The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.
A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
A class of proteins involved in the transport of molecules via TRANSPORT VESICLES. They perform functions such as binding to the cell membrane, capturing cargo molecules and promoting the assembly of CLATHRIN. The majority of adaptor proteins exist as multi-subunit complexes, however monomeric varieties have also been found.
A cytokine receptor that acts through the formation of oligomeric complexes of itself with a variety of CYTOKINE RECEPTORS.
A signal transducing adaptor protein that links extracellular signals to the MAP KINASE SIGNALING SYSTEM. Grb2 associates with activated EPIDERMAL GROWTH FACTOR RECEPTOR and PLATELET-DERIVED GROWTH FACTOR RECEPTORS via its SH2 DOMAIN. It also binds to and translocates the SON OF SEVENLESS PROTEINS through its SH3 DOMAINS to activate PROTO-ONCOGENE PROTEIN P21(RAS).
A family of signaling adaptor proteins that contain SRC HOMOLOGY DOMAINS. Many members of this family are involved in transmitting signals from CELL SURFACE RECEPTORS to MITOGEN-ACTIVATED PROTEIN KINASES.
An adaptor protein complex primarily involved in the formation of clathrin-related endocytotic vesicles (ENDOSOMES) at the CELL MEMBRANE.
An adaptor protein complex found primarily on perinuclear compartments.
Cell surface receptors that are specific for INTERLEUKIN-6. They are present on T-LYMPHOCYTES, mitogen-activated B-LYMPHOCYTES, and peripheral MONOCYTES. The receptors are heterodimers of the INTERLEUKIN-6 RECEPTOR ALPHA SUBUNIT and the CYTOKINE RECEPTOR GP130.
A clathrin adaptor protein complex primarily involved in clathrin-related transport at the TRANS-GOLGI NETWORK.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
The transfer of bacterial DNA by phages from an infected bacterium to another bacterium. This also refers to the transfer of genes into eukaryotic cells by viruses. This naturally occurring process is routinely employed as a GENE TRANSFER TECHNIQUE.
A binding partner for several RECEPTOR PROTEIN-TYROSINE KINASES, including INSULIN RECEPTOR and INSULIN-LIKE GROWTH FACTOR RECEPTOR. It contains a C-terminal SH2 DOMAIN and mediates various SIGNAL TRANSDUCTION pathways.
Established cell cultures that have the potential to propagate indefinitely.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A non-essential amino acid. In animals it is synthesized from PHENYLALANINE. It is also the precursor of EPINEPHRINE; THYROID HORMONES; and melanin.
Regions of AMINO ACID SEQUENCE similarity in the SRC-FAMILY TYROSINE KINASES that fold into specific functional tertiary structures. The SH1 domain is a CATALYTIC DOMAIN. SH2 and SH3 domains are protein interaction domains. SH2 usually binds PHOSPHOTYROSINE-containing proteins and SH3 interacts with CYTOSKELETAL PROTEINS.
Cell surface receptors with specificity for ONCOSTATIN M. Two subtypes of receptors have been identified and are defined by their subunit composition.
Cell surface receptors formed from the dimerization of LIF RECEPTOR ALPHA SUBUNIT with CYTOKINE RECEPTOR GP130. Although originally described as receptors for LEUKEMIA INHIBITORY FACTOR these receptors also bind the closely-related protein ONCOSTATIN M and are referred to as both LIF receptors and type I oncostatin M receptors.
A family of large adaptin protein subunits of approximately 100 kDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 2.
Cell surface proteins that bind cytokines and trigger intracellular changes influencing the behavior of cells.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.
A receptor subunit that combines with CYTOKINE RECEPTOR GP130 to form the dual specificity receptor for LEUKEMIA INHIBITORY FACTOR and ONCOSTATIN M. The subunit is also a component of the CILIARY NEUROTROPHIC FACTOR RECEPTOR. Both membrane-bound and secreted isoforms of the receptor subunit exist due to ALTERNATIVE SPLICING of its mRNA. The secreted isoform is believed to act as an inhibitory receptor, while the membrane-bound form is a signaling receptor.
Cell surface proteins that bind interleukins and trigger intracellular changes influencing the behavior of cells.
A family of large adaptin protein complex subunits of approximately 90-130 kDa in size.
Glycoproteins found on the membrane or surface of cells.
Differentiation antigens residing on mammalian leukocytes. CD stands for cluster of differentiation, which refers to groups of monoclonal antibodies that show similar reactivity with certain subpopulations of antigens of a particular lineage or differentiation stage. The subpopulations of antigens are also known by the same CD designation.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A family of medium adaptin protein subunits of approximately 45 KDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 3 and ADAPTOR PROTEIN COMPLEX 4.
Signal transducing adaptor proteins that contain SRC HOMOLOGY DOMAINS and play a role in CYTOSKELETON reorganization. c-crk protein is closely related to ONCOGENE PROTEIN V-CRK and includes several alternatively spliced isoforms.
A cytokine that stimulates the growth and differentiation of B-LYMPHOCYTES and is also a growth factor for HYBRIDOMAS and plasmacytomas. It is produced by many different cells including T-LYMPHOCYTES; MONOCYTES; and FIBROBLASTS.
An INTERLEUKIN-6 related cytokine that exhibits pleiotrophic effects on many physiological systems that involve cell proliferation, differentiation, and survival. Leukemia inhibitory factor binds to and acts through the lif receptor.
A set of protein subcomplexes involved in PROTEIN SORTING of UBIQUITINATED PROTEINS into intraluminal vesicles of MULTIVESICULAR BODIES and in membrane scission during formation of intraluminal vesicles, during the final step of CYTOKINESIS, and during the budding of enveloped viruses. The ESCRT machinery is comprised of the protein products of Class E vacuolar protein sorting genes.
Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
An adaptor protein complex involved in transport of molecules between the TRANS-GOLGI NETWORK and the endosomal-lysosomal system.
Transport proteins that carry specific substances in the blood or across cell membranes.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.
A family of large adaptin protein subunits of approximately 90 KDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 1.
The phenomenon by which a temperate phage incorporates itself into the DNA of a bacterial host, establishing a kind of symbiotic relation between PROPHAGE and bacterium which results in the perpetuation of the prophage in all the descendants of the bacterium. Upon induction (VIRUS ACTIVATION) by various agents, such as ultraviolet radiation, the phage is released, which then becomes virulent and lyses the bacterium.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Proteins prepared by recombinant DNA technology.
The main structural coat protein of COATED VESICLES which play a key role in the intracellular transport between membranous organelles. Each molecule of clathrin consists of three light chains (CLATHRIN LIGHT CHAINS) and three heavy chains (CLATHRIN HEAVY CHAINS) that form a structure called a triskelion. Clathrin also interacts with cytoskeletal proteins.
The subunits that make up the large, medium and small chains of adaptor proteins.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Endogenous or exogenous substances which inhibit the normal growth of human and animal cells or micro-organisms, as distinguished from those affecting plant growth (= PLANT GROWTH REGULATORS).
A signal transducer and activator of transcription that mediates cellular responses to INTERLEUKIN-6 family members. STAT3 is constitutively activated in a variety of TUMORS and is a major downstream transducer for the CYTOKINE RECEPTOR GP130.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A family of large adaptin protein subunits of approximately 130-kDa in size. They have been primarily found as components of ADAPTOR PROTEIN COMPLEX 3.
An intracellular signaling adaptor protein that plays a role in TOLL-LIKE RECEPTOR and INTERLEUKIN 1 RECEPTORS signal transduction. It forms a signaling complex with the activated cell surface receptors and members of the IRAK KINASES.
A Janus kinase subtype that is involved in signaling from a broad variety of CYTOKINE RECEPTORS.
Cell surface proteins that bind signalling molecules external to the cell with high affinity and convert this extracellular event into one or more intracellular signals that alter the behavior of the target cell (From Alberts, Molecular Biology of the Cell, 2nd ed, pp693-5). Cell surface receptors, unlike enzymes, do not chemically alter their ligands.
A death domain receptor signaling adaptor protein that plays a role in signaling the activation of INITIATOR CASPASES such as CASPASE 2. It contains a death domain that is specific for RIP SERINE-THEONINE KINASES and a caspase-binding domain that binds to and activates CASPASES such as CASPASE 2.
A cytokine with both pro- and anti-inflammatory actions that depend upon the cellular microenvironment. Oncostatin M is a 28 kDa monomeric glycoprotein that is similar in structure to LEUKEMIA INHIBITORY FACTOR. Its name derives from the the observation that it inhibited the growth of tumor cells and augmented the growth of normal fibroblasts.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Proteins and peptides that are involved in SIGNAL TRANSDUCTION within the cell. Included here are peptides and proteins that regulate the activity of TRANSCRIPTION FACTORS and cellular processes in response to signals from CELL SURFACE RECEPTORS. Intracellular signaling peptide and proteins may be part of an enzymatic signaling cascade or act through binding to and modifying the action of other signaling factors.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.
Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.
Cellular uptake of extracellular materials within membrane-limited vacuoles or microvesicles. ENDOSOMES play a central role in endocytosis.
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
Regulatory proteins that act as molecular switches. They control a wide range of biological processes including: receptor signaling, intracellular signal transduction pathways, and protein synthesis. Their activity is regulated by factors that control their ability to bind to and hydrolyze GTP to GDP. EC 3.6.1.-.
CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
The rate dynamics in chemical or physical systems.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
A SH2 DOMAIN-containing protein that mediates SIGNAL TRANSDUCTION pathways from multiple CELL SURFACE RECEPTORS, including the EPHB1 RECEPTOR. It interacts with FOCAL ADHESION KINASE and is involved in CELL MIGRATION.
Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
A CELL LINE derived from human T-CELL LEUKEMIA and used to determine the mechanism of differential susceptibility to anti-cancer drugs and radiation.
Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.
Viruses whose host is Escherichia coli.
An amino acid that occurs in endogenous proteins. Tyrosine phosphorylation and dephosphorylation plays a role in cellular signal transduction and possibly in cell growth control and carcinogenesis.
Crk-associated substrate was originally identified as a highly phosphorylated 130 kDa protein that associates with ONCOGENE PROTEIN CRK and ONCOGENE PROTEIN SRC. It is a signal transducing adaptor protein that undergoes tyrosine PHOSPHORYLATION in signaling pathways that regulate CELL MIGRATION and CELL PROLIFERATION.
A family of small adaptin protein complex subunits of approximately 19 KDa in size.
Vesicles formed when cell-membrane coated pits (COATED PITS, CELL-MEMBRANE) invaginate and pinch off. The outer surface of these vesicles is covered with a lattice-like network of the protein CLATHRIN. Shortly after formation, however, the clathrin coat is removed and the vesicles are referred to as ENDOSOMES.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
The aggregation of soluble ANTIGENS with ANTIBODIES, alone or with antibody binding factors such as ANTI-ANTIBODIES or STAPHYLOCOCCAL PROTEIN A, into complexes large enough to fall out of solution.
Proteins coded by oncogenes. They include proteins resulting from the fusion of an oncogene and another gene (ONCOGENE PROTEINS, FUSION).
Major constituent of the cytoskeleton found in the cytoplasm of eukaryotic cells. They form a flexible framework for the cell, provide attachment points for organelles and formed bodies, and make communication between parts of the cell possible.
Proto-oncogene proteins that negatively regulate RECEPTOR PROTEIN-TYROSINE KINASE signaling. It is a UBIQUITIN-PROTEIN LIGASE and the cellular homologue of ONCOGENE PROTEIN V-CBL.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.
A cell line generated from human embryonic kidney cells that were transformed with human adenovirus type 5.
Cell surface receptors that are specific for INTERLEUKIN-1. Included under this heading are signaling receptors, non-signaling receptors and accessory proteins required for receptor signaling. Signaling from interleukin-1 receptors occurs via interaction with SIGNAL TRANSDUCING ADAPTOR PROTEINS such as MYELOID DIFFERENTIATION FACTOR 88.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Viruses whose hosts are bacterial cells.
A subclass of clathrin assembly proteins that occur as monomers.
A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.
Soluble protein factors generated by activated lymphocytes that affect other cells, primarily those involved in cellular immunity.
Molecules on the surface of T-lymphocytes that recognize and combine with antigens. The receptors are non-covalently associated with a complex of several polypeptides collectively called CD3 antigens (ANTIGENS, CD3). Recognition of foreign antigen and the major histocompatibility complex is accomplished by a single heterodimeric antigen-receptor structure, composed of either alpha-beta (RECEPTORS, ANTIGEN, T-CELL, ALPHA-BETA) or gamma-delta (RECEPTORS, ANTIGEN, T-CELL, GAMMA-DELTA) chains.
DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.
A class of RAS GUANINE NUCLEOTIDE EXCHANGE FACTORS that are genetically related to the Son of Sevenless gene from DROSOPHILA. Sevenless refers to genetic mutations in DROSOPHILA that cause loss of the R7 photoreceptor which is required to see UV light.
A family of intracellular signaling adaptor proteins that contain caspase activation and recruitment domains. Proteins that contain this domain play a role in APOPTOSIS-related signal transduction by associating with other CARD domain-containing members and in activating INITIATOR CASPASES that contain CARD domains within their N-terminal pro-domain region.
A temperate inducible phage and type species of the genus lambda-like viruses, in the family SIPHOVIRIDAE. Its natural host is E. coli K12. Its VIRION contains linear double-stranded DNA with single-stranded 12-base 5' sticky ends. The DNA circularizes on infection.
Cytoplasmic vesicles formed when COATED VESICLES shed their CLATHRIN coat. Endosomes internalize macromolecules bound by receptors on the cell surface.
A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
A superfamily of PROTEIN-SERINE-THREONINE KINASES that are activated by diverse stimuli via protein kinase cascades. They are the final components of the cascades, activated by phosphorylation by MITOGEN-ACTIVATED PROTEIN KINASE KINASES, which in turn are activated by mitogen-activated protein kinase kinase kinases (MAP KINASE KINASE KINASES).
A phosphoinositide phospholipase C subtype that is primarily regulated by PROTEIN-TYROSINE KINASES. It is structurally related to PHOSPHOLIPASE C DELTA with the addition of SRC HOMOLOGY DOMAINS and pleckstrin homology domains located between two halves of the CATALYTIC DOMAIN.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A network of membrane compartments, located at the cytoplasmic side of the GOLGI APPARATUS, where proteins and lipids are sorted for transport to various locations in the cell or cell membrane.
Viruses whose host is Salmonella. A frequently encountered Salmonella phage is BACTERIOPHAGE P22.
A family of pattern recognition receptors characterized by an extracellular leucine-rich domain and a cytoplasmic domain that share homology with the INTERLEUKIN 1 RECEPTOR and the DROSOPHILA toll protein. Following pathogen recognition, toll-like receptors recruit and activate a variety of SIGNAL TRANSDUCING ADAPTOR PROTEINS.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
Phosphotransferases that catalyzes the conversion of 1-phosphatidylinositol to 1-phosphatidylinositol 3-phosphate. Many members of this enzyme class are involved in RECEPTOR MEDIATED SIGNAL TRANSDUCTION and regulation of vesicular transport with the cell. Phosphatidylinositol 3-Kinases have been classified both according to their substrate specificity and their mode of action within the cell.
A pattern recognition receptor that interacts with LYMPHOCYTE ANTIGEN 96 and LIPOPOLYSACCHARIDES. It mediates cellular responses to GRAM-NEGATIVE BACTERIA.
Paxillin is a signal transducing adaptor protein that localizes to FOCAL ADHESIONS via its four LIM domains. It undergoes PHOSPHORYLATION in response to integrin-mediated CELL ADHESION, and interacts with a variety of proteins including VINCULIN; FOCAL ADHESION KINASE; PROTO-ONCOGENE PROTEIN PP60(C-SRC); and PROTO-ONCOGENE PROTEIN C-CRK.
A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
A signal-transducing adaptor protein that associates with TNF RECEPTOR complexes. It contains a death effector domain that can interact with death effector domains found on INITIATOR CASPASES such as CASPASE 8 and CASPASE 10. Activation of CASPASES via interaction with this protein plays a role in the signaling cascade that leads to APOPTOSIS.
Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
Cell surface molecules on cells of the immune system that specifically bind surface molecules or messenger molecules and trigger changes in the behavior of cells. Although these receptors were first identified in the immune system, many have important functions elsewhere.
Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
Proteins found in any species of bacterium.
Protein modules with conserved ligand-binding surfaces which mediate specific interaction functions in SIGNAL TRANSDUCTION PATHWAYS and the specific BINDING SITES of their cognate protein LIGANDS.
A molecule that binds to another molecule, used especially to refer to a small molecule that binds specifically to a larger molecule, e.g., an antigen binding to an antibody, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme. Ligands are also molecules that donate or accept a pair of electrons to form a coordinate covalent bond with the central metal atom of a coordination complex. (From Dorland, 27th ed)
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
Specialized regions of the cell membrane composed of pits coated with a bristle covering made of the protein CLATHRIN. These pits are the entry route for macromolecules bound by cell surface receptors. The pits are then internalized into the cytoplasm to form the COATED VESICLES.
Membrane-associated tyrosine-specific kinases encoded by the c-src genes. They have an important role in cellular growth control. Truncation of carboxy-terminal residues in pp60(c-src) leads to PP60(V-SRC) which has the ability to transform cells. This kinase pp60 c-src should not be confused with csk, also known as c-src kinase.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
An intracellular signaling system involving the MAP kinase cascades (three-membered protein kinase cascades). Various upstream activators, which act in response to extracellular stimuli, trigger the cascades by activating the first member of a cascade, MAP KINASE KINASE KINASES; (MAPKKKs). Activated MAPKKKs phosphorylate MITOGEN-ACTIVATED PROTEIN KINASE KINASES which in turn phosphorylate the MITOGEN-ACTIVATED PROTEIN KINASES; (MAPKs). The MAPKs then act on various downstream targets to affect gene expression. In mammals, there are several distinct MAP kinase pathways including the ERK (extracellular signal-regulated kinase) pathway, the SAPK/JNK (stress-activated protein kinase/c-jun kinase) pathway, and the p38 kinase pathway. There is some sharing of components among the pathways depending on which stimulus originates activation of the cascade.
Morphologic alteration of small B LYMPHOCYTES or T LYMPHOCYTES in culture into large blast-like cells able to synthesize DNA and RNA and to divide mitotically. It is induced by INTERLEUKINS; MITOGENS such as PHYTOHEMAGGLUTININS, and by specific ANTIGENS. It may also occur in vivo as in GRAFT REJECTION.
Adherence of cells to surfaces or to other cells.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Any method used for determining the location of and relative distances between genes on a chromosome.
Elements of limited time intervals, contributing to particular results or situations.
A cell line derived from cultured tumor cells.
A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.
A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
A large class of structurally-related proteins that contain one or more LIM zinc finger domains. Many of the proteins in this class are involved in intracellular signaling processes and mediate their effects via LIM domain protein-protein interactions. The name LIM is derived from the first three proteins in which the motif was found: LIN-11, Isl1 and Mec-3.
A protein tyrosine kinase that is required for T-CELL development and T-CELL ANTIGEN RECEPTOR function.
A highly conserved 76-amino acid peptide universally found in eukaryotic cells that functions as a marker for intracellular PROTEIN TRANSPORT and degradation. Ubiquitin becomes activated through a series of complicated steps and forms an isopeptide bond to lysine residues of specific proteins within the cell. These "ubiquitinated" proteins can be recognized and degraded by proteosomes or be transported to specific compartments within the cell.
IMMUNOGLOBULINS on the surface of B-LYMPHOCYTES. Their MESSENGER RNA contains an EXON with a membrane spanning sequence, producing immunoglobulins in the form of type I transmembrane proteins as opposed to secreted immunoglobulins (ANTIBODIES) which do not contain the membrane spanning segment.
A diverse class of enzymes that interact with UBIQUITIN-CONJUGATING ENZYMES and ubiquitination-specific protein substrates. Each member of this enzyme group has its own distinct specificity for a substrate and ubiquitin-conjugating enzyme. Ubiquitin-protein ligases exist as both monomeric proteins multiprotein complexes.
Different forms of a protein that may be produced from different GENES, or from the same gene by ALTERNATIVE SPLICING.
Any of various enzymatically catalyzed post-translational modifications of PEPTIDES or PROTEINS in the cell of origin. These modifications include carboxylation; HYDROXYLATION; ACETYLATION; PHOSPHORYLATION; METHYLATION; GLYCOSYLATION; ubiquitination; oxidation; proteolysis; and crosslinking and result in changes in molecular weight and electrophoretic motility.
The act of ligating UBIQUITINS to PROTEINS to form ubiquitin-protein ligase complexes to label proteins for transport to the PROTEASOME ENDOPEPTIDASE COMPLEX where proteolysis occurs.
Macromolecular complexes formed from the association of defined protein subunits.
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
A subclass of phospholipases that hydrolyze the phosphoester bond found in the third position of GLYCEROPHOSPHOLIPIDS. Although the singular term phospholipase C specifically refers to an enzyme that catalyzes the hydrolysis of PHOSPHATIDYLCHOLINE (EC 3.1.4.3), it is commonly used in the literature to refer to broad variety of enzymes that specifically catalyze the hydrolysis of PHOSPHATIDYLINOSITOLS.
Computer-assisted processing of electric, ultrasonic, or electronic signals to interpret function and activity.
Lymphoid cells concerned with humoral immunity. They are short-lived cells resembling bursa-derived lymphocytes of birds in their production of immunoglobulin upon appropriate stimulation.
A cell surface receptor involved in regulation of cell growth and differentiation. It is specific for EPIDERMAL GROWTH FACTOR and EGF-related peptides including TRANSFORMING GROWTH FACTOR ALPHA; AMPHIREGULIN; and HEPARIN-BINDING EGF-LIKE GROWTH FACTOR. The binding of ligand to the receptor causes activation of its intrinsic tyrosine kinase activity and rapid internalization of the receptor-ligand complex into the cell.
Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.
The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
A broad category of proteins involved in the formation, transport and dissolution of TRANSPORT VESICLES. They play a role in the intracellular transport of molecules contained within membrane vesicles. Vesicular transport proteins are distinguished from MEMBRANE TRANSPORT PROTEINS, which move molecules across membranes, by the mode in which the molecules are transported.
A negative regulator of the CELL CYCLE that undergoes PHOSPHORYLATION by CYCLIN-DEPENDENT KINASES. RBL2 contains a conserved pocket region that binds E2F4 TRANSCRIPTION FACTOR and E2F5 TRANSCRIPTION FACTOR. RBL2 also interacts with viral ONCOPROTEINS such as POLYOMAVIRUS TUMOR ANTIGENS; ADENOVIRUS E1A PROTEINS; and PAPILLOMAVIRUS E7 PROTEINS.
An enzyme group that specifically dephosphorylates phosphotyrosyl residues in selected proteins. Together with PROTEIN-TYROSINE KINASE, it regulates tyrosine phosphorylation and dephosphorylation in cellular signal transduction and may play a role in cell growth control and carcinogenesis.
A large family of signal-transducing adaptor proteins present in wide variety of eukaryotes. They are PHOSPHOSERINE and PHOSPHOTHREONINE binding proteins involved in important cellular processes including SIGNAL TRANSDUCTION; CELL CYCLE control; APOPTOSIS; and cellular stress responses. 14-3-3 proteins function by interacting with other signal-transducing proteins and effecting changes in their enzymatic activity and subcellular localization. The name 14-3-3 derives from numerical designations used in the original fractionation patterns of the proteins.
A class of cellular receptors that have an intrinsic PROTEIN-TYROSINE KINASE activity.
A signal transducing tumor necrosis factor receptor associated factor that is involved in regulation of NF-KAPPA B signalling and activation of JNK MITOGEN-ACTIVATED PROTEIN KINASES.
The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.
Monomeric subunits of primarily globular ACTIN and found in the cytoplasmic matrix of almost all cells. They are often associated with microtubules and may play a role in cytoskeletal function and/or mediate movement of the cell or the organelles within the cell.
Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
Intracellular signaling adaptor proteins that play a role in the coupling of SYNDECANS to CYTOSKELETAL PROTEINS.
CELL LINE derived from the ovary of the Chinese hamster, Cricetulus griseus (CRICETULUS). The species is a favorite for cytogenetic studies because of its small chromosome number. The cell line has provided model systems for the study of genetic alterations in cultured mammalian cells.
Short, predominantly basic amino acid sequences identified as nuclear import signals for some proteins. These sequences are believed to interact with specific receptors at the NUCLEAR PORE.
The process by which two molecules of the same chemical composition form a condensation product or polymer.
A subtype of non-receptor protein tyrosine phosphatases that contain two SRC HOMOLOGY DOMAINS. Mutations in the gene for protein tyrosine phosphatase, non-receptor type 11 are associated with NOONAN SYNDROME.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
A family of structurally related proteins that were originally discovered for their role in cell-cycle regulation in CAENORHABDITIS ELEGANS. They play important roles in regulation of the CELL CYCLE and as components of UBIQUITIN-PROTEIN LIGASES.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
A pattern recognition receptor that forms heterodimers with other TOLL-LIKE RECEPTORS. It interacts with multiple ligands including PEPTIDOGLYCAN, bacterial LIPOPROTEINS, lipoarabinomannan, and a variety of PORINS.
Proteins that control the CELL DIVISION CYCLE. This family of proteins includes a wide variety of classes, including CYCLIN-DEPENDENT KINASES, mitogen-activated kinases, CYCLINS, and PHOSPHOPROTEIN PHOSPHATASES as well as their putative substrates such as chromatin-associated proteins, CYTOSKELETAL PROTEINS, and TRANSCRIPTION FACTORS.
Regulatory proteins that down-regulate phosphorylated G-protein membrane receptors, including rod and cone photoreceptors and adrenergic receptors.
Src-family kinases that associate with T-CELL ANTIGEN RECEPTOR and phosphorylate a wide variety of intracellular signaling molecules.

Endocytosis: EH domains lend a hand. (1/12958)

A number of proteins that have been implicated in endocytosis feature a conserved protein-interaction module known as an EH domain. The three-dimensional structure of an EH domain has recently been solved, and is likely to presage significant advances in understanding molecular mechanisms of endocytosis.  (+info)

The hematopoietic-specific adaptor protein gads functions in T-cell signaling via interactions with the SLP-76 and LAT adaptors. (2/12958)

BACKGROUND: The adaptor protein Gads is a Grb2-related protein originally identified on the basis of its interaction with the tyrosine-phosphorylated form of the docking protein Shc. Gads protein expression is restricted to hematopoietic tissues and cell lines. Gads contains a Src homology 2 (SH2) domain, which has previously been shown to have a similar binding specificity to that of Grb2. Gads also possesses two SH3 domains, but these have a distinct binding specificity to those of Grb2, as Gads does not bind to known Grb2 SH3 domain targets. Here, we investigated whether Gads is involved in T-cell signaling. RESULTS: We found that Gads is highly expressed in T cells and that the SLP-76 adaptor protein is a major Gads-associated protein in vivo. The constitutive interaction between Gads and SLP-76 was mediated by the carboxy-terminal SH3 domain of Gads and a 20 amino-acid proline-rich region in SLP-76. Gads also coimmunoprecipitated the tyrosine-phosphorylated form of the linker for activated T cells (LAT) adaptor protein following cross-linking of the T-cell receptor; this interaction was mediated by the Gads SH2 domain. Overexpression of Gads and SLP-76 resulted in a synergistic augmentation of T-cell signaling, as measured by activation of nuclear factor of activated T cells (NFAT), and this cooperation required a functional Gads SH2 domain. CONCLUSIONS: These results demonstrate that Gads plays an important role in T-cell signaling via its association with SLP-76 and LAT. Gads may promote cross-talk between the LAT and SLP-76 signaling complexes, thereby coupling membrane-proximal events to downstream signaling pathways.  (+info)

Vac1p coordinates Rab and phosphatidylinositol 3-kinase signaling in Vps45p-dependent vesicle docking/fusion at the endosome. (3/12958)

The vacuolar protein sorting (VPS) pathway of Saccharomyces cerevisiae mediates transport of vacuolar protein precursors from the late Golgi to the lysosome-like vacuole. Sorting of some vacuolar proteins occurs via a prevacuolar endosomal compartment and mutations in a subset of VPS genes (the class D VPS genes) interfere with the Golgi-to-endosome transport step. Several of the encoded proteins, including Pep12p/Vps6p (an endosomal target (t) SNARE) and Vps45p (a Sec1p homologue), bind each other directly [1]. Another of these proteins, Vac1p/Pep7p/Vps19p, associates with Pep12p and binds phosphatidylinositol 3-phosphate (PI(3)P), the product of the Vps34 phosphatidylinositol 3-kinase (PI 3-kinase) [1] [2]. Here, we demonstrate that Vac1p genetically and physically interacts with the activated, GTP-bound form of Vps21p, a Rab GTPase that functions in Golgi-to-endosome transport, and with Vps45p. These results implicate Vac1p as an effector of Vps21p and as a novel Sec1p-family-binding protein. We suggest that Vac1p functions as a multivalent adaptor protein that ensures the high fidelity of vesicle docking and fusion by integrating both phosphoinositide (Vps34p) and GTPase (Vps21p) signals, which are essential for Pep12p- and Vps45p-dependent targeting of Golgi-derived vesicles to the prevacuolar endosome.  (+info)

Concomitant activation of pathways downstream of Grb2 and PI 3-kinase is required for MET-mediated metastasis. (4/12958)

The Met tyrosine kinase - the HGF receptor - induces cell transformation and metastasis when constitutively activated. Met signaling is mediated by phosphorylation of two carboxy-terminal tyrosines which act as docking sites for a number of SH2-containing molecules. These include Grb2 and p85 which couple the receptor, respectively, with Ras and PI 3-kinase. We previously showed that a Met mutant designed to obtain preferential coupling with Grb2 (Met2xGrb2) is permissive for motility, increases transformation, but - surprisingly - is impaired in causing invasion and metastasis. In this work we used Met mutants optimized for binding either p85 alone (Met2xPI3K) or p85 and Grb2 (MetPI3K/Grb2) to evaluate the relative importance of Ras and PI 3-kinase as downstream effectors of Met. Met2xPI3K was competent in eliciting motility, but not transformation, invasion, or metastasis. Conversely, MetP13K/Grb2 induced motility, transformation, invasion and metastasis as efficiently as wild type Met. Furthermore, the expression of constitutively active PI 3-kinase in cells transformed by the Met2xGrb2 mutant, fully rescued their ability to invade and metastasize. These data point to a central role for PI 3-kinase in Met-mediated invasiveness, and indicate that simultaneous activation of Ras and PI 3-kinase is required to unleash the Met metastatic potential.  (+info)

Tyrosine phosphorylation and complex formation of Cbl-b upon T cell receptor stimulation. (5/12958)

Cbl-b, a mammalian homolog of Cbl, consists of an N-terminal region (Cbl-b-N) highly homologous to oncogenic v-Cbl, a Ring finger, and a C-terminal region containing multiple proline-rich stretches and potential tyrosine phosphorylation sites. In the present study, we demonstrate that upon engagement of the T cell receptor (TCR), endogenous Cbl-b becomes rapidly tyrosine-phosphorylated. In heterogeneous COS-1 cells, Cbl-b was phosphorylated on tyrosine residues by both Syk- (Syk/Zap-70) and Src- (Fyn/Lck) family kinases, with Syk kinase inducing the most prominent effect. Syk associates and phosphorylates Cbl-b in Jurkat T cells. A Tyr-316 Cbl-binding site in Syk was required for the association with and for the maximal tyrosine phosphorylation of Cbl-b. Mutation at a loss-of-function site (Gly-298) in Cbl-b-N disrupts its interaction with Syk. Cbl-b constitutively binds Grb2 and becomes associated with Crk-L upon TCR stimulation. The Grb2- and the Crk-L-binding regions were mapped to the C-terminus of Cbl-b. The Crk-L-binding sites were further determined to be Y655DVP and Y709KIP, with the latter being the primary binding site. Taken together, these results implicate that Cbl-b is involved in TCR-mediated intracellular signaling pathways.  (+info)

Polarized distribution of Bcr-Abl in migrating myeloid cells and co-localization of Bcr-Abl and its target proteins. (6/12958)

Bcr-Abl plays a critical role in the pathogenesis of Philadelphia chromosome-positive leukemia. Although a large number of substrates and interacting proteins of Bcr-Abl have been identified, it remains unclear whether Bcr-Abl assembles multi-protein complexes and if it does where these complexes are within cells. We have investigated the localization of Bcr-Abl in 32D myeloid cells attached to the extracellular matrix. We have found that Bcr-Abl displays a polarized distribution, colocalizing with a subset of filamentous actin at trailing portions of migrating 32D cells, and localizes on the cortical F-actin and on vesicle-like structures in resting 32D cells. Deletion of the actin binding domain of Bcr-Abl (Bcr-AbI-AD) dramatically enhances the localization of Bcr-Abl on the vesicle-like structures. These distinct localization patterns of Bcr-Abl and Bcr-Abl-AD enabled us to examine the localization of Bcr-Abl substrate and interacting proteins in relation to Bcr-Abl. We found that a subset of biochemically defined target proteins of Bcr-Abl redistributed and co-localized with Bcr-Abl on F-actin and on vesicle-like structures. The co-localization of signaling proteins with Bcr-Abl at its sites of localization supports the idea that Bcr-Abl forms a multi-protein signaling complex, while the polarized distribution and vesicle-like localization of Bcr-Abl may play a role in leukemogenesis.  (+info)

Growth inhibition of breast cancer cells by Grb2 downregulation is correlated with inactivation of mitogen-activated protein kinase in EGFR, but not in ErbB2, cells. (7/12958)

Increased breast cancer growth has been associated with increased expression of epidermal growth factor receptor (EGFR) and ErbB2 receptor tyrosine kinases (RTKs). Upon activation, RTKs may transmit their oncogenic signals by binding to the growth factor receptor bound protein-2 (Grb2), which in turn binds to SOS and activates the Ras/Raf/MEK/mitogen-activated protein (MAP) kinase pathway. Grb2 is important for the transformation of fibroblasts by EGFR and ErbB2; however, whether Grb2 is also important for the proliferation of breast cancer cells expressing these RTKs is unclear. We have used liposomes to deliver nuclease-resistant antisense oligodeoxynucleotides (oligos) specific for the GRB2 mRNA to breast cancer cells. Grb2 protein downregulation could inhibit breast cancer cell growth; the degree of growth inhibition was dependent upon the activation and/or endogenous levels of the RTKs. Grb2 inhibition led to MAP kinase inactivation in EGFR, but not in ErbB2, breast cancer cells, suggesting that different pathways might be used by EGFR and ErbB2 to regulate breast cancer growth.  (+info)

Socs1 binds to multiple signalling proteins and suppresses steel factor-dependent proliferation. (8/12958)

We have identified Socs1 as a downstream component of the Kit receptor tyrosine kinase signalling pathway. We show that the expression of Socs1 mRNA is rapidly increased in primary bone marrow-derived mast cells following exposure to Steel factor, and Socs1 inducibly binds to the Kit receptor tyrosine kinase via its Src homology 2 (SH2) domain. Previous studies have shown that Socs1 suppresses cytokine-mediated differentiation in M1 cells inhibiting Janus family kinases. In contrast, constitutive expression of Socs1 suppresses the mitogenic potential of Kit while maintaining Steel factor-dependent cell survival signals. Unlike Janus kinases, Socs1 does not inhibit the catalytic activity of the Kit tyrosine kinase. In order to define the mechanism by which Socs1-mediated suppression of Kit-dependent mitogenesis occurs, we demonstrate that Socs1 binds to the signalling proteins Grb-2 and the Rho-family guanine nucleotide exchange factors Vav. We show that Grb2 binds Socs1 via its SH3 domains to putative diproline determinants located in the N-terminus of Socs1, and Socs1 binds to the N-terminal regulatory region of Vav. These data suggest that Socs1 is an inducible switch which modulates proliferative signals in favour of cell survival signals and functions as an adaptor protein in receptor tyrosine kinase signalling pathways.  (+info)

Activation of cytoplasmic tyrosine kinase activity is required for T cell receptor (TCR)-dependent lymphocyte activation (1). Adapter proteins serve as substrates for these kinases and as such may function to couple the TCR with downstream signaling events (2-6). SLP-76 is a hematopoietic cell-specific adapter protein that is phosphorylated rapidly on NH2-terminal tyrosine residues after TCR ligation (3), providing a binding site for the Src homology 2 (SH2) domain of Vav (7). SLP-76 also contains a central proline-rich region that associates constitutively with the SH3 domains of Grb2 (8). In addition, SLP-76 has a COOH-terminal SH2 domain that inducibly associates with SLAP-130 (SLP-76-associated phosphoprotein of 130 kD) and an unidentified 62-kD tyrosine phosphoprotein (5, 8, 9). The ability of SLP-76 to augment TCR-dependent nuclear factor of activated T cells (NFAT) activation when transiently overexpressed in a T cell line is dependent on the presence of each of these domains, suggesting ...
Shop FAS-associated factor ELISA Kit, Recombinant Protein and FAS-associated factor Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Recombinant GRB2-Related Adaptor Protein (GRAP) Protein (Myc-DYKDDDDK Tag). Species: Human. Source: HEK-293 Cells. Order product ABIN2722222.
Shop JNK-interacting protein ELISA Kit, Recombinant Protein and JNK-interacting protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
SLP76 (SH2 domain-containing leukocyte protein of 76 kDa) is a cytosolic adaptor protein which translocates to the plasma mambrane and is involved in multiple signaling pathways in T cells, mast cells, neutrophils and platelets; B cells express its analog SLP65/BLNK (B cell linker protein). SLP76 is phosphorylated by Syk-family and Tec-family tyrosine kinases and couples them to the phosphorylation and activation of PLC-gamma. Via Gads or Grb2, SLP76 also associates with LAT adaptor by involvement of SLP76 proline-rich region. The SH2 domain of SLP76 has been identified as the region involved in binding the serine/threonine kinase HPK1. HPK1 may act as both a positive and a negative regulator by promoting the Jnk-mitogen activated protein kinase (MAPK) pathway and inhibiting the pathway leading to AP-1 activation ...
Severn Biotech, Limited : Protein Linker Conjugates - Electrophoresis Products PBS & Saline Solutions Hybridisation Reagents Biological Buffers & SDS Sodium Azide Solutions General Bio-chemical Products Fingerprinting Chemical Product Forensic Dyes & Chemicals HPLC Laboratory Solvents DNA / RNA Extraction Specialist Pure Water Products Protein Linker Conjugates Peptide Synthesis Reagents Alcohol Sprays Hand Sanitiser Products Customised Services Comet Assay Products Protein Antibody Reagents Scientific Plastics Catalogue Peptides Affinity Purification Materials Cytology Screening Antibodies Specials severn, biotech
Mammalian Nck1 and Nck2 are closely related adaptor proteins that possess three SH3 domains, followed by an SH2 domain, and are implicated in coupling phosphotyrosine signals to polypeptides that regulate the actin cytoskeleton. However, the in vivo functions of Nck1 and Nck2 have not been defined. We have mutated the murine Nck1 and Nck2 genes and incorporated β-galactosidase reporters into the mutant loci. In mouse embryos, the two Nck genes have broad and overlapping expression patterns. They are functionally redundant in the sense that mice deficient for either Nck1 or Nck2 are viable, whereas inactivation of both Nck1 and Nck2 results in profound defects in mesoderm-derived notochord and embryonic lethality at embryonic day 9.5. Fibroblast cell lines derived from Nck1−/− Nck2−/− embryos have defects in cell motility and in the organization of the lamellipodial actin network. These data suggest that the Nck SH2/SH3 adaptors have important functions in the development of mesodermal ...
The adaptor protein Src homology 2 domain-containing leukocyte phosphoprotein of 76 kDa (SLP-76) plays a crucial role in T cell activation by linking antigen receptor (T cell receptor, TCR) signals to downstream pathways ...
This gene encodes the substrate of breast tumor kinase, an Src-type non-receptor tyrosine kinase. The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008 ...
KARAP/DAP12/TYROBP: three names and a multiplicity of biological functions.: The signaling adaptor protein KARAP/DAP12/TYROBP (killer cell activating receptor-a
Article Stap-2 negatively regulates both canonical and noncanonical nf-b activation induced by epstein-barr virus-derived latent membrane protein 1. The signal-transducing adaptor protein 2 (STAP-2) is a recently identified adaptor protein that conta...
DAXX ; BING2 ; DAP6 ; Death domain-associated protein 6 ; Daxx ; hDaxx ; ETS1-associated protein 1 ; EAP1 ; Fas death domain-associated ...
The adhesion and degranulation adaptor protein (ADAP) was initially identified as a molecular adapter that couples T cell receptor (TCR) stimulation to the avidity of integrins governing T cell adhesion. TCR stimulation promotes the formation of a multi-protein complex containing CARMA1, MALT1, and BCL-10, which through the association of ADAP, ultimately activates the NF-kappaB family of transcription factors. More recent experiments have shown that ADAP controls optimal T cell proliferation, cytokine production, and expression of the Bcl-2 family member Bcl-x(L), suggesting that ADAP regulates T cell activation by promoting antigen-dependent T cell-antigen presenting cell (APC) activation. At least three isoforms of ADAP are known to exist ...
The Daxx protein (also known as death domain-associated protein 6) is thought to play a role in apoptosis. Daxx forms a complex with Axin [ (PUBMED:11225842) ]. Daxx is a scaffold protein shown to play diverse roles in transcription and cell cycle regulation. This N-terminal domain folds into a left-handed four-helix bundle (H1, H2, H4, H5) that binds to the N-terminal residues of the tumour-suppressor Rassf1C [ (PUBMED:21134643) ]. ...
HCLS1 antibody [N1N3] (hematopoietic cell-specific Lyn substrate 1) for IP, WB. Anti-HCLS1 pAb (GTX114467) is tested in Human samples. 100% Ab-Assurance.
Identification and characterization of the hematopoietic cell-specific enhancer-like element of the mouse hex gene.: Hex is one of the homeobox genes suggested
Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic menawarkan yang terbaik. mendapatkan murah Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic Termurah Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic. Smart Penawaran dan atas perbelanjaan . Beli Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic sekarang. Terbaik harga terbaik! 2012 .. Jika Anda menemukan penjualan produk produk, belanja Deals.If pada saat diskon akan lebih tabungan sehingga Anda sudah memutuskan Anda ingin memiliki Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic untuk Anda, tetapi Anda tidak tahu di mana untuk mendapatkan harga yang terbaik untuk ini Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic. Kita sudah melakukan penelitian dan menghabiskan banyak waktu untuk Anda. Eelic Poi-I500wu -Ups Power Inverter 500 Watt Adaptor Dc12v-Ac220v By Indoelic ...
Us Plug Adapter/ Adaptor/ Charger/ Recharger For Blinds Curtain Shade Shutter Motor - Buy Adapter,Adaptor,Recharger Product on Alibaba.com
TAB2, a novel adaptor protein, mediates activation of TAK1 MAPKKK by linking TAK1 to TRAF6 in the IL-1 signal transduction pathway ...
Shop online for USB to Serial RS485 and USB to RS232 serial adapters with industrial applications in mind. DIN Rail mounted Serial Adapters are the best COM adapters available to buy now online at the Coolgear web store.
PIM product data: Panasonic Serial Adapter DIN 8pin Dsub 9pin cable interface/gender adapter ET-ADSER cable interface/gender adapters SERIAL ADAPTOR, compare, review, comparison, specifications, price, brochure, catalog, product information, content syndication, product info, product data, datasheet
The KOMP Repository is located at the University of California Davis and Childrens Hospital Oakland Research Institute. Question? Comments? For Mice, Cells, and germplasm please contact us at [email protected], US 1-888-KOMP-MICE or International +1-530-752-KOMP, or for vectors [email protected] or +1-510-450-7917 ...
ECSIT兔多克隆抗体(ab21288)可与小鼠, 人样本反应并经WB, IP, IHC, ICC/IF实验严格验证,被9篇文献引用。所有产品均提供质保服务,中国75%以上现货。
Underwater kinetics Aqualite Adapter Kit. Ball Arm Adapter KitThe Ball Arm Adapter has been replaced by the Aqualite Photo Adapter Kit (1287, dive
PIM product data: MicroBattery MBC1043 Auto 90W Black power adapter & inverter MBC1043 power adapters & inverters DC Adapter 90W, 18-20V, compare, review, comparison, specifications, price, brochure, catalog, product information, content syndication, product info, product data, datasheet
Custom indexed adapters, universal adapters and indexed primers compatible with a variety of DNA library prep methods. SI, CDI, UDI, UMI available. Easy to use Custom Adapter Configurator tool.
Custom indexed adapters, universal adapters and indexed primers compatible with a variety of DNA library prep methods. SI, CDI, UDI, UMI available. Easy to use Custom Adapter Configurator tool.
Find an unbeatable range of ZTE Axon 9 Pro USB-C Adapters including cases and covers, screen protectors, chargers, cables and much more, handpicked by industry experts at the UKs leading accessories retailer. Everything for your USB-C Adapters
Linker for activation of B cells (LAB, also called NTAL; a product of wbscr5 gene) is a newly identified transmembrane adaptor… Expand ...
Satechi today announced an expansion of its Type-C accessory line, introducing the new Slim 4K Multi-Port USB-C Adapter. The Slim Multi-Port Adapter...
Thread Size: -4 AN Male to M12 x 1.5. Type: Adapter Part Number: TORQ-0004TOM121.5. Fitting,Adapter, -4 AN to M12 x 1.5, Aluminum, Black, Each. Fitting Finish: Black anodized. Each component is precision-machined to exact tolerances for trouble-free performance.
Gentaur molecular products has all kinds of products like :search , Gene Link \ Bam HI_ Sma I Adaptor \ 26-3100-07 for more molecular products just contact us
GoPro™-adapter for ski poles. For mounting the original GoPro™ support on the grip. Compatible with these models: 6366872, 6366870, 6362707, 636685...
Gentaur molecular products has all kinds of products like :search , Labne \ Individual adapters for 0.4_0.25 ml tubes, pk of 6 \ C1206 for more molecular products just contact us
Flow adapters can significantly improve FLEX-COLUMN® performance by protecting the gel bed from disruption during sample loading and by eliminating any...
Most difficulties in working with Micro-Manager arise from configuring the system and from problems/issues with specific devices. In both of these cases you are interacting mainly with device adapters. These device adapters have been written by several different authors, all behave slightly differently, and interact with specific hardware that has its own peculiarities. On these pages we will maintain as much information as possible about Micro-Manager device adapters. This will help you configure and understand your Micro-Manager system. We hope that the authors of the device adapters will maintain this information, but please feel free to update the information here with your own experiences. The information here will refer to the most recent Micro-Manager release. ...
Xcor to 14mm DT Adapter (TJB2DAPWW) by hunterseeker5 on Shapeways. Learn more before you buy, or discover other cool products in Other.
- Please make sure the part number, series number and model number are all matching your original adapter. Model : PCGA-AC19V3 Input :
Please make sure the part number Please make sure the part number, series number and model number are all matching your original adapter.
If you want to buy cheap usb adaptor charger, choose usb adaptor charger from banggood.com. It endeavors to provide the products that you want, offering the best bang for your buck. Whatever usb adaptor charger styles you want, can be easily bought here.
APPL 兔多克隆抗体(ab59592)可与小鼠, 大鼠, 人样本反应并经WB, IP, IHC, ICC/IF实验严格验证,被4篇文献引用并得到5个独立的用户反馈。
Adaptor proteins are essential components of T cell receptor (TCR) signaling cascades regulating gene transcription and cytoskeletal reorganization. The molecular adaptor adhesion- and degranulation-promoting adaptor protein (ADAP), also known as Fyn binding protein (FYB) or Slp-76-associated protein of 130 kilodaltons (SLAP-130), interacts with a number of signaling intermediates including Slp-76, the Src family tyrosine kinase Fyn, vasodilator-stimulated phosphoprotein (VASP), and the actin-nucleating protein WASP. Recently ADAP was shown genetically to positively regulate T cell activation, TCR-induced integrin clustering, and T cell adhesion. The mechanism by which ADAP couples TCR stimulation to integrin clustering remains unclear; however, studies of ADAP, the exchange factor Vav1, and WASP suggest that TCR and integrin clustering may be controlled by distinct signaling pathways.. ...
N-Myristoylated ubiquitin ligase Cbl-b inhibitor prevents on glucocorticoid-induced atrophy in mouse skeletal muscleN-Myristoylated ubiquitin ligase Cbl-b inhibitor prevents on glucocorticoid-induced atrophy in mouse skeletal muscle ...
Signal Transducing Adaptor Proteins: A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
Mammalian cell membranes provide an interface between the intracellular and extracellular compartments. It is currently thought that cytoplasmic signaling adapter proteins play no functional role within the extracellular tumor environment. Here, by selecting combinatorial random peptide libraries in tumor-bearing mice, we uncovered a direct, specific, and functional interaction between CRKL, an adapter protein [with Src homology 2 (SH2)- and SH3-containing domains], and the plexin-semaphorin-integrin domain of beta(1) integrin in the extracellular milieu. Through assays in vitro, in cellulo, and in vivo, we show that this unconventional and as yet unrecognized protein-protein interaction between a regulatory integrin domain (rather than a ligand-binding one) and an intracellular adapter (acting outside of the cells) triggers an alternative integrin-mediated cascade for cell growth and survival. Based on these data, here we propose that a secreted form of the SH3/SH2 adaptor protein CRKL may act ...
The Tec-family protein tyrosine kinase IL-2-inducible T cell kinase (ITK) mediates T cell activation, as does the adaptor protein SLP-76 (SH2-domain-containing leukocyte protein of 76 kD), which forms a complex with ITK and other intracellular signaling enzymes. One of these enzymes is phospholipase C-γ1 (PLC-γ1), which mediates T cell receptor (TCR)-stimulated intracellular calcium mobilization leading to the activation of transcription factors such as nuclear factor of activated T cells. The Src-family tyrosine kinase Lck and the Syk-family tyrosine kinase ζ chain-associated protein kinase of 70 kD (ZAP-70), together with ITK, are necessary for the phosphorylation of PLC-γ1 in response to TCR stimulation. ITK is thought to phosphorylate a specific tyrosine residue of PLC-γ1 that is required for its activation. The mechanism of activation of ITK appears to involve the interaction between SLP-76 and ITK, which not only initiates ITK activity but is also important to maintain the kinase ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Palmitoylated Wnt proteins comprise a conserved family of secreted signaling molecules associated with variety of human cancers. WIF domain of the human WI
Buy our Recombinant Human LIM domain only 3 protein. Ab163265 is a full length protein produced in Wheat germ and has been validated in WB, ELISA. Abcam…
Compare LIM Domain Only 4 ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
J. Biotechnol. 126, 463-474 (2006). Maruoka M*, Suzuki J*, Kawata S, Yoshida K, Hirano N, Sato S, Goff SP, Takeya T, Tani K and Shishido T. *equal contribution Identification of B cell adaptor for PI3-kinase (BCAP) as an Abl interactor 1-regulated substrate of Abl kinase ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Orderly progression through the cell cycle is essential to maintain ploidy and stability of the genome. For the transition from G2 into mitosis, upstream checkpoint proteins signal the timing of mitotic entry. Among these are checkpoints to detect completion of DNA replication, the absence of genomic lesions, the doubling of cell mass, and the synthesis of macromolecules. Ultimately, these signals up- or downregulate the inhibitory Y15 phosphorylation of Cdc2, the universal switch for the transition from G2 into mitosis. Through controlling the kinases and phosphatases that phosphorylate and dephosphorylate Y15, these checkpoint-signaling pathways work together to ensure that mitosis is initiated only when it will result in two viable and identical daughters. Although most checkpoints halt cell cycle progression in response to an insult, osmotic stress and limited nutrition actually advance mitotic entry in S. pombe (Young and Fantes 1987; Shiozaki and Russell 1995). It is therefore likely that ...
HPA005788: Rabbit Polyclonal Anti-GRAP2 Antibody against Human GRB2-related adaptor protein 2. Validated for IF, IHC, WB. Order at Bio-Connect.
|p|For Adapter-On Gene Fragments, universal adapters are synthesized onto the ends of each fragment. The adapters are 21-22 nucleotides in length. Fragments with these adapters are compatible with a number of assembly methods, namely Restriction Digestion/Ligation, Gateway, Golden Gate, and TOPO cloning.|/p| |p|The addition of restriction sites inside of the adapters can be used to remove adapters. TOPO cloning will work but will leave the adapters on. |/p| |p| |/p| |p||strong|ADAPTER SEQUENCES|/strong||/p|
Adapter Bearing in Pune, Adapter Bearing Products, Adapter Bearing Suppliers in Pune, Adapter Bearing Manufacturers in Pune - Pune Yellow Pages Online. Looking for Adapter Bearing in Pune, Adapter Bearing Products, Adapter Bearing Suppliers in Pune, Adapter Bearing Manufacturers in Pune - Pune Yellow Pages Online? Get Suppliers / Manufacturers / Retailers Company List in Pune, Maharashtra India
In this paper, Scheinfeld and colleagues from the DAdamio laboratory extended their work on the interaction between JIP-1 and APP. JIP is JNK-interacting protein-1, which several groups, including the DAdamio lab, last year showed to bind to the cytoplasmic tail of APP. Those labs showed that JIP-1 interacted with APP and that overexpression of JIP-1 altered APP processing and metabolism (principally dealing with APP phosphorylation and secretion and Aβ release).. An area of APP biology that has taken center stage recently is the potential role in nuclear signal transduction. This idea has been too inviting by analogy to Notch signaling ever since γ-secretase was shown to cleave both APP and Notch, the latter to generate the nuclear signaling-competent NICD fragment. Evidence has been building in the last two years that the APP cognate of NICD, coined AID or AICD, indeed has signaling properties. First shown in a reporter system by Cao and Sudhof, this observation was confirmed by the ...
Opens the Highlight Feature Bar and highlights feature annotations from the FEATURES table of the record. The Highlight Feature Bar can be used to navigate to and highlight other features and provides links to display the highlighted region separately. Links in the FEATURES table will also highlight the corresponding region of the sequence. More... ...
Helminthes are notorious for modulating host immune responses that help them survive for several years in the hostile environment in the host and cause the dis...
Lamtor2 - Lamtor2 (untagged) - Mouse late endosomal/lysosomal adaptor, MAPK and MTOR activator 2 (Lamtor2), (10ug) available for purchase from OriGene - Your Gene Company.
AC/DC Adapters Products catalog and AC/DC Adapters manufacturer directory. weiku.com is a AC/DC Adapters trade platform offering information about Global AC/DC Adapters Products and global AC/DC Adapters buyers
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
In this study, we have shown that a mutant CIKS protein lacking the N-terminal TRAF6 binding domain significantly impaired IL-17-induced expression of target genes, but had no impact on the response to IL-17 plus TNF-α. This was the case even though the genetic response to IL-17 plus TNF-α included genes that were induced by IL-17, but not TNF-α; furthermore, these genes were induced by IL-17 in manner dependent on the TRAF6 recruitment domain of CIKS. Importantly, among the proteins encoded by these latter genes were transcription factors such as IκBζ and C/EBPδ, which in turn are involved in the expression of later-induced genes in response to both IL-17 and IL-17 plus TNF-α. Therefore, our results may be extrapolated to suggest that the overall genetic response to IL-17 plus TNF-α appears to be largely unaffected by loss of the TRAF6 recruitment domain in CIKS. Consequently, such a mutant CIKS adaptor would not be expected to interfere with IL-17-mediated contributions in an ...
These reference sequences exist independently of genome builds. Explain. These reference sequences are curated independently of the genome annotation cycle, so their versions may not match the RefSeq versions in the current genome build. Identify version mismatches by comparing the version of the RefSeq in this section to the one reported in Genomic regions, transcripts, and products above. ...
Medical Power Adapter, You can Buy good quality Medical Power Adapter , we are Medical Power Adapter distributor & Medical Power Adapter manufacturer from China market.
Oligonucleotide sequences for TruSeqTM RNA and DNA Sample Prep Kits1 TruSeq Universal Adapter 5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TruSeq Adapters barcode: ATCACG TruSeq Adapter, Index 1 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 2 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 3 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 4 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 5 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 6 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 7 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 8 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG TruSeq Adapter, Index 9 5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG ...
|strong|Rabbit anti VISA antibody|/strong| recognizes the human Mitochondrial antiviral-signaling protein (MAVS), also known as Virus-induced-signalling-adaptor (VISA), and KIAA1271, VISA is a 540 am…
To clarify things a bit more here in the post though, let me provide a bit more detail on what goes into my VMs network configuration. In VBox Manager -, pfSense VM -, Settings -, Network, Adapter 1 is a Bridged Adapter and Adapter 2 is a Host-Only Adapter. Under the USB Settings, I have a USB Device Filter configured to match my Alfa USB WiFi adapter. These are all the configured devices that will eventually become the actual network interfaces in pfSense once the VM boots. During the VM boot process, the pfSense kernel detects Network Adapter 1 as /dev/em0, Network Adapter 2 as /dev/em1 and the USB WiFi adapter as /dev/run0. Later in the boot process, pfSense configures these network devices as network interfaces typical for a network router. In my case, the VM Bridged adapter (em0) becomes the WAN interface where all Internet-bound traffic is directed. Since pfSense provides a GUI for configuration, the VM Host-Only adapter (em1) becomes a LAN interface (192.168.56.2/24) which allows ...
Thermo Scientific™ Adapters for Thermo Scientific™ HIGHConic III Rotors 3.5mL Round Bottom Tube Adapter Thermo Scientific™ Adapters for...
Bitspower announces its new parts for water-cooling, snake-style adapters...maybe its tubing replacement! These new G 1/4 angle adapters are perfect for tight spaces and change the direction of your water input or output without affecting flow. Wi
0+HDMI+PD Charger Adapter: Computers & Accessories,USB C HDMI HUB,5 in 1 Type C to HDMI USB PD Adapter,3 USB 3,quality of service,Incredible shopping paradise,Cheap range,Find your favorite product,Easy to exchange! fast delivery ! safe payment!
USD 3.99 Only, Buy REMAX OTG Micro to USB Adapter Smart Connection Adapter Golden with Worldwide Free Shipping for All Orders at Tmart.com.
Berkley Fishing Lures, Berkley Bait, Gulp!®, Gulp! Alive®, Soft Bait, Scented & Flavored Bait, Gulp!® Waxies, Gulp! Alive® Sandworm, Pogy, Turtle Back Worm, Shaky Shad
Amphenol RF - N Female-N Female Adapter Bulkhead Low PIM (172371) AMPHENOL CONNEX N female to N female adapter. Nickel plated body, gold plated contacts.
As a member of the CNA 14000 family, the OCe14102 uses a 10Gbit/s DCB (Converged Enhanced Ethernet) infrastructure for networking and storage, reducing capital expense (CapEx) for adapters, switches and cables, and operational expense (OpEx) for power, cooling and IT administration. The OCe14102 adapter increases data center IT agility and scalability, as well as optimation of the server hardware utilization by scaling high density virtualization.
The 33 Series of precision adapters enable accurate measurements with V Connector® interfaces. Every adapter is fully specified and 100% tested to ensure low reflections and optimum phase performance.
Buy a Binocular Tripod Adapter for your custom optics from Maven Outdoor Equipment Company. The Kramer Designs Tripod Adapter works with all Maven binocular models.
Formula Adaptor PM6 to 180mm rotor Adaptor PM6 to use with a 180mm rotor front/rear Disk size: 180mmFork / Frame: Post Mount PMBrake: Pos…
Căutând pentru us adaptor de soclu? Gearbest România Mobil oferă cele mai bune us adaptor de soclu produse pentru cumpărături pe internet.
HealthSmart Select & Premium Series - A/C Adapter (Only)-This A/C adapter will allow you to keep your HealthSmart monitor charged for use at any time.
Combined with the NVMT 1 (2x24) or NVMT 4 (1x24), the NVMT Night Adapter for Optical Riflescope allows use of soft air guns with a day optical riflescope for night shooting. The reticle of the riflescope is perfect for aiming. The adapter comes equipped w
Posted by OnBelay (98.145.157.97) on 06:50:44 05/11/11. In Reply to: filter adapter torques posted by kcburb. : Anyone know the filter adapter torgue ...
(ID:13403) We have successfully demonstrated that the transmembrane adaptor SIT inhibits TCR-mediated signals required for i thymo
Find and order Lysates and products like NPTX2 293T Cell Transient Overexpression Lysate(Denatured) on www.antibodies-online.com. Order product ABIN1332793.
Find and order 裂解液 and products like SLC16A1 293T Cell Transient Overexpression Lysate(Denatured) on www.antibodies-online.cn. 产品编号 ABIN1333506.
Protocol After completion of the End Repair/dA-Tailing program add 1.0 μl of adaptor (or vector if generating an expression library)
Protocol After completion of the End Repair/dA-Tailing step add 1.0 μl of adaptor (or vector if generating an expression library)
The apoptotic signal is transduced inside these cells by cytoplasmic adaptor proteins. The protein encoded by this gene is a ... Nakayama M, Kikuno R, Ohara O (2003). "Protein-Protein Interactions Between Large Proteins: Two-Hybrid Screening Using a ... adaptor protein that interacts with the death domain of TNF-alpha receptor 1 to activate mitogen-activated protein kinase (MAPK ... Schievella AR, Chen JH, Graham JR, Lin LL (Jun 1997). "MADD, a novel death domain protein that interacts with the type 1 tumor ...
Signal transducing adaptor molecule, Transforming protein RhoA, RAC1, CDC42, ARHGAP4, MAP2K4, and PTK2. GRCh38: Ensembl release ... Cytokine signaling through MAP3K1 utilises two-stage cell signaling to recruit the signal transduction mechanism to cytokine ... Karin M, Gallagher E (March 2009). "TNFR signaling: ubiquitin-conjugated TRAFfic signals control stop-and-go for MAPK signaling ... and scaffold protein regions that mediate protein-protein interactions. MAP3K1 is highly conserved in Euteleostomi. The ...
Signal-transducing adaptor protein 1 is a protein that in humans is encoded by the STAP1 gene. The protein encoded by this gene ... A mouse ortholog, stem cell adaptor protein 1, shares 83% identity with its human counterpart. STAP1 has been shown to interact ... functions as a docking protein acting downstream of Tec tyrosine kinase in B cell antigen receptor signaling. The protein is ... an adaptor/docking protein, modulates STAT3 activation in acute-phase response through its YXXQ motif". J. Biol. Chem. 278 (13 ...
Alpha-1 syntrophin is a signal transducing adaptor protein and serves as a scaffold for various signaling molecules. Alpha-1 ... The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related ... Fernández-Larrea J, Merlos-Suárez A, Ureña JM, Baselga J, Arribas J (1999). "A role for a PDZ protein in the early secretory ... Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in ...
This receptor transduces signals that lead to the activation of NF-κB and MAPK8/JNK. Adaptor proteins TRAF2, TRAF3, and TRAF5 ... CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the ... The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is required for generation and long ... It is a type I transmembrane protein with cysteine-rich domains, but once T cells have become activated, a soluble form of CD27 ...
Signal-transducing adaptor protein 2 is a protein that in humans is encoded by the STAP2 gene. This gene encodes the substrate ... 2007). "Signal-transducing adaptor protein-2 regulates integrin-mediated T cell adhesion through protein degradation of focal ... "Entrez Gene: STAP2 signal-transducing adaptor protein-2". Rosenzweig BL, Imamura T, Okadome T, et al. (1995). "Cloning and ... 2003). "Regulation of FcepsilonRI-mediated signaling by an adaptor protein STAP-2/BSK in rat basophilic leukemia RBL-2H3 cells ...
Signal transducing adapter molecule 2 is a protein that in humans is encoded by the STAM2 gene. The protein encoded by this ... "Entrez Gene: STAM2 signal transducing adaptor molecule (SH3 domain and ITAM motif) 2". Rual JF, Venkatesan K, Hao T, Hirozane- ... an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the ... "Structural insight into modest binding of a non-PXXP ligand to the signal transducing adaptor molecule-2 Src homology 3 domain ...
... has been shown to interact with Signal transducing adaptor molecule and TIMM13. Three copies of TIMM8A and three copies ... "Interaction of the deafness-dystonia protein DDP/TIMM8a with the signal transduction adaptor molecule STAM1". Biochemical and ... 2007). "Large-scale mapping of human protein-protein interactions by mass spectrometry". Molecular Systems Biology. 3 (1): 89. ... It is known to be caused by a truncation or deletion of the 11 kDa protein product of TIMM8A. Defects in this gene also cause ...
MYD88: This gene's product is a signal transducing adaptor protein essential for the transduction of interleukin-1 and toll- ... Its product, Bcl-2 protein, regulates cellular apoptosis (i.e. survival) by inhibiting the apoptosis-causing proteins, Bcl-2- ... like receptor signaling pathways. It thereby regulates NF-κB and MAPK/ERK signaling pathways that control cell proliferation ... and NF-κB signaling pathways. These different gene mutations and dysregulated signaling pathways are also being studied as ...
2002). "Mitogen-activated protein kinase/extracellular signal-regulated kinase signaling in activated T cells abrogates TRAIL- ... Miyazaki, T; Reed J C (June 2001). "A GTP-binding adapter protein couples TRAIL receptors to apoptosis-inducing proteins". Nat ... and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death ... Miyazaki T, Reed JC (2001). "A GTP-binding adapter protein couples TRAIL receptors to apoptosis-inducing proteins". Nat. ...
... s are commonly found in adaptor proteins that aid in the signal transduction of receptor tyrosine kinase pathways. ... conserved protein domain contained within the Src oncoprotein and in many other intracellular signal-transducing proteins. SH2 ... have been used in protein engineering to create protein assemblies. Protein assemblies are formed when several proteins bind to ... Phosphorylation of tyrosine residues in a protein occurs during signal transduction and is carried out by tyrosine kinases. In ...
Reverse signaling between ephrin-B proteins and their Eph receptor tyrosine kinases have been found to initiate the retraction ... Ensuing binding of ephrin-B3 to the cytoplasmic adaptor protein, Grb4, leads to the recruitment and binding of Dock180 and p21 ... Ephrin-B3 is observed to transduce tyrosine phosphorylation-dependent reverse signals into hippocampal axons that trigger ... Forward signaling between ephrin-A and EphA, along the anterior-posterior axis, has been found to inhibit retinal axon branch ...
It is located in the cytoplasm and is an adaptor protein involved in transducing signals from receptor tyrosine kinases to ... Signal transducing adaptor protein Receptor tyrosine kinase Ras superfamily GRCh38: Ensembl release 89: ENSG00000158092 - ... The Nck (non-catalytic region of tyrosine kinase adaptor protein 1) belongs to the adaptor family of proteins. The nck gene was ... "Adaptor protein Nck1 interacts with p120 Ras GTPase-activating protein and regulates its activity". Cell. Signal. 23 (10): 1651 ...
The protein encoded by this gene binds to the SH3 domain of the signal-transducing adaptor molecule, and plays a critical role ... One such signal-transducing adaptor molecule contains an SH3 domain that is required for induction of MYC and cell growth. ... STAM-binding protein is a protein that in humans is encoded by the STAMBP gene. Cytokine-mediated signal transduction in the ... Signal transducing adaptor molecule and GRAP2. GRCm38: Ensembl release 89: ENSMUSG00000006906 - Ensembl, May 2017 "Human PubMed ...
... a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. DR5 has been shown to ... and transduces apoptosis signal. Mice have a homologous gene, tnfrsf10b, that has been essential in the elucidation of the ... a new alternatively spliced receptor that transduces the cytotoxic signal from TRAIL". Current Biology. 7 (9): 693-6. doi: ... The protein encoded by this gene is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This ...
The signal-transducing adaptor protein 1 (STAP1) Src homology 2 (SH2) domain binding motif at Tyr446 - Ile450 (YELLI) is a ... S-palmitoylation can also modulate protein-protein interactions of SLC46A3 by changing the affinity of the protein for lipid ... The SLC46A3 protein contains a signal peptide that facilitates co-translational translocation and is cleaved between Thr20 and ... The protein contains a C-(X)2-C motif (CLLC), which is mostly present in metal-binding proteins and oxidoreductases. A sorting- ...
... is an 80 kDa membrane-anchored signal transducing adaptor protein (STAP) that links specific activated Receptor Tyrosine ... protein FRS2 links the protein tyrosine kinase RET and its oncogenic forms with the mitogen-activated protein kinase signaling ... "Association of atypical protein kinase C isotypes with the docker protein FRS2 in fibroblast growth factor signaling". J. Biol ... "Association of atypical protein kinase C isotypes with the docker protein FRS2 in fibroblast growth factor signaling". J. Biol ...
... a signal-transducing adaptor protein encoded by the STAP1 gene STAP2, a signal-transducing adaptor protein encoded by the STAP2 ... STAP, or stap, may refer to: List of people with the surname Stap Space-time adaptive processing, a signal processing technique ...
DAP10 functions as an adaptor protein and transduces the signal after the ligand binding by recruiting the p85 subunit of PI3K ... DAP12 bears ITAM motif and activates protein tyrosine kinases Syk and Zap70 signalling. NKG2D ligands are induced-self proteins ... By contrast, NKG2D-S associates with two adaptor proteins: DAP10 and DAP12. DAP10 recruits the p85 subunit of PI3K and a ... "Selective associations with signaling proteins determine stimulatory versus costimulatory activity of NKG2D". Nature Immunology ...
... a short segment of DNA with many restriction sites Signal transducing adaptor protein, proteins that provide mechanisms by ... a protein in the biochemical signaling path transferring signals from T cell antigen receptors B-cell linker, a human gene that ... encodes a linker protein related to B cells Linker peptide, a flexible part of a peptide between relatively rigid structural ... which receptors can amplify and regulate downstream effector proteins Linker of activated T cells, ...
... adaptor proteins, signal transducing MeSH D12.644.360.024.264 - caveolin 1 MeSH D12.644.360.024.272 - caveolin 2 MeSH D12.644. ... grb2 adaptor protein MeSH D12.644.360.024.298 - grb7 adaptor protein MeSH D12.644.360.024.300 - grb10 adaptor protein MeSH ... 14-3-3 proteins MeSH D12.644.360.024.318 - proto-oncogene proteins c-crk MeSH D12.644.360.024.326 - proto-oncogene proteins c- ... ral gtp-binding proteins MeSH D12.644.360.525.462 - ran gtp-binding protein MeSH D12.644.360.525.475 - rap gtp-binding proteins ...
... a software design pattern used for computer programming Signal transducing adaptor protein, a type of protein involved in cell ... Adapter or adaptor may refer to: Adapter (device), used to match the physical or electrical characteristics of two different ... signalling Blank-firing adaptor, a device which enables automatic firearms to fire blanks Diving cylinder adapter, a diving ... used to connect various hardware devices Adapter (piping), a short length of pipe with two different ends Adapter pattern, ...
Signal transducing adaptor proteins CDC24 Cdc25 PI3 kinase Phospholipase Ras GTPase-activating protein Vav proto-oncogene GRB2 ... The SH3 proteins interact with adaptor proteins and tyrosine kinases. Interacting with tyrosine kinases, SH3 proteins usually ... SH3 domains are found in proteins of signaling pathways regulating the cytoskeleton, the Ras protein, and the Src kinase and ... In addition to that, the SH3 domain was responsible for controlling protein-protein interactions in the signal transduction ...
... inhibits signal transduction by its interaction with TLRs, IL-1R1 and downstream signalling proteins, and in this manner ... It interacts with IL-37, IL-18R1 and forms tripartite signaling complex. Activity of this complex transduce anti-inflammatory ... SIGIRR also prevents homodimerization of MYD88, and it also prevents signalization through adaptor protein TRIF, which is used ... transcription factor STAT3 and adaptor protein p62 (DOK1). Pre-treatment of mice by IL-37 before injection reduced examined ...
Signal transducing adapter molecule 1 is a protein that in humans is encoded by the STAM gene. This gene was identified by the ... suppresses the degradation of ESCRT proteins signal transducing adaptor molecule 1 and 2". The Journal of Biological Chemistry ... signal transducing adaptor molecule, is associated with Janus kinases and involved in signaling for cell growth and c-myc ... signal transducing adaptor molecule, is associated with Janus kinases and involved in signaling for cell growth and c-myc ...
... may refer to: Signal transducing adaptor protein Vesicular transport adaptor protein Clathrin adaptor protein, ... also known as adaptin This disambiguation page lists articles associated with the title Adaptor protein. If an internal link ...
SLP-76+signal+Transducing+adaptor+proteins at the US National Library of Medicine Medical Subject Headings (MeSH). ... is a gene that encodes a signal-transducing adaptor protein. No full structure for SLP-76 has been solved. The PDB file 1H3H ... "The hematopoietic-specific adaptor protein gads functions in T-cell signaling via interactions with the SLP-76 and LAT adaptors ... "The hematopoietic-specific adaptor protein gads functions in T-cell signaling via interactions with the SLP-76 and LAT adaptors ...
Signal transducing adaptor proteins (STAPs) are proteins that are accessory to main proteins in a signal transduction pathway. ... phosphoinositide-3-kinase adaptor protein 1 SH2B1 - SH2B adaptor protein 1 SH2B2 - SH2B adaptor protein 2 SH2B3 - SH2B adaptor ... adaptor protein Wikipedia:MeSH D12.776#MeSH D12.776.157.057 --- adaptor proteins.2C signal transducing Wikipedia:MeSH D12.776# ... adaptor proteins.2C vesicular transport "Role of Signal Transducing Adaptor Protein (STAP) Family in Chronic Myelogenous ...
The signal is transduced by cytoplasmatic kinases (such as IRAKs) and by other adaptors, such as tumor necrosis factor 6 (TRAF6 ... cytosolic adaptor proteins (such as MyD88 adaptor protein) and insect and nematode Toll. Each of these groups is involved ... When the receptor is activated TIR domain recruits downstream cytoplasmic signalization adaptor proteins (such as Myd88 adaptor ... O'Neill LA, Bowie AG (May 2007). "The family of five: TIR-domain-containing adaptors in Toll-like receptor signalling". Nature ...
... lack a cytoplasmic tail and therefore associate with adaptor proteins containing the same tyrosine residues. Adaptor proteins ... Inhibitory signals are transduced by Immunoreceptor tyrosine-based inhibitory motifs (ITIMs) of the signature (S/I/V/L)xYxx(I/V ... but because they share a conserved signalling pathway utilizing the same signalling motifs. A signaling cascade is initiated ... The signaling cascade is down-regulated by dephosphorylation by protein tyrosine phosphatases. Additional characteristics of ...
Signal transducing adaptor proteins. *EDARADD *EDARADD Hypohidrotic ectodermal dysplasia. *SH3BP2 *Cherubism. *LDB3 *Zaspopathy ... The RPS6KA3 gene makes a protein that is involved with signaling within cells. Researchers believe that this protein helps ... The protein is involved in cell signaling pathways that are required for learning, the formation of long-term memories, and the ... Mutations in the RPS6KA3 disturb the function of the protein, but it is unclear how a lack of this protein causes the signs and ...
Signal transducing adaptor protein. *I-kappa B protein. *Mucin-4. *Olfactory marker protein ... Small GTPases act as molecular switches in signaling pathways, which act to regulate functions of other proteins. They are ... GTP-binding protein regulators regulate G proteins in several different ways. ... and thus requires another class of regulatory proteins to accelerate this activity, the GTPase activating proteins (GAPs). ...
Signal transducing adaptor proteins. *EDARADD *EDARADD Hypohidrotic ectodermal dysplasia. *SH3BP2 *Cherubism. *LDB3 *Zaspopathy ... Like cowden syndrome, patients with Lhermitte-Duclos disease often have mutations in enzymes involved in the Akt/PKB signaling ...
... and the influx of Ca2+ triggers intracellular signaling pathways.[11][31] Allosteric receptor binding sites for zinc, proteins ... "Encoding and transducing the synaptic or extrasynaptic origin of NMDA receptor signals to the nucleus". Cell. 152 (5): 1119- ... adaptor, and scaffolding proteins. ... Many of these pathways use the same protein signals, but are ... which contain residues that can be directly modified by a series of protein kinases and protein phosphatases, as well as ...
受體蛋白(英语:Template:Signal transducing adaptor proteins). *GTP-binding(英语:Template:GTP-binding protein regulators) ... gamma-aminobutyric acid signaling pathway. • G-protein coupled receptor signaling pathway. • G-protein coupled receptor ... G-protein coupled receptor activity. • signal transducer activity. • G-protein coupled serotonin receptor activity. • trace- ... identical protein binding. • neurotransmitter receptor activity. 細胞組分. • 細胞質. • integral component of membrane. • 核内体. • 细胞膜
Signal transducing adaptor protein. *I-kappa B protein. *Mucin-4. *Olfactory marker protein ... protein complex binding. • signal transducer activity. • protein binding. • GTPase activity. • GTPase binding. • G-protein ... protein heterotrimerization. • Wnt signaling pathway, calcium modulating pathway. • protein folding. • G-protein coupled ... Ras protein signal transduction. • cell proliferation. • cellular response to hypoxia. • sensory perception of taste. • signal ...
... or directly transducing the signal via adaptor proteins to the apoptotic mechanisms. An extrinsic pathway for initiation ... Examples of viral Bcl-2 proteins include the Epstein-Barr virus BHRF1 protein and the adenovirus E1B 19K protein.[104] Some ... The adenovirus E1B-55K protein and the hepatitis B virus HBx protein are examples of viral proteins that can perform such a ... apoptotic signals must cause regulatory proteins to initiate the apoptosis pathway. This step allows those signals to cause ...
受體蛋白(英语:Template:Signal transducing adaptor proteins). *GTP-binding(英语:Template:GTP-binding protein regulators) ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... The 5-HT1 subfamily consists of five G protein-coupled receptors (GPCRs) that are coupled to Gi/Go and mediate inhibitory ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... In protein-ligand binding, the ligand is usually a molecule which produces a signal by binding to a site on a target protein. ... In DNA-ligand binding studies, the ligand can be a small molecule, ion,[1] or protein[2] which binds to the DNA double helix. ... Teif VB, Rippe K (October 2010). "Statistical-mechanical lattice models for protein-DNA binding in chromatin". Journal of ...
受體蛋白(英语:Template:Signal transducing adaptor proteins). *GTP-binding(英语:Template:GTP-binding protein regulators) ... Coding of sweet, bitter, and umami tastes: different receptor cells sharing similar signaling pathways.. Cell. 2003, 112 (3): ... MeSH(醫學主題詞)上面的TAS2R38+protein,+human ... MAPK ERK(英语:Template:MAPK ERK signaling pathway). *notch(英语
Signal transducing adaptor protein. *I-kappa B protein. *Mucin-4. *Olfactory marker protein ... G proteins are important signal transducing molecules in cells. "Malfunction of GPCR [G Protein-Coupled Receptor] signaling ... Types of G protein signaling[edit]. G protein can refer to two distinct families of proteins. Heterotrimeric G proteins, ... A group of proteins called Regulator of G protein signalling (RGSs), act as GTPase-activating proteins (GAPs), are specific for ...
... ranging from proteins to biogenic amines to protons, but all transduce this signal via a mechanism of G-protein coupling. This ... it undergoes a conformational change allowing it to serve as a scaffolding protein for an adaptor complex termed AP-2, which in ... G-protein-dependent signalingEdit. There are three main G-protein-mediated signaling pathways, mediated by four sub-classes of ... Cyclic AMP-dependent protein kinases (protein kinase A) are activated by the signal chain coming from the G protein (that was ...
... downregulating incoming signals are strong enough to shut down signaling completely without additional signal-transducing ... The cargo ligand and receptor will then recruit adaptor proteins and clathrin triskelions to the outside membrane of the cell ... "GPCR-G Protein-β-Arrestin Super-Complex Mediates Sustained G Protein Signaling". Cell. 166 (4): 907-919. doi:10.1016/j.cell. ... However, receptor-mediated endocytosis is also actively implicated in transducing signals from the cell periphery to the ...
Signal transducing adaptor proteins. *EDARADD *EDARADD Hypohidrotic ectodermal dysplasia. *SH3BP2 *Cherubism. *LDB3 *Zaspopathy ... Charcot-Marie-Tooth disease is caused by genetic mutations that cause defects in neuronal proteins. Nerve signals are conducted ... The mutation can appear in GJB1 coding for connexin 32, a gap junction protein expressed in Schwann cells. Because this protein ... The myelin sheath allows nerve cells to conduct signals faster. When the myelin sheath is damaged, nerve signals are slower, ...
Signal transducing adaptor protein. *I-kappa B protein. *Mucin-4. *Olfactory marker protein ... Guanylate cyclase is often part of the G protein signaling cascade that is activated by low intracellular calcium levels and ... "Differential calcium signaling by cone specific guanylate cyclase-activing proteins from the zebrafish retina". PLoS ONE. 6 (8 ... Guanylyl cyclase activator (protein). References[edit]. *^ Sakurai K.; Chen J.; Kefalov V. (2011). "Role of guanylate cylcase ...
Cowan CA, Henkemeyer M (2001). "The SH2/SH3 adaptor Grb4 transduces B-ephrin reverse signals". Nature. 413 (6852): 174-9. doi: ... Abi1 is adaptor protein. It interacts with c-Abl and WAVE2 which is an actin polymerization regulator. It is known that Abi1 ... 2000). "The Eps8 protein coordinates EGF receptor signalling through Rac and trafficking through Rab5". Nature. 408 (6810): 374 ... 1999). "EPS8 and E3B1 transduce signals from Ras to Rac". Nature. 401 (6750): 290-3. doi:10.1038/45822. PMID 10499589. Courtney ...
受體蛋白(英语:Template:Signal transducing adaptor proteins). *GTP-binding(英语:Template:GTP-binding protein regulators) ... Protein-binding assays in biological liquids using microscale thermophoresis. Nature Communications. 2010, 1 (7): 100. Bibcode: ... BindingDB, a public database of measured protein-ligand binding affinities.. *BioLiP, a comprehensive database for ligand- ... Teif VB, Rippe K. Statistical-mechanical lattice models for protein-DNA binding in chromatin.. Journal of Physics: Condensed ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... There are three types of juxtacrine signaling: *A membrane ligand (protein, oligosaccharide, lipid) and a membrane protein of ... Cell / extracellular matrix signaling[edit]. The extracellular matrix is composed of glycoproteins (proteins and ... Cell / cell signaling[edit]. In this type of signaling, a cell places a specific ligand on the surface of its membrane, and ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... Wajant H (2002). "The Fas signaling pathway: more than a paradigm". Science. 296 (5573): 1635-6. doi:10.1126/science.1071553. ... Chen G, Goeddel DV (2002). "TNF-R1 signaling: a beautiful pathway". Science. 296 (5573): 1634-5. doi:10.1126/science.1071924. ... Werlen G; Hausmann, B; Naeher, D; Palmer, E (2003). "Signaling life and death in the thymus: timing is everything". Science. ...
Signal transducing adaptor protein. *I-kappa B protein. *Mucin-4. *Olfactory marker protein ... G protein-coupled receptors (GPCRs) are a large family of integral membrane proteins that respond to a variety of extracellular ... Main article: function of cAMP-dependent protein kinase. In humans, cAMP works by activating protein kinase A (PKA, cAMP- ... Gi protein, which is a G protein that inhibits adenylyl cyclase, reducing cAMP levels. ...
Signal transducing adaptor protein. *I-kappa B protein. *Mucin-4. *Olfactory marker protein ... MPFs activate other proteins through phosphorylation. These phosphorylated proteins, in turn, are responsible for specific ... Protein cyclin A governs this process by keeping the process going until the errors are eliminated. In normal cells, persistent ... Cyclins, when bound with the dependent kinases, such as the p34/cdc2/cdk1 protein, form the maturation-promoting factor. ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... Activity at an axon terminal: Neuron A is transmitting a signal at the axon terminal to neuron B (receiving). Features: 1. ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... Ligands connect to specific receptor proteins based on the shape of the active site of the protein. ...
受體蛋白(英语:Template:Signal transducing adaptor proteins). *GTP-binding(英语:Template:GTP-binding protein regulators) ...
Ca2+ signaling. *Lipid signaling. Assistants:. *Signal transducing adaptor protein. *Scaffold protein ... One hemichannel proteins have four transmembrane domains[6][19]. *6 hemichannel proteins create one hemichannel. When different ... a protein from rat heart homologous to a gap junction protein from liver". The Journal of Cell Biology. 105 (6 Pt 1): 2621-9. ... genes can produce only the proteins that make up gap junction channels. An alternative naming system based on this protein's ...
受體蛋白(英语:Template:Signal transducing adaptor proteins). *GTP-binding(英语:Template:GTP-binding protein regulators) ... Template:DNA and protein biosynthesis navs. (. 编辑 讨论 链接 历史. ). - Genetics ... Template:Signal transduction navs. (. 编辑 讨论 链接 历史. ). ... belowstyle = background:transparent; padding:0; , below = {{Bone and cartilage navs}}{{Joint navs}}{{Protein defects by ...
Signal transducing adaptor proteins. *EDARADD *EDARADD Hypohidrotic ectodermal dysplasia. *SH3BP2 *Cherubism. *LDB3 *Zaspopathy ... Mutated p53 proteins are typically more stable than wild-type, and can inhibit the activity of the wild-type protein in ... The tetramerization domain plays a major role in the oligomerization of the p53 protein, which exists as a tetramer.[6] This ... With pH in the low to normal physiological range (up to 7.5), the mutant protein forms normal oligomers and retains its ...
Cell signaling: carrier proteins: signal transducing adaptor proteins. JAK-STAT. *see JAK-STAT signaling pathway ... Various classes of signaling molecules, including G-protein subunits, receptor and non-receptor tyrosine kinases, endothelial ... Caveolins may act as scaffolding proteins within caveolar membranes by compartmentalizing and concentrating signaling molecules ... In molecular biology caveolins are a family of integral membrane proteins that are the principal components of caveolae ...
Signal transducing adaptor proteins (STAPs) are proteins that are accessory to main proteins in a signal transduction pathway. ... phosphoinositide-3-kinase adaptor protein 1 SH2B1 - SH2B adaptor protein 1 SH2B2 - SH2B adaptor protein 2 SH2B3 - SH2B adaptor ... adaptor protein Wikipedia:MeSH D12.776#MeSH D12.776.157.057 --- adaptor proteins.2C signal transducing Wikipedia:MeSH D12.776# ... adaptor proteins.2C vesicular transport "Role of Signal Transducing Adaptor Protein (STAP) Family in Chronic Myelogenous ...
Upon IL-2 and GM-CSL stimulation, it plays a role in signaling leading to DNA synthesis and MYC induction. May also play a role ... Involved in intracellular signal transduction mediated by cytokines and growth factors. ... Protein. Similar proteins. Species. Score. Length. Source. O88811. Signal transducing adaptor molecule (SH3 domain and ITAM ... "Signal-transducing adaptor molecules STAM1 and STAM2 are required for T-cell development and survival.". Yamada M., Ishii N., ...
Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing ... A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, ... each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. ... Signal Transducing Adaptor Proteins. Subscribe to New Research on Signal Transducing Adaptor Proteins ...
G protein beta gamma subunits stimulate phosphorylation of Shc adapter protein.  Hawes, BE; Lefkowitz, Robert J; Touhara, K; ... Browsing by Subject "Adaptor Proteins, Signal Transducing". 0-9. A. B. C. D. E. F. G. H. I. J. K. L. M. N. O. P. Q. R. S. T. U ... Such motifs in other proteins are known to mediate protein-protein interactions ... ... One aspect of the function of the beta-arrestins is to serve as scaffold or adapter molecules coupling G-protein coupled ...
The protein is directly phosphorylated by Tec in vitro where it participates in a postive feedback loop, increasing Tec ... by this gene functions as a docking protein acting downstream of Tec tyrosine kinase in B cell antigen receptor signaling. ... docking protein BRDG1; stem cell adaptor protein 1; BCR downstream-signaling protein 1; signal-transducing adaptor protein- ... STAP1; signal transducing adaptor family member 1; signal-transducing adaptor protein 1; BCR downstream signaling 1; BRDG1; ...
General protein information Go to the top of the page Help Preferred Names. signal-transducing adaptor protein 2. Names. BRK ... STAP2 signal transducing adaptor family member 2 [Homo sapiens] STAP2 signal transducing adaptor family member 2 [Homo sapiens] ... mRNA and Protein(s) * XM_011528123.1 → XP_011526425.1 signal-transducing adaptor protein 2 isoform X1 ... mRNA and Protein(s) * NM_001013841.2 → NP_001013863.1 signal-transducing adaptor protein 2 isoform 2 ...
Signal-transducing adaptor protein-2 regulates stromal cell-derived factor-1 alpha-induced chemotaxis in T cells.. ... Signal-transducing adaptor protein-2 modulates Fas-mediated T cell apoptosis by interacting with caspase-8.. ... The protein content of an adaptor protein, STAP-2 is controlled by E3 ubiquitin ligase Cbl.. ... The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that ...
Adaptor Proteins, Signal Transducing/genetics*. *Adaptor Proteins, Signal Transducing/immunology*. *Adaptor Proteins, Signal ... and all AmphiCOMMD proteins contain the conserved COMM domain with two NES (Nuclear Export Signal) motifs. Secondly, the ...
Protein kinase Ciota (PKCiota) drives transformed growth of non-small cell lung cancer (NSCLC) cells through the Rho family ... Adaptor Proteins, Signal Transducing / physiology* * Animals * Carcinoma, Non-Small-Cell Lung / enzymology ... Protein kinase Ciota (PKCiota) drives transformed growth of non-small cell lung cancer (NSCLC) cells through the Rho family ... Matrix metalloproteinase-10 is a critical effector of protein kinase Ciota-Par6alpha-mediated lung cancer Oncogene. 2008 Aug 14 ...
To identify and characterize new genes conferring anchorage independence, we transduced MCF10A human normal breast cells with a ... Adaptor Proteins, Signal Transducing * GAB2 protein, human * STAT3 Transcription Factor * STAT3 protein, human ... The GAB2 signaling scaffold promotes anchorage independence and drives a transcriptional response associated with metastatic ... To identify and characterize new genes conferring anchorage independence, we transduced MCF10A human normal breast cells with a ...
Signal-Transducing Adaptor Protein-2 Blocks B Cell Recovery Under Hematological Stress at Pre-B Stage Via TLR4 Signaling ... Signal-transducing adaptor protein-2 (STAP-2) was cloned as a c-fms/M-CSFR interacting protein in 2003, and the interaction ... Signal-Transducing Adaptor Protein-2 Blocks B Cell Recovery Under Hematological Stress at Pre-B Stage Via TLR4 Signaling. Blood ... The function as an adaptor protein in various cell types and signaling pathways, and its ubiquitous expression promoted us to ...
Adaptor Proteins, Signal Transducing • Adenosine • Adolescent • Adult • Aedes • Aging • Algorithms • Alleles • Allosteric ... Protein Binding • Proteins • Proto-Oncogene Proteins • Pupa • Pyrrolidonecarboxylic Acid • Quantitative Trait Loci • ... Carrier Proteins • Case-Control Studies • Cautery • cdc42 GTP-Binding Protein, Saccharomyces cerevisiae • Cell Count • Cell ... Wheeler, DE; Nijhout, HF, A perspective for understanding the modes of juvenile hormone action as a lipid signaling system., ...
signal transducing adaptor molecule 2. VPS18. vacuolar protein sorting 18.. *Received September 9, 2013. ... IL-2 stimulation resulted in ∼2.7-fold increase in phosphorylation of signal transducing adaptor molecule 2 (STAM2) on Tyr374 ... B) Quantification of phosphotyrosine sites on canonical signaling proteins of the IL-2/15R signaling pathways. iTRAQ fold ... and protein translation, in addition to proteins known to be involved in signal transduction (Fig. 1C, Supplemental Table 1). ...
0/Adaptor Proteins, Signal Transducing; 0/BCL10 protein, human; 0/Carrier Proteins ... Adaptor Proteins, Signal Transducing*. Adult. Aged. Carrier Proteins / analysis. Cell Nucleus / chemistry. Chromosomes, Human, ...
Signal Transducing Adaptor Proteins. *PTEN. *Case-Control Studies. *Gene Expression Profiling. *HtrA1 ... Western blot further showed that PCDH10 restoration activate apoptotic signaling pathway via caspase signaling in both EEC cell ... Mutated Genes and Abnormal Protein Expression. Latest Publications. Found this page useful? ... Mutated Genes and Abnormal Protein Expression (38). Clicking on the Gene or Topic will take you to a separate more detailed ...
... protein, a necessary component of DNA mismatch repair (MMR), in G2-M cell cycle checkpoint arrest after 6-thioguanine (6-TG) ... 0/Adaptor Proteins, Signal Transducing; 0/Carrier Proteins; 0/MLH1 protein, human; 0/Mlh1 protein, mouse; 0/Neoplasm Proteins; ... Adaptor Proteins, Signal Transducing. Animals. Carrier Proteins. Cell Cycle / radiation effects*. Cell Survival. Cells, ... Nuclear Proteins. Thioguanine / pharmacology. Tumor Cells, Cultured. Tumor Suppressor Protein p53 / physiology. ...
p53 Protein. *Signal Transducing Adaptor Proteins. *Adenoma. *Chromosome 4. *Stomach Cancer. *CpG Islands ... What pathways are this gene/protein implicaed in?. Show (1). SFRP2 is involved in:. - Wnt signaling pathway KEGG. Data from ... Wnt receptor signaling pathway involved in somitogenesis - Wnt-activated receptor activity - Wnt-protein binding Data from Gene ... Secreted frizzled related protein 2 (SFRP2), APC1A in WNT signaling pathway and the DNA repair gene, O6-methylguanine-DNA ...
Signal-transducing adaptor protein-2 delays recovery of B lineage lymphocytes during hematopoietic stress Michiko Ichii, Kenji ... Protein-L-isoaspartate O-methyltransferase is required for in vivo control of oxidative damage in red blood cells Angelo ... BMP signaling is required for postnatal murine hematopoietic stem cell self-renewal Sarah Warsi, Ulrika Blank, Maria Dahl, Tan ... Transducin β-like protein 1 controls multiple oncogenic networks in diffuse large B-cell lymphoma Youssef Youssef, Vrajesh ...
Ab163151 is a protein fragment produced in Wheat germ and has been validated in WB, ELISA. Abcam provides free… ... Signal transducing adaptor protein 2. *Signal-transducing adaptor protein 2. *Ssignal transducing adaptor family member 2 ... Proteins and Peptides. Proteomics tools. Agonists, activators, antagonists and inhibitors. Lysates. Multiplex miRNA assays. By ... Substrate of protein kinase PTK6. May play a regulatory role in the acute-phase response in systemic inflammation and may ...
0 (Adaptor Proteins, Signal Transducing); 0 (Antineoplastic Agents); 0 (LIM Domain Proteins); 0 (LMNA protein, human); 0 (Lamin ... MET protein, human); EC 2.7.10.1 (Proto-Oncogene Proteins c-met); EC 2.7.10.1 (Receptor Protein-Tyrosine Kinases); EC 2.7.10.1 ... and NAD-dependent protein deacetylase sirtuin-3 (SIRT3). Knockdown of any of these proteins was shown in previous studies to ... Furthermore, we showed that miR-761 putatively targeted three proteins, thyroid hormone receptor interactor 6 (TRIP6), lamin A/ ...
0 (Adaptor Proteins, Signal Transducing); 0 (Carrier Proteins); 0 (Cytoskeletal Proteins); 0 (Intracellular Signaling Peptides ... 0 (Adaptor Proteins, Signal Transducing); 0 (Biomarkers); 0 (Bone Density Conservation Agents); 0 (Proteins); 0 (SQSTM1 protein ... 0 (Cyclin-Dependent Kinase Inhibitor p16); 0 (DNA, Viral); 0 (Oncogene Proteins, Viral). ... human); 0 (Sequestosome-1 Protein); 0 (urinary N-telopeptide of type I collagen, human); 9007-12-9 (Calcitonin); 9007-34-5 ( ...
keywords = "Adaptor Proteins, Signal Transducing, Colorectal Neoplasms, DNA-Binding Proteins, Denmark, European Continental ... Ancestry Group, Genetic Counseling, Humans, Introns, MutS Homolog 2 Protein, Mutation, Nuclear Proteins, RNA Splice Sites", ...
Adaptor Proteins, Signal Transducing. 1. 2015. 2550. 0.070. Why? Cell Cycle Proteins. 1. 2015. 3276. 0.070. Why? ...
Involved in IL-18 signaling and is proposed to function as a sorting adapter for MYD88 in IL-18 signaling during adaptive ... In TLR4 signaling, physically bridges TLR4 and TICAM1 and functionally transmits signal to TICAM1 in early endosomes after ... In TLR2 signaling, physically bridges TLR2 and MYD88 and is required for the TLR2-dependent movement of MYD88 to endosomes ... Functions as sorting adapter in different signaling pathways to facilitate downstream signaling leading to type I interferon ...
Signal transducing adapter molecule 1 is a protein that in humans is encoded by the STAM gene. This gene was identified by the ... suppresses the degradation of ESCRT proteins signal transducing adaptor molecule 1 and 2". The Journal of Biological Chemistry ... signal transducing adaptor molecule, is associated with Janus kinases and involved in signaling for cell growth and c-myc ... signal transducing adaptor molecule, is associated with Janus kinases and involved in signaling for cell growth and c-myc ...
Proteins [D12.776]. *Intracellular Signaling Peptides and Proteins [D12.776.476]. *Adaptor Proteins, Signal Transducing [ ... A family of proteins that bind to CELL SURFACE RECEPTORS and alter their specificity, signaling mechanism, or mode of ... "Receptor Activity-Modifying Proteins" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, ... This graph shows the total number of publications written about "Receptor Activity-Modifying Proteins" by people in Harvard ...
Carrier Proteins [D12.776.157]. *Adaptor Proteins, Signal Transducing [D12.776.157.057]. *Retinoblastoma Binding Proteins [ ... A retinoblastoma binding protein that is also a member of the Jumonji-domain histone demethylases. It has demethylation ... "Retinoblastoma-Binding Protein 2" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH ( ... PI3K/AKT Signaling Regulates H3K4 Methylation in Breast Cancer. Cell Rep. 2016 06 21; 15(12):2692-704. ...
Adaptor Proteins; Signal Transducing, Animals, Antigens; Differentiation/genetics/*metabolism, Cytokines/genetics/immunology, ... signal adaptor protein MyD88. These mice have been shown to have markedly impaired Th1 immunity. ... MyD88-dependent toll-like receptor signalling is not a requirement for fetal islet xenograft rejection in mice. Schmidt, Peter ... Hence, MyD88-dependent TLR signalling does not appear to be a crucial component of acute cellular xenograft rejection ...
... and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was ... Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. ... This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death ... This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. ...
The deubiquitinase AMSH (associated molecule with the SH3 domain of signal transducing adaptor molecule) specifically interacts ... The mammalian adaptor protein Alix [ALG-2 (apoptosis-linked-gene-2 product)-interacting protein X] belongs to a conserved ... associated molecule with the Src homology 3 domain of signal transducing adaptor molecule (AMSH) ... associated molecule with the Src homology 3 domain of signal transducing adaptor molecule (AMSH) ...
  • The deubiquitinase AMSH (associated molecule with the SH3 domain of signal transducing adaptor molecule) specifically interacts with phosphorylated Xp95 in M-phase cell lysates. (biochemj.org)
  • The pathway begins with ESCRT-0, a dimer of Vps27 (vacuolar protein sorting 27) and Hse1 [Hrs-binding protein, STAM (signal transducing adaptor molecule) and EAST 1 (EGFR-associated protein with SH3 and TAM domain 1)] [ 13 ]. (biochemsoctrans.org)
  • Signal transducing adapter molecule 1 is a protein that in humans is encoded by the STAM gene. (wikipedia.org)
  • This protein associates with JAK3 and JAK2 kinases via its ITAM region, and is phosphorylated by the JAK kinases upon cytokine stimulation, which suggests the function of this protein is as an adaptor molecule involved in the downstream signaling of cytokine receptors. (wikipedia.org)
  • Signal transducing adaptor molecule has been shown to interact with HGS, Janus kinase 2. (wikipedia.org)
  • Hrs is associated with STAM, a signal-transducing adaptor molecule. (wikipedia.org)
  • This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. (senescence.info)
  • Janssen E, Zhu M, Zhang W, Koonpae S and Zhang W (2003) LAB: A new membrane‐associated adaptor molecule in B cell activation. (els.net)
  • TRAF6 is the main adaptor molecule which activates NF-κB pathway downstream of RANKL signaling which is required for osteoclastogenesis and osteoclast activation. (wikipathways.org)
  • The adapter molecule FADD recruits caspase-8 to the activated receptor. (nih.gov)
  • We propose that CIN85 functions as a scaffold molecule that binds to numerous endocytic accessory proteins, thus controlling distinct steps in trafficking of EGF receptors along the endocytic and recycling pathways. (diva-portal.org)
  • We previously reported a new type of signal-transducing adaptor molecule, STAM, which was shown to be involved in cytokine-mediated intracellular signal transduction. (embl-heidelberg.de)
  • Signal transducing adaptor proteins (STAPs) are proteins that are accessory to main proteins in a signal transduction pathway. (wikipedia.org)
  • Much of the specificity of signal transduction depends on the recruitment of several signalling components such as protein kinases and G-protein GTPases into short-lived active complexes in response to an activating signal such as a growth factor binding to its receptor. (wikipedia.org)
  • There are many other types of interaction domains found within adaptor and other signalling proteins that allow a rich diversity of specific and coordinated protein-protein interactions to occur within the cell during signal transduction. (wikipedia.org)
  • TAB2 is an adaptor protein involved in the IL-1 signal transduction pathway: Takaesu G, Kishida S, Hiyama A, Yamaguchi K, Shibuya H, Irie K, Ninomiya-Tsuji J, Matsumoto K (April 2000). (wikipedia.org)
  • Good article about adaptor proteins involved in protein kinase C-mediated signal transduction: Schechtman D, Mochly-Rosen D (October 2001). (wikipedia.org)
  • Involved in intracellular signal transduction mediated by cytokines and growth factors. (uniprot.org)
  • A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. (curehunter.com)
  • One aspect of the function of the beta-arrestins is to serve as scaffold or adapter molecules coupling G-protein coupled receptors (GPCRs) to signal transduction pathways distinct from traditional second messenger pathways. (duke.edu)
  • The encoded protein possesses domains and several tyrosine phosphorylation sites characteristic of adaptor proteins that mediate the interactions linking proteins involved in signal transduction pathways. (nih.gov)
  • These results provide important insights into the function of other shared cytokine and growth factor receptors, quantitative regulation of cell proliferation and metabolism through signal transduction, and improved design of cytokine based clinical immunomodulatory therapies for cancer and infectious diseases. (jimmunol.org)
  • The α-chains function primarily as high-affinity ligand capture receptors while signal transduction occurs exclusively through the β and γ c chains, which are constitutively associated with the JAKs ( 10 ). (jimmunol.org)
  • It has been recently shown that BCR and the associated Igα rapidly translocate to GEMs upon receptor cross-linking, which is required for efficient signal transduction by the BCR 458. (nih.gov)
  • Moreover, cholesterol-sphingolipid raft membrane domains have been implicated to play a role in TCR signal transduction. (nih.gov)
  • Here, we studied the assembly of TCR with signal transduction proteins and raft markers in plasma membrane subdomains of Jurkat T leukemic cells. (nih.gov)
  • Many downstream signaling proteins coisolated with the TCR/LAT-enriched plasma membrane fragments, suggesting that LAT/TCR assemblies form a structural scaffold for TCR signal transduction proteins. (nih.gov)
  • Differentially expressed genes were categorized in seven functional groups: cell cycle and differentiation, apoptosis, tumor suppressor genes and oncogenes, cell adhesion and cell-cell interaction, transcription, signal transduction and energy metabolism. (tudelft.nl)
  • In addition, genes involved in signal transduction pathways like beta catenin/ TCF signalling and MAPK signal transduction were influenced by quercetin. (tudelft.nl)
  • Analysis of how these adapter proteins bind to the Met receptor and what signal transducers they recruit have led to more substantial models of HGF/SF-Met signal transduction and have uncovered new potential pathways that may be involved into Met mediated tumor cell invasion and metastasis. (novusbio.com)
  • A. Asea, M. Rehli, E. Kabingu, J. A. Boch, O. Baré, P. E. Auron, M. A. Stevenson, S. K. Calderwood, Novel signal transduction pathway utilized by extracellular HSP70: Role of Toll-like receptor (TLR) 2 and TLR4. (sciencemag.org)
  • The biological importance of CXCR7, its signal transduction, and further effects apparently depend on the cell types investigated. (aacrjournals.org)
  • The mitogen-activated protein kinases (MAPKs) are a group of protein serine/threonine kinases that are activated in response to a variety of extracellular stimuli and mediate signal transduction from the cell surface to the nucleus. (bloodjournal.org)
  • JIP3 is a member of a novel class of putative MAPK scaffold proteins that may regulate signal transduction by the JNK pathway. (umassmed.edu)
  • Multiple endocytic pathways of G protein-coupled receptors delineated by GIT1 sensitivity. (duke.edu)
  • We selected most pathways STAP1 participated on our site, such as B Cell Receptor Signaling Pathway, Kit Receptor Signaling Pathway, Signaling events mediated by Stem cell factor receptor (c-Kit), which may be useful for your reference. (creativebiomart.net)
  • The function as an adaptor protein in various cell types and signaling pathways, and its ubiquitous expression promoted us to investigate the effect of STAP-2 on HSPC under hematopoietic stress using gene-modified mice. (ashpublications.org)
  • As a consequence of sharing the β and the γ c chains, stimulation of T cells with IL-2 and IL-15 results in the activation of similar signaling pathways, which include the JAK-STAT, the Ras-Raf-MAPK, and the PI3K-Akt pathways ( 4 , 10 , 11 ). (jimmunol.org)
  • Despite signaling through the same receptors and sharing common effector pathways, multiple studies have reported unique and even antagonistic roles for IL-2 and IL-15 in the T cell immune response. (jimmunol.org)
  • What pathways are this gene/protein implicaed in? (cancerindex.org)
  • BAG (Bcl-2-associated athanogene) proteins are molecular chaperone regulators that affect diverse cellular pathways. (semanticscholar.org)
  • These molecules process downstream signals via the Ras-Raf-MAP kinase and PI3 kinase pathways which results in the activation of additional transcription factors. (kegg.jp)
  • However, Syk(hi)/ZAP-70(-) T cells differ from control T cells with respect to the T cell antigen receptor (TCR)-mediated activation of the MAPK cascades: extracellular signal-regulated kinase activity and recruitment of the JNK and p38 stress-related MAPK pathways are diminished. (cnrs.fr)
  • In addition, activation of some of the signalling pathways has effects in many other cell processes. (els.net)
  • So, it is important to understand the mechanism of recognition between NK receptors and their ligands in pathological conditions and the signaling pathways of NK cell receptors. (hindawi.com)
  • This review mainly summarizes the research progress on NK cell surface receptors and their signal pathways. (hindawi.com)
  • This article will summarize the existing research on NK cell receptors as well as their signaling pathways. (hindawi.com)
  • MAPK1 and MAPK3 phosphorylation was also shown to be dispensable for RANKL mediated osteoclast differentiation in vitro, but another report also show that specific inhibitors to MEK increased RANKL induced osteoclastogenesis suggesting a cross talk between p38 and ERK signaling pathways. (wikipathways.org)
  • In addition to these pathways, aPKC/p62 signaling is also reported to be essential for osteoclastogenesis. (wikipathways.org)
  • Among its related pathways are Cytokine Signaling in Immune system and Akt Signaling . (genecards.org)
  • Receptor Tyrosine Kinase (RTK)/Ras GTPase/MAP kinase (MAPK) signaling pathways are used repeatedly during metazoan development to control many different biological processes. (wormbook.org)
  • Ligation of PRRs induces downstream-signaling pathways modifying the activity of transcription factors that regulates the expression of genes linked to inflammation. (intechopen.com)
  • Also, LMP1 activation of IRF7 is suppressed by a naturally dominant negative IRF5 ( 40 , 70 ), which is induced in EBV-infected B cells through both TLR7 ( 35 ) and LMP1 ( 16 ) signaling pathways. (pubmedcentralcanada.ca)
  • Among its related pathways are Apoptosis Modulation and Signaling and Signaling by GPCR . (genecards.org)
  • Our findings suggest that caspase-1 regulates many new signaling pathways potentially via its known substrates and also via transcription factors and other proteins that are yet to be identified. (springer.com)
  • The AKT/mammalian target of rapamycin (AKT/mTOR) and ERK MAPK signaling pathways have been shown to cooperate in prostate cancer progression and the transition to androgen-independent disease. (jci.org)
  • Furthermore, analyses of human prostate cancer tissue microarrays demonstrated that AKT/mTOR and ERK MAPK signaling pathways are often coordinately deregulated during prostate cancer progression in humans. (jci.org)
  • We therefore propose that combination therapy targeting AKT/mTOR and ERK MAPK signaling pathways may be an effective treatment for patients with advanced prostate cancer, in particular those with hormone-refractory disease. (jci.org)
  • A good article regarding the role of adaptor proteins involved with the T-cell antigen receptor: Samelson LE (2002). (wikipedia.org)
  • beta2-Adrenergic receptor regulation by GIT1, a G protein-coupled receptor kinase-associated ADP ribosylation factor GTPase-activating protein. (duke.edu)
  • G protein-coupled receptor activation leads to the membrane recruitment and activation of G protein-coupled receptor kinases, which phosphorylate receptors and lead to their inactivation. (duke.edu)
  • Several G-protein coupled receptors, such as the beta1-adrenergic receptor (beta1-AR), contain polyproline motifs within their intracellular domains. (duke.edu)
  • The protein encoded by this gene functions as a docking protein acting downstream of Tec tyrosine kinase in B cell antigen receptor signaling. (creativebiomart.net)
  • STAP1 has several biochemical functions, for example, SH3/SH2 adaptor activity, macrophage colony-stimulating factor receptor binding, phospholipid binding. (creativebiomart.net)
  • Title: STAP-2 protein promotes prostate cancer growth by enhancing epidermal growth factor receptor stabilization. (nih.gov)
  • Distinct phenotypes associated with IL-2 or IL-15 stimulation therefore arise through differential regulation of IL-2/15R signal strength and duration because of differences in cytokine-receptor binding affinity, receptor expression levels, physiological cytokine levels, and cytokine-receptor intracellular trafficking kinetics. (jimmunol.org)
  • Furthermore, we showed that miR-761 putatively targeted three proteins, thyroid hormone receptor interactor 6 (TRIP6), lamin A/C (LMNA), and NAD-dependent protein deacetylase sirtuin-3 (SIRT3). (bireme.br)
  • Receptor Activity-Modifying Proteins" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (harvard.edu)
  • This graph shows the total number of publications written about "Receptor Activity-Modifying Proteins" by people in Harvard Catalyst Profiles by year, and whether "Receptor Activity-Modifying Proteins" was a major or minor topic of these publication. (harvard.edu)
  • Below are the most recent publications written about "Receptor Activity-Modifying Proteins" by people in Profiles. (harvard.edu)
  • Loss of function of the melanocortin 2 receptor accessory protein 2 is associated with mammalian obesity. (harvard.edu)
  • Calcitonin receptor-like receptor (CLR), receptor activity-modifying protein 1 (RAMP1), and calcitonin gene-related peptide (CGRP) immunoreactivity in the rat trigeminovascular system: differences between peripheral and central CGRP receptor distribution. (harvard.edu)
  • Adrenomedullin and its receptor complexes in remnant kidneys of rats with renal mass ablation: decreased expression of calcitonin receptor-like receptor and receptor-activity modifying protein-3. (harvard.edu)
  • The aim of the present study was to investigate the mechanism of acute cellular xenograft rejection in a strain of mice with a targeted gene disruption of the toll-like receptor (TLR) signal adaptor protein MyD88. (diva-portal.org)
  • Ligand-activated epidermal growth factor receptor (EGFR/ErbB1) is ubiquitinated by Cbl ubiquitin ligase [ 1 ] and then sorted to the MVB and thus down-regulated to turn off the signalling response. (biochemsoctrans.org)
  • B cell linker protein (BLNK) and Src homology 2 domain-containing leukocyte protein of 76 kD (SLP-76) are adaptor proteins required for B cell receptor (BCR) and T cell receptor function, respectively. (nih.gov)
  • Selective accumulation of raft-associated membrane protein LAT in T cell receptor signaling assemblies. (nih.gov)
  • Activation of T cell antigen receptor (TCR) induces tyrosine phosphorylations that mediate the assembly of signaling protein complexes. (nih.gov)
  • The Ephrin ligands are also membrane-anchored and we now know that they too are able to act like a receptor to transduce signals into their own cell. (utsouthwestern.edu)
  • Thus, when a cell expressing an Eph receptor contacts a cell expressing an Ephrin ligand, novel bidirectional signals are transduced into both the Eph receptor-expressing cell (forward signaling) and the Ephrin ligand-expressing cell (reverse signaling). (utsouthwestern.edu)
  • Holland S, Gale N, Mbamalu G, Yancopoulos G, Henkemeyer M, Pawson T. Bidirectional signaling through the Eph family receptor Nuk and its transmembrane ligands. (utsouthwestern.edu)
  • These phenotypes are consistent with a role for Nck in signaling initiated by different classes of guidance receptors, including the EphA4 receptor tyrosine kinase. (pnas.org)
  • Consistent with this possibility, a number of guidance receptors can associate with Nck, including the B-type Eph receptors ( 3 , 4 ) and their transmembrane ephrin ligands ( 5 ), Robo ( 6 ) and the netrin receptor DCC ( 7 ), as well as cytoplasmic docking proteins such as Dok1 ( 3 ), disabled-1 ( 8 ), and p130 cas ( 9 ). (pnas.org)
  • Death Domain Receptor Signaling Adaptor Proteins" is a descriptor in the National Library of Medicine's controlled vocabulary thesaurus, MeSH (Medical Subject Headings) . (umassmed.edu)
  • Below are the most recent publications written about "Death Domain Receptor Signaling Adaptor Proteins" by people in Profiles. (umassmed.edu)
  • Following ligand binding and autophosphorylation, Met transmits intercellular signals using a unique multisubstrate docking site present within the C-terminal end of the receptor. (novusbio.com)
  • In 2011, two scientists were awarded the 2011 Nobel Prize in Physiology or Medicine for identifying receptor proteins, named Toll-like receptors, that recognize these microorganisms and activate innate immunity, the body's first line of defense. (medindia.net)
  • Soon after this discovery, scientists found MyD88, known as a critical adaptor or bottleneck protein to transduce Toll-like receptor signaling. (medindia.net)
  • Their results demonstrate for the first time that NTHi induces lysine 63 (K63)-linked polyubiquitination, a process that is critical for MyD88 to transduce Toll-like receptor signaling, of MyD88 in human epithelial cells and the mice. (medindia.net)
  • R. M. Vabulas, P. Ahmad-Nejad, S. Ghose, C. J. Kirschning, R. D. Issels, H. Wagner, HSP70 as endogenous stimulus of the Toll/Interleukin-1 receptor signal pathway. (sciencemag.org)
  • The protein encoded by this gene is a member of the TNF-receptor superfamily. (genecards.org)
  • TRAF adaptor proteins have been shown to bind to this receptor and transduce the signals leading to activation of NF-kappaB. (genecards.org)
  • TNFRSF9 (TNF Receptor Superfamily Member 9) is a Protein Coding gene. (genecards.org)
  • The tyrosine-phosphorylated receptor provides for docking sites for SH2 domain containing signal transducing molecules such as Grb2 and phospholipase-Cγ1. (rupress.org)
  • Therefore, it has been proposed that the phosphorylation of another protein, an as yet unknown EGF receptor substrate, is required for the efficient recruitment of EGF receptors into coated pits ( Lamaze and Schmid, 1995 ). (rupress.org)
  • EGF receptor activation leads to the phosphorylation of various proteins. (rupress.org)
  • The protein encoded by this gene is a member of the TNF-receptor superfamily, and contains an intracellular death domain. (nih.gov)
  • This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. (nih.gov)
  • A20 possesses both deubiquitinase (DUB) and ubiquitin E3 ligase activities that are required for termination of Toll-like receptor (TLR) signaling leading to NF-κB activation and for blockage of tumor necrosis factor (TNF)-induced cytotoxicity and apoptosis. (pubmedcentralcanada.ca)
  • CD137L is a two directional signal transducer that has a role as a ligand to TNFRSF9 aka 4-1BBR, which is a co-stimulation receptor protein in T lymphocytes. (prospecbio.com)
  • low density lipoprotein receptor adaptor pr. (broadinstitute.org)
  • This receptor transduces signals that lead to the activation of NF-kappaB and MAPK8/JNK. (abnova.com)
  • Adaptor proteins TRAF2 and TRAF5 have been shown to mediate the signaling process of this receptor. (abnova.com)
  • CD27-binding protein (SIVA), a proapoptotic protein, can bind to this receptor and is thought to play an important role in the apoptosis induced by this receptor. (abnova.com)
  • This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. (genecards.org)
  • We found, furthermore, that STAP-2 regulated LMP1-mediated NF-B signaling through direct or indirect interactions with the tumor necrosis factor receptor (TNFR)-associated factor 3 (TRAF3) and TNFR-associated death domain (TRADD) proteins. (environmental-expert.com)
  • Despite signaling through the same receptors, IL-2 and IL-15 have non-redundant roles in T cell biology, both physiologically and at the cellular level. (jimmunol.org)
  • A family of proteins that bind to CELL SURFACE RECEPTORS and alter their specificity, signaling mechanism, or mode of intracellular transport. (harvard.edu)
  • The intracellular signaling targets used by mammalian axon guidance receptors to organize the nervous system in vivo are unclear. (pnas.org)
  • Axon guidance depends on the integration of signals from activated receptors and adhesion molecules to the growth-cone cytoskeleton. (pnas.org)
  • Our understanding of the mechanisms involved in transducing signals from these receptors to the actin cytoskeleton to influence growth-cone turning remain incomplete. (pnas.org)
  • Nck adaptors are therefore candidate targets for cell-surface receptors that modify the actin cytoskeleton in processes such as axon guidance. (pnas.org)
  • Intracellular signaling adaptor proteins that bind to the cytoplasmic death domain region found on DEATH DOMAIN RECEPTORS. (umassmed.edu)
  • Many of the proteins in this class take part in intracellular signaling from TUMOR NECROSIS FACTOR RECEPTORS. (umassmed.edu)
  • NK cells express several activating and inhibitory receptors that recognize the altered expression of proteins on target cells and control the cytolytic function. (frontiersin.org)
  • After binding to their ligands, NK cell receptors trigger subsequent signaling conduction and then determine whether NK is activated or inhibited. (hindawi.com)
  • Most of inhibitory receptors, by identifying MHC class I molecules, conduct inhibitory signals to suppress NK cell function and participate in autoimmune tolerance under physiological conditions to avoid killing normal cells. (hindawi.com)
  • MyD88 interacts with receptors known as Toll-like receptors that detect invading pathogens, but until now it has remained unknown how MYD88-mediated signaling was controlled. (medindia.net)
  • These adaptor molecules are called TNFR-associated factors or TRAF's that binds to different regions in the cytoplasmic tail of the TNF family receptors and transduces the signal downstream. (wikipathways.org)
  • The information encoded by tissue and ECM stiffness is transduced into intracellular stiffness and force by integrins, the transmembrane adhesion receptors for ECM proteins, their associated focal adhesion proteins, and the actin cytoskeleton ( 10 - 14 ). (sciencemag.org)
  • R3 and R4 receptors are decoy receptors that do not transduce apoptotic signals. (bloodjournal.org)
  • Both receptors recruit a Fas-associated DD adapter protein and activate several upstream caspases including caspase 8 and caspase 10, in addition to cleaving Bid with subsequent activation of caspase 9. (bloodjournal.org)
  • CIN85 is a multidomain adaptor protein involved in Cbl-mediated down-regulation of epidermal growth factor (EGF) receptors. (diva-portal.org)
  • Substrate of protein kinase PTK6. (nih.gov)
  • Protein kinase Ciota (PKCiota) drives transformed growth of non-small cell lung cancer (NSCLC) cells through the Rho family GTPase Rac1. (nih.gov)
  • Signal-transducing adaptor protein-2 (STAP-2) was cloned as a c-fms/M-CSFR interacting protein in 2003, and the interaction with a variety of signaling or transcriptional molecules such as STAT5, MyD88 and IκB kinase ( IKK) in macrophages or T cells has been reported. (ashpublications.org)
  • By tandem MS, Thr 745 within this region, which localizes in a conserved binding site to the adaptor protein SETA [SH3 (Src homology 3) domain-containing, expressed in tumorigenic astrocytes] CIN85 (α-cyano-4-hydroxycinnamate)/SH3KBP1 (SH3-domain kinase-binding protein 1), is one of the phosphorylation sites in Xp95. (biochemj.org)
  • HGS/HRS (hepatocyte growth factor-regulated tyrosine kinase substrate) has been found to bind and counteract the function of this protein. (wikipedia.org)
  • Journal Article] Zipper-interacting protein kinase modulates canonical Wnt/beta-catenin signaling through interacting with Nemo-like kinase and T-cell factor 4. (nii.ac.jp)
  • The Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway is one of a handful of pleiotropic cascades used to transduce a multitude of signals for development and homeostasis in animals, from humans to flies. (kegg.jp)
  • We find that a subset of primary ZAP-70-deficient T cells, expressing high levels of the related protein-tyrosine kinase Syk, can proliferate in vitro. (cnrs.fr)
  • Catalytic subunits, IκB kinase α and IκB kinase β and the non-catalytic subunit IKKγ (also called NEMO) are also essential for RANKL-RANK signaling and osteoclastogenesis. (wikipathways.org)
  • We found that a pathway consisting of focal adhesion kinase (FAK), the adaptor protein p130Cas (Cas), and the guanosine triphosphatase Rac selectively transduced ECM stiffness into stable intracellular stiffness, increased the abundance of the cell cycle protein cyclin D1, and promoted S-phase entry. (sciencemag.org)
  • Several focal adhesion proteins, including focal adhesion kinase (FAK), the adapter proteins p130Cas (Cas) and paxillin, and the cytoskeletal protein vinculin, have been implicated in the initial stiffness-sensing event ( 13 , 15 - 22 ). (sciencemag.org)
  • The mitogen-activated protein kinase (MAPK) (also called extracellular signal-regulated kinase [ERK]) pathway has been implicated in malignant transformation and in the regulation of cellular growth and proliferation of several tumor types, but its expression and function in Hodgkin disease (HD) are unknown. (bloodjournal.org)
  • In mammalian cells, 3 major types of MAPK cascades have been identified: extracellular signal-regulated kinase 1/2 (ERK) 1/2 MAPK, Jun N-terminal kinase (JNK)/stress-activated protein kinase (SAPK) kinase, and p38 kinase. (bloodjournal.org)
  • In this entry, the domain is found in ADP-ribosylation factor-binding proteins and Hepatocyte growth factor-regulated tyrosine kinase substrates as well as vacuolar protein-sorting machinery proteins, amongst others. (embl-heidelberg.de)
  • Interaction of a mitogen-activated protein kinase signaling module wit" by Nyaya Kelkar, Shashi Gupta et al. (umassmed.edu)
  • The c-Jun NH(2)-terminal kinase (JNK) group of mitogen-activated protein kinases (MAPKs) is activated in response to the treatment of cells with inflammatory cytokines and by exposure to environmental stress. (umassmed.edu)
  • JNK activation is mediated by a protein kinase cascade composed of a MAPK kinase and a MAPK kinase kinase. (umassmed.edu)
  • Here we describe the molecular cloning of a putative molecular scaffold protein, JIP3, that binds the protein kinase components of a JNK signaling module and facilitates JNK activation in cultured cells. (umassmed.edu)
  • They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. (curehunter.com)
  • Journal Article] A Novel Role of the L-Type Calcium Channel α(1D) Subunit as a Gatekeeper for Intracellular Zinc Signaling: Zinc Wave. (nii.ac.jp)
  • Other members are defined as an S to reflect their short ITIM-lacking intracellular region (KIR2DS and KIR3DS), which associate with adaptor proteins through the transmembrane region. (hindawi.com)
  • These adaptor proteins help to deliver activating signals by means of immunoreceptor tyrosine-based activating motifs (ITAMs) in their intracellular region [ 9 , 10 ]. (hindawi.com)
  • Similar sequences were later found in many other intracellular signal-transducing proteins [ PMID: 1377638 ]. (ebi.ac.uk)
  • SH2 domains function as regulatory modules of intracellular signalling cascades by interacting with high affinity to phosphotyrosine-containing target peptides in a sequence-specific, SH2 domains recognise between 3-6 residues C-terminal to the phosphorylated tyrosine in a fashion that differs from one SH2 domain to another, and strictly phosphorylation-dependent manner [ PMID: 7883800 , PMID: 15335710 , PMID: 14731533 , PMID: 7531822 ]. (ebi.ac.uk)
  • Tissue and extracellular matrix (ECM) stiffness is transduced into intracellular stiffness, signaling, and changes in cellular behavior. (sciencemag.org)
  • We investigated how an initial sensing event is translated into intracellular stiffness and a biologically interpretable signal. (sciencemag.org)
  • Rac-dependent intracellular stiffening involved its binding partner lamellipodin, a protein that transmits Rac signals to the cytoskeleton during cell migration. (sciencemag.org)
  • Our findings establish that mechanotransduction by a FAK-Cas-Rac-lamellipodin signaling module converts the external information encoded by ECM stiffness into stable intracellular stiffness and mechanosensitive cell cycling. (sciencemag.org)
  • However, the mechanism by which ECM stiffness is transduced into intracellular stiffness and stiffness-dependent cell cycling, and whether these processes are mediated by all or some of the stiffness-sensing focal adhesion proteins, remains largely unknown. (sciencemag.org)
  • The combination of α and β subunit determines ligand specificity and intracellular signaling activity. (wiley.com)
  • This is a characteristic of the type III membrane protein of TNFR superfamily (extracellular N terminus, intracellular C terminus, lacking a signal peptide). (sdbonline.org)
  • UO126 modulated the levels of several intracellular proteins including B-cell lymphoma protein 2 (Bcl-2), myeloid cell leukemia-1 (Mcl-1) and caspase 8 homolog FLICE-inhibitory protein (cFLIP), and induced G 2 M cell-cycle arrest or apoptosis. (bloodjournal.org)
  • 4 - 10 Inhibition of Ras/MEK/ERK signaling has been shown to induce cell-cycle arrest and cell death by interfering with several intracellular survival and cell-cycle proteins. (bloodjournal.org)
  • STAP-2 association with Vav1, the guanine-nucleotide exchanging factor for Rac1, enhances downstream Vav1/Rac1 signaling. (nih.gov)
  • Moreover, we demonstrate that addition of both linker for activation of T cells (LAT) and Grb2-related adaptor downstream of Shc (Gads) to SLP-76 allow SLP-76 to be recruited into GEMs, whereby the BCR function is reconstituted. (nih.gov)
  • Binding of RANKL to RANK triggers downstream signaling events that leads to the activation of osteoclasts and controlling of lineage commitment. (wikipathways.org)
  • Several mitogen activated protein kinases (MAPK's) have been shown to be activated downstream of RANK. (wikipathways.org)
  • We previously reported that in murine hematopoietic Ba/F3 cells, signal transducing adaptor protein-2 (STAP-2) binds to BCR-ABL and up-regulates BCR-ABL phosphorylation, leading to enhanced activation of its downstream signaling molecules. (sigmaaldrich.com)
  • This study revealed that the signaling networks activated by IL-2 or IL-15 are highly similar and that T cell proliferation and metabolism are controlled in a quantitatively distinct manner through IL-2/15R signal strength independent of the cytokine identity. (jimmunol.org)
  • Shown in A) are five nuclear proteins ( LIN-1 , SUR-2 , LIN-25 , EOR-1 , EOR-2 ) that are jointly important for vulval, excretory duct and P12 cell fates. (wormbook.org)
  • Recombinant protein encompassing a sequence within the center region of human STAM. (genetex.com)
  • We found that the raft transmembrane protein linker for activation of T cells (LAT), but not a palmitoylation-deficient non-raft LAT mutant, strongly accumulated in TCR-enriched immunoisolates in a tyrosine phosphorylation-dependent manner. (nih.gov)
  • Horejsí V, Zhang W and Schraven B (2004) Transmembrane adaptor proteins: organizers of immunoreceptor signalling. (els.net)
  • Unlike other members of TNF family, OPG lack a transmembrane domain and is secreted as a soluble protein by the cell. (wikipathways.org)
  • 4-1BB-L is absent of a signal sequence and N-linked glycosylation domain, however comprises a ser/pro-rich site proximal to the transmembrane region which is comprised of O-linked carbohydrates. (prospecbio.com)
  • This allows CD172b to interact with a transmembrane signaling adaptor protein, DAP12/KARAP, and transduce stimulatory signals into cells. (bdbiosciences.com)
  • G protein beta gamma subunits stimulate phosphorylation of Shc adapter protein. (duke.edu)
  • Following our previous finding that Xp95, the Xenopus orthologue of Alix, undergoes a phosphorylation-dependent gel mobility shift during progesteroneinduced oocyte meiotic maturation, we explored potential regulation of Xp95/Alix by protein phosphorylation in hormone-induced cell cycle re-entry or M-phase induction. (biochemj.org)
  • These findings establish that Xp95/Alix is phosphorylated within the PRD during M-phase induction, and indicate that the phosphorylation may both positively and negatively modulate their interaction with partner proteins. (biochemj.org)
  • Examples of adaptor proteins include MYD88, Grb2 and SHC1. (wikipedia.org)
  • The findings, published in the Proceedings of the National Academy of Sciences , describe how myeloid differentiation factor (MyD88), a protein that plays a major role in mediating host defense response against invading pathogens, is tightly regulated to prevent uncontrolled inflammation. (medindia.net)
  • Dr. Jian-Dong Li, director of the Institute for Biomedical Sciences at Georgia State and a Georgia Research Alliance Eminent Scholar in Inflammation and Immunity, said, "Here we found for the first time that a protein called CYLD plays a critical role in controlling the pathogen-induced inflammatory response by targeting MyD88. (medindia.net)
  • More specifically, we found CYLD inhibits bacteria-induced signaling of MyD88 by deactivating MyD88 at a critical amino acid, lysine 231. (medindia.net)
  • When pathogens invade the body, this triggers the cell signaling pathway, and small proteins called ubiquitin proteins are added to MyD88 to activate it. (medindia.net)
  • To deactivate MyD88, ubiquitin proteins need to be removed, an inactivation process called deubiquitination. (medindia.net)
  • The pathway activated by Hsp70 depended on the TLR adaptor MyD88 and required the presence of a coreceptor, either CD14 or MD-2. (sciencemag.org)
  • In previous studies, we demonstrated that STAP-2 binds to MyD88 and IKK- or IKK-β and modulates NF-B signaling in macrophages. (environmental-expert.com)
  • These proteins tend to lack any intrinsic enzymatic activity themselves, instead mediating specific protein-protein interactions that drive the formation of protein complexes. (wikipedia.org)
  • Src homology 2 (SH2) and SH3 domains) that allow specific interactions with several other specific proteins. (wikipedia.org)
  • STAP1 has direct interactions with proteins and molecules. (creativebiomart.net)
  • The mammalian adaptor protein Alix [ALG-2 (apoptosis-linked-gene-2 product)-interacting protein X] belongs to a conserved family of proteins that have in common an N-terminal Bro1 domain and a C-terminal PRD (proline-rich domain), both of which mediate partner protein interactions. (biochemj.org)
  • One of these is His domain protein tyrosine phosphatase (HD-PTP/PTPN23), and we review the interactions involving HD-PTP and ESCRTs. (biochemsoctrans.org)
  • The primary goal of my laboratory is to understand the biochemical signals that regulate cell-cell interactions during embryonic development. (utsouthwestern.edu)
  • Such cellular responses are consistent with the ability of the Ephs and Ephrins to form protein-protein interactions with a number of molecules with known roles in cytoskeletal regulation. (utsouthwestern.edu)
  • The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. (senescence.info)
  • True to the nature of many other proteins involved in multimolecular complexes, also endocytosis-associated proteins, such as Eps15, clathrin and AP-2, are characterized by distinct domains which mediate the protein-protein interactions. (embl-heidelberg.de)
  • The pathway maps illustrate protein interactions and regulation to provide a comprehensive picture of signaling and disease processes. (bio-rad.com)
  • The ligand for Met is hepatocyte growth factor/scatter factor (HGF/SF) and while normal HGF/SF-Met signaling is required for embryonic development, abnormal Met signaling has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. (novusbio.com)
  • It recruits adaptor molecules to transduce the signal after ligand binding. (wikipathways.org)
  • We cloned an ubiquitous 80-kDa protein, identical to CD2-associated protein/Cas ligand with multiple SH3 domains (CD2AP/CMS), that interacts with Rab4-Q67L in the yeast two-hybrid system and in vitro. (rug.nl)
  • Most of the genes for the TNFR superfamily encode type I or III membrane proteins with one or more extracellular ligand-binding domains and a cytoplasmic region that activates cell functions. (sdbonline.org)
  • In theory, malignant cells that express protein antigens that either are unique to the tumor, vastly over-expressed by the tumor, or whose expression is at least restricted to a narrow range of self-tissues provides a potential immunologic handle whereby tumors may be specifically recognized and destroyed. (aacrjournals.org)
  • The presence of killed bacteria in the adjuvant clearly enhances immunity against vaccine proteins, but whether this effect occurred primarily through an activation of unknown innate immune mechanisms, or through bystander activation of lymphocytes via strong bacterial antigens, is a subject for discussion. (aacrjournals.org)
  • TRAF adaptor proteins bind to CD137 and transduce the signals which results to the activation of NF-kappaB. (prospecbio.com)
  • Mutations affecting RTK/Ras/MAPK signaling cause many human syndromes and diseases, including cancer ( Malumbres and Barbacid, 2002 ). (wormbook.org)
  • Both RTKs signal through the adaptor SEM-5 (Grb2) to activate the same core Ras/MAPK pathway. (wormbook.org)
  • For the induction of CCR7 expression, signals mediated by the MAPK/ERK pathway were critical in Ba/F3 cells expressing BCR-ABL and STAP-2. (sigmaaldrich.com)
  • The Nck1 and Nck2 SH2/SH3 adaptors (collectively Nck) can couple phosphotyrosine (pTyr) signals to reorganization of the actin cytoskeleton and are therefore candidates for linking guidance cues to the regulatory machinery of the cytoskeleton. (pnas.org)
  • Nck proteins contain a C-terminal SH2 domain that binds preferentially to pY-D-X-V motifs ( 1 ) and three N-terminal SH3 domains that associate with proteins implicated in the regulation of the actin cytoskeleton, including N-WASP and the Pak serine/threonine kinases ( 2 ). (pnas.org)
  • beta-Arrestin1 modulates lymphoid enhancer factor transcriptional activity through interaction with phosphorylated dishevelled proteins. (duke.edu)
  • Signal-transducing adaptor protein-2 modulates Fas-mediated T cell apoptosis by interacting with caspase-8. (nih.gov)
  • Annexin A7 modulates BAG4 and BAG4-binding proteins in mitochondrial apoptosis. (semanticscholar.org)
  • A key role in DNA repair was confirmed in vivo, in 2 different Hltf null mouse models and showed that Hltf loss compromises error-free DNA replication and modulates mutagenesis by regulating proteins involved in the G2/M phase transition of the cell cycle in mouse heart and brain. (inist.fr)
  • The Src homology 2 (SH2) domain is a protein domain of about 100 amino-acid residues first identified as a conserved sequence region between the oncoproteins Src and Fps [ PMID: 3025655 ]. (ebi.ac.uk)
  • CKI reproduces several properties of Wnt signals, including generation of complete dorsal axes, stabilization of beta-catenin and induction of genes that are direct targets of Wnt signals. (nih.gov)
  • In reciprocal loss of function experiments, loss of maternal beta-catenin signaling leads to loss of early dorsal dpr1 and dpr2 expression, whereas loss of Boz and/or Nodal signaling does not. (zfin.org)
  • One important family of proteins involved in mediating phosphotyrosine-based signals are the Nck adaptor proteins Nck1 and Nck2. (pnas.org)
  • The Dapper/Frodo family of proteins are Dishevelled-interacting regulators of Wnt signaling. (zfin.org)
  • In general, the extracellular domain of this family of proteins shows a relatively low level of sequence conservation, despite sharing a common fundamental structure. (sdbonline.org)
  • However, despite this sequence specificity, the Tsg101 UEV domain presumably did not evolve to bind viral P(S/T)AP sequences, and it is therefore reasonable to speculate that the Tsg101 UEV domain may bind P(S/T)AP elements found in cellular proteins. (rupress.org)
  • The domains are frequently found as repeats in a single protein sequence and will then often bind both mono- and di-phosphorylated substrates. (ebi.ac.uk)
  • The HIV Gag protein orchestrates viral assembly and budding, and forms the structural shell of the immature virus (for review see Göttlinger, 2001 ). (rupress.org)
  • Lewis CM, Broussard C, Czar MJ and Schwartzberg PL (2001) Tec kinases: modulators of lymphocyte signaling and development. (els.net)
  • The multisubstrate docking site mediates the binding of several adapter proteins such as Grb2, SHC, Crk/CRKL, and the large adapter protein Gab1. (novusbio.com)
  • STAP-2 negatively regulates both canonical and noncanonical NF-kappaB activation induced by Epstein-Barr virus-derived latent membrane protein 1. (nih.gov)
  • Rsp5p has several proteasome-independent functions in membrane protein trafficking, including a role in the ubiquitination of most plasma membrane proteins, leading to their endocytosis. (biochemsoctrans.org)
  • In the present review, we discuss recent examples illustrating the role of Rsp5p in membrane protein trafficking and providing new insights into the regulation of this E3 by adaptor proteins. (biochemsoctrans.org)
  • Plasma membrane proteins govern how cells sense their environment, and therefore, the surface levels of many of these proteins are subject to strict control. (biochemsoctrans.org)
  • A key device for exerting such control is the endocytic pathway, and of particular importance is determining the fate of internalised membrane proteins once they enter the early endosome. (biochemsoctrans.org)
  • Internalised plasma membrane proteins either recycle or are ubiquitinated and sorted to the MVB. (biochemsoctrans.org)
  • ESCRT complexes act in succession to facilitate the MVB sorting of ubiquitinated membrane proteins. (biochemsoctrans.org)
  • We employed a novel method to immunoisolate plasma membrane subfragments that were highly concentrated in activated TCR-CD3 complexes and associated signaling proteins. (nih.gov)
  • In contrast, other raft-associated molecules, including protein tyrosine kinases Lck and Fyn, GM1, and cholesterol, were not highly concentrated in TCR-enriched plasma membrane immunoisolates. (nih.gov)
  • Our results indicate that TCR signaling assemblies in plasma membrane subdomains, rather than generally concentrating raft-associated membrane proteins and lipids, form by a selective protein-mediated anchoring of the raft membrane protein LAT in vicinity of TCR. (nih.gov)
  • The HIV Gag and Hrs proteins are aligned to emphasize their similarities, with the NH 2 -terminal membrane-binding domains separated from the COOH-terminal protein-protein interaction domains by a vertical dashed line. (rupress.org)
  • DEDAF interacts with FADD and augments the formation of CD95/FADD/capase 8 complexes at the cell membrane, and interacts with DED-containing DNA biding protein (DEDD) in the nucleus indicating it is involved in the regulation of both cytoplasmic and nuclear events of apoptosis. (abcam.com)
  • Alignment analysis revealed that Wengen harbors a TNFR homology domain in the extracellular region and a membrane-spanning region without signal sequence. (sdbonline.org)
  • To investigate whether Wengen is indeed a type III membrane protein like the other TNFR superfamily members, its subcellular localization was examined. (sdbonline.org)
  • We suggest that in these proteins VHS serves as a membrane targeting domain which by its specific features together with FYVE, SH3 and/or TAM domains, which are also present in some VHS-containing proteins, is involved in the stage-specific assembly of the endocytic machinery. (embl-heidelberg.de)
  • Using an antiserum to the vesicular acetylcholine transporter (VAChT), a marker for cholinergic neurons, many unusually large VAChT-immunoreactive (-ir) nerve terminals, identified by colocalization with the synaptic vesicle protein synaptophysin, were demonstrated in the hypothalamic arcuate nucleus of obese tub/tub mice. (strategian.com)
  • Our phenotypic analysis of these mutant mice demonstrates that forward and reverse signaling is important for nerve axon pathfinding and synaptogenesis as the developing brain and spinal cord become wired. (utsouthwestern.edu)
  • Consistent with cell migration/adhesion and axon pathfinding defects observed in knockout mice, our biochemical and cellular studies indicate that forward and reverse signaling can induce a variety of cytoskeletal responses, including the disassembly of F-actin stress fibers and focal adhesions leading to, for example, growth cone collapse and axonal repulsion. (utsouthwestern.edu)
  • To date, analysis of the role of mammalian Nck proteins in neuronal development has been limited by the observation that mice homozygous for null alleles of either Nck1 or Nck2 alone appear normal, whereas mice lacking both Nck1 and Nck2 die at embryonic day 9.5 ( 12 ). (pnas.org)
  • Mice Lacking Nck Protein in the Developing Nervous System Exhibit Locomotor Defects. (pnas.org)
  • This monoclonal antibody is generated from mice immunized with purified recombinant protein encoding the catalytic domain of human Met. (novusbio.com)
  • Mice lacking NF-κB p50 and p52 proteins have been shown to be osteopetrotic. (wikipathways.org)
  • Apart from their role in osteoclast differentiation and function, RANKL-RANK signaling is also required for development of lymph node and lactating mammary glands in mice and in the establishment of thymic microenvironment. (wikipathways.org)
  • Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. (nih.gov)
  • Lymphocyte activation triggers multiple signalling cascades that converge in the cell nucleus to cause significant changes in the pattern of gene expression that determine the phenotype of activated lymphocytes and, ultimately, the type of immune response. (els.net)
  • LMP1 exerts its functions by initiating both antiapoptotic and proliferative growth factor-like signals, which are complex, have diverse outcomes, and share signaling cascades with CD40 and a combination of TNFRI and TNFRII ( 30 ). (pubmedcentralcanada.ca)
  • Signalling discussed with regards to adaptor proteins: Pawson, T. (1997). (wikipedia.org)
  • Lyakh L, Ghosh P and Rice NR (1997) Expression of NFAT-family proteins in normal human T cells. (els.net)
  • Cell death signals are transduced by death domain containing adapter molecules and members of the caspase family of proteases. (abcam.com)
  • The encoded protein contains an SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). (wikipedia.org)
  • These results strongly suggest that Wengen is required as a functional transducer of Eiger signaling (Kanda, 2002). (sdbonline.org)
  • However, the amino acid sequence of Wengen reveals that it has neither a TRAF2-binding domain nor a death domain in the cytoplasmic region, suggesting that there should be another mechanism to transduce signals (Kanda, 2002). (sdbonline.org)
  • The bar plot below shows the proportion of tumor samples that have any kind of altering mutation(s) in the given protein. (phosphosite.org)
  • HLTF is a tumor suppressor gene - In cancer, two mechanisms of HLTF inactivation are reported: (i) hypermethylation of its promoter and (ii) expression of truncated protein forms that have lost domains involved in DNA repair. (inist.fr)
  • TRAIL (APO2L) is a potent death protein belonging to the tumor necrosis factor (TNF) family. (bloodjournal.org)
  • Conclusions: Alterations in the mismatch repair proteins MSH2 and MLH1 and the direct repair protein MGMT may result from tumor development and/or progression. (medscimonit.com)
  • Antigen‐induced lymphocyte activation: the two‐signal paradigm. (els.net)
  • Later studies showed that activation of naïve T cells required not only a foreign antigenic signal supplied by the accessory (or antigen-presenting) cell, but also a second, or costimulatory signal supplied by antigen-presenting cell-expressed surface proteins designated, CD80 and CD86 (7) . (aacrjournals.org)
  • For example, the adaptor protein BS69 ( 25 ) and signal transducing adaptor protein-2 (STAP2) ( 26 ) block LMP1 activation of NF-κB. (pubmedcentralcanada.ca)
  • Mammalian target of rapamycin (mTOR) is a component of a signaling pathway (PTEN/PI3K/AKT) that is frequently dysregulated in cancer. (jci.org)
  • PI3K/AKT Signaling Regulates H3K4 Methylation in Breast Cancer. (harvard.edu)
  • Regulation of FcepsilonRI-mediated signaling by an adaptor protein STAP-2/BSK in rat basophilic leukemia RBL-2H3 cells. (nih.gov)
  • Signal-transducing adaptor protein-2 promotes generation of functional long-term memory CD8+ T cells by preventing terminal effector differentiation. (nih.gov)
  • Signal-transducing adaptor protein-2 regulates stromal cell-derived factor-1 alpha-induced chemotaxis in T cells. (nih.gov)
  • Our data define a PKCiota-Par6alpha-Rac1 signaling axis that drives anchorage-independent growth and invasion of NSCLC cells through induction of MMP-10 expression. (nih.gov)
  • It has been reported that hematopoietic stem and progenitor cells (HSPC) are targets of pathogen products and danger signals. (ashpublications.org)
  • Interestingly, an enhanced p53 protein induction response was observed in HCT116 3-6 (MLH1+) compared with HCT116 (MLH1-) cells after IR or 6-TG. (biomedsearch.com)
  • Retroviral vector-mediated expression of the E6 protein did not, however, affect the enhanced G2-M cell cycle arrest observed in HCT116 3-6 compared with MLH1-deficient HCT116 cells. (biomedsearch.com)
  • MLH1-mediated G2-M cell cycle delay (caused by either MMR proofreading of DNA lesions or by a direct function of the MLH1 protein in cell cycle arrest) may be important for DNA damage detection and repair prior to chromosome segregation to eliminate carcinogenic lesions (possibly brought on by misrepair) in daughter cells. (biomedsearch.com)
  • Altered signaling of TNFalpha-TNFR1 and SODD/BAG4 is responsible for radioresistance in human HT-R15 cells. (semanticscholar.org)
  • Journal Article] Signaltransducing adaptor protein-2 regulates stromal cell-derived factor-1 alpha-induced chemotaxis in T cells. (nii.ac.jp)
  • However, a preliminary awakening of APC by exogenous or endogenous alarm signals from distressed/injured cells is critical to recruit and drive an efficient T cell activation. (frontiersin.org)
  • How can it be that proteins, describable by the laws of physics, assemble themselves into cellular machines and structures, these into complete living cells, and the latter into whole organisms that require a whole new language for their description? (genomicglossaries.com)
  • These uterine NK cells secrete IL-8, vascular endothelial growth factor (VEGF), stromal cell-derived factor-1, and interferon gamma-inducible protein-10 (IP-10) which help in tissue building, remodeling, and angiogenesis ( 4 ). (frontiersin.org)
  • Multiple factors such as cell-intrinsic signals (transcription factors) and external signals (cytokines and growth factors) govern the development of NK cells. (frontiersin.org)
  • A theory that is emerging is that the innate immune system may also be activated by endogenous ligands released from cells during necrotic cell death, thus producing a "danger" signal for the immune system. (sciencemag.org)
  • both show that the TLR2 and TLR4 are able to transduce a signal upon treatment of cells with the heat shock protein Hsp70. (sciencemag.org)
  • Although the true test of this concept of the danger signal awaits an in vivo assay, the idea of the release of signaling factors by dying cells is an intriguing one. (sciencemag.org)
  • Knockdown of endogenous A20 in Raji cells by expression of A20 short hairpin RNA (shRNA) vectors increases endogenous IRF7 activity and ubiquitination, as well as the protein level of LMP1, a target of IRF7. (pubmedcentralcanada.ca)
  • LMP1 is the only EBV protein that also has oncogenic potential in non-B cells. (pubmedcentralcanada.ca)
  • Indeed, STAP-2 associated with LMP1 through its PH and SH2-like domains, and these proteins interacted with each other in EBV-positive human B cells. (environmental-expert.com)
  • Adaptor proteins contain a variety of protein-binding modules that link protein-binding partners together and facilitate the creation of larger signaling complexes. (wikipedia.org)
  • This machinery is termed the ESCRT (endosomal sorting complexes required for transport) pathway, a series of multi-protein complexes and accessory factors first identified in yeast. (biochemsoctrans.org)
  • The molecular machinery that drives MVB sorting is termed the endosomal sorting complexes required for transport (ESCRT) pathway, a series of multi-protein complexes first identified in the yeast Saccharomyces cerevisiae ( Table 1 and Figure 2 ). (biochemsoctrans.org)
  • These results indicate that Cbl regulates STAP-2 protein levels and Brk/STAP-2-mediated STAT3 activation. (nih.gov)
  • Defective expression of the DNA mismatch repair protein, MLH1, alters G2-M cell cycle checkpoint arrest following ionizing radiation. (biomedsearch.com)
  • A role for the Mut L homologue-1 (MLH1) protein, a necessary component of DNA mismatch repair (MMR), in G2-M cell cycle checkpoint arrest after 6-thioguanine (6-TG) exposure was suggested previously. (biomedsearch.com)
  • Expression of the mismatch repair (MMR) proteins hMSH2, hMSH6 and hMLH1 was evaluated by immunohistochemistry. (uni-regensburg.de)
  • The KDM5A/RBP2 histone demethylase represses NOTCH signaling to sustain neuroendocrine differentiation and promote small cell lung cancer tumorigenesis. (harvard.edu)
  • This work is revealing that the control of body and organ size does not reside in any specific cellular or molecular mechanism but that it is a systems property in which cellular, physiological and environmental signals all contribute in inextricable ways to produce the final phenotype. (duke.edu)
  • Exogenous signals are a group of widespread natural microbial patterns called "pathogen-associated molecular patterns" (PAMP) and are supposed to be translocated from the microbiota in case of body natural barrier weakness, especially gut mucosa. (frontiersin.org)
  • The apparent molecular mass of both proteins is 142 kD, and they consist of three structural domains. (rupress.org)
  • This separation has given rise to individual proteins and other generalized molecular structures that serve to distinguish microbes from men. (aacrjournals.org)
  • Most Rsp5p substrates do not carry PY motifs, but some may depend on PY-containing proteins for their ubiquitination by Rsp5p, consistent with the latter's acting as specificity factors or adaptors. (biochemsoctrans.org)
  • It contains SRC HOMOLOGY DOMAINS and is closely related to its cellular homolog, PROTO-ONCOGENE PROTEIN C-CRK. (curehunter.com)
  • Even in the absence of any other viral proteins, HIV-1 Gag can form extracellular virus-like particles (VLPs) that resemble authentic HIV virions. (rupress.org)
  • Negative Regulation of Cytokine Signaling in Immunity. (pubfacts.com)
  • Interestingly, the delayed addition of CyP to DCs responding to LPS strongly inhibited signaling and cytokine production by immediate down-regulation of inflammatory cytokine mRNAs while not affecting other aspects of DC maturation, such as expression of major histocompatibility complex molecules, costimulatory molecules, and CCR7. (rupress.org)
  • 25825441 ). In TLR4 signaling, physically bridges TLR4 and TICAM1 and functionally transmits signal to TICAM1 in early endosomes after endocytosis of TLR4. (uniprot.org)
  • Proposed to inhibit LPS-TLR4 signaling at the late endosome by interaction with isoform 1 thereby disrupting the association of isoform 1 with TICAM1. (uniprot.org)
  • Xu NJ, Henkemeyer M. Ephrin-B3 reverse signaling through Grb4 and cytoskeletal regulators mediates axon pruning. (utsouthwestern.edu)
  • The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. (nih.gov)
  • Recombinant protein corresponding to full-length human CD27. (abnova.com)
  • The protein content of an adaptor protein, STAP-2 is controlled by E3 ubiquitin ligase Cbl. (nih.gov)
  • As in other ubiquitin-conjugating systems, these adaptors are also Rsp5p substrates and undergo ubiquitin-dependent trafficking. (biochemsoctrans.org)

No images available that match "adaptor proteins signal transducing"