AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation Science
Adherens JunctionsIntercellular JunctionsCadherinsTight Junctionsalpha CateninCateninsGap JunctionsDesmoplakinsbeta CateninZonula Occludens-1 Proteingamma CateninCytoskeletal ProteinsArmadillo Domain ProteinsDesmosomesCell AdhesionCell Adhesion MoleculesVinculinOccludinEpithelial CellsCell PolarityNeuromuscular JunctionActinsCell CommunicationMembrane ProteinsDesmogleinsCytoskeletonPhosphoproteinsDrosophila ProteinsConnexin 43DesmocollinsMicrofilament ProteinsPlakophilinsTrans-ActivatorsCapillary PermeabilityTight Junction ProteinsClaudin-1DogsConnexinsZonula Occludens-2 ProteinMicroscopy, FluorescenceCells, CulturedMorphogenesisCell LineActin CytoskeletonElectric ImpedanceEndothelial CellsSignal TransductionEpitheliumAntigens, CDrho GTP-Binding Proteinsrac1 GTP-Binding ProteinFluorescent Antibody TechniqueMicroscopy, Electronrap1 GTP-Binding ProteinsCell ShapeJunctional Adhesion MoleculesCell MovementDrosophila melanogasterPhosphorylationDrosophilaProtein BindingSeminiferous EpitheliumMicroscopy, ConfocalMolecular Sequence DataNeuroepithelial CellsProtein TransportModels, BiologicalEndothelium, VascularDesmosomal CadherinsVestibular Nucleus, LateralCell MembraneEmbryo, NonmammalianrhoA GTP-Binding Proteincdc42 GTP-Binding ProteinGastrulationrac GTP-Binding ProteinsBlood-Testis BarrierMutationSertoli CellsMadin Darby Canine Kidney CellsProtein Structure, TertiaryEsophagogastric JunctionPupaImmunohistochemistryNucleoside-Phosphate Kinasesrc-Family KinasesStress FibersAmino Acid SequenceFreeze FracturingKeratinocytesDesmoglein 2Myosin Type IIKinesinCaco-2 CellsTyrosineTransfectionEpidermisClaudin-3Holliday Junction ResolvasesActininActomyosinFluorescence Recovery After PhotobleachingMyosinsFocal AdhesionsHydrazinesPrecipitin TestsImmunoprecipitationGingival PocketBase SequencePermeabilityGuanylate KinaseClaudin-5Microscopy, Electron, TransmissionBlotting, WesternRNA InterferenceMicroscopy, ImmunoelectronHuman Umbilical Vein Endothelial CellsGreen Fluorescent ProteinsRecombinant Fusion ProteinsLysophospholipidsrho-Associated KinasesImmunoblottingSphingosineEndocytosisRNA, Small InterferingTime-Lapse ImagingCalciumIndazolesPhotoreceptor Cells, InvertebrateMice, KnockoutCell Membrane PermeabilityAnimals, Genetically ModifiedClaudinsBlood-Air BarrierCell Differentiation
Adherens Junctions: Anchoring points where the CYTOSKELETON of neighboring cells are connected to each other. They are composed of specialized areas of the plasma membrane where bundles of the ACTIN CYTOSKELETON attach to the membrane through the transmembrane linkers, CADHERINS, which in turn attach through their extracellular domains to cadherins in the neighboring cell membranes. In sheets of cells, they form into adhesion belts (zonula adherens) that go all the way around a cell.Intercellular Junctions: Direct contact of a cell with a neighboring cell. Most such junctions are too small to be resolved by light microscopy, but they can be visualized by conventional or freeze-fracture electron microscopy, both of which show that the interacting CELL MEMBRANE and often the underlying CYTOPLASM and the intervening EXTRACELLULAR SPACE are highly specialized in these regions. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p792)Cadherins: Calcium-dependent cell adhesion proteins. They are important in the formation of ADHERENS JUNCTIONS between cells. Cadherins are classified by their distinct immunological and tissue specificities, either by letters (E- for epithelial, N- for neural, and P- for placental cadherins) or by numbers (cadherin-12 or N-cadherin 2 for brain-cadherin). Cadherins promote cell adhesion via a homophilic mechanism as in the construction of tissues and of the whole animal body.Tight Junctions: Cell-cell junctions that seal adjacent epithelial cells together, preventing the passage of most dissolved molecules from one side of the epithelial sheet to the other. (Alberts et al., Molecular Biology of the Cell, 2nd ed, p22)alpha Catenin: A catenin that binds F-ACTIN and links the CYTOSKELETON with BETA CATENIN and GAMMA CATENIN.Catenins: A family of cytoskeletal proteins that play essential roles in CELL ADHESION at ADHERENS JUNCTIONS by linking CADHERINS to the ACTIN FILAMENTS of the CYTOSKELETON.Gap Junctions: Connections between cells which allow passage of small molecules and electric current. Gap junctions were first described anatomically as regions of close apposition between cells with a narrow (1-2 nm) gap between cell membranes. The variety in the properties of gap junctions is reflected in the number of CONNEXINS, the family of proteins which form the junctions.Desmoplakins: Desmoplakins are cytoskeletal linker proteins that anchor INTERMEDIATE FILAMENTS to the PLASMA MEMBRANE at DESMOSOMES.beta Catenin: A multi-functional catenin that participates in CELL ADHESION and nuclear signaling. Beta catenin binds CADHERINS and helps link their cytoplasmic tails to the ACTIN in the CYTOSKELETON via ALPHA CATENIN. It also serves as a transcriptional co-activator and downstream component of WNT PROTEIN-mediated SIGNAL TRANSDUCTION PATHWAYS.Zonula Occludens-1 Protein: A 195-kDa zonula occludens protein that is distinguished by the presence of a ZU5 domain at the C-terminal of the molecule.gamma Catenin: A multi-functional catenin that is highly homologous to BETA CATENIN. Gamma catenin binds CADHERINS and helps link their cytoplasmic tails to ACTIN in the CYTOSKELETON via ALPHA CATENIN. It is also found in DESMOSOMES where it mediates the link between DESMOSOMAL CADHERINS and DESMOPLAKIN.Cytoskeletal Proteins: Major constituent of the cytoskeleton found in the cytoplasm of eukaryotic cells. They form a flexible framework for the cell, provide attachment points for organelles and formed bodies, and make communication between parts of the cell possible.Armadillo Domain Proteins: A family of proteins that contain several 42-amino acid repeat domains and are homologous to the Drosophila armadillo protein. They bind to other proteins through their armadillo domains and play a variety of roles in the CELL including SIGNAL TRANSDUCTION, regulation of DESMOSOME assembly, and CELL ADHESION.Desmosomes: A type of junction that attaches one cell to its neighbor. One of a number of differentiated regions which occur, for example, where the cytoplasmic membranes of adjacent epithelial cells are closely apposed. It consists of a circular region of each membrane together with associated intracellular microfilaments and an intercellular material which may include, for example, mucopolysaccharides. (From Glick, Glossary of Biochemistry and Molecular Biology, 1990; Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Cell Adhesion: Adherence of cells to surfaces or to other cells.Cell Adhesion Molecules: Surface ligands, usually glycoproteins, that mediate cell-to-cell adhesion. Their functions include the assembly and interconnection of various vertebrate systems, as well as maintenance of tissue integration, wound healing, morphogenic movements, cellular migrations, and metastasis.Vinculin: A cytoskeletal protein associated with cell-cell and cell-matrix interactions. The amino acid sequence of human vinculin has been determined. The protein consists of 1066 amino acid residues and its gene has been assigned to chromosome 10.Occludin: A MARVEL domain protein that plays an important role in the formation and regulation of the TIGHT JUNCTION paracellular permeability barrier.Epithelial Cells: Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.Cell Polarity: Orientation of intracellular structures especially with respect to the apical and basolateral domains of the plasma membrane. Polarized cells must direct proteins from the Golgi apparatus to the appropriate domain since tight junctions prevent proteins from diffusing between the two domains.Neuromuscular Junction: The synapse between a neuron and a muscle.Actins: Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.Cell Communication: Any of several ways in which living cells of an organism communicate with one another, whether by direct contact between cells or by means of chemical signals carried by neurotransmitter substances, hormones, and cyclic AMP.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Desmogleins: A group of desmosomal cadherins with cytoplasmic tails that resemble those of classical CADHERINS.Cytoskeleton: The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.PhosphoproteinsDrosophila Proteins: Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.Connexin 43: A 43-kDa peptide which is a member of the connexin family of gap junction proteins. Connexin 43 is a product of a gene in the alpha class of connexin genes (the alpha-1 gene). It was first isolated from mammalian heart, but is widespread in the body including the brain.Desmocollins: A group of desmosomal cadherins with cytoplasmic tails that are divergent from those of classical CADHERINS. Their intracytoplasmic domains bind PLAKOGLOBIN; PLAKOPHILINS; and DESMOPLAKINS.Microfilament Proteins: Monomeric subunits of primarily globular ACTIN and found in the cytoplasmic matrix of almost all cells. They are often associated with microtubules and may play a role in cytoskeletal function and/or mediate movement of the cell or the organelles within the cell.Plakophilins: Members of the armadillo family of proteins that are found in DESMOSOMES and interact with various proteins including desmocadherins; DESMOPLAKIN; ACTIN FILAMENTS; and KERATINS.Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Capillary Permeability: The property of blood capillary ENDOTHELIUM that allows for the selective exchange of substances between the blood and surrounding tissues and through membranous barriers such as the BLOOD-AIR BARRIER; BLOOD-AQUEOUS BARRIER; BLOOD-BRAIN BARRIER; BLOOD-NERVE BARRIER; BLOOD-RETINAL BARRIER; and BLOOD-TESTIS BARRIER. Small lipid-soluble molecules such as carbon dioxide and oxygen move freely by diffusion. Water and water-soluble molecules cannot pass through the endothelial walls and are dependent on microscopic pores. These pores show narrow areas (TIGHT JUNCTIONS) which may limit large molecule movement.Tight Junction Proteins: Proteins that take part in the formation or structure of TIGHT JUNCTIONS.Claudin-1: An integral membrane protein that is localized to TIGHT JUNCTIONS, where it plays a role in controlling the paracellular permeability of polarized cells. Mutations in the gene for claudin-1 are associated with Neonatal Ichthyosis-Sclerosing Cholangitis (NISCH) Syndrome.Dogs: The domestic dog, Canis familiaris, comprising about 400 breeds, of the carnivore family CANIDAE. They are worldwide in distribution and live in association with people. (Walker's Mammals of the World, 5th ed, p1065)Connexins: A group of homologous proteins which form the intermembrane channels of GAP JUNCTIONS. The connexins are the products of an identified gene family which has both highly conserved and highly divergent regions. The variety contributes to the wide range of functional properties of gap junctions.Zonula Occludens-2 Protein: A zonula occludens protein subtype found in epithelial cell junctions. Several isoforms of zonula occludens-2 protein exist due to use of alternative promoter regions and alternative mRNA splicings.Microscopy, Fluorescence: Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Morphogenesis: The development of anatomical structures to create the form of a single- or multi-cell organism. Morphogenesis provides form changes of a part, parts, or the whole organism.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Actin Cytoskeleton: Fibers composed of MICROFILAMENT PROTEINS, which are predominately ACTIN. They are the smallest of the cytoskeletal filaments.Electric Impedance: The resistance to the flow of either alternating or direct electrical current.Endothelial Cells: Highly specialized EPITHELIAL CELLS that line the HEART; BLOOD VESSELS; and lymph vessels, forming the ENDOTHELIUM. They are polygonal in shape and joined together by TIGHT JUNCTIONS. The tight junctions allow for variable permeability to specific macromolecules that are transported across the endothelial layer.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Epithelium: One or more layers of EPITHELIAL CELLS, supported by the basal lamina, which covers the inner or outer surfaces of the body.Antigens, CD: Differentiation antigens residing on mammalian leukocytes. CD stands for cluster of differentiation, which refers to groups of monoclonal antibodies that show similar reactivity with certain subpopulations of antigens of a particular lineage or differentiation stage. The subpopulations of antigens are also known by the same CD designation.rho GTP-Binding Proteins: A large family of MONOMERIC GTP-BINDING PROTEINS that are involved in regulation of actin organization, gene expression and cell cycle progression. This enzyme was formerly listed as EC 3.6.1.47.rac1 GTP-Binding Protein: A rac GTP-binding protein involved in regulating actin filaments at the plasma membrane. It controls the development of filopodia and lamellipodia in cells and thereby influences cellular motility and adhesion. It is also involved in activation of NADPH OXIDASE. This enzyme was formerly listed as EC 3.6.1.47.Fluorescent Antibody Technique: Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.Microscopy, Electron: Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.rap1 GTP-Binding Proteins: A genetically related subfamily of RAP GTP-BINDING PROTEINS that share homology with RAS PROTEINS. They bind to Ras effectors but do not activate them, therefore they may antagonize the effects of RAS PROTEINS. This enzyme was formerly listed as EC 3.6.1.47.Cell Shape: The quality of surface form or outline of CELLS.Junctional Adhesion Molecules: A family of membrane glycoproteins localized to TIGHT JUNCTIONS that contain two extracellular Ig-like domains, a single transmembrane segment, and a cytoplasmic tail of variable length.Cell Movement: The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.Drosophila melanogaster: A species of fruit fly much used in genetics because of the large size of its chromosomes.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Drosophila: A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Seminiferous Epithelium: The epithelium lining the seminiferous tubules composed of primary male germ cells (SPERMATOGONIA) and supporting SERTOLI CELLS. As SPERMATOGENESIS proceeds, the developing germ cells migrate toward the lumen. The adluminal compartment, the inner two thirds of the tubules, contains SPERMATOCYTES and the more advanced germ cells.Microscopy, Confocal: A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Neuroepithelial Cells: Cells of epithelial origin possessing specialized sensory functions. They include cells that are found in the TASTE BUDS; OLFACTORY MUCOSA; COCHLEA; and NEUROEPITHELIAL BODIES.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Endothelium, Vascular: Single pavement layer of cells which line the luminal surface of the entire vascular system and regulate the transport of macromolecules and blood components.Desmosomal Cadherins: A single-pass transmembrane glycoproteins that mediate CALCIUM-dependent CELL ADHESION and are core components of DESMOSOMES.Vestibular Nucleus, Lateral: Vestibular nucleus lying immediately superior to the inferior vestibular nucleus and composed of large multipolar nerve cells. Its upper end becomes continuous with the superior vestibular nucleus.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Embryo, Nonmammalian: The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.rhoA GTP-Binding Protein: A RHO GTP-BINDING PROTEIN involved in regulating signal transduction pathways that control assembly of focal adhesions and actin stress fibers. This enzyme was formerly listed as EC 3.6.1.47.cdc42 GTP-Binding Protein: A member of the Rho family of MONOMERIC GTP-BINDING PROTEINS. It is associated with a diverse array of cellular functions including cytoskeletal changes, filopodia formation and transport through the GOLGI APPARATUS. This enzyme was formerly listed as EC 3.6.1.47.Gastrulation: A process of complicated morphogenetic cell movements that reorganizes a bilayer embryo into one with three GERM LAYERS and specific orientation (dorsal/ventral; anterior/posterior). Gastrulation describes the germ layer development of a non-mammalian BLASTULA or that of a mammalian BLASTOCYST.rac GTP-Binding Proteins: A sub-family of RHO GTP-BINDING PROTEINS that is involved in regulating the organization of cytoskeletal filaments. This enzyme was formerly listed as EC 3.6.1.47.Blood-Testis Barrier: A specialized barrier, in the TESTIS, between the interstitial BLOOD compartment and the adluminal compartment of the SEMINIFEROUS TUBULES. The barrier is formed by layers of cells from the VASCULAR ENDOTHELIUM of the capillary BLOOD VESSELS, to the SEMINIFEROUS EPITHELIUM of the seminiferous tubules. TIGHT JUNCTIONS form between adjacent SERTOLI CELLS, as well as between the ENDOTHELIAL CELLS.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Sertoli Cells: Supporting cells projecting inward from the basement membrane of SEMINIFEROUS TUBULES. They surround and nourish the developing male germ cells and secrete ANDROGEN-BINDING PROTEIN and hormones such as ANTI-MULLERIAN HORMONE. The tight junctions of Sertoli cells with the SPERMATOGONIA and SPERMATOCYTES provide a BLOOD-TESTIS BARRIER.Madin Darby Canine Kidney Cells: An epithelial cell line derived from a kidney of a normal adult female dog.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Esophagogastric Junction: The area covering the terminal portion of ESOPHAGUS and the beginning of STOMACH at the cardiac orifice.Pupa: An inactive stage between the larval and adult stages in the life cycle of insects.Immunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Nucleoside-Phosphate Kinase: An enzyme that catalyzes reversible reactions of a nucleoside triphosphate, e.g., ATP, with a nucleoside monophosphate, e.g., UMP, to form ADP and UDP. Many nucleoside monophosphates can act as acceptor while many ribo- and deoxyribonucleoside triphosphates can act as donor. EC 2.7.4.4.src-Family Kinases: A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.Stress Fibers: Bundles of actin filaments (ACTIN CYTOSKELETON) and myosin-II that span across the cell attaching to the cell membrane at FOCAL ADHESIONS and to the network of INTERMEDIATE FILAMENTS that surrounds the nucleus.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Freeze Fracturing: Preparation for electron microscopy of minute replicas of exposed surfaces of the cell which have been ruptured in the frozen state. The specimen is frozen, then cleaved under high vacuum at the same temperature. The exposed surface is shadowed with carbon and platinum and coated with carbon to obtain a carbon replica.Keratinocytes: Epidermal cells which synthesize keratin and undergo characteristic changes as they move upward from the basal layers of the epidermis to the cornified (horny) layer of the skin. Successive stages of differentiation of the keratinocytes forming the epidermal layers are basal cell, spinous or prickle cell, and the granular cell.Desmoglein 2: A CALCIUM-dependent adhesion molecule of DESMOSOMES that also plays a role in embryonic STEM CELL proliferation.Myosin Type II: The subfamily of myosin proteins that are commonly found in muscle fibers. Myosin II is also involved a diverse array of cellular functions including cell division, transport within the GOLGI APPARATUS, and maintaining MICROVILLI structure.Kinesin: A microtubule-associated mechanical adenosine triphosphatase, that uses the energy of ATP hydrolysis to move organelles along microtubules toward the plus end of the microtubule. The protein is found in squid axoplasm, optic lobes, and in bovine brain. Bovine kinesin is a heterotetramer composed of two heavy (120 kDa) and two light (62 kDa) chains. EC 3.6.1.-.Caco-2 Cells: Human colonic ADENOCARCINOMA cells that are able to express differentiation features characteristic of mature intestinal cells, such as ENTEROCYTES. These cells are valuable in vitro tools for studies related to intestinal cell function and differentiation.Tyrosine: A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Epidermis: The external, nonvascular layer of the skin. It is made up, from within outward, of five layers of EPITHELIUM: (1) basal layer (stratum basale epidermidis); (2) spinous layer (stratum spinosum epidermidis); (3) granular layer (stratum granulosum epidermidis); (4) clear layer (stratum lucidum epidermidis); and (5) horny layer (stratum corneum epidermidis).Claudin-3: A ubiquitously-expressed claudin subtype that acts as a general barrier-forming protein in TIGHT JUNCTIONS. Elevated expression of claudin-3 is found in a variety of tumor cell types, suggesting its role as a therapeutic target for specific ANTINEOPLASTIC AGENTS.Holliday Junction Resolvases: Enzymes that recognize CRUCIFORM DNA structures and introduce paired incisions that help to resolve the structure into two DNA helices.Actinin: A protein factor that regulates the length of R-actin. It is chemically similar, but immunochemically distinguishable from actin.Actomyosin: A protein complex of actin and MYOSINS occurring in muscle. It is the essential contractile substance of muscle.Fluorescence Recovery After Photobleaching: A method used to study the lateral movement of MEMBRANE PROTEINS and LIPIDS. A small area of a cell membrane is bleached by laser light and the amount of time necessary for unbleached fluorescent marker-tagged proteins to diffuse back into the bleached site is a measurement of the cell membrane's fluidity. The diffusion coefficient of a protein or lipid in the membrane can be calculated from the data. (From Segen, Current Med Talk, 1995).Myosins: A diverse superfamily of proteins that function as translocating proteins. They share the common characteristics of being able to bind ACTINS and hydrolyze MgATP. Myosins generally consist of heavy chains which are involved in locomotion, and light chains which are involved in regulation. Within the structure of myosin heavy chain are three domains: the head, the neck and the tail. The head region of the heavy chain contains the actin binding domain and MgATPase domain which provides energy for locomotion. The neck region is involved in binding the light-chains. The tail region provides the anchoring point that maintains the position of the heavy chain. The superfamily of myosins is organized into structural classes based upon the type and arrangement of the subunits they contain.Focal Adhesions: An anchoring junction of the cell to a non-cellular substrate. It is composed of a specialized area of the plasma membrane where bundles of the ACTIN CYTOSKELETON terminate and attach to the transmembrane linkers, INTEGRINS, which in turn attach through their extracellular domains to EXTRACELLULAR MATRIX PROTEINS.HydrazinesPrecipitin Tests: Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.Immunoprecipitation: The aggregation of soluble ANTIGENS with ANTIBODIES, alone or with antibody binding factors such as ANTI-ANTIBODIES or STAPHYLOCOCCAL PROTEIN A, into complexes large enough to fall out of solution.Gingival Pocket: An abnormal extension of a gingival sulcus not accompanied by the apical migration of the epithelial attachment.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Permeability: Property of membranes and other structures to permit passage of light, heat, gases, liquids, metabolites, and mineral ions.Guanylate Kinase: Catalyzes the ATP-dependent PHOSPHORYLATION of GMP to generate GDP and ADP.Claudin-5: A claudin subtype that is found localized to TIGHT JUNCTIONS in VASCULAR ENDOTHELIAL CELLS. The protein was initially identified as one of several proteins which are deleted in VELOCARDIOFACIAL SYNDROME and may play an important role in maintaining the integrity of the BLOOD-BRAIN BARRIER.Microscopy, Electron, Transmission: Electron microscopy in which the ELECTRONS or their reaction products that pass down through the specimen are imaged below the plane of the specimen.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Microscopy, Immunoelectron: Microscopy in which the samples are first stained immunocytochemically and then examined using an electron microscope. Immunoelectron microscopy is used extensively in diagnostic virology as part of very sensitive immunoassays.Human Umbilical Vein Endothelial Cells: Endothelial cells that line venous vessels of the UMBILICAL CORD.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Lysophospholipids: Derivatives of PHOSPHATIDIC ACIDS that lack one of its fatty acyl chains due to its hydrolytic removal.rho-Associated Kinases: A group of intracellular-signaling serine threonine kinases that bind to RHO GTP-BINDING PROTEINS. They were originally found to mediate the effects of rhoA GTP-BINDING PROTEIN on the formation of STRESS FIBERS and FOCAL ADHESIONS. Rho-associated kinases have specificity for a variety of substrates including MYOSIN-LIGHT-CHAIN PHOSPHATASE and LIM KINASES.Immunoblotting: Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.Sphingosine: An amino alcohol with a long unsaturated hydrocarbon chain. Sphingosine and its derivative sphinganine are the major bases of the sphingolipids in mammals. (Dorland, 28th ed)Endocytosis: Cellular uptake of extracellular materials within membrane-limited vacuoles or microvesicles. ENDOSOMES play a central role in endocytosis.RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.Time-Lapse Imaging: Recording serial images of a process at regular intervals spaced out over a longer period of time than the time in which the recordings will be played back.Calcium: A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.IndazolesPhotoreceptor Cells, Invertebrate: Specialized cells in the invertebrates that detect and transduce light. They are predominantly rhabdomeric with an array of photosensitive microvilli. Illumination depolarizes invertebrate photoreceptors by stimulating Na+ influx across the plasma membrane.Mice, Knockout: Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.Cell Membrane Permeability: A quality of cell membranes which permits the passage of solvents and solutes into and out of cells.Animals, Genetically Modified: ANIMALS whose GENOME has been altered by GENETIC ENGINEERING, or their offspring.Claudins: A large family of transmembrane proteins found in TIGHT JUNCTIONS. They take part in the formation of paracellular barriers and pores that regulate paracellular permeability.Blood-Air Barrier: The barrier between capillary blood and alveolar air comprising the alveolar EPITHELIUM and capillary ENDOTHELIUM with their adherent BASEMENT MEMBRANE and EPITHELIAL CELL cytoplasm. PULMONARY GAS EXCHANGE occurs across this membrane.Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.

Cell confluence-dependent remodeling of endothelial membranes mediated by cholesterol. (1/859)

The plasma membranes of endothelial cells reaching confluence undergo profound structural and functional modifications, including the formation of adherens junctions, crucial for the regulation of vascular permeability and angiogenesis. Adherens junction formation is accompanied by the tyrosine dephosphorylation of adherens junctions proteins, which has been correlated with the strength and stability of adherens junctions. Here we show that cholesterol is a critical determinant of plasma membrane remodeling in cultures of growing cow pulmonary aortic endothelial cells. Membrane cholesterol increased dramatically at an early stage in the formation of confluent cow pulmonary aortic endothelial cell monolayers, prior to formation of intercellular junctions. This increase was accompanied by the redistribution of caveolin from a high density to a low density membrane compartment, previously shown to require cholesterol, and increased binding of the annexin II-p11 complex to membranes, consistent with other studies indicating cholesterol-dependent binding of annexin II to membranes. Furthermore, partial depletion of cholesterol from confluent cells with methyl-beta-cyclodextrin both induced tyrosine phosphorylation of multiple membrane proteins, including adherens junctions proteins, and disrupted adherens junctions. Both effects were dramatically reduced by prior complexing of methyl-beta-cyclodextrin with cholesterol. Our results reveal a novel physiological role for cholesterol regulating the formation of adherens junctions and other plasma membrane remodeling events as endothelial cells reach confluence.  (+info)

Cell volume-dependent phosphorylation of proteins of the cortical cytoskeleton and cell-cell contact sites. The role of Fyn and FER kinases. (2/859)

Cell volume affects diverse functions including cytoskeletal organization, but the underlying signaling pathways remained undefined. We have shown previously that shrinkage induces Fyn-dependent tyrosine phosphorylation of the cortical actin-binding protein, cortactin. Because FER kinase was implicated in the direct phosphorylation of cortactin, we investigated the osmotic responsiveness of FER and its relationship to Fyn and cortactin. Shrinkage increased FER activity and tyrosine phosphorylation. These effects were abolished by the Src family inhibitor PP2 and strongly mitigated in Fyn-deficient but not in Src-deficient cells. FER overexpression caused cortactin phosphorylation that was further enhanced by hypertonicity. Exchange of tyrosine residues 421, 466, and 482 for phenylalanine prevented cortactin phosphorylation by hypertonicity and strongly decreased it upon FER overexpression, suggesting that FER targets primarily the same osmo-sensitive tyrosines. Because constituents of the cell-cell contacts are substrates of Fyn and FER, we investigated the effect of shrinkage on the adherens junctions. Hypertonicity provoked Fyn-dependent tyrosine phosphorylation in beta-catenin, alpha-catenin, and p120(Cas) and caused the dissociation of beta-catenin from the contacts. This process was delayed in Fyn-deficient or PP2-treated cells. Thus, FER is a volume-sensitive kinase downstream from Fyn, and the Fyn/FER pathway may contribute to the cell size-dependent reorganization of the cytoskeleton and the cell-cell contacts.  (+info)

Myosin light chain kinase plays an essential role in S. flexneri dissemination. (3/859)

Shigella flexneri, the causitive agent of bacillary dysentery, has been shown to disseminate in colonic epithelial cells via protrusions that extend from infected cells and are endocytosed by adjacent cells. This phenomenon occurs in the region of the eukaryotic cell's adherens junctions and is inhibited by pharmacological reagents or host cell mutations that completely disrupt the junctional complex. In this study, inhibitors of the myosin light chain kinase (MLCK) were shown to dramatically decrease intercellular spread of S. flexneri but to have no inhibitory effect on bacterial entry, multiplication or actin-based motility within the host cell. Furthermore, cell-to-cell spread of Listeria monocytogenes, another bacterial pathogen that uses an actin-based mechanism to move within the eukaryotic cytoplasm and to spread from cell to cell, was not affected by the MLCK inhibitors, indicating that (1) the inhibition of S. flexneri cell-to-cell spread in treated cells is not due to a complete break down of cell-cell contacts, which was subsequently confirmed by confocal microscopy, and (2) MLCK plays a role in a S. flexneri-specific mechanism of dissemination. Myosin has been shown to play a role in a variety of membrane-based phenomena. The work presented here suggests that activation of this molecule via phosphorylation by MLCK, at the very least participates in the formation of the bacteria-containing protrusion, and could also contribute to the endocytosis of this structure by neighboring cells.  (+info)

The molecular organization of endothelial junctions and their functional role in vascular morphogenesis and permeability. (4/859)

We review here our work on the molecular and functional organization of endothelial cell-to-cell junctions. The first part of the review is dedicated to VE-cadherin, characterized by our group few years ago. This protein is a member of the large family of transmembrane adhesion proteins called cadherins. It is endothelial cell specific and plays a major role in the organization of adherens junctions. Inactivation of VE-cadherin gene or in vivo truncation of its cytoplasmic tail leads to a lethal phenotype due to the lack of correct organization of the vasculature in the embryo. We found that the defect was due to apoptosis of endothelial cells, which became unresponsive to the survival signal induced by vascular endothelial cell growth factor. Our data indicate that VE-cadherin may act as a scaffolding protein able to associate vascular endothelial cell growth factor receptor and to promote its signaling. In the second part of the review we consider another protein more recently discovered by us and called junctional adhesion molecule (JAM). This protein is a small immunoglobulin which is located at tight junctions in the endothelium and in epithelial cells. Evidence is discussed indicating that JAM takes part in the organization of tight junctions and modulates leukocyte extravasation through endothelial intercellular junctions in vitro and in vivo. The general role of tight junctions in endothelial cells is also discussed.  (+info)

Reversibility of increased microvessel permeability in response to VE-cadherin disassembly. (5/859)

We determined the role of vascular endothelial (VE)-cadherin complex in regulating the permeability of pulmonary microvessels. Studies were made in mouse lungs perfused with albumin-Krebs containing EDTA, a Ca(2+) chelator, added to study the VE-cadherin junctional disassembly. We then repleted the perfusate with Ca(2+) to restore VE-cadherin integrity. Confocal microscopy showed a disappearance of VE-cadherin immunostaining in a time- and dose-dependent manner after Ca(2+) chelation and reassembly of the VE-cadherin complex within 5 min after Ca(2+) repletion. We determined the (125)I-labeled albumin permeability-surface area product and capillary filtration coefficient (K(fc)) to quantify alterations in the pulmonary microvessel barrier. The addition of EDTA increased (125)I-albumin permeability-surface area product and K(fc) in a concentration-dependent manner within 5 min. The permeability response was reversed within 5 min after repletion of Ca(2+). An anti-VE-cadherin monoclonal antibody against epitopes responsible for homotypic adhesion augmented the increase in K(fc) induced by Ca(2+) chelation and prevented reversal of the response. We conclude that the disassembled VE-cadherins in endothelial cells are mobilized at the junctional plasmalemmal membrane such that VE-cadherins can rapidly form adhesive contact and restore microvessel permeability by reannealing the adherens junctions.  (+info)

Actin-dependent membrane association of a Drosophila epithelial APC protein and its effect on junctional Armadillo. (6/859)

BACKGROUND: The adenomatous polyposis coli (APC) protein is an important tumour suppressor in the colon. It promotes the destabilisation of free cytoplasmic beta-catenin (the vertebrate homologue of the Drosophila protein Armadillo), a critical effector of the Wnt signalling pathway. The beta-catenin protein is also a component of adherens junctions, linking these to the actin cytoskeleton. In Drosophila epithelial cells, the ubiquitous form of APC, known as E-APC, is associated with adherens junctions. This association appears to be necessary for E-APC to function in destabilising Armadillo. RESULTS: Using actin-depolymerising drugs, we established that an intact actin cytoskeleton is required for the association of E-APC with adherens junctions in the Drosophila embryo. From an analysis of profilin mutants, whose actin cytoskeleton is disrupted, we found that E-APC also requires actin filaments to associate with adhesive cell membranes in the ovary. Notably, conditions that delocalised E-APC from membranes, including a mutation in E-APC itself, caused partial detachment of Armadillo from adhesive membranes. CONCLUSIONS: Actin filaments are continuously required for E-APC to be associated with junctional membranes. These filaments may serve as tracks for E-APC to reach the adherens junctions. The failure of E-APC to do so appears to affect the integrity of junctional complexes.  (+info)

Reversal of the Ras-induced transformed phenotype by HR12, a novel ras farnesylation inhibitor, is mediated by the Mek/Erk pathway. (7/859)

We have used the selective farnesylation inhibitor HR12 [cysteine-N(methyl)valine-N(cyclohexyl) glycine-methionine-O-methyl-ester] to study the role of oncogenic Ras in cytoskeletal reorganization in Ha-ras(V12)-transformed Rat1 cells (Rat1/ras). Application of HR12 resulted in complete restoration of the cytoskeleton and associated cell adhesions disrupted by oncogenic Ras. This included an increase in the number and size of focal adhesions, accompanied by massive stress fiber formation and enhanced tyrosine phosphorylation. Furthermore, HR12 induced assembly of adherens junctions and dramatically elevated the level of the junctional components, cadherin and beta-catenin. HR12 was unable to restore the nontransformed phenotype in cells expressing farnesylation-independent, myristylated Ras. Examination of the main Ras-regulated signaling pathways revealed that HR12 induced a dose- and time-dependent decline in Erk1&2 activation (t(1/2) approximately 6 h), which correlated with the accumulation of nonfarnesylated oncogenic-Ras. Inhibition of the Mek/Erk pathway in Rat1/ras cells, using the Mek inhibitor, PD98059, resulted in complete cytoskeletal recovery, indistinguishable from that induced by HR12. Moreover, a constitutively active Mek mimicked the effect of ras transformation in Rat1 cells, and prevented HR12-induced cytoskeletal effects in Rat1/ras cells. No such effects were observed after treatment of Rat1/ras cells with the phosphatidylinositol 3-kinase inhibitor LY294002. These findings establish the Mek/Erk pathway as the dominant pathway involved in conferring the cytoskeletal and junctional manifestations of the Ras-induced transformed phenotype.  (+info)

Endothelial adherens junctions. (8/859)

The principle of the molecular organization of adherens junctions follows a uniform pattern, which is found in epithelial, muscular, neuroneal as well as in endothelial cells and is highly conserved among species. Transmembrane molecules of the cadherin family link to catenins, which anchor the adhesion plaque to the cytoskeleton. The kind of cadherin used in adherens junctions is cell-type specific, vascular endothelial (VE)-cadherin is specific for endothelial cells. The assembly and disassembly of the cadherin/catenin complex is dynamic and regulated by growth factors. The functional status of adherens junctions controls endothelial cell-to-cell adhesion, cell scattering, vessel morphogenesis and has intracellular signaling properties, thereby playing an important role in vasculogenesis and angiogenesis.  (+info)

Endothelial adherens junctions at a glance | Journal of Cell ScienceEndothelial adherens junctions at a glance | Journal of Cell Science
Adherens junctions have an important role in the control of vascular permeability. These structures are located at cell-to-cell contacts, mediate cell adhesion and transfer intracellular signals. Adhesion is mediated by cadherins, which interact homophilically in trans and form lateral interactions in cis. VE-cadherin (also known as CDH5 and CD144) is the major component of endothelial adherens junctions and is specific to endothelial cells. Endothelial cells from different types of vessels, such as lymphatic vessels, arteries and veins, show differences in junction composition and organization. Vascular permeability is increased by modifications in the expression and function of adherens junction components. In some cases these defects might be cause of pathology. In this Cell Science at a Glance article, we present the example of the so-called cerebral cavernous malformation (CCM), where adherens junctions are dismantled in the vessels contributing to brain microcirculation. This causes the ...
Transient and Steady-State Effects of Shear Stress on Endothelial Cell Adherens Junctions | Circulation ResearchTransient and Steady-State Effects of Shear Stress on Endothelial Cell Adherens Junctions | Circulation Research
The structure and physiology of the endothelial cells that line the mammalian vasculature are greatly influenced by the shear stresses that are continuously imposed on them by blood flow. The most obvious structural responses of endothelium to shear stress are changes in cell shape and orientation; in areas of low or inconsistent shear stress in vivo, or when cells are maintained in static culture, endothelial cells assume a cuboidal, cobblestone morphology, whereas they elongate and align in the direction of flow when shear stress is moderate or high.1 2 These morphological changes are adaptive in that they reduce the spatial fluctuations in shear stress and the maximum shears to which the cells are exposed.3 Shape change of cells within monolayers probably necessitate changes in the interaction of individual cells with their neighbors at cell-cell junctions; however, changes in endothelial cell-cell contacts during responses to altered shear stress have not been examined. Endothelial cells ...
Pathway Central: Remodeling of Adherens JunctionsPathway Central: Remodeling of Adherens Junctions
The intercellular Adherens Junctions (AJs) are specialized sub-apical structures that function as principle mediators of cell-cell adhesion. Their disassembly correlates with a loss of cell-cell contact and an acquisition of migratory potential. The Adherens Junctions have a crucial role both as sensors of extracellular stimuli and in regulating the dynamics of epithelial cell sheets or with neighboring cells. Cadherins, the Type-I transmembrane proteins of the Adherens Junctions, are principally responsible for homotypic cell-cell adhesion. E-Cadherin, which is present primarily in epithelia, is the best-characterized Cadherin and represents the prototype of classical Cadherins. The extracellular domain of E-Cadherin binds to Ca2+ (Calcium) and forms complexes with the extracellular domains of E-Cadherin molecules on neighboring cells. The cytoplasmic domain of E-Cadherin associates with cytosolic proteins called Catenins (Alpha, Beta and p120), which in turn provide anchorage to the Actin ...
adherens junction facts, information, pictures | Encyclopedia.com articles about adherens junctionadherens junction facts, information, pictures | Encyclopedia.com articles about adherens junction
Get information, facts, and pictures about adherens junction at Encyclopedia.com. Make research projects and school reports about adherens junction easy with credible articles from our FREE, online encyclopedia and dictionary.
YAP and TAZ regulate adherens junction dynamics and endothelial cell distribution during vascular development - MDC RepositoryYAP and TAZ regulate adherens junction dynamics and endothelial cell distribution during vascular development - MDC Repository
Formation of blood vessel networks by sprouting angiogenesis is critical for tissue growth, homeostasis and regeneration. How endothelial cells arise in adequate numbers and arrange suitably to shape functional vascular networks is poorly understood. Here we show that YAP/TAZ promote stretch-induced proliferation and rearrangements of endothelial cells whilst preventing bleeding in developing vessels. Mechanistically, YAP/TAZ increase the turnover of VE-Cadherin and the formation of junction associated intermediate lamellipodia, promoting cell migration whilst maintaining barrier function. This is achieved in part by lowering BMP signalling. Consequently, the loss of YAP/TAZ in the mouse leads to stunted sprouting with local aggregation as well as scarcity of endothelial cells, branching irregularities and junction defects. Forced nuclear activity of TAZ instead drives hypersprouting and vascular hyperplasia. We propose a new model in which YAP/TAZ integrate mechanical signals with BMP signaling ...
KEGG PATHWAY: Adherens junction - Homo sapiens (human)KEGG PATHWAY: Adherens junction - Homo sapiens (human)
Cell-cell adherens junctions (AJs), the most common type of intercellular adhesions, are important for maintaining tissue architecture and cell polarity and can limit cell movement and proliferation. At AJs, E-cadherin serves as an essential cell adhesion molecules (CAMs). The cytoplasmic tail binds beta-catenin, which in turn binds alpha-catenin. Alpha-catenin is associated with F-actin bundles directly and indirectly. The integrity of the cadherin-catenin complex is negatively regulated by phosphorylation of beta-catenin by receptor tyrosine kinases (RTKs) and cytoplasmic tyrosine kinases (Fer, Fyn, Yes, and Src), which leads to dissociation of the cadherin-catenin complex. Integrity of this complex is positively regulated by beta -catenin phosphorylation by casein kinase II, and dephosphorylation by protein tyrosine phosphatases. Changes in the phosphorylation state of beta-catenin affect cell-cell adhesion, cell migration and the level of signaling beta-catenin. Wnt signaling acts as a ...
KEGG PATHWAY: Adherens junction - Homo sapiens (human)KEGG PATHWAY: Adherens junction - Homo sapiens (human)
Cell-cell adherens junctions (AJs), the most common type of intercellular adhesions, are important for maintaining tissue architecture and cell polarity and can limit cell movement and proliferation. At AJs, E-cadherin serves as an essential cell adhesion molecules (CAMs). The cytoplasmic tail binds beta-catenin, which in turn binds alpha-catenin. Alpha-catenin is associated with F-actin bundles directly and indirectly. The integrity of the cadherin-catenin complex is negatively regulated by phosphorylation of beta-catenin by receptor tyrosine kinases (RTKs) and cytoplasmic tyrosine kinases (Fer, Fyn, Yes, and Src), which leads to dissociation of the cadherin-catenin complex. Integrity of this complex is positively regulated by beta -catenin phosphorylation by casein kinase II, and dephosphorylation by protein tyrosine phosphatases. Changes in the phosphorylation state of beta-catenin affect cell-cell adhesion, cell migration and the level of signaling beta-catenin. Wnt signaling acts as a ...
KEGG PATHWAY: Adherens junction - Homo sapiens (human)KEGG PATHWAY: Adherens junction - Homo sapiens (human)
Cell-cell adherens junctions (AJs), the most common type of intercellular adhesions, are important for maintaining tissue architecture and cell polarity and can limit cell movement and proliferation. At AJs, E-cadherin serves as an essential cell adhesion molecules (CAMs). The cytoplasmic tail binds beta-catenin, which in turn binds alpha-catenin. Alpha-catenin is associated with F-actin bundles directly and indirectly. The integrity of the cadherin-catenin complex is negatively regulated by phosphorylation of beta-catenin by receptor tyrosine kinases (RTKs) and cytoplasmic tyrosine kinases (Fer, Fyn, Yes, and Src), which leads to dissociation of the cadherin-catenin complex. Integrity of this complex is positively regulated by beta -catenin phosphorylation by casein kinase II, and dephosphorylation by protein tyrosine phosphatases. Changes in the phosphorylation state of beta-catenin affect cell-cell adhesion, cell migration and the level of signaling beta-catenin. Wnt signaling acts as a ...
Drosophila p120catenin plays a supporting role in cell adhesion but is not an essential adherens junction component | JCBDrosophila p120catenin plays a supporting role in cell adhesion but is not an essential adherens junction component | JCB
The ability of cells to assemble into tissues, organs, and animals depends on cell-cell adhesion (for reviews see Yap et al., 1997; Tepass et al., 2001). The central mediators of cell adhesion are proteins of the cadherin-catenin complex, which localize to adherens junctions (AJs),* adhesive junctions near the apical end of the lateral cell interface of epithelial cells. Transmembrane cadherins mediate homophilic adhesion, whereas catenins anchor cadherins to actin at adhesion sites. β-catenin (β-cat) and its Drosophila ortholog Armadillo (Arm) bind directly to both the distal region of the cadherin cytoplasmic tail and to α-catenin (α-cat). α-Cat interacts with actin both directly and indirectly. Cadherins, β-cat, and α-cat play essential roles in adhesion-genetic experiments in animals and in cell culture reveal that adhesion is abolished in their absence. Consistent with this, the cadherin tail is important for strong cell-cell adhesion, at least in some cells.. However, ...
Cell confluence regulates tyrosine phosphorylation of adherens junction components in endothelial cells | Journal of Cell...Cell confluence regulates tyrosine phosphorylation of adherens junction components in endothelial cells | Journal of Cell...
In src- and ras-transformed cells, tyrosine phosphorylation of adherens junction (AJ) components is related to impairment of cell-cell adhesion. In this paper we report that in human endothelial cells (EC), tyrosine phosphorylation of AJ can be a physiological process regulated by cell density. Immunofluorescence analysis revealed that a phosphotyrosine (P-tyr) antibody could stain cell-cell junctions only in sparse or loosely confluent EC, while the staining was markedly reduced in tightly confluent cultures. This process was reversible, since on artificial wounding of EC monolayers, the cells at the migrating front reacquired P-tyr labelling at cell contacts. In EC, the major cadherin at intercellular AJ is the cell-type-specific VE-cadherin. We therefore analyzed whether this molecule was at least in part responsible for the changes in P-tyr content at cell junctions. Tyrosine phosphorylation of VE-cadherin, beta-catenin and p120, occurred in looser AJ, i.e. in recently confluent cells, and ...
Plus itPlus it
Cadherins mediate homophilic, Ca2+-dependent cellular adhesion at adherens junctions. Experiments in MDCK cells, which provide a model for cadherins at adherens junctions, demonstrated the formation of cadherin-NPRAP-ABP complexes dependent on the expression of NPRAP and the integrity of the NPRAP-ABP interaction, and the formation of NPRAP-ABP-GluR2 complexes dependent on expression of ABP. This suggests that the proposed cadherin-NPRAP-ABP-GluR2 complexes can indeed form in cells. Two dominant-negative mutants of NPRAP were assayed for their effects on GluR2. One mutant does not interact with ABP, GRIP, or PSD-95, and the second binds these scaffolding proteins but does not bind to cadherins. Both mutants reduced GluR2 surface levels. This suggests that cadherin-NPRAP-ABP-GluR2 complexes contribute to the surface stabilization of GluR2. In neurons, adherens junction structures containing cadherins are found at synapses (Takeichi and Abe, 2005). This suggests that the AMPARs that are anchored ...
Caveolin-1 says NO to permeability | JCBCaveolin-1 says NO to permeability | JCB
Proteins and other substances can cross the endothelial layer that lines a blood vessel via two routes. Caveolin-1 is essential for both, Siddiqui et al. show.. Researchers already knew that caveolin-1 was necessary for transcellular protein trafficking, in which macromolecules such as albumin enter an endothelial cell from the bloodstream and exit on the tissue side. Caveolae swallow these molecular travelers and bundle them into vesicles that wend through the cell. In an alternative pathway, known as the paracellular route, molecules slip between the cells of the endothelial layer, passing through the adherens junctions that fasten adjacent cells together. Previous work showed that adherens junctions become permeable in mice lacking caveolin-1, suggesting that the protein helps seal the junctions.. Siddiqui et al. dissected the molecular chain of events that connects caveolin-1 to adherens junction integrity. Loss of caveolin-1 activated the enzyme eNOS, which spawns nitric oxide (NO) that ...
E-N-cadherin heterodimers define novel adherens junctions connecting endoderm-derived cells.E-N-cadherin heterodimers define novel adherens junctions connecting endoderm-derived cells.
Intercellular junctions play a pivotal role in tissue development and function and also in tumorigenesis. In epithelial cells, decrease or loss of E-cadherin, the hallmark molecule of adherens junctions (AJs), and increase of N-cadherin are widely thought to promote carcinoma progression and metastasis. In this paper, we show that this "cadherin switch" hypothesis does not hold for diverse endoderm-derived cells and cells of tumors derived from them. We show that the cadherins in a major portion of AJs in these cells can be chemically cross-linked in E-N heterodimers. We also show that cells possessing E-N heterodimer AJs can form semistable hemihomotypic AJs with purely N-cadherin-based AJs of mesenchymally derived cells, including stroma cells. We conclude that these heterodimers are the major AJ constituents of several endoderm-derived tissues and tumors and that the prevailing concept of antagonistic roles of these two cadherins in developmental and tumor biology has to be reconsidered. ...
Volume 4.00 | Jan 07 - Endothelial Cell NewsVolume 4.00 | Jan 07 - Endothelial Cell News
TFEB Controls Vascular Development by Regulating the Proliferation of Endothelial Cells In endothelial cells, transcription factor EB (TFEB) depletion halted proliferation at the G1-S transition by inhibiting the cyclin-dependent kinase 4/retinoblastoma pathway. TFEB-deficient cells attempted to compensate for this limitation by increasing VEGFR2 levels at the plasma membrane via microRNA-mediated mechanisms and controlled membrane trafficking. [EMBO J] Full Article , Graphical Abstract SENCR Stabilizes Vascular Endothelial Cell Adherens Junctions through Interaction with CKAP4 Levels of SENCR RNA were shown to be elevated in several differentiated human endothelial cell (EC) lineages subjected to laminar shear stress. SENCR loss-of-function studies disclosed perturbations in EC membrane integrity resulting in increased EC permeability. [Proc Natl Acad Sci USA] Abstract Engineering an Environment for the Study of Fibrosis: A 3D Human Muscle Model with Endothelium Specificity and Endomysium The ...
Requirements for adherens junction components in the interaction between epithelial tissues during dorsal closure in Drosophila...Requirements for adherens junction components in the interaction between epithelial tissues during dorsal closure in Drosophila...
When DArcy Wentworth Thompsons On Growth and Form was published 100 years ago, it raised the question of how biological forms arise during development and across evolution. In light of the advances in molecular and cellular biology since then, a succinct modern view of the question states: how do genes encode geometry? Our new special issue is packed with articles that use mathematical and physical approaches to gain insights into cell and tissue patterning, morphogenesis and dynamics, and that provide a physical framework to capture these processes operating across scales.. Read the Editorial by guest editors Thomas Lecuit and L. Mahadevan, as they provide a perspective on the influence of DArcy Thompsons work and an overview of the articles in this issue.. ...
Mammalian diaphanous 1 mediates a pathway for E-cadherin to stabilize epithelial barriers through junctional contractility - UQ...Mammalian diaphanous 1 mediates a pathway for E-cadherin to stabilize epithelial barriers through junctional contractility - UQ...
Formins are a diverse class of actin regulators that influence filament dynamics and organization. Several formins have been identified at epithelial adherens junctions, but their functional impact remains incompletely understood. Here, we tested the hypothesis that formins might affect epithelial interactions through junctional contractility. We focused on mDia1, which was recruited to the zonula adherens (ZA) of established Caco-2 monolayers in response to E-cadherin and RhoA. mDia1 was necessary for contractility at the ZA, measured by assays that include a FRET-based sensor that reports molecular-level tension across αE-catenin. This reflected a role in reorganizing F-actin networks to form stable bundles that resisted myosin-induced stress. Finally, we found that the impact of mDia1 ramified beyond adherens junctions to stabilize tight junctions and maintain the epithelial permeability barrier. Therefore, control of tissue barrier function constitutes a pathway for cadherin-based ...
COMMENTARY See related article on page 1182 Talk to the Hand ‘Cause the Nucleus Aint Listening: Adhesion, Communication, and...COMMENTARY See related article on page 1182 Talk to the Hand ‘Cause the Nucleus Ain't Listening: Adhesion, Communication, and...
Involvement of nectin in the localization of IQGAP1 at the cell-cell adhesion sites through the actin cytoskeleton in Madin-Darby canine kidney cells. Katata, Tatsuo; Irie, Kenji; Fukuhara, Atsunori; Kawakatsu, Tomomi; Yamada, Akio; Shimizu, Kazuya; Takai, Yoshimi // Oncogene;4/10/2003, Vol. 22 Issue 14, p2097 IQGAP1, a putative downstream target of the Rho family small G proteins, Cdc42 and Rac, localizes at adherens junctions (AJs) in epithelial cells. It has been suggested that IQGAP1 localizes at AJs through its binding to ?-catenin, and negatively regulates the E-cadherin-mediated cell-cell... ...
Thrombospondin-1 induces tyrosine phosphorylation of adherens junction proteins and regulates an endothelial paracellular...Thrombospondin-1 induces tyrosine phosphorylation of adherens junction proteins and regulates an endothelial paracellular...
Thrombospondin-1 (TSP) induces endothelial cell (EC) actin reorganization and focal adhesion disassembly and influences multiple EC functions. To determine whether TSP might regulate EC-EC interactions, we studied the effect of exogenous TSP on the movement of albumin across postconfluent EC monolayers. TSP increased transendothelial albumin flux in a dose-dependent manner at concentrations ≥1 μg/ml (2.2 nM). Increases in albumin flux were observed as early as 1 h after exposure to 30 μg/ml (71 nM) TSP. Inhibition of tyrosine kinases with herbimycin A or genistein protected against the TSP-induced barrier dysfunction by >80% and >50%, respectively. TSP-exposed monolayers exhibited actin reorganization and intercellular gap formation, whereas pretreatment with herbimycin A protected against this effect. Increased staining of phosphotyrosine-containing proteins was observed in plaque-like structures and at the intercellular boundaries of TSP-treated cells. In the presence of protein tyrosine ...
Hakai reduces cell-substratum adhesion and increases epithelial cell invasion | Springer for Research & DevelopmentHakai reduces cell-substratum adhesion and increases epithelial cell invasion | Springer for Research & Development
Background The dynamic regulation of cell-cell adhesions is crucial for developmental processes, including tissue formation, differentiation and motility. Adherens junctions are important components...
How is cadherin recruited to the adherens junction? | MBInfoHow is cadherin recruited to the adherens junction? | MBInfo
The role of cis interactions between cadherins is less established, with no clear consensus on precisely which domains are engaged in these interactions (as reviewed in [3]). Recent evidence however suggests that these interactions are not required to facilitate trans interactions [8], whereas trans interactions are required in order for cis interactions to occur [9]. Computational modeling has been carried out to determine how these interactions, both trans and cis, result in the formation of a stable junction [9]. These in silico experiments showed that cadherins freely floating in the plasma membrane are not able to successfully form trans dimers unless their diffusion is slowed down in some manner. The introduction of a diffusion trap permitted the formation of trans dimers, however without subsequent cis interactions these trans dimers were unable to coalesce to form an ordered structure. Though weak, cis interactions were nonetheless shown to be vital for junction formation. Moreover, the ...
Development of a High-Throughput Assay for Identifying Inhibitors - Page 125Development of a High-Throughput Assay for Identifying Inhibitors - Page 125
Signal propagation from your cell membrane to a promoter may induce gene expression. Nuclear deposition dynamics were originally rapid cell routine unbiased and differed significantly from LiCl arousal presumed to imitate Wnt signaling. β-catenin amounts elevated concurrently at adherens junctions as well as the centrosome and a membrane-centrosome transportation program was uncovered. Correlating β-catenin nuclear dynamics to transcriptional activation demonstrated which the nuclear accumulation price of change from the signaling aspect and not real protein amounts correlated with the transcriptional result from the pathway. DOI: http://dx.doi.org/10.7554/eLife.16748.001 gene alter in living individual cells. These analyses had been Dorzolamide HCL initially performed within a people of cells and verified that β-catenin quickly accumulates after a Wnt indication which the gene turns into activated. Specific cells within a people can react in different ways to signaling occasions. To assess ...
Dual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis | DevelopmentDual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis | Development
When DArcy Wentworth Thompsons On Growth and Form was published 100 years ago, it raised the question of how biological forms arise during development and across evolution. In light of the advances in molecular and cellular biology since then, a succinct modern view of the question states: how do genes encode geometry? Our new special issue is packed with articles that use mathematical and physical approaches to gain insights into cell and tissue patterning, morphogenesis and dynamics, and that provide a physical framework to capture these processes operating across scales.. Read the Editorial by guest editors Thomas Lecuit and L. Mahadevan, as they provide a perspective on the influence of DArcy Thompsons work and an overview of the articles in this issue.. ...
Genatlas sheetGenatlas sheet
has likely a key role in regulating recycling through the RAB11A-dependent perinuclear recycling compartment, and links the regulation of adherens junctions to recycling to allow dynamic modulation of intercellular adhesion ...
User:Z3217345 - CellBiologyUser:Z3217345 - CellBiology
Group 5: Adherens Junctions Introduction: The introductions sentence structure is a bit difficult to understand. Whilst much of the content is there, it could be written a bit clearer. Also a bit of an overview on what will be discussed would be helpful for the reader. History: The history has too few enteries, however the layout makes it easy to read and understand. Structure: The structure is informative and the adjoining pictures are good, giving the reader an idea of their form on a molecular and what they actually look like through a microscope. Function: Whilst the section is clearer, it could be made even more accessible by the addition of subheadings for the main functions. Importance And Regulation: The link to the picture at the beginning of this section does look very detailed and important to your subject, however it may be better to either explain the link or upload the actual picture to the page. Also the extracellular regulator sentence would be more informative and professional ...
AJAP1 Gene - GeneCards | AJAP1 Protein | AJAP1 AntibodyAJAP1 Gene - GeneCards | AJAP1 Protein | AJAP1 Antibody
Complete information for AJAP1 gene (Protein Coding), Adherens Junctions Associated Protein 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
PLEKHA5 polyclonal antibody - (PAB22925) - Products - AbnovaPLEKHA5 polyclonal antibody - (PAB22925) - Products - Abnova
Rabbit polyclonal antibody raised against recombinant PLEKHA5. Recombinant protein corresponding to amino acids of human PLEKHA5. (PAB22925) - Products - Abnova
PLEKHA3 antibody | acris-antibodies.comPLEKHA3 antibody | acris-antibodies.com
Kit Component:- KN313440G1, Plekha3 gRNA vector 1 in pCas-Guide vector- KN313440G2, Plekha3 gRNA vector 2 in pCas-Guide vector- KN313440D, donor…
PLEKHA7 ORF clone FXC01027 - KOP/KDRIPLEKHA7 ORF clone FXC01027 - KOP/KDRI
pF1KB9403 6929 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGGCGGCGGCG ACGGTCGGGCGGGACACTTTACCTGAGCATTGGTCCTACGGGGTGTGCCGGGATGGCCGC GTCTTCTTCATCAATGACCAGCTCCGCTGCACGACCTGGCTGCATCCGCGCACCGGGGAG CCCGTCAACTCGGGCCACATGATCCGCTCAGACCTGCCCCGCGGCTGGGAGGAGGGCTTC ACGGAGGAGGGCGCCAGCTACTTCATCGACCATAACCAGCAGACCACAGCATTCAGGCAT CCTGTGACGGGACAGTTTTCTCCAGAAAATAGTGAATTCATTCTTCAAGAAGAGCCGAAT CCACATATGTCGAAGCAAGACAGAAACCAAAGACCGTCCAGCATGGTCAGTGAAACATCC ACGGCTGGGACCGCCTCCACCCTGGAGGCCAAGCCTGGACCCAAGATCATAAAGTCCAGC AGTAAAGTCCACAGCTTTGGGAAGAGAGACCAGGCCATTCGGAGGAACCCCAATGTTCCC GTGGTGGTGAGGGGCTGGCTGCACAAGCAGGACAGTTCTGGGATGAGGCTGTGGAAAAGG AGGTGGTTTGTGCTTGCTGATTACTGCTTATTTTACTATAAAGACAGCCGAGAAGAAGCG GTCCTCGGGAGCATCCCCTTGCCCAGCTACGTGATCTCTCCTGTGGCCCCTGAGGATCGC ATAAGCCGCAAATATTCCTTTAAGGCTGTGCACACGGGGATGCGAGCGCTCATCTATAAC AGCTCCACAGCGGGCTCTCAGGCCGAGCAGTCAGGCATGAGGACCTACTACTTCAGTGCC GACACCCAGGAGGACATGAACGCTTGGGTCAGGGCCATGAACCAGGCTGCACAGGTGCTG ...
Cortactin is a scaffolding platform for the E-cadherin adhesion complex and is regulated by protein kinase D1 phosphorylationCortactin is a scaffolding platform for the E-cadherin adhesion complex and is regulated by protein kinase D1 phosphorylation
Dynamic regulation of cell-cell adhesion by the coordinated formation and dissolution of E-cadherin-based adherens junctions is crucial for tissue homeostasis. The actin-binding protein cortactin interacts with E-cadherin and enables F-actin accumulation at adherens junctions. Here, we were interested to study the broader functional interactions of cortactin in adhesion complexes. In line with literature, we demonstrate that cortactin binds to E-cadherin, and that a posttranslational modification of cortactin, RhoA-induced phosphorylation by protein kinase D1 (PKD1;also known as PRKD1) at S298, impairs adherens junction assembly and supports their dissolution. Two new S298-phosphorylation-dependent interactions were also identified, namely, that phosphorylation of cortactin decreases its interaction with beta-catenin and the actin-binding protein vinculin. In addition, binding of vinculin to beta-catenin, as well as linkage of vinculin to F-actin, are also significantly compromised upon ...
Zona adherens | definition of zona adherens by Medical dictionaryZona adherens | definition of zona adherens by Medical dictionary
Looking for online definition of zona adherens in the Medical Dictionary? zona adherens explanation free. What is zona adherens? Meaning of zona adherens medical term. What does zona adherens mean?
Abstract 17951: S-glutathionylation of Rac1 is a Novel Mechanism of Vascular Barrier Dysfunction in Diabetes Mellitus |...Abstract 17951: S-glutathionylation of Rac1 is a Novel Mechanism of Vascular Barrier Dysfunction in Diabetes Mellitus |...
Background: - Protein S-glutathionylation (Pr-SSG) is a prevalent form of oxidative modification of reactive cysteines and serves as an important mode of redox signaling. Vascular redox dysregulation and impaired barrier function have long been recognized as early vascular alterations in diabetes, a major risk factor for atherosclerotic cardiovascular diseases, but the mechanistic link of Pr-SSG to the metabolic stress-induced endothelial cell (EC) hyper-permeability is not established and being investigated in the present study.. Methods and Results: - elevated Pr-SSG was observed in ECs isolated from patients with type-2 diabetes and atherosclerotic lesions of ApoE deficient (ApoE-/-) mice, concurring with a decrease in glutaredoxin-1 (Glrx-1), a specific deglutathionylation enzyme. Exposure of human aortic ECs to diabetic conditions increased the formation of Pr-SSG and permeability that was associated with the disassembly of cell adherens junctions and cortical actin structures, all of which ...
Fluid shear stress-induced reorganization of adherens junctions in hum by Jon A. Ukropec"Fluid shear stress-induced reorganization of adherens junctions in hum" by Jon A. Ukropec
Ukropec, Jon A., "Fluid shear stress-induced reorganization of adherens junctions in human endothelial cells" (1999). Theses. 24 ...
Cambridge Bioscience: ViraDuctin™ Adenovirus Transduction Reagent CitationsCambridge Bioscience: ViraDuctin™ Adenovirus Transduction Reagent Citations
Haidari, M. et al. (2014). Disruption of endothelial adherens junctions by high glucose is mediated by protein kinase C-β-dependent vascular endothelial cadherin tyrosine phosphorylation. Cardiovasc Diabetol. 13:112.. Ackerman, W. et al. (2008). Nuclear Factor-kappa B regulates inducible prostaglandin E synthase expression in human amnion mesenchymal cells. Biol. Reprod. 78:68-76. ...
Dr Jim Ralphs - Pobl - Prifysgol Caerdydd - Pobl - Prifysgol CaerdyddDr Jim Ralphs - Pobl - Prifysgol Caerdydd - Pobl - Prifysgol Caerdydd
The function of connective tissues depends on the organisation of their collagen fibres, arranged in parallel fibres, in parallel sheets (lamellae; annulus fibrosus, cornea, bone), or with more complex or random, orientation (cartilage, dermis, loose connective tissue).. My research is on roles of the cytoskeleton and cell-cell interactions in control of secretion and orientation of the extracellular matrix in fibrous connective tissues.. In tendons, longitudinal rows of fibroblasts are embedded between parallel collagen fibre bundles. Along a row, cells are connected by gap junctions made of connexins 43 and 32, and by adherens junctions. The adherens junctions link short lengths of actin stress fibres end to end from cell to cell along the cell row.. Gap junctions modulate cell response to load: antisense downregulation of of connexin 43 enhances, and connexin 32 depresses, matrix secretion. Adherens junction and stress fibre components are upregulated by load suggesting that cells may bind ...
Cell Behavior and Mechanical Forces in Cylindrical Epithelia | Luschnig LabCell Behavior and Mechanical Forces in Cylindrical Epithelia | Luschnig Lab
Although many organ functions rely on epithelial tubes with correct dimensions, mechanisms underlying tube size control are poorly understood. We analyse the cellular mechanism of tracheal tube elongation in Drosophila, and describe an essential role of the conserved tyrosine kinase Src42A in this process. We show that Src42A is required for polarized cell shape changes and cell rearrangements that mediate tube elongation. In contrast, diametric expansion is controlled by apical secretion independently of Src42A. Constitutive activation of Src42A induces axial cell stretching and tracheal overelongation, indicating that Src42A acts instructively in this process. We propose that Src42A-dependent recycling of E-Cadherin at adherens junctions is limiting for cell shape changes and rearrangements in the axial dimension of the tube. Thus, we define distinct cellular processes that independently control axial and diametric expansion of a cylindrical epithelium in a developing organ. Whereas ...
Desmoplakin is essential in epidermal sheet formation.Desmoplakin is essential in epidermal sheet formation.
Vasioukhin V., Bowers E., Bauer C., Degenstein L., Fuchs E.. We have generated an epidermis-specific desmoplakin (DP) mouse knockout, and show that epidermal integrity requires DP; mechanical stresses to DP-null skin cause intercellular separations. The number of epidermal desmosomes in DP-null skin is similar to wild type (WT), but they lack keratin filaments, which compromise their function. DP-null keratinocytes have few desmosomes in vitro, and are unable to undergo actin reorganization and membrane sealing during epithelial sheet formation. Adherens junctions are also reduced. In vitro, DP transgene expression rescues these defects. DP is therefore required for assembly of functional desmosomes, maintaining cytoskeletal architecture and reinforcing membrane attachments essential for stable intercellular adhesion.. Nat. Cell Biol. 3:1076-1085(2001) [PubMed] [Europe PMC] ...
XIRP2 - WikipediaXIRP2 - Wikipedia
Xin actin-binding repeat-containing protein 2 is a protein that in humans is encoded by the XIRP2 gene. GRCh38: Ensembl release 89: ENSG00000163092 - Ensembl, May 2017 GRCm38: Ensembl release 89: ENSMUSG00000027022 - Ensembl, May 2017 "Human PubMed Reference:". "Mouse PubMed Reference:". Huang HT, Brand OM, Mathew M, Ignatiou C, Ewen EP, McCalmon SA, Naya FJ (Dec 2006). "Myomaxin is a novel transcriptional target of MEF2A that encodes a Xin-related alpha-actinin-interacting protein". J Biol Chem. 281 (51): 39370-9. doi:10.1074/jbc.M603244200. PMID 17046827. Sinn HW, Balsamo J, Lilien J, Lin JJ (Aug 2002). "Localization of the novel Xin protein to the adherens junction complex in cardiac and skeletal muscle during development". Dev Dyn. 225 (1): 1-13. doi:10.1002/dvdy.10131. PMID 12203715. Pacholsky D, Vakeel P, Himmel M, Lowe T, Stradal T, Rottner K, Furst DO, van der Ven PF (Oct 2004). "Xin repeats define a novel actin-binding motif". J Cell Sci. 117 (Pt 22): 5257-68. doi:10.1242/jcs.01406. ...
Association of the -160 C>A Polymorphism in the CDH1 Promoter with Gastric Cancer: A Case-control...Association of the -160 C>A Polymorphism in the CDH1 Promoter with Gastric Cancer: A Case-control...
E-cadherin is a tumor suppressor protein that plays a crucial role in cell-cell adherens junction and tissue architecture and it is hypothesized to participate in carcinogenesis. It has been shown that a polymorphism in the upstream of the transcription start site of the CDH1 gene affects E-cadherin transcriptional regulation and seems to be associated with a variety of cancers. For the first time, we investigated the association of the rs16260 in the 5-untranslated region of the CDH1 gene with gastric cancer in Iranian population. Seventy- eight patients with gastric cancer and 72 healthy individuals were included and genotyped for this SNP using the PCR-RFLP method. Our results showed that the frequency of the AA genotype in gastric cancer patients (16 of 78, 20.5%) was higher than healthy individuals (9 of 72, 12.5%), the frequency of the A allele in the patients group was higher than controls (OR=1.231, 95% CI= 0.772-1.962, p-value= 0.383), but statistical analysis revealed the absence of
Lmo7 - LMO7a - Rattus norvegicus (Rat) - Lmo7 gene & proteinLmo7 - LMO7a - Rattus norvegicus (Rat) - Lmo7 gene & protein
apical plasma membrane, cell-cell adherens junction, focal adhesion, actinin binding, protein C-terminus binding, ubiquitin-protein transferase activity, cell-cell adhesion
Plus itPlus it
KAI1 (CD82) belongs to the transmembrane 4 superfamily in which members have inhibitory effects on tumor cell motility and metastasis. During reverse transcription-PCR analysis, we found a splice variant of KAI1 (spliced-KAI1) in which exon 7 was deleted. This exon encodes the 28 amino acids that span from the distal part of the second extracellular loop to the proximal part of the fourth transmembrane region. Expression of spliced-KAI1 was observed in metastatic tissues of gastric cancer patients with poor prognosis after operation. Genomic DNA analysis revealed that this variant was derived from the alternative splicing of exon 7. Immunoprecipitation showed that the interaction of spliced-KAI1 with integrin α3β1 was weaker than that of wild-type KAI1. Wild-type KAI1, but not spliced-KAI1, colocalized with E-cadherin, an adherens junction protein. Also, mouse colon adenocarcinoma cells stably expressing spliced-KAI1 (CT-26/spliced-KAI1) showed increased in vivo tumorigenicity, as well as ...
FENS Forum 2004 - AbstractsFENS Forum 2004 - Abstracts
LOSS OF DELTA-CATENIN, A NEURONAL ADHERENS JUNCTION PROTEIN INTERACTING WITH PRESENILIN-1, LEADS TO SEVERE IMPAIRMENTS IN LEARNING AND SYNAPTIC PLASTICITY, AND MAY UNDERLIE THE MENTAL RETARDATION IN CRI-DU-CHAT SYNDROME.. A040.14. Poster 46 - Sun 11/07, 16:00 - Hall ...
The Importance of Cell Biology: Cells and Molecules are at the Root of Tissue Functions: Kathleen Green Lab: Feinberg School of...The Importance of Cell Biology: Cells and Molecules are at the Root of Tissue Functions: Kathleen Green Lab: Feinberg School of...
To understand tissue morphogenesis and disease pathogenesis, ultimately we must understand what happens at the cellular and molecular levels. To do this, we use a number of techniques. To identify new protein-protein interactions important for establishing the machinery through which junctions carry out structural and signaling functions, we use in vitro biochemistry and a variety of protein interaction screens, including recently emerging Bio-ID proteomic approaches that allow for mapping nearest neighbors in cells and tissues in situ. How these protein interactions are regulated by post-translational modifications, including phosphorylation and protein methylation is also being uncovered through the use of mass spectrometry approaches.. To look at the importance of these protein interactions in cells, state-of-the-art optical imaging techniques are being employed. Fluorescently-tagged wild type and mutant desmosome and adherens junction molecules are tracked during intercellular junction ...
A presenilin‐1/γ‐secretase cleavage releases the E‐cadherin intracellular domain and regulates disassembly of adherens...A presenilin‐1/γ‐secretase cleavage releases the E‐cadherin intracellular domain and regulates disassembly of adherens...
Disassembly of CAJs and abrogation of cadherin‐mediated cell-cell adhesion is involved in changes of cell state including differentiation, apoptosis and tumor metastasis. For example, induction of apoptotic cell death or Ca2+ imbalance involves cleavage of cadherins and disassembly of CAJs (Herren et al., 1998; Ito et al., 1999; Vallorosi et al., 2000; Steinhusen et al., 2001). Furthermore, in the case of metastasis of epithelia tumors, inhibition of E‐cadherin‐mediated cell-cell adhesion is promoted by cleavage and secretion of extracytoplasmic E‐cadherin by MMPs (Lochter et al., 1997; Christofori and Semb, 1999; Noe et al., 2001). Although in some cell cultures PS1 was found mainly in the ER-Golgi system (De Strooper et al., 1997; Cupers et al., 2001), in cell cultures with extensive cell-cell contacts and in tissues PS1 concentrates mainly at the plasma membrane (Georgakopoulos et al., 1999; Nowotny et al., 2000; Xia et al., 2001) and, in the brain, this protein concentrates at ...
Mechanics of epithelial tissue | Journal of The Royal Society InterfaceMechanics of epithelial tissue | Journal of The Royal Society Interface
An epithelial tissue is a sheet of cells that acts as a barrier, separating, for instance, the outside and the inside of a multicellular organism. Its biological function relies in part on the formation of a network of adherens junction belts, connected to the acto-myosin cytoskeleton, where cells adhere to each other [1], and which transmits mechanical information over several cell diameters [1-3]. A key issue is to understand and model the role of tissue mechanics (forces, displacements and their time evolution) in the coordinated changes of cell shape and position that determine morphogenetic flows at the tissue level [1,4,5].. Several models describe tissues using continuum mechanics [3,6-12]. One precondition is the existence of a mesoscopic scale defining a domain over which averages of cell properties are well defined [6,13]. This description further relies on the assumption that the tissue mechanical state can be quantified, at the same mesoscopic scale, by two variables [6]: the stress ...
E-Cadherin Antibody (67A4) [FITC] (NBP1-44694): Novus BiologicalsE-Cadherin Antibody (67A4) [FITC] (NBP1-44694): Novus Biologicals
Mouse Monoclonal Anti-E-Cadherin Antibody (67A4) [FITC]. Epithelial Cell Marker, Adherens Junctions Marker. Validated: Flow. Tested Reactivity: Human. 100% Guaranteed.
Publications | Sivasankar LaboratoryPublications | Sivasankar Laboratory
D. Leckband and Sivasankar, S., "Biophysics of cadherin adhesion", in Adherens junctions: from molecular mechanisms to tissue development and disease, Springer Netherlands, 2012, pp. 63-88. ...
Color Change Garnet Gemstone Information at AJS GemsColor Change Garnet Gemstone Information at AJS Gems
The color change can be intense and equal to the color change of top quality alexandrite. See our stock in Fine Color Change Garnet.
Dr A Karakesisoglou - Durham UniversityDr A Karakesisoglou - Durham University
Karakesisoglou, I., Yang, Y. M. & Fuchs, E. (2000). An epidermal plakin that integrates actin and microtubule networks at cellular junctions. Journal Of Cell Biology 149(1): 195-208. ...
Prírodné farbivá, extrakty a farbiace potravinyPrírodné farbivá, extrakty a farbiace potraviny
Úplný sortiment výlučne prírodných farbív, aj mikroinkapsulované. Farbiace extrakty Fruitmax(R), aj do tukových aplikácií.
Connexins, E-Cadherin, Claudin-7 and beta-catenin transiently form junctional nexuses during the post-natal mammary gland...Connexins, E-Cadherin, Claudin-7 and beta-catenin transiently form junctional nexuses during the post-natal mammary gland...
Gap junctions are intercellular channels made of connexins (Cxs) that allow direct communication between adjacent cells. Modulation of Cxs has been associated with abnormal development and function of the mammary gland and breast cancer. However, the mechanisms underlying their expression during normal mammary gland are not yet known. Cxs interact with components of tight and adherens junctions. Thus, we hypothesized that the expression levels of Cxs vary during mammary gland development and are regulated through stage-dependent interactions with members of the tight and adherens junctions. Our specific objectives were to: 1) determine the expression of Cxs and tight and adherens junction proteins throughout development and 2) characterize Cxs interactions with components of tight and adherens junctions. Murine mammary glands were sampled at various developmental stages (pre-pubescent to post-weaning). RT-qPCR and western-blot analyses demonstrated differential expression patterns for all gap ...
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation Science
Adherens JunctionsIntercellular JunctionsCadherinsTight Junctionsalpha CateninCateninsGap JunctionsDesmoplakinsbeta CateninZonula Occludens-1 Proteingamma CateninCytoskeletal ProteinsArmadillo Domain ProteinsDesmosomesCell AdhesionCell Adhesion MoleculesVinculinOccludinEpithelial CellsCell PolarityNeuromuscular JunctionActinsCell CommunicationMembrane ProteinsDesmogleinsCytoskeletonPhosphoproteinsDrosophila ProteinsConnexin 43DesmocollinsMicrofilament ProteinsPlakophilinsTrans-ActivatorsCapillary PermeabilityTight Junction ProteinsClaudin-1DogsConnexinsZonula Occludens-2 ProteinMicroscopy, FluorescenceCells, CulturedMorphogenesisCell LineActin CytoskeletonElectric ImpedanceEndothelial CellsSignal TransductionEpitheliumAntigens, CDrho GTP-Binding Proteinsrac1 GTP-Binding ProteinFluorescent Antibody TechniqueMicroscopy, Electronrap1 GTP-Binding ProteinsCell ShapeJunctional Adhesion MoleculesCell MovementDrosophila melanogasterPhosphorylationDrosophilaProtein BindingSeminiferous EpitheliumMicroscopy, ConfocalMolecular Sequence DataNeuroepithelial CellsProtein TransportModels, BiologicalEndothelium, VascularDesmosomal CadherinsVestibular Nucleus, LateralCell MembraneEmbryo, NonmammalianrhoA GTP-Binding Proteincdc42 GTP-Binding ProteinGastrulationrac GTP-Binding ProteinsBlood-Testis BarrierMutationSertoli CellsMadin Darby Canine Kidney CellsProtein Structure, TertiaryEsophagogastric JunctionPupaImmunohistochemistryNucleoside-Phosphate Kinasesrc-Family KinasesStress FibersAmino Acid SequenceFreeze FracturingKeratinocytesDesmoglein 2Myosin Type IIKinesinCaco-2 CellsTyrosineTransfectionEpidermisClaudin-3Holliday Junction ResolvasesActininActomyosinFluorescence Recovery After PhotobleachingMyosinsFocal AdhesionsHydrazinesPrecipitin TestsImmunoprecipitationGingival PocketBase SequencePermeabilityGuanylate KinaseClaudin-5Microscopy, Electron, TransmissionBlotting, WesternRNA InterferenceMicroscopy, ImmunoelectronHuman Umbilical Vein Endothelial CellsGreen Fluorescent ProteinsRecombinant Fusion ProteinsLysophospholipidsrho-Associated KinasesImmunoblottingSphingosineEndocytosisRNA, Small InterferingTime-Lapse ImagingCalciumIndazolesPhotoreceptor Cells, InvertebrateMice, KnockoutCell Membrane PermeabilityAnimals, Genetically ModifiedClaudinsBlood-Air BarrierCell Differentiation
MYH10MYH10
It appears that NM-IIB plays an essential role in maintaining normal adherens junction integrity and structure. A cardiac ... widened adherens junctions; and progressive hypertrophic cardiomyopathy at 6 months. These data indicate that NM-IIB functions ... where it localizes to adherens junctions within intercalated discs. NM-IIB is essential for normal development of cardiac ...
Keith BurridgeKeith Burridge
Geiger, B; Volk, T; Volberg, T (1985). "Molecular heterogeneity of adherens junctions". The Journal of Cell Biology. 101 (4): ...
CadherinCadherin
Volk, T.; Cohen, O.; Geiger, B. (1987). "Formation of heterotypic adherens-type junctions between L-CAM containing liver cells ... Harris, T. J.; Tepass, U (2010). "Adherens junctions: From molecules to morphogenesis". Nature Reviews Molecular Cell Biology. ... adherens junctions can then be made when protein complexes, usually composed of α-, β-, and γ-catenins, bind to the actin ... that is important in the formation of adherens junctions to bind cells with each other. Cadherins are a class of type-1 ...
HomeoboxHomeobox
"HoxA5 stabilizes adherens junctions via increased Akt1". Cell Adhesion & Migration. 1 (4): 185-95. doi:10.4161/cam.1.4.5448. ... and stabilizing adherens junctions by upregulating TIMP1/downregulating uPAR and MMP14, and by upregulating Tsp2/downregulating ...
VEZTVEZT
... adherens junctions transmembrane protein". Blaschuk OW, Rowlands TM (2003). "Plasma membrane components of adherens junctions ( ... The protein is documented as an adherens junction component in a number of cell types. VEZT has been shown to interact with ... a protein associated to adherens junctions, is required for mouse blastocyst morphogenesis". Developmental Biology. 287 (1): ...
HOXA5HOXA5
"HoxA5 stabilizes adherens junctions via increased Akt1". Cell Adhesion & Migration. 1 (4): 185-95. doi:10.4161/cam.1.4.5448. ...
MARCKSL1MARCKSL1
The encoded protein affects the formation of adherens junction. Alternative splicing results in multiple transcript variants. ...
PLEKHA7PLEKHA7
... is an adherens junction (AJ) protein, involved in the junction's integrity and stability. The protein was discovered in ... Knock-out of PLEKHA7 results in the loss of PDZD11 from epithelial adherens junctions, and this is rescued by the introduction ... Pulimeno P, Bauer C, Stutz J, Citi S (Aug 2010). "PLEKHA7 is an adherens junction protein with a tissue distribution and ... The first identified function of PLEKHA7 was is to contribute to integrity and stability of the zonula adherens junctions by ...
Stress fiberStress fiber
... such as the formation of adherens junctions, tight junctions and focal adhesions. Adherens junctions are a type of cell-cell ... This may serve as a mechanism for how actin is recruited to adherens junctions. Tight junctions, or zona occludens, are the ... α-catenin and β-catenin are integral components of adherens junctions, which bind together to produce cadherin-α-catenin-β- ... Hartsock, Andrea; Nelson, W. James (March 2008). "Adherens and tight junctions: Structure, function and connections to the ...
Marilyn FarquharMarilyn Farquhar
Together Farquhar and Palade named tight junctions and adherens junctions. Since then, Farquhar has continued to study ... Cell junction-associated proteins IQGAP1, MAGI-2, CASK, spectrins, and alpha-actinin are components of the nephrin multiprotein ... junctions in the podocytes. After leaving Rockefeller in 1962, she established her own laboratory at the University of ...
AdhesomeAdhesome
"Jack of all trades: functional modularity in the adherens junction". Current Opinion in Cell Biology. 36: 32-40. doi:10.1016/j. ... they localize to a cell adhesion structure such as focal adhesion or adherens junction. 2. they directly interact with one of ...
EpidermisEpidermis
The junctions between the epidermal cells is adherens junction type. These junctions are formed by transmembrane proteins ... Because of the proximity of the neighboring cells and tightness of the junctions, the actin immunofluorescence appears as a ... Characteristics Physical barrier through keratinocytes attached together via cell-cell junctions and associated to cytoskeletal ...
Stem cellStem cell
Song X, Zhu CH, Doan C, Xie T (June 2002). "Germline stem cells anchored by adherens junctions in the Drosophila ovary niches ... Studies in Drosophila germarium have identified the signals decapentaplegic and adherens junctions that prevent germarium stem ...
Cadherin-catenin complex in learning and memoryCadherin-catenin complex in learning and memory
"Endocytosis is required for E-cadherin redistribution at mature adherens junctions". PNAS. 106 (17): 7010-15. doi:10.1073/pnas. ... of cadherins into the adhesive junctions at the synapse. P120 ctn proteins are thought to either inhibit endocytosis of neural ...
Intercalated discIntercalated disc
Three types of cell junction make up an intercalated disc - fascia adherens, desmosomes and gap junctions. Fascia adherens are ... Thus cardiomyocyte adherens junctions differ from epithelial adherens junctions and desmosomes. Franke, Werner W.; Borrmann, ... Desmosomes are also known as macula adherens. Gap junctions allow action potentials to spread between cardiac cells by ... and comprehensive studies have shown that intercalated discs consist for the most part of mixed type adherens junctions, termed ...
CateninCatenin
The exact mechanisms by which α-catenin acts in adherens junctions is still unclear; however, it is likely that α-catenin acts ... For instance, when an epithelial layer is complete and the adherens junctions indicate that the cell is surrounded, β-catenin ... α-catenin participates in the formation and stabilization of adherens junctions by binding to β-catenin-cadherin complexes in ... Tripathi V, Popescu NC, Zimonjic DB (April 2012). "DLC1 interaction with α-catenin stabilizes adherens junctions and enhances ...
CTNND1CTNND1
"Nephrin forms a complex with adherens junction proteins and CASK in podocytes and in Madin-Darby canine kidney cells expressing ... "Cell confluence regulates tyrosine phosphorylation of adherens junction components in endothelial cells". J. Cell Sci. 110 (17 ... "Cell confluence regulates tyrosine phosphorylation of adherens junction components in endothelial cells". J. Cell Sci. 110 (17 ... "A novel cell-cell junction system: the cortex adhaerens mosaic of lens fiber cells". J. Cell Sci. 116 (Pt 24): 4985-95. doi: ...
DIAPH1DIAPH1
Sahai E, Marshall CJ (June 2002). "ROCK and Dia have opposing effects on adherens junctions downstream of Rho". Nature Cell ...
Poliovirus receptor-related 2Poliovirus receptor-related 2
This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant ... 1999). "Nectin/PRR: An Immunoglobulin-like Cell Adhesion Molecule Recruited to Cadherin-based Adherens Junctions through ... a Component of Cell-Cell Adherens Junctions". Mol. Cell. Biol. 20 (8): 2865-73. doi:10.1128/MCB.20.8.2865-2873.2000. PMC 85510 ...
Stem-cell nicheStem-cell niche
Song, Xiaoqing; Zhu, Chun-Hong; Doan, Chuong; Xie, Ting (2002). "Germline Stem Cells Anchored by Adherens Junctions in the ... adherens junctions and if this physical attachment is lost GSCs will differentiate and lose their identity as a stem cell. The ... whereby differentiating spermatocytes must traverse the tight junctions. These tight junctions form the blood testis barrier ( ... The bulge area at the junction of arrector pili muscle to the hair follicle sheath has been shown to host the skin stem cells ...
Janus kinase 3Janus kinase 3
Compromise in adherens junctions (AJs) is associated with several chronic inflammatory diseases. Functional characterization ... Mishra, Jayshree; Das, Jugal Kishore; Kumar, Narendra (2017). "Janus kinase 3 regulates adherens junctions and epithelial ... Jak3 redistributed to basolateral surfaces and interacted with adherens junction (AJ) protein β-catenin. Jak3 expression in ...
Plakophilin-4Plakophilin-4
cell-cell adherens junction. Biological process. • cell-cell signaling. • positive regulation of cytokinesis. • positive ... cell-cell junction. • spindle. • desmosome. • cell junction. • midbody. • spindle midzone. • perinuclear region of cytoplasm. • ... Hatzfeld M, Green KJ, Sauter H (2003). "Targeting of p0071 to desmosomes and adherens junctions is mediated by different ... at cell-cell junctions of epithelial cells". Genes Cells. 7 (5): 475-85. doi:10.1046/j.1365-2443.2002.00533.x. PMID 12047349.. ...
PlakoglobinPlakoglobin
... is a major cytoplasmic component of both desmosomes and adherens junctions, and is the only known constituent ... Shasby DM, Ries DR, Shasby SS, Winter MC (Jun 2002). "Histamine stimulates phosphorylation of adherens junction proteins and ... Plakoglobin is a cytoplasmic component of desmosomes and adherens junctions structures located within intercalated discs of ... "Plakoglobin is essential for myocardial compliance but dispensable for myofibril insertion into adherens junctions". Journal of ...
VE-cadherinVE-cadherin
Shasby DM, Ries DR, Shasby SS, Winter MC (Jun 2002). "Histamine stimulates phosphorylation of adherens junction proteins and ... and the VE-cadherin-based adherens junction is thought to be particularly important. VE-cadherin is known to be required for ... "Alteration of interendothelial adherens junctions following tumor cell-endothelial cell interaction in vitro". Exp. Cell Res. ... "Alteration of interendothelial adherens junctions following tumor cell-endothelial cell interaction in vitro". Exp. Cell Res. ...
CRB1CRB1
2002). "Drosophila Crumbs is a positional cue in photoreceptor adherens junctions and rhabdomeres". Nature. 416 (6877): 178-83 ...
Category:Mid-importance Anatomy articlesCategory:Mid-importance Anatomy articles
Talk:Adherens junction. *Talk:Adipocyte. *Talk:Adrenal artery. *Talk:Adrenal cortex. *Talk:Adrenal medulla ...
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation Science
Adherens JunctionsIntercellular JunctionsCadherinsTight Junctionsalpha CateninCateninsGap JunctionsDesmoplakinsbeta CateninZonula Occludens-1 Proteingamma CateninCytoskeletal ProteinsArmadillo Domain ProteinsDesmosomesCell AdhesionCell Adhesion MoleculesVinculinOccludinEpithelial CellsCell PolarityNeuromuscular JunctionActinsCell CommunicationMembrane ProteinsDesmogleinsCytoskeletonPhosphoproteinsDrosophila ProteinsConnexin 43DesmocollinsMicrofilament ProteinsPlakophilinsTrans-ActivatorsCapillary PermeabilityTight Junction ProteinsClaudin-1DogsConnexinsZonula Occludens-2 ProteinMicroscopy, FluorescenceCells, CulturedMorphogenesisCell LineActin CytoskeletonElectric ImpedanceEndothelial CellsSignal TransductionEpitheliumAntigens, CDrho GTP-Binding Proteinsrac1 GTP-Binding ProteinFluorescent Antibody TechniqueMicroscopy, Electronrap1 GTP-Binding ProteinsCell ShapeJunctional Adhesion MoleculesCell MovementDrosophila melanogasterPhosphorylationDrosophilaProtein BindingSeminiferous EpitheliumMicroscopy, ConfocalMolecular Sequence DataNeuroepithelial CellsProtein TransportModels, BiologicalEndothelium, VascularDesmosomal CadherinsVestibular Nucleus, LateralCell MembraneEmbryo, NonmammalianrhoA GTP-Binding Proteincdc42 GTP-Binding ProteinGastrulationrac GTP-Binding ProteinsBlood-Testis BarrierMutationSertoli CellsMadin Darby Canine Kidney CellsProtein Structure, TertiaryEsophagogastric JunctionPupaImmunohistochemistryNucleoside-Phosphate Kinasesrc-Family KinasesStress FibersAmino Acid SequenceFreeze FracturingKeratinocytesDesmoglein 2Myosin Type IIKinesinCaco-2 CellsTyrosineTransfectionEpidermisClaudin-3Holliday Junction ResolvasesActininActomyosinFluorescence Recovery After PhotobleachingMyosinsFocal AdhesionsHydrazinesPrecipitin TestsImmunoprecipitationGingival PocketBase SequencePermeabilityGuanylate KinaseClaudin-5Microscopy, Electron, TransmissionBlotting, WesternRNA InterferenceMicroscopy, ImmunoelectronHuman Umbilical Vein Endothelial CellsGreen Fluorescent ProteinsRecombinant Fusion ProteinsLysophospholipidsrho-Associated KinasesImmunoblottingSphingosineEndocytosisRNA, Small InterferingTime-Lapse ImagingCalciumIndazolesPhotoreceptor Cells, InvertebrateMice, KnockoutCell Membrane PermeabilityAnimals, Genetically ModifiedClaudinsBlood-Air BarrierCell Differentiation
AJAP1 adherens junctions associated protein 1 [Homo sapiens (human)] - Gene - NCBIAJAP1 adherens junctions associated protein 1 [Homo sapiens (human)] - Gene - NCBI
AJAP1 adherens junctions associated protein 1 [Homo sapiens] AJAP1 adherens junctions associated protein 1 [Homo sapiens]. Gene ... adherens junctions associated protein 1provided by HGNC. Primary source. HGNC:HGNC:30801 See related. Ensembl:ENSG00000196581 ... Adherens junctions associated protein 1 serves as a predictor of recurrence of squamous cell carcinoma of the esophagus. Tanaka ... AJAP1 adherens junctions associated protein 1 [ Homo sapiens (human) ] Gene ID: 55966, updated on 1-Jun-2020 ...
ncbi.nlm.nih.gov
Adherens junction - WikipediaAdherens junction - Wikipedia
MBInfo - Adherens Junction MBInfo - Adherens Junction Assembly Adherens Junctions at the US National Library of Medicine ... Adherens junctions (or zonula adherens, intermediate junction, or "belt desmosome") are protein complexes that occur at cell- ... cell junctions in epithelial and endothelial tissues, usually more basal than tight junctions. An adherens junction is defined ... "Signaling to and through the Endothelial Adherens Junction". In LaFlamme SE, Kowalczyck AP. Cell Junctions: Adhesion, ...
en.wikipedia.org
adherens junction facts, information, pictures | Encyclopedia.com articles about adherens junctionadherens junction facts, information, pictures | Encyclopedia.com articles about adherens junction
Make research projects and school reports about adherens junction easy with credible articles from our FREE, online ... and pictures about adherens junction at Encyclopedia.com. ... adherens junction (zonula adherens) A type of cell junction, ... adherens junction A cell junction that is commonly observed in epithelial (see EPITHELIUM) cells (e.g. those lining the ... adherens junction A Dictionary of Zoology © A Dictionary of Zoology 1999, originally published by Oxford University Press 1999. ...
encyclopedia.com
Does Notch Delta Interact At New Adherens Junction... | BartlebyDoes Notch Delta Interact At New Adherens Junction... | Bartleby
Does Notch Delta interact at new adherens junction interface formed between the two sister cells? There is evidence in ... Adherens junction will be labeled by Par3-GFP or -CFP and new adherens junction interface will be monitored by live-imaging as ... To test whether Notch Delta interact at new adherens junction formed between the two sister cells we will first assess whether ... Does Notch Delta Interact At New Adherens Junction Interface Formed Between The Two Sisters Cells. 1087 Words5 Pages ...
bartleby.com
NIOSHTIC-2 Publications Search - 20030033 - Reduction of IQGAP1 increases insoluble VE-cadherin at endothelial adherens...NIOSHTIC-2 Publications Search - 20030033 - Reduction of IQGAP1 increases insoluble VE-cadherin at endothelial adherens...
The objectives of the present study were to determine if IQGAP1 associates with components of the endothelial adherens junction ... The objectives of the present study were to determine if IQGAP1 associates with components of the endothelial adherens junction ... Furthermore, more insoluble (actin-associated) VE-cadherin was localized at intercellular junctions and less insoluble N- ...
cdc.gov
KEGG PATHWAY: Adherens junction - Homo sapiens (human)KEGG PATHWAY: Adherens junction - Homo sapiens (human)
Adherens junction - Homo sapiens (human) [ Pathway menu , Pathway entry , Download KGML , Show description , Image (png) file ... Cell-cell adherens junctions (AJs), the most common type of intercellular adhesions, are important for maintaining tissue ...
genome.jp
The effect of tyrosine-specific protein phosphorylation on the assembly of adherens-type junctions. - PubMed - NCBIThe effect of tyrosine-specific protein phosphorylation on the assembly of adherens-type junctions. - PubMed - NCBI
The effect of tyrosine-specific protein phosphorylation on the assembly of adherens-type junctions.. Volberg T1, Zick Y, Dror R ... Adherens-type junctions (AJs) are major subcellular targets for tyrosine specific protein phosphorylation [Volberg et al. (1991 ... Other intercellular junctions, including desmosomes and tight junctions, visualized by staining with desmoplakin and ZO-I ...
ncbi.nlm.nih.gov
Rap1 GTPase Regulation of Adherens Junction Positioning and Cell Adhesion | ScienceRap1 GTPase Regulation of Adherens Junction Positioning and Cell Adhesion | Science
Rap1 is enriched at adherens junctions, particularly between newly divided sister cells where it may reseal the adherens ... Rap1 GTPase Regulation of Adherens Junction Positioning and Cell Adhesion Message Subject. (Your Name) has forwarded a page to ... The regulation of adherens junction positioning could play a role in cell mobility and cell division. ... Cells mutant forRap1 condensed their adherens junctions to one side of the cell. This disrupted normal epithelial cell behavior ...
science.sciencemag.org
AFDN (afadin, adherens junction formation factor )AFDN (afadin, adherens junction formation factor )
... adherens junction formation factor ) , Authors: Jean-Loup Huret. Published in: Atlas Genet Cytogenet Oncol Haematol. ... protein binding nucleoplasm cytosol cytosol plasma membrane cell-cell junction cell-cell adherens junction cell adhesion signal ... protein binding nucleoplasm cytosol cytosol plasma membrane cell-cell junction cell-cell adherens junction cell adhesion signal ... AFDN (afadin, adherens junction formation factor ) Written. 1997-12. Jean-Loup Huret. ...
atlasgeneticsoncology.org
Overexpression of CD97 in Intestinal Epithelial Cells of Transgenic Mice Attenuates Colitis by Strengthening Adherens JunctionsOverexpression of CD97 in Intestinal Epithelial Cells of Transgenic Mice Attenuates Colitis by Strengthening Adherens Junctions
In summary, CD97 increases the structural integrity of enterocytic adherens junctions by increasing and stabilizing junctional ... enterocytes as well as in colorectal cell lines CD97 was localized preferentially in E-cadherin-based adherens junctions. CD97 ... Transepithelial resistance was not altered in Tg and Ko mice, indicating that tight junctions were not affected. In Tg murine ...
journals.plos.org
Pathway Central: Remodeling of Adherens JunctionsPathway Central: Remodeling of Adherens Junctions
The Adherens Junctions have a crucial role both as sensors of extracellular stimuli and in regulating the dynamics of ... The intercellular Adherens Junctions (AJs) are specialized sub-apical structures that function as principle mediators of cell- ... Disassembling adherens junctions: breaking up is hard to do.. Trends Cell Biol. 2005 Jan;15(1):19-26. ... Ctnn-Alpha (Catenin-Alpha) binds to Ctnn-Beta and links components of the Adherens Junctions to the Actin cytoskeleton. It also ...
sabiosciences.com
Endothelial adherens junctions at a glance | Journal of Cell ScienceEndothelial adherens junctions at a glance | Journal of Cell Science
Adherens junctions have an important role in the control of vascular permeability. These structures are located at cell-to-cell ... VE-cadherin (also known as CDH5 and CD144) is the major component of endothelial adherens junctions and is specific to ... Vascular permeability is increased by modifications in the expression and function of adherens junction components. In some ... where adherens junctions are dismantled in the vessels contributing to brain microcirculation. This causes the loss of ...
jcs.biologists.org
Overexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA-dependent mechanism | DevelopmentOverexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA-dependent mechanism | Development
Overexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA-dependent mechanism ... Overexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA-dependent mechanism ... Overexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA-dependent mechanism ... Overexpression of EPHA2 receptor destabilizes adherens junctions via a RhoA-dependent mechanism ...
dev.biologists.org
The role of adherens junction proteins in the regulation of insulin secretion | Bioscience Reports | Portland PressThe role of adherens junction proteins in the regulation of insulin secretion | Bioscience Reports | Portland Press
The role of adherens junction proteins in the regulation of insulin secretion Waruni C. Dissanayake Waruni C. Dissanayake ... Physiological implications of adherens junction mediated regulation of insulin release in human disease. The corollary of the ... Adherens junctions were first implicated in regulating insulin secretion over 25 years ago [26]. More recently, this has been ... In addition to its role in adherens junctions, β-catenin is also known to play a pivotal role in mediating the effects of the ...
portlandpress.com
Vang-like protein 2 and Rac1 interact to regulate adherens junctions | Journal of Cell ScienceVang-like protein 2 and Rac1 interact to regulate adherens junctions | Journal of Cell Science
Caudal of this, adherens junctions displayed aberrant distribution of cytoskeletal components. Ring-like adherens junctions ... over the adherens junctions. Rac1 in loop-tail embryos (L, arrowhead) is not focused to adherens junctions but evenly ... which is located at adherens junctions (Fig. 1O′), is required for the proper recruitment of Rac1 to the adherens junction. ... displayed a reduced level of Rac1 labeling over the adherens junctions (Fig. 7D, arrowhead). Apart from the adherens junctions ...
jcs.biologists.org
Dual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis | DevelopmentDual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis | Development
Dual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis ... Dual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis ... Dual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis ... Dual function of Src in the maintenance of adherens junctions during tracheal epithelial morphogenesis ...
dev.biologists.org
Alpha-catenin-dependent recruitment of the centrosomal protein CAP350 to adherens junctions allows epithelial cells to acquire...Alpha-catenin-dependent recruitment of the centrosomal protein CAP350 to adherens junctions allows epithelial cells to acquire...
Our results indicate that CAP350 may act as an adaptor between adherens junctions and microtubules, thus regulating epithelial ... Alpha-catenin-dependent recruitment of the centrosomal protein CAP350 to adherens junctions allows epithelial cells to acquire ... Here, we report that the centrosomal microtubule (MT)-binding protein CAP350 localises at adherens junctions in epithelial ... mediated cell-cell adhesion or α-catenin depletion prevented CAP350 localisation at cell-cell junctions. Knocking down junction ...
sigmaaldrich.com
Molecular Vision: Adherens junction proteins are expressed in collagen corneal equivalents produced in vitro with human cellsMolecular Vision: Adherens junction proteins are expressed in collagen corneal equivalents produced in vitro with human cells
Adherens junction proteins are expressed in collagen corneal equivalents produced in vitro with human cells. Claude J. Giasson, ... The comparative histology and immunochemistry of adherens junction proteins of a native cornea (Figure 3A,D,G,J,M) may be ... Adherens junction complexes are also essential in establishing distinct basolateral and apical domains [2]. The polarized ... Epithelial cells are attached to each other by E-cadherin, an adherens junction protein. Other classical cadherins such as N-, ...
molvis.org
The Role of Tight and Adherens Junctions in Cervical Neoplasia by Ciaran Cunniffe"The Role of Tight and Adherens Junctions in Cervical Neoplasia" by Ciaran Cunniffe
Adherens (AJ) and tight junctions (TJ) play a key role in maintaining the apical-basolateral polarity and cohesive structure of ... These junctions are maintained by the interaction of several key proteins including, claudins, catenins, cadherins and SNAIL. ... Cunniffe, C. The Role of Tight and Adherens Junctions in Cervical Neoplasia.. Doctoral Thesis. Dublin Institute of Technology. ... Adherens (AJ) and tight junctions (TJ) play a key role in maintaining the apical-basolateral polarity and cohesive structure of ...
arrow.dit.ie
Abstract 11114: Effects of Epigenetic Modifiers on Lps-induced Enos/rho Signaling And Restoration of Adherens Junction...Abstract 11114: Effects of Epigenetic Modifiers on Lps-induced Enos/rho Signaling And Restoration of Adherens Junction...
Abstract 11114: Effects of Epigenetic Modifiers on Lps-induced Enos/rho Signaling And Restoration of Adherens Junction ... Abstract 11114: Effects of Epigenetic Modifiers on Lps-induced Enos/rho Signaling And Restoration of Adherens Junction ... Abstract 11114: Effects of Epigenetic Modifiers on Lps-induced Enos/rho Signaling And Restoration of Adherens Junction ... Abstract 11114: Effects of Epigenetic Modifiers on Lps-induced Enos/rho Signaling And Restoration of Adherens Junction ...
circ.ahajournals.org
The Glomerular Slit Diaphragm Is a Modified Adherens Junction | American Society of NephrologyThe Glomerular Slit Diaphragm Is a Modified Adherens Junction | American Society of Nephrology
This organization essentially represents an adherens-type junction. A similar P-cadherin-based adherens junction has recently ... and because ZO-1 is also found in adherens junctions (1), we asked whether the cells expressed other markers of adherens ... which was originally thought to be specific for tight junctions, is also present in adherens junctions (9). Recently, ... we studied the expression of marker proteins of tight junctions, adherens junctions, and desmosomes by immunocytochemistry in ...
jasn.asnjournals.org
AJAP1 (adherens junction associated protein 1) - KOMP (Knockout Mouse Project)AJAP1 (adherens junction associated protein 1) - KOMP (Knockout Mouse Project)
Vega: OTTMUSG10367 (Ajap1, adherens junction associated protein 1)*CCDS: 23976.1, 38987*OMIM: ADHERENS JUNCTION-ASSOCIATED ... adherens junction associated protein 1. Synonyms: LOC230959. Gene nomenclature, locus information, and GO, OMIM, and PMID ...
komp.org
The Extracellular Architecture of Adherens Junctions Revealed by Crystal Structures of Type I CadherinsThe Extracellular Architecture of Adherens Junctions Revealed by Crystal Structures of Type I Cadherins
Adherens junctions, which play a central role in intercellular adhesion, comprise clusters of type I classical cadherins that ... Adherens junctions, which play a central role in intercellular adhesion, comprise clusters of type I classical cadherins that ... The Extracellular Architecture of Adherens Junctions Revealed by Crystal Structures of Type I Cadherins Structure. 2011 Feb 9; ... Fluorescent imaging of junctions formed from wild-type and mutant E-cadherins in cultured cells confirm conclusions derived ...
pubmed.ncbi.nlm.nih.gov
Fluid shear stress-induced reorganization of adherens junctions in hum by Jon A. Ukropec"Fluid shear stress-induced reorganization of adherens junctions in hum" by Jon A. Ukropec
Ukropec, Jon A., "Fluid shear stress-induced reorganization of adherens junctions in human endothelial cells" (1999). Theses. ... Fluid shear stress-induced reorganization of adherens junctions in human endothelial cells ...
jdc.jefferson.edu
Implication of Metastasis Suppressor NM23-H1 in Maintaining Adherens Junctions and Limiting the Invasive Potential of Human...Implication of Metastasis Suppressor NM23-H1 in Maintaining Adherens Junctions and Limiting the Invasive Potential of Human...
Disassembly of adherens junctions and β-catenin-TCF/LEF-1 transactivation by NM23-H1 silencing. A, immunostaining of E-cadherin ... These adherens junction defects, which were not associated with loss of cytokeratin 18 (CK 18) and gain of vimentin, likely ... NM23-H1 silencing disrupts adherens junction complexes and activates the Wnt pathway. Both E-cadherin and catenins are involved ... Implication of Metastasis Suppressor NM23-H1 in Maintaining Adherens Junctions and Limiting the Invasive Potential of Human ...
cancerres.aacrjournals.org
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsInformation Science
Adherens JunctionsIntercellular JunctionsCadherinsTight Junctionsalpha CateninCateninsGap JunctionsDesmoplakinsbeta CateninZonula Occludens-1 Proteingamma CateninCytoskeletal ProteinsArmadillo Domain ProteinsDesmosomesCell AdhesionCell Adhesion MoleculesVinculinOccludinEpithelial CellsCell PolarityNeuromuscular JunctionActinsCell CommunicationMembrane ProteinsDesmogleinsCytoskeletonPhosphoproteinsDrosophila ProteinsConnexin 43DesmocollinsMicrofilament ProteinsPlakophilinsTrans-ActivatorsCapillary PermeabilityTight Junction ProteinsClaudin-1DogsConnexinsZonula Occludens-2 ProteinMicroscopy, FluorescenceCells, CulturedMorphogenesisCell LineActin CytoskeletonElectric ImpedanceEndothelial CellsSignal TransductionEpitheliumAntigens, CDrho GTP-Binding Proteinsrac1 GTP-Binding ProteinFluorescent Antibody TechniqueMicroscopy, Electronrap1 GTP-Binding ProteinsCell ShapeJunctional Adhesion MoleculesCell MovementDrosophila melanogasterPhosphorylationDrosophilaProtein BindingSeminiferous EpitheliumMicroscopy, ConfocalMolecular Sequence DataNeuroepithelial CellsProtein TransportModels, BiologicalEndothelium, VascularDesmosomal CadherinsVestibular Nucleus, LateralCell MembraneEmbryo, NonmammalianrhoA GTP-Binding Proteincdc42 GTP-Binding ProteinGastrulationrac GTP-Binding ProteinsBlood-Testis BarrierMutationSertoli CellsMadin Darby Canine Kidney CellsProtein Structure, TertiaryEsophagogastric JunctionPupaImmunohistochemistryNucleoside-Phosphate Kinasesrc-Family KinasesStress FibersAmino Acid SequenceFreeze FracturingKeratinocytesDesmoglein 2Myosin Type IIKinesinCaco-2 CellsTyrosineTransfectionEpidermisClaudin-3Holliday Junction ResolvasesActininActomyosinFluorescence Recovery After PhotobleachingMyosinsFocal AdhesionsHydrazinesPrecipitin TestsImmunoprecipitationGingival PocketBase SequencePermeabilityGuanylate KinaseClaudin-5Microscopy, Electron, TransmissionBlotting, WesternRNA InterferenceMicroscopy, ImmunoelectronHuman Umbilical Vein Endothelial CellsGreen Fluorescent ProteinsRecombinant Fusion ProteinsLysophospholipidsrho-Associated KinasesImmunoblottingSphingosineEndocytosisRNA, Small InterferingTime-Lapse ImagingCalciumIndazolesPhotoreceptor Cells, InvertebrateMice, KnockoutCell Membrane PermeabilityAnimals, Genetically ModifiedClaudinsBlood-Air BarrierCell Differentiation
ProteinDisassembly of adherens junctionsJunctionalApicalAssembly of adherens junctionsComponents of adherens junctionsStabilization of adherens junctionsPATHWAYDisruption of endothelialDynamicsActin cytoskeletonEPITHELIUMParacellularPhosphorylationCellHomotypicAdhesiveIntracellularRegulatesVascular permeabilityTissueEpithelial junctionsEndothelial barrier functionInteractions
Protein33
Disassembly of adherens junctions2
Junctional5
Apical10
  • In the neural tube, adherens junctions are present as ring-like structures surrounding the apical end of the cells, which face the lumen of the neural tube. (biologists.org)
  • Adherens (AJ) and tight junctions (TJ) play a key role in maintaining the apical-basolateral polarity and cohesive structure of epithelial cells. (dit.ie)
  • In the Drosophila embryo, the apical constrictions that internalize the mesoderm are controlled by the transcription factor Twist and require intact adherens junctions and a contractile acto-myosin network. (asm.org)
  • In the developing Drosophila embryo, the first dramatic defect resulting from failure in the proper formation of junctions is seen during the apical constrictions of the ventral cells of the blastoderm epithelium that lead to the invagination of the mesoderm ( 17 , 71 ). (asm.org)
  • In the absence of properly assembled junctions, the contracting cytoskeleton is unable to constrict the apical part of the cells but rather detaches from the periphery and collapses in a large aggregate under the apical surface. (asm.org)
  • In addition to the junctions being assembled properly, the underlying cortical domain also has to be patterned or polarized correctly for apical constriction to occur. (asm.org)
  • Control of Drosophila gastrulation by apical localization of adherens junctions and RhoGEF2. (crg.eu)
  • Using quantitative whole-mount imaging, genetic ablation, and traction force microscopy and atomic force microscopy, we find that ubiquitously localized E-cadherin coordinates tissue polarization of tension-bearing adherens junction (AJ) and F-actin organization to allow formation of an apical TJ network only in the uppermost viable layer. (nature.com)
  • g SG2 projections from apical to subapical cell-cell junctions stained for vinculin, E-cadherin, and ZO-1 showing an basolateral AJs network and an apical TJ network. (nature.com)
  • Moreover, after anti-DNAM-1 or anti-PVR mAb treatment, monocytes were arrested at the apical surface of the endothelium over intercellular junctions, which strongly suggests that the DNAM-1-PVR interaction occurs during the diapedesis step. (rupress.org)
Assembly of adherens junctions1
Components of adherens junctions1
Stabilization of adherens junctions1
PATHWAY2
  • The results show an upregulated paracellular pathway with breakdown of the tight and ahherens junctions and increased bacterial translocation in deficit schizophrenia. (preprints.org)
  • FAM116 and Rab14 therefore define an endocytic recycling pathway needed for ADAM protease trafficking and regulation of cell-cell junctions. (ox.ac.uk)
Disruption of endothelial3
Dynamics4
Actin cytoskeleton6
EPITHELIUM2
Paracellular4
Phosphorylation1
Cell36
Homotypic1
Adhesive1
Intracellular1
Regulates1
Vascular permeability2
Tissue3
Epithelial junctions1
Endothelial barrier function1
Interactions1
  • Our observations are consistent with a model for junction assembly involving strong trans and weak cis interactions localized in the ectodomain. (nih.gov)