Adaptor Proteins, Signal Transducing: A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymesAdaptor Proteins, Vesicular Transport: A class of proteins involved in the transport of molecules via TRANSPORT VESICLES. They perform functions such as binding to the cell membrane, capturing cargo molecules and promoting the assembly of CLATHRIN. The majority of adaptor proteins exist as multi-subunit complexes, however monomeric varieties have also been found.Vesicular Transport Proteins: A broad category of proteins involved in the formation, transport and dissolution of TRANSPORT VESICLES. They play a role in the intracellular transport of molecules contained within membrane vesicles. Vesicular transport proteins are distinguished from MEMBRANE TRANSPORT PROTEINS, which move molecules across membranes, by the mode in which the molecules are transported.Biological Transport: The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.Transport Vesicles: Vesicles that are involved in shuttling cargo from the interior of the cell to the cell surface, from the cell surface to the interior, across the cell or around the cell to various locations.GRB2 Adaptor Protein: A signal transducing adaptor protein that links extracellular signals to the MAP KINASE SIGNALING SYSTEM. Grb2 associates with activated EPIDERMAL GROWTH FACTOR RECEPTOR and PLATELET-DERIVED GROWTH FACTOR RECEPTORS via its SH2 DOMAIN. It also binds to and translocates the SON OF SEVENLESS PROTEINS through its SH3 DOMAINS to activate PROTO-ONCOGENE PROTEIN P21(RAS).Shc Signaling Adaptor Proteins: A family of signaling adaptor proteins that contain SRC HOMOLOGY DOMAINS. Many members of this family are involved in transmitting signals from CELL SURFACE RECEPTORS to MITOGEN-ACTIVATED PROTEIN KINASES.Golgi Apparatus: A stack of flattened vesicles that functions in posttranslational processing and sorting of proteins, receiving them from the rough ENDOPLASMIC RETICULUM and directing them to secretory vesicles, LYSOSOMES, or the CELL MEMBRANE. The movement of proteins takes place by transfer vesicles that bud off from the rough endoplasmic reticulum or Golgi apparatus and fuse with the Golgi, lysosomes or cell membrane. (From Glick, Glossary of Biochemistry and Molecular Biology, 1990)Adaptor Protein Complex 2: An adaptor protein complex primarily involved in the formation of clathrin-related endocytotic vesicles (ENDOSOMES) at the CELL MEMBRANE.Biological Transport, Active: The movement of materials across cell membranes and epithelial layers against an electrochemical gradient, requiring the expenditure of metabolic energy.Adaptor Protein Complex 3: An adaptor protein complex found primarily on perinuclear compartments.Adaptor Protein Complex 1: A clathrin adaptor protein complex primarily involved in clathrin-related transport at the TRANS-GOLGI NETWORK.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.rab GTP-Binding Proteins: A large family of MONOMERIC GTP-BINDING PROTEINS that play a key role in cellular secretory and endocytic pathways. EC 3.6.1.-.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Brefeldin A: A fungal metabolite which is a macrocyclic lactone exhibiting a wide range of antibiotic activity.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.GRB10 Adaptor Protein: A binding partner for several RECEPTOR PROTEIN-TYROSINE KINASES, including INSULIN RECEPTOR and INSULIN-LIKE GROWTH FACTOR RECEPTOR. It contains a C-terminal SH2 DOMAIN and mediates various SIGNAL TRANSDUCTION pathways.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.src Homology Domains: Regions of AMINO ACID SEQUENCE similarity in the SRC-FAMILY TYROSINE KINASES that fold into specific functional tertiary structures. The SH1 domain is a CATALYTIC DOMAIN. SH2 and SH3 domains are protein interaction domains. SH2 usually binds PHOSPHOTYROSINE-containing proteins and SH3 interacts with CYTOSKELETAL PROTEINS.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Adaptor Protein Complex alpha Subunits: A family of large adaptin protein subunits of approximately 100 kDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 2.Coated Vesicles: Vesicles formed when cell-membrane coated pits (COATED PITS, CELL-MEMBRANE) invaginate and pinch off. The outer surface of these vesicles are covered with a lattice-like network of coat proteins, such as CLATHRIN, coat protein complex proteins, or CAVEOLINS.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.ADP-Ribosylation Factors: MONOMERIC GTP-BINDING PROTEINS that were initially recognized as allosteric activators of the MONO(ADP-RIBOSE) TRANSFERASE of the CHOLERA TOXIN catalytic subunit. They are involved in vesicle trafficking and activation of PHOSPHOLIPASE D. This enzyme was formerly listed as EC 3.6.1.47Cell Line: Established cell cultures that have the potential to propagate indefinitely.Adaptor Protein Complex beta Subunits: A family of large adaptin protein complex subunits of approximately 90-130 kDa in size.Endoplasmic Reticulum: A system of cisternae in the CYTOPLASM of many cells. In places the endoplasmic reticulum is continuous with the plasma membrane (CELL MEMBRANE) or outer membrane of the nuclear envelope. If the outer surfaces of the endoplasmic reticulum membranes are coated with ribosomes, the endoplasmic reticulum is said to be rough-surfaced (ENDOPLASMIC RETICULUM, ROUGH); otherwise it is said to be smooth-surfaced (ENDOPLASMIC RETICULUM, SMOOTH). (King & Stansfield, A Dictionary of Genetics, 4th ed)Endocytosis: Cellular uptake of extracellular materials within membrane-limited vacuoles or microvesicles. ENDOSOMES play a central role in endocytosis.rab2 GTP-Binding Protein: A protein involved in transport between the ENDOPLASMIC RETICULUM and the GOLGI APPARATUS. This enzyme was formerly listed as EC 3.6.1.47.Endosomes: Cytoplasmic vesicles formed when COATED VESICLES shed their CLATHRIN coat. Endosomes internalize macromolecules bound by receptors on the cell surface.Clathrin: The main structural coat protein of COATED VESICLES which play a key role in the intracellular transport between membranous organelles. Each molecule of clathrin consists of three light chains (CLATHRIN LIGHT CHAINS) and three heavy chains (CLATHRIN HEAVY CHAINS) that form a structure called a triskelion. Clathrin also interacts with cytoskeletal proteins.Membrane Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.trans-Golgi Network: A network of membrane compartments, located at the cytoplasmic side of the GOLGI APPARATUS, where proteins and lipids are sorted for transport to various locations in the cell or cell membrane.Adaptor Protein Complex mu Subunits: A family of medium adaptin protein subunits of approximately 45 KDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 3 and ADAPTOR PROTEIN COMPLEX 4.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.COP-Coated Vesicles: TRANSPORT VESICLES formed when cell-membrane coated pits (COATED PITS, CELL-MEMBRANE) invaginate and pinch off. The outer surface of these vesicles is covered with a lattice-like network of COP (coat protein complex) proteins, either COPI or COPII. COPI coated vesicles transport backwards from the cisternae of the GOLGI APPARATUS to the rough endoplasmic reticulum (ENDOPLASMIC RETICULUM, ROUGH), while COPII coated vesicles transport forward from the rough endoplasmic reticulum to the Golgi apparatus.Proto-Oncogene Proteins c-crk: Signal transducing adaptor proteins that contain SRC HOMOLOGY DOMAINS and play a role in CYTOSKELETON reorganization. c-crk protein is closely related to ONCOGENE PROTEIN V-CRK and includes several alternatively spliced isoforms.Cytoplasmic Vesicles: Membrane-limited structures derived from the plasma membrane or various intracellular membranes which function in storage, transport or metabolism.Adaptor Protein Complex 4: An adaptor protein complex involved in transport of molecules between the TRANS-GOLGI NETWORK and the endosomal-lysosomal system.Axonal Transport: The directed transport of ORGANELLES and molecules along nerve cell AXONS. Transport can be anterograde (from the cell body) or retrograde (toward the cell body). (Alberts et al., Molecular Biology of the Cell, 3d ed, pG3)rab1 GTP-Binding Proteins: A genetically related subfamily of RAB GTP-BINDING PROTEINS involved in vesicle transport between the ENDOPLASMIC RETICULUM and the GOLGI APPARATUS and through early Golgi compartments. This enzyme was formerly listed as EC 3.6.1.47.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.PhosphoproteinsIntracellular Membranes: Thin structures that encapsulate subcellular structures or ORGANELLES in EUKARYOTIC CELLS. They include a variety of membranes associated with the CELL NUCLEUS; the MITOCHONDRIA; the GOLGI APPARATUS; the ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.Adaptor Protein Complex gamma Subunits: A family of large adaptin protein subunits of approximately 90 KDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 1.ADP-Ribosylation Factor 1: ADP-RIBOSYLATION FACTOR 1 is involved in regulating intracellular transport by modulating the interaction of coat proteins with organelle membranes in the early secretory pathway. It is a component of COAT PROTEIN COMPLEX I. This enzyme was formerly listed as EC 3.6.1.47.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Qa-SNARE Proteins: A subfamily of Q-SNARE PROTEINS which occupy the same position as syntaxin 1A in the SNARE complex and which also are most similar to syntaxin 1A in their AMINO ACID SEQUENCE. This subfamily is also known as the syntaxins, although a few so called syntaxins are Qc-SNARES.N-Ethylmaleimide-Sensitive Proteins: ATPases that are members of the AAA protein superfamily (ATPase family Associated with various cellular Activities). The NSFs functions, acting in conjunction with SOLUBLE NSF ATTACHMENT PROTEINS (i.e. SNAPs, which have no relation to SNAP 25), are to dissociate SNARE complexes.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Organelles: Specific particles of membrane-bound organized living substances present in eukaryotic cells, such as the MITOCHONDRIA; the GOLGI APPARATUS; ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.Soluble N-Ethylmaleimide-Sensitive Factor Attachment Proteins: SNARE binding proteins that facilitate the ATP hydrolysis-driven dissociation of the SNARE complex. They are required for the binding of N-ETHYLMALEIMIDE-SENSITIVE PROTEIN (NSF) to the SNARE complex which also stimulates the ATPASE activity of NSF. They are unrelated structurally to SNAP-25 PROTEIN.Ion Transport: The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.Coat Protein Complex I: A protein complex comprised of COATOMER PROTEIN and ADP RIBOSYLATION FACTOR 1. It is involved in transport of vesicles between the ENDOPLASMIC RETICULUM and the GOLGI APPARATUS.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Adaptor Protein Complex Subunits: The subunits that make up the large, medium and small chains of adaptor proteins.Cell Compartmentation: A partitioning within cells due to the selectively permeable membranes which enclose each of the separate parts, e.g., mitochondria, lysosomes, etc.Coatomer Protein: A 700-kDa cytosolic protein complex consisting of seven equimolar subunits (alpha, beta, beta', gamma, delta, epsilon and zeta). COATOMER PROTEIN and ADP-RIBOSYLATION FACTOR 1 are principle components of COAT PROTEIN COMPLEX I and are involved in vesicle transport between the ENDOPLASMIC RETICULUM and the GOLGI APPARATUS.Adaptor Protein Complex delta Subunits: A family of large adaptin protein subunits of approximately 130-kDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 3.SNARE Proteins: A superfamily of small proteins which are involved in the MEMBRANE FUSION events, intracellular protein trafficking and secretory processes. They share a homologous SNARE motif. The SNARE proteins are divided into subfamilies: QA-SNARES; QB-SNARES; QC-SNARES; and R-SNARES. The formation of a SNARE complex (composed of one each of the four different types SNARE domains (Qa, Qb, Qc, and R)) mediates MEMBRANE FUSION. Following membrane fusion SNARE complexes are dissociated by the NSFs (N-ETHYLMALEIMIDE-SENSITIVE FACTORS), in conjunction with SOLUBLE NSF ATTACHMENT PROTEIN, i.e., SNAPs (no relation to SNAP 25.)Two-Hybrid System Techniques: Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.Kinetics: The rate dynamics in chemical or physical systems.Nerve Tissue ProteinsMyeloid Differentiation Factor 88: An intracellular signaling adaptor protein that plays a role in TOLL-LIKE RECEPTOR and INTERLEUKIN 1 RECEPTORS signal transduction. It forms a signaling complex with the activated cell surface receptors and members of the IRAK KINASES.COS Cells: CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)CRADD Signaling Adaptor Protein: A death domain receptor signaling adaptor protein that plays a role in signaling the activation of INITIATOR CASPASES such as CASPASE 2. It contains a death domain that is specific for RIP SERINE-THEONINE KINASES and a caspase-binding domain that binds to and activates CASPASES such as CASPASE 2.Lysosomes: A class of morphologically heterogeneous cytoplasmic particles in animal and plant tissues characterized by their content of hydrolytic enzymes and the structure-linked latency of these enzymes. The intracellular functions of lysosomes depend on their lytic potential. The single unit membrane of the lysosome acts as a barrier between the enzymes enclosed in the lysosome and the external substrate. The activity of the enzymes contained in lysosomes is limited or nil unless the vesicle in which they are enclosed is ruptured. Such rupture is supposed to be under metabolic (hormonal) control. (From Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)GTP-Binding Proteins: Regulatory proteins that act as molecular switches. They control a wide range of biological processes including: receptor signaling, intracellular signal transduction pathways, and protein synthesis. Their activity is regulated by factors that control their ability to bind to and hydrolyze GTP to GDP. EC 3.6.1.-.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Cytoplasm: The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Tyrosine: A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.Membrane Glycoproteins: Glycoproteins found on the membrane or surface of cells.GTPase-Activating Proteins: Proteins that activate the GTPase of specific GTP-BINDING PROTEINS.Immunoprecipitation: The aggregation of soluble ANTIGENS with ANTIBODIES, alone or with antibody binding factors such as ANTI-ANTIBODIES or STAPHYLOCOCCAL PROTEIN A, into complexes large enough to fall out of solution.Fungal Proteins: Proteins found in any species of fungus.Microscopy, Fluorescence: Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.Amino Acid Motifs: Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.GTP Phosphohydrolases: Enzymes that hydrolyze GTP to GDP. EC 3.6.1.-.Exocytosis: Cellular release of material within membrane-limited vesicles by fusion of the vesicles with the CELL MEMBRANE.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Intracellular Signaling Peptides and Proteins: Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Precipitin Tests: Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.GRB7 Adaptor Protein: A SH2 DOMAIN-containing protein that mediates SIGNAL TRANSDUCTION pathways from multiple CELL SURFACE RECEPTORS, including the EPHB1 RECEPTOR. It interacts with FOCAL ADHESION KINASE and is involved in CELL MIGRATION.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Microscopy, Electron: Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.Mice, Knockout: Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.Vacuoles: Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.Qc-SNARE Proteins: A subfamily of Q-SNARE PROTEINS which occupy the same position in the SNARE complex as the C-terminal SNARE domain of SNAP-25 and which also are most similar to the C-terminal region of SNAP-25 in their AMINO ACID SEQUENCE.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Monosaccharide Transport Proteins: A large group of membrane transport proteins that shuttle MONOSACCHARIDES across CELL MEMBRANES.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Cercopithecus aethiops: A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.rab5 GTP-Binding Proteins: A genetically related subfamily of RAB GTP-BINDING PROTEINS involved in transport from the cell membrane to early endosomes. This enzyme was formerly listed as EC 3.6.1.47.R-SNARE Proteins: SNARE proteins where the central amino acid residue of the SNARE motif is an ARGININE. They are classified separately from the Q-SNARE PROTEINS where the central amino acid residue of the SNARE motif is a GLUTAMINE. This subfamily contains the vesicle associated membrane proteins (VAMPs) based on similarity to the prototype for the R-SNAREs, VAMP2 (synaptobrevin 2).Microscopy, Confocal: A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.Guanosine Triphosphate: Guanosine 5'-(tetrahydrogen triphosphate). A guanine nucleotide containing three phosphate groups esterified to the sugar moiety.Qb-SNARE Proteins: A subfamily of Q-SNARE PROTEINS which occupy the same position in the SNARE complex as the N-terminal SNARE domain of SNAP-25 and which also are most similar to the N-terminal region of SNAP-25 in their AMINO ACID SEQUENCE.Clathrin-Coated Vesicles: Vesicles formed when cell-membrane coated pits (COATED PITS, CELL-MEMBRANE) invaginate and pinch off. The outer surface of these vesicles is covered with a lattice-like network of the protein CLATHRIN. Shortly after formation, however, the clathrin coat is removed and the vesicles are referred to as ENDOSOMES.Adaptor Protein Complex sigma Subunits: A family of small adaptin protein complex subunits of approximately 19 KDa in size.Vesicular Biogenic Amine Transport Proteins: Integral membrane proteins of the LIPID BILAYER of SECRETORY VESICLES that catalyze transport and storage of biogenic amine NEUROTRANSMITTERS such as ACETYLCHOLINE; SEROTONIN; MELATONIN; HISTAMINE; and CATECHOLAMINES. The transporters exchange vesicular protons for cytoplasmic neurotransmitters.Horseradish Peroxidase: An enzyme isolated from horseradish which is able to act as an antigen. It is frequently used as a histochemical tracer for light and electron microscopy. Its antigenicity has permitted its use as a combined antigen and marker in experimental immunology.Microtubules: Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.Cyclopentanes: A group of alicyclic hydrocarbons with the general formula R-C5H9.Crk-Associated Substrate Protein: Crk-associated substrate was originally identified as a highly phosphorylated 130 kDa protein that associates with ONCOGENE PROTEIN CRK and ONCOGENE PROTEIN SRC. It is a signal transducing adaptor protein that undergoes tyrosine PHOSPHORYLATION in signaling pathways that regulate CELL MIGRATION and CELL PROLIFERATION.Cytosol: Intracellular fluid from the cytoplasm after removal of ORGANELLES and other insoluble cytoplasmic components.Proto-Oncogene Proteins c-cbl: Proto-oncogene proteins that negatively regulate RECEPTOR PROTEIN-TYROSINE KINASE signaling. It is a UBIQUITIN-PROTEIN LIGASE and the cellular homologue of ONCOGENE PROTEIN V-CBL.Immunoblotting: Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.CHO Cells: CELL LINE derived from the ovary of the Chinese hamster, Cricetulus griseus (CRICETULUS). The species is a favorite for cytogenetic studies because of its small chromosome number. The cell line has provided model systems for the study of genetic alterations in cultured mammalian cells.Mice, Inbred C57BLCell Polarity: Orientation of intracellular structures especially with respect to the apical and basolateral domains of the plasma membrane. Polarized cells must direct proteins from the Golgi apparatus to the appropriate domain since tight junctions prevent proteins from diffusing between the two domains.Guanine Nucleotide Exchange Factors: Protein factors that promote the exchange of GTP for GDP bound to GTP-BINDING PROTEINS.Protein Synthesis Inhibitors: Compounds which inhibit the synthesis of proteins. They are usually ANTI-BACTERIAL AGENTS or toxins. Mechanism of the action of inhibition includes the interruption of peptide-chain elongation, the blocking the A site of ribosomes, the misreading of the genetic code or the prevention of the attachment of oligosaccharide side chains to glycoproteins.Oncogene Proteins: Proteins coded by oncogenes. They include proteins resulting from the fusion of an oncogene and another gene (ONCOGENE PROTEINS, FUSION).Electron Transport: The process by which ELECTRONS are transported from a reduced substrate to molecular OXYGEN. (From Bennington, Saunders Dictionary and Encyclopedia of Laboratory Medicine and Technology, 1984, p270)Ethylmaleimide: A sulfhydryl reagent that is widely used in experimental biochemical studies.Membrane Fusion: The adherence and merging of cell membranes, intracellular membranes, or artificial membranes to each other or to viruses, parasites, or interstitial particles through a variety of chemical and physical processes.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Jurkat Cells: A CELL LINE derived from human T-CELL LEUKEMIA and used to determine the mechanism of differential susceptibility to anti-cancer drugs and radiation.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Microscopy, Immunoelectron: Microscopy in which the samples are first stained immunocytochemically and then examined using an electron microscope. Immunoelectron microscopy is used extensively in diagnostic virology as part of very sensitive immunoassays.Yeasts: A general term for single-celled rounded fungi that reproduce by budding. Brewers' and bakers' yeasts are SACCHAROMYCES CEREVISIAE; therapeutic dried yeast is YEAST, DRIED.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Cytoskeletal Proteins: Major constituent of the cytoskeleton found in the cytoplasm of eukaryotic cells. They form a flexible framework for the cell, provide attachment points for organelles and formed bodies, and make communication between parts of the cell possible.Cytoplasmic Granules: Condensed areas of cellular material that may be bounded by a membrane.Monomeric Clathrin Assembly Proteins: A subclass of clathrin assembly proteins that occur as monomers.Protein Processing, Post-Translational: Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.Receptors, Interleukin-1: Cell surface receptors that are specific for INTERLEUKIN-1. Included under this heading are signaling receptors, non-signaling receptors and accessory proteins required for receptor signaling. Signaling from interleukin-1 receptors occurs via interaction with SIGNAL TRANSDUCING ADAPTOR PROTEINS such as MYELOID DIFFERENTIATION FACTOR 88.Subcellular Fractions: Components of a cell produced by various separation techniques which, though they disrupt the delicate anatomy of a cell, preserve the structure and physiology of its functioning constituents for biochemical and ultrastructural analysis. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p163)Protein-Tyrosine Kinases: Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.Secretory Vesicles: Vesicles derived from the GOLGI APPARATUS containing material to be released at the cell surface.Transferrin: An iron-binding beta1-globulin that is synthesized in the LIVER and secreted into the blood. It plays a central role in the transport of IRON throughout the circulation. A variety of transferrin isoforms exist in humans, including some that are considered markers for specific disease states.beta-Fructofuranosidase: A glycoside hydrolase found primarily in PLANTS and YEASTS. It has specificity for beta-D-fructofuranosides such as SUCROSE.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Son of Sevenless Proteins: A class of RAS GUANINE NUCLEOTIDE EXCHANGE FACTORS that are genetically related to the Son of Sevenless gene from DROSOPHILA. Sevenless refers to genetic mutations in DROSOPHILA that cause loss of the R7 photoreceptor which is required to see UV light.Luminescent Proteins: Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.ATP-Binding Cassette Transporters: A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.Phosphotyrosine: An amino acid that occurs in endogenous proteins. Tyrosine phosphorylation and dephosphorylation plays a role in cellular signal transduction and possibly in cell growth control and carcinogenesis.Cytoskeleton: The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.Dyneins: A family of multisubunit cytoskeletal motor proteins that use the energy of ATP hydrolysis to power a variety of cellular functions. Dyneins fall into two major classes based upon structural and functional criteria.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.HEK293 Cells: A cell line generated from human embryonic kidney cells that were transformed with human adenovirus type 5.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Enzyme Activation: Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.CARD Signaling Adaptor Proteins: A family of intracellular signaling adaptor proteins that contain caspase activation and recruitment domains. Proteins that contain this domain play a role in APOPTOSIS-related signal transduction by associating with other CARD domain-containing members and in activating INITIATOR CASPASES that contain CARD domains within their N-terminal pro-domain region.Endoplasmic Reticulum, Smooth: A type of endoplasmic reticulum lacking associated ribosomes on the membrane surface. It exhibits a wide range of specialized metabolic functions including supplying enzymes for steroid synthesis, detoxification, and glycogen breakdown. In muscle cells, smooth endoplasmic reticulum is called SARCOPLASMIC RETICULUM.Monensin: An antiprotozoal agent produced by Streptomyces cinnamonensis. It exerts its effect during the development of first-generation trophozoites into first-generation schizonts within the intestinal epithelial cells. It does not interfere with hosts' development of acquired immunity to the majority of coccidial species. Monensin is a sodium and proton selective ionophore and is widely used as such in biochemical studies.Fluorescent Antibody Technique: Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.Monomeric GTP-Binding Proteins: A class of monomeric, low molecular weight (20-25 kDa) GTP-binding proteins that regulate a variety of intracellular processes. The GTP bound form of the protein is active and limited by its inherent GTPase activity, which is controlled by an array of GTPase activators, GDP dissociation inhibitors, and guanine nucleotide exchange factors. This enzyme was formerly listed as EC 3.6.1.47Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Guanosine 5'-O-(3-Thiotriphosphate): Guanosine 5'-(trihydrogen diphosphate), monoanhydride with phosphorothioic acid. A stable GTP analog which enjoys a variety of physiological actions such as stimulation of guanine nucleotide-binding proteins, phosphoinositide hydrolysis, cyclic AMP accumulation, and activation of specific proto-oncogenes.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Cathepsin A: A carboxypeptidase that catalyzes the release of a C-terminal amino acid with a broad specificity. It also plays a role in the LYSOSOMES by protecting BETA-GALACTOSIDASE and NEURAMINIDASE from degradation. It was formerly classified as EC 3.4.12.1 and EC 3.4.21.13.Adenosine Triphosphate: An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.Synaptic Vesicles: Membrane-bound compartments which contain transmitter molecules. Synaptic vesicles are concentrated at presynaptic terminals. They actively sequester transmitter molecules from the cytoplasm. In at least some synapses, transmitter release occurs by fusion of these vesicles with the presynaptic membrane, followed by exocytosis of their contents.Munc18 Proteins: A family of proteins involved in intracellular membrane trafficking. They interact with SYNTAXINS and play important roles in vesicular docking and fusion during EXOCYTOSIS. Their name derives from the fact that they are related to Unc-18 protein, C elegans.Active Transport, Cell Nucleus: Gated transport mechanisms by which proteins or RNA are moved across the NUCLEAR MEMBRANE.src-Family Kinases: A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.Phospholipase C gamma: A phosphoinositide phospholipase C subtype that is primarily regulated by PROTEIN-TYROSINE KINASES. It is structurally related to PHOSPHOLIPASE C DELTA with the addition of SRC HOMOLOGY DOMAINS and pleckstrin homology domains located between two halves of the CATALYTIC DOMAIN.PC12 Cells: A CELL LINE derived from a PHEOCHROMOCYTOMA of the rat ADRENAL MEDULLA. PC12 cells stop dividing and undergo terminal differentiation when treated with NERVE GROWTH FACTOR, making the line a useful model system for NERVE CELL differentiation.Microtubule-Associated Proteins: High molecular weight proteins found in the MICROTUBULES of the cytoskeletal system. Under certain conditions they are required for TUBULIN assembly into the microtubules and stabilize the assembled microtubules.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.Nocodazole: Nocodazole is an antineoplastic agent which exerts its effect by depolymerizing microtubules.Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.Molecular Motor Proteins: Proteins that are involved in or cause CELL MOVEMENT such as the rotary structures (flagellar motor) or the structures whose movement is directed along cytoskeletal filaments (MYOSIN; KINESIN; and DYNEIN motor families).Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Toll-Like Receptors: A family of pattern recognition receptors characterized by an extracellular leucine-rich domain and a cytoplasmic domain that share homology with the INTERLEUKIN 1 RECEPTOR and the DROSOPHILA toll protein. Following pathogen recognition, toll-like receptors recruit and activate a variety of SIGNAL TRANSDUCING ADAPTOR PROTEINS.Neurons: The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.rab3 GTP-Binding Proteins: A genetically related subfamily of RAB GTP-BINDING PROTEINS involved in calcium-dependent EXOCYTOSIS. This enzyme was formerly listed as EC 3.6.1.47.Kinesin: A microtubule-associated mechanical adenosine triphosphatase, that uses the energy of ATP hydrolysis to move organelles along microtubules toward the plus end of the microtubule. The protein is found in squid axoplasm, optic lobes, and in bovine brain. Bovine kinesin is a heterotetramer composed of two heavy (120 kDa) and two light (62 kDa) chains. EC 3.6.1.-.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Paxillin: Paxillin is a signal transducing adaptor protein that localizes to FOCAL ADHESIONS via its four LIM domains. It undergoes PHOSPHORYLATION in response to integrin-mediated CELL ADHESION, and interacts with a variety of proteins including VINCULIN; FOCAL ADHESION KINASE; PROTO-ONCOGENE PROTEIN PP60(C-SRC); and PROTO-ONCOGENE PROTEIN C-CRK.Toll-Like Receptor 4: A pattern recognition receptor that interacts with LYMPHOCYTE ANTIGEN 96 and LIPOPOLYSACCHARIDES. It mediates cellular responses to GRAM-NEGATIVE BACTERIA.Endosomal Sorting Complexes Required for Transport: A set of protein subcomplexes involved in PROTEIN SORTING of UBIQUITINATED PROTEINS into intraluminal vesicles of MULTIVESICULAR BODIES and in membrane scission during formation of intraluminal vesicles, during the final step of CYTOKINESIS, and during the budding of enveloped viruses. The ESCRT machinery is comprised of the protein products of Class E vacuolar protein sorting genes.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.Protein Interaction Domains and Motifs: Protein modules with conserved ligand-binding surfaces which mediate specific interaction functions in SIGNAL TRANSDUCTION PATHWAYS and the specific BINDING SITES of their cognate protein LIGANDS.Fas-Associated Death Domain Protein: A signal-transducing adaptor protein that associates with TNF RECEPTOR complexes. It contains a death effector domain that can interact with death effector domains found on INITIATOR CASPASES such as CASPASE 8 and CASPASE 10. Activation of CASPASES via interaction with this protein plays a role in the signaling cascade that leads to APOPTOSIS.Coated Pits, Cell-Membrane: Specialized regions of the cell membrane composed of pits coated with a bristle covering made of the protein CLATHRIN. These pits are the entry route for macromolecules bound by cell surface receptors. The pits are then internalized into the cytoplasm to form the COATED VESICLES.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Protein Conformation: The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).Gene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Anion Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of negatively charged molecules (anions) across a biological membrane.Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Receptors, Antigen, T-Cell: Molecules on the surface of T-lymphocytes that recognize and combine with antigens. The receptors are non-covalently associated with a complex of several polypeptides collectively called CD3 antigens (ANTIGENS, CD3). Recognition of foreign antigen and the major histocompatibility complex is accomplished by a single heterodimeric antigen-receptor structure, composed of either alpha-beta (RECEPTORS, ANTIGEN, T-CELL, ALPHA-BETA) or gamma-delta (RECEPTORS, ANTIGEN, T-CELL, GAMMA-DELTA) chains.Cation Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.Brain: The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.

Polarized distribution of Bcr-Abl in migrating myeloid cells and co-localization of Bcr-Abl and its target proteins. (1/2017)

Bcr-Abl plays a critical role in the pathogenesis of Philadelphia chromosome-positive leukemia. Although a large number of substrates and interacting proteins of Bcr-Abl have been identified, it remains unclear whether Bcr-Abl assembles multi-protein complexes and if it does where these complexes are within cells. We have investigated the localization of Bcr-Abl in 32D myeloid cells attached to the extracellular matrix. We have found that Bcr-Abl displays a polarized distribution, colocalizing with a subset of filamentous actin at trailing portions of migrating 32D cells, and localizes on the cortical F-actin and on vesicle-like structures in resting 32D cells. Deletion of the actin binding domain of Bcr-Abl (Bcr-AbI-AD) dramatically enhances the localization of Bcr-Abl on the vesicle-like structures. These distinct localization patterns of Bcr-Abl and Bcr-Abl-AD enabled us to examine the localization of Bcr-Abl substrate and interacting proteins in relation to Bcr-Abl. We found that a subset of biochemically defined target proteins of Bcr-Abl redistributed and co-localized with Bcr-Abl on F-actin and on vesicle-like structures. The co-localization of signaling proteins with Bcr-Abl at its sites of localization supports the idea that Bcr-Abl forms a multi-protein signaling complex, while the polarized distribution and vesicle-like localization of Bcr-Abl may play a role in leukemogenesis.  (+info)

Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor. (2/2017)

Hermansky-Pudlak syndrome (HPS) is a genetic disorder characterized by defective lysosome-related organelles. Here, we report the identification of two HPS patients with mutations in the beta 3A subunit of the heterotetrameric AP-3 complex. The patients' fibroblasts exhibit drastically reduced levels of AP-3 due to enhanced degradation of mutant beta 3A. The AP-3 deficiency results in increased surface expression of the lysosomal membrane proteins CD63, lamp-1, and lamp-2, but not of nonlysosomal proteins. These differential effects are consistent with the preferential interaction of the AP-3 mu 3A subunit with tyrosine-based signals involved in lysosomal targeting. Our results suggest that AP-3 functions in protein sorting to lysosomes and provide an example of a human disease in which altered trafficking of integral membrane proteins is due to mutations in a component of the sorting machinery.  (+info)

Phosphotyrosine binding domains of Shc and insulin receptor substrate 1 recognize the NPXpY motif in a thermodynamically distinct manner. (3/2017)

Phosphotyrosine binding (PTB) domains of the adaptor protein Shc and insulin receptor substrate (IRS-1) interact with a distinct set of activated and tyrosine-phosphorylated cytokine and growth factor receptors and play important roles in mediating mitogenic signal transduction. By using the technique of isothermal titration calorimetry, we have studied the thermodynamics of binding of the Shc and IRS-1 PTB domains to tyrosine-phosphorylated NPXY-containing peptides derived from known receptor binding sites. The results showed that relative contributions of enthalpy and entropy to the free energy of binding are dependent on specific phosphopeptides. Binding of the Shc PTB domain to tyrosine-phosphorylated peptides from TrkA, epidermal growth factor, ErbB3, and insulin receptors is achieved via an overall entropy-driven reaction. On the other hand, recognition of the phosphopeptides of insulin and interleukin-4 receptors by the IRS-1 PTB domain is predominantly an enthalpy-driven process. Mutagenesis and amino acid substitution experiments showed that in addition to the tyrosine-phosphorylated NPXY motif, the PTB domains of Shc and IRS-1 prefer a large hydrophobic residue at pY-5 and a small hydrophobic residue at pY-1, respectively (where pY is phosphotyrosine). These results agree with the calculated solvent accessibility of these two key peptide residues in the PTB domain/peptide structures and support the notion that the PTB domains of Shc and IRS-1 employ functionally distinct mechanisms to recognize tyrosine-phosphorylated receptors.  (+info)

Identification of a novel domain shared by putative components of the endocytic and cytoskeletal machinery. (4/2017)

We have identified a approximately 140 amino acid domain that is shared by a variety of proteins in budding and fission yeast, nematode, rat, mouse, frog, oat, and man. Typically, this domain is located within 20 residues of the N-terminus of the various proteins. The percent identity among the domains in the 12 proteins ranges from 42 to 93%, with 16 absolutely conserved residues: N-x(11-13)-V-x2-A-T-x(34-36)-R-x(7-8)-W-R-x3-K-x12-G-x-E-x15 -L-x11-12-D-x-G-R-x11-D-x7-R. Even though these proteins share little beyond their segment of homology, data are emerging that several of the proteins are involved in endocytosis and or regulation of cytoskeletal organization. We have named this protein segment the ENTH domain, for Epsin N-terminal Homology domain, and hypothesize that it is a candidate for binding specific ligands and/or enzymatic activity in the cell.  (+info)

Phosphorylation of the medium chain subunit of the AP-2 adaptor complex does not influence its interaction with the tyrosine based internalisation motif of TGN38. (5/2017)

Tyrosine based motifs conforming to the consensus YXXphi (where phi represents a bulky hydrophobic residue) have been shown to interact with the medium chain subunit of clathrin adaptor complexes. These medium chains are targets for phosphorylation by a kinase activity associated with clathrin coated vesicles. We have used the clathrin coated vesicle associated kinase activity to specifically phosphorylate a soluble recombinant fusion protein of mu2, the medium chain subunit of the plasma membrane associated adaptor protein complex AP-2. We have tested whether this phosphorylation has any effect on the interaction of mu2 with the tyrosine based motif containing protein, TGN38, that has previously been shown to interact with mu2. Phosphorylation of mu2 was shown to have no significant effect on the in vitro interaction of mu2 with the cytosolic domain of TGN38, indicating that reversible phosphorylation of mu2 does not play a role in regulating its direct interaction with tyrosine based internalisation motifs. In addition, although a casein kinase II-like activity has been shown to be associated with clathrin coated vesicles, we show that mu2 is not phosphorylated by casein kinase II implying that another kinase activity is present in clathrin coated vesicles. Furthermore the kinase activity associated with clathrin coated vesicles was shown to be capable of phosphorylating dynamin 1. Phosphorylation of dynamin 1 has previously been shown to regulate its interaction with other proteins involved in clathrin mediated endocytosis.  (+info)

The EH and SH3 domain Ese proteins regulate endocytosis by linking to dynamin and Eps15. (6/2017)

Clathrin-mediated endocytosis is a multistep process which requires interaction between a number of conserved proteins. We have cloned two mammalian genes which code for a number of endocytic adaptor proteins. Two of these proteins, termed Ese1 and Ese2, contain two N-terminal EH domains, a central coiled-coil domain and five C-terminal SH3 domains. Ese1 is constitutively associated with Eps15 proteins to form a complex with at least 14 protein-protein interaction surfaces. Yeast two-hybrid assays have revealed that Ese1 EH and SH3 domains bind epsin family proteins and dynamin, respectively. Overexpression of Ese1 is sufficient to block clathrin-mediated endocytosis in cultured cells, presumably through disruption of higher order protein complexes, which are assembled on the endogenous Ese1-Eps15 scaffold. The Ese1-Eps15 scaffold therefore links dynamin, epsin and other endocytic pathway components.  (+info)

AP-4, a novel protein complex related to clathrin adaptors. (7/2017)

Here we report the identification and characterization of AP-4, a novel protein complex related to the heterotetrameric AP-1, AP-2, and AP-3 adaptors that mediate protein sorting in the endocytic and late secretory pathways. The key to the identification of this complex was the cloning and sequencing of two widely expressed, mammalian cDNAs encoding new homologs of the adaptor beta and sigma subunits named beta4 and sigma4, respectively. An antibody to beta4 recognized in human cells an approximately 83-kDa polypeptide that exists in both soluble and membrane-associated forms. Gel filtration, sedimentation velocity, and immunoprecipitation experiments revealed that beta4 is a component of a multisubunit complex (AP-4) that also contains the sigma4 polypeptide and two additional adaptor subunit homologs named mu4 (mu-ARP2) and epsilon. Immunofluorescence analyses showed that AP-4 is associated with the trans-Golgi network or an adjacent structure and that this association is sensitive to the drug brefeldin A. We propose that, like the related AP-1, AP-2, and AP-3 complexes, AP-4 plays a role in signal-mediated trafficking of integral membrane proteins in mammalian cells.  (+info)

High-affinity binding of the AP-1 adaptor complex to trans-golgi network membranes devoid of mannose 6-phosphate receptors. (8/2017)

The GTP-binding protein ADP-ribosylation factor (ARF) initiates clathrin-coat assembly at the trans-Goli network (TGN) by generating high-affinity membrane-binding sites for the AP-1 adaptor complex. Both transmembrane proteins, which are sorted into the assembling coated bud, and novel docking proteins have been suggested to be partners with GTP-bound ARF in generating the AP-1-docking sites. The best characterized, and probably the major transmembrane molecules sorted into the clathrin-coated vesicles that form on the TGN, are the mannose 6-phosphate receptors (MPRs). Here, we have examined the role of the MPRs in the AP-1 recruitment process by comparing fibroblasts derived from embryos of either normal or MPR-negative animals. Despite major alterations to the lysosome compartment in the MPR-deficient cells, the steady-state distribution of AP-1 at the TGN is comparable to that of normal cells. Golgi-enriched membranes prepared from the receptor-negative cells also display an apparently normal capacity to recruit AP-1 in vitro in the presence of ARF and either GTP or GTPgammaS. The AP-1 adaptor is recruited specifically onto the TGN and not onto the numerous abnormal membrane elements that accumulate within the MPR-negative fibroblasts. AP-1 bound to TGN membranes from either normal or MPR-negative fibroblasts is fully resistant to chemical extraction with 1 M Tris-HCl, pH 7, indicating that the adaptor binds to both membrane types with high affinity. The only difference we do note between the Golgi prepared from the MPR-deficient cells and the normal cells is that AP-1 recruited onto the receptor-lacking membranes in the presence of ARF1.GTP is consistently more resistant to extraction with Tris. Because sensitivity to Tris extraction correlates well with nucleotide hydrolysis, this finding might suggest a possible link between MPR sorting and ARF GAP regulation. We conclude that the MPRs are not essential determinants in the initial steps of AP-1 binding to the TGN but, instead, they may play a regulatory role in clathrin-coated vesicle formation by affecting ARF.GTP hydrolysis.  (+info)

In the present study, we have explored the function of the C-terminal sequences of complexins, relatively large sequences that account for nearly half of the complexin protein but nevertheless have remained functionally incompletely characterized. Because complexin-1 and complexin-2, and complexin-3 and complexin-4 form homologous pairs, we tested the effect of deleting or mutating the C-terminal sequences of complexin-1 and complexin-3, asking among others whether complexin-1 and complexin-3 perform similar functions in synaptic exocytosis and whether the functional differences between these complexins localize to their C-terminal regions. We made the following principal observations.. (1) Deletion of the complexin-1 C-terminal sequence revealed that it is essential for both its priming and clamping function but not for its synaptotagmin-activating function, thereby dissociating the two "positive " functions (synaptotagmin-activating and priming) of complexin.. (2) Complexin-1 and complexin-3 ...
Functions as sorting adapter in LPS-TLR4 signaling to regulate the MYD88-independent pathway during the innate immune response to LPS. Physically bridges TLR4 and TICAM1 and functionally transmits LPS-TRL4 signal to TICAM1; signaling is proposed to occur in early endosomes after endocytosis of TLR4. May also be involved in IL1-triggered NF-kappa-B activation, functioning upstream of IRAK1, IRAK2, TRAF6, and IKBKB; however, reports are controversial. Involved in IL-18 signaling and is proposed to function as a sorting adaptor for MYD88 in IL-18 signaling during adaptive immune response.
TLR signaling is mediated by the recruitment of distinct combinations of adaptor molecules to the cytoplasmic TIR domain of each TLR. Distribution and localization of the adaptor molecules are important factors controlling TLR-mediated signaling. TIRAP/Mal was found to be associated with the plasma membrane via a phosphatidylinositol 4,5-biphosphate-binding domain and facilitates MyD88 delivery to activated TLR4 (22). Also, myristoylation of TICAM-2/TRAM targets it to the plasma membrane and the Golgi apparatus, where it colocalizes with TLR4 (23). Thus, the role of these adaptor proteins other than TICAM-1 has been clearly demonstrated; TIRAP/Mal and TICAM-2/TRAM mainly function as bridges between TLR4 and the signaling adaptors, whereas MyD88 restricts its localization by TIRAP to assemble signal molecules around the TLR4 complex (9, 10, 24, 25). In this study we demonstrated that TICAM-1/TRIF delivers a signal in a unique fashion distinct from that of MyD88.. This is the first study to ...
Shop WW domain-containing adapter protein ELISA Kit, Recombinant Protein and WW domain-containing adapter protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
The ENTH domain is about half the size of an ANTH domain, but is also alpha-helical and in fact some of the helices superimpose very nicely (see below). The ENTH domain also binds to PtdInsPhosphates but using completely different residues. We have shown that the binding of PtdIns(4,5)P2 to epsin1 ENTH domain causes the folding of an additional N-terminal helix that can insert into the membrane and drive positive membrane curvature. ...
The following pictures illustrate how the lipids must move apart to accommodate the insertion of helix zero. The first picture shows 2 different views of the ENTH domain with a space filled PtdIns(4,5)P2 docked in the structure. In the bottom picture a membrane (to scale) is added such that the PtdIns(4,5)P2 is inserted and consequently helix zero is buried. One can image a space filled helix zero an d the number of lipids that would have to be displaced to accommodate epsin docking on the membrane ...
VHS domains are found at the N-termini of select proteins involved inintracellular membrane trafficking. We have determined the crystalstructure of the VHS domain of the human Tom1 (target of myb 1) protein to1.5 A resolution. The domain consists of eight helices arranged in asuperhelix. The surface of the domain has two main features: (1) a basicpatch on one side due to several conserved positively charged residues onhelix 3 and (2) a negatively charged ridge on the opposite side, formed byresidues on helix 2. We compare our structure to the recently obtainedstructure of tandem VHS-FYVE domains from Hrs [Mao, Y., Nickitenko, A.,Duan, X., Lloyd, T. E., Wu, M. N., Bellen, H., and Quiocho, F. A. (2000)Cell 100, 447-456]. Key features of the interaction surface between theFYVE and VHS domains of Hrs, involving helices 2 and 4 of the VHS domain,are conserved in the VHS domain of Tom1, even though Tom1 does not have aFYVE domain. We also compare the structures of the VHS domains of Tom1 andHrs to the ...
Interferon regulatory aspect (IRF)-3 may have a crucial function in viral and bacterial innate immune system replies by regulating the creation of type We interferon (IFN). cells. This inhibition was because of its suppression from the transcriptional activation TC-E 5001 of IRF-3, as proven by inhibition of IRF-3 PRD (III-I) luciferase activity along with the phosphorylation design of IRF-3 within the immunoblotting test. Furthermore, TQ targeted the autophosphorylation of TANK-binding kinase 1 (TBK1), an upstream essential enzyme in charge of IRF-3 activation. Used together, these results claim that TQ can downregulate IRF-3 activation via inhibition of TBK1, which would eventually decrease the creation of type I IFN. TQ also governed IRF-3, among the inflammatory transcription elements, offering a novel understanding into its anti-inflammatory actions. (TRIF). Upon arousal by LPS, TLR-4 recruits the adaptor proteins TRIF, which in turn recruits tumor necrosis TC-E 5001 aspect ...
Build: Sat Nov 17 23:53:08 EST 2018 (commit: a759bb7). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
VMware Tools for linux exists in 2 forms: the official VMware Tools and Open-VM-Tools. VMware Tools is based on a stable snapshot of Open-VM-Tools. Open-VM-Tools contains more experimental code and features. The official VMware Tools are not available for Archlinux. Originally, VMware Tools provided the best drivers for network and storage, combined with the functionality for other features such as time synchronization. However, for quite a while now the drivers for the network adapter en scsi adapter are part of the linux kernel, and VMware Tools is only needed for extra features and support for the "old" vmxnet adapter. ...
Epsin 1兔多克隆抗体(ab82688)可与人样本反应并经WB, ELISA实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
TRIF兔多克隆抗体(ab62583)可与人样本反应并经WB, IHC, ICC/IF实验严格验证,被1篇文献引用并得到1个独立的用户反馈。所有产品均提供质保服务,中国75%以上现货。
TLR4 recruits TRIF-related adaptor molecule (TRAM, also known as TICAM2) as a sorting adaptor to facilitate the interaction between TLR4 and TRIF and then initiate TRIF-dependent IRF3 activation. However, the mechanisms by which TRAM links downstream molecules are not fully elucidated. In this study, we show that TRAM undergoes tyrosine phosphorylation upon TLR4 activation and that is required for TLR4-induced IRF3 activation. Protein tyrosine phosphatase nonreceptor type 4 (PTPN4), a protein tyrosine phosphatase, inhibits tyrosine phosphorylation and subsequent cytoplasm translocation of TRAM, resulting in the disturbance of TRAM-TRIF interaction. Consequently, PTPN4 specifically inhibits TRIF-dependent IRF3 activation and IFN-β production in TLR4 pathway. Therefore, our results provide new insight into the TLR4 pathway and identify PTPN4 as a specific inhibitor of TRIF-dependent TLR4 pathway. Targeting PTPN4 would be beneficial for the development of new strategy to control TLR4-associated ...
The vesicle-mediated membrane transport is a multi-step process, consisting of vesicle formation (budding), targeting, tethering and membrane fusion (Bonifacino and Glick, 2004; Jahn and Scheller, 2006). Cargo proteins are concentrated at a specialized region on the donor membrane and packed into a nascent vesicle generated by the assembly of coat proteins such as clathrin into a cage-like lattice around the budding vesicle. Adaptor protein complexes (AP) are required to recruit cargo into coated vesicles thus playing an essential role in cargo selectivity of the transport vesicle in traffic between the trans-Golgi network (TGN) and endosomes (Owen et al., 2004). Gga proteins are monomeric clathrin adaptor proteins mediating TGN to the endosome transport (Nakayama and Wakatsuki, 2003). Apart from the AP complexes and the monomeric GGA adaptors, the list is expanding to new sets of adaptors, which are specific to only a particular type of cargo or to one family of cargo (Bonifacino and Rojas, ...
The liver responds to inflammation by down-regulating key hepatic genes involved in regulation of metabolic processes in the liver. This leads to disruption of drug metabolism and clearance and can cause drugs to become potentially ineffective or even toxic. To understand the mechanism of alteration of hepatic drug metabolism in inflammation, we are focusing on elucidating inflammation-induced signaling pathways in the liver. Cross-talk between the signaling components and DME gene regulators contribute to the down-regulation of these genes. We find that the LTA-mediated regulation of hepatic DME genes and serum cytokines involves the LTA receptor TLR2 as expected. However, the first adaptor protein, TIRAP, mediates the effects of LTA on DME genes in vivo and in isolated primary hepatocytes but not on cytokine expression in the liver.. In the liver, cytokines released from Kupffer cells bind to their respective receptors on hepatocytes to initiate signaling events, leading to down-regulation of ...
Background: Epsins are a family of ubiquitin-binding endocytic clathrin adaptors. We recently published that endothelial epsins function as critical regulators of tumor angiogenesis by controlling VEGF signaling (JCI, 2012; ATVB, 2013). Our goal is to define the novel role of epsins in macrophages in regulating atherogenesis.. Methods and Results: We engineered mice with specific deletion of epsins in myeloid cells (MΦ-DKO). Strikingly, MΦ-DKO mice on ApoE-/- background fed western diet significantly reduced atherosclerotic lesion formation and foam cell accumulation. In macrophages, epsin deficiency did not alter LDL scavenger receptors, CD36, Lox1 or SRB1, or reverse cholesterol transport proteins, ABCA1 or ABCG1, but did significantly reduce Lucifer Yellow pinocytosis, indicating a major defect in lipid uptake. Epsin deficiency did decrease total and surface protein levels of LRP-1, a protein with anti-inflammatory and anti-atherosclerotic properties. Oil Red O staining of isolated ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Enlarged early endosomes in the neurons of young Down syndrome (DS) and pre-Alzheimers disease (AD) brains suggest that a disturbance in endocytosis is one of the earliest hallmarks of AD pathogenesis in both conditions. We identified a chromosome 21 gene, Intersectin-1 (ITSN1) that is up-regulated in DS brains and has a putative function in endocytosis and vesicle trafficking. To elucidate the function of ITSN1 and assess its contribution to endocytic defects associated with DS and AD, we generated Itsn1 null mice. In knockout mice we found alterations in a number of parameters associated with endocyic and vesicle trafficking events. We found a reduced number of exocytosis events in chromaffin cells and a slowing of endocytosis in neurons. Endosome size was increased in neurons and NGF levels were reduced in the septal region of the brain. Our data is the first indication that Itsn1 has a role in endocytosis in an in vivo mammalian model, and that a disruption in Itsn1 expression causes a ...
Genetic variations in the vacuolar protein sorting 10 protein (Vps10p) family have been linked to Alzheimers disease (AD). Here we demonstrate deposition of fragments from the Vps10p protein sortilin at senile plaques (SPs) in aged and AD human cerebrum. Sortilin changes were characterized in postmortem brains with antibodies against the extracellular and intracellular C-terminal domains. The two antibodies exhibited identical labeling in normal human cerebrum, occurring in the somata and dendrites of cortical and hippocampal neurons. The C-terminal antibody also marked extracellular lesions in some aged and all AD cases, appearing as isolated fibrils, mini-plaques, dense-packing or circular mature-looking plaques. Sortilin and β-amyloid (Aβ) deposition were correlated overtly in a region/lamina- and case-dependent manner as analyzed in the temporal lobe structures, with co-localized immunofluorescence at individual SPs. However, sortilin deposition rarely occurred around the pia, vascular wall or
In collaboration with Dr. Kerstin Reim, MPI Göttingen, Germany) Complexin (Cplx) 1, 2, 3 and 4 are a family of small, soluble proteins that bind to the assembled exocytotic core complex, and are involved in the regulated release of neurotransmitter at chemical synapses in the central nervous system. In the mouse genome the four proteins are encoded by different genes: Cplx 1 and 2 are - like Cplx 3 and 4 - highly homologous to each other, whereas Cplx 1 and 2 show only a very limited homology to Cplx 3 and 4. In contrast to Cplx 1 and 2, Cplx 3 and 4 contain a CAAX box motif, which leads to farnesylation. It has been shown that this farnesylation motif causes membrane targeting of Cplx 3 and 4. Whereas Cplxs 1, 2 and 3 are distributed in the retina and brain, Cplx 4 is restricted to the retina. With immunocytochemistry and high resolution light microscopy, I examine the cellular, synaptic and developmental expression of all four Cplx isoforms in the mouse retina. Using a variety of different ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
Reactome is pathway database which provides intuitive bioinformatics tools for the visualisation, interpretation and analysis of pathway knowledge.
Reactome is pathway database which provides intuitive bioinformatics tools for the visualisation, interpretation and analysis of pathway knowledge.
Complete information for CPLX3 gene (Protein Coding), Complexin 3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Complete information for CPLX2 gene (Protein Coding), Complexin 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
PIM product data: Panasonic Serial Adapter DIN 8pin Dsub 9pin cable interface/gender adapter ET-ADSER cable interface/gender adapters SERIAL ADAPTOR, compare, review, comparison, specifications, price, brochure, catalog, product information, content syndication, product info, product data, datasheet
... , Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol.
References for Abcams Recombinant Human CPLX1 protein (ab79148). Please let us know if you have used this product in your publication
A three-piece anastomotic coupling device for end-to-end anastomosis of tubular members consisting of two open bore cylindrical adaptors and an open bore cylindrical connector. Each end of a tubular member is passed through the axial bore of an adaptor and everted over the end thereof. The adaptors are then inserted into opposite ends of the connector until the everted ends of the vessel abut under light compression. Integral locking means are provided to secure the adaptors and tubular members of the connector piece.
With the release of OS X 10.8.2, Apple disabled USB 2.0 drivers over Thunderbolt. Because many SD-to-SxS adapters use the ExpressCard USB interface, and Qio and Qio E3 support USB-based adapters through the ExpressCard (SxS) slots USB interfaces, the adapters are not recognized under 10.8.2+. Sonnets USB 2.0 Over Thunderbolt Patch for Qio/Qio E3 removes the limitation and allows your adapter to be recognized ...
PIM product data: MicroBattery MBC1043 Auto 90W Black power adapter & inverter MBC1043 power adapters & inverters DC Adapter 90W, 18-20V, compare, review, comparison, specifications, price, brochure, catalog, product information, content syndication, product info, product data, datasheet
Thread Size: -4 AN Male to M12 x 1.5. Type: Adapter Part Number: TORQ-0004TOM121.5. Fitting,Adapter, -4 AN to M12 x 1.5, Aluminum, Black, Each. Fitting Finish: Black anodized. Each component is precision-machined to exact tolerances for trouble-free performance.
Gentaur molecular products has all kinds of products like :search , Gene Link \ Bam HI_ Sma I Adaptor \ 26-3100-07 for more molecular products just contact us
Gentaur molecular products has all kinds of products like :search , Labne \ Individual adapters for 0.4_0.25 ml tubes, pk of 6 \ C1206 for more molecular products just contact us
Most difficulties in working with Micro-Manager arise from configuring the system and from problems/issues with specific devices. In both of these cases you are interacting mainly with device adapters. These device adapters have been written by several different authors, all behave slightly differently, and interact with specific hardware that has its own peculiarities. On these pages we will maintain as much information as possible about Micro-Manager device adapters. This will help you configure and understand your Micro-Manager system. We hope that the authors of the device adapters will maintain this information, but please feel free to update the information here with your own experiences. The information here will refer to the most recent Micro-Manager release. ...
... on Shapeways. Learn more before you buy, or discover other cool products in Other.
Please make sure the part number Please make sure the part number, series number and model number are all matching your original adapter.
Please make sure the part number Please make sure the part number, series number and model number are all matching your original adapter.
If you want to buy cheap usb adaptor charger, choose usb adaptor charger from banggood.com. It endeavors to provide the products that you want, offering the best bang for your buck. Whatever usb adaptor charger styles you want, can be easily bought here.
here is what i will be using: weeks: 1-12 500mg test enth/week 1-6 300mg tren enth 5-8 60mg t-bol 6-12 1-t dermal (10g total will be used in the 6
Diese Fotogalerie enthält eine Umfangreiche Bildersammlung, wie Astroaufnahmen,Wetterbilder,Landschaftsaufnahmen, und weitere Bilder davon.
Diese Fotogalerie enthält eine Umfangreiche Bildersammlung, wie Astroaufnahmen,Wetterbilder,Landschaftsaufnahmen, und weitere Bilder davon.
The protein encoded by this gene resides in the golgi, and constitutes one of the 8 subunits of the conserved oligomeric Golgi (COG) complex, which is required for normal golgi morphology and localization. Mutations in this gene are associated with the congenital disorder of glycosylation type IIe.[provided by RefSeq, May 2010 ...
Analyses with the yeast two-hybrid system showed that the cytosolic tail of the human CI-MPR interacted with full-length GGA3 as well as with the ∼150-amino acid VHS domain, but not the GAT or GAE domains of GGA3 (Fig. 1C). Further analyses revealed that the CI-MPR tail interacted with the VHS domains of all three GGAs and that the CD-MPR tail interacted with the VHS domains of GGA1 and, more weakly, GGA3 (Fig. 1D). These interactions were highly specific, because neither MPR tail bound to the VHS domains of STAM1, HRS, TOM1, and TOM1L1 (Fig. 1D). Likewise, we did not detect interactions between the GGA VHS domains and the cytosolic tails of TGN38, TRP2, tyrosinase, TRP1, LAMP-2, LIMP II, low density lipoprotein (LDL) receptor, β-amyloid precursor, and transferrin receptor (Fig. 1D), which contain either tyrosine-based sorting signals or dileucine-based sorting signals devoid of acidic clusters.. Deletion of the acidic-cluster-dileucine signals from the CI-MPR and CD-MPR tails abolished ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Sortilin (SORT1) is a protein that in humans is encoded by the SORT1 gene on chromosome 1. This protein is a type I membrane glycoprotein in the vacuolar protein sorting 10 protein (Vps10p) family of sorting receptors. While it is ubiquitously expressed in many tissues, sortilin is most abundant in the central nervous system. At the cellular level, sortilin functions in protein transport between the Golgi apparatus, endosome, lysosome, and plasma membrane, leading to its involvement in multiple biological processes such as glucose and lipid metabolism as well as neural development and cell death. Moreover, the function and role of sortilin is now emerging in several major human diseases such as atherosclerosis and coronary artery disease, Alzheimers disease, and cancer. The SORT1 gene also contains one of 27 loci associated with increased risk of coronary artery disease. The SORT1 gene resides on chromosome 1 at the band 1p13.3 and includes 23 exons. This gene encodes 2 isoforms through ...
Predicted to be involved in several processes, including Golgi organization; Golgi vesicle transport; and protein stabilization. Predicted to localize to the Golgi transport complex; cytosol; and plasma membrane. Is expressed in several structures, including brain; pancreas; and reproductive system. Orthologous to human COG3 (component of oligomeric golgi complex 3 ...
Adapter Bearing in Pune, Adapter Bearing Products, Adapter Bearing Suppliers in Pune, Adapter Bearing Manufacturers in Pune - Pune Yellow Pages Online. Looking for Adapter Bearing in Pune, Adapter Bearing Products, Adapter Bearing Suppliers in Pune, Adapter Bearing Manufacturers in Pune - Pune Yellow Pages Online? Get Suppliers / Manufacturers / Retailers Company List in Pune, Maharashtra India
AC/DC Adapters Products catalog and AC/DC Adapters manufacturer directory. weiku.com is a AC/DC Adapters trade platform offering information about Global AC/DC Adapters Products and global AC/DC Adapters buyers
To clarify things a bit more here in the post though, let me provide a bit more detail on what goes into my VMs network configuration. In VBox Manager -, pfSense VM -, Settings -, Network, Adapter 1 is a Bridged Adapter and Adapter 2 is a Host-Only Adapter. Under the USB Settings, I have a USB Device Filter configured to match my Alfa USB WiFi adapter. These are all the configured devices that will eventually become the actual network interfaces in pfSense once the VM boots. During the VM boot process, the pfSense kernel detects Network Adapter 1 as /dev/em0, Network Adapter 2 as /dev/em1 and the USB WiFi adapter as /dev/run0. Later in the boot process, pfSense configures these network devices as network interfaces typical for a network router. In my case, the VM Bridged adapter (em0) becomes the WAN interface where all Internet-bound traffic is directed. Since pfSense provides a GUI for configuration, the VM Host-Only adapter (em1) becomes a LAN interface (192.168.56.2/24) which allows ...
Underwater kinetics Aqualite Adapter Kit. Ball Arm Adapter KitThe Ball Arm Adapter has been replaced by the Aqualite Photo Adapter Kit (1287, dive
Thermo Scientific™ Adapters for Thermo Scientific™ HIGHConic III Rotors 3.5mL Round Bottom Tube Adapter Thermo Scientific™ Adapters for...
USD 3.99 Only, Buy REMAX OTG Micro to USB Adapter Smart Connection Adapter Golden with Worldwide Free Shipping for All Orders at Tmart.com.
As a member of the CNA 14000 family, the OCe14102 uses a 10Gbit/s DCB (Converged Enhanced Ethernet) infrastructure for networking and storage, reducing capital expense (CapEx) for adapters, switches and cables, and operational expense (OpEx) for power, cooling and IT administration. The OCe14102 adapter increases data center IT agility and scalability, as well as optimation of the server hardware utilization by scaling high density virtualization.
Amphenol RF - N Female-N Female Adapter Bulkhead Low PIM (172371) AMPHENOL CONNEX N female to N female adapter. Nickel plated body, gold plated contacts.
The 33 Series of precision adapters enable accurate measurements with V Connector® interfaces. Every adapter is fully specified and 100% tested to ensure low reflections and optimum phase performance.
... and other CPAP machine parts are easy to buy at EasyCPAP.com. We ship the same day you order and we offer a price guarantee.
An Ideal Solution:Adaptor interface is an accessory to an isolated 2-channel tDCS stimulator, intelligently dividing & guiding current, converting it to HD-tDCS
The Mediatrix S7 Series of analog VoIP adaptors (ATAs) offers the ability to smoothly connect all IP and legacy equipment to a hosted or on premise IP-PBX.
DENAQ AC Power Adapter and Charger for Select Toshiba Laptops: Compatible with select Toshiba laptops; charges your device; safety fuses; smart technology
You might not know this, but life as you once knew it is over. No, were not talking about crises economic or environmental, the Red Menace, or the count down t...
셀레믹스는 아래의 가이드라인에 따라 샘플을 준비할 것을 권장합니다. 아래 제시된 최소 샘플 요구 조건을 충족할 수 없는 샘플의 경우 별도로 문의해 주시기 바랍니다 ...
Component of the adaptor complexes which link clathrin to receptors in coated vesicles. Clathrin-associated protein complexes are believed to interact with the cytoplasmic tails of membrane proteins, leading to their selection and concentration. AP50 is a subunit of the plasma membrane adaptor. The complex binds polyphosphoinositide-containing lipids. [-] ...
Results Patients with lupus display decreased expression of Bim in circulating monocytes and reduced Bim expression in kidney macrophages. CreLysMBimflox/flox mice develop a lupus-like disease that mirrors aged Bim-/- mice including loss of the marginal zone macrophages, splenomegaly, lymphadenopathy, autoantibodies including anti-DNA IgG, and a type I interferon signature as compared to control mice. CreLysMBimflox/flox mice also exhibit increased mortality attributed to immune complex deposition and increased numbers of kidney macrophages all of which contribute to glomerulonephritis. The loss of Bim in macrophages is sufficient to break tolerance as adoptive transfer of wild-type lymphocytes into CreLysMBimflox/floxRag-/- mice leads to systemic autoimmunity. We also identified that the loss of TLR signalling adaptor protein TRIF but not MyD88 is essential for progression to GN phase but is dispensable for systemic autoimmunity. RNA seq analysis of sorted kidney macrophages revealed a novel ...
TAK-242 (resatorvid), a small molecule specific inhibitor of Toll-like receptor (TLR) 4 signaling, inhibits the production of lipopolysaccharide-induced inflammatory mediators by binding to the intracellular domain of TLR4. Previously, Cys747 in TLR4 was identified as the binding site of TAK-242. However, the mechanism by which TAK-242 inhibits TLR4 signaling after binding to TLR4 remains unknown. The present study demonstrated, using coimmunoprecipitation, that TAK-242 interferes with protein-protein interactions between TLR4 and its adaptor molecules. Among ten different human TLRs, TAK-242 selectively bound to TLR4. The time course of the inhibitory effect of TAK-242 on inflammatory mediator production corresponded to that of the binding of TAK-242 to TLR4. TAK-242 inhibited the association of TLR4 with TIR domain-containing adaptor protein (TIRAP) or TRIF-related adaptor molecule (TRAM) in HEK293 cells overexpressing TLR4, MD-2 and TIRAP or TRAM, respectively. TAK-242 inhibited the ...
Pictured at right is the pre-release G4 adapter next to the ridiculously huge Apple UFO adapter at left (encased in the cool PackAge 45W from id east end.). This pre-release adapter is essentially an Apple cable connected to their existing Micro adapter. The final product will ship with the Madsonline L-shaped connector plug and may be a slightly different color. Madsonline may sell a limited quantity of the first generation adapters in about three weeks via their Web site.. The pre-release adapter that I am using functions just as you would expect and runs at about the same temperature as their previous G3 Micro adapter, which is warmer than the Apple AC adapter. The temperature is normal according to Madsonline and is simply a tradeoff of such a small design.. The company expects the final model to be available in about six weeks. Pricing has not yet been determined.. ...
Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic menawarkan yang terbaik. mendapatkan murah Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic Termurah Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic. Smart Penawaran dan atas perbelanjaan . Beli Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic sekarang. Terbaik harga terbaik! 2012 .. Jika Anda menemukan penjualan produk produk, belanja Deals.If pada saat diskon akan lebih tabungan sehingga Anda sudah memutuskan Anda ingin memiliki Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic untuk Anda, tetapi Anda tidak tahu di mana untuk mendapatkan harga yang terbaik untuk ini Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic. Kita sudah melakukan penelitian dan menghabiskan banyak waktu untuk Anda. Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic ...
Signal Transducing Adaptor Proteins: A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
View Notes - lactosenotes8-18 from ANTH 143 at UNC. Anth 143: Lactose Announcements: *Extra Credit talk (re-scheduled) CLONED BEEF 7pm 3/20 (thurs) Morehead Planetarium, Banquet Hall (5 pts.
Discover the best homework help resource for ANTH at Rio Hondo College. Find ANTH study guides, notes, and practice tests for Rio Hondo College.
Theres also focus issues with lens adapters as you have 3 potential places for de-focus: the front lens, the back focus on the adapter, and the stock lens. When youre running and gunning, this can really slow things down. If I can have it my way, Im going to burden my brain with as few hardware related thoughts as possible so I can focus on making effective creative decisions. I think Lens Adapters are a great solution but can also be a lot of headaches (and back aches!). Because the Pro35 bypasses the stocks lens and has such precise controls, I found it to be a lot more comfortable to operate and with less things to worry my brain about. With the Zacuto plate, shoulder pad, and handles, the rig effortlessly went from studio mode to handheld as fast as we could get it off the sticks. That was awesome. Definitely the biggest issue with this setup is the crop factor. Without a real relay lens, your 18mm is more like a 35 or a 40. Thats wide but not really wide enough in a tight space or if ...
Medical gas adapters are for use to connect medical gas devices to medical gas terminals.. • Suitable for medical gas and vacuum (negative pressure). • Adapter material is chrome-plated brass or stainless steel. • Gas specific adapters ...
You can expect to find around four sockets in an average room in a house. Although this is enough for most purposes, an increase in the use of computers, games consoles and other appliances has led to the number of sockets being needed in an average room to increase to eight. Extension leads and adaptors often provide a quick and easy solution but, in reality, these leads and adaptors are often misused, and can present a very real danger. In extreme cases they can overheat, which can cause a fire ...
Oligonucleotide sequences for TruSeqTM RNA and DNA Sample Prep Kits1 TruSeq Universal Adapter 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TruSeq Adapters barcode: ATCACG TruSeq Adapter, Index 1 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 2 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 3 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 4 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 5 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 6 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 7 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 8 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 9 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG ...
Nike Zoom Vapor 9 Tour Mint/Anth/Wh Womens Shoe from tennis-warehouse.com. Shop more products from tennis-warehouse.com on Wanelo.
TRIF−/− mice are more susceptible to vaccinia infection than WT.TRIF−/− and WT BL/6 mice were infected with 1×104 pfu Vac-FL. (A) Weight loss, expresse
Vehicle Power Adapter Charge your detector easily anywhere you go with the vehicle power adapter (CLA) cigarette lighter adapter. Only 12V suitable. Simply attach the detector or battery through the charging and IR communications port and wait for the
As a member of the CNA 14000 family, the OCe14401 uses a 40Gbit/s DCB (Converged Enhanced Ethernet) infrastructure for networking and storage, reducing capital expense (CapEx) for adapters, switches and cables, and operational expense (OpEx) for power, cooling and IT administration. The OCe14401 adapter increases data center IT agility and scalability, as well as optimation of the server hardware utilization by scaling high density virtualization.
Watts Drainage Products MS-930 epoxy coated cast iron trap primer adaptor with 1/2 in. (13mm) NPT threaded tapping, and no hub connections.
Tin (Sn) AAnalyst Coded Intensitron Adapter from PerkinElmer. An item from our line of Adapters for System 2 EDL for AAnalyst Spectrometers.
Posted by OnBelay (98.145.157.97) on 06:50:44 05/11/11. In Reply to: filter adapter torques posted by kcburb. : Anyone know the filter adapter torgue ...
Inhibition of the MyD88 adaptor results in reduced cytokine productions.PBMC from TB-IRIS patients (week 2) were treated with MyD88 inhibitor (MYD88-Inh), contr
Browse our collection of electrical accessories at Tesco direct and choose from adaptors and chargers to a fantastic selection of practical lightbulbs.
Apple uses a Proprietary PCIe 2.0 x4 blade SSD. The best solution outside of buying a used Apple SSD is to buy the OWC: MacBook Pro with Retina Display 13 & 15 Late 2013, 2014, & 2015 as they are the only 3rd party that makes a replacement. That is what I recommend. As for using some adapter to ho... - MacBook Pro 13 Retina Display Early 2015
With the new ProPEX® Auto Rotation Adapter from Uponor Inc., installers no longer need to rotate the expander tool or the tubing itself by hand when making ProPEX connections on Wirsbo AQUAPEX® and hePEX™ plus tubing.
Looking for NIBCO Adapter, Wrot Copper, 3/8, C x FNPT (1VLT1)? Graingers got your back. Price $6.70. Easy online ordering for the ones who get it done along with 24/7 customer service, free technical support & more.
Find Compaq TFT 8020 adapter prices and learn where to buy. CNET brings you pricing information for retailers, as well as reviews, ratings, specs and more.
Black PEEK threaded adapter to convert Optima 8000 Series sapphire injectors with ESI connector for use with Optima 7x00 and earlier models.
říj 09 6:45:21: There are no TAP-Windows adapters on this system. You should be able to create a TAP-Windows adapter by going to Start -, All Programs -, TAP-Windows -, Utilities -, Add a new TAP-Windows virtual ethernet adapter ...
This board can do it all - break out the Synapse RF module pins, give you a USB port/FTDI chip to program, supply it with a regulated 3.3V, integrate a reset switch (for updating & erasing), and also give you mounting options.
Are there alternate cards that would work? Does it need to be the Prism2 chipset, or will the Prism or Prism3 chipset also work ...
We love to talk to customers and we would love to be your one stop source for all your medical supply needs. Send us a note and let us know how we are doing or send us a question we would love to help ...
Die neue Auflage des erfolgreichen Lehrbuchs bietet deutlich mehr Stoff. Es enthält jetzt eine Darstellung der Grundlagen von Biosensoren und Immunoassays sowie einen ersten Einstieg in das wichtige G
Die BioTaurus Pflanzen Linie ist ein biologischer Bodenverbesserer und enthält natürliche, im Boden vorkommende Mikroorganismen für gesunde und üppige Pflanzen.
I still have my old Magsafe Adapter that came with my 2010 White MacBook in 2010 and I left it at work. Would it be safe to use it on my new MacBook Pro...
Some kids continue to be their parents pride and joy for years after theyve flown the nest. But the pleasure parents can experience from a grown childs success cuts both ways, new research suggests.
gi,17538522,ref,NP_501092.1, component of oligomeric Golgi complex 2; brefeldin A-sensitive, LDLC related peripheral Golgi protein, required for normal Golgi function; contains an N myristoylation domain (78.6 kD) (4H802) [Caenorhabditis elegans] gi,2498513,sp,Q21444,COG2_CAEEL Conserved oligomeric Golgi complex component 2 (LDLC protein homolog) gi,1078836,pir,,B53542 brefeldin A-sensitive Golgi protein LDLC - Caenorhabditis elegans gi,807871,emb,CAA84428.1, Cog2 protein [Caenorhabditis elegans] ...
EpsinR is a clathrin-coated vesicle (CCV) enriched 70-kD protein that binds to phosphatidylinositol-4-phosphate, clathrin, and the gamma appendage domain of the adaptor protein complex 1 (AP1). In cells, its distribution overlaps with the perinuclear pool of clathrin and AP1 adaptors. Overexpression disrupts the CCV-dependent trafficking of cathepsin D from the trans-Golgi network to lysosomes and the incorporation of mannose-6-phosphate receptors into CCVs. These biochemical and cell biological data point to a role for epsinR in AP1/clathrin budding events in the cell, just as epsin1 is involved in the budding of AP2 CCVs. Furthermore, we show that two gamma appendage domains can simultaneously bind to epsinR with affinities of 0.7 and 45 microM, respectively. Thus, potentially, two AP1 complexes can bind to one epsinR. This high affinity binding allowed us to identify a consensus binding motif of the form DFxDF, which we also find in gamma-synergin and use to predict that an uncharacterized EF-hand
The protein encoded by this gene is the medium chain of the trans-Golgi network clathrin-associated protein complex AP-1. The other components of this complex are beta-prime-adaptin, gamma-adaptin, and the small chain AP1S1. This complex is located at the…
AP2 adaptor complex Vesicular transport adaptor protein Umasankar PK, Ma L, Thieman JR, Jha A, Doray B, Watkins SC, Traub LM ( ... The μ homology domain of muniscins has been reported to have evolved from part of an ancient cargo adaptor protein complex ... The muniscin protein family was initially defined in 2009 as proteins having 2 homologous domains that are involved in clathrin ... The muniscins are early arriving proteins involved in CME. FCHO proteins are required for CME, but do not appear to be required ...
... tied to kinesin-dependent vesicular transport. In this context, JIP1/2 act as cargo adaptors, binding to a motor protein and a ... This protein is a member of the mitogen-activated protein kinase kinase family. The MKK7 protein exists as six different ... In addition to their "normal" cargoes (C-termini of transmembrane proteins), they also transport MAP2K and MAP3K enzymes, ... Several mammalian scaffold proteins have been identified. These include the JNK-interacting protein (JIP) 1 and its closerly- ...
... may refer to: Signal transducing adaptor protein Vesicular transport adaptor protein Clathrin adaptor protein, ...
... such as the EHD protein family Rab proteins SNAREs Vesicular transport adaptor proteins e.g. Sorting nexins Synaptotagmin TRAPP ... Membrane transport protein Wikipedia:MeSH_D12.776#MeSH_D12.776.543.990_---_vesicular_transport_proteins Vesicular Transport ... A vesicular transport protein, or vesicular transporter, is a membrane protein that regulates or facilitates the movement of ... retrograde transport ; Golgi ----> Endoplasmic reticulum COP 2 (Cytosolic coat protein complex ) : anterograde transport ; RER ...
Clathrin adaptor proteins, also known as adaptins, are vesicular transport adaptor proteins associated with clathrin. These ... The two major types of clathrin adaptor complexes are the heterotetrameric vesicular transport adaptor proteins (AP1-5), and ... Touz MC, Kulakova L, Nash TE (July 2004). "Adaptor protein complex 1 mediates the transport of lysosomal proteins from a Golgi- ... adaptors. Adaptins are distantly related to the other main type of vesicular transport proteins, the coatomer subunits, sharing ...
Vesicular transport adaptor proteins are proteins involved in forming complexes that function in the trafficking of molecules ... Epsin and AP180 in the ANTH domain are other adaptor proteins that have been reviewed. An important transport complex, COPII, ... Most of the adaptor proteins are heterotetramers. In the AP complexes, there are two large proteins (∼100 kD) and two smaller ... in the cargo proteins that interact with the adaptor proteins can be very short. For example, one well-know example is the ...
... a mammalian master molecule in vesicular transport and protein sorting, suppresses the degradation of ESCRT proteins signal ... Signal transducing adapter molecule 1 is a protein that in humans is encoded by the STAM gene. This gene was identified by the ... The encoded protein contains an SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). This protein ... Mizuno E, Kawahata K, Kato M, Kitamura N, Komada M (September 2003). "STAM proteins bind ubiquitinated proteins on the early ...
... adaptor proteins.2C vesicular transport Signal Transducing Adaptor Proteins at the US National Library of Medicine Medical ... phosphoinositide-3-kinase adaptor protein 1 SH2B1 - SH2B adaptor protein 1 SH2B2 - SH2B adaptor protein 2 SH2B3 - SH2B adaptor ... GRB2-related adaptor protein GRAP2 - GRB2-related adaptor protein 2 LDLRAP1 - low-density lipoprotein receptor adaptor protein ... NCK adaptor protein 1 NCK2 - NCK adaptor protein 2 NOS1AP - nitric oxide synthase 1 (neuronal) adaptor protein PIK3AP1 - ...
"Protrudin serves as an adaptor molecule that connects KIF5 and its cargoes in vesicular transport during process formation". ... Zinc finger, FYVE domain containing 27 is a protein that in humans is encoded by the ZFYVE27 gene. This gene encodes a protein ... The encoded protein appears to promote Neuriteformation. A mutation in this gene has been reported to be associated with ... of neurite extension by protrudin requires its interaction with vesicle-associated membrane protein-associated protein". The ...
2001). "Novel adapter protein AP162 connects a sialyl-Le(x)-positive mucin with an apoptotic signal transduction pathway". ... PLEKHM1 may have critical function in vesicular transport in osteoclasts. Mutations in the PLEKHM1 gene are associated with ... 2007). "Involvement of PLEKHM1 in osteoclastic vesicular transport and osteopetrosis in incisors absent rats and humans". J. ... 2005). "A human protein-protein interaction network: a resource for annotating the proteome". Cell. 122 (6): 957-68. doi: ...
RIAM (Rap1-GTP-interacting adapter molecule) is a broadly expressed adaptor protein that contains an RA (Ras association)-like ... PKD-dependent regulation of vesicular transport requires PKD kinase activity, while PKD-dependent regulation of TCR signaling ... These proteins are divided into families depending on their protein structure, and the most well studied is the Ras superfamily ... Rap1 (Ras-proximate-1 or Ras-related protein 1) is a small GTPase, which are small cytosolic proteins that act like cellular ...
... vesicular transport, apoptosis, membrane dynamics and receptor signaling. This protein family is of great clinical importance ... protein-protein interactions, vesicle trafficking, membrane dynamics, receptor signaling, apoptosis, adaptor/regulatory modules ... "neurobeachin-like protein 1 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2017-02-24. "Pfam: Family: ... NBEAL1 is a protein that in humans is encoded by the NBEAL1 gene. It is found on chromosome 2q33.2 of Homo sapiens. Through the ...
These findings suggest that the SCAMPs may function at the same site during vesicular transport rather than in separate ... Secretory carrier-associated membrane protein 1 is a protein that in humans is encoded by the SCAMP1 gene. This gene product ... Andersson B, Wentland MA, Ricafrente JY, Liu W, Gibbs RA (April 1996). "A "double adaptor" method for improved shotgun library ... Liu L, Guo Z, Tieu Q, Castle A, Castle D (December 2002). "Role of secretory carrier membrane protein SCAMP2 in granule ...
Vesicular transport adaptor protein)-1(adaptor protein 1、AP-1)、AP-3及AP-4蛋白復合物的網格蛋白囊泡可參與貨物分子在反面Golgi與內體、溶酶體及質膜間的轉運[6][7]。含AP-2蛋白 ... 運輸囊泡(Transport vesicles)在真核生物中,通過在不同細胞器及細胞表面進行轉運發揮它的作用。目前已知的運輸囊泡有網格蛋白囊泡、外被體蛋白(英语:Coat protein)Ⅰ(coat protein、COPI(英语:COPI)囊泡)和 ... Assembly of COPI
Additionally, reticulons may be used to shape coated protein vesicles by interacting with a component of the adaptor protein ... In one example, it was shown that increasing expression of RTN3 keeps transport of proteins from retrograding from the Golgi ... Reticulons have been found to interact with proteins that are involved with vesicular formation and morphogenesis of the ER. ... The family of vertebrate proteins are called reticulons, and all other located eukaryotes are called reticulon-like proteins. ...
... which is involved in vesicular transport. These 3 complexes are identical and have been termed the conserved oligomeric Golgi ( ... 2005). "Towards a proteome-scale map of the human protein-protein interaction network". Nature. 437 (7062): 1173-8. doi:10.1038 ... 1996). "A "double adaptor" method for improved shotgun library construction". Anal. Biochem. 236 (1): 107-13. doi:10.1006/abio. ... 2003). "The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and ...
The active form, ARF*GTP, binds to vesicle coat proteins and adaptors, including coat protein I (COPI) and various ... Activators of cholera toxin and critical components of intracellular vesicular transport processes". The Journal of Biological ... ARF requires assistance from other proteins in order to switch between binding to GTP and GDP. GTPase activating proteins (GAPs ... Arp and Sar proteins: A family of GTP-binding proteins with a structural device for 'front-back' communication". EMBO Reports. ...
... complementary distribution and proposed function as vesicular adapter proteins in early stages of secretion". Neuron. 18 (3): ... Implication in dynein-dependent vesicle transport". J. Biol. Chem. 273 (46): 30065-8. doi:10.1074/jbc.273.46.30065. PMID ... Double C2-like domain-containing protein alpha is a protein that in humans is encoded by the DOC2A gene. There are at least two ... "Protein unc-13 homolog A". UniProt. Sakaguchi G, Orita S, Maeda M, Igarashi H, Takai Y (December 1995). "Molecular cloning of ...
... , like most other Rab11FIP proteins, interacts with Rab11 by serving as an adaptor protein. This leads to downstream ... Rab11FIP5 aids in this sorting process by binding to kinesin II and forming a protein complex to regulate vesicular trafficking ... This process involves the transport of cargo proteins, like endocytosed receptors, to endosome recycling complexes and ... Rab11 family-interacting protein 5 is a protein that in humans is encoded by the RAB11FIP5 gene. RAB11FIP5 has been shown to ...
Transferring to the GSL synthesis site is done with the help of a transport protein known as four phosphate adaptor protein 2 ( ... C1P also has known roles in vesicular trafficking, cell survival, phagocytosis ("cell eating") and macrophage degranulation. ... 2007). "Regulation of secretory transport by protein kinase D-mediated phosphorylation of the ceramide transfer protein". J. ... Sph is also known to interact with protein targets such as the protein kinase H homologue (PKH) and the yeast protein kinase ( ...
The ARF1 protein is localized to the Golgi apparatus and has a central role in intra-Golgi transport. Multiple alternatively ... a family of ADP ribosylation factor-binding proteins related to adaptors and associated with the Golgi complex". J. Cell Biol. ... nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular ... including 6 ARF proteins and 11 ARF-like proteins, constitute a family of the RAS superfamily. The ARF proteins are categorized ...
ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene ... uncouples brefeldin A-induced adaptor protein-1 coat dissociation and membrane tubulation". The Journal of Biological Chemistry ... is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP and is involved in Golgi transport. It ... Brefeldin A-inhibited guanine nucleotide-exchange protein 2 is a protein that in humans is encoded by the ARFGEF2 gene. ...
VSIV G does not follow the same path as most vesicles because transport of the G protein from the ER to the plasma membrane is ... virus-containing vesicles contain more clathrin and clathrin adaptor than conventional vesicles. Virus-containing vesicles ... G protein (G), large protein (L), phosphoprotein, matrix protein (M) and nucleoprotein: The VSIV G protein, aka VSVG, enables ... Vesiculovirus matrix proteins Viral neuronal tracing VSV-EBOV "Vesicular Stomatitis Virus". reviewed and published by WikiVet, ...
Hausser A, Storz P, Märtens S, Link G, Toker A, Pfizenmaier K (Sep 2005). "Protein kinase D regulates vesicular transport by ... with small GTP binding proteins Arf1 and Rab11, or a Golgi adaptor protein ACBD3. PI4KB can be phosphorylated by the protein ... The N-terminal region contains a physiologically important binding site for a Golgi adaptor protein ACBD3, but is likely ... which promotes the interaction with 14-3-3 proteins and stabilization of the protein in its active conformation. In cytoplasm ...
"Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins". Proc ... These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in ... Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A, is required for both MVB ... Charged multivesicular body protein 5 is a protein that in humans is encoded by the CHMP5 gene. CHMP5 belongs to the chromatin- ...
Membrane protein: vesicular transport proteins (TC 1F). Synaptic vesicle. SNARE. Q-SNARE. *SNAP25 ... Adaptor molecules are responsible for self-assembly and recruitment. Two examples of adaptor proteins are AP180[3] and epsin.[4 ... Coat-proteins, like clathrin, are used to build small vesicles in order to transport molecules within cells. The endocytosis ... In a cell, a triskelion floating in the cytoplasm binds to an adaptor protein, linking one of its feet to the membrane at a ...
Vesicular transport adaptor proteins are proteins involved in forming complexes that function in the trafficking of molecules ... Epsin and AP180 in the ANTH domain are other adaptor proteins that have been reviewed. An important transport complex, COPII, ... Most of the adaptor proteins are heterotetramers. In the AP complexes, there are two large proteins (∼100 kD) and two smaller ... in the cargo proteins that interact with the adaptor proteins can be very short. For example, one well-know example is the ...
Soluble N-ethylmaleimide-sensitive-factor Attachment protein Receptors (SNAREs) participate in the specificity of membrane ... 0/Adaptor Protein Complex 2; 0/Adaptor Proteins, Vesicular Transport; 0/Macromolecular Substances; 0/Protozoan Proteins; 0/R- ... Adaptor Protein Complex 2 / metabolism. Adaptor Proteins, Vesicular Transport / metabolism*. Animals. Cell Membrane / ... Protein Transport / physiology. Protozoan Proteins / metabolism. R-SNARE Proteins / metabolism*. Recombinant Fusion Proteins / ...
Subtilase cytotoxin (SubAB) is transported in a retrograde manner through the endosome to the Golgi and then to the endoplasmic ... Toxin trafficking studies provide valuable information about endogenous pathways of intracellular transport. ... Adaptor Proteins, Vesicular Transport / genetics * Adaptor Proteins, Vesicular Transport / metabolism* * Animals * Blotting, ... Binding immunoglobin protein/Glucose-Regulated Protein of 78 kDa). To identify the SubAB Golgi trafficking route, we have used ...
0/ATG14 protein, human; 0/Adaptor Proteins, Vesicular Transport; 0/Apoptosis Regulatory Proteins; 0/BECN1 protein, human; 0/ ... Adaptor Proteins, Vesicular Transport / chemistry*. Amino Acid Motifs. Amino Acid Sequence. Apoptosis Regulatory Proteins / ... Membrane Proteins; 0/Tumor Suppressor Proteins; 0/UVRAG protein, human; EC 2.7.1.137/Class III Phosphatidylinositol 3-Kinases ... Protein expression and purification The CC domain of rat Beclin 1 (residues 174-266) was cloned as a His6-tagged protein in a ...
Adaptor Proteins, Vesicular Transport / genetics * Adaptor Proteins, Vesicular Transport / metabolism* * Amino Acid Transport ... Thus, in addition to its regulatory role in homotypic vacuolar fusion and vacuole protein sorting within the HOPS complex, Vam6 ... Protein Transport * Protein-Serine-Threonine Kinases / antagonists & inhibitors * Protein-Serine-Threonine Kinases / metabolism ...
They control the vesicular transport of proteins in different trafficking pathways (PubMed:10066790, PubMed:10436028). AP-4 ... Component of the adaptor protein complex 4 (AP-4). Adaptor protein complexes are vesicle coat components involved both in ... adaptor related protein complex 4 subunit beta 1. Enable Javascript to view the expand/collapse boxes.. Open All Close All ... This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans- ...
ADP-Ribosylation Factors/immunology/*metabolism, Adaptor Proteins; Vesicular Transport/immunology/*metabolism, Amino Acid ... Protein Binding/physiology, Protein Structure; Tertiary/physiology, Protein Transport/drug effects/immunology, Receptors; ... Stabilin-1 localizes to endosomes and the trans-Golgi network in human macrophages and interacts with GGA adaptors.. ... Motifs/immunology, Antigens; CD/immunology, Brefeldin A/pharmacology, Carrier Proteins/immunology/metabolism, Cell Adhesion ...
Adaptor Proteins, Vesicular Transport/genetics/physiology. *Animals. *Cytoprotection/genetics/immunology. *Female. *Liver ... and TIR-domain-containing adaptor protein inducing IFNbeta (TRIF) are regarded as the key signaling adaptor proteins for TLRs. ... and TIR-domain-containing adaptor protein inducing IFNbeta (TRIF) are regarded as the key signaling adaptor proteins for TLRs. ...
Adaptor Proteins, Vesicular Transport/deficiency/immunology. *Animals. *Cells, Cultured. *Immunity, Innate. *Macrophages/ ... the only known adapter protein for TLR3.We then focused on TLR4, the other Toll-like receptor that signals through TRIF.The ... the only known adapter protein for TLR3.We then focused on TLR4, the other Toll-like receptor that signals through TRIF.The ... the only known adapter protein for TLR3. Unexpectedly, bioluminescence imaging showed that mice lacking TRIF are more ...
Clathrin adaptor proteins, also known as adaptins, are vesicular transport adaptor proteins associated with clathrin. These ... The two major types of clathrin adaptor complexes are the heterotetrameric vesicular transport adaptor proteins (AP1-5), and ... Touz MC, Kulakova L, Nash TE (July 2004). "Adaptor protein complex 1 mediates the transport of lysosomal proteins from a Golgi- ... adaptors. Adaptins are distantly related to the other main type of vesicular transport proteins, the coatomer subunits, sharing ...
... separates chromophobe renal cell carcinoma from oncocytoma and identifies vesicular transport and cell junction proteins as ... adaptor protein complex AP-1 mu-2 subunit. adaptor related protein complex 1 mu 2 subunit. clathrin assembly protein complex 1 ... clathrin-associated adaptor medium chain mu2. golgi adaptor AP-1 47 kDa protein. golgi adaptor HA1/AP1 adaptin mu-2 subunit. mu ... AP1M2 adaptor related protein complex 1 subunit mu 2 [Homo sapiens] AP1M2 adaptor related protein complex 1 subunit mu 2 [Homo ...
They control the vesicular transport of proteins in different trafficking pathways (PubMed:10066790, PubMed:10436028). AP-4 ... Component of the adaptor protein complex 4 (AP-4). Adaptor protein complexes are vesicle coat components involved both in ... The encoded protein is a large subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin- ... These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory ...
Here, we describe a new pathway for maintaining protein homeostasis mediated by the proteasome shuttle factor UBQLN2. The 26S ... Clearance of misfolded and aggregated proteins is central to cell survival. ... Adaptor Proteins, Vesicular Transport / metabolism *. Actions. * Search in PubMed * Search in MeSH ... Inhibition of Retrograde Transport Modulates Misfolded Protein Accumulation and Clearance in Motoneuron Diseases R Cristofani ...
1986) Oligomerization is essential for transport of vesicular stomatitis viral glycoprotein to the cell surface. Cell 46:929- ... adaptor protein. CSLM. confocal laser scanning microscope. G. vesicular stomatitis virus G protein. HC. heavy chain. LC. light ... These regions contain a number of proteins, including the adaptor proteins (APs)1 and the heavy and light chains of clathrin ... The adaptor proteins have been shown to bind to the clathrin coat of the coated vesicle (Pearse and Crowther, 1987). To check ...
Pearse BMF, Robinson MS (1990) Clathrin, adaptors, and sorting. Annu Rev Cell Biol 6: 151-171PubMedCrossRefGoogle Scholar ... β-COP, a Coat Protein of Nonclathrin-Coated Vesicles of the Golgi Complex, is Involved in Transport of Vesicular Stomatitis ... 1993) β-COP, a Coat Protein of Nonclathrin-Coated Vesicles of the Golgi Complex, is Involved in Transport of Vesicular ... Coat Protein Golgi Complex Coated Vesicle Vesicular Structure Membrane Traffic These keywords were added by machine and not by ...
... a mammalian master molecule in vesicular transport and protein sorting, suppresses the degradation of ESCRT proteins signal ... is targeted to endosomes independently of signal-transducing adaptor molecule (STAM) and the complex formation with STAM ... BASP1; Brain acid soluble protein 1 (BASP1 protein). pfam07223. Location:525 → 769. DUF1421; Protein of unknown function ( ... BASP1; Brain acid soluble protein 1 (BASP1 protein). pfam07223. Location:525 → 743. DUF1421; Protein of unknown function ( ...
Protein Coding), Adaptor Related Protein Complex 4 Mu 1 Subunit, including: function, proteins, disorders, pathways, orthologs ... They control the vesicular transport of proteins in different trafficking pathways (PubMed:10436028, PubMed:11139587, PubMed: ... Component of the adaptor protein complex 4 (AP-4). Adaptor protein complexes are vesicle coat components involved both in ... Component of the adaptor protein complex 4 (AP-4). Adaptor protein complexes are vesicle coat components involved both in ...
Adaptor protein may refer to: Signal transducing adaptor protein Vesicular transport adaptor protein Clathrin adaptor protein, ...
... and movement of transmembrane proteins between different membranes in a cell is performed by the cells vesicular transport ... The resolution of the structure of the AP2 clatherin adapter complex in an open, liganded form (Jackson et al.) follows on from ... provided molecular details of the alternating access model of transport used by secondary active membrane transport proteins to ... Askarieh et al. report the structure of a key protein responsible for forming the large assemblies involved in the formation of ...
AP2 adaptor complex Vesicular transport adaptor protein Umasankar PK, Ma L, Thieman JR, Jha A, Doray B, Watkins SC, Traub LM ( ... The μ homology domain of muniscins has been reported to have evolved from part of an ancient cargo adaptor protein complex ... The muniscin protein family was initially defined in 2009 as proteins having 2 homologous domains that are involved in clathrin ... The muniscins are early arriving proteins involved in CME. FCHO proteins are required for CME, but do not appear to be required ...
2013) Recruitment of the Mint3 adaptor is necessary for export of the amyloid precursor protein (APP) from the Golgi complex. J ... retention of TRAF3 at the ER-to-Golgi vesicular transport system blunted the ability of TRAF3 to interact with MAVS upon viral ... Munc18-1-interacting protein 3 (Mint3), also known as amyloid-β A4 precursor protein-binding family A member 3 (APBA3), is a ... 2006) SHP-2 phosphatase negatively regulates the TRIF adaptor protein-dependent type I interferon and proinflammatory cytokine ...
... introduce thermotherapeutic and immunotherapeutic effects through nonapoptotic cell death and generation of heat shock protein ... Vesicular transport then occurs to carry tyrosinase and its related proteins (TRPs) from trans-Golgi network to melanosomal ... In this process a number of transporters, such as small GTP-binding protein, adaptor proteins, and PI3-kinase, play important ... to which tyrosinase was transported from the trans-Golgi network by vesicular transport [26]. ...
Differential regulation of clathrin and its adaptor proteins during membrane recruitment for endocytosis. Wang, C., Hu, T., Yan ... Using the split-ubiquitin yeast two-hybrid system to test protein-protein interactions of transmembrane proteins. Bashline, L ... Cellulose synthase interactive protein 1 (CSI1) links microtubules and cellulose synthase complexes. Li, S., Lei, L., ... The TWD40-2 protein and the AP2 complex cooperate in the clathrin-mediated endocytosis of cellulose synthase to regulate ...
... such as the EHD protein family Rab proteins SNAREs Vesicular transport adaptor proteins e.g. Sorting nexins Synaptotagmin TRAPP ... Membrane transport protein Wikipedia:MeSH_D12.776#MeSH_D12.776.543.990_---_vesicular_transport_proteins Vesicular Transport ... A vesicular transport protein, or vesicular transporter, is a membrane protein that regulates or facilitates the movement of ... retrograde transport ; Golgi -- Endoplasmic reticulum COP 2 (Cytosolic coat protein complex ) : anterograde transport ; RER ...
Adaptor Proteins, Vesicular Transport/chemistry. *Adaptor Proteins, Vesicular Transport/genetics*. *Adaptor Proteins, Vesicular ... Ap1b1 is a subunit of the adaptor complex AP-1, which has been implicated in the targeting of basolateral membrane proteins. In ... we describe auditory/vestibular mutants isolated from forward genetic screens in zebrafish with lesions in the adaptor protein ... we examined the localization of basolateral membrane proteins in hair cells. We observed that the Na+/K+-ATPase pump (NKA) was ...
  • The ER stress response is subsequently transmitted to mitochondria and initiates a cascade of cellular events including: rise in cytosolic calcium levels, activation of VAD-FMK-binding proteases, dysregulation of mitochondrial development and suppression of protein translation machinery. (icgeb.org)
  • Rap1 (Ras-proximate-1 or Ras-related protein 1) is a small GTPase, which are small cytosolic proteins that act like cellular switches and are vital for effective signal transduction. (wikipedia.org)
  • The N-terminal, loop region and C-terminal are all on the cytosol side of the ER membrane and they are able to interact with other cytosolic proteins. (wikipedia.org)
  • It works as both a direct cytosolic DNA sensor (CDS) and an adaptor protein in Type I interferon signaling through different molecular mechanisms. (wikipedia.org)
  • In this study, we demonstrate, through detailed analysis of NLRP3 activation in macrophages deficient in key downstream TLR signaling molecules, that MyD88 is required for an immediate early phase, whereas Toll/IL-1R domain-containing adapter inducing IFN-beta is required for a subsequent intermediate phase of posttranslational NLRP3 activation. (umassmed.edu)
  • Mutations in AHI1, which encodes a cilium-localized protein, have been shown to cause a form of Joubert syndrome that is highly penetrant for retinal degeneration. (nih.gov)
  • DNA binding is a feature of many proteins and is integral for the successful maintenance of cellular function. (esrf.eu)
  • The resulting sequence of Y RS L E conforms to a tyrosine-based consensus motif (YxxL) for sorting of integral membrane proteins into specific cellular compartments. (jneurosci.org)
  • One peculiarity of the MNT-1 cellular model is the expression of Pmel17, a melanosome-specific protein (and the product of murine silver locus, also named GP100) that transits in these early sorting MVEs. (biologists.org)
  • In order to gain deeper understanding of their roles in diverse cellular functions at the molecular level, the next step should be perturbation of protein activities at a precise subcellular location and timing. (jove.com)
  • Solar-simulated UV radiation up-regulated expression of genes involved in cellular stress and inflammation, and down-regulated genes involved in chemotaxis, vesicular transport and RNA processing. (csic.es)
  • Alternation in the glycolipid transfer protein expression causes changes in the cellular lipidome. (nih.gov)
  • Ubiquitination induced down-regulation of cell surface proteins by internalization and lysosomal targeting plays a fundamental role in cell physiology and pathogenesis of diseases. (elsevier.com)
  • The lysosomal trafficking of sphingolipid activator proteins (SAPs) is mediated by sortilin. (nih.gov)
  • However, the lysosomes of I-cell disease (ICD) patients, a condition resulting from a mutation in the phosphotransferase that adds mannose 6-phosphate to hydrolases, have near normal levels of several lysosomal proteins, including the sphingolipid activator proteins (SAPs), GM2AP and prosaposin. (nih.gov)
  • Adaptins recognise and bind to clathrin through their hinge region (clathrin box), and recruit accessory proteins that modulate AP function through their C-terminal ear (appendage) domains. (wikipedia.org)
  • Elucidating the consequences of tissue-specific protein expression is a key challenge towards understanding how proteins modulate phenotypic variation during differentiation and conduct cell-type specific functions in various (patho-)physiological settings. (biomedcentral.com)
  • BM29 will become the new home for our Protein Solution Scattering beamline, benefiting from a wide wavelength range and a close interaction with both ID29 and ID30. (esrf.eu)
  • Using dominant negative manner with ERM1 domain to disrupt the BPAG1n4-dynactin interaction, the impaired retrograde transport in cultured DRG neurons (dorsal root ganglia) recapitulates the transport phenotype observed in the BPAG1 null neurons. (stanford.edu)
  • Although serine-phosphorylated BACE was distributed throughout the cell, interaction of GGA1 with the wild-type protein occurred in juxtanuclear compartments. (biologists.org)
  • Hinge and ear domains are important to the interaction with coat proteins and regulatory/accessory proteins. (bioscirep.org)
  • Mutation of a conserved HPD motif within the J domain of auxilin prevented binding to Hsc70 in vitro and injecting this mutant protein inhibited CCV uncoating in vivo, demonstrating that the interaction of auxilin with Hsc70 is critical for CCV uncoating. (mblwhoilibrary.org)