Acyl-CoA Oxidase: An enzyme that catalyzes the first and rate-determining steps of peroxisomal beta-oxidation of fatty acids. It acts on COENZYME A derivatives of fatty acids with chain lengths from 8 to 18, using FLAVIN-ADENINE DINUCLEOTIDE as a cofactor.Acyl Coenzyme A: S-Acyl coenzyme A. Fatty acid coenzyme A derivatives that are involved in the biosynthesis and oxidation of fatty acids as well as in ceramide formation.Diacylglycerol O-Acyltransferase: An enzyme that catalyses the last step of the TRIACYLGLYCEROL synthesis reaction in which diacylglycerol is covalently joined to LONG-CHAIN ACYL COA to form triglyceride. It was formerly categorized as EC 2.3.1.124.Sterol O-Acyltransferase: An enzyme that catalyzes the formation of cholesterol esters by the direct transfer of the fatty acid group from a fatty acyl CoA derivative. This enzyme has been found in the adrenal gland, gonads, liver, intestinal mucosa, and aorta of many mammalian species. EC 2.3.1.26.NADPH Oxidase: A flavoprotein enzyme that catalyzes the univalent reduction of OXYGEN using NADPH as an electron donor to create SUPEROXIDE ANION. The enzyme is dependent on a variety of CYTOCHROMES. Defects in the production of superoxide ions by enzymes such as NADPH oxidase result in GRANULOMATOUS DISEASE, CHRONIC.Acyltransferases: Enzymes from the transferase class that catalyze the transfer of acyl groups from donor to acceptor, forming either esters or amides. (From Enzyme Nomenclature 1992) EC 2.3.Coenzyme ACoenzyme A Ligases: Enzymes that catalyze the formation of acyl-CoA derivatives. EC 6.2.1.Cytochrome-c Oxidase Deficiency: A disease that results from a congenital defect in ELECTRON TRANSPORT COMPLEX IV. Defects in ELECTRON TRANSPORT COMPLEX IV can be caused by mutations in the SURF1, SCO2, COX10, or SCO1 genes. ELECTRON TRANSPORT COMPLEX IV deficiency caused by mutation in SURF1 manifests itself as LEIGH DISEASE; that caused by mutation in SCO2 as fatal infantile cardioencephalomyopathy; that caused by mutation in COX10 as tubulopathy and leukodystrophy; and that caused by mutation in SCO1 as early-onset hepatic failure and neurologic disorder. (from Online Mendelian Inheritance in Man, http://www.ncbi.nlm.nih.gov/Omim, MIM#220110, May 17, 2001)Rare Diseases: A large group of diseases which are characterized by a low prevalence in the population. They frequently are associated with problems in diagnosis and treatment.Microbodies: Electron-dense cytoplasmic particles bounded by a single membrane, such as PEROXISOMES; GLYOXYSOMES; and glycosomes.Oxidoreductases: The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)Leigh Disease: A group of metabolic disorders primarily of infancy characterized by the subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, dysphagia, and lactic acidosis. Pathological features include spongy degeneration of the neuropile of the basal ganglia, thalamus, brain stem, and spinal cord. Patterns of inheritance include X-linked recessive, autosomal recessive, and mitochondrial. Leigh disease has been associated with mutations in genes for the PYRUVATE DEHYDROGENASE COMPLEX; CYTOCHROME-C OXIDASE; ATP synthase subunit 6; and subunits of mitochondrial complex I. (From Menkes, Textbook of Child Neurology, 5th ed, p850).Orphan Drug Production: Production of drugs or biologicals which are unlikely to be manufactured by private industry unless special incentives are provided by others.Kupffer Cells: Specialized phagocytic cells of the MONONUCLEAR PHAGOCYTE SYSTEM found on the luminal surface of the hepatic sinusoids. They filter bacteria and small foreign proteins out of the blood, and dispose of worn out red blood cells.Liver Diseases, Alcoholic: Liver diseases associated with ALCOHOLISM. It usually refers to the coexistence of two or more subentities, i.e., ALCOHOLIC FATTY LIVER; ALCOHOLIC HEPATITIS; and ALCOHOLIC CIRRHOSIS.Acetaminophen: Analgesic antipyretic derivative of acetanilide. It has weak anti-inflammatory properties and is used as a common analgesic, but may cause liver, blood cell, and kidney damage.Drug-Induced Liver Injury: A spectrum of clinical liver diseases ranging from mild biochemical abnormalities to ACUTE LIVER FAILURE, caused by drugs, drug metabolites, and chemicals from the environment.Cell Transdifferentiation: A naturally occurring phenomenon where terminally differentiated cells dedifferentiate to the point where they can switch CELL LINEAGES. The cells then differentiate into other cell types.Analgesics, Non-Narcotic: A subclass of analgesic agents that typically do not bind to OPIOID RECEPTORS and are not addictive. Many non-narcotic analgesics are offered as NONPRESCRIPTION DRUGS.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Opuntia: A plant genus of the family CACTACEAE. Species with cylindrical joints are called Cholla; flat jointed ones are Prickly-pear.Peroxisomes: Microbodies which occur in animal and plant cells and in certain fungi and protozoa. They contain peroxidase, catalase, and allied enzymes. (From Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd ed)Cactaceae: The cactus plant family of the order Caryophyllales, subclass Caryophyllidae, class Magnoliopsida. Cacti are succulent perennial plants well adapted to dry regions.Asparagus Plant: A plant genus in the family LILIACEAE (sometimes placed in Asparagaceae) that contains ECDYSTEROIDS and is an ingredient of Siotone. The shoots are used as a vegetable and the roots are used in FOLK MEDICINE.Microglia: The third type of glial cell, along with astrocytes and oligodendrocytes (which together form the macroglia). Microglia vary in appearance depending on developmental stage, functional state, and anatomical location; subtype terms include ramified, perivascular, ameboid, resting, and activated. Microglia clearly are capable of phagocytosis and play an important role in a wide spectrum of neuropathologies. They have also been suggested to act in several other roles including in secretion (e.g., of cytokines and neural growth factors), in immunological processing (e.g., antigen presentation), and in central nervous system development and remodeling.Catalase: An oxidoreductase that catalyzes the conversion of HYDROGEN PEROXIDE to water and oxygen. It is present in many animal cells. A deficiency of this enzyme results in ACATALASIA.Leukodystrophy, Globoid Cell: An autosomal recessive metabolic disorder caused by a deficiency of GALACTOSYLCERAMIDASE leading to intralysosomal accumulation of galactolipids such as GALACTOSYLCERAMIDES and PSYCHOSINE. It is characterized by demyelination associated with large multinucleated globoid cells, predominantly involving the white matter of the central nervous system. The loss of MYELIN disrupts normal conduction of nerve impulses.Sphingolipidoses: A group of inherited metabolic disorders characterized by the intralysosomal accumulation of SPHINGOLIPIDS primarily in the CENTRAL NERVOUS SYSTEM and to a variable degree in the visceral organs. They are classified by the enzyme defect in the degradation pathway and the substrate accumulation (or storage). Clinical features vary in subtypes but neurodegeneration is a common sign.Osteopetrosis: Excessive formation of dense trabecular bone leading to pathological fractures; OSTEITIS; SPLENOMEGALY with infarct; ANEMIA; and extramedullary hemopoiesis (HEMATOPOIESIS, EXTRAMEDULLARY).Aspartylglucosaminuria: A recessively inherited, progressive lysosomal storage disease caused by a deficiency of GLYCOSYLASPARAGINASE activity. The lack of this enzyme activity results in the accumulation of N-acetylglucosaminylasparagine (the linkage unit of asparagine-linked glycoproteins) in LYSOSOMES.Leukodystrophy, Metachromatic: An autosomal recessive metabolic disease caused by a deficiency of CEREBROSIDE-SULFATASE leading to intralysosomal accumulation of cerebroside sulfate (SULFOGLYCOSPHINGOLIPIDS) in the nervous system and other organs. Pathological features include diffuse demyelination, and metachromatically-staining granules in many cell types such as the GLIAL CELLS. There are several allelic and nonallelic forms with a variety of neurological symptoms.alpha-Mannosidosis: An inborn error of metabolism marked by a defect in the lysosomal isoform of ALPHA-MANNOSIDASE activity that results in lysosomal accumulation of mannose-rich intermediate metabolites. Virtually all patients have psychomotor retardation, facial coarsening, and some degree of dysostosis multiplex. It is thought to be an autosomal recessive disorder.Adrenoleukodystrophy: An X-linked recessive disorder characterized by the accumulation of saturated very long chain fatty acids in the LYSOSOMES of ADRENAL CORTEX and the white matter of CENTRAL NERVOUS SYSTEM. This disease occurs almost exclusively in the males. Clinical features include the childhood onset of ATAXIA; NEUROBEHAVIORAL MANIFESTATIONS; HYPERPIGMENTATION; ADRENAL INSUFFICIENCY; SEIZURES; MUSCLE SPASTICITY; and DEMENTIA. The slowly progressive adult form is called adrenomyeloneuropathy. The defective gene ABCD1 is located at Xq28, and encodes the adrenoleukodystrophy protein (ATP-BINDING CASSETTE TRANSPORTERS).Acyl-CoA Dehydrogenases: Enzymes that catalyze the first step in the beta-oxidation of FATTY ACIDS.Acyl-CoA Dehydrogenase: A flavoprotein oxidoreductase that has specificity for medium-chain fatty acids. It forms a complex with ELECTRON TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.Acyl-CoA Dehydrogenase, Long-Chain: A flavoprotein oxidoreductase that has specificity for long-chain fatty acids. It forms a complex with ELECTRON-TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.Algorithms: A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.Butyryl-CoA Dehydrogenase: A flavoprotein oxidoreductase that has specificity for short-chain fatty acids. It forms a complex with ELECTRON-TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.Lipid Metabolism, Inborn Errors: Errors in the metabolism of LIPIDS resulting from inborn genetic MUTATIONS that are heritable.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Congenital Disorders of Glycosylation: A genetically heterogeneous group of heritable disorders resulting from defects in protein N-glycosylation.Peroxisomal Disorders: A heterogeneous group of inherited metabolic disorders marked by absent or dysfunctional PEROXISOMES. Peroxisomal enzymatic abnormalities may be single or multiple. Biosynthetic peroxisomal pathways are compromised, including the ability to synthesize ether lipids and to oxidize long-chain fatty acid precursors. Diseases in this category include ZELLWEGER SYNDROME; INFANTILE REFSUM DISEASE; rhizomelic chondrodysplasia (CHONDRODYSPLASIA PUNCTATA, RHIZOMELIC); hyperpipecolic acidemia; neonatal adrenoleukodystrophy; and ADRENOLEUKODYSTROPHY (X-linked). Neurologic dysfunction is a prominent feature of most peroxisomal disorders.Seeds: The encapsulated embryos of flowering plants. They are used as is or for animal feed because of the high content of concentrated nutrients like starches, proteins, and fats. Rapeseed, cottonseed, and sunflower seed are also produced for the oils (fats) they yield.Indoleacetic Acids: Acetic acid derivatives of the heterocyclic compound indole. (Merck Index, 11th ed)Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Orotic AcidSea Cucumbers: A class of Echinodermata characterized by long, slender bodies.Fatty Liver: Lipid infiltration of the hepatic parenchymal cells resulting in a yellow-colored liver. The abnormal lipid accumulation is usually in the form of TRIGLYCERIDES, either as a single large droplet or multiple small droplets. Fatty liver is caused by an imbalance in the metabolism of FATTY ACIDS.Saponins: A type of glycoside widely distributed in plants. Each consists of a sapogenin as the aglycone moiety, and a sugar. The sapogenin may be a steroid or a triterpene and the sugar may be glucose, galactose, a pentose, or a methylpentose.Holothuria: A genus of large SEA CUCUMBERS in the family Holothuriidae possessing thick body walls, a warty body surface, and microscopic ossicles.Stichopus: A genus of very large, epibenthic SEA CUCUMBERS in the family Stichopodidae, commercially harvested in Southeast Asia for food.Liver Diseases: Pathological processes of the LIVER.

The peroxisome proliferator (PP) response element upstream of the human acyl CoA oxidase gene is inactive among a sample human population: significance for species differences in response to PPs. (1/269)

Peroxisome proliferators (PP) cause peroxisome proliferation, associated with rodent hepatocyte growth perturbation and hepatocarcinogenesis. However, in humans this class of non-genotoxic carcinogens does not appear to have the same adverse effects. The peroxisome proliferator-activated receptor alpha (PPARalpha) mediates the effects of PPs in rodents via peroxisome proliferator response elements (PPREs) upstream of PP-responsive genes such as acyl coenzyme A oxidase (ACO). When the human ACO promoter was cloned previously, it was found to be active and to contain a consensus PPRE (-1918 AGGTCA C TGGTCA -1906). To confirm and extend those original findings, we isolated a 2 kb genomic fragment of the ACO gene promoter from a human liver biopsy and used it to create a beta-galactosidase reporter gene plasmid. The human ACO promoter reporter plasmid was added to both Hepalclc7 and NIH 3T3 cells together with a plasmid expressing mPPARa and assessed for its ability to drive PP-mediated gene transcription. The human ACO promoter fragment was inactive, unlike the equivalent rat ACO promoter fragment used as a positive control. The PPRE within our cloned fragment of the human ACO promoter differed at three positions (5'-AGGTCA G CTGTCA-3') from the previously published active human ACO promoter. Next, we studied the frequency of the inactive versus the active human PPRE within the human population. Using a PCR strategy, we isolated and analysed genomic DNA fragments from 22 unrelated human individuals and from the human hepatoma cell line HepG2. In each case, the PPRE contained the inactive sequence. These data show that the human ACO gene promoter found in a sample human population is inactive. This may explain at the genomic level the lack of response of humans to some of the adverse effects of the PP class of non-genotoxic hepatocarcinogens.  (+info)

Oxidation of medium-chain acyl-CoA esters by extracts of Aspergillus niger: enzymology and characterization of intermediates by HPLC. (2/269)

The activities of beta-oxidation enzymes were measured in extracts of glucose- and triolein-grown cells of Aspergillus niger. Growth on triolein stimulated increased enzyme activity, especially for acyl-CoA dehydrogenase. No acyl-CoA oxidase activity was detected. HPLC analysis after incubation of triolein-grown cell extracts with decanoyl-CoA showed that beta-oxidation was limited to one cycle. Octanoyl-CoA accumulated as the decanoyl-CoA was oxidized. Beta-oxidation enzymes in isolated mitochondrial fractions were also studied. The results are discussed in the context of methyl ketone production by fungi.  (+info)

Beneficial effects of fibrates on apolipoprotein A-I metabolism occur independently of any peroxisome proliferative response. (3/269)

BACKGROUND: In humans, fibrates are frequently used normolipidemic drugs. Fibrates act by regulating genes involved in lipoprotein metabolism via activation of the peroxisome proliferator-activated receptor-alpha (PPARalpha) in liver. In rodents, however, fibrates induce a peroxisome proliferation, leading to hepatomegaly and possibly hepatocarcinogenesis. Although this peroxisome proliferative response appears not to occur in humans, it remains controversial whether the beneficial effects of fibrates on lipoprotein metabolism can occur dissociated from such undesirable peroxisomal response. Here, we assessed the influence of fenofibrate on lipoprotein metabolism and peroxisome proliferation in the rabbit, an animal that, contrary to rodents and similar to humans, is less sensitive to peroxisome proliferators. METHODS AND RESULTS: First, we demonstrate that in normal rabbits, fenofibrate given at a high dose for 2 weeks does not influence serum concentrations or intestinal mRNA levels of the HDL apolipoprotein apoA-I. Therefore, the study was continued with human apoA-I transgenic rabbits that overexpress the human apoA-I gene under control of its homologous promoter, including its PPAR-response elements. In these animals, fenofibrate increases serum human apoA-I concentrations via an increased expression of the human apoA-I gene in liver. Interestingly, liver weight or mRNA levels and activity of fatty acyl-CoA oxidase, a rate-limiting and marker enzyme of peroxisomal beta-oxidation, remain unchanged after fenofibrate. CONCLUSIONS: Expression of the human apoA-I transgene in rabbit liver suffices to confer fibrate-mediated induction of serum apoA-I. Furthermore, these data provide in vivo evidence that the beneficial effects of fibrates on lipoprotein metabolism occur mechanistically dissociated from any deleterious activity on peroxisome proliferation and possibly hepatocarcinogenesis.  (+info)

Absence of spontaneous peroxisome proliferation in enoyl-CoA Hydratase/L-3-hydroxyacyl-CoA dehydrogenase-deficient mouse liver. Further support for the role of fatty acyl CoA oxidase in PPARalpha ligand metabolism. (4/269)

Peroxisomes contain a classical L-hydroxy-specific peroxisome proliferator-inducible beta-oxidation system and also a second noninducible D-hydroxy-specific beta-oxidation system. We previously generated mice lacking fatty acyl-CoA oxidase (AOX), the first enzyme of the L-hydroxy-specific classical beta-oxidation system; these AOX-/- mice exhibited sustained activation of peroxisome proliferator-activated receptor alpha (PPARalpha), resulting in profound spontaneous peroxisome proliferation in liver cells. These observations implied that AOX is responsible for the metabolic degradation of PPARalpha ligands. In this study, the function of enoyl-CoA hydratase/L-3-hydroxyacyl-CoA dehydrogenase (L-PBE), the second enzyme of this peroxisomal beta-oxidation system, was investigated by disrupting its gene. Mutant mice (L-PBE-/-) were viable and fertile and exhibited no detectable gross phenotypic defects. L-PBE-/- mice showed no hepatic steatosis and manifested no spontaneous peroxisome proliferation, unlike that encountered in livers of mice deficient in AOX. These results indicate that disruption of classical peroxisomal fatty acid beta-oxidation system distal to AOX step does not interfere with the inactivation of endogenous ligands of PPARalpha, further confirming that the AOX gene is indispensable for the physiological regulation of this receptor. The absence of appreciable changes in lipid metabolism also indicates that enoyl-CoAs, generated in the classical system in L-PBE-/- mice are diverted to D-hydroxy-specific system for metabolism by D-PBE. When challenged with a peroxisome proliferator, L-PBE-/- mice showed increases in the levels of hepatic mRNAs and proteins that are regulated by PPARalpha except for appreciable blunting of peroxisome proliferative response as compared with that observed in hepatocytes of wild type mice similarly treated. This blunting of peroxisome proliferative response is attributed to the absence of L-PBE protein in L-PBE-/- mouse liver, because all other proteins are induced essentially to the same extent in both wild type and L-PBE-/- mice.  (+info)

Activation of flavin-containing oxidases underlies light-induced production of H2O2 in mammalian cells. (5/269)

Violet-blue light is toxic to mammalian cells, and this toxicity has been linked with cellular production of H2O2. In this report, we show that violet-blue light, as well as UVA, stimulated H2O2 production in cultured mouse, monkey, and human cells. We found that H2O2 originated in peroxisomes and mitochondria, and it was enhanced in cells overexpressing flavin-containing oxidases. These results support the hypothesis that photoreduction of flavoproteins underlies light-induced production of H2O2 in cells. Because H2O2 and its metabolite, hydroxyl radicals, can cause cellular damage, these reactive oxygen species may contribute to pathologies associated with exposure to UVA, violet, and blue light. They may also contribute to phototoxicity often encountered during light microscopy. Because multiphoton excitation imaging with 1,047-nm wavelength prevented light-induced H2O2 production in cells, possibly by minimizing photoreduction of flavoproteins, this technique may be useful for decreasing phototoxicity during fluorescence microscopy.  (+info)

Impairment of peroxisomal biogenesis in human colon carcinoma. (6/269)

Peroxisomes and the activities of their enzymes have been reported to be significantly reduced in various types of tumors including the colon carcinoma. Therefore, the present study was designed to investigate the gene expression of several peroxisomal proteins in human colon carcinoma and additionally those of the peroxisome proliferator activated receptor alpha (PPARalpha) and PEX5, a receptor protein involved in the import of most peroxisomal matrix proteins. Samples from adenocarcinomas and adjacent normal colon were analyzed by immunohistochemistry and western blotting. The mRNA content was assessed by a novel sensitive dot blot RNase protection assay and northern blotting. By immunohistochemistry, peroxisomes were distinctly visualized in normal colonocytes but were not detected in colon carcinoma cells. The protein levels of catalase (CAT), acyl-CoA oxidase as well as the 22 and 70 kDa peroxisomal membrane proteins (PMP22 and PMP70) were all significantly decreased in carcinomas. The corresponding mRNAs for CAT and PMP70, however, were unchanged. In contrast, the mRNA of PEX5 was significantly increased. The expression of PPARalpha was not altered in tumors, neither at protein nor mRNA levels. These observations show that the reduction of peroxisomes and their proteins in colon carcinoma is not due to a generalized reduction of transcription of their genes. It seems more likely that this phenomenon is regulated at a post-transcriptional or translational level. Alternatively, and more likely, an impairment of the biogenesis of the organelle could account for the paucity of peroxisomes in colon carcinoma.  (+info)

Arachidonic acid and PGE2 regulation of hepatic lipogenic gene expression. (7/269)

N-6 polyunsaturated fatty acids (PUFA) suppress hepatic and adipocyte de novo lipogenesis by inhibiting the transcription of genes encoding key lipogenic proteins. In cultured 3T3-L1 adipocytes, arachidonic acid (20:4,n-6) suppression of lipogenic gene expression requires cyclooxygenase (COX) activity. In this study, we found no evidence to support a role for COX-1 or -2 in the 20:4,n-6 inhibition of hepatocyte lipogenic gene expression. In contrast to L1 preadipocytes, adipocytes and rat liver, RT-PCR and Western analyses did not detect COX-1 or COX-2 expression in cultured primary hepatocytes. Moreover, the COX inhibitor, flurbiprofen, did not affect the 20:4,n-6 regulation of lipogenic gene expression in primary hepatocytes. Despite the absence of COX-1 and -2 expression in primary hepatocytes, prostaglandins (PGE2 and PGF2alpha) suppressed fatty acid synthase, l-pyruvate kinase, and the S14 protein mRNA, while having no effect on acyl-CoA oxidase or CYP4A2 mRNA. Using PGE2 receptor agonist, the PGE2 effect on lipogenic gene expression was linked to EP3 receptors. PGE2 inhibited S14CAT activity in transfected primary hepatocytes and targeted the S14 PUFA-response region located -220 to -80 bp upstream from the transcription start site. Taken together, these studies show that COX-1 and COX-2 do not contribute to the n-6 PUFA suppression of hepatocyte lipogenic gene expression. However, cyclooxygenase products from non-parenchymal cells can act on parenchymal cells through a paracrine process and mimic the effects of n-6 PUFA on lipogenic gene expression.  (+info)

Novel form of lipolysis induced by leptin. (8/269)

Hyperleptinemia causes disappearance of body fat without a rise in free fatty acids (FFA) or ketones, suggesting that leptin can deplete adipocytes of fat without releasing FFA. To test this, we measured FFA and glycerol released from adipocytes obtained from normal lean Zucker diabetic fatty rats (+/+) and incubated for 0, 3, 6, or 24 h in either 20 ng/ml recombinant leptin or 100 nM norepinephrine (NE). Whereas NE increased both FFA and glycerol release from adipocytes of +/+ rats, leptin increased glycerol release in +/+ adipocytes without a parallel increase in FFA release. In adipocytes of obese Zucker diabetic fatty rats (fa/fa) with defective leptin receptors, NE increased both FFA and glycerol release, but leptin had no effect on either. Leptin significantly lowered the mRNA of leptin and fatty acid synthase of adipocytes (FAS) (p < 0.05), and up-regulated the mRNA of peroxisome proliferator-activated receptor (PPAR)-alpha, carnitine palmitoyl transferase-1, (CPT-1), and acyl CoA oxidase (ACO) (p < 0.05). NE (100 nM) also lowered leptin mRNA (p < 0.05) but did not affect FAS, PPARalpha, ACO, or CPT-1 expression. We conclude that in normal adipocytes leptin directly decreases FAS expression, increases PPARalpha and the enzymes of FFA oxidation, and stimulates a novel form of lipolysis in which glycerol is released without a proportional release of FFA.  (+info)

Abstract Text: Short chain fatty acids (SCFA), primarily acetate, propionate and butyrate, are the major carbohydrate fermentation end products of in the gut. Previously, we had demonstrated that inulin, a fermentable fiber, alleviated high fat diet induced fat mass accumulation, and that this was accompanied by increased expression of acyl CoA oxidase (ACO), a marker of peroxisomal fatty acid oxidation, decreased expression of fatty acid synthase (FAS) and alteration in the gut microbial community structure to favor increased level of butyrate-producing bacteria. Although gut microbial structure is highly associated with SCFAs production, direct effect of SCFAs on lipid metabolism is still unclear. Therefore, we examined, by RT-PCR, the effect of SCFAs administration on markers of lipid metabolism in differentiated pig adipocytes. Increasing concentrations of SCFAs (µM to low mM) led to an upregulation of expression of acyl CoA oxidase (ACO) and sterol regulatory element binding protein 1c ...
This pathway mainly shows the oxidation of fatty acids. The fatty acid oxidation takes place in mitochondria in animals. This is the reverse of fatty acid biosynthesis and utilises CoA as acyl carrier. The four main enzymes involved in the degradation of fatty acids are acyl-CoA oxidase (acyl-CoA dehydrogenase), Enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase and 3-oxoacyl-CoA thiolase. Each cycle of activities of these enzymes removes 2-carbon units in the form of acetyl-CoA. This cycle of activities can continue until the fatty acid chain is degraded to 4-carbon acetoacetyl-CoA. Acetoacetyl-CoA can then be cleaved to 2 acetyl-CoAs by the reverse action of the enzyme acetyl-CoA C-acetyltransferase.. This pathway may provide a carbon source in the form of acetyl-CoA for mitochondrial TCA cycle and other biosynthesis pathways. The enzymes acyl-CoA oxidase and 3-hydroxyacyl-CoA dehydrogenase are absent in Plasmodium falciparum. There is no biochemical evidence of this pathway taking place in ...
Administration of dehydroepiandrosterone (DHEA), or its sulfated form (DHEAS), controls hyperglycemia in diabetic rodents without directly altering insulin sensitivity. We show that DHEAS enhanced glucose-stimulated insulin secretion when administered in vivo to rats or in vitro to beta-cell lines, without changing cellular insulin content. Insulin secretion increased from 3 days of steroid exposure in vitro, suggesting that DHEAS did not directly activate the secretory processes. DHEAS selectively increased the beta-cell mRNA expression of acyl CoA synthetase-2 and peroxisomal acyl CoA oxidase in a time-dependent manner. Although DHEAS is a peroxisomal proliferator, it did not alter the mRNA expression of peroxisomal proliferator-activated receptor (PPAR) alpha or beta, or enhance the activity of transfected PPAR alpha, beta, or gamma in vitro. Thus, DHEAS directly affected the beta-cell to enhance glucose-stimulated insulin secretion and increased the mRNA expression of specific beta-cell ...
mapping. Gene Expr. 4:28l-299 ( l 995). ll. JD Tugwood. l. lsseman. RG Anderson. KR Bundell, WL Mepheat and S. Green. The mouse peroxisome proliferator activated receptor recognizes a response element in the 5-flanking sequence of the rat acyl CoA oxidase gene. EMBOJ. ll : 433-439 (l992). l2. B. Zhang. SL ...
PAC275Hu01, ACOX; PALMCOX; SCOX; Peroxisomal Acyl-Coenzyme A Oxidase 1; Straight-chain acyl-CoA oxidase | Products for research use only!
NIH Rare Diseases : 50 the following summary is from orphanet, a european reference portal for information on rare diseases and orphan drugs.orpha number: 2971disease definitionperoxisomal acyl-coa oxidase deficiency is a rare neurodegenerative disorder that belongs to the group of inherited peroxisomal disorders and is characterized by hypotonia and seizures in the neonatal period and neurological regression in early infancy.epidemiologyacyl-coa oxidase deficiency is a rare disease with only 30-40 patients identified world-wide so far.clinical descriptionthe disease manifests in the neonatal period with hypotonia (92%) and seizures (91%) as dominant features. facial dysmorphism (50%) with hypertelorism, epicanthus, low nasal bridge, and low-set ears may be present. some children have polydactyly and hepatomegaly. psychomotor development is delayed, but children are usually able to walk and say a few words. however, neurological regression occurs usually at the age of 1-3 years (mean age: 28 ...
Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE) and modulates the transcription of its target genes, such as acyl-CoA oxidase. It therefore controls the peroxisomal beta-oxidation pathway of fatty acids. Key regulator of adipocyte differentiation and glucose homeostasis. ARF6 acts as a key regulator of the tissue-specific adipocyte P2 (aP2) enhancer. Acts as a critical regulator of gut homeostasis by suppressing NF-kappa-B-mediated proinflammatory responses. Plays a role in the regulation of cardiovascular circadian rhythms by regulating the transcription of ARNTL/BMAL1 in the blood vessels (PubMed:19041764).
ACOX3 Antibody 17360-1-AP has been identified with ELISA. 17360-1-AP detected band in {{ptg:PositiveWB}} with {{ptg:WesternTiter}} dilution...
One of the purposes of this study was to test in brown trout liver the spectrophotometric method originally used by Cablé et al. [13] for measurement of peroxisomal oxidase activities in mammalian tissues. However, some modifications were introduced and the method was extended to urate and glycolate oxidases. To calculate the amounts of H2O2 produced by these enzymes, instead of using the extinction coefficient previously published [13], a calibration line was made with known amounts of H2O2. Others also made similar calibration lines, but when using luminometric methods [15] and fluorometric techniques [16].. Since the physiological temperature is much lower in brown trout than in mammals, temperature influence in the activity of five peroxisomal enzymes was investigated. The results showed that the activities of these enzymes rose in a linear mode from 10 to 37°C, but while the activity of hydrogen peroxide producing oxidases were strongly influenced by temperature, catalase activity was ...
ENCODES a protein that exhibits fatty-acyl-CoA reductase (alcohol-forming) activity (ortholog); INVOLVED IN ether lipid biosynthetic process (ortholog); glycerophospholipid biosynthetic process (ortholog); long-chain fatty-acyl-CoA metabolic process (ortholog); ASSOCIATED WITH Peroxisomal Fatty Acyl-CoA Reductase 1 Disorder (ortholog); FOUND IN integral component of peroxisomal membrane (ortholog); peroxisome (ortholog)
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Expression of ACOX1 (PALMCOX) in rectum tissue. Antibody staining with HPA021192, HPA021195, HPA028759 and CAB021094 in immunohistochemistry.
KROMOSOM Kromosom manusia merupakan struktur kompleks yang terdiri dari asam deoksiribonukleat - DNA dan asam ribonukleat - RNA serta protein. Setiap helix tunggal DNA terikat dengan telomer pada masing masing ujungnya, dan memiliki sentromer disuatu tempat sepanjang kromosom. Telomer melindungi ujung kromosom selama replikasi DNA. Pemendekan telomer berhubungan dengan penuaan ...
Expression of ACOX1 (PALMCOX) in pancreas tissue. Antibody staining with HPA021192, HPA021195, HPA028759 and CAB021094 in immunohistochemistry.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
We use cookies to ensure that we give you the best experience on our website. If you continue to use this site we will assume that you are happy with it.Ok ...
Ligand-activated transcription factor. Key regulator of lipid metabolism. Activated by the endogenous ligand 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (16:0/18:1-GPC). Activated by oleylethanolamide, a naturally occurring lipid that regulates satiety. Receptor for peroxisome proliferators such as hypolipidemic drugs and fatty acids. Regulates the peroxisomal beta-oxidation pathway of fatty acids. Functions as transcription activator for the ACOX1 and P450 genes. Transactivation activity requires heterodimerization with RXRA and is antagonized by NR2C2. May be required for the propagation of clock information to metabolic pathways regulated by PER2 (By similarity).
Initial step of β-oxidation is catalyzed by acyl-CoA dehydrogenase in prokaryotes and mitochondria, while acyl-CoA oxidase primarily functions in the peroxisomes of eukaryotes. Oxidase reaction accompanies emission of toxic by-product reactive oxygen molecules including superoxide anion, and superoxide dismutase and catalase activities are essential to detoxify them in the peroxisomes. Although there is an argument about whether primitive life was born and evolved under high temperature conditions, thermophilic archaea apparently share living systems with both bacteria and eukaryotes. We hypothesized that alkane degradation pathways in thermophilic microorganisms could be premature and useful to understand their evolution. An extremely thermophilic and alkane degrading Geobacillus thermoleovorans B23 was previously isolated from a deep subsurface oil reservoir in Japan. In the present study, we identified novel membrane proteins (P16, P21) and superoxide dismutase (P24) whose production levels were
In biochemical protein targeting, a peroxisomal targeting signal (PTS) is a region of the peroxisomal protein that receptors recognize and bind to. It is responsible for specifying that proteins containing this motif are localised to the peroxisome. All peroxisomal proteins are synthesized in the cytoplasm and must be directed to the peroxisome. The first step in this process is the binding of the protein to a receptor. The receptor then directs the complex to the peroxisome. Receptors recognize and bind to a region of the peroxisomal protein called a peroxisomal targeting signal, or PTS. Peroxisomes consist of a matrix surrounded by a specific membrane. Most peroxisomal matrix proteins contain a short sequence, usually three amino acids at the extreme carboxy tail of the protein, that serves as the PTS. The prototypic sequence (many variations exist) is serine-lysine-leucine (-SKL in the one letter amino acid code). This motif, and its variations, is known as the PTS1, and the receptor is ...
Shop Alcohol-forming fatty acyl-CoA reductase ELISA Kit, Recombinant Protein and Alcohol-forming fatty acyl-CoA reductase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
putative acyl-CoA carboxylase alpha subunit [putative Acyl-CoA carboxylase] ATGAGCGCCGCCCTCCTAGGCCTCCGTCAGGCCCGCATACGCAAGGTGTTGATCGCCAAC CGTGGCGAAATCGCTGTTCGTGTCGCCCGGGCGTGCCGAGACGCCGGTATCGCGAGCGTG GCGGTGTACGCCGAGCCGGACCGGGACGCACTGCATGTGCGGGCCGCGGACGAGGCGTTC GCGCTGGGCGGTGACACCCCCGCGACCAGCTACCTCGACATGGCCAAGGTGCTGCAGGCC GCCAAGGACTCCGGCGCGGACGCCATCCACCCCGGTTACGGCTTCCTTTCCGAGAACGCC GACTTCGCCCAGGCCGTCCTGGACGCCCAGCTGATCTGGATCGGCCCGCCGCCGCAGGCG ATTCGCGACCTGGGTGACAAGGCCCATATCGCCCAGCGCGCCGGCGCCCCGCTGGTCGCC GGCACCCCCGACCCGGTCTCGGGCTCGGACGAGGTCGTCGCCTTCGCGGAGGAGCACGGG CTGCCGATCGCCATCAAGGCCGCCTTCGGTGGCGGTGGCCGCGGTCTGAAGGTCGCCCGC ACCCTGGAAGAAGTCCCCGAGCTGTACGACTCGGCCGTCCGCGAGGCGGTGGCCGCCTTC GGCCGCGGTGAGTGCTTCGTCGAGCGCTACCTCGACAAGCCCCGGCACGTGGAGACCCAG TGCCTGGCCGACTCCCACGGCAACGTGGTCGTCGTCTCCACCCGCGACTGCTCACTGCAG CGCCGCCACCAGAAGCTGGTCGAGGAGGCGCCCGCGCCGTTCCTCTCCGACGAGCAGGTC GCCGAGCTGTACTCCTCTTCGAAGGCCATCCTCAAGGAGGCCGGCTATGTCGGCGCCGGG ACCGTGGAGTTCCTGGTCGGCACGGACGGCACGATCTCCTTCCTGGAGGTCAACACCCGC ...
At Seton Accountable Care Organization, Inc. (Seton ACO) we have a big idea for Central Texas: healthcare thats friendlier and more connected.
As a neuromodulator, serotonin regulates numerous behavioral and emotional states. This study shows in the nematode C. elegans, metabolic cues that originate in the organisms periphery modulate neurally regulated serotonergic processes, including feeding behavior and egg laying, revealing a homeostatic signal that informs the nervous system of the organisms nutritional state.
While concepts and theories can go a long way, sometimes the best way to understand something is through a concrete example. So, from time to time, ACO Insider will check in on a new...
7-Keto Trim 60 VCapsules Is a natural, safe, non androgenic derivative of DHEA, this ingredient has been found to be 3x more effective than diet and exercise alone &-Keto is very effevtive in stimulating fat metabolism, especially in diets focused on appetite suppression and calorie reduction. It activates three different fat burning enzymes: -Fatty Acetyl?CoA Oxidase -Glycerol-3-Phosphate Dehydrogenase -Malic Enzyme Acetyl L-Carnitine supports the burning of fat for energy,5-HTP supports appetite control, L-Tryosine supports fat metabolism Supplement Facts Servings Size: 1 capsule Servings Per Container: 60 Amount Per Serving: % Daily Value* 7-Keto 100mg, ~ (3-Acetyl-7-oxo dehydroeplandrosterone) Proprietary Blend 25mg providing: Acetyl L-Carnitine ~ 5-HTP(5-hydroxytryptophan)(Griffonia simplicifolia)(seed) ~ L-Tryosine(free form)~ GreenTea (leaf) (45% EGCG epigallocatechin gallate) ~ Other Ingredients Cellulose, magnesium stearate, silica cellulose(capsule shell).
Dynamic control of peroxisome proliferation is integral to the peroxisomes many functions. The endoplasmic reticulum (ER) serves as a source of preperoxisomal vesicles (PPVs) that mature into peroxisomes during de novo peroxisome biogenesis and support growth and division of existing peroxisomes. H …
Plant peroxisomes maintain a plethora of key life processes including fatty acid β-oxidation, photorespiration, synthesis of hormones, and homeostasis of reactive oxygen species (ROS). Abundance of peroxisomes in cells is dynamic; however mechanisms controlling peroxisome proliferation remain poorly …
1998 11 18.43762 04 59 35.44 +21 49 05.4 22.6R 98WY24 695 Ca3208 1998 11 18.50897 04 59 35.07 +21 49 04.7 98WY24 695 Ca3208 1998 11 19.49641 04 59 30.18 +21 48 57.5 22.5R 98WY24 695 a3608 1998 11 19.53615 04 59 29.97 +21 48 57.4 98WY24 695 a3608 1998 11 26.37301 04 58 55.18 +21 48 06.5 22.7R 98WY24 695 Ca3208 1998 11 27.37204 04 58 50.01 +21 47 59.2 98WY24 695 Ca3208 1998 12 19.01745 04 56 55.74 +21 45 18.4 22.7R 98WY24 950 a3608 1998 12 19.10795 04 56 55.29 +21 45 17.3 98WY24 950 a3608 1998 12 19.15789 04 56 55.04 +21 45 16.8 98WY24 950 a3608 1999 01 22.30591 04 54 23.97 +21 41 59.6 22.9R 98WY24 568 Ca5544 1999 01 22.35924 04 54 23.79 +21 41 59.7 98WY24 568 Ca5545 1999 01 23.34528 04 54 20.55 +21 41 55.8 98WY24 568 Ca5545 2000 11 23.44734 05 10 59.69 +22 09 06.5 22.8R 98WY24 695 Cc3588 2000 11 23.49502 05 10 59.45 +22 09 06.2 98WY24 695 Cc3588 2000 11 27.35230 05 10 39.68 +22 08 43.3 23.1R 98WY24 695 Cc3588 2000 11 27.42891 05 10 39.28 +22 08 42.9 23.1R 98WY24 695 Cc3588 2000 11 28.39859 05 10 ...
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
GJ assembly between S364PCx43, S364ECx43 and S364ACx43/KO fibroblasts. (A) Example of Lucifer yellow dye transfer between S364PCx43 and S364ECx43/KO fibroblasts
The potential peroxisomal localization of a pathway supplying NADPH for β-oxidation.(A) The putative pathway follows the TCA reaction cycle, beginning with pyr
Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Fundacja
A linear rate of H2O2 production is found when glutaryl-CoA is incubated with liver homogenates. We term this enzyme activity glutaryl-CoA oxidase. Its main characteristics are described and compared with those of glutaryl-CoA dehydrogenase (EC 1.3.99.7) and palmitoyl-CoA oxidase (EC 1.1.3.-). The latter enzyme catalyses the first step of peroxisomal beta-oxidation. Glutaryl-CoA oxidase shares several properties with palmitoyl-CoA oxidase. The activities of both enzymes in mouse liver are increased by feeding the animals with a clofibrate-containing diet. Subcellular fractionation of the liver homogenates on a linear sucrose gradient indicates that glutaryl-CoA oxidase is a peroxisomal enzyme.. ...
Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency (OMIM 201450) is the most common inherited disorder of fatty acid metabolism presenting with hypoglycaemia, hepatopathy and Reye-like symptoms during catabolism. In the past, the majority of patients carried the prevalent c.985A|G mutation in the ACADM gene. Since the introduction of newborn screening many other mutations with unknown clinical relevance have been identified in asymptomatic newborns. In order to identify functional effects of these mutant genotypes we correlated residual MCAD (OMIM 607008) activities as measured by octanoyl-CoA oxidation in lymphocytes with both genotype and relevant medical reports in 65 newborns harbouring mutant alleles. We identified true disease-causing mutations with residual activities of 0 to 20%. In individuals carrying the c.199T|C or c.127G|A mutation on one allele, residual activities were much higher and in the range of heterozygotes (31%-60%). Therefore, both mutations cannot clearly be associated with a
Inductions of FABP in hepatic cytosol by administration of tiadenol and clofibric acid were studied in rats, mice and guinea-pigs. In rats and mice, [1-14C]oleic acid-binding capacity of hepatic cytosol was increased, in association with induction of
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Reactivity: Chicken, Cow, Dog and more. Compare 67 different PPARA ELISA Kits & buy the right one directly at antibodies-online.com!
71073-93-3 - 2-Propenoic acid, telomer with trichloroacetaldehyde - Similar structures search, synonyms, formulas, resource links, and other chemical information.
Opens the Highlight Feature Bar and highlights feature annotations from the FEATURES table of the record. The Highlight Feature Bar can be used to navigate to and highlight other features and provides links to display the highlighted region separately. Links in the FEATURES table will also highlight the corresponding region of the sequence. More... ...
Free GRE Subject Test: Biology flashcards - Other Organelles - Understanding Lysosomes and Peroxisomes. Work through hundreds of free flashcards and see your gr
ARFGEF2 Peroxisomal acyl-CoA oxidase deficiency; 264470; ACOX1 Perry syndrome; 168605; DCTN1 Persistent Mullerian duct syndrome ... SCARB2 Acyl-CoA dehydrogenase, long chain, deficiency of; 201460; ACADL Acyl-CoA dehydrogenase, medium chain, deficiency of; ... ACADM Acyl-CoA dehydrogenase, short chain, deficiency of; 201470; ACADS Adenocarcinoma of lung, response to tyrosine kinase ... HADHSC 3-hydroxyisobutryl-CoA hydrolase deficiency; 250620; HIBCH 3-M syndrome; 273750; CUL7 3-Methylcrotonyl-CoA carboxylase 1 ...
2002). "Peroxisomal acyl CoA oxidase deficiency". J. Pediatr. 140 (1): 128-30. doi:10.1067/mpd.2002.120511. PMID 11815777. ... ACOX3 Acyl-CoA oxidase GRCh38: Ensembl release 89: ENSG00000161533 - Ensembl, May 2017 GRCm38: Ensembl release 89: ... 1995). "Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells". J. Biol. Chem. 270 (9 ... 1994). "Large deletion of the peroxisomal acyl-CoA oxidase gene in pseudoneonatal adrenoleukodystrophy". J. Clin. Invest. 94 (2 ...
It shows some homology to acyl-CoA oxidases and those containing flavins. Recent observations suggest that AidB may bind to ...
Malic Enzyme and Fatty Acyl CoA Oxidase. In keeping with the biological definition of thermogenesis, all three of these enzyme ...
Acyl-Coenzyme A oxidase 3 also known as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched ... ACOX1 Acyl-CoA oxidase GRCh38: Ensembl release 89: ENSG00000087008 - Ensembl, May 2017 GRCm38: Ensembl release 89: ... and trihydroxycoprostanic acids are oxidized by one single peroxisomal branched chain acyl-CoA oxidase in human liver and ... "Entrez Gene: ACOX3 acyl-Coenzyme A oxidase 3, pristanoyl". Human ACOX3 genome location and ACOX3 gene details page in the UCSC ...
... and acyl-CoA oxidase. Changes in expression were reportedly due to epigenetic regulation of either the gene promoter itself, or ... Feeding a PR-diet to pregnant and/or lactating mice also increased expression of glucokinase, acetyl-CoA carboxylase, PPARα, ...
... acyl-CoA oxidase (see, e.g., ACOX1, MIM 609751); the 'D-bifunctional enzyme,' with enoyl-CoA hydratase and D-3-hydroxyacyl-CoA ... Jiang LL, Miyazawa S, Souri M, Hashimoto T (1997). "Structure of D-3-hydroxyacyl-CoA dehydratase/D-3-hydroxyacyl-CoA ... Itoh M, Suzuki Y, Takashima S (1999). "A novel peroxisomal enzyme, D-3-hydroxyacyl-CoA dehydratase/D-3-hydroxyacyl-CoA ... 1997). "Purification and properties of human D-3-hydroxyacyl-CoA dehydratase: medium-chain enoyl-CoA hydratase is D-3- ...
... and branched chain acyl-CoA oxidase. G. Möller; E.G. van Grunsven; R.J.A. Wanders; J. Adamski (2001). "Molecular basis of D- ... DBP is a stereospecific enzyme; hydratase domain forms only (R)-hydroxy-acyl-CoA intermediates from trans-2-enoyl-CoAs. D-BP is ... D-BP knockout mice show compensatory upregulation of other peroxisomal enzymes in absence of D-BP such as palmitoyl-CoA oxidase ... This breaks the hydrophobic interactions necessary for proper substrate binding with CoA esters. The most common clinical ...
D-amino acid oxidase, glucose oxidase, xanthine oxidase, and acyl CoA dehydrogenase. FADH and FADH2 are reduced forms of FAD. ... Flavin adenine dinucleotide is a group bound to many enzymes including ferredoxin-NADP+ reductase, monoamine oxidase, ...
"Cloning of nitroalkane oxidase from Fusarium oxysporum identifies a new member of the acyl-CoA dehydrogenase superfamily". Proc ... a carbanion-forming flavoprotein homologous to acyl-CoA dehydrogenase". Arch. Biochem. Biophys. 433 (1): 157-65. doi:10.1016/j. ... In enzymology, a nitroalkane oxidase (EC 1.7.3.1) is an enzyme that catalyzes the chemical reaction a nitroalkane + H2O + O2 ... Other names in common use include nitroethane oxidase, NAO, and nitroethane:oxygen oxidoreductase. This enzyme participates in ...
Other names in common use include fatty acyl-CoA oxidase, acyl coenzyme A oxidase, and fatty acyl-coenzyme A oxidase. This ... In enzymology, an acyl-CoA oxidase (EC 1.3.3.6) is an enzyme that catalyzes the chemical reaction acyl-CoA + O2 ⇌ {\ ... Osumi T, Hashimoto T, Ui N (June 1980). "Purification and properties of acyl-CoA oxidase from rat liver". J. Biochem. 87 (6): ... November 1980). "Stereochemistry of dehydrogenation catalyzed by Acyl-CoA oxidase". J. Biochem. 88 (5): 1481-6. PMID 7462191. ...
... dehydrogenation of fatty acyl-CoA in peroxisomes). Most of the oxidases are flavoproteins. The name "mixed-function oxidase" ... saturated fatty acyl-CoA and NADPH are oxidized by molecular oxygen (O2) to produce monounsaturated fatty acyl-CoA, NADP+ and 2 ... Desaturation of fatty acyl-CoA in vertebrates is an example of the mixed-function oxidase reaction. In the process, ... Mixed-function oxidase is the name of a family of oxidase enzymes that catalyze a reaction in which each of the two atoms of ...
An inducible fatty acyl-CoA oxidase, a noninducible fatty acyl-CoA oxidase, and a noninducible trihydroxycoprostanoyl-CoA ... THC-CoA oxidase, THCA-CoA oxidase, 3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA oxidase, 3alpha,7alpha,12alpha- ... Schepers L, Van Veldhoven PP, Casteels M, Eyssen HJ, Mannaerts GP (1990). "Presence of three acyl-CoA oxidases in rat liver ... 12alpha-trihydroxy-5beta-chole stanoyl-CoA oxidase from rabbit liver". J. Biol. Chem. 272 (29): 18481-9. doi:10.1074/jbc.272.29 ...
long-chain-fatty-acyl-CoA reductase Ja 1.2.3.1 aldehyde oxidase Ja ... cytochroom-c-oxidase Ja Externe links[bewerken , brontekst bewerken]. *Integrated Enzyme Database (European Bioinformatics ...
... cytochrome c oxidase, subunit 4, isoform 2) genes with racing performance in Thoroughbred horses". Equine Veterinary Journal. ... Acyl-CoA thioesterase 9 is a protein that is encoded by the human ACOT9 gene. It is a member of the acyl-CoA thioesterase ... These enzymes have also been referred to in the literature as acyl-CoA hydrolases, acyl-CoA thioester hydrolases, and palmitoyl ... as opposed to long-chain acyl-CoA synthetases, which ligate fatty acids to CoA, to produce the CoA ester. The role of the ACOT ...
... deficiency of Acyl-CoA dehydrogenase, very long chain, deficiency of Acyl-CoA oxidase deficiency Adactylia unilateral dominant ... Acute promyelocytic leukemia Acute renal failure Acute respiratory distress syndrome Acute tubular necrosis Acyl-CoA ... dehydrogenase, medium chain, deficiency of Acyl-CoA dehydrogenase, short chain, ...
... acyl-coa dehydrogenase, long-chain MeSH D08.811.682.660.150.200 --- acyl-CoA oxidase MeSH D08.811.682.660.150.300 --- butyryl- ... acyl-coa dehydrogenases MeSH D08.811.682.660.150.100 --- acyl-coa dehydrogenase MeSH D08.811.682.660.150.150 --- ... sarcosine oxidase MeSH D08.811.682.662.640 --- proline oxidase MeSH D08.811.682.662.680 --- pyridoxamine-phosphate oxidase MeSH ... acyl-carrier protein s-acetyltransferase MeSH D08.811.913.050.134.060 --- acetyl-CoA C-acetyltransferase MeSH D08.811.913.050. ...
It has been found in certain Candida yeast, where it participates in omega oxidation of fatty acids to produce acyl-CoA for ... Other names in common use include long-chain fatty alcohol oxidase, fatty alcohol oxidase, fatty alcohol:oxygen oxidoreductase ... Long-chain alcohol oxidase is one of two enzyme classes that oxidize long-chain or fatty alcohols to aldehydes. ... Long-chain alcohol oxidase is also used in germinating seedlings of jojoba (Simmondsia chinensis) to degrade esterified long- ...
... deficiency of subtypes of acyl CoA dehydrogenase (LCAD, SCAD, MCAD, VLCAD, 3-hydroxyacyl-coenzyme A dehydrogenase deficiency), ... thiolase deficiency Mitochondrial myopathies: deficiency of succinate dehydrogenase, cytochrome c oxidase and coenzyme Q10 ...
fatty acid beta-oxidation using acyl-CoA oxidase. • تمثيل غذائي. • protein localization to plasma membrane. • bile acid ... fatty-acyl-CoA binding. • transferase activity, transferring acyl groups other than amino-acyl groups. • sterol transporter ... long-chain fatty acyl-CoA binding. • cholesterol binding. • ربط بروتيني. • propanoyl-CoA C-acyltransferase activity. • نشاط ... transferase activity, transferring acyl groups. • lipid binding. • propionyl-CoA C2-trimethyltridecanoyltransferase activity. ...
Dozens of ATP equivalents are generated by the beta-oxidation of a single long acyl chain. The acetyl-CoA produced by beta- ... In oxidative phosphorylation, the key control point is the reaction catalyzed by cytochrome c oxidase, which is regulated by ... In the presence of air and various cofactors and enzymes, fatty acids are degraded to acetyl-CoA. The pathway is called beta- ... imply a high amount of reduced cytochrome c and a high level of cytochrome c oxidase activity. An additional level of ...
... and branched-chain amino acids requires FAD in the shared E3 portion of their respective dehydrogenase complexes Fatty acyl CoA ... phosphate oxidase The primary coenzyme form of vitamin B6 (pyridoxal phosphate) is FMN dependent Oxidation of pyruvate, α- ...
The first oxidation step in the peroxisome is catalyzed by the enzyme acyl-CoA oxidase. The β-ketothiolase used in peroxisomal ... Cn-acyl CoA + FAD + NAD+ + H 2O + CoA → Cn-2-acyl CoA + FADH 2 + NADH + H+ + acetyl CoA Fatty acid catabolism consists of: ... The final cycle produces two separate acetyl CoAs, instead of one acyl CoA and one acetyl CoA. For every cycle, the Acyl CoA ... is not an appropriate substrate for acyl CoA dehydrogenase, or enoyl CoA hydratase: If the acyl CoA contains a cis-Δ3 bond, ...
... short/branched-chain acyl-CoA dehydrogenase), valine (isobutyryl-CoA dehydrogenase), and lysine (glutaryl-CoA dehydrogenase). ... Glucose oxidase (GOX) catalyzes the oxidation of β-D-glucose to D-glucono-δ-lactone with the simultaneous reduction of enzyme- ... such as for multiple acyl-CoA dehydrogenase deficiency. In addition, riboflavin deficiency itself (and the resulting lack of ... Monoamine oxidase (MAO) is an extensively studied flavoenzyme due to its biological importance with the catabolism of ...
... protoporphyrinogen oxidase EC 1.3.3.5: bilirubin oxidase EC 1.3.3.6: acyl-CoA oxidase EC 1.3.3.7: dihydrouracil oxidase EC 1.3. ... medium-chain acyl-CoA dehydrogenase EC 1.3.8.8: long-chain acyl-CoA dehydrogenase EC 1.3.8.9: very-long-chain acyl-CoA ... pyruvate oxidase EC 1.2.3.4: oxalate oxidase EC 1.2.3.5: glyoxylate oxidase EC 1.2.3.6: pyruvate oxidase (CoA-acetylating) EC ... stearoyl-CoA 9-desaturase EC 1.14.19.2: acyl-(acyl-carrier-protein) desaturase EC 1.14.19.3: linoleoyl-CoA desaturase EC 1.14. ...
Protoporphyrinogen oxidase. *Bilirubin oxidase. *Acyl-CoA oxidase. *Dihydrouracil oxidase. *Tetrahydroberberine oxidase. * ...
Reversal of mouse Acyl-CoA oxidase 1 (ACOX1) null phenotype by human ACOX1b isoform. Lab. Investig. 2010, 90, 696-708. [Google ... acyl-CoA oxidase 1; catalase; β-oxidation; Escherichia coli; lipopolysaccharides; LPS; nitric oxide; Opuntia; peroxisomes; ... Modulation of peroxisomes abundance by argan oil and lipopolysaccharides in acyl-CoA oxidase 1-deficient fibroblasts. Health ... The inflammatory response in acyl-CoA oxidase 1 deficiency (pseudoneonatal adrenoleukodystrophy). Endocrinology 2012, 153, 2568 ...
Other names in common use include fatty acyl-CoA oxidase, acyl coenzyme A oxidase, and fatty acyl-coenzyme A oxidase. This ... In enzymology, an acyl-CoA oxidase (EC 1.3.3.6) is an enzyme that catalyzes the chemical reaction acyl-CoA + O2 ⇌ {\ ... Osumi T, Hashimoto T, Ui N (June 1980). "Purification and properties of acyl-CoA oxidase from rat liver". J. Biochem. 87 (6): ... November 1980). "Stereochemistry of dehydrogenation catalyzed by Acyl-CoA oxidase". J. Biochem. 88 (5): 1481-6. PMID 7462191. ...
... medlineplus.gov/genetics/condition/peroxisomal-acyl-coa-oxidase-deficiency/ Peroxisomal acyl-CoA oxidase deficiency. ... Peroxisomal acyl-CoA oxidase deficiency is caused by mutations in the ACOX1 gene, which provides instructions for making an ... Peroxisomal acyl-CoA oxidase deficiency is a rare disorder. Its prevalence is unknown. Only a few dozen cases have been ... Newborns with peroxisomal acyl-CoA oxidase deficiency have weak muscle tone (hypotonia) and seizures. They may have unusual ...
Progressive endoplasmic reticulum stress contributes to hepatocarcinogenesis in fatty acyl-CoA oxidase 1-deficient mice.. Huang ... Progressive Endoplasmic Reticulum Stress Contributes to Hepatocarcinogenesis in Fatty Acyl-CoA Oxidase 1-Deficient Mice ... Progressive Endoplasmic Reticulum Stress Contributes to Hepatocarcinogenesis in Fatty Acyl-CoA Oxidase 1-Deficient Mice ... Progressive Endoplasmic Reticulum Stress Contributes to Hepatocarcinogenesis in Fatty Acyl-CoA Oxidase 1-Deficient Mice ...
... fatty acid beta-oxidation using acyl-CoA oxidase, lipid homeostasis ... acyl-CoA oxidase activity, fatty acid binding, flavin adenine dinucleotide binding, ... IPR006091 Acyl-CoA_Oxase/DH_cen-dom. IPR002655 Acyl-CoA_oxidase_C. IPR036250 AcylCo_DH-like_C. IPR009075 AcylCo_DH/oxidase_C. ... IPR006091 Acyl-CoA_Oxase/DH_cen-dom. IPR002655 Acyl-CoA_oxidase_C. IPR036250 AcylCo_DH-like_C. IPR009075 AcylCo_DH/oxidase_C. ...
... Plant J. 2017 Apr; ... Keywords: Chlamydomonas reinhardtii; acyl-CoA oxidase; catalase; hydrogen peroxide; lipid catabolism; lipid droplet; lipid ... This result demonstrated that CrACX2 is a genuine acyl-CoA oxidase, which is responsible for the first step of the peroxisomal ... a gene encoding a member of the acyl-CoA oxidase/dehydrogenase superfamily. The purified recombinant CrACX2 expressed in ...
MalaCards integrated aliases for Peroxisomal Acyl-Coa Oxidase Deficiency:. Name: Peroxisomal Acyl-Coa Oxidase Deficiency 54 12 ... An important gene associated with Peroxisomal Acyl-Coa Oxidase Deficiency is ACOX1 (Acyl-CoA Oxidase 1), and among its related ... MalaCards organs/tissues related to Peroxisomal Acyl-Coa Oxidase Deficiency:. 39 Liver, Brain, Eye, Testes ... peroxisomal acyl-coa oxidase deficiency:. Onset and clinical course infantile onset Mortality/Aging death in infancy ...
The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast Title:. The role of Acyl-CoA oxidase in peroxisome ... Acyl-CoA oxidase (Aox) is an enzyme that carries out the first step of Ý-oxidation of free fatty acids in peroxisomes. Here I ... Gregg, Christopher (2009) The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast. PhD thesis, Concordia ... The role of Acyl-CoA oxidase in peroxisome division and longevity in yeast ...
Peroxisomal Acyl-CoA Oxidase Deficiency. Straight-Chain Acyl-CoA Oxidase Deficiency; Pseudoneonatal Adrenoleukodystrophy. ... The ACOX1 gene creates an enzyme called peroxisomal straight-chain Acyl-CoA oxidase, which plays a role in the break down of ...
The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is ... acyl-CoA oxidase 2. Enable Javascript to view the expand/collapse boxes.. Open All Close All ... Oxidizes the CoA esters of the bile acid intermediates di- and tri-hydroxycholestanoic acids (PubMed:27884763). Capable of ...
The binding sites of Platinum atom in the structure of Arabidopsis Thaliana Acyl-Coa Oxidase 1 (pdb code 1w07). This binding ... Platinum in the structure of Arabidopsis Thaliana Acyl-Coa Oxidase 1 (pdb 1w07). ... Arabidopsis Thaliana Acyl-Coa Oxidase 1 ...
Acyl-CoA dehydrogenases and acyl-CoA oxidases. Structural basis for mechanistic similarities and differences journal, February ... Acyl-CoA Dehydrogenase Drives Heat Adaptation by Sequestering Fatty Acids journal, May 2015 * Ma, Dengke K.; Li, Zhijie; Lu, ... Acyl-CoA dehydrogenases. A mechanistic overview journal, February 2004 * Ghisla, Sandro; Thorpe, Colin ... Genes encoding acyl-CoA dehydrogenase (AcdH) homologues from Streptomyces coelicolor and Streptomyces avermitilis provide ...
ARFGEF2 Peroxisomal acyl-CoA oxidase deficiency; 264470; ACOX1 Perry syndrome; 168605; DCTN1 Persistent Mullerian duct syndrome ... SCARB2 Acyl-CoA dehydrogenase, long chain, deficiency of; 201460; ACADL Acyl-CoA dehydrogenase, medium chain, deficiency of; ... ACADM Acyl-CoA dehydrogenase, short chain, deficiency of; 201470; ACADS Adenocarcinoma of lung, response to tyrosine kinase ... HADHSC 3-hydroxyisobutryl-CoA hydrolase deficiency; 250620; HIBCH 3-M syndrome; 273750; CUL7 3-Methylcrotonyl-CoA carboxylase 1 ...
... acyl-CoA oxidase; CYP4A, cytochrome P450 4A. ... acyl-CoA carboxylase; MCD, malonyl-CoA decarboxylase; CPT-1, ...
Acyl-CoA Oxidase / genetics * Acyl-CoA Oxidase / metabolism * Amidohydrolases * Animals * Anticholesteremic Agents / ...
... acyl-CoA-oxidase, encoded by Acox1; peroxisome proliferator-activated receptor γ coactivator, encoded by Pgc1a; and peroxisome ... proliferator-activated receptor alpha, encoded by Ppara) without affecting lipogenesis markers (e.g., acetyl-CoA carboxylase, ...
PPAR stimulation facilitates oxidation of lipids by upregulating acyl-CoA oxidase and medium-chain acyl-CoA dehydrogenase (MCAD ... PPAR stimulation facilitates oxidation of lipids by upregulating acyl-CoA-oxidase and MCAD. Thus, PPARs are possible ... The nicotinamide adenine dinucleotide phosphate oxidase (NOX) homologues NOX1 and NOX2/gp91(phox) mediate hepatic fibrosis in ... Hepatocyte nicotinamide adenine dinucleotide phosphate reduced oxidase 4 regulates stress signaling, fibrosis, and insulin ...
Acyl-CoA Oxidase Deficiency D-Bifunctional Enzyme Deficiency Multifunctional Enzyme Deficiency Alpha-methylacyl-CoA Racmase ... Alpha-methylacyl-CoA racemase deficiency Aspartylglucosaminuria Fucosidosis Leukoencephalopathy with vanishing white matter ... Megalencephalic leukoencephalopathy with subcortical cysts Multiple sulfatase deficiency Osteopetrosis Peroxisomal acyl-CoA ...
Isoform 2 is active against a much broader range of substrates and shows activity towards very long-chain acyl-CoAs (By ... Isoform 1 shows highest activity against medium-chain fatty acyl-CoAs and activity decreases with increasing chain length. ... Catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. ... IPR012258 Acyl-CoA_oxidase. IPR002655 Acyl-CoA_oxidase_C. ... IPR029320 Acyl-CoA_ox_N. IPR006091 Acyl-CoA_Oxase/DH_cen-dom. IPR012258 Acyl-CoA_oxidase. IPR002655 Acyl-CoA_oxidase_C. ...
Aco acyl coA oxidase, cptI carnitine palmitoyl transferase I, elovl5 fatty acyl elongase 5, fabp2 fatty acid binding protein 2 ... Nutritional regulation of carnitine palmitoyl transferase I (cptI) and acyl coA oxidase (aco) gene transcription in liver of ... Nutritional regulation of fatty acid synthase (fas), delta-6 fatty acyl desaturase (fads2d6) and fatty acyl elongase 5 (elovl5 ... Morais S, Mourente G, Ortega A, Tocher JA, Tocher DR (2011) Expression of fatty acyl desaturase and elongase genes, and ...
Acyl-CoA oxidase. 3.63 ± 0.40*. 10.7 ± 1.5†. 8.24 ± 0.83†. 11.7 ± 1.1†‡. 10.5 ± 1.0†. 11.8 ± 1.4†‡. ... Enoyl-CoA hydratase. 3,175 ± 71*. 5,723 ± 371†. 5,368 ± 595†. 6,106 ± 280†. 5,860 ± 427†. 6,466 ± 477†. ... 3-Ketoacyl-CoA thiolase. 668 ± 36*. 1,259 ± 48†. 1,194 ± 68†. 1,425 ± 96†. 1,333 ± 163†. 1,384 ± 79†. ... Acyl-CoA oxidase. 100 ± 8*. 208 ± 29†‡. 168 ± 9†. 163 ± 6†. 139 ± 6§. 133 ± 8. ...
These genes, containing PPAR-response elements, are fatty acyl-CoA oxidase (ACO) and UCP2, which catalyze the limiting steps of ... ACO, acyl-CoA oxidase; DAG, diacylglycerol; detox, detoxification; G3P, glycerol 3-phosphate; PL, phospholipid; UCP2, ... THE MALONYL-CoA/CPT-1 INTERACTION IN THE CONTROL OF INSULIN SECRETION. The role of acyl-CoA compounds as coupling factors ... ACC, acetyl-CoA carboxylase; CPT-1, carnitine palmitoyltransferase-1; FACoA, FFA-derived long chain acyl-CoA esters; FAS, fatty ...
Acyl-CoA dehydrogenase/oxidase C-terminal (IPR009075) Pfam signature: PF00441 Peptidase C19, ubiquitin carboxyl-terminal ... Cytochrome c oxidase subunit I (IPR000883) Pfam signature: PF00115 Cytochrome c oxidase subunit II-like C-terminal (IPR002429) ... NADH:flavin oxidoreductase/NADH oxidase, N-terminal (IPR001155) Pfam signature: PF00724 3-hydroxyacyl-CoA dehydrogenase, C- ... Cytochrome c oxidase subunit III-like (IPR000298) Pfam signature: PF00510 Papillomavirus E2, C-terminal (IPR000427) Pfam ...
2005 Mutations in Arabidopsis acyl-CoA oxidase genes reveal distinct and overlapping roles in β-oxidation. Plant J. 41: 859-874 ... 2000b The Arabidopsis acyl-CoA oxidase gene family. Biochem. Soc. Trans. 28: 95-99. ... H2O2 is generated by the acyl-CoA oxidases acting in fatty acid β-oxidation (Eastmond et al. 2000b; Adham et al. 2005) and the ... 2007 IBR3, a novel peroxisomal acyl-CoA dehydrogenase-like protein required for indole-3-butyric acid response. Plant Mol. Biol ...
Hepatic peroxisome proliferator-activated receptor (PPARalpha), together with its target gene CPT and acyl-CoA oxidase (ACO) ... The malonyl-CoA-dependent rate was monitored for 3 min.. The enzyme activity of malic enzyme (ME; EC1.1.1.40) was determined as ... The difference between with and without L-carnitine gave the L-carnitine-dependent rate for formation of CoA-SH. ... M of palmitoyl-CoA, and 0.1% Triton-X. The entire solution was equilibrated at 27?C. The reaction was initiated by the addition ...
  • Here, we report the characterization of an Arabidopsis cDNA clone encoding for a glyoxysomal acyl-CoA synthetase designated At LACS6. (plantphysiol.org)
  • The cDNA sequence is 2,106 bp long and it encodes a polypeptide of 701 amino acids with a calculated molecular mass of 76,617 D. Analysis of the amino-terminal sequence indicates that acyl-CoA synthetase is synthesized as a larger precursor containing a cleavable amino-terminal presequence so that the mature polypeptide size is 663 amino acids. (plantphysiol.org)
  • We also cloned human cDNA for cytosolic acetoacetyl-CoA thiolase with anti-human cytosolic thiolase antibody and publishied it in BBRC. (nii.ac.jp)
  • To determine the extent to which peroxisomes associate with lipid bodies in S. cerevisiae , Pot1p (peroxisomal 3-ketoacyl-CoA thiolase) was tagged with GFP, and cells were stained for lipid bodies with oil red O. Cells cultured in glucose had relatively small lipid bodies and few peroxisomes ( Fig. 1 A ), although peroxisomes associating with lipid bodies could easily be seen ( Fig. 1 A , arrows). (rupress.org)
  • Finally, we propose a testable model of β-cell "glucolipotoxicity" that implicates malonyl-CoA, peroxisome proliferator-activated receptor (PPAR)-α and -γ, sterol regulatory element binding protein (SREBP)-1c, and altered lipid partitioning. (diabetesjournals.org)
  • The combination of FO and ASX significantly decreased hepatic sterol regulatory element-binding transcription factor 1 and 3-hydroxy-3-methylglutaryl-CoA reductase but increased peroxisome proliferator activated receptor expression. (greenmedinfo.com)
  • This process shortens the VLCFA molecules by two carbon atoms at a time until the VLCFAs are converted to a molecule called acetyl-CoA, which is transported out of the peroxisomes for reuse by the cell. (medlineplus.gov)
  • Catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. (uniprot.org)
  • Able to isomerize both 3-cis and 3-trans double bonds into the 2-trans form in a range of enoyl-CoA species. (genecards.org)