An enzyme which catalyzes the catabolism of S-ADENOSYLHOMOCYSTEINE to ADENOSINE and HOMOCYSTEINE. It may play a role in regulating the concentration of intracellular adenosylhomocysteine.

S-adenosylmethionine synthetase is overexpressed in murine neuroblastoma cells resistant to nucleoside analogue inhibitors of S-adenosylhomocysteine hydrolase: a novel mechanism of drug resistance. (1/196)

S-Adenosylmethionine (AdoMet) synthetase (EC 2.5.1.6), which catalyzes the synthesis of AdoMet from methionine and ATP, is the major methyl donor for transmethylation reactions and propylamino donor for the biosynthesis of polyamines in biological systems. We have reported previously that wild-type C-1300 murine neuroblastoma (wMNB) cells, made resistant to the nucleoside analogue (Z)-5'-fluoro-4',5'-didehydro-5'-deoxyadenosine (MDL 28,842), an irreversible inhibitor of S-adenosylhomocysteine (AdoHcy) hydrolase (EC 3.3.1.1), express increased AdoMet synthetase activity (M. R. Hamre et al., Oncol. Res., 7: 487-492, 1995). In the present study, immunoblot analyses of AdoMet Synthetase with isoform-specific (MATII) antibodies demonstrated an elevation in the AdoMet synthetase immunoprotein in nucleoside analogue-resistant MNB cells (rMNB-MDL) when compared to wild-type, nonresistant MNB cells. An increase of 2.1-fold was observed in the alpha2/alpha2' catalytic subunit, which differed significantly from the much smaller increment in the noncatalytic beta-subunit of AdoMet synthetase. Densitometric analyses revealed that an increased expression of AdoMet synthetase in rMNB-MDL cells was due to overexpression of the alpha2 (Mr 53,000; 2.6-fold) and alpha2' (Mr 51,000; 1.8-fold) subunits. AdoMet synthetase mRNA expression in rMNB-MDL cells was remarkably greater than wMNB cells, as determined by quantitative competitive reverse transcription-PCR (QC-PCR) analysis. DNA (cytosine) methyl transferase expression, measured by reverse transcription-PCR analysis, was also elevated significantly in rMNB-MDL cells. In contrast, Western blot analyses demonstrated down-regulation (1.6-fold) of AdoMet synthetase in doxorubicin-resistant human leukemia cells (HL-60-R) expressing multidrug resistance protein when compared with wild-type, nonresistant HL-60 cells. The resistance of rMNB-MDL cells to nucleoside analogue inhibitors of S-adenosylhomocysteine hydrolase correlates directly with overexpression of the alpha2/alpha2' subunits of AdoMet synthetase. Cellular adaptation allows sufficient AdoMet to be synthesized, so that viability of the MNB cells can be maintained even in the presence of high AdoHcy concentrations. This novel mechanism of drug resistance does not appear to require multidrug resistance protein (P-glycoprotein) overexpression.  (+info)

3-deazaadenosine, a S-adenosylhomocysteine hydrolase inhibitor, has dual effects on NF-kappaB regulation. Inhibition of NF-kappaB transcriptional activity and promotion of IkappaBalpha degradation. (2/196)

Previously we reported that 3-deazaadenosine (DZA), a potent inhibitor and substrate for S-adenosylhomocysteine hydrolase inhibits bacterial lipopolysaccharide-induced transcription of tumor necrosis factor-alpha and interleukin-1beta in mouse macrophage RAW 264.7 cells. In this study, we demonstrate the effects of DZA on nuclear factor-kappaB (NF-kappaB) regulation. DZA inhibits the transcriptional activity of NF-kappaB through the hindrance of p65 (Rel-A) phosphorylation without reduction of its nuclear translocation and DNA binding activity. The inhibitory effect of DZA on NF-kappaB transcriptional activity is potentiated by the addition of homocysteine. Taken together, DZA promotes the proteolytic degradation of IkappaBalpha, but not IkappaBbeta, resulting in an increase of DNA binding activity of NF-kappaB in the nucleus in the absence of its transcriptional activity in RAW 264.7 cells. The reduction of IkappaBalpha by DZA is neither involved in IkappaB kinase complex activation nor modulated by the addition of homocysteine. This study strongly suggests that DZA may be a potent drug for the treatment of diseases in which NF-kappaB plays a central pathogenic role, as well as a useful tool for studying the regulation and physiological functions of NF-kappaB.  (+info)

Nuclear accumulation of S-adenosylhomocysteine hydrolase in transcriptionally active cells during development of Xenopus laevis. (3/196)

The oocyte nuclear antigen of the monoclonal antibody 32-5B6 of Xenopus laevis is subject to regulated nuclear translocation during embryogenesis. It is distributed in the cytoplasm during oocyte maturation, where it remains during cleavage and blastula stages, before it gradually reaccumulates in the nuclei during gastrulation. We have now identified this antigen to be the enzyme S-adenosylhomocysteine hydrolase (SAHH). SAHH is the only enzyme that cleaves S-adenosylhomocysteine, a reaction product and an inhibitor of all S-adenosylmethionine-dependent methylation reactions. We have compared the spatial and temporal patterns of nuclear localization of SAHH and of nuclear methyltransferase activities during embryogenesis and in tissue culture cells. Nuclear localization of Xenopus SAHH did not temporally correlate with DNA methylation. However, we found that SAHH nuclear localization coincides with high rates of mRNA synthesis, a subpopulation colocalizes with RNA polymerase II, and inhibitors of SAHH reduce both methylation and synthesis of poly(A)(+) RNA. We therefore propose that accumulation of SAHH in the nucleus may be required for efficient cap methylation in transcriptionally active cells. Mutation analysis revealed that the C terminus and the N terminus are both required for efficient nuclear translocation in tissue culture cells, indicating that more than one interacting domain contributes to nuclear accumulation of Xenopus SAHH.  (+info)

UV light selectively coinduces supply pathways from primary metabolism and flavonoid secondary product formation in parsley. (4/196)

The UV light-induced synthesis of UV-protective flavonoids diverts substantial amounts of substrates from primary metabolism into secondary product formation and thus causes major perturbations of the cellular homeostasis. Results from this study show that the mRNAs encoding representative enzymes from various supply pathways are coinduced in UV-irradiated parsley cells (Petroselinum crispum) with two mRNAs of flavonoid glycoside biosynthesis, encoding phenylalanine ammonia-lyase and chalcone synthase. Strong induction was observed for mRNAs encoding glucose 6-phosphate dehydrogenase (carbohydrate metabolism, providing substrates for the shikimate pathway), 3-deoxyarabinoheptulosonate 7-phosphate synthase (shikimate pathway, yielding phenylalanine), and acyl-CoA oxidase (fatty acid degradation, yielding acetyl-CoA), and moderate induction for an mRNA encoding S-adenosyl-homocysteine hydrolase (activated methyl cycle, yielding S-adenosyl-methionine for B-ring methylation). Ten arbitrarily selected mRNAs representing various unrelated metabolic activities remained unaffected. Comparative analysis of acyl-CoA oxidase and chalcone synthase with respect to mRNA expression modes and gene promoter structure and function revealed close similarities. These results indicate a fine-tuned regulatory network integrating those functionally related pathways of primary and secondary metabolism that are specifically required for protective adaptation to UV irradiation. Although the response of parsley cells to UV light is considerably broader than previously assumed, it contrasts greatly with the extensive metabolic reprogramming observed previously in elicitor-treated or fungus-infected cells.  (+info)

Simple and sensitive binding assay for measurement of adenosine using reduced S-adenosylhomocysteine hydrolase. (5/196)

BACKGROUND: Adenosine has been suggested to play an important role in the regulation of renal function. We developed a simple and sensitive binding assay for the detection of adenosine based on the displacement of [(3)H]adenosine from S-adenosylhomocysteine (SAH) hydrolase in its reduced form. METHODS: SAH hydrolase was purified to apparent homogeneity from bovine kidney by standard chromatographic methods. SAH hydrolase was converted in its reduced form, which had the advantage that the SAH hydrolase is enzymatically inactive. This reduced enzyme retains its ability to bind adenosine with high affinity. To determine adenosine in urine or tissues, samples must be deproteinized (e.g., with 10 g/L sulfosalicylic acid or 0.6 mol/L perchloric acid). RESULTS: The reduced SAH hydrolase bound adenosine with a dissociation constant of 33.0 +/- 2 nmol/L. Displacement of adenosine binding by the adenine 5'-nucleotides, adenine and hypoxanthine, required >1000-fold higher concentrations than adenosine itself. The intra- and interassay imprecision (CV) was <3.9% and 7.8%, respectively, and the values obtained showed acceptable correlation with those by HPLC. CONCLUSIONS: The highly sensitive adenosine-binding protein assay is a simple test that allows detection of adenosine in samples with small volumes without purification, and is in this respect superior to HPLC.  (+info)

Synthesis of S-adenosyl-L-homocysteine hydrolase inhibitors and their biological activities. (6/196)

Several nucleosides have been prepared as a possible inhibitor of human S-adenosyl-L-homocysteine (SAH) hydrolase for the development of anti-viral agents. Recently, SAH hydrolase has been considered as an attractive target for parasite chemotherapy for malaria. We report synthesis of several nucleosides including carbocyclic nucleosides and their inhibitory activities against recombinant malaria and human SAH hydrolases.  (+info)

Identification and characterization of three differentially expressed genes, encoding S-adenosylhomocysteine hydrolase, methionine aminopeptidase, and a histone-like protein, in the toxic dinoflagellate Alexandrium fundyense. (7/196)

Genes showing differential expression related to the early G(1) phase of the cell cycle during synchronized circadian growth of the toxic dinoflagellate Alexandrium fundyense were identified and characterized by differential display (DD). The determination in our previous work that toxin production in Alexandrium is relegated to a narrow time frame in early G(1) led to the hypothesis that transcriptionally up- or downregulated genes during this subphase of the cell cycle might be related to toxin biosynthesis. Three genes, encoding S-adenosylhomocysteine hydrolase (Sahh), methionine aminopeptidase (Map), and a histone-like protein (HAf), were isolated. Sahh was downregulated, while Map and HAf were upregulated, during the early G(1) phase of the cell cycle. Sahh and Map encoded amino acid sequences with about 90 and 70% similarity to those encoded by several eukaryotic and prokaryotic Sahh and Map genes, respectively. The partial Map sequence also contained three cobalt binding motifs characteristic of all Map genes. HAf encoded an amino acid sequence with 60% similarity to those of two histone-like proteins from the dinoflagellate Crypthecodinium cohnii Biecheler. This study documents the potential of applying DD to the identification of genes that are related to physiological processes or cell cycle events in phytoplankton under conditions where small sample volumes represent an experimental constraint. The identification of an additional 21 genes with various cell cycle-related DD patterns also provides evidence for the importance of pretranslational or transcriptional regulation in dinoflagellates, contrary to previous reports suggesting the possibility that translational mechanisms are the primary means of circadian regulation in this group of organisms.  (+info)

The use of enzyme therapy to regulate the metabolic and phenotypic consequences of adenosine deaminase deficiency in mice. Differential impact on pulmonary and immunologic abnormalities. (8/196)

Adenosine deaminase (ADA) deficiency results in a combined immunodeficiency brought about by the immunotoxic properties of elevated ADA substrates. Additional non-lymphoid abnormalities are associated with ADA deficiency, however, little is known about how these relate to the metabolic consequences of ADA deficiency. ADA-deficient mice develop a combined immunodeficiency as well as severe pulmonary insufficiency. ADA enzyme therapy was used to examine the relative impact of ADA substrate elevations on these phenotypes. A "low-dose" enzyme therapy protocol prevented the pulmonary phenotype seen in ADA-deficient mice, but did little to improve their immune status. This treatment protocol reduced metabolic disturbances in the circulation and lung, but not in the thymus and spleen. A "high-dose" enzyme therapy protocol resulted in decreased metabolic disturbances in the thymus and spleen and was associated with improvement in immune status. These findings suggest that the pulmonary and immune phenotypes are separable and are related to the severity of metabolic disturbances in these tissues. This model will be useful in examining the efficacy of ADA enzyme therapy and studying the mechanisms underlying the immunodeficiency and pulmonary phenotypes associated with ADA deficiency.  (+info)

Adenosylhomocysteinase is an enzyme that plays a crucial role in the methionine cycle, which is a biochemical pathway involved in the synthesis and metabolism of various essential molecules in the body. The formal medical definition of adenosylhomocysteinase is:

"An enzyme that catalyzes the reversible conversion of S-adenosylhomocysteine to homocysteine and adenosine. This reaction is the first step in the recycling of methionine, a sulfur-containing amino acid that is essential for various metabolic processes, including the synthesis of proteins, neurotransmitters, and phospholipids."

In simpler terms, adenosylhomocysteinase helps break down S-adenosylhomocysteine, a byproduct of methylation reactions in the body, into its component parts: homocysteine and adenosine. This breakdown is essential for the proper functioning of the methionine cycle and the maintenance of normal levels of homocysteine, which can be toxic at high concentrations.

Deficiencies or mutations in the adenosylhomocysteinase gene can lead to an accumulation of S-adenosylhomocysteine and homocysteine, which can contribute to various health issues, including neurological disorders, cardiovascular disease, and developmental abnormalities.

GeneCards.org - AHCY Gene - Adenosylhomocysteinase NLM - AHCY adenosylhomocysteinase Chicco, Davide; Sanavia, Tiziana; Jurman, ... Adenosylhomocysteinase at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Vizán, Pedro; Di Croce, Luciano ... Palmer JL, Abeles RH (February 1979). "The mechanism of action of S-adenosylhomocysteinase". The Journal of Biological ... Adenosylhomocysteinase (EC 3.3.1.1, S-adenosylhomocysteine synthase, S-adenosylhomocysteine hydrolase, adenosylhomocysteine ...
Adenosylhomocysteinase cysteine. Methionine can be regenerated from homocysteine via (4) methionine synthase in a reaction that ...
Guranowski, Andrzej; Pawelkiewicz, Jerzy (1977). "Adenosylhomocysteinase from Yellow Lupin Seeds. Purification and Properties ...
Adenosylhomocysteinase converts SAH into homocysteine and adenosine. DNA methyltransferases are inhibited by SAH. Two S- ...
Putative adenosylhomocysteinase 2 is an enzyme that in humans is encoded by the AHCYL1 gene. AHCYL1 has been shown to interact ...
... may refer to: Adenosylhomocysteinase, an enzyme Adenosylhomocysteine nucleosidase, an enzyme ...
... adenosylhomocysteinase EC 3.3.1.2: S-adenosyl-L-methionine hydrolase (L-homoserine-forming) EC 3.3.1.3: The activity is most ...
GeneCards.org - AHCY Gene - Adenosylhomocysteinase NLM - AHCY adenosylhomocysteinase Chicco, Davide; Sanavia, Tiziana; Jurman, ... Adenosylhomocysteinase at the U.S. National Library of Medicine Medical Subject Headings (MeSH) Vizán, Pedro; Di Croce, Luciano ... Palmer JL, Abeles RH (February 1979). "The mechanism of action of S-adenosylhomocysteinase". The Journal of Biological ... Adenosylhomocysteinase (EC 3.3.1.1, S-adenosylhomocysteine synthase, S-adenosylhomocysteine hydrolase, adenosylhomocysteine ...
2.85 Angstrom Crystal Structure of S-adenosylhomocysteinase from Cryptosporidium parvum in Complex with Adenosine and NAD. ... 2.85 Angstrom Crystal Structure of S-adenosylhomocysteinase from Cryptosporidium parvum in Complex with Adenosine and NAD.. * ... 2.85 Angstrom Crystal Structure of S-adenosylhomocysteinase from Cryptosporidium parvum in Complex with Adenosine and NAD.. ...
Recombinant Triticum Aestivum Adenosylhomocysteinase (SAHH) (Recombinant Протеини) Recombinant Triticum aestivum ... Gene Name : SAHH; SH6.2; SHH; Ado Hcyase.Syn Name : Adenosylhomocysteinase; S-adenosyl-L-homocysteine hydrolase.Видови : ...
adenosylhomocysteinase To use the sharing features on this page, please enable JavaScript.. ...
Adenosylhomocysteinase (EC 3.3.1.1)(S-adenosyl-L-homocysteine hydrolase) (AdoHcyase). 8e-171. At4g13940. MEE58 (MATERNAL EFFECT ...
adenosylhomocysteinase. Image. Gene Ontology Annotations. Cellular Component. *Chromosome, Telomeric Region. *Nuclear Telomere ...
... is used for the treatment of hairy cell leukemia and multiple sclerosis (MS). As a purine analog, it is a synthetic anti-cancer agent that also suppresses the immune system. Chemically, it mimics the nucleoside adenosine and thus inhibits the enzyme adenosine deaminase, which interferes with the cells ability to process DNA. It can be distinguished from other chemotherapeutic agents affecting purine metabolism in that it is cytotoxic to both actively dividing and quiescent lymphocytes and monocytes, inhibiting both DNA synthesis and repair. Cladribine injection is a potent antineoplastic agent with potentially significant toxic side effects. In MS, the novel mechanism of action of cladribine is expected to reduce inflammation, autoimmune effects and autoreactive cell damage, thereby improving the integrity of the blood-brain barrier. Thus, the effects of cladribine may target some of the key events that are central to the pathophysiology of MS ...
This project is supported by the Canadian Institutes of Health Research, Canada Foundation for Innovation, and by The Metabolomics Innovation Centre (TMIC), a nationally-funded research and core facility that supports a wide range of cutting-edge metabolomic studies. TMIC is funded by Genome Canada, Genome Alberta, and Genome British Columbia, a not-for-profit organization that is leading Canadas national genomics strategy with $900 million in funding from the federal government ...
Full Name: Adenosylhomocysteinase O-GlcNAc Score: 13 References 2 O-GlcNAc sites ...
Adenosylhomocysteinase. Methylation ALCAM. CD166 antigen. Required for normal hematopoietic stem cell engraftment in the bone ...
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2023 Elsevier B.V. We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. ...
adenosylhomocysteinase (NCBI). 20, 46. GSU1966. GSU1966. conserved hypothetical protein (VIMSS). 77, 90. ...
A knowledge graph of biological entities such as genes, gene functions, diseases, phenotypes and chemicals. Embeddings are generated with Walking RDF and OWL method ...
adenosylhomocysteinase like 1 [S.... ALDH1B1. 219. ALDH1B1. aldehyde dehydrogenase 1 family .... AMELY. 266. AMELY. amelogenin ...
Adenosylhomocysteinase (EC 3.3.1.1). Position: -93. Score: 6.6. Sequence: ATATAAAGATATATTTATGT Locus tag: NGR_c00480. Name: ...
adenosylhomocysteinase [Source:HGNC Sy.... AKR1C2. 1646. AKR1C2. aldo-keto reductase family 1 member C2.... ...
Adenosylhomocysteinase Medicine & Life Sciences 19% * Oxidative Stress Medicine & Life Sciences 16% * Cystathionine beta- ...
S-ADENOSYL-L-HOMOCYSTEINE (SAH) HYDROLASE 2 (SAHH2); FUNCTIONS IN: adenosylhomocysteinase activity, binding, catalytic activity ... adenosylhomocysteinase/ copper ion binding (TAIR:AT4G13940.1); Has 6533 Blast hits to 6529 proteins in 950 species: Archae - ...
Adenosylhomocysteinase [Source:UniProtKB/Swiss-Prot;Acc:P27604]. 98.. F11C3.3. unc-54. 516.00. 1647.86. Myosin-4 [Source: ...
Adenosylhomocysteinase AdoHcyase ahcY S adenosyl L homocysteine hydrolase S adenosylhomocysteine hydrolase S-adenosyl-L- ...
中文名稱:AHCY (Adenosylhomocysteinase, AdoHcyase, S-adenosyl-L-homocysteine hydrolase, SAHH) BioAssay ELISA Kit (Human) ... 英文名稱:AHCY (Adenosylhomocysteinase, AdoHcyase, S-adenosyl-L-homocysteine hydrolase, SAHH) BioAssay ELISA Kit (Human) ...
Here, we show that 3-deazaadenosine (3DA), an S-adenosyl homocysteinase (AHCY) inhibitor, alleviates replicative and oncogene- ...
Minekus M, Alminger M, Alvito P, Ballance S, Bohn T, Bourlieu C, Carri?re F, Boutrou R, Corredig M, Dupont D, Dufour C, Egger L, Golding M, Karakaya S, Kirkhus B, Le Feunteun S, Lesmes U, Macierzanka A, Mackie A, Marze S, McClements DJ, M?nard O, Recio I, Santos CN, Singh RP, Vegarud GE, Wickham MS, Weitschies W, Brodkorb A. A standardised static in vitro digestion method suitable for food - an international consensus. Food Funct. 2014 Jun; 5(6):1113-24 ...
Besides, adenosylhomocysteinase (AHCY) down-regulation may contribute to balanced transmethylations, and methionine salvage ...
Adenosylhomocysteinase. Choline. dehydrogenase. Phosphatidylethanolamine. N-. methyltransferase. Tetrahydrofolic acid. 5- ...
Adenosylhomocysteinase. Betaine--. homocysteine S-. methyltransferase. 1. L-amino-acid. oxidase. Methionine--. tRNA ligase,. ...
Putative adenosylhomocysteinase 2) (S-adenosyl-L-homocysteine hydrolase 2) (AdoHcyase 2). AHCYL1 DCAL IRBIT XPVKONA. O43865. ...
  • Besides, adenosylhomocysteinase (AHCY) down-regulation may contribute to balanced transmethylations, and methionine salvage pathway appears important for the adaptation to Zn. (bionanoteam.com)
  • Adenosylhomocysteinase (EC 3.3.1.1, S-adenosylhomocysteine synthase, S-adenosylhomocysteine hydrolase, adenosylhomocysteine hydrolase, S-adenosylhomocysteinase, SAHase, AdoHcyase) is an enzyme that converts S-adenosylhomocysteine to homocysteine and adenosine. (wikipedia.org)
  • Grupo de enzimas que catalizan la hidrólisis de enlaces difosfato en compuestos tales como nucleósidos difosfatos y trifosfatos, y anhídridos que contienen grupos sulfonilo, como el adenililsulfato (Enzyme Nomenclature, 1992). (bvsalud.org)
  • Adenosylhomocysteinase (EC 3.3.1.1, S-adenosylhomocysteine synthase, S-adenosylhomocysteine hydrolase, adenosylhomocysteine hydrolase, S-adenosylhomocysteinase, SAHase, AdoHcyase) is an enzyme that converts S-adenosylhomocysteine to homocysteine and adenosine. (wikipedia.org)
  • S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. (nih.gov)
  • therefore adenosylhomocysteinase may play a key role in the control of methylations via regulation of the intracellular concentration of adenosylhomocysteine. (nih.gov)
  • Dose-dependent repression of methionine adenosyltransferase 1A (Mat1a), adenosylhomocysteinase (Achy) and betaine-homocysteine S-methyltransferase (Bhmt) mRNA and protein levels following repeated treatments were greater at 28 days compared to 8 days. (nih.gov)