AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesTechnology, Industry, AgricultureInformation Science
Acyl-CoA OxidaseAcyl Coenzyme ADiacylglycerol O-AcyltransferaseSterol O-AcyltransferaseNADPH OxidaseAcyltransferasesCoenzyme ACoenzyme A LigasesCytochrome-c Oxidase DeficiencyRare DiseasesMicrobodiesOxidoreductasesLeigh DiseaseOrphan Drug ProductionClofibrateAcetaminophenDrug-Induced Liver InjuryLiverGene Expression ProfilingPeroxisome ProliferatorsProtective AgentsKupffer CellsLiver Diseases, AlcoholicCell TransdifferentiationAnalgesics, Non-NarcoticOpuntiaPeroxisomesCactaceaeAsparagus PlantMicrogliaCatalaseLeukodystrophy, Globoid CellSphingolipidosesOsteopetrosisAspartylglucosaminuriaLeukodystrophy, Metachromaticalpha-MannosidosisAdrenoleukodystrophyAcyl-CoA DehydrogenasesAcyl-CoA DehydrogenaseAcyl-CoA Dehydrogenase, Long-ChainAlgorithmsButyryl-CoA DehydrogenaseLipid Metabolism, Inborn ErrorsMolecular Sequence Data
Acyl-CoA Oxidase
An enzyme that catalyzes the first and rate-determining steps of peroxisomal beta-oxidation of fatty acids. It acts on COENZYME A derivatives of fatty acids with chain lengths from 8 to 18, using FLAVIN-ADENINE DINUCLEOTIDE as a cofactor.
Acyl Coenzyme A
S-Acyl coenzyme A. Fatty acid coenzyme A derivatives that are involved in the biosynthesis and oxidation of fatty acids as well as in ceramide formation.
Diacylglycerol O-Acyltransferase
An enzyme that catalyses the last step of the TRIACYLGLYCEROL synthesis reaction in which diacylglycerol is covalently joined to LONG-CHAIN ACYL COA to form triglyceride. It was formerly categorized as EC 2.3.1.124.
Sterol O-Acyltransferase
An enzyme that catalyzes the formation of cholesterol esters by the direct transfer of the fatty acid group from a fatty acyl CoA derivative. This enzyme has been found in the adrenal gland, gonads, liver, intestinal mucosa, and aorta of many mammalian species. EC 2.3.1.26.
NADPH Oxidase
A flavoprotein enzyme that catalyzes the univalent reduction of OXYGEN using NADPH as an electron donor to create SUPEROXIDE ANION. The enzyme is dependent on a variety of CYTOCHROMES. Defects in the production of superoxide ions by enzymes such as NADPH oxidase result in GRANULOMATOUS DISEASE, CHRONIC.
Acyltransferases
Enzymes from the transferase class that catalyze the transfer of acyl groups from donor to acceptor, forming either esters or amides. (From Enzyme Nomenclature 1992) EC 2.3.
Coenzyme A
Coenzyme A Ligases
Enzymes that catalyze the formation of acyl-CoA derivatives. EC 6.2.1.
Cytochrome-c Oxidase Deficiency
A disease that results from a congenital defect in ELECTRON TRANSPORT COMPLEX IV. Defects in ELECTRON TRANSPORT COMPLEX IV can be caused by mutations in the SURF1, SCO2, COX10, or SCO1 genes. ELECTRON TRANSPORT COMPLEX IV deficiency caused by mutation in SURF1 manifests itself as LEIGH DISEASE; that caused by mutation in SCO2 as fatal infantile cardioencephalomyopathy; that caused by mutation in COX10 as tubulopathy and leukodystrophy; and that caused by mutation in SCO1 as early-onset hepatic failure and neurologic disorder. (from Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim, MIM#220110, May 17, 2001)
Rare Diseases
A large group of diseases which are characterized by a low prevalence in the population. They frequently are associated with problems in diagnosis and treatment.
Microbodies
Electron-dense cytoplasmic particles bounded by a single membrane, such as PEROXISOMES; GLYOXYSOMES; and glycosomes.
Oxidoreductases
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
Leigh Disease
A group of metabolic disorders primarily of infancy characterized by the subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, dysphagia, and lactic acidosis. Pathological features include spongy degeneration of the neuropile of the basal ganglia, thalamus, brain stem, and spinal cord. Patterns of inheritance include X-linked recessive, autosomal recessive, and mitochondrial. Leigh disease has been associated with mutations in genes for the PYRUVATE DEHYDROGENASE COMPLEX; CYTOCHROME-C OXIDASE; ATP synthase subunit 6; and subunits of mitochondrial complex I. (From Menkes, Textbook of Child Neurology, 5th ed, p850).
Orphan Drug Production
Production of drugs or biologicals which are unlikely to be manufactured by private industry unless special incentives are provided by others.
Clofibrate
A fibric acid derivative used in the treatment of HYPERLIPOPROTEINEMIA TYPE III and severe HYPERTRIGLYCERIDEMIA. (From Martindale, The Extra Pharmacopoeia, 30th ed, p986)
Acetaminophen
Analgesic antipyretic derivative of acetanilide. It has weak anti-inflammatory properties and is used as a common analgesic, but may cause liver, blood cell, and kidney damage.
Drug-Induced Liver Injury
A spectrum of clinical liver diseases ranging from mild biochemical abnormalities to ACUTE LIVER FAILURE, caused by drugs, drug metabolites, and chemicals from the environment.
Liver
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
Gene Expression Profiling
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
Peroxisome Proliferators
A class of nongenotoxic CARCINOGENS that induce the production of hepatic PEROXISOMES and induce hepatic neoplasms after long-term administration.
Protective Agents
Synthetic or natural substances which are given to prevent a disease or disorder or are used in the process of treating a disease or injury due to a poisonous agent.
Kupffer Cells
Specialized phagocytic cells of the MONONUCLEAR PHAGOCYTE SYSTEM found on the luminal surface of the hepatic sinusoids. They filter bacteria and small foreign proteins out of the blood, and dispose of worn out red blood cells.
Liver Diseases, Alcoholic
Liver diseases associated with ALCOHOLISM. It usually refers to the coexistence of two or more subentities, i.e., ALCOHOLIC FATTY LIVER; ALCOHOLIC HEPATITIS; and ALCOHOLIC CIRRHOSIS.
Cell Transdifferentiation
A naturally occurring phenomenon where terminally differentiated cells dedifferentiate to the point where they can switch CELL LINEAGES. The cells then differentiate into other cell types.
Analgesics, Non-Narcotic
A subclass of analgesic agents that typically do not bind to OPIOID RECEPTORS and are not addictive. Many non-narcotic analgesics are offered as NONPRESCRIPTION DRUGS.
Opuntia
A plant genus of the family CACTACEAE. Species with cylindrical joints are called Cholla; flat jointed ones are Prickly-pear.
Peroxisomes
Microbodies which occur in animal and plant cells and in certain fungi and protozoa. They contain peroxidase, catalase, and allied enzymes. (From Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd ed)
Cactaceae
The cactus plant family of the order Caryophyllales, subclass Caryophyllidae, class Magnoliopsida. Cacti are succulent perennial plants well adapted to dry regions.
Asparagus Plant
A plant genus in the family LILIACEAE (sometimes placed in Asparagaceae) that contains ECDYSTEROIDS and is an ingredient of Siotone. The shoots are used as a vegetable and the roots are used in FOLK MEDICINE.
Microglia
The third type of glial cell, along with astrocytes and oligodendrocytes (which together form the macroglia). Microglia vary in appearance depending on developmental stage, functional state, and anatomical location; subtype terms include ramified, perivascular, ameboid, resting, and activated. Microglia clearly are capable of phagocytosis and play an important role in a wide spectrum of neuropathologies. They have also been suggested to act in several other roles including in secretion (e.g., of cytokines and neural growth factors), in immunological processing (e.g., antigen presentation), and in central nervous system development and remodeling.
Catalase
An oxidoreductase that catalyzes the conversion of HYDROGEN PEROXIDE to water and oxygen. It is present in many animal cells. A deficiency of this enzyme results in ACATALASIA.
Leukodystrophy, Globoid Cell
An autosomal recessive metabolic disorder caused by a deficiency of GALACTOSYLCERAMIDASE leading to intralysosomal accumulation of galactolipids such as GALACTOSYLCERAMIDES and PSYCHOSINE. It is characterized by demyelination associated with large multinucleated globoid cells, predominantly involving the white matter of the central nervous system. The loss of MYELIN disrupts normal conduction of nerve impulses.
Sphingolipidoses
A group of inherited metabolic disorders characterized by the intralysosomal accumulation of SPHINGOLIPIDS primarily in the CENTRAL NERVOUS SYSTEM and to a variable degree in the visceral organs. They are classified by the enzyme defect in the degradation pathway and the substrate accumulation (or storage). Clinical features vary in subtypes but neurodegeneration is a common sign.
Osteopetrosis
Excessive formation of dense trabecular bone leading to pathological fractures; OSTEITIS; SPLENOMEGALY with infarct; ANEMIA; and extramedullary hemopoiesis (HEMATOPOIESIS, EXTRAMEDULLARY).
Aspartylglucosaminuria
A recessively inherited, progressive lysosomal storage disease caused by a deficiency of GLYCOSYLASPARAGINASE activity. The lack of this enzyme activity results in the accumulation of N-acetylglucosaminylasparagine (the linkage unit of asparagine-linked glycoproteins) in LYSOSOMES.
Leukodystrophy, Metachromatic
An autosomal recessive metabolic disease caused by a deficiency of CEREBROSIDE-SULFATASE leading to intralysosomal accumulation of cerebroside sulfate (SULFOGLYCOSPHINGOLIPIDS) in the nervous system and other organs. Pathological features include diffuse demyelination, and metachromatically-staining granules in many cell types such as the GLIAL CELLS. There are several allelic and nonallelic forms with a variety of neurological symptoms.
alpha-Mannosidosis
An inborn error of metabolism marked by a defect in the lysosomal isoform of ALPHA-MANNOSIDASE activity that results in lysosomal accumulation of mannose-rich intermediate metabolites. Virtually all patients have psychomotor retardation, facial coarsening, and some degree of dysostosis multiplex. It is thought to be an autosomal recessive disorder.
Adrenoleukodystrophy
An X-linked recessive disorder characterized by the accumulation of saturated very long chain fatty acids in the LYSOSOMES of ADRENAL CORTEX and the white matter of CENTRAL NERVOUS SYSTEM. This disease occurs almost exclusively in the males. Clinical features include the childhood onset of ATAXIA; NEUROBEHAVIORAL MANIFESTATIONS; HYPERPIGMENTATION; ADRENAL INSUFFICIENCY; SEIZURES; MUSCLE SPASTICITY; and DEMENTIA. The slowly progressive adult form is called adrenomyeloneuropathy. The defective gene ABCD1 is located at Xq28, and encodes the adrenoleukodystrophy protein (ATP-BINDING CASSETTE TRANSPORTERS).
Acyl-CoA Dehydrogenases
Enzymes that catalyze the first step in the beta-oxidation of FATTY ACIDS.
Acyl-CoA Dehydrogenase
A flavoprotein oxidoreductase that has specificity for medium-chain fatty acids. It forms a complex with ELECTRON TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.
Acyl-CoA Dehydrogenase, Long-Chain
A flavoprotein oxidoreductase that has specificity for long-chain fatty acids. It forms a complex with ELECTRON-TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.
Algorithms
A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.
Butyryl-CoA Dehydrogenase
A flavoprotein oxidoreductase that has specificity for short-chain fatty acids. It forms a complex with ELECTRON-TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.
Lipid Metabolism, Inborn Errors
Errors in the metabolism of LIPIDS resulting from inborn genetic MUTATIONS that are heritable.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.

The peroxisome proliferator (PP) response element upstream of the human acyl CoA oxidase gene is inactive among a sample human population: significance for species differences in response to PPs. (1/269)

Peroxisome proliferators (PP) cause peroxisome proliferation, associated with rodent hepatocyte growth perturbation and hepatocarcinogenesis. However, in humans this class of non-genotoxic carcinogens does not appear to have the same adverse effects. The peroxisome proliferator-activated receptor alpha (PPARalpha) mediates the effects of PPs in rodents via peroxisome proliferator response elements (PPREs) upstream of PP-responsive genes such as acyl coenzyme A oxidase (ACO). When the human ACO promoter was cloned previously, it was found to be active and to contain a consensus PPRE (-1918 AGGTCA C TGGTCA -1906). To confirm and extend those original findings, we isolated a 2 kb genomic fragment of the ACO gene promoter from a human liver biopsy and used it to create a beta-galactosidase reporter gene plasmid. The human ACO promoter reporter plasmid was added to both Hepalclc7 and NIH 3T3 cells together with a plasmid expressing mPPARa and assessed for its ability to drive PP-mediated gene transcription. The human ACO promoter fragment was inactive, unlike the equivalent rat ACO promoter fragment used as a positive control. The PPRE within our cloned fragment of the human ACO promoter differed at three positions (5'-AGGTCA G CTGTCA-3') from the previously published active human ACO promoter. Next, we studied the frequency of the inactive versus the active human PPRE within the human population. Using a PCR strategy, we isolated and analysed genomic DNA fragments from 22 unrelated human individuals and from the human hepatoma cell line HepG2. In each case, the PPRE contained the inactive sequence. These data show that the human ACO gene promoter found in a sample human population is inactive. This may explain at the genomic level the lack of response of humans to some of the adverse effects of the PP class of non-genotoxic hepatocarcinogens.  (+info)

Oxidation of medium-chain acyl-CoA esters by extracts of Aspergillus niger: enzymology and characterization of intermediates by HPLC. (2/269)

The activities of beta-oxidation enzymes were measured in extracts of glucose- and triolein-grown cells of Aspergillus niger. Growth on triolein stimulated increased enzyme activity, especially for acyl-CoA dehydrogenase. No acyl-CoA oxidase activity was detected. HPLC analysis after incubation of triolein-grown cell extracts with decanoyl-CoA showed that beta-oxidation was limited to one cycle. Octanoyl-CoA accumulated as the decanoyl-CoA was oxidized. Beta-oxidation enzymes in isolated mitochondrial fractions were also studied. The results are discussed in the context of methyl ketone production by fungi.  (+info)

Beneficial effects of fibrates on apolipoprotein A-I metabolism occur independently of any peroxisome proliferative response. (3/269)

BACKGROUND: In humans, fibrates are frequently used normolipidemic drugs. Fibrates act by regulating genes involved in lipoprotein metabolism via activation of the peroxisome proliferator-activated receptor-alpha (PPARalpha) in liver. In rodents, however, fibrates induce a peroxisome proliferation, leading to hepatomegaly and possibly hepatocarcinogenesis. Although this peroxisome proliferative response appears not to occur in humans, it remains controversial whether the beneficial effects of fibrates on lipoprotein metabolism can occur dissociated from such undesirable peroxisomal response. Here, we assessed the influence of fenofibrate on lipoprotein metabolism and peroxisome proliferation in the rabbit, an animal that, contrary to rodents and similar to humans, is less sensitive to peroxisome proliferators. METHODS AND RESULTS: First, we demonstrate that in normal rabbits, fenofibrate given at a high dose for 2 weeks does not influence serum concentrations or intestinal mRNA levels of the HDL apolipoprotein apoA-I. Therefore, the study was continued with human apoA-I transgenic rabbits that overexpress the human apoA-I gene under control of its homologous promoter, including its PPAR-response elements. In these animals, fenofibrate increases serum human apoA-I concentrations via an increased expression of the human apoA-I gene in liver. Interestingly, liver weight or mRNA levels and activity of fatty acyl-CoA oxidase, a rate-limiting and marker enzyme of peroxisomal beta-oxidation, remain unchanged after fenofibrate. CONCLUSIONS: Expression of the human apoA-I transgene in rabbit liver suffices to confer fibrate-mediated induction of serum apoA-I. Furthermore, these data provide in vivo evidence that the beneficial effects of fibrates on lipoprotein metabolism occur mechanistically dissociated from any deleterious activity on peroxisome proliferation and possibly hepatocarcinogenesis.  (+info)

Absence of spontaneous peroxisome proliferation in enoyl-CoA Hydratase/L-3-hydroxyacyl-CoA dehydrogenase-deficient mouse liver. Further support for the role of fatty acyl CoA oxidase in PPARalpha ligand metabolism. (4/269)

Peroxisomes contain a classical L-hydroxy-specific peroxisome proliferator-inducible beta-oxidation system and also a second noninducible D-hydroxy-specific beta-oxidation system. We previously generated mice lacking fatty acyl-CoA oxidase (AOX), the first enzyme of the L-hydroxy-specific classical beta-oxidation system; these AOX-/- mice exhibited sustained activation of peroxisome proliferator-activated receptor alpha (PPARalpha), resulting in profound spontaneous peroxisome proliferation in liver cells. These observations implied that AOX is responsible for the metabolic degradation of PPARalpha ligands. In this study, the function of enoyl-CoA hydratase/L-3-hydroxyacyl-CoA dehydrogenase (L-PBE), the second enzyme of this peroxisomal beta-oxidation system, was investigated by disrupting its gene. Mutant mice (L-PBE-/-) were viable and fertile and exhibited no detectable gross phenotypic defects. L-PBE-/- mice showed no hepatic steatosis and manifested no spontaneous peroxisome proliferation, unlike that encountered in livers of mice deficient in AOX. These results indicate that disruption of classical peroxisomal fatty acid beta-oxidation system distal to AOX step does not interfere with the inactivation of endogenous ligands of PPARalpha, further confirming that the AOX gene is indispensable for the physiological regulation of this receptor. The absence of appreciable changes in lipid metabolism also indicates that enoyl-CoAs, generated in the classical system in L-PBE-/- mice are diverted to D-hydroxy-specific system for metabolism by D-PBE. When challenged with a peroxisome proliferator, L-PBE-/- mice showed increases in the levels of hepatic mRNAs and proteins that are regulated by PPARalpha except for appreciable blunting of peroxisome proliferative response as compared with that observed in hepatocytes of wild type mice similarly treated. This blunting of peroxisome proliferative response is attributed to the absence of L-PBE protein in L-PBE-/- mouse liver, because all other proteins are induced essentially to the same extent in both wild type and L-PBE-/- mice.  (+info)

Activation of flavin-containing oxidases underlies light-induced production of H2O2 in mammalian cells. (5/269)

Violet-blue light is toxic to mammalian cells, and this toxicity has been linked with cellular production of H2O2. In this report, we show that violet-blue light, as well as UVA, stimulated H2O2 production in cultured mouse, monkey, and human cells. We found that H2O2 originated in peroxisomes and mitochondria, and it was enhanced in cells overexpressing flavin-containing oxidases. These results support the hypothesis that photoreduction of flavoproteins underlies light-induced production of H2O2 in cells. Because H2O2 and its metabolite, hydroxyl radicals, can cause cellular damage, these reactive oxygen species may contribute to pathologies associated with exposure to UVA, violet, and blue light. They may also contribute to phototoxicity often encountered during light microscopy. Because multiphoton excitation imaging with 1,047-nm wavelength prevented light-induced H2O2 production in cells, possibly by minimizing photoreduction of flavoproteins, this technique may be useful for decreasing phototoxicity during fluorescence microscopy.  (+info)

Impairment of peroxisomal biogenesis in human colon carcinoma. (6/269)

Peroxisomes and the activities of their enzymes have been reported to be significantly reduced in various types of tumors including the colon carcinoma. Therefore, the present study was designed to investigate the gene expression of several peroxisomal proteins in human colon carcinoma and additionally those of the peroxisome proliferator activated receptor alpha (PPARalpha) and PEX5, a receptor protein involved in the import of most peroxisomal matrix proteins. Samples from adenocarcinomas and adjacent normal colon were analyzed by immunohistochemistry and western blotting. The mRNA content was assessed by a novel sensitive dot blot RNase protection assay and northern blotting. By immunohistochemistry, peroxisomes were distinctly visualized in normal colonocytes but were not detected in colon carcinoma cells. The protein levels of catalase (CAT), acyl-CoA oxidase as well as the 22 and 70 kDa peroxisomal membrane proteins (PMP22 and PMP70) were all significantly decreased in carcinomas. The corresponding mRNAs for CAT and PMP70, however, were unchanged. In contrast, the mRNA of PEX5 was significantly increased. The expression of PPARalpha was not altered in tumors, neither at protein nor mRNA levels. These observations show that the reduction of peroxisomes and their proteins in colon carcinoma is not due to a generalized reduction of transcription of their genes. It seems more likely that this phenomenon is regulated at a post-transcriptional or translational level. Alternatively, and more likely, an impairment of the biogenesis of the organelle could account for the paucity of peroxisomes in colon carcinoma.  (+info)

Arachidonic acid and PGE2 regulation of hepatic lipogenic gene expression. (7/269)

N-6 polyunsaturated fatty acids (PUFA) suppress hepatic and adipocyte de novo lipogenesis by inhibiting the transcription of genes encoding key lipogenic proteins. In cultured 3T3-L1 adipocytes, arachidonic acid (20:4,n-6) suppression of lipogenic gene expression requires cyclooxygenase (COX) activity. In this study, we found no evidence to support a role for COX-1 or -2 in the 20:4,n-6 inhibition of hepatocyte lipogenic gene expression. In contrast to L1 preadipocytes, adipocytes and rat liver, RT-PCR and Western analyses did not detect COX-1 or COX-2 expression in cultured primary hepatocytes. Moreover, the COX inhibitor, flurbiprofen, did not affect the 20:4,n-6 regulation of lipogenic gene expression in primary hepatocytes. Despite the absence of COX-1 and -2 expression in primary hepatocytes, prostaglandins (PGE2 and PGF2alpha) suppressed fatty acid synthase, l-pyruvate kinase, and the S14 protein mRNA, while having no effect on acyl-CoA oxidase or CYP4A2 mRNA. Using PGE2 receptor agonist, the PGE2 effect on lipogenic gene expression was linked to EP3 receptors. PGE2 inhibited S14CAT activity in transfected primary hepatocytes and targeted the S14 PUFA-response region located -220 to -80 bp upstream from the transcription start site. Taken together, these studies show that COX-1 and COX-2 do not contribute to the n-6 PUFA suppression of hepatocyte lipogenic gene expression. However, cyclooxygenase products from non-parenchymal cells can act on parenchymal cells through a paracrine process and mimic the effects of n-6 PUFA on lipogenic gene expression.  (+info)

Novel form of lipolysis induced by leptin. (8/269)

Hyperleptinemia causes disappearance of body fat without a rise in free fatty acids (FFA) or ketones, suggesting that leptin can deplete adipocytes of fat without releasing FFA. To test this, we measured FFA and glycerol released from adipocytes obtained from normal lean Zucker diabetic fatty rats (+/+) and incubated for 0, 3, 6, or 24 h in either 20 ng/ml recombinant leptin or 100 nM norepinephrine (NE). Whereas NE increased both FFA and glycerol release from adipocytes of +/+ rats, leptin increased glycerol release in +/+ adipocytes without a parallel increase in FFA release. In adipocytes of obese Zucker diabetic fatty rats (fa/fa) with defective leptin receptors, NE increased both FFA and glycerol release, but leptin had no effect on either. Leptin significantly lowered the mRNA of leptin and fatty acid synthase of adipocytes (FAS) (p < 0.05), and up-regulated the mRNA of peroxisome proliferator-activated receptor (PPAR)-alpha, carnitine palmitoyl transferase-1, (CPT-1), and acyl CoA oxidase (ACO) (p < 0.05). NE (100 nM) also lowered leptin mRNA (p < 0.05) but did not affect FAS, PPARalpha, ACO, or CPT-1 expression. We conclude that in normal adipocytes leptin directly decreases FAS expression, increases PPARalpha and the enzymes of FFA oxidation, and stimulates a novel form of lipolysis in which glycerol is released without a proportional release of FFA.  (+info)

Abstract: Regulation of key markers of lipid metabolism by short chain fatty acids in differentiated pig adipocytes (2014 ADSA...Abstract: Regulation of key markers of lipid metabolism by short chain fatty acids in differentiated pig adipocytes (2014 ADSA...
Abstract Text: Short chain fatty acids (SCFA), primarily acetate, propionate and butyrate, are the major carbohydrate fermentation end products of in the gut. Previously, we had demonstrated that inulin, a fermentable fiber, alleviated high fat diet induced fat mass accumulation, and that this was accompanied by increased expression of acyl CoA oxidase (ACO), a marker of peroxisomal fatty acid oxidation, decreased expression of fatty acid synthase (FAS) and alteration in the gut microbial community structure to favor increased level of butyrate-producing bacteria. Although gut microbial structure is highly associated with SCFAs production, direct effect of SCFAs on lipid metabolism is still unclear. Therefore, we examined, by RT-PCR, the effect of SCFAs administration on markers of lipid metabolism in differentiated pig adipocytes. Increasing concentrations of SCFAs (µM to low mM) led to an upregulation of expression of acyl CoA oxidase (ACO) and sterol regulatory element binding protein 1c ...
https://asas.confex.com/asas/jam2014/webprogram/Paper7574.html
Fatty acid recycling and degradation | LAMPFatty acid recycling and degradation | LAMP
This pathway mainly shows the oxidation of fatty acids. The fatty acid oxidation takes place in mitochondria in animals. This is the reverse of fatty acid biosynthesis and utilises CoA as acyl carrier. The four main enzymes involved in the degradation of fatty acids are acyl-CoA oxidase (acyl-CoA dehydrogenase), Enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase and 3-oxoacyl-CoA thiolase. Each cycle of activities of these enzymes removes 2-carbon units in the form of acetyl-CoA. This cycle of activities can continue until the fatty acid chain is degraded to 4-carbon acetoacetyl-CoA. Acetoacetyl-CoA can then be cleaved to 2 acetyl-CoAs by the reverse action of the enzyme acetyl-CoA C-acetyltransferase.. This pathway may provide a carbon source in the form of acetyl-CoA for mitochondrial TCA cycle and other biosynthesis pathways. The enzymes acyl-CoA oxidase and 3-hydroxyacyl-CoA dehydrogenase are absent in Plasmodium falciparum. There is no biochemical evidence of this pathway taking place in ...
http://www.llamp.net/?q=Fatty%20acid%20degradation
The mouse peroxisome proliferator activated receptor recognizes a response element in the 5 flanking sequence of the rat acyl...The mouse peroxisome proliferator activated receptor recognizes a response element in the 5 flanking sequence of the rat acyl...
Peroxisome proliferators are a diverse group of chemicals, including several hypolipidaemic drugs, that activate a nuclear hormone receptor termed the peroxisome proliferator activated receptor (PPAR). The peroxisomal enzyme acyl CoA oxidase (ACO) is the most widely used marker of peroxisome prolife …
https://pubmed.ncbi.nlm.nih.gov/1537328/?dopt=Abstract
Plus itPlus it
Administration of dehydroepiandrosterone (DHEA), or its sulfated form (DHEAS), controls hyperglycemia in diabetic rodents without directly altering insulin sensitivity. We show that DHEAS enhanced glucose-stimulated insulin secretion when administered in vivo to rats or in vitro to beta-cell lines, without changing cellular insulin content. Insulin secretion increased from 3 days of steroid exposure in vitro, suggesting that DHEAS did not directly activate the secretory processes. DHEAS selectively increased the beta-cell mRNA expression of acyl CoA synthetase-2 and peroxisomal acyl CoA oxidase in a time-dependent manner. Although DHEAS is a peroxisomal proliferator, it did not alter the mRNA expression of peroxisomal proliferator-activated receptor (PPAR) alpha or beta, or enhance the activity of transfected PPAR alpha, beta, or gamma in vitro. Thus, DHEAS directly affected the beta-cell to enhance glucose-stimulated insulin secretion and increased the mRNA expression of specific beta-cell ...
http://diabetes.diabetesjournals.org/content/49/12/2012
Google LivresGoogle Livres
mapping. Gene Expr. 4:28l-299 ( l 995). ll. JD Tugwood. l. lsseman. RG Anderson. KR Bundell, WL Mepheat and S. Green. The mouse peroxisome proliferator activated receptor recognizes a response element in the 5-flanking sequence of the rat acyl CoA oxidase gene. EMBOJ. ll : 433-439 (l992). l2. B. Zhang. SL ...
https://books.google.fr/books?id=9KztuPhf3xAC&qtid=7c7e7a4a&hl=fr&source=gbs_quotes_r&cad=5
7-Keto-Dehydroepiandrosterone Acetate (7-Keto DHEA Acetate) Powder CAS 1449-61-27-Keto-Dehydroepiandrosterone Acetate (7-Keto DHEA Acetate) Powder CAS 1449-61-2
7-Keto demonstrates documented thermogenic activity in rats. This is accomplished through the activation of three thermogenic enzymes: Glycerol-3-Phosphate Dehydrogenase, Malic Enzyme and Fatty Acyl CoA Oxidase. In keeping with the biological definition of thermogenesis, all three of these enzyme activations drive energy-producing substrates in a direction of less efficient ATP production relative to heat production. The enzymes also promote the utilization of fat stores for energy and heat production. This is the basis for 7-Ketos ability to enhance thermogenesis and, through that mechanism, accelerate the utilization of fat stores for energy.
http://www.steroid-sarms.com/th/7-Keto-Dehydroepiandrosterone-%E0%B8%AD%E0%B8%B0%E0%B8%8B%E0%B8%B4%E0%B9%80%E0%B8%95%E0%B8%97-7-Keto-DHEA-%E0%B8%9C%E0%B8%87%E0%B8%AD%E0%B8%B0%E0%B8%8B%E0%B8%B4%E0%B9%80%E0%B8%95%E0%B8%97-CAS-1449-61-2/
JCI - Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fissionJCI - Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission
Peroxisomes perform essential functions in lipid metabolism, including fatty acid oxidation and plasmalogen synthesis. Here, we describe a role for peroxisomal lipid metabolism in mitochondrial dynamics in brown and beige adipocytes. Adipose tissue peroxisomal biogenesis was induced in response to cold exposure through activation of the thermogenic coregulator PRDM16. Adipose-specific knockout of the peroxisomal biogenesis factor Pex16 (Pex16-AKO) in mice impaired cold tolerance, decreased energy expenditure, and increased diet-induced obesity. Pex16 deficiency blocked cold-induced mitochondrial fission, decreased mitochondrial copy number, and caused mitochondrial dysfunction. Adipose-specific knockout of the peroxisomal β-oxidation enzyme acyl-CoA oxidase 1 (Acox1-AKO) was not sufficient to affect adiposity, thermogenesis, or mitochondrial copy number, but knockdown of the plasmalogen synthetic enzyme glyceronephosphate O-acyltransferase (GNPAT) recapitulated the effects of Pex16 inactivation ...
https://www.jci.org/articles/view/120606/pdf
Polyclonal Antibody to Acyl Coenzyme A Oxidase 1, Palmitoyl (ACOX1) | PAC275Hu01 | Homo sapiens (Human) CLOUD-CLONE CORP.(CCC)Polyclonal Antibody to Acyl Coenzyme A Oxidase 1, Palmitoyl (ACOX1) | PAC275Hu01 | Homo sapiens (Human) CLOUD-CLONE CORP.(CCC)
PAC275Hu01, ACOX; PALMCOX; SCOX; Peroxisomal Acyl-Coenzyme A Oxidase 1; Straight-chain acyl-CoA oxidase | Products for research use only!
http://www.cloud-clone.com/products/PAC275Hu01.html
Peroxisomal Acyl-Coa Oxidase Deficiency disease: Malacards - Research Articles, Drugs, Genes, Clinical TrialsPeroxisomal Acyl-Coa Oxidase Deficiency disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials
NIH Rare Diseases : 50 the following summary is from orphanet, a european reference portal for information on rare diseases and orphan drugs.orpha number: 2971disease definitionperoxisomal acyl-coa oxidase deficiency is a rare neurodegenerative disorder that belongs to the group of inherited peroxisomal disorders and is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy.epidemiologyacyl-coa oxidase deficiency is a rare disease with only 30-40 patients identified world-wide so far.clinical descriptionthe disease manifests in the neonatal period with hypotonia (92%) and seizures (91%) as dominant features. facial dysmorphism (50%) with hypertelorism, epicanthus, low nasal bridge, and low-set ears may be present. some children have polydactyly and hepatomegaly. psychomotor development is delayed, but children are usually able to walk and say a few words. however, neurological regression occurs usually at the age of 1-3 years (mean age: 28 ...
http://www.malacards.org/card/peroxisomal_acyl_coa_oxidase_deficiency
Mahidol Universitys Institutional Repository (Mahidol IR): Activation of peroxisome proliferator-activated receptor isoforms...Mahidol Universitys Institutional Repository (Mahidol IR): Activation of peroxisome proliferator-activated receptor isoforms...
A series of nonsteroidal anti-inflammatory drugs (NSAIDs) [S(+)-naproxen, ibuprofen isomers, and indomethacin] were evaluated for their activation of peroxisome proliferator-activated receptor (PPAR) α and γ isoforms in CV-1 cells co-transfected with rat PPAR α and γ, and peroxisome proliferator response element (PPRE)-luciferase reporter gene plasmids, for stimulation of peroxisomal fatty acyl CoA β-oxidase activity in H4IIEC3 cells, and for comparative inhibition of ovine prostaglandin endoperoxide H synthase (PGHS)-1 and PGHS-2 and arachidonic acid-induced human platelet activation. Each drug produced a concentration-dependent activation of the PPAR isoforms and fatty acid β-oxidase activity, inhibition of human arachidonic acid-induced platelet aggregation and serotonin secretion, and inhibition of PGHS-1 and PGHS-2 activities. For PPARα activation in CV-1 and H4IIEC3 cells, and the stimulation of fatty acyl oxidase activity in H4IIEC3 cells, the rank order of stereoselectivity was ...
http://repository.li.mahidol.ac.th/dspace/handle/123456789/26425
Pparg - Peroxisome proliferator-activated receptor gamma - Mus musculus (Mouse) - Pparg gene & proteinPparg - Peroxisome proliferator-activated receptor gamma - Mus musculus (Mouse) - Pparg gene & protein
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE) and modulates the transcription of its target genes, such as acyl-CoA oxidase. It therefore controls the peroxisomal beta-oxidation pathway of fatty acids. Key regulator of adipocyte differentiation and glucose homeostasis. ARF6 acts as a key regulator of the tissue-specific adipocyte P2 (aP2) enhancer. Acts as a critical regulator of gut homeostasis by suppressing NF-kappa-B-mediated proinflammatory responses. Plays a role in the regulation of cardiovascular circadian rhythms by regulating the transcription of ARNTL/BMAL1 in the blood vessels (PubMed:19041764).
http://www.uniprot.org/uniprot/P37238
ACOX3 Antibody 17360-1-AP | ProteintechACOX3 Antibody 17360-1-AP | Proteintech
ACOX3 Antibody 17360-1-AP has been identified with ELISA. 17360-1-AP detected band in {{ptg:PositiveWB}} with {{ptg:WesternTiter}} dilution...
https://www.ptglab.com/Products/ACOX3-Antibody-17360-1-AP.htm
Download Aging In China: Implications To Social Policy Of A Changing Economic StateDownload Aging In China: Implications To Social Policy Of A Changing Economic State
Krawinkel MB, Keding GB: regular download aging in china: implications to social policy of a changing economic state( Momordica Charantia): A acute emphasis to book. Harinantenaina L, Tanaka M, Takaoka S, Oda M, Mogami O, Uchida M, Asakawa Y: Momordica download aging in china: implications vitamins and private STANDARD of the original Open years. Shetty AK, Kumar GS, Sambaiah K, Salimath PV: download aging in china: implications to social of individual combat( Momordica charantia) on solitary well-being in interview been age-dependent plants. Chao CY, Huang C: Bitter Gourd( Momordica charantia) Extract Activates Peroxisome Proliferator-Activated Receptors and Upregulates the download aging in china: implications to social policy of the Acyl CoA Oxidase Gene in H4IIEC3 Hepatoma Cells. Chuang CY, Hsu C, Chao CY, Wein YS, Kuo YH, Huang CJ: download aging in and History of condition, 11t, poor limited hangover as an official-language of PPARalpha in feminine director( Momordica charantia L). Tan MJ, ...
http://peterkim.com/ebooks/ebooks/download-aging-in-china%3A-implications-to-social-policy-of-a-changing-economic-state.html
Measurement of peroxisomal enzyme activities in the liver of brown trout (Salmo trutta), using spectrophotometric methods | BMC...Measurement of peroxisomal enzyme activities in the liver of brown trout (Salmo trutta), using spectrophotometric methods | BMC...
One of the purposes of this study was to test in brown trout liver the spectrophotometric method originally used by Cablé et al. [13] for measurement of peroxisomal oxidase activities in mammalian tissues. However, some modifications were introduced and the method was extended to urate and glycolate oxidases. To calculate the amounts of H2O2 produced by these enzymes, instead of using the extinction coefficient previously published [13], a calibration line was made with known amounts of H2O2. Others also made similar calibration lines, but when using luminometric methods [15] and fluorometric techniques [16].. Since the physiological temperature is much lower in brown trout than in mammals, temperature influence in the activity of five peroxisomal enzymes was investigated. The results showed that the activities of these enzymes rose in a linear mode from 10 to 37°C, but while the activity of hydrogen peroxide producing oxidases were strongly influenced by temperature, catalase activity was ...
https://bmcbiochem.biomedcentral.com/articles/10.1186/1471-2091-4-2
Far1 (fatty acyl-CoA reductase 1) - Rat Genome DatabaseFar1 (fatty acyl-CoA reductase 1) - Rat Genome Database
ENCODES a protein that exhibits fatty-acyl-CoA reductase (alcohol-forming) activity (ortholog); INVOLVED IN ether lipid biosynthetic process (ortholog); glycerophospholipid biosynthetic process (ortholog); long-chain fatty-acyl-CoA metabolic process (ortholog); ASSOCIATED WITH Peroxisomal Fatty Acyl-CoA Reductase 1 Disorder (ortholog); FOUND IN integral component of peroxisomal membrane (ortholog); peroxisome (ortholog)
https://rgd.mcw.edu/rgdweb/report/gene/main.html?id=8796460
DISCOVERY AND INITIAL CHARACTERIZATION OF A NOVEL D-AMINO ACID OXIDASE MRNA VARIANT - Wellcome Centre for Integrative...DISCOVERY AND INITIAL CHARACTERIZATION OF A NOVEL D-AMINO ACID OXIDASE MRNA VARIANT - Wellcome Centre for Integrative...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
https://www.win.ox.ac.uk/publications/98129
Tissue expression of ACOX1 - Staining in rectum - The Human Protein AtlasTissue expression of ACOX1 - Staining in rectum - The Human Protein Atlas
Expression of ACOX1 (PALMCOX) in rectum tissue. Antibody staining with HPA021192, HPA021195, HPA028759 and CAB021094 in immunohistochemistry.
http://www.proteinatlas.org/ENSG00000161533-ACOX1/tissue/rectum
mutiara kesehatan: GENETIKA REPRODUKSImutiara kesehatan: GENETIKA REPRODUKSI
KROMOSOM Kromosom manusia merupakan struktur kompleks yang terdiri dari asam deoksiribonukleat - DNA dan asam ribonukleat - RNA serta protein. Setiap helix tunggal DNA terikat dengan telomer pada masing masing ujungnya, dan memiliki sentromer disuatu tempat sepanjang kromosom. Telomer melindungi ujung kromosom selama replikasi DNA. Pemendekan telomer berhubungan dengan penuaan ...
http://mutiarakesehatann.blogspot.com/2011/08/genetika-reproduksi.html
网友留言-How To Really Lose Weight During Christmas-三晋网络新闻网网友留言-How To Really Lose Weight During Christmas-三晋网络新闻网
Most from the weight reducing pills contains ephedrine. Individuals extracted from ephedra a herb. Always be one of this oldest meditations used along with Chinese. Features workout plans discovered in China over 5000 rice. However the 7 Keto GX800 Reviews DEHA diet pill increases the of the thermogenic digestive support enzymes. These enzymes are related to one`s metabolism. The enzymes include acyl-COA oxidase fat and malic molecule. The enzymes play a crucial role in burning of fats. The enzymes force the liver cells to burn the essential for your energy. The 7 keto guidelines pills have been shown to be very effective and proven positive closing results ...
http://www.sjxww.com.cn/comment/html/?249204.html
Sparrho | Peroxisomal beta-oxidation and peroxisome proliferator-actiSparrho | Peroxisomal beta-oxidation and peroxisome proliferator-acti
beta-Oxidation occurs in both mitochondria and peroxisomes. Mitochondria catalyze the beta-oxidation of the bulk of short-, medium-, and long-chain fatty acids
https://www.sparrho.com/item/peroxisomal-beta-oxidation-and-peroxisome-proliferator-activated-receptor-alpha-an-adaptive-metabolic-system/275599/
Tissue expression of ACOX1 - Staining in pancreas - The Human Protein AtlasTissue expression of ACOX1 - Staining in pancreas - The Human Protein Atlas
Expression of ACOX1 (PALMCOX) in pancreas tissue. Antibody staining with HPA021192, HPA021195, HPA028759 and CAB021094 in immunohistochemistry.
http://www.proteinatlas.org/ENSG00000161533-ACOX1/tissue/pancreas
ACOX3 - PrimePCR Assay and Template | Life Science | Bio-RadACOX3 - PrimePCR Assay and Template | Life Science | Bio-Rad
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
https://www.bio-rad.com/en-us/prime-pcr-assays/gene/acox3-rhesus-monkey
The Maize High-lysine Mutant opaque7 is Defective in an acyl-CoA Synthetase-like ProteinThe Maize High-lysine Mutant opaque7 is Defective in an acyl-CoA Synthetase-like Protein
We use cookies to ensure that we give you the best experience on our website. If you continue to use this site we will assume that you are happy with it.Ok ...
https://ad-astra.ro/2011/09/12/the-maize-high-lysine-mutant-opaque7-is-defective-in-an-acyl-coa-synthetase-like-protein/
PPARA - Peroxisome proliferator-activated receptor alpha - Canis lupus familiaris (Dog) - PPARA gene & proteinPPARA - Peroxisome proliferator-activated receptor alpha - Canis lupus familiaris (Dog) - PPARA gene & protein
Ligand-activated transcription factor. Key regulator of lipid metabolism. Activated by the endogenous ligand 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (16:0/18:1-GPC). Activated by oleylethanolamide, a naturally occurring lipid that regulates satiety. Receptor for peroxisome proliferators such as hypolipidemic drugs and fatty acids. Regulates the peroxisomal beta-oxidation pathway of fatty acids. Functions as transcription activator for the ACOX1 and P450 genes. Transactivation activity requires heterodimerization with RXRA and is antagonized by NR2C2. May be required for the propagation of clock information to metabolic pathways regulated by PER2 (By similarity).
http://www.uniprot.org/uniprot/Q95N78
Alkane inducible proteins in Geobacillus thermoleovorans B23 | BMC Microbiology | Full TextAlkane inducible proteins in Geobacillus thermoleovorans B23 | BMC Microbiology | Full Text
Initial step of β-oxidation is catalyzed by acyl-CoA dehydrogenase in prokaryotes and mitochondria, while acyl-CoA oxidase primarily functions in the peroxisomes of eukaryotes. Oxidase reaction accompanies emission of toxic by-product reactive oxygen molecules including superoxide anion, and superoxide dismutase and catalase activities are essential to detoxify them in the peroxisomes. Although there is an argument about whether primitive life was born and evolved under high temperature conditions, thermophilic archaea apparently share living systems with both bacteria and eukaryotes. We hypothesized that alkane degradation pathways in thermophilic microorganisms could be premature and useful to understand their evolution. An extremely thermophilic and alkane degrading Geobacillus thermoleovorans B23 was previously isolated from a deep subsurface oil reservoir in Japan. In the present study, we identified novel membrane proteins (P16, P21) and superoxide dismutase (P24) whose production levels were
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/1471-2180-9-60/figures/7
Peroxisomal targeting signal - WikipediaPeroxisomal targeting signal - Wikipedia
In biochemical protein targeting, a peroxisomal targeting signal (PTS) is a region of the peroxisomal protein that receptors recognize and bind to. It is responsible for specifying that proteins containing this motif are localised to the peroxisome. All peroxisomal proteins are synthesized in the cytoplasm and must be directed to the peroxisome. The first step in this process is the binding of the protein to a receptor. The receptor then directs the complex to the peroxisome. Receptors recognize and bind to a region of the peroxisomal protein called a peroxisomal targeting signal, or PTS. Peroxisomes consist of a matrix surrounded by a specific membrane. Most peroxisomal matrix proteins contain a short sequence, usually three amino acids at the extreme carboxy tail of the protein, that serves as the PTS. The prototypic sequence (many variations exist) is serine-lysine-leucine (-SKL in the one letter amino acid code). This motif, and its variations, is known as the PTS1, and the receptor is ...
https://en.wikipedia.org/wiki/Peroxisomal_targeting_signal
Alcohol-forming fatty acyl-CoA reductase elisa and antibodyAlcohol-forming fatty acyl-CoA reductase elisa and antibody
Shop Alcohol-forming fatty acyl-CoA reductase ELISA Kit, Recombinant Protein and Alcohol-forming fatty acyl-CoA reductase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
https://www.mybiosource.com/protein_family.php?root=alcohol-forming-fatty-acyl-coa-reductase
Sch475 00200 : CDS information --- DoBISCUITSch475 00200 : CDS information --- DoBISCUIT
putative acyl-CoA carboxylase alpha subunit [putative Acyl-CoA carboxylase] ATGAGCGCCGCCCTCCTAGGCCTCCGTCAGGCCCGCATACGCAAGGTGTTGATCGCCAAC CGTGGCGAAATCGCTGTTCGTGTCGCCCGGGCGTGCCGAGACGCCGGTATCGCGAGCGTG GCGGTGTACGCCGAGCCGGACCGGGACGCACTGCATGTGCGGGCCGCGGACGAGGCGTTC GCGCTGGGCGGTGACACCCCCGCGACCAGCTACCTCGACATGGCCAAGGTGCTGCAGGCC GCCAAGGACTCCGGCGCGGACGCCATCCACCCCGGTTACGGCTTCCTTTCCGAGAACGCC GACTTCGCCCAGGCCGTCCTGGACGCCCAGCTGATCTGGATCGGCCCGCCGCCGCAGGCG ATTCGCGACCTGGGTGACAAGGCCCATATCGCCCAGCGCGCCGGCGCCCCGCTGGTCGCC GGCACCCCCGACCCGGTCTCGGGCTCGGACGAGGTCGTCGCCTTCGCGGAGGAGCACGGG CTGCCGATCGCCATCAAGGCCGCCTTCGGTGGCGGTGGCCGCGGTCTGAAGGTCGCCCGC ACCCTGGAAGAAGTCCCCGAGCTGTACGACTCGGCCGTCCGCGAGGCGGTGGCCGCCTTC GGCCGCGGTGAGTGCTTCGTCGAGCGCTACCTCGACAAGCCCCGGCACGTGGAGACCCAG TGCCTGGCCGACTCCCACGGCAACGTGGTCGTCGTCTCCACCCGCGACTGCTCACTGCAG CGCCGCCACCAGAAGCTGGTCGAGGAGGCGCCCGCGCCGTTCCTCTCCGACGAGCAGGTC GCCGAGCTGTACTCCTCTTCGAAGGCCATCCTCAAGGAGGCCGGCTATGTCGGCGCCGGG ACCGTGGAGTTCCTGGTCGGCACGGACGGCACGATCTCCTTCCTGGAGGTCAACACCCGC ...
http://www.bio.nite.go.jp/pks/feature/view/Sch475_00200
Seton Accountable Care Organization, Inc. Seton ACOSeton Accountable Care Organization, Inc. Seton ACO
At Seton Accountable Care Organization, Inc. (Seton ACO) we have a big idea for Central Texas: healthcare thats friendlier and more connected.
https://www.seton.net/medical-services-and-programs/seton-accountable-care-organization/
Intestinal peroxisomal fatty acid β-oxidation regulates neural serotonin signaling through a feedback mechanismIntestinal peroxisomal fatty acid β-oxidation regulates neural serotonin signaling through a feedback mechanism
As a neuromodulator, serotonin regulates numerous behavioral and emotional states. This study shows in the nematode C. elegans, metabolic cues that originate in the organisms periphery modulate neurally regulated serotonergic processes, including feeding behavior and egg laying, revealing a homeostatic signal that informs the nervous system of the organisms nutritional state.
https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.3000242
BETA OXIDACION PEROXISOMAL PDFBETA OXIDACION PEROXISOMAL PDF
BETA OXIDACION PEROXISOMAL PDF - B-OXIDACION EN PEROXISOMAS: •. For peroxisomal β -oxidation, fatty acids are activated at different subcellular locations. Long-straight-chain and
https://parzaragoza.xyz/beta-oxidacion-peroxisomal-57/
Franciscan Riverview Health ACO, LLC | Franciscan HealthFranciscan Riverview Health ACO, LLC | Franciscan Health
ACO Name and LocationFranciscan Central Indiana ACO, LLCTrade Name/DBA: Franciscan Riverview Health ACO1515 Dragoon TrailMishawaka, IN 46544 ACO Primary
https://www.franciscanhealth.org/about-us/aco/franciscan-riverview-health-aco-llc
Anatomy of an Independent Primary Care ACO, Part I | Smith Anderson - JDSupraAnatomy of an Independent Primary Care ACO, Part I | Smith Anderson - JDSupra
While concepts and theories can go a long way, sometimes the best way to understand something is through a concrete example. So, from time to time, ACO Insider will check in on a new...
https://www.jdsupra.com/legalnews/anatomy-of-an-independent-primary-care-a-39862/
AS 186c | Semantic ScholarAS 186c | Semantic Scholar
AS-186a, b, c, d, and g were isolated from the cultured broth of Penicillium asperosporum KY1635 as inhibitors of acyl-CoA… Expand ...
https://www.semanticscholar.org/topic/AS-186c/1336444
7 Keto - Country Life - 7-Keto Trim 60cap7 Keto - Country Life - 7-Keto Trim 60cap
7-Keto Trim 60 VCapsules Is a natural, safe, non androgenic derivative of DHEA, this ingredient has been found to be 3x more effective than diet and exercise alone &-Keto is very effevtive in stimulating fat metabolism, especially in diets focused on appetite suppression and calorie reduction. It activates three different fat burning enzymes: -Fatty Acetyl?CoA Oxidase -Glycerol-3-Phosphate Dehydrogenase -Malic Enzyme Acetyl L-Carnitine supports the burning of fat for energy,5-HTP supports appetite control, L-Tryosine supports fat metabolism Supplement Facts Servings Size: 1 capsule Servings Per Container: 60 Amount Per Serving: % Daily Value* 7-Keto 100mg, ~ (3-Acetyl-7-oxo dehydroeplandrosterone) Proprietary Blend 25mg providing: Acetyl L-Carnitine ~ 5-HTP(5-hydroxytryptophan)(Griffonia simplicifolia)(seed) ~ L-Tryosine(free form)~ GreenTea (leaf) (45% EGCG epigallocatechin gallate) ~ Other Ingredients Cellulose, magnesium stearate, silica cellulose(capsule shell).
https://www.totaldiscountvitamins.com/product/2719/7keto
ESCRT-III Is Required for Scissioning New Peroxisomes From the Endoplasmic ReticulumESCRT-III Is Required for Scissioning New Peroxisomes From the Endoplasmic Reticulum
Dynamic control of peroxisome proliferation is integral to the peroxisomes many functions. The endoplasmic reticulum (ER) serves as a source of preperoxisomal vesicles (PPVs) that mature into peroxisomes during de novo peroxisome biogenesis and support growth and division of existing peroxisomes. H …
https://pubmed.ncbi.nlm.nih.gov/29588378/
screwfix aco drainscrewfix aco drain
Call 24/7 on: 03330 … Easy method to create corners, tees or 4-way junctions. £26.29 Ex VAT £31.55 Inc VAT. Low Profile Drainage … The high quality ACO … £7.29 Ex VAT £8.75 Inc VAT. ; loc_en_GB, sid_42589, prod, sort_[SortEntry(order=LOCALE, direction=DESCENDING), SortEntry(order=FEATURED, direction=DESCENDING), SortEntry(order=SUBMISSION_TIME, direction=DESCENDING)]. Buy Guttering & Drainage at Screwfix.com. Screwfix Community Forum. Channel drain. Hi, ACO make several rages of drainage channels But yours was installed about 6 years ago , so taking a shot as to which one and your description, it is very possible you have the now discontinued Power Drain … The ACO Wedge Wire Stainless Steel Grating is manufactured from high-quality materials and connects onto an ACO HexDrain or RainDrain. Buy Underground Drainage at Screwfix. FREE ACO RainDrain B 125 Channel with Cast Iron Heelguard Grating 1m. Finish your patio and protect your property with ACOs complete range of channels, and ...
https://lamezquita.net/pharmaceutical-uses-pidcwb/screwfix-aco-drain-ff3e59
Orbit and Astrometry for 98WY24Orbit and Astrometry for 98WY24
1998 11 18.43762 04 59 35.44 +21 49 05.4 22.6R 98WY24 695 Ca3208 1998 11 18.50897 04 59 35.07 +21 49 04.7 98WY24 695 Ca3208 1998 11 19.49641 04 59 30.18 +21 48 57.5 22.5R 98WY24 695 a3608 1998 11 19.53615 04 59 29.97 +21 48 57.4 98WY24 695 a3608 1998 11 26.37301 04 58 55.18 +21 48 06.5 22.7R 98WY24 695 Ca3208 1998 11 27.37204 04 58 50.01 +21 47 59.2 98WY24 695 Ca3208 1998 12 19.01745 04 56 55.74 +21 45 18.4 22.7R 98WY24 950 a3608 1998 12 19.10795 04 56 55.29 +21 45 17.3 98WY24 950 a3608 1998 12 19.15789 04 56 55.04 +21 45 16.8 98WY24 950 a3608 1999 01 22.30591 04 54 23.97 +21 41 59.6 22.9R 98WY24 568 Ca5544 1999 01 22.35924 04 54 23.79 +21 41 59.7 98WY24 568 Ca5545 1999 01 23.34528 04 54 20.55 +21 41 55.8 98WY24 568 Ca5545 2000 11 23.44734 05 10 59.69 +22 09 06.5 22.8R 98WY24 695 Cc3588 2000 11 23.49502 05 10 59.45 +22 09 06.2 98WY24 695 Cc3588 2000 11 27.35230 05 10 39.68 +22 08 43.3 23.1R 98WY24 695 Cc3588 2000 11 27.42891 05 10 39.28 +22 08 42.9 23.1R 98WY24 695 Cc3588 2000 11 28.39859 05 10 ...
https://www.boulder.swri.edu/~buie/kbo/astrom/98WY24.html
Peroxisome proliferation in response to xenobiotics | Biochemical Society TransactionsPeroxisome proliferation in response to xenobiotics | Biochemical Society Transactions
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
http://www.biochemsoctrans.org/content/23/2/425
GJ assembly between S364PCx43, S364ECx43 and S364ACx43/ | Open-iGJ assembly between S364PCx43, S364ECx43 and S364ACx43/ | Open-i
GJ assembly between S364PCx43, S364ECx43 and S364ACx43/KO fibroblasts. (A) Example of Lucifer yellow dye transfer between S364PCx43 and S364ECx43/KO fibroblasts
https://openi.nlm.nih.gov/detailedresult.php?img=PMC2199346_0102017f5b&req=4
The potential peroxisomal localization of a pathway sup | Open-iThe potential peroxisomal localization of a pathway sup | Open-i
The potential peroxisomal localization of a pathway supplying NADPH for β-oxidation.(A) The putative pathway follows the TCA reaction cycle, beginning with pyr
https://openi.nlm.nih.gov/detailedresult.php?img=PMC4526572_pgen.1005445.g003&req=4
Que é um cardíaco de ataque?Que é um cardíaco de ataque?
Um cardíaco de ataque é uma emergência médica que ocorra quando o fluxo sanguíneo à parte do coração é eliminado de repente. Os músculos de coração são fornecidos pelas artérias coronárias, que
https://www.news-medical.net/health/What-is-a-Heart-Attack-
Industry-Leading Drainage Technical Support by ACOIndustry-Leading Drainage Technical Support by ACO
Industry-Leading Drainage Technical Support | ACO. When dealing with an industry-leading manufacturer of some of Australias greatest drainage solutions, you expect world-class customer support.
https://www.spec-net.com.au/press/1019/aco_301019/Industry-Leading-Drainage-Technical-Support-by-ACO
Creating a Relationship Having a Thai Particular date | ACO RI S.LCreating a Relationship Having a Thai Particular date | ACO RI S.L
So you want to how to build a marriage, or at least get started with dating in Thailand, then you certainly need to know regarding the internet dating method. Well you will discover two major stages included in getting yourself into an important relationship in Thailand, or perhaps anywhere else even. This means that in Leer másCreating a Relationship Having a Thai Particular date[…]
https://www.acori.es/2019/12/07/creating-a-relationship-having-a-thai-particular-date/
Internacjonalizacja studiów wyższych. Redakcja Waldemar Martyniuk - PDFInternacjonalizacja studiów wyższych. Redakcja Waldemar Martyniuk - PDF
Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Fundacja
http://docplayer.pl/2286757-Internacjonalizacja-studiow-wyzszych-redakcja-waldemar-martyniuk.html
Implication of a peroxisomal enzyme in the catabolism of glutaryl-CoA | Biochemical JournalImplication of a peroxisomal enzyme in the catabolism of glutaryl-CoA | Biochemical Journal
A linear rate of H2O2 production is found when glutaryl-CoA is incubated with liver homogenates. We term this enzyme activity glutaryl-CoA oxidase. Its main characteristics are described and compared with those of glutaryl-CoA dehydrogenase (EC 1.3.99.7) and palmitoyl-CoA oxidase (EC 1.1.3.-). The latter enzyme catalyses the first step of peroxisomal beta-oxidation. Glutaryl-CoA oxidase shares several properties with palmitoyl-CoA oxidase. The activities of both enzymes in mouse liver are increased by feeding the animals with a clofibrate-containing diet. Subcellular fractionation of the liver homogenates on a linear sucrose gradient indicates that glutaryl-CoA oxidase is a peroxisomal enzyme.. ...
http://www.biochemj.org/content/221/1/203
Functional Effects of Different Medium-Chain Acyl-CoA Dehydrogenase Genotypes and Identification of Asymptomatic VariantsFunctional Effects of Different Medium-Chain Acyl-CoA Dehydrogenase Genotypes and Identification of Asymptomatic Variants
Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency (OMIM 201450) is the most common inherited disorder of fatty acid metabolism presenting with hypoglycaemia, hepatopathy and Reye-like symptoms during catabolism. In the past, the majority of patients carried the prevalent c.985A|G mutation in the ACADM gene. Since the introduction of newborn screening many other mutations with unknown clinical relevance have been identified in asymptomatic newborns. In order to identify functional effects of these mutant genotypes we correlated residual MCAD (OMIM 607008) activities as measured by octanoyl-CoA oxidation in lymphocytes with both genotype and relevant medical reports in 65 newborns harbouring mutant alleles. We identified true disease-causing mutations with residual activities of 0 to 20%. In individuals carrying the c.199T|C or c.127G|A mutation on one allele, residual activities were much higher and in the range of heterozygotes (31%-60%). Therefore, both mutations cannot clearly be associated with a
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0045110
Molecular effects of leptin on peroxisome proliferator activated receptor gamma (PPAR-γ) mRNA expression in rats adipose and...Molecular effects of leptin on peroxisome proliferator activated receptor gamma (PPAR-γ) mRNA expression in rats adipose and...
Leptin is a 16-kDa peptide hormone secreted by adipose tissue that participates in the regulation of energy homeostasis. The aim of this study was to determine the effect of leptin injection on mRNA expression of peroxisome proliferator-activated receptor gamma (PPAR-γ) and comparison of PPAR-γ mRNA expression in rats adipose and liver tissue. Twenty adult male rats were divided into the following groups: Group 1asa control (n=10) that did not receive any treatment. Group 2as a treatment (n=10) that received leptin (30 µg â „ kg BW) intraperitoneally (ip) for two successive days. Blood samples were taken before and one day after second leptin injection for triglyceride (TG), Free Fatty Acid (FFA), HLD-cholesterol, and LDL-cholesterol measurement. Total RNA was extractedfrom the adipose tissue and liver tissues of rats. Adipose and liver tissue cells cDNA was synthesized to characterize the expression of PPAR-γ. Gene expression of PPAR-γ mRNA was tested by RT- PCR technique. Results show
https://cellmolbiol.org/index.php/CMB/article/view/1259
Concomitant increase by peroxisome proliferators of fatty acid-binding protein, peroxisomal beta-oxidation and cytosolic acyl...Concomitant increase by peroxisome proliferators of fatty acid-binding protein, peroxisomal beta-oxidation and cytosolic acyl...
Inductions of FABP in hepatic cytosol by administration of tiadenol and clofibric acid were studied in rats, mice and guinea-pigs. In rats and mice, [1-14C]oleic acid-binding capacity of hepatic cytosol was increased, in association with induction of
http://www.biomedsearch.com/nih/Concomitant-increase-by-peroxisome-proliferators/2865776.html
77 Mutations of Human Medium-Chain Acyl-CoA Dehydrogenase | Biochemical Society Transactions77 Mutations of Human Medium-Chain Acyl-CoA Dehydrogenase | Biochemical Society Transactions
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
http://www.biochemsoctrans.org/content/26/1/S65
Peroxisome Proliferator-Activated Receptor alpha (PPARA) ELISA KitsPeroxisome Proliferator-Activated Receptor alpha (PPARA) ELISA Kits
Reactivity: Chicken, Cow, Dog and more. Compare 67 different PPARA ELISA Kits & buy the right one directly at antibodies-online.com!
http://www.antibodies-online.com/nuclear-receptor-transcription-pathway-pathway-23/ppara-elisa-kit-7740/
ChemIDplus - 71073-93-3 - 2-Propenoic acid, telomer with trichloroacetaldehyde - Similar structures search, synonyms, formulas,...ChemIDplus - 71073-93-3 - 2-Propenoic acid, telomer with trichloroacetaldehyde - Similar structures search, synonyms, formulas,...
71073-93-3 - 2-Propenoic acid, telomer with trichloroacetaldehyde - Similar structures search, synonyms, formulas, resource links, and other chemical information.
https://chem.nlm.nih.gov/chemidplus/rn/71073-93-3
Mus musculus peroxisomal protein (Pex14) mRNA, complete cds - Nucleotide - NCBIMus musculus peroxisomal protein (Pex14) mRNA, complete cds - Nucleotide - NCBI
Opens the Highlight Feature Bar and highlights feature annotations from the FEATURES table of the record. The Highlight Feature Bar can be used to navigate to and highlight other features and provides links to display the highlighted region separately. Links in the FEATURES table will also highlight the corresponding region of the sequence. More... ...
https://www.ncbi.nlm.nih.gov/nuccore/AF097512?report=fasta
Free GRE Subject Test: Biology Flashcards - Understanding Lysosomes and PeroxisomesFree GRE Subject Test: Biology Flashcards - Understanding Lysosomes and Peroxisomes
Free GRE Subject Test: Biology flashcards - Other Organelles - Understanding Lysosomes and Peroxisomes. Work through hundreds of free flashcards and see your gr
https://www.varsitytutors.com/gre_subject_test_biology-flashcards/understanding-lysosomes-and-peroxisomes
OxidoreductaseOxidoreductase
long-chain-fatty-acyl-CoA reductase Ja 1.2.3.1 aldehyde oxidase Ja ... cytochroom-c-oxidase Ja Externe links[bewerken , brontekst bewerken]. *Integrated Enzyme Database (European Bioinformatics ...
https://nl.wikipedia.org/wiki/Oxidoreductase
List of OMIM disorder codesList of OMIM disorder codes
ARFGEF2 Peroxisomal acyl-CoA oxidase deficiency; 264470; ACOX1 Perry syndrome; 168605; DCTN1 Persistent Mullerian duct syndrome ... SCARB2 Acyl-CoA dehydrogenase, long chain, deficiency of; 201460; ACADL Acyl-CoA dehydrogenase, medium chain, deficiency of; ... ACADM Acyl-CoA dehydrogenase, short chain, deficiency of; 201470; ACADS Adenocarcinoma of lung, response to tyrosine kinase ... HADHSC 3-hydroxyisobutryl-CoA hydrolase deficiency; 250620; HIBCH 3-M syndrome; 273750; CUL7 3-Methylcrotonyl-CoA carboxylase 1 ...
https://en.wikipedia.org/wiki/List_of_OMIM_disorder_codes
ACOX1ACOX1
Varanasi U, Chu R, Chu S, Espinosa R, LeBeau MM, Reddy JK (May 1994). "Isolation of the human peroxisomal acyl-CoA oxidase gene ... 2002). "Peroxisomal acyl CoA oxidase deficiency". J. Pediatr. 140 (1): 128-30. doi:10.1067/mpd.2002.120511. PMID 11815777. ... ACOX3 Acyl-CoA oxidase GRCh38: Ensembl release 89: ENSG00000161533 - Ensembl, May 2017 GRCm38: Ensembl release 89: ... 1995). "Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells". J. Biol. Chem. 270 (9 ...
https://en.wikipedia.org/wiki/ACOX1
Ada regulonAda regulon
It shows some homology to acyl-CoA oxidases and those containing flavins. Recent observations suggest that AidB may bind to ...
https://en.wikipedia.org/wiki/Ada_regulon
ACOX3ACOX3
Acyl-Coenzyme A oxidase 3 also known as pristanoyl-CoA oxidase (ACOX3) is involved in the desaturation of 2-methyl branched ... ACOX1 Acyl-CoA oxidase GRCh38: Ensembl release 89: ENSG00000087008 - Ensembl, May 2017 GRCm38: Ensembl release 89: ... and trihydroxycoprostanic acids are oxidized by one single peroxisomal branched chain acyl-CoA oxidase in human liver and ... "Entrez Gene: ACOX3 acyl-Coenzyme A oxidase 3, pristanoyl". Maruyama K, Sugano S (1994). "Oligo-capping: a simple method to ...
https://en.wikipedia.org/wiki/ACOX3
NutriepigenomicsNutriepigenomics
... and acyl-CoA oxidase. Changes in expression were reportedly due to epigenetic regulation of either the gene promoter itself, or ... Feeding a PR-diet to pregnant and/or lactating mice also increased expression of glucokinase, acetyl-CoA carboxylase, PPARα, ...
https://en.wikipedia.org/wiki/Nutriepigenomics
HSD17B4HSD17B4
... acyl-CoA oxidase (see, e.g., ACOX1, MIM 609751); the 'D-bifunctional enzyme,' with enoyl-CoA hydratase and D-3-hydroxyacyl-CoA ... "Purification and properties of human D-3-hydroxyacyl-CoA dehydratase: medium-chain enoyl-CoA hydratase is D-3-hydroxyacyl-CoA ... Jiang LL, Miyazawa S, Souri M, Hashimoto T (February 1997). "Structure of D-3-hydroxyacyl-CoA dehydratase/D-3-hydroxyacyl-CoA ... Itoh M, Suzuki Y, Takashima S (June 1999). "A novel peroxisomal enzyme, D-3-hydroxyacyl-CoA dehydratase/D-3-hydroxyacyl-CoA ...
https://en.wikipedia.org/wiki/HSD17B4
Flavin groupFlavin group
D-amino acid oxidase, glucose oxidase, xanthine oxidase, and acyl CoA dehydrogenase. FADH and FADH2 are reduced forms of FAD. ... Flavin adenine dinucleotide is a group bound to many enzymes including ferredoxin-NADP+ reductase, monoamine oxidase, ...
https://en.wikipedia.org/wiki/Flavin_group
D-bifunctional protein deficiencyD-bifunctional protein deficiency
... and branched chain acyl-CoA oxidase. Möller G, van Grunsven EG, Wanders RJ, Adamski J (January 2001). "Molecular basis of D- ... DBP is a stereospecific enzyme; hydratase domain forms only (R)-hydroxy-acyl-CoA intermediates from trans-2-enoyl-CoAs. D-BP is ... D-BP knockout mice show compensatory upregulation of other peroxisomal enzymes in absence of D-BP such as palmitoyl-CoA oxidase ... van Grunsven EG, Mooijer PA, Aubourg P, Wanders RJ (August 1999). "Enoyl-CoA hydratase deficiency: identification of a new type ...
https://en.wikipedia.org/wiki/D-bifunctional_protein_deficiency
Nitroalkane oxidaseNitroalkane oxidase
"Cloning of nitroalkane oxidase from Fusarium oxysporum identifies a new member of the acyl-CoA dehydrogenase superfamily". Proc ... a carbanion-forming flavoprotein homologous to acyl-CoA dehydrogenase". Arch. Biochem. Biophys. 433 (1): 157-65. doi:10.1016/j. ... In enzymology, a nitroalkane oxidase (EC 1.7.3.1) is an enzyme that catalyzes the chemical reaction a nitroalkane + H2O + O2 ... Other names in common use include nitroethane oxidase, NAO, and nitroethane:oxygen oxidoreductase. This enzyme participates in ...
https://en.wikipedia.org/wiki/Nitroalkane_oxidase
Acyl-CoA oxidaseAcyl-CoA oxidase
Other names in common use include fatty acyl-CoA oxidase, acyl coenzyme A oxidase, and fatty acyl-coenzyme A oxidase. This ... In enzymology, an acyl-CoA oxidase (EC 1.3.3.6) is an enzyme that catalyzes the chemical reaction acyl-CoA + O2 ⇌ {\ ... Osumi T, Hashimoto T, Ui N (June 1980). "Purification and properties of acyl-CoA oxidase from rat liver". J. Biochem. 87 (6): ... November 1980). "Stereochemistry of dehydrogenation catalyzed by Acyl-CoA oxidase". J. Biochem. 88 (5): 1481-6. doi:10.1093/ ...
https://en.wikipedia.org/wiki/Acyl-CoA_oxidase
Mixed-function oxidaseMixed-function oxidase
... dehydrogenation of fatty acyl-CoA in peroxisomes). Most of the oxidases are flavoproteins. The name "mixed-function oxidase" ... saturated fatty acyl-CoA and NADPH are oxidized by molecular oxygen (O2) to produce monounsaturated fatty acyl-CoA, NADP+ and 2 ... Desaturation of fatty acyl-CoA in vertebrates is an example of the mixed-function oxidase reaction. In the process, ... Mixed-function oxidase is the name of a family of oxidase enzymes that catalyze a reaction in which each of the two atoms of ...
https://en.wikipedia.org/wiki/Mixed-function_oxidase
SCP2 - ويكيبيديا، الموسوعة الحرةSCP2 - ويكيبيديا، الموسوعة الحرة
fatty acid beta-oxidation using acyl-CoA oxidase. • تمثيل غذائي. • protein localization to plasma membrane. • bile acid ... fatty-acyl-CoA binding. • transferase activity, transferring acyl groups other than amino-acyl groups. • sterol transporter ... long-chain fatty acyl-CoA binding. • cholesterol binding. • ربط بروتيني. • propanoyl-CoA C-acyltransferase activity. • نشاط ... transferase activity, transferring acyl groups. • lipid binding. • propionyl-CoA C2-trimethyltridecanoyltransferase activity. ...
https://ar.wikipedia.org/wiki/SCP2
Acyl-CoA thioesterase 9Acyl-CoA thioesterase 9
... cytochrome c oxidase, subunit 4, isoform 2) genes with racing performance in Thoroughbred horses". Equine Veterinary Journal. ... Acyl-CoA thioesterase 9 is a protein that is encoded by the human ACOT9 gene. It is a member of the acyl-CoA thioesterase ... These enzymes have also been referred to in the literature as acyl-CoA hydrolases, acyl-CoA thioester hydrolases, and palmitoyl ... as opposed to long-chain acyl-CoA synthetases, which ligate fatty acids to CoA, to produce the CoA ester. The role of the ACOT ...
https://en.wikipedia.org/wiki/Acyl-CoA_thioesterase_9
Acyl-CoA oxidase deficiencyAcyl-CoA oxidase deficiency
... affects a person from birth, and most newborns affected with this condition will not survive past ... Acyl-CoA oxidase deficiency is an extremely rare condition. Diagnosis can be done both prenatally based on family history and ... Acyl-CoA oxidase deficiency is a rare disorder that leads to significant damage and deterioration of nervous system functions ( ... Acyl-CoA oxidase deficiency is an autosomal recessive disorder that is caused by biallelic pathogenic variants in ACOX1. This ...
https://en.wikipedia.org/wiki/Acyl-CoA_oxidase_deficiency
List of diseases (A)List of diseases (A)
... deficiency of Acyl-CoA dehydrogenase, very long chain, deficiency of Acyl-CoA oxidase deficiency Adactylia unilateral dominant ... Acute promyelocytic leukemia Acute renal failure Acute respiratory distress syndrome Acute tubular necrosis Acyl-CoA ... dehydrogenase, medium chain, deficiency of Acyl-CoA dehydrogenase, short chain, ...
https://en.wikipedia.org/wiki/List_of_diseases_(A)
Long-chain-alcohol oxidaseLong-chain-alcohol oxidase
It has been found in certain Candida yeast, where it participates in omega oxidation of fatty acids to produce acyl-CoA for ... Other names in common use include long-chain fatty alcohol oxidase, fatty alcohol oxidase, fatty alcohol:oxygen oxidoreductase ... Long-chain alcohol oxidase is one of two enzyme classes that oxidize long-chain or fatty alcohols to aldehydes. ... Long-chain alcohol oxidase is also used in germinating seedlings of jojoba (Simmondsia chinensis) to degrade esterified long- ...
https://en.wikipedia.org/wiki/Long-chain-alcohol_oxidase
List of MeSH codes (D08)List of MeSH codes (D08)
... acyl-coa dehydrogenase, long-chain MeSH D08.811.682.660.150.200 - acyl-CoA oxidase MeSH D08.811.682.660.150.300 - butyryl-coa ... acyl-coa dehydrogenases MeSH D08.811.682.660.150.100 - acyl-coa dehydrogenase MeSH D08.811.682.660.150.150 - ... sarcosine oxidase MeSH D08.811.682.662.640 - proline oxidase MeSH D08.811.682.662.680 - pyridoxamine-phosphate oxidase MeSH ... acyl-carrier protein) reductase (nadph, b-specific) MeSH D08.811.682.660.425 - Glutaryl-CoA dehydrogenase MeSH D08.811.682.660. ...
https://en.wikipedia.org/wiki/List_of_MeSH_codes_(D08)
RhabdomyolysisRhabdomyolysis
... deficiency of subtypes of acyl CoA dehydrogenase (LCAD, SCAD, MCAD, VLCAD, 3-hydroxyacyl-coenzyme A dehydrogenase deficiency), ... thiolase deficiency Mitochondrial myopathies: deficiency of succinate dehydrogenase, cytochrome c oxidase and coenzyme Q10 ...
https://en.wikipedia.org/wiki/Rhabdomyolysis
RiboflavinRiboflavin
Fatty acyl CoA dehydrogenase requires FAD in fatty acid oxidation. *FAD is required to convert retinol (vitamin A) to retinoic ... FAD is required for the production of pyridoxic acid from pyridoxal (vitamin B6) by pyridoxine 5'-phosphate oxidase ...
https://en.m.wikipedia.org/wiki/Riboflavin
RiboflavinRiboflavin
... and branched-chain amino acids requires FAD in the shared E3 portion of their respective dehydrogenase complexes Fatty acyl CoA ... phosphate oxidase The primary coenzyme form of vitamin B6 (pyridoxal phosphate) is FMN dependent Oxidation of pyruvate, α- ...
https://en.wikipedia.org/wiki/Riboflavin
Flavin adenine dinucleotideFlavin adenine dinucleotide
... short/branched-chain acyl-CoA dehydrogenase), valine (isobutyryl-CoA dehydrogenase), and lysine (glutaryl-CoA dehydrogenase). ... Glucose oxidase (GOX) catalyzes the oxidation of β-D-glucose to D-glucono-δ-lactone with the simultaneous reduction of enzyme- ... such as for multiple acyl-CoA dehydrogenase deficiency. In addition, riboflavin deficiency itself (and the resulting lack of ... Monoamine oxidase (MAO) is an extensively studied flavoenzyme due to its biological importance with the catabolism of ...
https://en.wikipedia.org/wiki/Flavin_adenine_dinucleotide
Beta oxidationBeta oxidation
The first oxidation step in the peroxisome is catalyzed by the enzyme acyl-CoA oxidase. The β-ketothiolase used in peroxisomal ... Cn-acyl-CoA + FAD + NAD+ + H 2O + CoA → Cn-2-acyl-CoA + FADH 2 + NADH + H+ + acetyl-CoA Free fatty acids cannot penetrate any ... The final cycle produces two separate acetyl CoAs, instead of one acyl CoA and one acetyl CoA. For every cycle, the Acyl CoA ... is not an appropriate substrate for acyl CoA dehydrogenase, or enoyl CoA hydratase: If the acyl CoA contains a cis-Δ3 bond, ...
https://en.wikipedia.org/wiki/Beta_oxidation
2-alkenal reductase2-alkenal reductase
Protoporphyrinogen oxidase. *Bilirubin oxidase. *Acyl-CoA oxidase. *Dihydrouracil oxidase. *Tetrahydroberberine oxidase. * ...
https://en.wikipedia.org/wiki/2-alkenal_reductase
Adenosine triphosphateAdenosine triphosphate
... through substrate-level phosphorylation catalyzed by succinyl-CoA synthetase, as succinyl- CoA is converted to Succinate, three ... Dozens of ATP equivalents are generated by the beta-oxidation of a single long acyl chain. In oxidative phosphorylation, the ... imply a high amount of reduced cytochrome c and a high level of cytochrome c oxidase activity. An additional level of ... The acetyl-CoA is metabolized by the citric acid cycle to generate ATP, while the NADH and FADH2 are used by oxidative ...
https://en.wikipedia.org/wiki/Adenosine_triphosphate
Mitochondrial matrixMitochondrial matrix
The citric acid cycle involves acyl-CoA, pyruvate, acetyl-CoA, citrate, isocitrate, α-ketoglutarate, succinyl-CoA, fumarate, ... cytochrome c oxidase). The electron transport chain is responsible for establishing a pH and electrochemical gradient that ... β-Oxidation uses pyruvate carboxylase, acyl-CoA dehydrogenase, and β-ketothiolase. Amino acid production is facilitated by ... The production of acetyl-CoA begins the citric acid cycle while the co-enzymes produced are used in the electron transport ...
https://en.wikipedia.org/wiki/Mitochondrial_matrix
Flavin groupFlavin group
D-amino acid oxidase, glucose oxidase, xanthine oxidase, and acyl CoA dehydrogenase. ... Flavin adenine dinucleotide is a group bound to many enzymes including ferredoxin-NADP+ reductase, monoamine oxidase, ...
https://en.m.wikipedia.org/wiki/Flavin_group
Transporter Classification DatabaseTransporter Classification Database
Family 4.C.2 The Carnitine O-Acyl Transferase (CrAT) Family 4.C.3 The Acyl-CoA Thioesterase (AcoT) Family 4.D.1 The Putative ... NADPH Oxidase Family 5.B.2 The Eukaryotic Cytochrome b561 (Cytb561) Family 5.B.3 The Geobacter Nanowire Electron Transfer (G- ... Superfamily 3.D.4 Proton-translocating Cytochrome Oxidase (COX) Superfamily 3.D.5 The Na+-translocating NADH:Quinone ...
https://en.wikipedia.org/wiki/Transporter_Classification_Database
Succinate dehydrogenaseSuccinate dehydrogenase
Protoporphyrinogen oxidase. *Bilirubin oxidase. *Acyl-CoA oxidase. *Dihydrouracil oxidase. *Tetrahydroberberine oxidase. * ... to acetyl-CoA. *Pyruvate dehydrogenase complex (E1, E2, E3). *(regulated by Pyruvate dehydrogenase kinase and Pyruvate ... to acetyl-CoA. *Pyruvate dehydrogenase complex (E1, E2, E3). *(regulated by Pyruvate dehydrogenase kinase and Pyruvate ...
https://en.wikipedia.org/wiki/Succinate_dehydrogenase
Enoyl-acyl carrier protein reductaseEnoyl-acyl carrier protein reductase
Protoporphyrinogen oxidase. *Bilirubin oxidase. *Acyl-CoA oxidase. *Dihydrouracil oxidase. *Tetrahydroberberine oxidase. * ... Enoyl-acyl carrier protein reductase (or ENR) (EC 1.3.1.9), is a key enzyme of the type II fatty acid synthesis (FAS) system.[1 ... "Identification and characterization of inhibitors of bacterial enoyl-acyl carrier protein reductase". Antimicrobial Agents and ... "Mutational analysis of the triclosan-binding region of enoyl-ACP (acyl-carrier protein) reductase from Plasmodium falciparum" ...
https://en.wikipedia.org/wiki/Enoyl-acyl_carrier_protein_reductase
효소 - 위키백과, 우리 모두의 백과사전효소 - 위키백과, 우리 모두의 백과사전
"Role of long-chain fatty acyl-CoA esters in the regulation of metabolism and in cell signalling". 》The Biochemical Journal》 323 ... "Infrared evidence of cyanide binding to iron and copper sites in bovine heart cytochrome c oxidase. Implications regarding ... "The discovery and development of HMG-CoA reductase inhibitors" (PDF). 》J. Lipid Res.》 33 (11): 1569-82. PMID 1464741 ...
https://ko.wikipedia.org/wiki/효소
PhotosynthesisPhotosynthesis
Reactive hydrogen peroxide (H2O2), the byproduct of oxalate oxidase reaction, can be neutralized by catalase. Alarm ... Acyl-CoA Fatty. acids Glyco-. sphingolipids Sphingolipids Waxes Polyunsaturated. fatty acids Neurotransmitters. & thyroid ... oxalate released from calcium oxalate crystals is converted to CO2 by an oxalate oxidase enzyme and the produced CO2 can ...
https://en.wikipedia.org/wiki/Photosynthesis
EphedrineEphedrine
... pathway proposed suggests that phenylalanine first forms cinnamoyl-CoA via the enzymes phenylalanine ammonia-lyase and acyl CoA ... monoamine oxidase inhibitor (MAOI) therapy, general anaesthesia with halogenated hydrocarbons (particularly halothane), ... ligase.[31] The cinnamoyl-CoA is then reacted with a hydratase to attach the alcohol functional group. The product is then ...
https://en.m.wikipedia.org/wiki/Ephedrine
Fosforylacja oksydacyjna, wolna encyklopediaFosforylacja oksydacyjna, wolna encyklopedia
Identification of a new 2-methyl branched chain acyl-CoA dehydrogenase. „J. Biol. Chem.". 258 (2), s. 1066-76, 1983. PMID: ... Ito Y, Saisho D, Nakazono M, Tsutsumi N, Hirai A. Transcript levels of tandem-arranged alternative oxidase genes in rice are ... Ikeda Y, Dabrowski C, Tanaka K. Separation and properties of five distinct acyl-CoA dehydrogenases from rat liver mitochondria ... Calhoun M, Thomas J, Gennis R. The cytochrome oxidase superfamily of redox-driven proton pumps. „Trends Biochem Sci". 19 (8), s ...
https://pl.wikipedia.org/wiki/Fosforylacja_oksydacyjna
Vitamin B6Vitamin B6
... which is combined with a fatty acyl-CoA to form dihydroceramide. Dihydroceramide is then further desaturated to form ceramide. ... phosphate oxidase[3] which also catalyzes the conversion of PNP to PLP. Pyridoxine 5′-phosphate oxidase is dependent on flavin ... In this reaction, serine is decarboxylated and combined with palmitoyl-CoA to form sphinganine, ...
https://en.wikipedia.org/wiki/Vitamin_B6
Citrate synthaseCitrate synthase
The enzyme is inhibited by high ratios of ATP:ADP, acetyl-CoA:CoA, and NADH:NAD, as high concentrations of ATP, acetyl-CoA, and ... transferase activity, transferring acyl groups, acyl groups converted into alkyl on transfer. • citrate (Si)-synthase activity ... This induces the enzyme to change its conformation, and creates a binding site for the acetyl-CoA. Only when this citroyl-CoA ... It is also inhibited by succinyl-CoA, which resembles Acetyl-coA and acts as a uncompetitive inhibitor. Citrate inhibits the ...
https://en.wikipedia.org/wiki/Citrate_synthase
Oxidative phosphorylationOxidative phosphorylation
Identification of a new 2-methyl branched chain acyl-CoA dehydrogenase". J. Biol. Chem. 258 (2): 1066-76. PMID 6401712. ... Cytochrome c oxidase, also known as complex IV, is the final protein complex in the electron transport chain.[39] The mammalian ... "Separation and properties of five distinct acyl-CoA dehydrogenases from rat liver mitochondria. ... Another example of a divergent electron transport chain is the alternative oxidase, which is found in plants, as well as some ...
https://en.m.wikipedia.org/wiki/Oxidative_phosphorylation
산화적 인산화 - 위키백과, 우리 모두의 백과사전산화적 인산화 - 위키백과, 우리 모두의 백과사전
Identification of a new 2-methyl branched chain acyl-CoA dehydrogenase". 《J. Biol. Chem.》 258 (2): 1066-76. PMID 6401712. 29 ... 전자전달계의 또 다른 예는 식물 뿐만 아니라 일부 균류, 원생생물, 동물에서 발견되는 대체 산화효소(alternative oxidase)이다.[43][44] 대체 산화효소는 유비퀴놀에서 산소로 전자를 직접 전달한다.[45] ... 포유류에서 ETF:Q 산화환원효소 대사 경로는 여러 아실-CoA 탈수소효소로부터 전자를 받아들일 수 있기 때문에 지방산의 β 산화와 아미노산과 콜린의 이화작용에서 중요하다.[30][31] 식물에서 ETF:Q 산화환원효소는 ... "Separation and properties of five distinct acyl-CoA dehydrogenases from rat liver mitochondria. ...
https://ko.m.wikipedia.org/wiki/산화적_인산화
3-oxoacyl-(acyl-carrier-protein) reductase3-oxoacyl-(acyl-carrier-protein) reductase
Malonyl-CoA synthesis. *ATP citrate lyase. *Acetyl-CoA carboxylase. Fatty acid synthesis/. Fatty acid synthase. *Beta-ketoacyl- ... Xanthine oxidase. 1.1.4: disulfide as acceptor. *Vitamin K epoxide reductase. *Vitamin-K-epoxide reductase (warfarin- ... 3R)-3-hydroxyacyl-[acyl-carrier-protein] + NADP+ ⇌. {\displaystyle \rightleftharpoons }. 3-oxoacyl-[acyl-carrier-protein] + ... Other names in common use include beta-ketoacyl-[acyl-carrier protein](ACP) reductase, beta-ketoacyl acyl carrier protein (ACP ...
https://en.wikipedia.org/wiki/Beta-Ketoacyl_ACP_reductase
Glutamine synthetaseGlutamine synthetase
Methylglutaconyl-CoA hydratase. (See Template:Leucine metabolism in humans - this diagram does not include the pathway for β- ... Glutamine is formed if an ammonium ion attacks the acyl-phosphate intermediate, while glutamate is remade if water attacks the ... Proline oxidase. *Pyrroline-5-carboxylate reductase. *1-Pyrroline-5-carboxylate dehydrogenase/ALDH4A1 ... Ammonium binds strongly to GS only if the acyl-phosphate intermediate is present. Ammonium, rather than ammonia, binds to GS ...
https://en.wikipedia.org/wiki/Glutamine_synthetase
Adenosine triphosphateAdenosine triphosphate
Dozens of ATP equivalents are generated by the beta-oxidation of a single long acyl chain.[20] The acetyl-CoA produced by beta- ... In oxidative phosphorylation, the key control point is the reaction catalyzed by cytochrome c oxidase, which is regulated by ... In the presence of air and various cofactors and enzymes, fatty acids are degraded to acetyl-CoA. The pathway is called beta- ... imply a high amount of reduced cytochrome c and a high level of cytochrome c oxidase activity.[17] An additional level of ...
https://en.m.wikipedia.org/wiki/Adenosine_triphosphate
Citric acid cycleCitric acid cycle
Acyl-CoA is oxidized to trans-Enoyl-CoA while FAD is reduced to FADH2, which is similar to the oxidation of succinate to ... Succinyl-CoA + GDP + Pi Succinate + CoA-SH + GTP Succinyl-CoA synthetase substrate-level. phosphorylation or ADP→ATP instead of ... CH3C(=O)C(=O)O−pyruvate + HSCoA + NAD+ → CH3C(=O)SCoAacetyl-CoA + NADH + CO2. The product of this reaction, acetyl-CoA, is the ... Oxaloacetate + Acetyl CoA + H2O Citrate + CoA-SH Citrate synthase Aldol condensation This is the same as step 0 and restarts ...
https://en.wikipedia.org/wiki/Citric_acid_cycle
GlycineGlycine
In higher eukaryotes, δ-aminolevulinic acid, the key precursor to porphyrins, is biosynthesized from glycine and succinyl-CoA ... In the third pathway of its degradation, glycine is converted to glyoxylate by D-amino acid oxidase. Glyoxylate is then ... The acyl radical is glycyl. Contents. *1 History and etymology. *2 Production ...
https://en.wikipedia.org/wiki/Glycine
KynureninaseKynureninase
Methylglutaconyl-CoA hydratase. (See Template:Leucine metabolism in humans - this diagram does not include the pathway for β- ... This is followed by Cβ-Cγ bond cleavage to generate an acyl-enzyme intermediate together with a tautomerized Ala-PLP adduct. ... Proline oxidase. *Pyrroline-5-carboxylate reductase. *1-Pyrroline-5-carboxylate dehydrogenase/ALDH4A1 ... tryptophan catabolic process to acetyl-CoA. • L-kynurenine catabolic process. • tryptophan catabolic process. • tryptophan ...
https://en.wikipedia.org/wiki/Kynureninase
Respiratory complex IRespiratory complex I
Acyl CoA dehydrogenase. *Apoptosis-inducing factor. *Butyryl CoA dehydrogenase. *Cryptochrome. *Cytochrome b5 reductase ... and cytochrome c oxidase (complex IV).[1] Complex I is the largest and most complicated enzyme of the electron transport chain. ... to acetyl-CoA. *Pyruvate dehydrogenase complex (E1, E2, E3). *(regulated by Pyruvate dehydrogenase kinase and Pyruvate ... Acyl carrier protein, mitochondrial. Pfam PF00550 20. NDUFA2 / B8. NDUA2_HUMAN. NADH dehydrogenase [ubiquinone] 1 alpha ...
https://en.wikipedia.org/wiki/NADH_dehydrogenase_
Fosforilasi oksidatif bahasa Indonesia, ensiklopedia bebasFosforilasi oksidatif bahasa Indonesia, ensiklopedia bebas
Identification of a new 2-methyl branched chain acyl-CoA dehydrogenase". J. Biol. Chem. 258 (2): 1066-76. PMID 6401712.. ... "Cooperative coupling and role of heme a in the proton pump of heme-copper oxidases". Institute of Medical Biochemistry and ... "Separation and properties of five distinct acyl-CoA dehydrogenases from rat liver mitochondria. ... "Vectorial nature of redox Bohr effects in bovine heart cytochrome c oxidase". Institute of Medical Biochemistry and Chemistry, ...
https://id.wikipedia.org/wiki/Fosforilasi_oksidatif
Cofactor (biochemistry)Cofactor (biochemistry)
acyl groups. Bacteria, archaea and eukaryotes Cobalamine [5]. Cobalamine (B12). None. hydrogen, alkyl groups. Bacteria, archaea ... Denessiouk KA, Rantanen VV, Johnson MS (August 2001). "Adenine recognition: a motif present in ATP-, CoA-, NAD-, NADP-, and FAD ... Cytochrome oxidase Ferrous or Ferric. Catalase. Cytochrome (via Heme). Nitrogenase. Hydrogenase Magnesium. Glucose 6- ... Acetyl group and other acyl groups. Bacteria, archaea and eukaryotes Tetrahydrofolic acid [36]. Folic acid (B9). Glutamate ...
https://en.wikipedia.org/wiki/Cofactor_
Nucleic acid metabolismNucleic acid metabolism
The leftover carbon skeletons such as acetyl-CoA and Succinyl-CoA can then be oxidized by the citric acid cycle. Pyrimidine ... Hypoxanthine is then oxidized to form xanthine and then uric acid through the action of xanthine oxidase. The other purine ... Cytosine and uracil are converted into beta-alanine and later to malonyl-CoA which is needed for fatty acid synthesis, among ... Thymine, on the other hand, is converted into β-aminoisobutyric acid which is then used to form methylmalonyl-CoA. ...
https://en.wikipedia.org/wiki/Nucleic_acid_metabolism
List of enzymesList of enzymes
EC 6.2.1.2: Medium-chain acyl-CoA ligase. *EC 6.2.1.3: Long-chain-fatty-acid--CoA ligase ... Category:EC 1.13.12 (With incorporation of one atom of oxygen (internal monooxygenases or internal mixed function oxidases)) * ... EC 6.2.1.40: 4-hydroxybutyrate--CoA ligase. *EC 6.2.1.41: 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl) ... EC 6.2.1.38: (2,2,3-trimethyl-5-oxocyclopent-3-enyl)acetyl-CoA synthase ...
https://en.m.wikipedia.org/wiki/List_of_enzymes
ഓക്സിഡേറ്റീവ് ഫോസ്ഫോറിലേഷൻ - വിക്കിപീഡിയഓക്സിഡേറ്റീവ് ഫോസ്ഫോറിലേഷൻ - വിക്കിപീഡിയ
Identification of a new 2-methyl branched chain acyl-CoA dehydrogenase". J. Biol. Chem. 258 (2): 1066-76. PMID 6401712. മൂലതാളി ... Vanlerberghe GC, McIntosh L (1997). "ALTERNATIVE OXIDASE: From Gene to Function". Annu. Rev. Plant Physiol. Plant Mol. Biol. 48 ... "Separation and properties of five distinct acyl-CoA dehydrogenases from rat liver mitochondria. ... to acetyl-CoA. *Pyruvate dehydrogenase complex (E1, E2, E3). *(regulated by Pyruvate dehydrogenase kinase and Pyruvate ...
https://ml.wikipedia.org/wiki/ഓക്സിഡേറ്റീവ്_ഫോസ്ഫോറിലേഷൻ
Chromosome 1Chromosome 1
HAO2 encoding protein Hydroxyacid oxidase 2. *HMGCS2: 3-hydroxy-3-methylglutaryl-CoA synthase 2 ... ACADM: acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain ... MECR: Trans-2-enoyl-CoA reductase, mitochondrial. *MFAP2: ... 3-hydroxy-3-methylglutaryl-CoA lyase deficiency. *Hypertrophic cardiomyopathy, autosomal dominant mutations of TNNT2; ...
https://en.m.wikipedia.org/wiki/Chromosome_1
Kromosomang 1 (tao), ang malayang ensiklopedyaKromosomang 1 (tao), ang malayang ensiklopedya
ACADM: acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain ... 3-hydroxy-3-methylglutaryl-CoA lyase deficiency. *Hypertrophic ... PPOX: protoporphyrinogen oxidase. *PSEN2: presenilin 2 (Alzheimer disease 4). *SDHB: succinate dehydrogenase complex subunit B ...
https://tl.wikipedia.org/wiki/Kromosomang_1_
Category:Protein pages needing a pictureCategory:Protein pages needing a picture
Acyl-CoA:lysocardiolipin acyltransferase-1. *Acyl-protein thioesterase. *Acylphosphatase. *Acyltransferase like 2 ... Aldehyde oxidase and xanthine dehydrogenase, a/b hammerhead domain. *Alkylglycerone phosphate synthase ...
https://en.wikipedia.org/wiki/Category:Protein_pages_needing_a_picture
Enterococcus faecalisEnterococcus faecalis
Glutamate racemase, hydroxymethylglutaryl-CoA synthase, diphosphomevalonate decarboxylase, topoisomerase DNA gyrase B, D- ... acyl carrier protein, 3‐Dehydroquinate dehydratase and Deoxynucleotide triphosphate triphosphohydrolase are all potential ... production by Enterococcus faecalis requires demethylmenaquinone and is attenuated by functional terminal quinol oxidases: E. ...
https://en.wikipedia.org/wiki/Enterococcus_faecalis
Peroxisomal acyl-CoA oxidase deficiency: MedlinePlus GeneticsPeroxisomal acyl-CoA oxidase deficiency: MedlinePlus Genetics
Peroxisomal acyl-CoA oxidase deficiency is a disorder that causes deterioration of nervous system functions (neurodegeneration ... medlineplus.gov/genetics/condition/peroxisomal-acyl-coa-oxidase-deficiency/ Peroxisomal acyl-CoA oxidase deficiency. ... Peroxisomal acyl-CoA oxidase deficiency is caused by mutations in the ACOX1 gene, which provides instructions for making an ... Peroxisomal acyl-CoA oxidase deficiency is a rare disorder. Its prevalence is unknown. Only a few dozen cases have been ...
https://medlineplus.gov/genetics/condition/peroxisomal-acyl-coa-oxidase-deficiency
Acyl-CoA oxidase - WikipediaAcyl-CoA oxidase - Wikipedia
Other names in common use include fatty acyl-CoA oxidase, acyl coenzyme A oxidase, and fatty acyl-coenzyme A oxidase. This ... In enzymology, an acyl-CoA oxidase (EC 1.3.3.6) is an enzyme that catalyzes the chemical reaction acyl-CoA + O2 ⇌ {\ ... Osumi T, Hashimoto T, Ui N (June 1980). "Purification and properties of acyl-CoA oxidase from rat liver". J. Biochem. 87 (6): ... November 1980). "Stereochemistry of dehydrogenation catalyzed by Acyl-CoA oxidase". J. Biochem. 88 (5): 1481-6. doi:10.1093/ ...
https://en.wikipedia.org/wiki/Acyl-CoA_oxidase
Acyl-CoA oxidase deficiency - WikipediaAcyl-CoA oxidase deficiency - Wikipedia
Acyl-CoA oxidase deficiency affects a person from birth, and most newborns affected with this condition will not survive past ... Acyl-CoA oxidase deficiency is an extremely rare condition. Diagnosis can be done both prenatally based on family history and ... Acyl-CoA oxidase deficiency is a rare disorder that leads to significant damage and deterioration of nervous system functions ( ... Acyl-CoA oxidase deficiency is an autosomal recessive disorder that is caused by biallelic pathogenic variants in ACOX1. This ...
https://en.wikipedia.org/wiki/Acyl-CoA_oxidase_deficiency
Progressive endoplasmic reticulum stress contributes to hepatocarcinogenesis in fatty acyl-CoA oxidase 1-deficient mice. -...Progressive endoplasmic reticulum stress contributes to hepatocarcinogenesis in fatty acyl-CoA oxidase 1-deficient mice. -...
Progressive endoplasmic reticulum stress contributes to hepatocarcinogenesis in fatty acyl-CoA oxidase 1-deficient mice.. Huang ... Progressive Endoplasmic Reticulum Stress Contributes to Hepatocarcinogenesis in Fatty Acyl-CoA Oxidase 1-Deficient Mice ... Progressive Endoplasmic Reticulum Stress Contributes to Hepatocarcinogenesis in Fatty Acyl-CoA Oxidase 1-Deficient Mice ... Progressive Endoplasmic Reticulum Stress Contributes to Hepatocarcinogenesis in Fatty Acyl-CoA Oxidase 1-Deficient Mice ...
https://www.ncbi.nlm.nih.gov/pubmed?term=Huang%20J%2C%20Viswakarma%20N%2C%20Yu%20S%2C%20Jia%20Y%2C%20Bai%20L%2C%20Vluggens%20A%2C%20Cherkaoui-Malki%20M%2C%20Khan%20M
acoxl - Acyl-CoA oxidase-like - Xenopus tropicalis (Western clawed frog) - acoxl gene & proteinacoxl - Acyl-CoA oxidase-like - Xenopus tropicalis (Western clawed frog) - acoxl gene & protein
... fatty acid beta-oxidation using acyl-CoA oxidase, lipid homeostasis ... acyl-CoA oxidase activity, fatty acid binding, flavin adenine dinucleotide binding, ... IPR006091 Acyl-CoA_Oxase/DH_cen-dom. IPR002655 Acyl-CoA_oxidase_C. IPR036250 AcylCo_DH-like_C. IPR009075 AcylCo_DH/oxidase_C. ... IPR006091 Acyl-CoA_Oxase/DH_cen-dom. IPR002655 Acyl-CoA_oxidase_C. IPR036250 AcylCo_DH-like_C. IPR009075 AcylCo_DH/oxidase_C. ...
https://www.uniprot.org/uniprot/F6WJR4
Chlamydomonas carries out fatty acid β-oxidation in ancestral peroxisomes using a bona fide acyl-CoA oxidaseChlamydomonas carries out fatty acid β-oxidation in ancestral peroxisomes using a bona fide acyl-CoA oxidase
... Plant J. 2017 Apr; ... Keywords: Chlamydomonas reinhardtii; acyl-CoA oxidase; catalase; hydrogen peroxide; lipid catabolism; lipid droplet; lipid ... This result demonstrated that CrACX2 is a genuine acyl-CoA oxidase, which is responsible for the first step of the peroxisomal ... a gene encoding a member of the acyl-CoA oxidase/dehydrogenase superfamily. The purified recombinant CrACX2 expressed in ...
https://pubmed.ncbi.nlm.nih.gov/28142200/
Peroxisomal Acyl-Coa Oxidase Deficiency disease: Malacards - Research Articles, Drugs, Genes, Clinical TrialsPeroxisomal Acyl-Coa Oxidase Deficiency disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials
MalaCards integrated aliases for Peroxisomal Acyl-Coa Oxidase Deficiency:. Name: Peroxisomal Acyl-Coa Oxidase Deficiency 54 12 ... An important gene associated with Peroxisomal Acyl-Coa Oxidase Deficiency is ACOX1 (Acyl-CoA Oxidase 1), and among its related ... MalaCards organs/tissues related to Peroxisomal Acyl-Coa Oxidase Deficiency:. 39 Liver, Brain, Eye, Testes ... peroxisomal acyl-coa oxidase deficiency:. Onset and clinical course infantile onset Mortality/Aging death in infancy ...
http://www.malacards.org/card/peroxisomal_acyl_coa_oxidase_deficiency
The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast - Spectrum: Concordia University Research RepositoryThe role of Acyl-CoA oxidase in peroxisome division and longevity in yeast - Spectrum: Concordia University Research Repository
The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast Title:. The role of Acyl-CoA oxidase in peroxisome ... Acyl-CoA oxidase (Aox) is an enzyme that carries out the first step of Ý-oxidation of free fatty acids in peroxisomes. Here I ... Gregg, Christopher (2009) The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast. PhD thesis, Concordia ... The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast ...
https://spectrum.library.concordia.ca/976261/
acyl-CoA oxidase | Semantic Scholaracyl-CoA oxidase | Semantic Scholar
acyl-CoA oxidase. Known as: Oxidase, Acyl-CoA, Oxidase, Fatty Acyl-CoA, Fatty Acyl Coenzyme A Oxidase Expand. ... flanking sequence of the rat acyl CoA oxidase gene.. *J. Tugwood, I. Issemann, R. Anderson, K. Bundell, W. L. McPheat, S. Green ... Steatohepatitis, Spontaneous Peroxisome Proliferation and Liver Tumors in Mice Lacking Peroxisomal Fatty Acyl-CoA Oxidase ... Fibrates downregulate apolipoprotein C-III expression independent of induction of peroxisomal acyl coenzyme A oxidase. A ...
https://www.semanticscholar.org/topic/acyl-CoA-oxidase/30680
Peroxisomal Acyl-Coa Oxidase Deficiency | EncyclopediaPeroxisomal Acyl-Coa Oxidase Deficiency | Encyclopedia
straight-chain acyl-CoA oxidase deficiency. The entry is from https://medlineplus.gov/genetics/condition/peroxisomal-acyl-coa- ... Peroxisomal acyl-CoA oxidase deficiency is a rare disorder. Its prevalence is unknown. Only a few dozen cases have been ... Peroxisomal acyl-CoA oxidase deficiency is caused by mutations in the ACOX1 gene, which provides instructions for making an ... Newborns with peroxisomal acyl-CoA oxidase deficiency have weak muscle tone (hypotonia) and seizures. They may have unusual ...
https://encyclopedia.pub/6104
Acyl-CoA Oxidase from microorganisms, lyophilizateAcyl-CoA Oxidase from microorganisms, lyophilizate
"Acyl-CoA-Oxidase, Lyo.". Unit of measure is "kU". +- Overview Oxidoreductase that catalyzes the interconversion of acyl-CoA to ... Use Acyl-CoA Oxidase in diagnostic tests for the determination of free fatty acids in combination with Acetate-CoA Ligase ( ... Acyl-CoA Oxidase material number and pack size: Material Number. Pack Size. ... Catalase: ≤12 U/U Acyl-CoA oxidase. Stability: At -15 to -25 °C within specification range for 12 months. ...
https://custombiotech.roche.com/home/Product_Details/3_1_4_2_18_1.html
Peroxisomal Acyl-CoA Oxidase Deficiency - Alex - The Leukodystrophy CharityPeroxisomal Acyl-CoA Oxidase Deficiency - Alex - The Leukodystrophy Charity
Peroxisomal Acyl-CoA Oxidase Deficiency. Straight-Chain Acyl-CoA Oxidase Deficiency; Pseudoneonatal Adrenoleukodystrophy. ... The ACOX1 gene creates an enzyme called peroxisomal straight-chain Acyl-CoA oxidase, which plays a role in the break down of ...
https://www.alextlc.org/what-is-a-leukodystrophy/the-different-leukodystrophies/peroxisomal-acyl-coa-oxidase-deficiency/
ACOX2 gene - Genetics Home Reference - NIHACOX2 gene - Genetics Home Reference - NIH
The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is ... acyl-CoA oxidase 2. Enable Javascript to view the expand/collapse boxes.. Open All Close All ... Oxidizes the CoA esters of the bile acid intermediates di- and tri-hydroxycholestanoic acids (PubMed:27884763). Capable of ...
https://ghr.nlm.nih.gov/gene/ACOX2
Platinum in the structure of Arabidopsis Thaliana Acyl-Coa Oxidase 1 (pdb 1w07)Platinum in the structure of Arabidopsis Thaliana Acyl-Coa Oxidase 1 (pdb 1w07)
The binding sites of Platinum atom in the structure of Arabidopsis Thaliana Acyl-Coa Oxidase 1 (pdb code 1w07). This binding ... Platinum in the structure of Arabidopsis Thaliana Acyl-Coa Oxidase 1 (pdb 1w07). ... Arabidopsis Thaliana Acyl-Coa Oxidase 1 ...
http://platinum.atomistry.com/pdb1w07.html
Target highlights in CASP13: Experimental target structures through the eyes of their authors (Journal Article) | OSTI.GOVTarget highlights in CASP13: Experimental target structures through the eyes of their authors (Journal Article) | OSTI.GOV
Acyl-CoA dehydrogenases and acyl-CoA oxidases. Structural basis for mechanistic similarities and differences journal, February ... Acyl-CoA Dehydrogenase Drives Heat Adaptation by Sequestering Fatty Acids journal, May 2015 * Ma, Dengke K.; Li, Zhijie; Lu, ... Acyl-CoA dehydrogenases. A mechanistic overview journal, February 2004 * Ghisla, Sandro; Thorpe, Colin ... Genes encoding acyl-CoA dehydrogenase (AcdH) homologues from Streptomyces coelicolor and Streptomyces avermitilis provide ...
https://www.osti.gov/biblio/1559927-img252482-figure
Molecular mechanisms of alcoholic fatty liver. - PubMed - NCBIMolecular mechanisms of alcoholic fatty liver. - PubMed - NCBI
... acyl-CoA oxidase; CYP4A, cytochrome P450 4A. ... acyl-CoA carboxylase; MCD, malonyl-CoA decarboxylase; CPT-1, ...
https://www.ncbi.nlm.nih.gov/pubmed/19032584
Differential gene expression in mouse liver associated with the hepatoprotective effect of clofibrateDifferential gene expression in mouse liver associated with the hepatoprotective effect of clofibrate
Acyl-CoA Oxidase / genetics * Acyl-CoA Oxidase / metabolism * Amidohydrolases * Animals * Anticholesteremic Agents / ...
https://pubmed.ncbi.nlm.nih.gov/17585979/
Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity | PNASCross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity | PNAS
... acyl-CoA-oxidase, encoded by Acox1; peroxisome proliferator-activated receptor γ coactivator, encoded by Pgc1a; and peroxisome ... proliferator-activated receptor alpha, encoded by Ppara) without affecting lipogenesis markers (e.g., acetyl-CoA carboxylase, ...
http://www.pnas.org/content/110/22/9066
MT2013-31: Allo HCT for Metabolic Disorders and Severe Osteopetrosis - Full Text View - ClinicalTrials.govMT2013-31: Allo HCT for Metabolic Disorders and Severe Osteopetrosis - Full Text View - ClinicalTrials.gov
Acyl-CoA Oxidase Deficiency D-Bifunctional Enzyme Deficiency Multifunctional Enzyme Deficiency Alpha-methylacyl-CoA Racmase ... Peroxisomal acyl-CoA oxidase deficiency Osteopetrosis Alpha-methylacyl-CoA racemase deficiency Fucosidosis Megalencephalic ...
https://clinicaltrials.gov/ct2/show/NCT02171104?term=rett+syndrome&rank=10
JCI - Liver inflammation and fibrosisJCI - Liver inflammation and fibrosis
PPAR stimulation facilitates oxidation of lipids by upregulating acyl-CoA oxidase and medium-chain acyl-CoA dehydrogenase (MCAD ... PPAR stimulation facilitates oxidation of lipids by upregulating acyl-CoA-oxidase and MCAD. Thus, PPARs are possible ... The nicotinamide adenine dinucleotide phosphate oxidase (NOX) homologues NOX1 and NOX2/gp91(phox) mediate hepatic fibrosis in ... Hepatocyte nicotinamide adenine dinucleotide phosphate reduced oxidase 4 regulates stress signaling, fibrosis, and insulin ...
https://www.jci.org/articles/view/88881
Molecules | Free Full-Text | Protective Effect of Cactus Cladode Extracts on Peroxisomal Functions in Microglial BV-2 Cells...Molecules | Free Full-Text | Protective Effect of Cactus Cladode Extracts on Peroxisomal Functions in Microglial BV-2 Cells...
Reversal of mouse Acyl-CoA oxidase 1 (ACOX1) null phenotype by human ACOX1b isoform. Lab. Investig. 2010, 90, 696-708. [Google ... acyl-CoA oxidase 1; catalase; β-oxidation; Escherichia coli; lipopolysaccharides; LPS; nitric oxide; Opuntia; peroxisomes; ... Modulation of peroxisomes abundance by argan oil and lipopolysaccharides in acyl-CoA oxidase 1-deficient fibroblasts. Health ... The inflammatory response in acyl-CoA oxidase 1 deficiency (pseudoneonatal adrenoleukodystrophy). Endocrinology 2012, 153, 2568 ...
http://www.mdpi.com/1420-3049/22/1/102/htm
MT2013-31: Allo HCT for Metabolic Disorders and Severe Osteopetrosis - Full Text View - ClinicalTrials.govMT2013-31: Allo HCT for Metabolic Disorders and Severe Osteopetrosis - Full Text View - ClinicalTrials.gov
Acyl-CoA Oxidase Deficiency D-Bifunctional Enzyme Deficiency Multifunctional Enzyme Deficiency Alpha-methylacyl-CoA Racmase ... Alpha-methylacyl-CoA racemase deficiency Aspartylglucosaminuria Fucosidosis Leukoencephalopathy with vanishing white matter ... Megalencephalic leukoencephalopathy with subcortical cysts Multiple sulfatase deficiency Osteopetrosis Peroxisomal acyl-CoA ...
https://clinicaltrials.gov/ct2/show/NCT02171104?term=weston+miller&rank=1
Longitudinal Natural History Study of Patients With Peroxisome Biogenesis Disorders (PBD) - Tabular View - ClinicalTrials.govLongitudinal Natural History Study of Patients With Peroxisome Biogenesis Disorders (PBD) - Tabular View - ClinicalTrials.gov
Alpha-Methylacyl-CoA Racemase Deficiency. *Peroxisomal Acyl-CoA Oxidase Deficiency. *Peroxisomal Acyl-CoA Oxidase 2 Deficiency ...
https://www.clinicaltrials.gov/ct2/show/record/NCT01668186?term=peroxisome+biogenesis+disorder
Performance, feed utilization, and hepatic metabolic response of weaned juvenile Atlantic bluefin tuna ( Thunnus thynnus L.):...Performance, feed utilization, and hepatic metabolic response of weaned juvenile Atlantic bluefin tuna ( Thunnus thynnus L.):...
Aco acyl coA oxidase, cptI carnitine palmitoyl transferase I, elovl5 fatty acyl elongase 5, fabp2 fatty acid binding protein 2 ... Nutritional regulation of carnitine palmitoyl transferase I (cptI) and acyl coA oxidase (aco) gene transcription in liver of ... Nutritional regulation of fatty acid synthase (fas), delta-6 fatty acyl desaturase (fads2d6) and fatty acyl elongase 5 (elovl5 ... Morais S, Mourente G, Ortega A, Tocher JA, Tocher DR (2011) Expression of fatty acyl desaturase and elongase genes, and ...
https://link.springer.com/article/10.1007%2Fs10695-018-0587-9
Interaction of Fish Oil and Conjugated Linoleic Acid in Affecting Hepatic Activity of Lipogenic Enzymes and Gene Expression in...Interaction of Fish Oil and Conjugated Linoleic Acid in Affecting Hepatic Activity of Lipogenic Enzymes and Gene Expression in...
Acyl-CoA oxidase. 3.63 ± 0.40*. 10.7 ± 1.5†. 8.24 ± 0.83†. 11.7 ± 1.1†‡. 10.5 ± 1.0†. 11.8 ± 1.4†‡. ... Enoyl-CoA hydratase. 3,175 ± 71*. 5,723 ± 371†. 5,368 ± 595†. 6,106 ± 280†. 5,860 ± 427†. 6,466 ± 477†. ... 3-Ketoacyl-CoA thiolase. 668 ± 36*. 1,259 ± 48†. 1,194 ± 68†. 1,425 ± 96†. 1,333 ± 163†. 1,384 ± 79†. ... Acyl-CoA oxidase. 100 ± 8*. 208 ± 29†‡. 168 ± 9†. 163 ± 6†. 139 ± 6§. 133 ± 8. ...
http://diabetes.diabetesjournals.org/content/54/2/412.figures-only
Acox1 - Peroxisomal acyl-coenzyme A oxidase 1 - Mus musculus (Mouse) - Acox1 gene & proteinAcox1 - Peroxisomal acyl-coenzyme A oxidase 1 - Mus musculus (Mouse) - Acox1 gene & protein
Isoform 2 is active against a much broader range of substrates and shows activity towards very long-chain acyl-CoAs (By ... Isoform 1 shows highest activity against medium-chain fatty acyl-CoAs and activity decreases with increasing chain length. ... Catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. ... IPR012258 Acyl-CoA_oxidase. IPR002655 Acyl-CoA_oxidase_C. ... IPR029320 Acyl-CoA_ox_N. IPR006091 Acyl-CoA_Oxase/DH_cen-dom. IPR012258 Acyl-CoA_oxidase. IPR002655 Acyl-CoA_oxidase_C. ...
https://www.uniprot.org/uniprot/Q9R0H0
Malonyl-CoA Signaling, Lipid Partitioning, and Glucolipotoxicity | DiabetesMalonyl-CoA Signaling, Lipid Partitioning, and Glucolipotoxicity | Diabetes
These genes, containing PPAR-response elements, are fatty acyl-CoA oxidase (ACO) and UCP2, which catalyze the limiting steps of ... ACO, acyl-CoA oxidase; DAG, diacylglycerol; detox, detoxification; G3P, glycerol 3-phosphate; PL, phospholipid; UCP2, ... THE MALONYL-CoA/CPT-1 INTERACTION IN THE CONTROL OF INSULIN SECRETION. The role of acyl-CoA compounds as coupling factors ... ACC, acetyl-CoA carboxylase; CPT-1, carnitine palmitoyltransferase-1; FACoA, FFA-derived long chain acyl-CoA esters; FAS, fatty ...
https://diabetes.diabetesjournals.org/content/51/suppl_3/S405
Search: All Pfam signatures | InterPro | EMBL-EBISearch: All Pfam signatures | InterPro | EMBL-EBI
Acyl-CoA dehydrogenase/oxidase C-terminal (IPR009075) Pfam signature: PF00441 Peptidase C19, ubiquitin carboxyl-terminal ... Cytochrome c oxidase subunit I (IPR000883) Pfam signature: PF00115 Cytochrome c oxidase subunit II-like C-terminal (IPR002429) ... NADH:flavin oxidoreductase/NADH oxidase, N-terminal (IPR001155) Pfam signature: PF00724 3-hydroxyacyl-CoA dehydrogenase, C- ... Cytochrome c oxidase subunit III-like (IPR000298) Pfam signature: PF00510 Papillomavirus E2, C-terminal (IPR000427) Pfam ...
http://www.ebi.ac.uk/interpro/member-database/Pfam
Heterelogous Expression of Plant GenesHeterelogous Expression of Plant Genes
"A novel Acyl-CoA oxidase that can oxidize short-chain Acyl-CoA in plant peroxisomes," The Journal of Biological Chemistry, vol ... Peroxisomal short-chain acyl-CoA oxidase A. Arabidopsis thaliana. [83]. Cyclin-dependent kinase A (CDKA). Arabidopsis thaliana ... The most recent examples include the Arabidopsis reductase isoforms, AR1 and AR2 [82], peroxisomal short-chain acyl-CoA oxidase ... acyl-CoA synthetase [87], homogentisate phytyltransferase [88], (+)-abscisic acid 8-hydroxylase [89], 1,2-xylosyltransferase [ ...
https://www.hindawi.com/journals/ijpg/2009/296482/
Produktübersicht anti-ACOX3 AntikörperProduktübersicht anti-ACOX3 Antikörper
BRCACox , acyl-Coenzyme A oxidase 3, pristanoyl , branched-chain acyl-CoA oxidase , peroxisomal acyl-coenzyme A oxidase 3 , ... Target Acyl-CoA Oxidase 3, Pristanoyl (ACOX3) * Acyl-CoA Oxidase 3, Pristanoyl (ACOX3) ... Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched ... anti-ACOX3 Antikörper (Acyl-CoA Oxidase 3, Pristanoyl) Primary Antibody ACOX3 Reaktivität: Human IHC (p), WB Wirt: Kaninchen ...
https://www.antikoerper-online.de/monocarboxylic-acid-catabolic-process-pathway-92/acox3-antibody-23073/
ACOX1DeficiencyGeneCatalasePeroxisomal straight-chainCoenzymePeroxisomeFatty acidACOX3Branched fatty acidsThioestersArabidopsisCatalyzesCarnitineAcetyl CoAFibroblastsFree fattyActivitySubstratesBelongs
ACOX17
  • Peroxisomal acyl-CoA oxidase deficiency is caused by mutations in the ACOX1 gene, which provides instructions for making an enzyme called peroxisomal straight-chain acyl-CoA oxidase. (medlineplus.gov)
  • ACOX1 gene mutations prevent the peroxisomal straight-chain acyl-CoA oxidase enzyme from breaking down VLCFAs efficiently. (medlineplus.gov)
  • It is caused by pathogenic variants in ACOX1, which codes for the production of an enzyme called peroxisomal straight-chain acyl-CoA oxidase (ACOX1). (wikipedia.org)
  • Acyl-CoA oxidase deficiency is an autosomal recessive disorder that is caused by biallelic pathogenic variants in ACOX1. (wikipedia.org)
  • Fatty acyl-coenzyme A oxidase 1 (ACOX1) knockout (ACOX1(-/-)) mice manifest hepatic metabolic derangements that lead to the development of steatohepatitis, hepatocellular regeneration, spontaneous peroxisome proliferation, and hepatocellular carcinomas. (nih.gov)
  • strabismus, nystagmus, and optic atrophy can also occur.etiologyperoxisomal acyl-coa oxidase deficiency is caused by mutations in the acox1 gene (17q25.1) encoding peroxisomal straight-chain acyl-coa oxidase.diagnostic methodsdiagnosis is based on laboratory studies revealing increased serum very-long chain fatty acids (vlcfa) and markedly reduced acyl-coa oxidase activity in fibroblasts. (malacards.org)
  • The ACOX1 gene creates an enzyme called peroxisomal straight-chain Acyl-CoA oxidase, which plays a role in the break down of Very Long Chain Fatty Acids, or VLCFAs. (alextlc.org)
Deficiency15
  • Peroxisomal acyl-CoA oxidase deficiency is a disorder that causes deterioration of nervous system functions (neurodegeneration) beginning in infancy. (medlineplus.gov)
  • Newborns with peroxisomal acyl-CoA oxidase deficiency have weak muscle tone (hypotonia) and seizures. (medlineplus.gov)
  • Most babies with peroxisomal acyl-CoA oxidase deficiency learn to walk and begin speaking, but they experience a gradual loss of these skills (developmental regression), usually beginning between the ages of 1 and 3. (medlineplus.gov)
  • Most children with peroxisomal acyl-CoA oxidase deficiency do not survive past early childhood. (medlineplus.gov)
  • Peroxisomal acyl-CoA oxidase deficiency is a rare disorder. (medlineplus.gov)
  • It is unclear exactly how VLCFA accumulation leads to the specific features of peroxisomal acyl-CoA oxidase deficiency. (medlineplus.gov)
  • Leukodystrophy is likely involved in the development of the neurological abnormalities that occur in peroxisomal acyl-CoA oxidase deficiency. (medlineplus.gov)
  • Acyl-CoA oxidase deficiency is a rare disorder that leads to significant damage and deterioration of nervous system functions (neurodegeneration). (wikipedia.org)
  • Acyl-CoA oxidase deficiency affects a person from birth, and most newborns affected with this condition will not survive past early childhood. (wikipedia.org)
  • It is this leukodystrophy that is related to the development of neurological abnormalities in people with Acyl-CoA oxidase deficiency. (wikipedia.org)
  • Acyl-CoA oxidase deficiency is an extremely rare condition. (wikipedia.org)
  • As a result, acyl-CoA oxidase deficiency may be misdiagnosed as similar conditions such as Usher syndrome and neonatal adrenoleukodystrophy. (wikipedia.org)
  • Peroxisomal Acyl-Coa Oxidase Deficiency, also known as pseudoneonatal adrenoleukodystrophy , is related to d-bifunctional protein deficiency and adrenoleukodystrophy , and has symptoms including failure to thrive , optic atrophy and nystagmus . (malacards.org)
  • Group 4 comprises hyperoxaluria, acatalasemia, Refsum's disease, mevalonate kinase deficiency, glutaryl-CoA oxidase deficiency, and dihydroxy or trihydroxy cholestanoic acidemia (enzyme unknown). (medscape.com)
  • Epub ahead of print] Effects of hematopoietic stem cell transplantation on acyl-CoA oxidase deficiency: a sibling comparison study. (nhnscr.org)
Gene8
  • This is the gene that codes for the production of an enzyme called peroxisomal straight-chain acyl-CoA oxidase which is responsible for the breakdown of VLCFAs. (wikipedia.org)
  • Screening of a Chlamydomonas insertional mutant library identified a strain strongly impaired in oil remobilization and defective in Cre05.g232002 (CrACX2), a gene encoding a member of the acyl-CoA oxidase/dehydrogenase superfamily. (nih.gov)
  • The mouse peroxisome proliferator activated receptor recognizes a response element in the 5′ flanking sequence of the rat acyl CoA oxidase gene. (semanticscholar.org)
  • The product of this gene belongs to the acyl-CoA oxidase family. (nih.gov)
  • One pfl mutant was missing the peroxisomal 3-ketoacyl-CoA thiolase encoded by the PEROXISOME DEFECTIVE1 ( PED1/At2g33150 ) gene, suggesting that peroxisomal metabolism influences the rate of matrix protein degradation. (genetics.org)
  • Hepatic peroxisome proliferator-activated receptor (PPARalpha), together with its target gene CPT and acyl-CoA oxidase (ACO) mRNA expression were also upregulated by SSC. (biomedsearch.com)
  • Functions as transcription activator for the acyl-CoA oxidase gene. (proteopedia.org)
  • sequence of the rat acyl CoA oxidase gene. (google.fr)
Catalase1
  • J. (2000) 350, 313 319 (Printed in Great Britain) 313 Oxygen and haem regulate the synthesis of peroxisomal proteins : catalase A, acyl-CoA oxidase. (portlandpress.com)
Peroxisomal straight-chain1
  • The peroxisomal straight-chain acyl-CoA oxidase enzyme plays a role in the breakdown of certain fat molecules called very long-chain fatty acids (VLCFAs). (medlineplus.gov)
Coenzyme4
  • Other names in common use include fatty acyl-CoA oxidase, acyl coenzyme A oxidase, and fatty acyl-coenzyme A oxidase. (wikipedia.org)
  • Fibrates downregulate apolipoprotein C-III expression independent of induction of peroxisomal acyl coenzyme A oxidase. (semanticscholar.org)
  • In this cycle, pyruvic acid generated from glycolysis is converted into acetyl coenzyme A ( acetyl CoA ) by losing a carbon dioxide molecule. (bionity.com)
  • Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. (genetex.com)
Peroxisome1
  • Finally, we propose a testable model of β-cell "glucolipotoxicity" that implicates malonyl-CoA, peroxisome proliferator-activated receptor (PPAR)-α and -γ, sterol regulatory element binding protein (SREBP)-1c, and altered lipid partitioning. (diabetesjournals.org)
Fatty acid3
  • This result demonstrated that CrACX2 is a genuine acyl-CoA oxidase, which is responsible for the first step of the peroxisomal fatty acid (FA) β-oxidation spiral. (nih.gov)
  • mRNA levels of glucose transporter 4 (GLUT4), fatty acid binding protein 3 (FABP3), palmitoyl transferase 1α (CPT-1α), acyl-CoA oxidase 1 (AOX1), D-bifunctional protein (DBP), 3-ketoacyl-CoA thiolase A (THLA), uncoupling protein (UCP) 2 and UCP3 were investigated by quantitative reverse-transcription polymerase chain reaction. (springer.com)
  • fatty acid:CoA ligase, AMP binding forming, EC 6.2.1.3 ) catalyzes the formation of acyl-CoA thioesters from free fatty acids in the presence of CoA, ATP, and Mg 2+ . (plantphysiol.org)
ACOX31
  • 24 Acyl-CoA Oxidase 3, Pristanoyl (ACOX3) Antikörper von 8 Herstellern verfügbar auf www.antikoerper-online.de. (antikoerper-online.de)
Branched fatty acids1
  • It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. (nih.gov)
Thioesters2
  • To a lesser extent, is also able to catalyze the oxidation of other saturated short-chain acyl-CoA thioesters as pentanoyl-CoA, hexenoyl-CoA and butenoyl-CoA. (uniprot.org)
  • Acyl-CoA dehydrogenases ( EC 1.3.99.3 ) are a family of flavoproteins that catalyse the alpha,beta-dehydrogenation of acyl-CoA thioesters to the corresponding trans 2,3-enoyl CoA-products with the concomitant reduction of enzyme-bound FAD. (embl.de)
Arabidopsis2
  • Long-chain acyl-CoA oxidases of Arabidopsis. (semanticscholar.org)
  • Here, we report the characterization of an Arabidopsis cDNA clone encoding for a glyoxysomal acyl-CoA synthetase designated At LACS6. (plantphysiol.org)
Catalyzes4
  • In enzymology, an acyl-CoA oxidase (EC 1.3.3.6) is an enzyme that catalyzes the chemical reaction acyl-CoA + O2 ⇌ {\displaystyle \rightleftharpoons } trans-2,3-dehydroacyl-CoA + H2O2 Thus, the two substrates of this enzyme are acyl-CoA and O2, whereas its two products are trans-2,3-dehydroacyl-CoA and H2O2. (wikipedia.org)
  • Oxidoreductase that catalyzes the interconversion of acyl-CoA to trans-2,3-dehydroacyl-CoA. (roche.com)
  • Catalyzes the conversion of isovaleryl-CoA/3-methylbutanoyl-CoA to 3-methylbut-2-enoyl-CoA as an intermediate step in the leucine (Leu) catabolic pathway. (uniprot.org)
  • Catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. (abcam.com)
Carnitine2
  • Following entry of FAs into the cell via FA transporters located on the cell membrane, a CoA group is added, and the long-chain fatty acyl-CoA is converted to an acyl-carnitine. (springer.com)
  • During PPARα activation, transcription of PPARα-regulated genes [e.g., carnitine- O -palmitoyltransferase 1 ( CPT1 ) and acyl-CoA oxidase ( ACO )] is stimulated and β-oxidation is activated ( 12 - 14 ). (pubmedcentralcanada.ca)
Acetyl CoA3
  • This process shortens the VLCFA molecules by two carbon atoms at a time until the VLCFAs are converted to a molecule called acetyl-CoA, which is transported out of the peroxisomes for reuse by the cell. (medlineplus.gov)
  • Use Acyl-CoA Oxidase in diagnostic tests for the determination of free fatty acids in combination with Acetate-CoA Ligase (Acetyl-CoA Synthetase), catalog no. 10 885 568 103. (roche.com)
  • What enzyme converts citrate to oxaloacetate and results in Acetyl CoA in the cytosol? (brainscape.com)
Fibroblasts1
  • The primary prenatal diagnosis techniques involve the assessment of amniotic fluid for an abnormal elevation in VLCFAs, and a reduced presence (or in some cases complete absence) of acyl-CoA oxidase in fibroblasts. (wikipedia.org)
Free fatty1
  • Acyl-CoA oxidase (Aox) is an enzyme that carries out the first step of Ý-oxidation of free fatty acids in peroxisomes. (concordia.ca)
Activity7
  • A blood sample can be taken, from which the serum levels of VLCFAs and acyl-CoA oxidase activity can be assessed. (wikipedia.org)
  • This study provides experimental evidence that a plant-type FA β-oxidation involving H 2 O 2 -producing acyl-CoA oxidation activity has already evolved in the microbodies of the unicellular green alga Chlamydomonas reinhardtii. (nih.gov)
  • Isoform 1 shows highest activity against medium-chain fatty acyl-CoAs and activity decreases with increasing chain length. (abcam.com)
  • Isoform 2 is active against a much broader range of substrates and shows activity towards very long-chain acyl-CoAs. (abcam.com)
  • ROS overproduction can result from changes in many processes, such as oxidative phosphorylation (OXPHOS), transition metal ions, oxidase activity, protein folding, thymidine, and polyamine catabolism [ 3 - 7 ]. (hindawi.com)
  • Urate oxidase activity was higher in rats fed on the starch diet than in the three other groups. (portlandpress.com)
  • There were no significant differences in the activity of acyl-CoA oxidase among the groups. (portlandpress.com)
Substrates2
  • In fact, fatty acyl-CoAs represent important bioactive compounds, which are involved in many cellular processes in addition to serving as substrates for lipid biosynthesis and β-oxidation ( Schulz, 1991 ). (plantphysiol.org)
  • Butyryl-CoA dehydrogenase [ ( PUBMED:11812788 ) ] prefers short chain substrates, medium chain- and long-chain acyl-CoA dehydrogenases prefer medium and long chain substrates, respectively, and Isovaleryl-CoA dehydrogenase [ ( PUBMED:9214289 ) ] prefers branched-chain substrates. (embl.de)
Belongs1
  • SIMILARITY: Belongs to the acyl-CoA dehydrogenase family. (univ-lyon1.fr)
ACOX1 gene: MedlinePlus Genetics
ACOX1 gene: MedlinePlus Genetics (medlineplus.gov)
Peroxisomal acyl-CoA oxidase deficiency: MedlinePlus Genetics
Peroxisomal acyl-CoA oxidase deficiency: MedlinePlus Genetics (medlineplus.gov)
Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity | PNAS
Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity | PNAS (pnas.org)
MT2013-31: Allo HCT for Metabolic Disorders and Severe Osteopetrosis - Full Text View - ClinicalTrials.gov
MT2013-31: Allo HCT for Metabolic Disorders and Severe Osteopetrosis - Full Text View - ClinicalTrials.gov (clinicaltrials.gov)
Leukodystrophies | MedlinePlus
Leukodystrophies | MedlinePlus (medlineplus.gov)
Performance, feed utilization, and hepatic metabolic response of weaned juvenile Atlantic bluefin tuna ( Thunnus thynnus L.):...
Performance, feed utilization, and hepatic metabolic response of weaned juvenile Atlantic bluefin tuna ( Thunnus thynnus L.):... (link.springer.com)
Produktübersicht anti-ACOX3 Antikörper
Produktübersicht anti-ACOX3 Antikörper (antikoerper-online.de)
Genetic Dissection of Peroxisome-Associated Matrix Protein Degradation in Arabidopsis thaliana | Genetics
Genetic Dissection of Peroxisome-Associated Matrix Protein Degradation in Arabidopsis thaliana | Genetics (genetics.org)
Peroxisomes form intralumenal vesicles with roles in fatty acid catabolism and protein compartmentalization in Arabidopsis |...
Peroxisomes form intralumenal vesicles with roles in fatty acid catabolism and protein compartmentalization in Arabidopsis |... (nature.com)
Acox1 - Peroxisomal acyl-coenzyme A oxidase 1 - Mus musculus (Mouse) - Acox1 gene & protein
Acox1 - Peroxisomal acyl-coenzyme A oxidase 1 - Mus musculus (Mouse) - Acox1 gene & protein (uniprot.org)
Drug-Induced Alterations of Mitochondrial DNA Homeostasis in Steatotic and Nonsteatotic HepaRG Cells | Journal of Pharmacology...
Drug-Induced Alterations of Mitochondrial DNA Homeostasis in Steatotic and Nonsteatotic HepaRG Cells | Journal of Pharmacology... (jpet.aspetjournals.org)
Peroxisomal Acyl-Coa Oxidase Deficiency disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials
Peroxisomal Acyl-Coa Oxidase Deficiency disease: Malacards - Research Articles, Drugs, Genes, Clinical Trials (malacards.org)
Metformin attenuates the onset of non-alcoholic fatty liver disease and affects intestinal microbiota and barrier in small...
Metformin attenuates the onset of non-alcoholic fatty liver disease and affects intestinal microbiota and barrier in small... (nature.com)
RNA-Seq Links the Transcription Factors AINTEGUMENTA and AINTEGUMENTA-LIKE6 to Cell Wall Remodeling and Plant Defense Pathways ...
RNA-Seq Links the Transcription Factors AINTEGUMENTA and AINTEGUMENTA-LIKE6 to Cell Wall Remodeling and Plant Defense Pathways ... (plantphysiol.org)
HsaA - Flavin-dependent monooxygenase, oxygenase subunit HsaA - Rhodococcus jostii (strain RHA1) - hsaA gene & protein
HsaA - Flavin-dependent monooxygenase, oxygenase subunit HsaA - Rhodococcus jostii (strain RHA1) - hsaA gene & protein (uniprot.org)
FadE - Acyl-coenzyme A dehydrogenase - Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) - fadE gene & protein
FadE - Acyl-coenzyme A dehydrogenase - Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) - fadE gene & protein (uniprot.org)
FadE28 - Acyl-CoA dehydrogenase FadE28 - Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) - fadE28 gene & protein
FadE28 - Acyl-CoA dehydrogenase FadE28 - Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv) - fadE28 gene & protein (uniprot.org)
Recombinant Human ACOX2 protein (ab159986) | Abcam
Recombinant Human ACOX2 protein (ab159986) | Abcam (abcam.com)
Recombinant Anti-ACOX1/AOX antibody [EPR19038] (ab184032) | Abcam
Recombinant Anti-ACOX1/AOX antibody [EPR19038] (ab184032) | Abcam (abcam.com)
KEGG PATHWAY: xtr00120
KEGG PATHWAY: xtr00120 (genome.jp)
Unrestrained markerless trait stacking in Nannochloropsis gaditana through combined genome editing and marker recycling...
Unrestrained markerless trait stacking in Nannochloropsis gaditana through combined genome editing and marker recycling... (pnas.org)
A large-scale analysis of mRNAs expressed by primary mesenchyme cells of the sea urchin embryo | Development
A large-scale analysis of mRNAs expressed by primary mesenchyme cells of the sea urchin embryo | Development (dev.biologists.org)
Frontiers | Toward a Hybrid Biosensor System for Analysis of Organic and Volatile Fatty Acids in Fermentation Processes |...
Frontiers | Toward a Hybrid Biosensor System for Analysis of Organic and Volatile Fatty Acids in Fermentation Processes |... (frontiersin.org)
Lipogenesis Flashcards by boden christianson | Brainscape
Lipogenesis Flashcards by boden christianson | Brainscape (brainscape.com)
Quantitative genomics of starvation stress resistance in Drosophila | Genome Biology | Full Text
Quantitative genomics of starvation stress resistance in Drosophila | Genome Biology | Full Text (genomebiology.biomedcentral.com)
Peroxisomal β-oxidation activities and γ-decalactone production by the yeast Yarrowia lipolytica | SpringerLink
Peroxisomal β-oxidation activities and γ-decalactone production by the yeast Yarrowia lipolytica | SpringerLink (link.springer.com)
Genetic Determinants of the Network of Primary Metabolism and Their Relationships to Plant Performance in a Maize Recombinant...
Genetic Determinants of the Network of Primary Metabolism and Their Relationships to Plant Performance in a Maize Recombinant... (plantcell.org)