromatographic column under two different gradients based on the differences between D and I sequences. (hindawi.com)
  • Many of these noncoding RNAs are copied from repeated DNA sequences called short interspersed nuclear elements (SINEs). (eurekalert.org)
  • Likewise, if the distribution of Alu sequences is quite different, this meant that the organisms shared an ancestor in a more distant evolutionary past. (icr.org)
  • However, the fact that those human and chimp Alu sequences are in similar places on corresponding chromosomes could just as well indicate that at least some of them were intentionally placed there for a purpose. (icr.org)
  • Since the Alu sequences serve a specific and necessary function in the cell, then "this observation" clearly indicates purposeful design, not evolutionary history. (icr.org)
  • Thus, Alu sequences can no longer be considered indicators of "evolutionary relatedness. (icr.org)
  • Many of those sequences were located in gene deserts, which are in fact so clogged with regulatory DNA elements that they have recently been renamed regulatory jungles . (creation.com)
  • The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates, including the evolution of humans. (wikipedia.org)
  • Most human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans. (wikiversity.org)
  • Both primates and rodents have also MIR (mammalian-wide interspersed repeat) elements which are ancient tRNA-derived SINEs. (thetechnoant.info)
  • These Alu exon peptides represent species-specific protein differences between primates and other mammals, and in certain instances between humans and closely related primates. (biomedcentral.com)
  • We have also found that B SINES in mouse, which evolved independently of Alu elements in primates, also populate mRNA 3'UTRs and lncRNAs and can likewise base-pair to form SBSs and trigger SMD (Wang et al. (rochester.edu)
  • This evolutionary tree shows the split between primate and rodent lineages about 90 million years ago, before the emergence of Alu elements in primates and B/ID elements in rodents. (eurekalert.org)
  • Most of this editing is in Alu element transcripts, which are unique to primates. (semanticscholar.org)
  • But Longo found something different - short pieces of DNA called Alu elements that are unique to humans and other primates. (discovermagazine.com)
  • These elements are mostly found in introns and upstream regulatory elements of genes. (wikipedia.org)
  • Alu elements are responsible for regulation of tissue-specific genes. (wikipedia.org)
  • Although almost all Alu-derived coding exons appear to be in alternative transcripts, they have been incorporated into the main coding transcript in at least 11 genes. (mit.edu)
  • Transposition of this element into coding and regulatory regions of genes is responsible for many heritable diseases. (umassmed.edu)
  • The individual miRNA genes within this cluster are flanked by an Alu-LINE signature, which has been duplicated with the clustered miRNA genes. (nih.gov)
  • Alu elements were used as a marker for chromosomes and chromosome bands rich in genes. (wikiversity.org)
  • Using the RT PCR method, we analyzed the pre-mRNA (heterogeneous nuclear RNA) content of allele pairs of four genes in five human cell lines, heterozygous with respect to intronic inserts of L1 and Alu elements. (nih.gov)
  • This research was extended to mouse and rat genomes and the results accordingly reveal overrepresentation of 3'UTR-embedded B1 (Alu-like) elements in PP mother or WAY-100635 father genes. (thetechnoant.info)
  • Completely our outcomes suggest a book part for Alu or Alu-like components inside 3'UTRs as facilitators from the genesis of PPs especially in lowly indicated genes. (thetechnoant.info)
  • Transposed genes at 3' UTR without Alu repeat have about two processed pseudogenes per gene on average while we found with statistical significance that a transposed gene with Alu had over three processed Pseudogenes on average. (bvsalud.org)
  • While the total number of cellular genes has remained relatively conserved in the course of mammalian evolution, the genomic mass occupied by transposable elements populating mammalian genomes has grown up to as much as 52% (58,65,79,94,119,126). (bioscience.org)
  • Virtually, all human genes contain an Alu element in at least one intron. (elifesciences.org)
  • The most highly conserved noncoding elements (HCNEs) in mammalian genomes cluster within regions enriched for genes encoding developmentally important transcription factors (TFs). (psu.edu)
  • Indeed, mobile elements and genes appear to have forged a mutually beneficial relationship. (sciencemag.org)
  • It is clear how mobile elements benefit from genes, because without genes they cannot survive from one generation to the next. (sciencemag.org)
  • Here, I concentrate on how mobile elements have affected the evolution of genes and their function, particularly of humans and other mammals. (sciencemag.org)
  • These elements have terminal LTRs and slightly overlapping ORFs for their group-specific antigen ( gag ), protease ( prt ), polymerase ( pol ), and envelope ( env ) genes. (sciencemag.org)
  • Most of the short DNA elements cluster near genes that play a decisive role during an organism's first weeks after conception. (creation.com)
  • Alu elements are classified as SINEs, or Short INterspersed Elements. (docplayer.net)
  • Alu retrotransposons are primate-specific short interspersed elements. (springer.com)
  • Over the past 15 years, our discovery and subsequent work on the mechanism of Staufen (Stau)-mediated mRNA decay (SMD) has uncovered new roles for cytoplasmic long non-coding RNAs (lncRNAs) and retrotransposon-derived short interspersed elements (SINEs) in post-transcriptional gene regulation. (rochester.edu)
  • Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. (wikipedia.org)
  • Kim EZ, Wespiser AR, Caffrey DR. The domain structure and distribution of Alu elements in long noncoding RNAs and mRNAs. (umassmed.edu)
  • DICER1 knockdown induces accumulation of Alu RNA in human RPE cells and Alu-like B1 and B2 RNAs in mouse RPE. (nih.gov)
  • Antisense oligonucleotides targeting Alu/B1/B2 RNAs prevent DICER1 depletion-induced RPE degeneration despite global miRNA downregulation. (nih.gov)
  • In contrast, nuclear retention is promoted by specialized cis -elements found in certain RNAs. (frontiersin.org)
  • reteroelements move by retrotransposition high copy number possible as several RNAs can be transcribed froma s ingle class 1 element. (brainscape.com)
  • 2007, EMBO J, 26:2670-2681) but also by intermolecular base-pairing either between the Alu element of an mRNA 3'UTR and a partially complementary Alu element in one or more Alu element-containing long noncoding (lnc)RNAs (Gong and Maquat, 2011, Nature, 470:284-288) or between the 3'UTR Alu elements of two different mRNAs (Gong et al. (rochester.edu)
  • Maquat discovered that Alu elements team up with molecules called long noncoding RNAs (lncRNAs) to regulate protein production. (eurekalert.org)
  • Previously, no one knew what Alu elements and long noncoding RNAs did, whether they were junk or if they had any purpose. (eurekalert.org)
  • Maquat and the study's first author, Chenguang Gong, a graduate student in the Department of Biochemistry and Biophysics at the Medical Center, found that long noncoding RNAs and Alu elements work together to trigger a process known as SMD (Staufen 1-mediated mRNA decay). (eurekalert.org)
  • Specifically, long noncoding RNAs and Alu elements recruit the protein Staufen-1 to bind to numerous mRNAs. (eurekalert.org)
  • In Nucleic Acids Research this week: pipeline for genotyping Alu retrotransposon mobile element insertions, previously undocumented non-coding RNAs, and more. (genomeweb.com)
  • Transposable elements colonize genomes and with time may end up being incorporated into functional regions. (mit.edu)
  • Mutagenic NHEJ repair involving divergent Alu elements may represent a common repair event in primate genomes. (prolekare.cz)
  • [7] Alu elements of different kinds occur in large numbers in primate genomes. (wikiversity.org)
  • Nevertheless rodent genomes possess other SINEs named B1 elements which are Alu-like elements with a monomeric structure and a length of approximately 140 bp [3]. (thetechnoant.info)
  • Interestingly old free Alu monomers which predate the first dimeric element are still present in primate genomes [4 5 Phylogenetic studies indicate that the monomers of Alu and the B1 elements originated from the gene that encodes WAY-100635 the 7SL RNA the RNA component of the signal recognition particle (SRP) which is the ribonucleoprotein that targets secreted proteins to the endoplasmic reticulum [3-6]. (thetechnoant.info)
  • Rodent genomes have in addition B2 and ID elements which are tRNA-derived SINEs and B4 elements which resemble a fusion between B1 and ID elements. (thetechnoant.info)
  • Mammalian transposable elements have been restructuring their host genomes for millions of years, to both deleterious and advantageous effects. (bioscience.org)
  • 2010. Endogenous non-retroviral RNA virus elements in mammalian genomes. (scienceblogs.com)
  • Transposable elements (TEs) represent a variable but often sizeable fraction of genomes (e.g. (biomedcentral.com)
  • Alu elements are major contributors to lineage-specific new exons in primate and human genomes. (biomedcentral.com)
  • Mobile, or transposable, elements are prevalent in the genomes of all plants and animals. (sciencemag.org)
  • This study highlights the importance of noncoding RNA and transposable elements in the regulation of gene expression and in the evolution of gene expression networks in mammalian genomes," said coauthor Manuel Ares, professor of molecular, cell, and developmental biology at UC Santa Cruz. (eurekalert.org)
  • Evidence is accumulating that transposable elements, including retrotransposons (which account for about 90% of all transposable elements inserted in primate genomes), are potent mediators of new gene origination. (els.net)
  • Evolutionists have generally assumed that Alu elements arose through being copied and spliced throughout various animals' genomes. (icr.org)
  • More than 99% of the one million copies of the Alu family of retrotransposons that are present in both [human and chimpanzee] genomes are in corresponding positions. (icr.org)
  • DICER1 deficit induces Alu RNA toxicity in age-related macular degeneration ,' Nature 17 March 2011) now points to one likely cause of AMD, and in the process provides a chilling example of what can happen when the parasitic Alu elements in our genomes (see the previous post for an introduction) are left unrestrained. (blogspot.com)
  • There is, in fact, some scientific disagreement about functions of various elements in genomes, but it's not the crude standoff that ID apologists depict, and it has very little to do with 'Darwinism. (blogspot.com)
  • Alu insertions have been implicated in several inherited human diseases and in various forms of cancer. (wikipedia.org)
  • Polymorphisms for Alu insertions have been much studied as a tool in human population genetic inference, particularly because the absence of the element can always be identified as the ancestral state ( Batzer & Deininger, 2002 ). (peerj.com)
  • Expression vectors bearing wild-type and mutant Alu insertions in the promoter regions of the reporter gene have been prepared, and their regulatory effects have been compared during transfection of НЕК293 and HeLa cells. (springer.com)
  • Like other structural variants, transposable element insertions can be highly polymorphic across individuals. (biomedcentral.com)
  • We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. (biomedcentral.com)
  • Other LTR retrotransposons that are responsible for most mobile-element insertions in mice are the intracisternal A-particles (IAPs), early transposons (Etns), and mammalian LTR-retrotransposons (MaLRs). (sciencemag.org)
  • Particularly interesting is the finding that all identified lineage-specific SINE elements show a strong tendency to insert within or in very close proximity to the preexisting MIRs for their efficient integrations, suggesting that the MIR element is a hot spot for successive insertions of other SINEs. (deepdyve.com)
  • They are replicated as any other DNA sequence, but depend on LINE retrotransposons for generation of new elements. (wikipedia.org)
  • The Alu sequence family (named for the restriction endonuclease cleavage enzyme Alu I) is the most highly repeated interspersed repeat element in humans (over a million copies). (umassmed.edu)
  • Either single-strand annealing (SSA) repair or microhomology-mediated end joining occurs 'in register' between two Alu elements when Alu sequence divergence is low. (prolekare.cz)
  • These results indicate that this cis -acting structural element, downstream of the sequence required for A-to-I catalysis, increases the local concentration of the editing enzyme by attracting ADAR, thus enabling editing in the vicinity. (biomedcentral.com)
  • However, you will first amplify a nucleotide sequence from your own 8 th chromosome, to look for an insertion of a short DNA sequence, called Alu, within the tissue plasminogen activator (TPA) gene. (docplayer.net)
  • All Alu elements are approximately 300-bp in length and derive their name from a single recognition site for the endonuclease Alu I, located near the middle of the Alu sequence. (docplayer.net)
  • This yielded all Alu elements without and with an overlap of at least one expressed sequence tag (EST), in the case of the intronic and exonic data sets, respectively. (psu.edu)
  • An analysis of C. elegans transposable elements =-=[25,26]-=- revealed that a 205-bp ITR sequence within Turmoil-1 is highly similar to a region of two exons separated by an intron of the rsp-2 gene (see pairwise alignment using bl2seq [27] Figure 1B). (psu.edu)
  • These sites were found to be characteristic of young (active) Alu families (Alu-Y). A recombinant DNA sequence bearing the Alu element of the human bcl2 gene (304 bp) and its PQS-mutant (Alu-PQS) were constructed. (springer.com)
  • The 17 CpG sites are marked with the capital letters (A-Q) above the Alu consensus sequence (Ref. [ 15 ]) and highlighted in the colour pink. (beds.ac.uk)
  • The appreciation for TE modification of mammalian gene expression gained significant interest after the discoveries that the majority of transposable elements either carry cis -acting elements in their sequence that are recognized by the mammalian transcriptional or RNA processing machineries or have high propensity for accrual of these cis -signals via mutations long after the completion of the integration process. (bioscience.org)
  • This insertion sequence is an Alu element (three Alu-repeat). (hindawi.com)
  • Activation of the cryptic donor (d) and acceptor (a) splice sites of an Alu element (black arrow) inserted in opposite orientation relative to gene transcription in the first intron leads to integration of noncoding Alu sequence in the gene's transcript (dashed lines below gene) and conversion to coding sequence. (els.net)
  • Ectopic recombination (crossed thin lines) between two intronic Alu elements (dashed arrows) leads to the deletion of the intervening sequence containing the entire white exon (middle). (els.net)
  • The transcript therefore consists of the L1 RNA sequence, followed by the downstream sequence flanking the L1 element and a poly A tail (bottom). (els.net)
  • The differences include 'cytogenetic differences, differences in the type and number of repetitive genomic DNA and transposable elements, abundance and distribution of endogenous retroviruses, the presence and extent of allelic polymorphisms, specific gene inactivation events, gene sequence differences, gene duplications, single nucleotide polymorphisms, gene expression differences, and messenger RNA splicing variations. (answersingenesis.org)
  • A certain kind of repetitive DNA sequence called an Alu element was found to limit the number of protein copies made in the cell. (icr.org)
  • Furthermore, Alu/Alu recombination is estimated to cause as many as 0.5% of all new genetic diseases and is responsible for mutations that contribute to human cancers [ 4 - 6 ]. (prolekare.cz)
  • For the purposes of this study, we will refer to any DNA repair event that occurs through either homologous or homeologous recombination between two non-allelic Alu elements and generates a single chimeric, Alu element, as Alu/Alu recombination. (prolekare.cz)
  • One is loss of exon 34 in the tropoelastin gene, which was possibly facilitated by Alu -mediated recombination events ( 6 ). (pnas.org)
  • The broken chromosome has been stabilised with a newly positioned telomere acquired by recombination between this 16p Alu element and a closely related subtelomeric Alu element of the Sx subfamily. (ox.ac.uk)
  • Possible CNV formation based on Alu-mediated homologous recombination model. (cdc.gov)
  • Estimation of total methylation content of Alu elements is useful for evaluation of the global genomic methylation status and level of homologous and non-homologous chromatin recombination in gene-rich regions. (beds.ac.uk)
  • The second most abundant class of transposons in humans, the LINE (L1) elements, are autonomous poly(A) retrotransposons ( O stertag and K azazian 2001 and references therein). (genetics.org)
  • Alu elements do not encode for protein products and depend on LINE retrotransposons for their replication. (wikiversity.org)
  • SINEs lack protein-coding capability and since the 1990s it had been hypothesized that their retrotransposition is driven by long interspersed nucleotide elements (LINEs) retrotransposons that are transcribed by RNA polymerase II (Pol II) and encode the enzymes required for their mobility [8]. (thetechnoant.info)
  • Alu elements are retrotransposons that frequently form new exons during primate evolution. (elifesciences.org)
  • These elements include (i) DNA transposons, (ii) autonomous retrotransposons, and (iii) nonautonomous retrotransposons ( Fig. 1 ). (sciencemag.org)
  • The mechanism by which many of these elements move is well known, but for others, such as mammalian retrotransposons, there is still much to learn. (sciencemag.org)
  • Examples of LTR retrotransposons are human endogenous retroviruses (HERV) (shown) and various Ty elements of S. cerevisiae (not shown). (sciencemag.org)
  • Alu and SVA elements are nonautonomous retrotransposons that hijack the molecular retrotransposition machinery of the autonomous L1 element to mediate their own retrotransposition. (els.net)
  • Alteration of gene structure mediated by Alu retrotransposons. (els.net)
  • The extent to which Alu regions are incorporated into functional proteins is unclear, but we detected reliable peptide evidence to support the translation to protein of 33 Alu-derived exons. (mit.edu)
  • All but one of the Alu elements for which we detected peptides were frame-preserving and there was proportionally seven times more peptide evidence for Alu elements as for other primate exons. (mit.edu)
  • Despite this strong evidence for translation to protein we found no evidence of selection, either from cross species alignments or human population variation data, among these Alu-derived exons. (mit.edu)
  • Alternative splicing of Alu exons--two arms are better than one. (psu.edu)
  • Comparative meta-analysis with the 80 other CNV cases from 12 publications describing STK11 mutations in patients with PJS revealed the participation of specific Alu elements in all deletions of exons 2-3 so far described. (cdc.gov)
  • Recent studies indicate that some Alu exons have high transcript inclusion levels or tissue-specific splicing profiles, and may play important regulatory roles in modulating mRNA degradation or translational efficiency. (biomedcentral.com)
  • However, the contribution of Alu exons to the human proteome remains unclear and controversial. (biomedcentral.com)
  • The prevailing view is that exons derived from young repetitive elements, such as Alu elements, are restricted to regulatory functions and have not had adequate evolutionary time to be incorporated into stable, functional proteins. (biomedcentral.com)
  • We adopt a proteotranscriptomics approach to systematically assess the contribution of Alu exons to the human proteome. (biomedcentral.com)
  • Using RNA sequencing, ribosome profiling, and proteomics data from human tissues and cell lines, we provide evidence for the translational activities of Alu exons and the presence of Alu exon derived peptides in human proteins. (biomedcentral.com)
  • Together, these data have established the regulatory roles of Alu exons in multiple aspects of RNA metabolism including translation and degradation. (biomedcentral.com)
  • They identified numerous instances of 'in-frame' Alu exons in the coding region of human mRNAs that are predicted to add Alu -derived peptides to the protein products. (biomedcentral.com)
  • Here, we assess the interplay of splicing repression by hnRNPC and nonsense-mediated mRNA decay (NMD) in the quality control and evolution of new Alu-exons. (elifesciences.org)
  • We identify 3100 new Alu-exons and show that NMD more efficiently recognises transcripts with Alu-exons compared to other exons with premature termination codons. (elifesciences.org)
  • However, some Alu-exons escape NMD, especially when an adjacent intron is retained, highlighting the importance of concerted repression by splicing and NMD. (elifesciences.org)
  • Once the 3' splice site at ancient Alu-exons reaches a stable phase, splicing repression by hnRNPC decreases, but the exons generally remain sensitive to NMD. (elifesciences.org)
  • Thus, it is important to understand the protective molecular mechanisms imposing constraints on the emergence and expression of Alu-exons. (elifesciences.org)
  • Thus, the U-tract:hnRNPC interaction is crucial to prevent the splicing machinery from accessing cryptic splice sites at Alu-exons. (elifesciences.org)
  • However, the total number of Alu-exons regulated by hnRNPC is likely to be even larger, since Alu-exon-containing transcripts (Alu-exon transcripts) may evade detection if they are unstable. (elifesciences.org)
  • Moreover, most Alu-exons will introduce a premature termination codon (PTC) into the transcript, and Alu-exon transcripts are therefore likely to be targeted by nonsense-mediated mRNA decay (NMD). (elifesciences.org)
  • a) Alu exonization: a hypothetical gene constituted of three exons (light grey, white and dark grey boxes) is shown with its splicing pattern (dashed lines above gene). (els.net)
  • Repetitive elements are a major component of lncRNA and their molecular functions in lncRNA are poorly understood. (labroots.com)
  • Rusiecki JA, Chen L, Srikantan V, Zhang L, Yan L, Polin ML, Baccarelli A. DNA methylation in repetitive elements and post-traumatic stress disorder: a case-control study of US military service members. (uchicago.edu)
  • The Alu element is a member of the SINE family of repetitive elements. (beds.ac.uk)
  • Spatial distribution and clustering of repetitive elements are extensively studied during the last years, as well as their colocalization with other genomic components. (mendeley.com)
  • These findings reveal a miRNA-independent cell survival function for DICER1 involving retrotransposon transcript degradation, show that Alu RNA can directly cause human pathology, and identify new targets for a major cause of blindness. (nih.gov)
  • The "presence" of a given retrotransposon in related taxa suggests their orthologous integration, a derived condition acquired via a common ancestry, while the "absence" of particular elements indicates the plesiomorphic condition prior to integration in more distant taxa. (wikipedia.org)
  • Chromatin of major retrotransposon classes, Alu, SVA and L1, becomes relatively more open in senescent cells, affecting most strongly the evolutionarily recent elements, and leads to an increase in their transcription and ultimately transposition. (wiley.com)
  • An Alu element is an example of a nonautonomous retrotransposon. (sciencemag.org)
  • Modern Alu elements are about 300 base pairs long and are therefore classified as short interspersed nuclear elements (SINEs) among the class of repetitive DNA elements. (wikipedia.org)
  • instead it has a distinct set of SINEs called B/ID elements. (eurekalert.org)
  • These SINEs include human Alu elements and mouse B1, B2, B4 and ID elements. (rochester.edu)
  • Each Alu family contains a unique set of diagnostic base changes that can be used to identify copies belonging to that family. (genetics.org)
  • However, most of these Alu copies are not identical and can be classified into several subfamilies (reviewed in D eininger and B atzer 1993 ). (genetics.org)
  • The total number of copies of B1 B2 B4 and ID elements in mouse (1.4 millions) surpasses that of human Alu elements [7]. (thetechnoant.info)
  • Thus, we have defined unexpected roles for Alu elements, lncRNAs and mRNAs. (rochester.edu)
  • In other studies, we have found that STAU1 (and probably STAU2) binding to 3'UTR inverted Alu elements competes with binding of the largely nuclear paraspeckle protein p54nrb and largely cytoplasmic protein kinase R (PKR) to mediate, respectively, the nuclear export and cytoplasmic translation of a number of mRNAs that contain these elements. (rochester.edu)
  • Here, we report that human mRNAs containing inverted Alu elements are present in the mammalian cytoplasm. (iu.edu)
  • One such Alu element, called TPA-25, is found within an intron of the tissue plasminogen activator (TPA) gene. (docplayer.net)
  • Allele 5 of a tetranucleotide polymorphism in an Alu element (GXAlu) localized in intron 27b of the NF1 gene has previously been associated with autism. (cdc.gov)
  • Zhang, Ya-ping 2005-10-14 00:00:00 An analysis of the nuclear β-fibrinogen intron 7 locus from 30 taxa representing 12 placental orders of mammals reveals the enriched occurrences of short interspersed element (SINE) insertion events. (deepdyve.com)
  • element in intron 16 [5]. (deepdyve.com)
  • antisense orientation, as observed for the ADAR Alu exon. (psu.edu)
  • Furthermore the insertion of IRAlu at the 3'-UTR of the EGFP cDNA led to a rhythmic circadian nuclear retention of the egfp mRNA that was lost when paraspeckles were disrupted whereas insertion of a single antisense Alu had only a weak effect. (elifesciences.org)
  • Several Alu subfamilies are known to be actively transposing and it is thought that a new insertion occurs approximately every 20 births in humans ( Cordaux & Batzer, 2009 ). (peerj.com)
  • Subsequently retrotransposition of Alu B1 and B2 elements mediated by L1 (or LINE1) a LINE present in all mammals was formally demonstrated [9 10 L1 is the only currently active autonomous transposon in humans [2 11 L1 elements have two open reading frames (ORF1 and ORF2) that encode two proteins critical for the process of retrotransposition. (thetechnoant.info)
  • Alu RNA is increased in the RPE of humans with GA, and this pathogenic RNA induces human RPE cytotoxicity and RPE degeneration in mice. (nih.gov)
  • Shown is Alu an active SINE in humans. (nih.gov)
  • These elements are not present in humans, and essentially all are defective, so the source of their RT in trans remains unknown. (sciencemag.org)
  • Alu elements do not encode for protein products. (wikipedia.org)
  • In the case of the RNA editing enzyme ADARB1, which contains an Alu exon peptide in its catalytic domain, RNA sequencing analyses of A-to-I editing demonstrate that both the Alu exon skipping and inclusion isoforms encode active enzymes. (biomedcentral.com)
  • Bailey JA, Liu G and Eichler EE (2003) An Alu transposition model for the origin and expansion of human segmental duplications. (els.net)
  • The study of Alu elements thus reveals details of ancestry because individuals will only share a particular Alu element insertion if they have a common ancestor. (wikiversity.org)
  • In 1988, Jerzy Jurka and Temple Smith discovered that Alu elements were split in two major subfamilies known as AluJ (named after Jurka) and AluS (named after Smith), and other Alu subfamilies were also independently discovered by several groups. (wikipedia.org)
  • We analyzed Alu elements retrieved from the GenBank database and identified two new Alu subfamilies, Alu Yb9 and Alu Yc2, and further characterized Yc1 subfamily members. (genetics.org)
  • Subsequent or concurrent mutations in the new source element(s) result in groups of elements that are identifiable as new subfamilies. (genetics.org)
  • The basic components of DNA transposons are shown as a "representative" of the multiple superfamilies of Class II elements. (nih.gov)
  • Miniature inverted repeat transposable elements (MITEs) are examples non-autonomous DNA transposons. (nih.gov)
  • Later on, a sub-subfamily of AluS which included active Alu elements was given the separate name AluY. (wikipedia.org)
  • These observations have been made by relying on the subfamily as a proxy for age of an element. (peerj.com)
  • We show that the previously-reported effect of GC content correlating with subfamily age is not reflected by the ages of the individual elements. (peerj.com)
  • The link between Alu subfamily age and GC region was made due to an over-simplification of the data and is incorrect. (peerj.com)
  • Expressed another way, it is believed modern Alu elements emerged from a head to tail fusion of two distinct FAMs (fossil antique monomers) over 100 million years ago, hence its dimeric structure of two similar, but distinct monomers (left and right arms) joined by an A-rich linker. (wikipedia.org)
  • Free-floating forms of the left and right arms exist, termed free left Alu monomers (FLAMs) and free right Alu monomers (FRAMs) respectively. (wikipedia.org)
  • The Alu exon derived peptide may fine tune the overall editing activity and, in limited cases, the site selectivity of ADARB1 protein products. (biomedcentral.com)
  • A cis-acting element in the 3'-untranslated region of human TNF-alpha mRNA renders splicing dependent on the activation of protein kinase PKR. (semanticscholar.org)
  • We use a new reporter assay to show that repair of DSBs results in Alu-mediated deletions that resolve through several distinct repair pathways. (prolekare.cz)
  • A number of different pathways can give rise to these Alu/Alu deletions, including single-strand annealing (SSA) repair that may predominate when there are high levels of homology, and mechanisms such as microhomology-mediated end joining (MMEJ) where the microhomology happens to be 'in register' between the two Alu elements, allowing formation of a single chimeric Alu element [ 7 ]. (prolekare.cz)
  • Possible editing of Alu transcripts in blood cells of sporadic Creutzfeldt-Jakob disease (sCJD). (semanticscholar.org)
  • The average human in our study was estimated to harbor 1283 Alu insertion polymorphisms, 180 L1 polymorphisms, 56 SVA polymorphisms, and 17 polymorphisms related to other forms of mobilized DNA. (genetics.org)
  • These newly identified Alu insertion polymorphisms will serve as identical-by-descent genetic markers for the study of human evolution and forensics. (genetics.org)
  • Knight Johnson A, Schaefer GB, Lee J, Hu Y, Del Gaudio D. Alu-mediated deletion of PIGL in a Patient with CHIME syndrome. (uchicago.edu)
  • An Alu-mediated rearrangement causing a 3.2kb deletion and a novel two base pair deletion in AAAS gene as the cause of triple A syndrome. (uchicago.edu)
  • Here we present a novel 7001 bps deletion of STK11 gene fragment, in which we identified the presence of breakpoints (BPs) within the Alu elements. (cdc.gov)
  • Mutations may also result from insertion or deletion of segments of DNA due to mobile genetic elements . (wikipedia.org)
  • An Alu element is a short stretch of DNA originally characterized by the action of the Arthrobacter luteus (Alu) restriction endonuclease. (wikipedia.org)
  • Exonization of Alu elements creates primate-specific genomic diversity. (psu.edu)
  • Our analyses revealed an intricate network involved in Alu exonization. (psu.edu)
  • Overall, our results demonstrate the complex interplay between at least four interacting layers that affect Alu exonization. (psu.edu)
  • These results shed light on the mechanism through which Alu elements enrich the primate transcrip-tome and allow a better understanding of the exonization process in general. (psu.edu)
  • Here, I describe the evolution of Alu elements in lncRNA and mRNA. (labroots.com)
  • We showed for the first time a tissue-specific decrease in the pre-mRNA content of the gene allele bearing L1 or Alu inserts relative to the other allele of the same gene lacking the retroelement. (nih.gov)
  • 2011. lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements. (icr.org)
  • We have characterised a subtelomeric rearrangement involving the short arm of chromosome 16 that gives rise to alpha-thalassaemia by deleting the major, remote regulatory element controlling alpha-globin expression. (ox.ac.uk)
  • A team of investigators lead by Haussler recently provided direct evidence that even when a short interspersed nucleotide element (SINE) lands at some distance from a gene, it can take on a regulatory role with powerful regulatory functions. (creation.com)
  • Two main promoter "boxes" are found in Alu: a 5' A box with the consensus TGGCTCACGCC, and a 3' B box with the consensus GWTCGAGAC (IUPAC nucleic acid notation). (wikipedia.org)
  • The majority of identified Alu elements diverge 4%-20% from the consensus [ 3 ]. (prolekare.cz)
  • Alu Elements" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (umassmed.edu)
  • This is of great interest as Alu is a retro-element that can transpose in a cycle containing a free Alu transcript, which is always in sense orientation. (nih.gov)
  • Instead, elements are preferentially lost from areas of high GC content over time. (peerj.com)
  • The length of the polyA tail varies between Alu families. (wikipedia.org)
  • Overall, our results confirm that SINE Alu elements have contributed to the expansion of the human proteome, and this contribution appears to be stronger than might be expected over such a relatively short evolutionary timeframe. (mit.edu)
  • The most common target site coincides with the evolutionary most conserved part of Alu. (nih.gov)
  • Thus, a dual relationship exists between an evolutionary young miRNA cluster and their Alu targets that may have evolved in the same time window. (nih.gov)
  • Because many of the Alu elements within C19MC are evolutionary old (AluJ and AluS), expansion of the cluster may have occurred at an early wave of expansion of the Alu elements. (nih.gov)
  • The target sites are relatively unspecific so that the chance of an independent integration of exactly the same element into one specific site in different taxa is not large and may even be negligible over evolutionary time scales. (wikipedia.org)
  • The so-called 'junk' DNAs that have perplexed creationists and evolutionary scientists alike may be the very elements that can explain the mechanisms by which God is at work in His creation now and in the past. (creation.com)
  • The GC elements are bound by transcription factors and have similar functions to enhancers. (wikiversity.org)
  • However, stress-induced demethylation of these CpGs could reactivate Alu transcription. (beds.ac.uk)
  • RNA transcription starts at the 5′ end of the L1 element (thin horizontal arrow) and normally proceeds down to the L1 polyadenylation signal, resulting in transcription termination. (els.net)
  • The size of the amplification product(s) will depend upon the presence or absence of the Alu insertion at the TPA-25 locus on each copy of chromosome 8. (docplayer.net)
  • The formation of noncanonical structures in Alu bcl2 dsDNA and their absence in the case of Alu-PQS have been shown using DMS-footprinting and atomic force microscopy (AFM). (springer.com)
  • The autonomous retroelements comprise the LTR-retroelements or endogenous retroviruses (ERVs) and the non-LTR retroelements also known as Long INterspersed Elements (LINEs). (nih.gov)
  • The currently-accepted dogma when analysing human Alu transposable elements is that 'young' Alu elements are found in low GC regions and 'old' Alus in high GC regions. (peerj.com)
  • 1 Exercise 5: Detection of a Human Alu Element by PCR (adapted from Dolan DNA Learning Center, Cold Spring Harbor Laboratory, NY and Science Outreach, Washington University, St. Louis, MO) Background Information Although the DNA from different individuals is more alike than different, there are many regions of the human chromosomes that exhibit a great deal of diversity. (docplayer.net)
  • Alu elements are mainly distributed in gene-rich regions. (beds.ac.uk)
  • While the disruption of normal gene function by transposable elements upon integration into exonic regions is obvious, their post-insertional effects on gene expression have not received much attention. (bioscience.org)
  • The L1 element consists of two open reading frames ( ORF 1 and ORF 2) surrounded by 5′ and 3′ untranslated regions ( UTR ). (els.net)
  • A typical Alu element contains multiple sites with the potential to serve as 5 splice sites (5ss). (psu.edu)
  • Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. (bioscience.org)
  • The younger AluS lineage is about 30 million years old and still contains some active elements. (wikipedia.org)
  • B1 elements in rats and mice are similar to Alus in that they also evolved from 7SL RNA, but they only have one left monomer arm. (wikipedia.org)
  • 95% percent of human Alus are also found in chimpanzees, and 50% of B elements in mice are also found in rats. (wikipedia.org)
  • It is suggested that Alu elements have played potentially important roles in genotypic and phenotypic evolution in the hominid lineage. (pnas.org)
  • Once gained an Alu element is rarely lost so comparison of Alu between species can be used to map primate evolution and diversity. (phys.org)
  • Since that time, her laboratory has developed a monoclonal antibody to one of the proteins encoded for by Long INterspersed Element-1 (LINE-1) and showed its aberrant expression in a wide breadth of human cancers. (hopkinsmedicine.org)
  • We are additionally extending our studies of inverted-repeat Alu elements (IRAlus) and how competitive binding among the many nuclear and cytoplasmic double-stranded RNA binding proteins influence nuclear and cytoplasmic IRAlus-containing RNA metabolism. (rochester.edu)