Adenovirus E1A Proteins: Proteins transcribed from the E1A genome region of ADENOVIRUSES which are involved in positive regulation of transcription of the early genes of host infection.Adenoviruses, Human: Species of the genus MASTADENOVIRUS, causing a wide range of diseases in humans. Infections are mostly asymptomatic, but can be associated with diseases of the respiratory, ocular, and gastrointestinal systems. Serotypes (named with Arabic numbers) have been grouped into species designated Human adenovirus A-F.Adenovirus E4 Proteins: Proteins transcribed from the E4 region of ADENOVIRUSES. The E4 19K protein transactivates transcription of the adenovirus E2F protein and complexes with it.Adenovirus E1B Proteins: Proteins transcribed from the E1B region of ADENOVIRUSES which are involved in regulation of the levels of early and late viral gene expression.Adenovirus Early Proteins: Proteins encoded by adenoviruses that are synthesized prior to, and in the absence of, viral DNA replication. The proteins are involved in both positive and negative regulation of expression in viral and cellular genes, and also affect the stability of viral mRNA. Some are also involved in oncogenic transformation.Adenovirus E3 Proteins: Proteins transcribed from the E3 region of ADENOVIRUSES but not essential for viral replication. The E3 19K protein mediates adenovirus persistence by reducing the expression of class I major histocompatibility complex antigens on the surface of infected cells.Adenoviridae: A family of non-enveloped viruses infecting mammals (MASTADENOVIRUS) and birds (AVIADENOVIRUS) or both (ATADENOVIRUS). Infections may be asymptomatic or result in a variety of diseases.Adenovirus Infections, Human: Respiratory and conjunctival infections caused by 33 identified serotypes of human adenoviruses.Adenovirus E2 Proteins: Proteins transcribed from the E2 region of ADENOVIRUSES. Several of these are required for viral DNA replication.Adenoviridae Infections: Virus diseases caused by the ADENOVIRIDAE.Adenovirus E1 Proteins: The very first viral gene products synthesized after cells are infected with adenovirus. The E1 region of the genome has been divided into two major transcriptional units, E1A and E1B, each expressing proteins of the same name (ADENOVIRUS E1A PROTEINS and ADENOVIRUS E1B PROTEINS).Oncogene Proteins, Viral: Products of viral oncogenes, most commonly retroviral oncogenes. They usually have transforming and often protein kinase activities.Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Mastadenovirus: A genus of ADENOVIRIDAE that infects MAMMALS including humans and causes a wide range of diseases. The type species is Human adenovirus C (see ADENOVIRUSES, HUMAN).Adenoviruses, Canine: Species of the genus MASTADENOVIRUS that causes fever, edema, vomiting, and diarrhea in dogs and encephalitis in foxes. Epizootics have also been caused in bears, wolves, coyotes, and skunks. The official species name is Canine adenovirus and it contains two serotypes.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Genes, Viral: The functional hereditary units of VIRUSES.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Cell Transformation, Viral: An inheritable change in cells manifested by changes in cell division and growth and alterations in cell surface properties. It is induced by infection with a transforming virus.E1A-Associated p300 Protein: A member of the p300-CBP transcription factors that was originally identified as a binding partner for ADENOVIRUS E1A PROTEINS.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Gene Expression Regulation, Viral: Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.Retinoblastoma Protein: Product of the retinoblastoma tumor suppressor gene. It is a nuclear phosphoprotein hypothesized to normally act as an inhibitor of cell proliferation. Rb protein is absent in retinoblastoma cell lines. It also has been shown to form complexes with the adenovirus E1A protein, the SV40 T antigen, and the human papilloma virus E7 protein.Antigens, Viral, Tumor: Those proteins recognized by antibodies from serum of animals bearing tumors induced by viruses; these proteins are presumably coded for by the nucleic acids of the same viruses that caused the neoplastic transformation.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Transcription Factor DP1: A transcription factor that possesses DNA-binding and E2F-binding domains but lacks a transcriptional activation domain. It is a binding partner for E2F TRANSCRIPTION FACTORS and enhances the DNA binding and transactivation function of the DP-E2F complex.Adenoviruses, Porcine: Species of the genus MASTADENOVIRUS, causing neurological disease in pigs.Viral Proteins: Proteins found in any species of virus.Aviadenovirus: A genus of ADENOVIRIDAE that infects birds. The type species is FOWL ADENOVIRUS A.Retinoblastoma-Binding Protein 1: A ubiquitously expressed regulatory protein that contains a retinoblastoma protein binding domain and an AT-rich interactive domain. The protein may play a role in recruiting HISTONE DEACETYLASES to the site of RETINOBLASTOMA PROTEIN-containing transcriptional repressor complexes.Genetic Therapy: Techniques and strategies which include the use of coding sequences and other conventional or radical means to transform or modify cells for the purpose of treating or reversing disease conditions.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.E2F Transcription Factors: A family of basic helix-loop-helix transcription factors that control expression of a variety of GENES involved in CELL CYCLE regulation. E2F transcription factors typically form heterodimeric complexes with TRANSCRIPTION FACTOR DP1 or transcription factor DP2, and they have N-terminal DNA binding and dimerization domains. E2F transcription factors can act as mediators of transcriptional repression or transcriptional activation.Fowl adenovirus A: The type species of the genus AVIADENOVIRUS, family ADENOVIRIDAE, an oncogenic virus of birds. This is also called CELO virus for chick embryo lethal orphan virus.Gene Transfer Techniques: The introduction of functional (usually cloned) GENES into cells. A variety of techniques and naturally occurring processes are used for the gene transfer such as cell hybridization, LIPOSOMES or microcell-mediated gene transfer, ELECTROPORATION, chromosome-mediated gene transfer, TRANSFECTION, and GENETIC TRANSDUCTION. Gene transfer may result in genetically transformed cells and individual organisms.Transcriptional Activation: Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Capsid Proteins: Proteins that form the CAPSID of VIRUSES.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Simian virus 40: A species of POLYOMAVIRUS originally isolated from Rhesus monkey kidney tissue. It produces malignancy in human and newborn hamster kidney cell cultures.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Cell Line, Transformed: Eukaryotic cell line obtained in a quiescent or stationary phase which undergoes conversion to a state of unregulated growth in culture, resembling an in vitro tumor. It occurs spontaneously or through interaction with viruses, oncogenes, radiation, or drugs/chemicals.Receptors, Virus: Specific molecular components of the cell capable of recognizing and interacting with a virus, and which, after binding it, are capable of generating some signal that initiates the chain of events leading to the biological response.Tumor Suppressor Protein p53: Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.Oncolytic Virotherapy: Use of attenuated VIRUSES as ANTINEOPLASTIC AGENTS to selectively kill CANCER cells.Activating Transcription Factors: Activating transcription factors were originally identified as DNA-BINDING PROTEINS that interact with early promoters from ADENOVIRUSES. They are a family of basic leucine zipper transcription factors that bind to the consensus site TGACGTCA of the cyclic AMP response element, and are closely related to CYCLIC AMP-RESPONSIVE DNA-BINDING PROTEIN.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Antigens, Polyomavirus Transforming: Polyomavirus antigens which cause infection and cellular transformation. The large T antigen is necessary for the initiation of viral DNA synthesis, repression of transcription of the early region and is responsible in conjunction with the middle T antigen for the transformation of primary cells. Small T antigen is necessary for the completion of the productive infection cycle.Oncolytic Viruses: Tumor-selective, replication competent VIRUSES that have antineoplastic effects. This is achieved by producing cytotoxicity-enhancing proteins and/or eliciting an antitumor immune response. They are genetically engineered so that they can replicate in CANCER cells but not in normal cells, and are used in ONCOLYTIC VIROTHERAPY.Keratoconjunctivitis: Simultaneous inflammation of the cornea and conjunctiva.Transduction, Genetic: The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Retinoblastoma-Like Protein p107: A negative regulator of the CELL CYCLE that undergoes PHOSPHORYLATION by CYCLIN-DEPENDENT KINASES. It contains a conserved pocket region that binds E2F4 TRANSCRIPTION FACTOR and interacts with viral ONCOPROTEINS such as POLYOMAVIRUS TUMOR ANTIGENS; ADENOVIRUS E1A PROTEINS; and PAPILLOMAVIRUS E7 PROTEINS.CREB-Binding Protein: A member of the p300-CBP transcription factor family that was initially identified as a binding partner for CAMP RESPONSE ELEMENT-BINDING PROTEIN. Mutations in CREB-binding protein are associated with RUBINSTEIN-TAYBI SYNDROME.Cell Transformation, Neoplastic: Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill.Chloramphenicol O-Acetyltransferase: An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Apoptosis: One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.DNA Replication: The process by which a DNA molecule is duplicated.Papillomavirus E7 Proteins: ONCOGENE PROTEINS from papillomavirus that deregulate the CELL CYCLE of infected cells and lead to NEOPLASTIC CELL TRANSFORMATION. Papillomavirus E7 proteins have been shown to interact with various regulators of the cell cycle including RETINOBLASTOMA PROTEIN and certain cyclin-dependent kinase inhibitors.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.E2F1 Transcription Factor: An E2F transcription factor that interacts directly with RETINOBLASTOMA PROTEIN and CYCLIN A and activates GENETIC TRANSCRIPTION required for CELL CYCLE entry and DNA synthesis. E2F1 is involved in DNA REPAIR and APOPTOSIS.Repressor Proteins: Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Oncogenes: Genes whose gain-of-function alterations lead to NEOPLASTIC CELL TRANSFORMATION. They include, for example, genes for activators or stimulators of CELL PROLIFERATION such as growth factors, growth factor receptors, protein kinases, signal transducers, nuclear phosphoproteins, and transcription factors. A prefix of "v-" before oncogene symbols indicates oncogenes captured and transmitted by RETROVIRUSES; the prefix "c-" before the gene symbol of an oncogene indicates it is the cellular homolog (PROTO-ONCOGENES) of a v-oncogene.KB Cells: This line KB is now known to be a subline of the ubiquitous KERATIN-forming tumor cell line HeLa. It was originally thought to be derived from an epidermal carcinoma of the mouth, but was subsequently found, based on isoenzyme analysis, HeLa marker chromosomes, and DNA fingerprinting, to have been established via contamination by HELA CELLS. The cells are positive for keratin by immunoperoxidase staining. KB cells have been reported to contain human papillomavirus18 (HPV-18) sequences.Conjunctivitis, Viral: Inflammation, often mild, of the conjunctiva caused by a variety of viral agents. Conjunctival involvement may be part of a systemic infection.Cell Cycle Proteins: Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.Enhancer Elements, Genetic: Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Adenovirus Vaccines: Vaccines used to prevent infection by any virus from the family ADENOVIRIDAE.TATA Box: A conserved A-T rich sequence which is contained in promoters for RNA polymerase II. The segment is seven base pairs long and the nucleotides most commonly found are TATAAAA.Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).Dependovirus: A genus of the family PARVOVIRIDAE, subfamily PARVOVIRINAE, which are dependent on a coinfection with helper adenoviruses or herpesviruses for their efficient replication. The type species is Adeno-associated virus 2.Capsid: The outer protein protective shell of a virus, which protects the viral nucleic acid.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Precipitin Tests: Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.Cell Cycle: The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.Protein Phosphatase 2: A phosphoprotein phosphatase subtype that is comprised of a catalytic subunit and two different regulatory subunits. At least two genes encode isoforms of the protein phosphatase catalytic subunit, while several isoforms of regulatory subunits exist due to the presence of multiple genes and the alternative splicing of their mRNAs. Protein phosphatase 2 acts on a broad variety of cellular proteins and may play a role as a regulator of intracellular signaling processes.Acetyltransferases: Enzymes catalyzing the transfer of an acetyl group, usually from acetyl coenzyme A, to another compound. EC 2.3.1.PhosphoproteinsTransgenes: Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.TATA-Box Binding Protein: A general transcription factor that plays a major role in the activation of eukaryotic genes transcribed by RNA POLYMERASES. It binds specifically to the TATA BOX promoter element, which lies close to the position of transcription initiation in RNA transcribed by RNA POLYMERASE II. Although considered a principal component of TRANSCRIPTION FACTOR TFIID it also takes part in general transcription factor complexes involved in RNA POLYMERASE I and RNA POLYMERASE III transcription.DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.Transcription Factor TFIID: The major sequence-specific DNA-binding component involved in the activation of transcription of RNA POLYMERASE II. It was originally described as a complex of TATA-BOX BINDING PROTEIN and TATA-BINDING PROTEIN ASSOCIATED FACTORS. It is now know that TATA BOX BINDING PROTEIN-LIKE PROTEINS may take the place of TATA-box binding protein in the complex.Cytopathogenic Effect, Viral: Visible morphologic changes in cells infected with viruses. It includes shutdown of cellular RNA and protein synthesis, cell fusion, release of lysosomal enzymes, changes in cell membrane permeability, diffuse changes in intracellular structures, presence of viral inclusion bodies, and chromosomal aberrations. It excludes malignant transformation, which is CELL TRANSFORMATION, VIRAL. Viral cytopathogenic effects provide a valuable method for identifying and classifying the infecting viruses.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Helper Viruses: Viruses which enable defective viruses to replicate or to form a protein coat by complementing the missing gene function of the defective (satellite) virus. Helper and satellite may be of the same or different genus.Cell Line, Tumor: A cell line derived from cultured tumor cells.Genes, Retinoblastoma: Tumor suppressor genes located on human chromosome 13 in the region 13q14 and coding for a family of phosphoproteins with molecular weights ranging from 104 kDa to 115 kDa. One copy of the wild-type Rb gene is necessary for normal retinal development. Loss or inactivation of both alleles at this locus results in retinoblastoma.DNA, Concatenated: Head to tail array of covalently joined DNA sequences generated by concatenation. Concatenated DNA is attached end to end in contrast to CATENATED DNA which is attached loop to loop.Defective Viruses: Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Mice, Nude: Mutant mice homozygous for the recessive gene "nude" which fail to develop a thymus. They are useful in tumor studies and studies on immune responses.DNA Tumor Viruses: DNA viruses producing malignant tumors. Of the six major groupings of DNA viruses four contain members which are actually or potentially oncogenic: the Adenoviridae, the Herpesviridae, the Papovaviridae, and the Poxviridae.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Cell Division: The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.Molecular Weight: The sum of the weight of all the atoms in a molecule.beta-Galactosidase: A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.Down-Regulation: A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.Kidney: Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.Mice, Inbred BALB CGenes, Reporter: Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Chromosome Deletion: Actual loss of portion of a chromosome.3T3 Cells: Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.Retinoblastoma-Like Protein p130: A negative regulator of the CELL CYCLE that undergoes PHOSPHORYLATION by CYCLIN-DEPENDENT KINASES. RBL2 contains a conserved pocket region that binds E2F4 TRANSCRIPTION FACTOR and E2F5 TRANSCRIPTION FACTOR. RBL2 also interacts with viral ONCOPROTEINS such as POLYOMAVIRUS TUMOR ANTIGENS; ADENOVIRUS E1A PROTEINS; and PAPILLOMAVIRUS E7 PROTEINS.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Enterovirus: A genus of the family PICORNAVIRIDAE whose members preferentially inhabit the intestinal tract of a variety of hosts. The genus contains many species. Newly described members of human enteroviruses are assigned continuous numbers with the species designated "human enterovirus".Cell Nucleus Structures: Structures that are part of or contained in the CELL NUCLEUS.p300-CBP Transcription Factors: A family of histone acetyltransferases that is structurally-related to CREB-BINDING PROTEIN and to E1A-ASSOCIATED P300 PROTEIN. They function as transcriptional coactivators by bridging between DNA-binding TRANSCRIPTION FACTORS and the basal transcription machinery. They also modify transcription factors and CHROMATIN through ACETYLATION.Alcohol Oxidoreductases: A subclass of enzymes which includes all dehydrogenases acting on primary and secondary alcohols as well as hemiacetals. They are further classified according to the acceptor which can be NAD+ or NADP+ (subclass 1.1.1), cytochrome (1.1.2), oxygen (1.1.3), quinone (1.1.5), or another acceptor (1.1.99).ConjunctivitisE2F2 Transcription Factor: An E2F transcription factor that interacts directly with RETINOBLASTOMA PROTEIN and CYCLIN A. E2F2 activates GENETIC TRANSCRIPTION required for CELL CYCLE entry and DNA synthesis.Cyclins: A large family of regulatory proteins that function as accessory subunits to a variety of CYCLIN-DEPENDENT KINASES. They generally function as ENZYME ACTIVATORS that drive the CELL CYCLE through transitions between phases. A subset of cyclins may also function as transcriptional regulators.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.Proto-Oncogene Proteins c-jun: Cellular DNA-binding proteins encoded by the c-jun genes (GENES, JUN). They are involved in growth-related transcriptional control. There appear to be three distinct functions: dimerization (with c-fos), DNA-binding, and transcriptional activation. Oncogenic transformation can take place by constitutive expression of c-jun.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Atadenovirus: A genus of ADENOVIRIDAE that comprises viruses of several species of MAMMALS and BIRDS. The type species is Ovine adenovirus D.Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Luciferases: Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.YY1 Transcription Factor: A ubiquitously expressed zinc finger-containing protein that acts both as a repressor and activator of transcription. It interacts with key regulatory proteins such as TATA-BINDING PROTEIN; TFIIB; and ADENOVIRUS E1A PROTEINS.Virus Cultivation: Process of growing viruses in live animals, plants, or cultured cells.Papillomaviridae: A family of small, non-enveloped DNA viruses infecting birds and most mammals, especially humans. They are grouped into multiple genera, but the viruses are highly host-species specific and tissue-restricted. They are commonly divided into hundreds of papillomavirus "types", each with specific gene function and gene control regions, despite sequence homology. Human papillomaviruses are found in the genera ALPHAPAPILLOMAVIRUS; BETAPAPILLOMAVIRUS; GAMMAPAPILLOMAVIRUS; and MUPAPILLOMAVIRUS.Genes, p53: Tumor suppressor genes located on the short arm of human chromosome 17 and coding for the phosphoprotein p53.RNA Polymerase III: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Tumor Suppressor Proteins: Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Genome, Viral: The complete genetic complement contained in a DNA or RNA molecule in a virus.Cercopithecus aethiops: A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.Polyomavirus: A genus of potentially oncogenic viruses of the family POLYOMAVIRIDAE. These viruses are normally present in their natural hosts as latent infections. The virus is oncogenic in hosts different from the species of origin.Proto-Oncogene Proteins c-myc: Cellular DNA-binding proteins encoded by the c-myc genes. They are normally involved in nucleic acid metabolism and in mediating the cellular response to growth factors. Elevated and deregulated (constitutive) expression of c-myc proteins can cause tumorigenesis.Cytoplasm: The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)Histone Acetyltransferases: Enzymes that catalyze acyl group transfer from ACETYL-CoA to HISTONES forming CoA and acetyl-histones.Proliferating Cell Nuclear Antigen: Nuclear antigen with a role in DNA synthesis, DNA repair, and cell cycle progression. PCNA is required for the coordinated synthesis of both leading and lagging strands at the replication fork during DNA replication. PCNA expression correlates with the proliferation activity of several malignant and non-malignant cell types.Kinetics: The rate dynamics in chemical or physical systems.RNA Splicing: The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.Ubiquitin-Protein Ligases: A diverse class of enzymes that interact with UBIQUITIN-CONJUGATING ENZYMES and ubiquitination-specific protein substrates. Each member of this enzyme group has its own distinct specificity for a substrate and ubiquitin-conjugating enzyme. Ubiquitin-protein ligases exist as both monomeric proteins multiprotein complexes.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.G-Box Binding Factors: A family of transcription factors found primarily in PLANTS that bind to the G-box DNA sequence CACGTG or to a consensus sequence CANNTG.Respiratory Tract Infections: Invasion of the host RESPIRATORY SYSTEM by microorganisms, usually leading to pathological processes or diseases.Recombination, Genetic: Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.Genetic Complementation Test: A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.Antibodies, Viral: Immunoglobulins produced in response to VIRAL ANTIGENS.Oncogene Proteins: Proteins coded by oncogenes. They include proteins resulting from the fusion of an oncogene and another gene (ONCOGENE PROTEINS, FUSION).Cyclic AMP Response Element-Binding Protein: A protein that has been shown to function as a calcium-regulated transcription factor as well as a substrate for depolarization-activated CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASES. This protein functions to integrate both calcium and cAMP signals.Viruses: Minute infectious agents whose genomes are composed of DNA or RNA, but not both. They are characterized by a lack of independent metabolism and the inability to replicate outside living host cells.Serotyping: Process of determining and distinguishing species of bacteria or viruses based on antigens they share.Inclusion Bodies, Viral: An area showing altered staining behavior in the nucleus or cytoplasm of a virus-infected cell. Some inclusion bodies represent "virus factories" in which viral nucleic acid or protein is being synthesized; others are merely artifacts of fixation and staining. One example, Negri bodies, are found in the cytoplasm or processes of nerve cells in animals that have died from rabies.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Pneumonia, Viral: Inflammation of the lung parenchyma that is caused by a viral infection.Haplorhini: A suborder of PRIMATES consisting of six families: CEBIDAE (some New World monkeys), ATELIDAE (some New World monkeys), CERCOPITHECIDAE (Old World monkeys), HYLOBATIDAE (gibbons and siamangs), CALLITRICHINAE (marmosets and tamarins), and HOMINIDAE (humans and great apes).Time Factors: Elements of limited time intervals, contributing to particular results or situations.Antigens, Viral: Substances elaborated by viruses that have antigenic activity.Fluorescent Antibody Technique: Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.RNA Polymerase II: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Proto-Oncogene Proteins c-bcl-2: Membrane proteins encoded by the BCL-2 GENES and serving as potent inhibitors of cell death by APOPTOSIS. The proteins are found on mitochondrial, microsomal, and NUCLEAR MEMBRANE sites within many cell types. Overexpression of bcl-2 proteins, due to a translocation of the gene, is associated with follicular lymphoma.Antigens, CD46: A ubiquitously expressed complement receptor that binds COMPLEMENT C3B and COMPLEMENT C4B and serves as a cofactor for their inactivation. CD46 also interacts with a wide variety of pathogens and mediates immune response.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Macromolecular Substances: Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Viral Vaccines: Suspensions of attenuated or killed viruses administered for the prevention or treatment of infectious viral disease.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Zinc Fingers: Motifs in DNA- and RNA-binding proteins whose amino acids are folded into a single structural unit around a zinc atom. In the classic zinc finger, one zinc atom is bound to two cysteines and two histidines. In between the cysteines and histidines are 12 residues which form a DNA binding fingertip. By variations in the composition of the sequences in the fingertip and the number and spacing of tandem repeats of the motif, zinc fingers can form a large number of different sequence specific binding sites.Regulatory Sequences, Nucleic Acid: Nucleic acid sequences involved in regulating the expression of genes.COS Cells: CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)Gastroenteritis: INFLAMMATION of any segment of the GASTROINTESTINAL TRACT from ESOPHAGUS to RECTUM. Causes of gastroenteritis are many including genetic, infection, HYPERSENSITIVITY, drug effects, and CANCER.Binding, Competitive: The interaction of two or more substrates or ligands with the same binding site. The displacement of one by the other is used in quantitative and selective affinity measurements.Mice, Inbred C57BLCell Survival: The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.Rats, Inbred F344Oncogenic Viruses: Viruses that produce tumors.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Tropism: The directional growth of an organism in response to an external stimulus such as light, touch, or gravity. Growth towards the stimulus is a positive tropism; growth away from the stimulus is a negative tropism. (From Concise Dictionary of Biology, 1990)Cytomegalovirus: A genus of the family HERPESVIRIDAE, subfamily BETAHERPESVIRINAE, infecting the salivary glands, liver, spleen, lungs, eyes, and other organs, in which they produce characteristically enlarged cells with intranuclear inclusions. Infection with Cytomegalovirus is also seen as an opportunistic infection in AIDS.
(1/94) Early region 1 transforming functions are dispensable for mammary tumorigenesis by human adenovirus type 9.

Some human adenoviruses are tumorigenic in rodents. Subgroup A and B human adenoviruses generally induce sarcomas in both male and female animals, and the gene products encoded within viral early region 1 (E1 region) are both necessary and sufficient for this tumorigenicity. In contrast, subgroup D human adenovirus type 9 (Ad9) induces estrogen-dependent mammary tumors in female rats and requires the E4 region-encoded ORF1 oncoprotein for its tumorigenicity. Considering the established importance of the viral E1 region for tumorigenesis by adenoviruses, we investigated whether this viral transcription unit is also necessary for Ad9 to generate mammary tumors. The nucleotide sequence of the Ad9 E1 region indicated that the gene organization and predicted E1A and E1B polypeptides of Ad9 are closely related to those of other human adenovirus E1 regions. In addition, an Ad9 E1 region plasmid demonstrated focus-forming activity in both low-passage-number and established rat embryo fibroblasts, whereas a large deletion within either the E1A or E1B gene of this plasmid diminished transforming activity. Surprisingly, we found that introducing the same transformation-inactivating E1A and E1B deletions into Ad9 results in mutant viruses that retain the ability to elicit mammary tumors in rats. These results are novel in showing that Ad9 represents a unique oncogenic adenovirus in which the E4 region, rather than the E1 region, encodes the major oncogenic determinant in the rat.  (+info)

(2/94) E1(-)E4(+) adenoviral gene transfer vectors function as a "pro-life" signal to promote survival of primary human endothelial cells.

Although endothelial cells are quiescent and long-lived in vivo, when they are removed from blood vessels and cultured in vitro they die within days to weeks. In studies of the interaction of E1(-)E4(+) replication-deficient adenovirus (Ad) vectors and human endothelium, the cells remained quiescent and were viable for prolonged periods. Evaluation of these cultures showed that E1(-)E4(+) Ad vectors provide an "antiapoptotic" signal that, in association with an increase in the ratio of Bcl2 to Bax levels, induces the endothelial cells to enter a state of "suspended animation," remaining viable for at least 30 days, even in the absence of serum and growth factors. Although the mechanisms initiating these events are unclear, the antiapoptoic signal requires the presence of E4 genes in the vector genome, suggesting that one or more E4 open reading frames of subgroup C Ad initiate a "pro-life" program that modifies cultured endothelial cells to survive for prolonged periods.  (+info)

(3/94) Generation of an adenovirus vector lacking E1, e2a, E3, and all of E4 except open reading frame 3.

Toxicity and immunity associated with adenovirus backbone gene expression is an important hurdle to overcome for successful gene therapy. Recent efforts to improve adenovirus vectors for in vivo use have focused on the sequential deletion of essential early genes. Adenovirus vectors have been constructed with the E1 gene deleted and with this deletion in combination with an E2a, E2b, or E4 deletion. We report here a novel vector (Av4orf3nBg) lacking E1, E2a, and all of E4 except open reading frame 3 (ORF3) and expressing a beta-galactosidase reporter gene. This vector was generated by transfection of a plasmid carrying the full-length vector sequence into A30.S8 cells that express E1 and E2a but not E4. Production was subsequently performed in an E1-, E2a-, and E4-complementing cell line. We demonstrated with C57BL/6 mice that the Av4orf3nBg vector effected gene transfer with an efficiency comparable to that of the Av3nBg (wild-type E4) vector but that the former exhibited a higher level of beta-galactosidase expression. This observation suggests that E4 ORF3 alone is able to enhance RNA levels from the beta-galactosidase gene when the Rous sarcoma virus promoter is used to drive transgene expression in the mouse liver. In addition, we observed less liver toxicity in mice injected with the Av4orf3nBg vector than those injected with the Av3nBg vector at a comparable DNA copy number per cell. This study suggests that the additional deletion of E4 in an E1 and E2a deletion background may be beneficial in decreasing immunogenicity and improving safety and toxicity profiles, as well as increasing transgene capacity and expression for liver-directed gene therapy.  (+info)

(4/94) Frequency and stability of chromosomal integration of adenovirus vectors.

One of the limitations of adenovirus vectors is the lack of machinery necessary for their integration into host chromosomes, resulting in short-term gene expression in dividing cells. We analyzed frequencies of integration and persistence of gene expression from integrated adenovirus vectors. Both E1-substituted and helper-dependent adenovirus vectors achieved similar integration efficiencies of approximately 10(-3) to 10(-5) per cell, with the helper-dependent vector showing slightly higher efficiencies. In stable cell pools, gene expression of the integrated vector persisted for at least 50 cell divisions without selection. However, some stable cell clones showed changes in gene expression, which were accompanied by structural changes in the integrated vector DNA.  (+info)

(5/94) Reduced toxicity, attenuated immunogenicity and efficient mediation of human p53 gene expression in vivo by an adenovirus vector with deleted E1-E3 and inactivated E4 by GAL4-TATA promoter replacement.

A recombinant adenovirus with deleted E1 and E3, and E4-inactivated by replacing the E4 promoter with a synthetic promoter composed of a minimal TATA box and five consensus yeast GAL4-binding site elements was developed and used to express the human tumor suppresser gene p53. The toxicity and immunogenicity of this vector and vector-mediated p53 gene expression in vivo were studied in immunocompetent C3H and C57BL/6 mice. Expression of the late viral gene product, hexon protein, was observed in C3H and C57BL/6 mice injected with E4 wild-type adenovirus constructs Adv-cmv-beta-Gal (BG), Adv-cmv-hp53 (WT), and empty E1- vector Adv-E4 (EW) 3 to 28 days after injection, but was undetectable in mice treated with E4 modified empty E1- vector Adv-GAL4 (EG) or Adv-cmv-hp53-GAL4 (G4). Expression of the p53 gene was observed in both WT- and G4-injected C3H and C57BL/6 mouse livers from days 3 to 28. Ten weeks after injection, p53 gene expression was still detected in G4-treated C57BL/6 mice at similar levels, but was not detectable in WT-treated mice. Vector-induced liver toxicity was evaluated by analyzing serum transaminases (SGOT and SGPT) activities. In all cases, SGOT and SGPT activities were markedly decreased in EG-treated C3H and C57BL/6 mice compared with those in EW-treated mice on days 3, 7 and 14 after injection. In C57BL/6 mice, the total anti-adenoviral CTL activities were two- to three-fold higher in animals treated with EW vector than in those treated with EG vector. These results suggest that inactivation of the E4 promoter efficiently diminished the viral replication and the late viral gene expression, reduced host immune response and consequently reduced toxicity and prolonged the duration of transgene expression in vivo.  (+info)

(6/94) Induction of endogenous genes following infection of human endothelial cells with an E1(-) E4(+) adenovirus gene transfer vector.

Recombinant adenovirus (Ad) gene transfer vectors are effective at transferring exogenous genes to a variety of cells and tissue types both in vitro and in vivo. However, in the process of gene transfer, the Ad vectors induce the expression of target cell genes, some of which may modify the function of the target cell and/or alter the local milieu. To develop a broader understanding of Ad vector-mediated induction of endogenous gene expression, genes induced by first-generation E1(-) E4(+) Ad vectors in primary human umbilical vein endothelial cells were identified by cDNA subtraction cloning. The identified cDNAs included signaling molecules (lymphoid blast crisis [LBC], guanine nucleotide binding protein alpha type S [Galpha-S], and mitogen kinase [MEK5]), calcium-regulated/cytoskeletal proteins (calpactin p11 and p36 subunits, vinculin, and spinocerebellar ataxia [SCA1]), growth factors (insulin-like growth factor binding protein 4 and transforming growth factor beta2), glyceraldehyde-6-phosphate dehydrogenase, an expressed sequence tag, and a novel cDNA showing homology to a LIM domain sequence. Two- to sevenfold induction of the endogenous gene expression was observed at 24 h postinfection, and induction continued up to 72 h, although the timing of gene expression varied among the identified genes. In contrast to that observed in endothelial cells, the Ad vector-mediated induction of gene expression was not found following Ad vector infection of primary human dermal fibroblasts or human alveolar macrophages. Empty Ad capsids did not induce endogenous gene expression in endothelial cells. Interestingly, additional deletion of the E4 gene obviated the upregulation of genes in endothelial cells by the E1(-) E3(-) Ad vector, suggesting that genes carried by the E4 region play a central role in modifying target cell gene expression. These findings are consistent with the notion that efficient transfer of exogenous genes to endothelial cells by first-generation Ad vectors comes with the price that these vectors also induce the expression of a variety of cellular genes.  (+info)

(7/94) Porcine adenovirus-3 as a helper-dependent expression vector.

Porcine adenovirus has been proposed as a potential vector for generating novel and effective vaccines for pigs. As a prerequisite for the generation of helper-dependent porcine adenovirus-3 (PAV-3) vectors, two E1-complementing porcine cell lines expressing E1 proteins of human adenovirus-5 (HAV-5) were made. These cell lines could be efficiently transfected with DNA and allowed the rescue and propagation of a PAV-3 recombinant, PAV201, containing a 0.597 kb E3 deletion and a 0.803 kb E1A deletion. Our data demonstrate that E1A proteins of HAV-5 have the capacity to transform foetal porcine retina cells and complement for the E1A proteins of PAV-3. The green fluorescent protein (GFP) gene placed under the control of a cytomegalovirus immediate early promoter was inserted into the E1A region of the PAV201 genome. Using these cell lines, a helper-dependent PAV-3 recombinant expressing GFP, PAV202, was constructed and characterized. The wild-type PAV-3 and the recombinant PAV202 expressing GFP were used to determine the ability of the virus to enter and replicate in cells of human and animal origin under cell culture conditions. Our results suggest that PAV-3 enters but does not replicate in dog, sheep, bovine and human cells.  (+info)

(8/94) Recombinant E1-deleted adenoviral vectors induce apoptosis in a rat airway epithelial mucous goblet cell line.

Replication-defective adenoviruses (Ad) are used as vectors for delivering therapeutic genes to human airway cells. We examined whether E1-deleted Ad vectors (Ad5-CMV-LacZ) had effects on cell kinetics in SPOC1 cells, which is a rat airway epithelial mucous goblet cell line. There was a vector multiplicity of infection (moi)-dependent increase of the transduction efficiency of the LacZ reporter gene in SPOC cells. Cell proliferation was inhibited in the vector-infected cells compared with that in vehicle-exposed cells. However, increased cell death was observed in the vector-infected cells with a higher moi. The morphology of vector-exposed cells revealed apoptotic features including nuclear condensation and a fragmented nucleus. These results indicate that higher moi of vectors allows the cells to achieve higher gene transfer, but also induce apoptosis of infected cells. Minimizing the induction of apoptosis of vector-infected cells may be an important strategy for the prolongation of transduction efficiency of Ad vectors in airway epithelial mucous goblet cells.  (+info)

*  List of MeSH codes (D12.776)
... adenovirus e1 proteins MeSH D12.776.964.700.045.050.100 - adenovirus e1a proteins MeSH D12.776.964.700.045.050.110 - adenovirus ... adenovirus E1 proteins MeSH D12.776.624.664.520.045.050.100 - adenovirus E1A proteins MeSH D12.776.624.664.520.045.050.110 - ... adenovirus e2 proteins MeSH D12.776.624.664.520.045.070 - adenovirus e3 proteins MeSH D12.776.624.664.520.045.080 - adenovirus ... adenovirus e2 proteins MeSH D12.776.964.700.045.070 - adenovirus e3 proteins MeSH D12.776.964.700.045.080 - adenovirus e4 ...
*  Cyclin E1
Li Y, Graham C, Lacy S, Duncan AM, Whyte P (1994). "The adenovirus E1A-associated 130-kD protein is encoded by a member of the ... G1/S-specific cyclin-E1 is a protein that in humans is encoded by the CCNE1 gene. The protein encoded by this gene belongs to ... This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to ... Li Y, Graham C, Lacy S, Duncan AM, Whyte P (December 1993). "The adenovirus E1A-associated 130-kD protein is encoded by a ...
*  Immortalised cell line
... the adenovirus type 5 E1 gene was used to immortalize the HEK 293 cell line). Artificial expression of key proteins required ... from testing toxicity of compounds or drugs to production of eukaryotic proteins. While immortalized cell lines often originate ...
*  List of MeSH codes (D23)
... adenovirus e1 proteins MeSH D23.050.327.045.060 --- adenovirus e2 proteins MeSH D23.050.327.045.070 --- adenovirus e3 proteins ... adenovirus e4 proteins MeSH D23.050.327.062 --- antigens, viral, tumor MeSH D23.050.327.062.045 --- adenovirus e1a proteins ... adenovirus e1a proteins MeSH D23.050.285.062.050 --- adenovirus e1b proteins MeSH D23.050.285.062.090 --- antigens, ... hiv core protein p24 MeSH D23.050.327.520.330 --- hiv envelope protein gp41 MeSH D23.050.327.520.350 --- hiv envelope protein ...
*  S100A10
"Induction of endogenous genes following infection of human endothelial cells with an E1(-) E4(+) adenovirus gene transfer ... S100 calcium-binding protein A10 (S100A10), also known as p11, is a protein that is encoded by the S100A10 gene in humans and ... The S100 protein is implicated in exocytosis and endocytosis by reorganization of F-actin. The p11 protein is linked with the ... As a member of the S-100 family, its structure resembles that of the S-100A1 and S-100B proteins. This class of proteins has ...
*  YY1
... and relief of repression by adenovirus E1A protein". Cell. 67 (2): 377-88. doi:10.1016/0092-8674(91)90189-6. PMID 1655281. Zhu ... Park K, Atchison ML (Nov 1991). "Isolation of a candidate repressor/activator, NF-E1 (YY-1, delta), that binds to the ... YY1 is a ubiquitously distributed transcription factor belonging to the GLI-Kruppel class of zinc finger proteins. The protein ... "Relief of YY1 transcriptional repression by adenovirus E1A is mediated by E1A-associated protein p300". Genes & Development. 9 ...
*  UBE2I
In a second step, an E1 activating complex binds to SUMO at its di-glycine and passes it on to the E2 protein Ubc9, where it ... Hateboer G, Hijmans EM, Nooij JB, Schlenker S, Jentsch S, Bernards R (1996). "mUBC9, a novel adenovirus E1A-interacting protein ... For example, sumoylation may affect a protein's localization in the cell, its ability to interact with other proteins or DNA. ... Four alternatively spliced transcript variants encoding the same protein have been found for this gene. The UBC9 protein ...
*  HEK 293 cells
... system Isoform-selective protein kinase C agonist Interaction between two proteins Nuclear export signal in a protein A more ... and could be preferentially transformed by adenovirus. Adenoviruses transform neuronal lineage cells much more efficiently than ... E1 and E3) are deleted, such as AdEasy. An important variant of this cell line is the 293T cell line. It contains the SV40 ... The cells were cultured by van der Eb; the transformation by adenovirus was performed by Frank Graham, a post-doc in van der ...
*  Cyclin-dependent kinase 2
The protein encoded by this gene is a member of the cyclin-dependent kinase family of Ser/Thr protein kinases. This protein ... Cyclin-dependent kinase 2 has been shown to interact with: BRCA1, CDK2AP1, CDKN1B CDKN3, CEBPA, Cyclin A1, Cyclin E1, Flap ... and adenovirus E1A-associated p33 kinase". Nature. 353 (6340): 174-7. doi:10.1038/353174a0. PMID 1653904. "Entrez Gene: CDK2 ... This protein associates with and is regulated by the regulatory subunits of the complex including cyclin E or A. Cyclin E binds ...
*  ATF3
"Altered AP-1/ATF complexes in adenovirus-E1-transformed cells due to EIA-dependent induction of ATF3". Oncogene. 12 (5): 1025- ... "A human protein-protein interaction network: a resource for annotating the proteome". Cell. 122 (6): 957-68. doi:10.1016/j.cell ... ATF3 protein, human at the US National Library of Medicine Medical Subject Headings (MeSH) FactorBook ATF3 This article ... Cyclic AMP-dependent transcription factor ATF-3 is a protein that, in humans, is encoded by the ATF3 gene. Activating ...
*  Centrifugation
By 1900, it had been generally accepted that proteins were composed of amino acids; however, whether proteins were colloids or ... Berkowitz, S.A., Philo, J.S. Monitoring the Homogeneity of Adenovirus Preparations (a Gene Therapy Delivery System) Using ... 277(31): e1-e2. ... One protein being investigated at the time was hemoglobin. It ... Sedimentation Velocity Analysis of Heterogeneous Protein-Protein Interactions: Lamm Equation Modeling and Sedimentation ...
*  Retinoblastoma-like protein 2
... has been shown to interact with: BRCA1, BRF1 C-Raf, Cyclin E1, Cyclin-dependent kinase 2, HDAC1, ... Li Y, Graham C, Lacy S, Duncan AM, Whyte P (Dec 1993). "The adenovirus E1A-associated 130-kD protein is encoded by a member of ... Li Y, Graham C, Lacy S, Duncan AM, Whyte P (Dec 1993). "The adenovirus E1A-associated 130-kD protein is encoded by a member of ... Retinoblastoma-like protein 2 is a protein that in humans is encoded by the RBL2 gene. ...
*  Minigene
... proteins and small ribonucleoproteins (snRNP). Proteins encoded by aberrantly spliced pre-mRNAs are functionally different and ... 32 (4): 757.e1-757.e11. doi:10.1016/j.neurobiolaging.2010.12.013. Rajan, P.; Elliott, DJ; Robson, CN; Leung, HY (Aug 2009). " ... RNA splicing was discovered in the late 1970s through the study of adenoviruses that invade mammals and replicate inside them. ... Tau protein isoforms are created by alternative splicing of exons 2, 3 and 10. The regulation of tau splicing is specific to ...
*  Papillomaviridae
Encodes a protein that binds to the viral origin of replication in the long control region of the viral genome. E1 uses ATP to ... Glaunsinger BA, Lee SS, Thomas M, Banks L, Javier R (2000). "Interactions of the PDZ-protein MAGI-1 with adenovirus E4-ORF1 and ... E6 proteins also interact with the MAGUK (membrane-associated guanylate kinase family) proteins. These proteins, including MAGI ... very hydrophobic proteins that destabilise the function of many membrane proteins in the infected cell. The E5 protein of some ...
*  MiR-155
... the protein-encoding mRNA for the transcriptional regulator Pu.1-protein, elevation of Pu.1 protein predisposes defective IgG1 ... 202 (5): 466.e1-7. doi:10.1016/j.ajog.2010.01.057. PMID 20452491. Hu YL, Fong S, Largman C, Shen WF (Sep 2010). "HOXA9 ... and adenoviruses, another virus expressing miR-155-like miRNA in chickens is the oncogenic MDV-1 whose non-oncogenic relative ... Immature B cells which are miR-155 deficient evade apoptosis as a result of elevated Bcl-2 protein levels; a protein that was ...
*  Vaccine
Egg protein is present in influenza and yellow fever vaccines as they are prepared using chicken eggs. Other proteins may be ... Hulst MM, Westra DF, Wensvoort G, Moormann RJ (1993). "Glycoprotein E1 of hog cholera virus expressed in insect cells protects ... Other canine vaccines include canine distemper, canine parvovirus, infectious canine hepatitis, adenovirus-2, leptospirosis, ... Some cells of the immune system that recognize the proteins expressed will mount an attack against these proteins and cells ...
Improved adenoviral vector for vascular gene therapy : beneficial effects on vascular function and inflammation. - CLAHRC  Improved adenoviral vector for vascular gene therapy : beneficial effects on vascular function and inflammation. - CLAHRC
We conclude that the E1/E4-AV vector is superior to the E1-AV vector for vascular gene therapy because of the prolonged ... To reduce the impact of viral proteins on the gene-modified cells, a second-generation adenoviral vector with an additional ... The E1-AV vector-transduced vessels also demonstrated significantly impaired endothelium-dependent relaxation whereas the E1/E4 ... we directly compared the efficiency of gene transfer to uninjured rabbit carotid arteries using either an E1/E4-AV or an E1-AV ...
more infohttps://www.clahrc-oxford.nihr.ac.uk/publications/105349
Frontiers | Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of...  Frontiers | Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of...
Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation ... Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation ... we tracked vectors derived from the human adenovirus type 5 at whole body, tissue and cellular scales throughout the digestive ... detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical ...
more infohttps://www.frontiersin.org/articles/10.3389/fcimb.2018.00006/full
Intraocular Adenoviral Vector-Mediated Gene Transfer in Proliferative Retinopathies | IOVS | ARVO Journals  Intraocular Adenoviral Vector-Mediated Gene Transfer in Proliferative Retinopathies | IOVS | ARVO Journals
A gene transfer vector-cell line system for complete functional complementation of adenovirus early regions E1 and E4. J Virol. ... The delivery of proteins is particularly problematic and may require repeated intraocular injections, which are risky and ... Adenovirus-mediated gene transfer to murine retinal cells in vitro and in vivo. FEBS Lett. 1994;347:117-122. [CrossRef] [PubMed ... Recombinant adenovirus-mediated gene transfer into the adult rat retina. Curr Eye Res. 1998;17:316-321. [CrossRef] [PubMed] ...
more infohttp://iovs.arvojournals.org/article.aspx?articleid=2123325
The failed HIV Merck vaccine study: a step back or a launching point for future vaccine development? | JEM  The failed HIV Merck vaccine study: a step back or a launching point for future vaccine development? | JEM
... the Merck rAD5 vector is missing only one adenovirus protein (E1) and thus expresses more viral genes than other adenovirus ... Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein. J ... The vector used by National Institutes of Health's Vaccine Research Center, for example, lacks both the E1 and E3 protein. ... Adenovirus types 5 and 35 seroprevalence in AIDS risk groups supports type 35 as a vaccine vector. AIDS. 18:1213-1216. ...
more infohttp://jem.rupress.org/content/205/1/7
List of MeSH codes (D12.776) - Wikipedia  List of MeSH codes (D12.776) - Wikipedia
... adenovirus e1 proteins MeSH D12.776.964.700.045.050.100 - adenovirus e1a proteins MeSH D12.776.964.700.045.050.110 - adenovirus ... adenovirus E1 proteins MeSH D12.776.624.664.520.045.050.100 - adenovirus E1A proteins MeSH D12.776.624.664.520.045.050.110 - ... adenovirus e2 proteins MeSH D12.776.624.664.520.045.070 - adenovirus e3 proteins MeSH D12.776.624.664.520.045.080 - adenovirus ... adenovirus e2 proteins MeSH D12.776.964.700.045.070 - adenovirus e3 proteins MeSH D12.776.964.700.045.080 - adenovirus e4 ...
more infohttps://en.wikipedia.org/wiki/List_of_MeSH_codes_(D12.776)
NONNEUROTROPIC ADENOVIRUS: A VECTOR FOR GENE TRANSFER TO THE BRAIN AND GENE THERAPY OF NEUROLOGICAL DISORDERS  NONNEUROTROPIC ADENOVIRUS: A VECTOR FOR GENE TRANSFER TO THE BRAIN AND GENE THERAPY OF NEUROLOGICAL DISORDERS
Additionally, E1/E3-deleted adenoviruses do express adenoviral proteins encoded within their genomes (Yang et al., 1994a,b). ... Tumor-specific, replication-competent adenovirus vectors overexpressing the adenovirus death protein. J. Virol. 2000;74(13): ... 3) Following peripheral immunization against adenovirus type 5, transgene expression from an E1/E3-deleted adenovirus vector is ... Expression from an E1/E3-deleted adenovirus in brains of animals previously immunized against adenovirus type 5 is almost ...
more infohttp://pubmedcentralcanada.ca/pmcc/articles/PMC2902245/
Richard J. Grand, MD | Boston Childrens Hospital  Richard J. Grand, MD | Boston Children's Hospital
Consequences of disruption of the interaction between p53 and the larger adenovirus early region 1B protein in adenovirus E1 ... Adenovirus type 12 early region 1 proteins: a study of their subcellular localization and protein-protein interactions. J Gen ... C-terminal-binding protein interacting protein binds directly to adenovirus early region 1A through its N-terminal region and ... Structural determinants present in the C-terminal binding protein binding site of adenovirus early region 1A proteins. J Biol ...
more infohttp://www.childrenshospital.org/directory/physicians/g/richard-grand
Suresh Mittal - College of Veterinary Medicine - Purdue University  Suresh Mittal - College of Veterinary Medicine - Purdue University
E1) proteins and isolation of E1 expressing cell lines. Virology 295:108-118.. ... Bovine adenovirus type 3 internalization is independent of primary receptors of human adenovirus type 5 and porcine adenovirus ... Aggarwal, N. and Mittal, S. K. (2000). Sequence analyses of porcine adenovirus type 3 E1 region, pIX, and pIVa2 genes. ... Breker-Klassen, M. M., Yoo, D., Mittal, S. K., Sorden, S. D., Haines, D. M. and Babiuk, L. A. (1995). Recombinant adenoviruses ...
more infohttps://vet.purdue.edu/directory/person.php?id=82
Adenoviral E2 IVa2 protein interacts with L4 33K protein and E2 DNA-binding protein | Microbiology Society  Adenoviral E2 IVa2 protein interacts with L4 33K protein and E2 DNA-binding protein | Microbiology Society
In this study, we demonstrated interactions among IVa2, 33K and DNA-binding protein (DBP) in virus-infected cells by in vivo ... In human AdV serotype 5 (HAdV5), the IVa2 protein initiates specific recognition of viral genome by associating with the viral ... Adenovirus (AdV) is thought to follow a sequential assembly pathway similar to that observed in dsDNA bacteriophages and ... 2002;). Characterization of bovine adenovirus type 3 E1 proteins and isolation of E1-expressing cell lines. . Virology 295:, ...
more infohttps://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.049346-0
Decreased Vector Gene Expression from E2b Gene-Deleted Adenovirus Serotype 5 Vaccines Intensifies Proinflammatory Immune...  Decreased Vector Gene Expression from E2b Gene-Deleted Adenovirus Serotype 5 Vaccines Intensifies Proinflammatory Immune...
HEK293 cells constitutively produce the Ad5 E1 protein (41), allowing the Ad5[E1−] vaccine platform but not the Ad5[E1−,E2b−] ... Multiply deleted [E1, polymerase-, and pTP-] adenovirus vector persists despite deletion of the preterminal protein. J Gene Med ... Recombinant adenovirus vaccine vector construction.Transgene-lacking recombinant Ad5 vector platforms Ad5[E1−] (64) and Ad5[E1 ... Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus hexon protein. J ...
more infohttps://cvi.asm.org/content/24/6/e00061-17
Real-Time PCR Quantification of Human Adenoviruses in Urban Rivers Indicates Genome Prevalence but Low Infectivity | Applied...  Real-Time PCR Quantification of Human Adenoviruses in Urban Rivers Indicates Genome Prevalence but Low Infectivity | Applied...
HEK-293A is a recombinant cell line with an insertion of adenovirus E1 gene, so that E1 protein (early expression protein) is ... Trans E1 component requirements for maximal replication of E1-defective recombinant adenovirus. Virology 248:406-419. ... Detection of human adenovirus by real-time PCR.For adenovirus analysis by real-time PCR, samples were further concentrated by ... In spite of the higher concentration of adenoviruses detected at the mouth of the river, adenoviruses were found more ...
more infohttps://aem.asm.org/content/71/11/7426?ijkey=f4c3b9b7f2f452a224e95093d8e7a3b0101ff2a4&keytype2=tf_ipsecsha
Selected Publications | Etubics  Selected Publications | Etubics
Isolation and characterization of packaging cell lines that coexpress the adenovirus E1, DNA polymerase, and preterminal ... proteins: implications for gene therapy. Proceedings of the National Academy of Sciences of the United States of America, April ... Anti-tumor immunotherapy despite immunity to adenovirus using a novel adenoviral vector Ad5 [E1-, E2b-]-CEA ... Production and characterization of improved adenovirus vectors with the E1, E2b, and E3 genes deleted ...
more infohttp://etubics.com/selected-publications/
Adenovirus Methods and Protocols | Springer for Research & Development  Adenovirus Methods and Protocols | Springer for Research & Development
Wold has organized a collection of readily reproducible methods for conducting research with adenoviruses, the premier and most ... In Adenovirus Methods and Protocols, William S.M. ... Immunoprecipitation of E1 A-Containing Protein Complexes ... Simultaneous Detection of RNA and Proteins in Adenovirus-Infected Cells by Fluorescence In Situ Hybridization (FISH) and ... Methods for Creating and Analyzing Adenovirus Vectors that Express Proteins that Act on the Viral Genome ...
more infohttps://rd.springer.com/book/10.1385%2F0896035514
RanBP2 associates with Ubc9p and a modified form of RanGAP1 | PNAS  RanBP2 associates with Ubc9p and a modified form of RanGAP1 | PNAS
... the papillomavirus E1 protein (14), and the adenovirus E1A protein (15).. We previously documented the association of three Ran ... A) Protein sequence of Xenopus RanGAP1. The protein sequence of human RanGAP1 is shown below for comparison. Straight vertical ... The proteins on the membranes were visualized by Ponceau S. Determination of peptide sequences was performed at the protein ... In all figures, proteins were analyzed on 4-20% gradient SDS/polyacrylamide gels (NOVEX, San Diego). Protein concentrations ...
more infohttps://www.pnas.org/content/94/8/3736?ijkey=bcb5f86514cd502cc25ffa613eb086653a0f8ad0&keytype2=tf_ipsecsha
Adenoviral Gene Delivery for Mammalian Expression-Getting Started | Thermo Fisher Scientific - JP  Adenoviral Gene Delivery for Mammalian Expression-Getting Started | Thermo Fisher Scientific - JP
... adenovirus production, storage and amplification of adenoviral stocks, viral titering, transduction, and analysis of expression ... Can I use any 293 cells for adenovirus production? Any 293-derived cell line or other cell line that expresses the E1 proteins ... Is long-term expression of my recombinant protein possible using adenovirus? The pAd/CMV/V5-DEST™ or pAd/PL-DEST™ adenoviral ... Since expression of E1 (E1a and E1b) proteins is required for the expression of the other adenoviral viral genes (e.g., late ...
more infohttps://www.thermofisher.com/jp/en/home/technical-resources/technical-reference-library/protein-expression-support-center/adenoviral-gene-delivery-support/adenoviral-gene-delivery-support-getting-started.html
Generation of an Adenovirus Vector Lacking E1, E2a, E3, and All of E4 except Open Reading Frame 3 | Journal of Virology  Generation of an Adenovirus Vector Lacking E1, E2a, E3, and All of E4 except Open Reading Frame 3 | Journal of Virology
1997) The adenovirus E4orf6 protein can promote E1A/E1β-induced focus formation by interfering with p53 tumor suppressor ... 1998) In vitro and in vivo biology of recombinant adenovirus vectors with E1, E1/E2a, or E1/E4 deleted. J. Virol. 72:2022-2032. ... Adenovirus vectors have been constructed with the E1 gene deleted (28, 36, 37, 45) and with E1 plus E2a, E2b, or E4 deleted (1 ... 1993) Adenovirus E4orf4 protein binds to protein phosphatase 2A, and the complex down regulates E1A-enhanced junB transcription ...
more infohttps://jvi.asm.org/content/73/7/6048
Parks RJ[au] - PubMed - NCBI  Parks RJ[au] - PubMed - NCBI
Human adenovirus type 5 vectors deleted of early region 1 (E1) undergo limited expression of early replicative E2 proteins and ... Adenovirus-Mediated Expression of the p14 Fusion-Associated Small Transmembrane Protein Promotes Cancer Cell Fusion and ... A reduction in the human adenovirus virion size through use of a shortened fibre protein does not enhance muscle transduction ... Expression of the fusogenic p14 FAST protein from a replication-defective adenovirus vector does not provide a therapeutic ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed?cmd=search&term=Parks+RJ%5Bau%5D&dispmax=50
Anti-tumor immunotherapy despite immunity to adenovirus using a novel adenoviral vector Ad5 [E1-, E2b-]-CEA | SpringerLink  Anti-tumor immunotherapy despite immunity to adenovirus using a novel adenoviral vector Ad5 [E1-, E2b-]-CEA | SpringerLink
Adenovirus serotype 5 (Ad5) has been widely used in clinical trials because it expresses inserted transgenes robustly and ... adenovirus vector persists despite deletion of the preterminal protein. J Gene Med 2:250-259CrossRefPubMedGoogle Scholar ... Anti-tumor immunotherapy despite immunity to adenovirus using a novel adenoviral vector Ad5 [E1-, E2b-]-CEA. ... Production and characterization of improved adenovirus vectors with the E1, E2b, and E3 genes deleted. J Virol 72:926-933PubMed ...
more infohttps://link.springer.com/article/10.1007%2Fs00262-010-0847-8
US20090317417A1 - Modified AAV Vectors Having Reduced Capsid Immunogenicity and Use Thereof 
        - Google Patents  US20090317417A1 - Modified AAV Vectors Having Reduced Capsid Immunogenicity and Use Thereof - Google Patents
... a human kidney cell line containing functional adenovirus E1 genes which provides trans-acting E1 proteins). ... Modified adenovirus hexon protein and uses thereof. EP2325298B1 (en) 2016-10-05. SIMIAN ADENOVIRUSES SAdV-36, -42.1, -42.2, AND ... Adeno-associated virus capsid protein gene, corresponding protein and application of protein ... target antigens include the E1 (also called M or matrix protein), E2 (also called S or Spike protein), E3 (also called HE or ...
more infohttps://patents.google.com/patent/US20090317417A1/en
Adenovirus-Mediated Overexpression of c-Jun and c-Fos Induces Intercellular Adhesion Molecule-1 and Monocyte Chemoattractant...  Adenovirus-Mediated Overexpression of c-Jun and c-Fos Induces Intercellular Adhesion Molecule-1 and Monocyte Chemoattractant...
Protein Extraction and Western Blot Analysis. Nuclear proteins were extracted from HUVECs as previously described.12 Protein ... with E1- and E3-deleted adenovirus-5 genome DNA (Ψ5). An intermolecular recombination of the shuttle vector and Ψ5 then creates ... Using an adenovirus-mediated gene transfer protocol, we found that the AP-1 proteins c-Fos and c-Jun directly cause phenotypic ... By using adenovirus-mediated gene transfer, we show that overexpression of AP-1 proteins directly causes coinduction of gene ...
more infohttp://atvb.ahajournals.org/content/19/9/2078
  • First-generation, E1-deleted adenoviral vectors (E1-AV) can transduce the vascular endothelium with high efficiency, but their use is limited by the resulting acute endothelial injury and the long-term development of intimal hyperplasia. (nihr.ac.uk)
  • To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. (frontiersin.org)
  • After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. (frontiersin.org)
  • however, the E1/E4-AV vector gene-modified vessels showed higher beta-galactosidase expression 10 days after gene transfer. (nihr.ac.uk)
  • We conclude that the E1/E4-AV vector is superior to the E1-AV vector for vascular gene therapy because of the prolonged transgene expression, reduced vascular inflammation, reduced intimal hyperplasia, and maintenance of normal vasomotor function. (nihr.ac.uk)
  • Importantly, the E1/E4-AV vector produced substantially less endothelial cell activation, less inflammation, and reduced neointimal hyperplasia compared with the E1-AV vector-treated vessels. (nihr.ac.uk)
  • To determine whether this E1/E4-AV vector would be useful for vascular gene transfer, we directly compared the efficiency of gene transfer to uninjured rabbit carotid arteries using either an E1/E4-AV or an E1-AV vector encoding beta-galactosidase. (nihr.ac.uk)
  • This study suggests that the additional deletion of E4 in an E1 and E2a deletion background may be beneficial in decreasing immunogenicity and improving safety and toxicity profiles, as well as increasing transgene capacity and expression for liver-directed gene therapy. (asm.org)
  • Recently, we extended those studies by semiquantifying the levels of early and late transcripts in an adenovector with a double deletion of E1 and E2a in vitro and in vivo. (asm.org)
  • Experiments with d17001, an E3-deleted variant of wtAd5, confirmed that the specificity of Ad5-gfa2(B)3-E1 replication was based on the promoter driving E1 and not on the E3 deletion. (eur.nl)
  • Furthermore, it is controversial whether adenoviruses with a deletion in the E1B-55 kDa-coding region might selectively replicate in cells with a mutation or deletion of the p53 gene and, therefore, represent a tool in cancer therapy. (aacrjournals.org)
  • The viral proteins discussed are the two major KSHV encoded transcription factors, K-Rta (KSHV replication and transcriptional activator) and K-bZIP (KSHV basic leucine zipper) and the viral latency-associated nuclear antigen (LANA). (frontiersin.org)
  • A replication-deficient adenovirus encoding β-galactosidase (rAd-βgal) was injected intravenously into these mice. (aacrjournals.org)
  • Artificial expression of key proteins required for immortality, for example telomerase which prevents degradation of chromosome ends during DNA replication in eukaryotes Hybridoma technology, specifically used for the generation of immortalized antibody-producing B cell lines, where an antibody-producing B cell is fused with a myeloma (B cell cancer) cell. (wikipedia.org)
  • Oncolytic adenoviruses act by replicating within and lysing tumor cells. (aacrjournals.org)
  • Evidence suggests that interfering with either the expression of the livin gene or the function of the livin protein could provide a potential therapeutic avenue to induce apoptosis in tumor cells and to significantly improve antitumor responses ( 13 - 15 ). (spandidos-publications.com)
  • Surprisingly, even strong overexpression of p53 or p53mt24-28 allowed the virus to replicate as efficiently as in the absence of p53 proteins, both in tumor cells and in primary endothelial cells. (aacrjournals.org)
  • A similar titer reconstituted in the nude mice with human serum, as was done in the SCID/beige mice, did not abrogate the antitumor efficacy of the replicating adenovirus after intravenous administration. (aacrjournals.org)
  • the same titer had no affect on the activity of an equivalent dose of replicating adenovirus. (aacrjournals.org)
  • In this construct, the E1 region is under control of the tissue-specific GFAP promoter (gfa2) with three additional copies of the glial specific 'B' enhancer. (eur.nl)
  • Other reasons for these failures include the genetic variability of the viral envelope proteins, which allows the virus to escape neutralizing antibodies, and the difficulty in identifying immunogens and immunization platforms that consistently induce antibodies that can neutralize several HIV clades ( 6 ). (rupress.org)
  • In studies comparing these two types of Ads, Ad5[E1−,E2b−] vaccines have been found to promote the decreased expression of viral proteins, persist longer in vivo , and induce less virus-associated toxicity following in vivo administration ( 16 , 28 , 29 ). (asm.org)
  • These results demonstrate that Ad5 [E1-, E2b-]-CEA can induce CMI immune responses which result in tumor growth inhibition despite the presence of pre-existing Ad5 immunity. (springer.com)
  • It is not known whether AP-1 proteins are sufficient to induce phenotypic changes or whether they must act in concert with other effectors. (ahajournals.org)
  • When plasmids that constitutively express the ORF 50 protein are transfected into cell lines derived from primary effusion lymphoma harboring KSHV in the latent stage of its life cycle they autostimulate ORF 50 expression, they activate kinetically appropriate expression of downstream early- and late-stage lytic KSHV mRNAs and polypeptides, and they induce the release of encapsidated viral DNA ( 7 , 14 , 15 , 30 ). (asm.org)
  • Data obtained from murine and other animal models have shown that host immune responses to viral and transgene protein products are responsible for eliminating transduced cells and preventing readministration ( 9 , 20-22 , 41-44 ). (asm.org)
  • Interaction of the putative human cytomegalovirus portal protein pUL104 with the large terminase subunit pUL56 and its inhibition by benzimidazole-D-ribonucleosides. (microbiologyresearch.org)
  • Real-time PCR was applied to quantify the abundance of human adenoviruses in two southern California urban rivers, the San Gabriel and Los Angeles. (asm.org)
  • A total of 114 river samples from five different locations were collected over a 1-year period and analyzed for human adenoviruses, along with fecal indicator bacteria and coliphages. (asm.org)
  • However, a plaque assay using two human tissue culture cell lines, HEK-293A and A549, yielded negative results, suggesting that adenoviruses detected by real-time PCR are likely noninfectious. (asm.org)
  • However, no significant correlations were found between human adenoviruses quantified by real-time PCR and culturable coliphages or fecal indicator bacteria. (asm.org)
  • This study presents the first quantitative measurement of human adenovirus genomes in urban rivers and their statistical relationship to fecal indicator bacteria and coliphages. (asm.org)
  • Adenovirus is frequently found in urban rivers and polluted coastal waters ( 5 , 7 , 20 , 32 , 33 , 39 ), and studies conducted in Europe suggest that adenovirus be used as an index of human viral pollution ( 32 ). (asm.org)
  • Even in the presence of anti-Ad5 immunity, recent murine and human studies have confirmed E2b gene-deleted Ad5 (Ad5[E1−,E2b−]) vaccines to be highly efficacious inducers of transgene-specific memory responses and significantly less toxic options than Ad5[E1−] vaccines. (asm.org)
  • Using cultures of human peripheral blood mononuclear cells (hPBMCs) derived from multiple human donors, we found that Ad5[E1−,E2b−] vaccines trigger higher levels of hPBMC proinflammatory cytokine secretion than Ad5[E1−] vaccines. (asm.org)
  • No, our system uses human adenovirus type 5 (Ad5). (thermofisher.com)
  • By using adenovirus-mediated gene transfer, we show that overexpression of AP-1 proteins directly causes coinduction of gene expression of an adhesion molecule, intercellular adhesion molecule-1 (ICAM-1), and a chemokine, monocyte chemoattractant protein-1 (MCP-1), in human vascular endothelial cells (ECs). (ahajournals.org)
  • However, the regulatory effects of AP-1 proteins in human ECs remain unclear. (ahajournals.org)
  • Using an adenovirus-mediated gene transfer protocol, we found that the AP-1 proteins c-Fos and c-Jun directly cause phenotypic activation and induction of intercellular adhesion molecule-1 (ICAM-1) and monocyte chemoattractant protein-1 (MCP-1) in human ECs. (ahajournals.org)
  • When tested in human tumor xenografts in nude mice, Ad5-gfa2(B)3-E1 effectively suppressed the growth of GFAP-positive SNB-19 glial tumors but not of GFAP-negative A549 lung tumors. (eur.nl)
  • The high levels of p53 present in adenovirus early region 1-transformed human cells do not cause up-regulation of MDM2 expression. (nih.gov)
  • In view of these observations the expression of MDM2 in a panel of adenovirus transformed human cell lines has been examined. (nih.gov)
  • Antibodies to adenoviruses are common in the human population due to natural infection. (aacrjournals.org)
  • HEK 293 cells were generated in 1973 by transformation of cultures of normal human embryonic kidney cells with sheared adenovirus 5 DNA in Alex van der Eb's laboratory in Leiden, the Netherlands. (wikipedia.org)
  • Graham and coworkers provided evidence that HEK 293 cells and other human cell lines generated by adenovirus transformation of human embryonic kidney cells have many properties of immature neurons, suggesting that the adenovirus preferentially transformed a neuronal lineage cell in the original kidney culture. (wikipedia.org)
  • Adenoviruses transform neuronal lineage cells much more efficiently than typical human kidney epithelial cells. (wikipedia.org)
  • In vitro hPBMC infection with the Ad5[E1−,E2b−] vaccine also provoked greater Th1-dominant gene responses yet smaller amounts of Ad-derived gene expression than Ad5[E1−] vaccines. (asm.org)
  • In addition, there are methods to study transcription and splicing with in vitro systems and for the adenovirus-mediated transformation of cells to a malignant state. (springer.com)
  • In summary, local overexpression of uptake-1 in the myocardium results in marked structural and functional improvement of heart failure, thus underlining the importance of uptake-1 as a key protein in heart failure. (ahajournals.org)
  • This tetrameric complex is more stable than the p11 dimer, therefore the overexpression of the annexin II gene results in higher levels of p11 protein. (wikipedia.org)
  • In this study, we demonstrated interactions among IVa2, 33K and DNA-binding protein (DBP) in virus-infected cells by in vivo cross-linking of HAdV5-infected cells followed by Western blot, and co-immunoprecipitation of IVa2, 33K and DBP from nuclear extracts of HAdV5-infected cells. (microbiologyresearch.org)
  • Nuclear factor I is specifically targeted to discrete subnuclear sites in adenovirus type 2-infected cells. (microbiologyresearch.org)
  • Adenoviruses have also been shown to display greater resistance to UV treatments because they contain double-stranded DNA, which allows for repair of damaged DNA by using the enzymes of host cells ( 18 , 23 ). (asm.org)
  • Adenovirus requires that host cells have the CAR receptor for efficient transduction, whereas due to the VSVG membrane coat on lentivirus particles, these viruses have broad tropism for a variety of mammalian cell types. (thermofisher.com)
  • Survival Motor Neuron Protein is Released from Cells in Exosomes: A Potential Biomarker for Spinal Muscular Atrophy. (nih.gov)
  • This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. (wikipedia.org)
  • 16 The adenoviruses were plaque-purified, amplified, and titered in 293 cells. (ahajournals.org)
  • It is possible for many viruses or virus-like particles to safely and efficiently propagate these in host cells (see, for instance, WO 01/38362, which describes the propagation of various viruses in host cells being E1-immortalized retina cells). (google.com)
  • Cell viability assays showed efficient elimination of GFAP-positive cells by Ad5-gfa2(B)3-E1, in some cell lines as efficiently as wtAd5, while the elimination was attenuated in GFAP-negative cell lines. (eur.nl)
  • We and others have previously shown that p53 is present at high levels in adenovirus-transformed cells which express the larger E1B protein. (nih.gov)
  • Stable interactions were observed between p53 and MDM2 in the adenovirus-transformed cell lines and in Ad5 E1 HEK 293 cells a ternary complex of p53, MDM2, and the Ad5 E1B 58K protein was demonstrated. (nih.gov)
  • Gelonin, a New Inhibitor of Protein Synthesis, Nontoxic to Intact Cells," Journal of Biological Chemistry 255(14): 6947-6953, 1980. (patentgenius.com)
  • The 25-nt sequence 5′ AAATGGGTGGCTAACCTGTCCAAAA from the PAN promoter (PANp) confers a response to ORF 50 protein in both epithelial cells and B cells in the absence of other KSHV proteins. (asm.org)
  • The cells are used for a wide variety of purposes, from testing toxicity of compounds or drugs to production of eukaryotic proteins. (wikipedia.org)
  • S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells. (wikipedia.org)
  • Given the location of the adrenal gland (adrenal means "next to the kidney"), a few adrenal cells could plausibly have appeared in an embryonic kidney derived culture, and could be preferentially transformed by adenovirus. (wikipedia.org)
  • The role of this protein in G1-S transition has been recently questioned as cells lacking Cdk2 are reported to have no problem during this transition. (wikipedia.org)
  • Several strategies to evade preexisting immunity toward Ad5 have been attempted, including the use of alternative delivery methods ( 21 , 22 ), modification of viral surface proteins ( 23 ), and the use of varied Ad serotypes ( 10 , 24 , 25 ), and each of these has had various levels of success. (asm.org)
  • A vaccine typically contains an agent that resembles a disease-causing microorganism and is often made from weakened or killed forms of the microbe, its toxins, or one of its surface proteins. (wikipedia.org)
  • It is concluded, on the basis of all of these data, that the high concentrations of p53 found in adenovirus transformants are not transcriptionally active and have no influence on MDM2 expression. (nih.gov)
  • This replacement leaves p53 transcriptionally active but renders the modified protein, termed p53mt24-28, completely resistant to inhibition and degradation by adenoviral oncoproteins. (aacrjournals.org)
  • Centrifugation of protein solution, for example, allows elimination of impurities into the supernatant. (wikipedia.org)
  • The scientific community has recently learned that the STEP HIV vaccine trial, which used an rAd5-based vaccine developed by Merck, failed to protect Ad5-seronegative individuals against infection and may even have enhanced infection in vaccinees with prior immunity to adenoviruses ( 23 - 26 ). (rupress.org)
  • Infection of a GFAP-positive cell line with Ad5-gfa2(B)3-E1 resulted in E1A and E1B expression at 75% and 30% of the levels obtained after wtAd5 infection. (eur.nl)
  • Compared to microcentrifuges or high-speed centrifuges, ultracentrifuges can isolate much smaller particles, including ribosomes, proteins, and viruses. (wikipedia.org)
  • Purification and Propeties of a Second Antiviral Protein from Phytolacca americana which inactivates Eukaryotic Ribosomes," Archives of Biochemistry and Biophysics 200(2): 418-425, 1980. (patentgenius.com)
  • The shorter isoform (deltaZip2) lacks the leucine zipper protein-dimerization motif and does not bind to DNA, and it stimulates transcription, it is presumed, by sequestering inhibitory co-factors away from the promoter. (wikipedia.org)
  • Q-PCR showed that Ad5-gfa2(B)3-E1 replicated 4.5 times more efficiently in the GFAP-positive than in the GFAP-negative cell lines. (eur.nl)
  • RNA splicing was discovered in the late 1970s through the study of adenoviruses that invade mammals and replicate inside them. (wikipedia.org)
  • however, widespread preexisting Ad5 immunity has been considered a developmental impediment to the use of traditional, or conventional, E1 and E3 gene-deleted Ad5 (Ad5[E1−]) vaccines. (asm.org)
  • Extended evaluation of a Phase 1/2 trial on dosing, safety, immunogenicity, and overall survival after immunizations with an advanced generation Ad5 [E1-, E2b-]-CEA(6D) vaccine in late stage colorectal cancer. (etubics.com)
  • The CEA immunogenicity and in vivo anti-tumor effects of repeated immunizations with Ad5 [E1-, E2b-]-CEA compared with those observed with current generation Ad5 [E1-]-CEA were tested in Ad5 pre-immunized mice. (springer.com)
  • Adenovirus type 5 expresses proteins that regulate the activity and stability of the tumor suppressor p53. (aacrjournals.org)
  • Once miR-155 pri-miRNA is transcribed, this transcript is cleaved by the nuclear microprocessor complex, of which the core components are the RNase III type endonuclease Drosha and the DiGeorge critical region 8 (DGCR8) protein, to produce a 65 nucleotide stem-loop precursor miRNA (pre-mir-155) (see Figure 2). (wikipedia.org)
  • In addition, due to its interaction with serotonin-signaling proteins and its correlation with symptoms of mood disorders, p11 is a new potential target for drug therapy. (wikipedia.org)
  • Ion channels are among the several proteins that are transported through the interaction with p11. (wikipedia.org)
  • Ad5 immune mice bearing CEA-expressing tumors that were treated with Ad5 [E1-, E2b-]-CEA had increased anti-tumor response as compared with Ad5 [E1-]-CEA treated mice. (springer.com)
  • In an effort to understand the role of Ran in these diverse processes, we previously characterized 10 Ran interacting proteins (Rips) from Xenopus egg extracts. (pnas.org)
  • We previously documented the association of three Ran-interacting proteins in Xenopus extracts as a complex that was independent of the nucleotide binding state of Ran ( 16 ). (pnas.org)
  • Adenovirus-Mediated Transfer of a Rcombinant .alpha.1-Antitrypsin Gene to the Lung Epithelium in Vivo," Science 252: 431-434, 1991. (patentgenius.com)
  • Two of these virion proteins, matrix (MA) and virion protein R (VPR), are used to transport the cDNA/integrase complex (also called preintegration complex) across the nuclear membrane in the absence of mitosis. (pubmedcentralcanada.ca)
  • The best characterized role of Ran is in nuclear protein import, and multiple lines of evidence suggest that GTP hydrolysis by Ran is required to sustain both active protein import and export ( 1 ). (pnas.org)
  • Another protein that has been implicated in regulating the onset of mitosis is Ubc9p, a nuclear E2 ubiquitin-conjugating enzyme ( 9 ). (pnas.org)
  • KSHV ORF 50 protein contains two putative arginine- and lysine-rich nuclear localization signals (aa 1 to 13) and (aa 516 to 530) ( 4 , 15 ). (asm.org)
  • E2 ubiquitin-conjugating enzymes mediate the attachment of ubiquitin to a variety of protein substrates ( 10 ). (pnas.org)
  • The loaded Ubc9 is now ready to perform the sumoylation of its various target proteins (also called substrates). (wikipedia.org)
  • These DNA-protein complexes were supershifted by antibody to VP16. (asm.org)