Aconitate Hydratase: An enzyme that catalyzes the reversible hydration of cis-aconitate to yield citrate or isocitrate. It is one of the citric acid cycle enzymes. EC 4.2.1.3.Aconitic AcidIsocitratesHydro-Lyases: Enzymes that catalyze the breakage of a carbon-oxygen bond leading to unsaturated products via the removal of water. EC 4.2.1.Fluorine: A nonmetallic, diatomic gas that is a trace element and member of the halogen family. It is used in dentistry as flouride (FLUORIDES) to prevent dental caries.CitratesEnoyl-CoA Hydratase: An enzyme that catalyzes reversibly the hydration of unsaturated fatty acyl-CoA to yield beta-hydroxyacyl-CoA. It plays a role in the oxidation of fatty acids and in mitochondrial fatty acid synthesis, has broad specificity, and is most active with crotonyl-CoA. EC 4.2.1.17.Isocitrate Dehydrogenase: An enzyme of the oxidoreductase class that catalyzes the conversion of isocitrate and NAD+ to yield 2-ketoglutarate, carbon dioxide, and NADH. It occurs in cell mitochondria. The enzyme requires Mg2+, Mn2+; it is activated by ADP, citrate, and Ca2+, and inhibited by NADH, NADPH, and ATP. The reaction is the key rate-limiting step of the citric acid (tricarboxylic) cycle. (From Dorland, 27th ed) (The NADP+ enzyme is EC 1.1.1.42.) EC 1.1.1.41.MalatesFumarate Hydratase: An enzyme that catalyzes the reversible hydration of fumaric acid to yield L-malic acid. It is one of the citric acid cycle enzymes. EC 4.2.1.2.3-Hydroxyacyl CoA Dehydrogenases: Enzymes that reversibly catalyze the oxidation of a 3-hydroxyacyl CoA to 3-ketoacyl CoA in the presence of NAD. They are key enzymes in the oxidation of fatty acids and in mitochondrial fatty acid synthesis.Leiomyomatosis: The state of having multiple leiomyomas throughout the body. (Stedman, 25th ed)Peroxisomal Bifunctional Enzyme: A monomeric protein found in liver peroxisomes that contains two enzymatically active domains; an enoyl-CoA hydratase/3,2-trans-enoyl-CoA isomerase domain, and an (S)-3-hydroxyacyl-CoA dehydrogenase domain. The enzyme is stereospecific with regards to how cis and trans double bonds are metabolized. It is complemented by PEROXISOMAL MULTIFUNCTIONAL PROTEIN-2, which has the opposite stereospecificity.Rhodococcus: A bacterial genus of the order ACTINOMYCETALES.Dodecenoyl-CoA Isomerase: A carbon-carbon double bond isomerase that catalyzes the movement double bond from C3 to C2 of an unsaturated acyl-CoA. The enzyme plays a key role in allowing acyl-CoA substrates to re-enter the beta-oxidation pathway.Carbon-Carbon Double Bond Isomerases: Enzymes that catalyze the shifting of a carbon-carbon double bond from one position to another within the same molecule. EC 5.3.3.Peroxisomal Multifunctional Protein-2: A dimeric protein found in liver peroxisomes that plays an important role in FATTY ACID metabolism and steroid metabolism. The dimer is formed by cleavage of a single protein precursor and contains an enoyl-CoA hydratase-2 domain and a second domain that displays (S)-3-hydroxyacyl-CoA dehydrogenase and 17-beta-estradiol dehydrogenase activities. The enzyme is stereospecific with regards to arrangement of the substrate double bonds and position of the 3-hydroxy group of the reaction intermediate. It is complemented by PEROXISOMAL BIFUNCTIONAL ENZYME, which has the opposite reaction stereospecificity.Enoyl-CoA Hydratase 2: A PEROXISOME-specific enzyme that catalyzes the hydration step of the beta-oxidation pathway.Isomerases: A class of enzymes that catalyze geometric or structural changes within a molecule to form a single product. The reactions do not involve a net change in the concentrations of compounds other than the substrate and the product.(from Dorland, 28th ed) EC 5.Racemases and Epimerases: Enzymes that catalyze inversion of the configuration around an asymmetric carbon in a substrate having one (racemase) or more (epimerase) center(s) of asymmetry. (Dorland, 28th ed) EC 5.1.Microbodies: Electron-dense cytoplasmic particles bounded by a single membrane, such as PEROXISOMES; GLYOXYSOMES; and glycosomes.Acyl Coenzyme A: S-Acyl coenzyme A. Fatty acid coenzyme A derivatives that are involved in the biosynthesis and oxidation of fatty acids as well as in ceramide formation.Tungsten: Tungsten. A metallic element with the atomic symbol W, atomic number 74, and atomic weight 183.85. It is used in many manufacturing applications, including increasing the hardness, toughness, and tensile strength of steel; manufacture of filaments for incandescent light bulbs; and in contact points for automotive and electrical apparatus.Mitochondrial Trifunctional Protein: A mitochondrial protein consisting of four alpha-subunits and four beta-subunits. It contains enoyl-CoA hydratase, long-chain-3-hydroxyacyl-CoA dehydrogenase, and acetyl-CoA C-acyltransferase activities and plays an important role in the metabolism of long chain FATTY ACIDS.Crotonates: Derivatives of BUTYRIC ACID that include a double bond between carbon 2 and 3 of the aliphatic structure. Included under this heading are a broad variety of acid forms, salts, esters, and amides that include the aminobutryrate structure.Multienzyme Complexes: Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.Acrylonitrile: A highly poisonous compound used widely in the manufacture of plastics, adhesives and synthetic rubber.Thauera: A genus of gram-negative, rod-shaped bacteria able to anaerobically oxidize and degrade toluene.Epoxide Hydrolases: Enzymes that catalyze reversibly the formation of an epoxide or arene oxide from a glycol or aromatic diol, respectively.Polyhydroxyalkanoates: Fatty acid biopolymers that are biosynthesized by microbial polyhydroxyalkanoate synthase enzymes. They are being investigated for use as biodegradable polyesters.Neoplastic Syndromes, Hereditary: The condition of a pattern of malignancies within a family, but not every individual's necessarily having the same neoplasm. Characteristically the tumor tends to occur at an earlier than average age, individuals may have more than one primary tumor, the tumors may be multicentric, usually more than 25 percent of the individuals in direct lineal descent from the proband are affected, and the cancer predisposition in these families behaves as an autosomal dominant trait with about 60 percent penetrance.17-Hydroxysteroid Dehydrogenases: A class of enzymes that catalyzes the oxidation of 17-hydroxysteroids to 17-ketosteroids. EC 1.1.-.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Brevibacterium: A gram-positive organism found in dairy products, fresh and salt water, marine organisms, insects, and decaying organic matter.Carbonic Anhydrase I: A cytosolic carbonic anhydrase isoenzyme primarily expressed in ERYTHROCYTES, vascular endothelial cells, and the gastrointestinal mucosa. EC 4.2.1.-Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Deltaproteobacteria: A group of PROTEOBACTERIA represented by morphologically diverse, anaerobic sulfidogens. Some members of this group are considered bacterial predators, having bacteriolytic properties.Peroxisomes: Microbodies which occur in animal and plant cells and in certain fungi and protozoa. They contain peroxidase, catalase, and allied enzymes. (From Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd ed)Fibric Acids: Compounds that either share the structure of fibric acid in their molecular arrangement or are considered variants of the fibric acid structure.Vanillic Acid: A flavoring agent. It is the intermediate product in the two-step bioconversion of ferulic acid to vanillin. (J Biotechnol 1996;50(2-3):107-13).Fumarates: Compounds based on fumaric acid.Cobalt: A trace element that is a component of vitamin B12. It has the atomic symbol Co, atomic number 27, and atomic weight 58.93. It is used in nuclear weapons, alloys, and pigments. Deficiency in animals leads to anemia; its excess in humans can lead to erythrocytosis.
(1/505) Inactivation of both RNA binding and aconitase activities of iron regulatory protein-1 by quinone-induced oxidative stress.

Iron regulatory protein-1 (IRP-1) controls the expression of several mRNAs by binding to iron-responsive elements (IREs) in their untranslated regions. In iron-replete cells, a 4Fe-4S cluster converts IRP-1 to cytoplasmic aconitase. IRE binding activity is restored by cluster loss in response to iron starvation, NO, or extracellular H2O2. Here, we study the effects of intracellular quinone-induced oxidative stress on IRP-1. Treatment of murine B6 fibroblasts with menadione sodium bisulfite (MSB), a redox cycling drug, causes a modest activation of IRP-1 to bind to IREs within 15-30 min. However, IRE binding drops to basal levels within 60 min. Surprisingly, a remarkable loss of both IRE binding and aconitase activities of IRP-1 follows treatment with MSB for 1-2 h. These effects do not result from alterations in IRP-1 half-life, can be antagonized by the antioxidant N-acetylcysteine, and regulate IRE-containing mRNAs; the capacity of iron-starved MSB-treated cells to increase transferrin receptor mRNA levels is inhibited, and MSB increases the translation of a human growth hormone indicator mRNA bearing an IRE in its 5'-untranslated region. Nonetheless, MSB inhibits ferritin synthesis. Thus, menadione-induced oxidative stress leads to post-translational inactivation of both genetic and enzymatic functions of IRP-1 by a mechanism that lies beyond the "classical" Fe-S cluster switch and exerts multiple effects on cellular iron metabolism.  (+info)

(2/505) The aconitase of yeast. IV. Studies on iron and sulfur in yeast aconitase.

Chemical analyses were carried out to determine the active components of the crystalline aconitase [EC 4.2.1.3] of Candida lipolytica. The enzyme contained 2 atoms of non-heme iron, 1 atom of labile sulfur, and 6 sulfhydryl groups per molecule. One atom of the non-heme iron was released by the addition of metal-chelating agents such as sodium citrate, sodium nitrilotriacetate (NTA) or sodium ethylenediaminetetraacetate (EDTA) without loss of the enzyme activity. The non-heme iron and labile sulfur were released by the addition of sulfhydryl reagents such as rho-chloromercuribenzoate (PCMB), sodium mersalyl or urea with loss of the enzyme activity. o-Phenanthroline reacted with the iron atoms in the enzyme at pH 6.0 with loss of the activity. These results show that yeast aconitase is an iron-sulfur protein and that only one of the two non-heme iron atoms is essential for enzyme activity.  (+info)

(3/505) The aconitase of yeast. V. The reconstitution of yeast aconitase.

The apoenzyme of yeast aconitase [EC 4.2.1.3] was prepared by treatment of yeast aconitase with sodium mersalyl, followed by passage by passage of the reaction mixture through a column of Dowex A-1 and gel filtration on Sephadex G-25. The apoenzyme had no aconitase activity, but the active enzyme could be reconstituted by treatment of the apoenzyme with ferrous ions and sodium sulfide in the presence of 2-mercapto-ethanol. The reconstituted active enzyme was isolated by DEAE-Sephadex A-50 column chromatography and Sephadex G-100 gel filtration from the reaction mixture. The reconstituted enzyme was identical with the original untreated enzyme in terms of specific activity, iron content and spectral characteristics, but not in terms of labile sulfur content. A significant difference in visible spectra between the holo- and apoenzymes appeared to be due to the difference in iron and labile sulfur contents between the two proteins.  (+info)

(4/505) Population structure and genetic divergence in Anopheles nuneztovari (Diptera: Culicidae) from Brazil and Colombia.

Anopheles nuneztovari is considered an important vector of human malaria in several localities in Venezuela and Colombia. Its status as a vector of human malaria is still unresolved in areas of the Brazilian Amazon, in spite of have been found infected with Plasmodium sp.. For a better understanding of the genetic differentiation of populations of A. nuneztovari, electrophoretic analysis using 11 enzymes was performed on four populations from Brazil and two from Colombia. The results showed a strong differentiation for two loci: alpha-glycerophosphate dehydrogenase (alpha-Gpd) and malate dehydrogenase (Mdh) from 16 loci analyzed. Diagnostic loci were not detected. The populations of A. nuneztovari from the Brazilian Amazon showed little genetic structure and low geographic differentiation, based on the F(IS) (0.029), F(ST) (0.070), and genetic distance (0.001-0.032) values. The results of the isozyme analysis do not coincide with the indication of two lineages in the Amazon Basin by analysis of mitochondrial DNA, suggesting that this evolutionary event is recent. The mean F(ST) value (0.324) suggests that there is considerable genetic divergence among populations from the Brazilian Amazon and Colombia. The genetic distance among populations from the Brazilian Amazon and Colombia is ranges from 0.047 to 0.148, with the highest values between the Brazilian Amazon and Sitronela (SIT) (0.125-0.148). These results are consistent with those observed among members of anopheline species complexes. It is suggested that geographic isolation has reduced the gene flow, resulting in the genetic divergence of the SIT population. Dendrogram analysis showed three large groups: one Amazonian and two Colombia, indicating some genetic structuring. The present study is important because it attempted to clarify the taxonomic status of A. nuneztovari and provide a better understanding of the role of this mosquito in transmission of human malaria in northern South America.  (+info)

(5/505) Human cytoplasmic aconitase (Iron regulatory protein 1) is converted into its [3Fe-4S] form by hydrogen peroxide in vitro but is not activated for iron-responsive element binding.

Iron regulatory protein 1 (IRP1) regulates the synthesis of proteins involved in iron homeostasis by binding to iron-responsive elements (IREs) of messenger RNA. IRP1 is a cytoplasmic aconitase when it contains a [4Fe-4S] cluster and an RNA-binding protein after complete removal of the metal center by an unknown mechanism. Human IRP1, obtained as the pure recombinant [4Fe-4S] form, is an enzyme as efficient toward cis-aconitate as the homologous mitochondrial aconitase. The aconitase activity of IRP1 is rapidly lost by reaction with hydrogen peroxide as the [4Fe-4S] cluster is quantitatively converted into the [3Fe-4S] form with release of a single ferrous ion per molecule. The IRE binding capacity of IRP1 is not elicited with H(2)O(2). Ferrous sulfate (but not other more tightly coordinated ferrous ions, such as the complex with ethylenediamine tetraacetic acid) counteracts the inhibitory action of hydrogen peroxide on cytoplasmic aconitase, probably by replenishing iron at the active site. These results cast doubt on the ability of reactive oxygen species to directly increase IRP1 binding to IRE and support a signaling role for hydrogen peroxide in the posttranscriptional control of proteins involved in iron homeostasis in vivo.  (+info)

(6/505) Low iron concentration and aconitase deficiency in a yeast frataxin homologue deficient strain.

Deletion of the yeast frataxin homologue, YFH1, elicits accumulation of iron in mitochondria and mitochondrial defects. We report here that in the presence of an iron chelator in the culture medium, the concentration of iron in mitochondria is the same in wild-type and YFH1 deletant strains. Under these conditions, the activity of the respiratory complexes is restored. However, the activity of the mitochondrial aconitase, a 4Fe-4S cluster-containing protein, remains low. The frataxin family bears homology to a bacterial protein family which confers resistance to tellurium, a metal closely related to sulfur. Yfh1p might control the synthesis of iron-sulfur clusters in mitochondria.  (+info)

(7/505) Bacillus subtilis aconitase is an RNA-binding protein.

The aconitase protein of Bacillus subtilis was able to bind specifically to sequences resembling the iron response elements (IREs) found in eukaryotic mRNAs. The sequences bound include the rabbit ferritin IRE and IRE-like sequences in the B. subtilis operons that encode the major cytochrome oxidase and an iron uptake system. IRE binding activity was affected by the availability of iron both in vivo and in vitro. In eukaryotic cells, aconitase-like proteins regulate translation and stability of iron metabolism mRNAs in response to iron availability. A mutant strain of B. subtilis that produces an enzymatically inactive aconitase that was still able to bind RNA sporulated 40x more efficiently than did an aconitase null mutant, suggesting that a nonenzymatic activity of aconitase is important for sporulation. The results support the idea that bacterial aconitases, like their eukaryotic homologs, are bifunctional proteins, showing aconitase activity in the presence of iron and RNA binding activity when cells are iron-deprived.  (+info)

(8/505) Iron-dependent regulation of transferrin receptor expression in Trypanosoma brucei.

Transferrin is an essential growth factor for African trypanosomes. Here we show that expression of the trypanosomal transferrin receptor, which bears no structural similarity with mammalian transferrin receptors, is regulated by iron availability. Iron depletion of bloodstream forms of Trypanosoma brucei with the iron chelator deferoxamine resulted in a 3-fold up-regulation of the transferrin receptor and a 3-fold increase of the transferrin uptake rate. The abundance of expression site associated gene product 6 (ESAG6) mRNA, which encodes one of the two subunits of the trypanosome transferrin receptor, is regulated 5-fold by a post-transcriptional mechanism. In mammalian cells the stability of transferrin receptor mRNA is controlled by iron regulatory proteins (IRPs) binding to iron-responsive elements (IREs) in the 3'-untranslated region (UTR). Therefore, the role of a T. brucei cytoplasmic aconitase (TbACO) that is highly related to mammalian IRP-1 was investigated. Iron regulation of the transferrin receptor was found to be unaffected in Deltaaco::NEO/Deltaaco::HYG null mutants generated by targeted disruption of the TbACO gene. Thus, the mechanism of post-transcriptional transferrin receptor regulation in trypanosomes appears to be distinct from the IRE/IRP paradigm. The transferrin uptake rate was also increased when trypanosomes were transferred from medium supplemented with foetal bovine serum to medium supplemented with sera from other vertebrates. Due to varying binding affinities of the trypanosomal transferrin receptor for transferrins of different species, serum change can result in iron starvation. Thus, regulation of transferrin receptor expression may be a fast compensatory mechanism upon transmission of the parasite to a new host species.  (+info)

*  Aconitase
... (aconitate hydratase; EC 4.2.1.3) is an enzyme that catalyses the stereo-specific isomerization of citrate to ... One theory is that, in the rate-limiting step of the mechanism, the cis-aconitate is released from the enzyme, then reattached ... Another hypothesis is that cis-aconitate stays bound to the enzyme while it flips from the citrate to the isocitrate mode. In ... PDB: 1ACO​; Lauble, H; Kennedy, MC; Beinert, H; Stout, CD (1994). "Crystal Structures of Aconitase with Trans-aconitate and ...
*  List of MeSH codes (D08)
... aconitate hydratase MeSH D08.811.520.241.300.050.500 --- iron regulatory protein 1 MeSH D08.811.520.241.300.050.750 --- iron ... enoyl-coa hydratase MeSH D08.811.520.241.300.300 --- fumarate hydratase MeSH D08.811.520.241.300.500 --- phosphopyruvate ... urocanate hydratase MeSH D08.811.520.241.300.950 --- uroporphyrinogen iii synthetase MeSH D08.811.520.241.700 --- ... hydratase MeSH D08.811.520.241.300.500.500 --- tau-crystallins MeSH D08.811.520.241.300.550 --- porphobilinogen synthase MeSH ...
*  List of EC numbers (EC 4)
... fumarate hydratase EC 4.2.1.3: aconitate hydratase EC 4.2.1.4: citrate dehydratase EC 4.2.1.5: arabinonate dehydratase EC 4.2. ... 2-hydratase EC 4.2.1.132: 2-hydroxyhexa-2,4-dienoate hydratase EC 4.2.1.133: copal-8-ol diphosphate hydratase EC 4.2.1.134: ... itaconyl-CoA hydratase EC 4.2.1.57: isohexenylglutaconyl-CoA hydratase EC 4.2.1.58: crotonoyl-(acyl-carrier-protein) hydratase ... 4-oxalmesaconate hydratase EC 4.2.1.84: nitrile hydratase EC 4.2.1.85: dimethylmaleate hydratase EC 4.2.1.86: deleted identical ...
*  Crossover experiment (chemistry)
... citrate with aconitase in the presence of 2-methyl-cis-aconitate. This reaction produced both unlabeled cis-aconitate and 2- ... Isotope scrambling experiments using tritium, deuterium, and 18O were carried out on the aconitase hydratase reaction by I.A. ...
Fumarate Hydratase
      - Fumarase
     Summary Report | CureHunter  Fumarate Hydratase - Fumarase Summary Report | CureHunter
Fumarate Hydratase: An enzyme that catalyzes the reversible hydration of fumaric acid to yield L-malic acid. It is one of the ... Aconitate Hydratase (Aconitase) 8. Reed's syndrome 9. L-Lactate Dehydrogenase (Lactate Dehydrogenase) ... Fumarate Hydratase (Fumarase). Subscribe to New Research on Fumarate Hydratase An enzyme that catalyzes the reversible ... 07/01/2015 - "Because of a family history of renal cell cancer, she was tested for fumarate hydratase mutations and found to be ...
more infohttp://www.curehunter.com/public/keywordSummaryD005649-Fumarate-Hydratase-Fumarase.do
DI49 2832 - Aconitate hydratase, mitochondrial - Saccharomyces eubayanus (Yeast) - DI49 2832 gene & protein  DI49 2832 - Aconitate hydratase, mitochondrial - Saccharomyces eubayanus (Yeast) - DI49 2832 gene & protein
Aconitate hydratase, mitochondrialUniRule annotation. ,p>Information which has been generated by the UniProtKB automatic ... tr,A0A0L8RGC2,A0A0L8RGC2_SACEU Aconitate hydratase, mitochondrial OS=Saccharomyces eubayanus GN=DI49_2832 PE=3 SV=1 ...
more infohttp://www.uniprot.org/uniprot/A0A0L8RGC2
Synpcc7942 0903 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [Synechococcus elongatus PCC 7942] - Gene -...  Synpcc7942 0903 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [Synechococcus elongatus PCC 7942] - Gene -...
bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase. Locus tag. Synpcc7942_0903. Gene type. protein coding. ... bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase. YP_399920.1. *EC 4.2.1.3 ... Synpcc7942_0903 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [ Synechococcus elongatus PCC 7942 ] Gene ID ... YP_399920.1 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [Synechococcus elongatus PCC 7942] ...
more infohttps://www.ncbi.nlm.nih.gov/gene/3774081
AID 558447 - Upregulation of Putative mitochondrial aconitate hydratase expression in Candida albicans SC5314 at 40 uM after 24...  AID 558447 - Upregulation of Putative mitochondrial aconitate hydratase expression in Candida albicans SC5314 at 40 uM after 24...
Upregulation of Putative mitochondrial aconitate hydratase expression in Candida albicans SC5314 at 40 uM after 24 hrs by MALDI ...
more infohttps://pubchem.ncbi.nlm.nih.gov/bioassay/558447
T3DB: Aconitate hydratase, mitochondrial  T3DB: Aconitate hydratase, mitochondrial
lcl,BSEQ0013152,Aconitate hydratase, mitochondrial (ACO2) ATGGCGCCCTACAGCCTACTGGTGACTCGGCTGCAGAAAGCTCTGGGTGTGCGGCAGTAC ...
more infohttp://www.t3db.ca/biodb/polypeptides/Q99798
Effect of melaxen and valdoxan on free radical processes intensity, aconitate hydratase activity and citrate content in rats...  Effect of melaxen and valdoxan on free radical processes intensity, aconitate hydratase activity and citrate content in rats...
Aconitate hydratase activity and citrate concentration in rats liver and heart, growing at pathological conditions, changed ... Effect of melaxen and valdoxan on free radical processes intensity, aconitate hydratase activity and citrate content in rats ... Abstract: The influence of melaxen and valdoxan on the biochemiluminescence parameters, aconitate hydratase activity and ... aconitate hydratase activity and citrate content in rats tissues under hyperthyroidism, Biomeditsinskaya khimiya, 2014, vol: 60 ...
more infohttp://pbmc.ibmc.msk.ru/index.php/en/article/PBMC-2014-60-4-462-en
Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism | PNAS  Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism | PNAS
... aconitate hydratase; acs, acetyl-CoA synthase; 13BPG, 1,3-bisphosphoglycerate; Cra, catabolite repressor activator; CreBC, a ...
more infohttp://www.pnas.org/content/115/14/3538
Plants  | Free Full-Text | Differential Expression Proteins Contribute to Race-Specific Resistant Ability in Rice (Oryza sativa...  Plants | Free Full-Text | Differential Expression Proteins Contribute to Race-Specific Resistant Ability in Rice (Oryza sativa...
Putative aconitate hydratase. 98.6. 5.67. 18. 22. 15. gi,115439655. NADP-dependent malic enzyme. 65.6. 8.59. 9. 23. ...
more infohttps://www.mdpi.com/2223-7747/8/2/29/htm
Frontiers | Novel, Deep-Branching Heterotrophic Bacterial Populations Recovered from Thermal Spring Metagenomes | Microbiology  Frontiers | Novel, Deep-Branching Heterotrophic Bacterial Populations Recovered from Thermal Spring Metagenomes | Microbiology
... aconitate hydratase; icd, isocitrate dehydrogenase; kor, 2-oxoglutarate:ferredoxin oxidoreductase; suc, succinyl-CoA synthetase ...
more infohttps://www.frontiersin.org/articles/10.3389/fmicb.2016.00304/full
TIGR01342  TIGR01342
GO:0003994: aconitate hydratase activity molecular_function. GO:0006099: tricarboxylic acid cycle biological_process. ...
more infohttp://www.jcvi.org/cgi-bin/tigrfams/HmmReportPage.cgi?acc=TIGR01342
CS - Citrate synthase, mitochondrial precursor - Homo sapiens (Human) - CS gene & protein  CS - Citrate synthase, mitochondrial precursor - Homo sapiens (Human) - CS gene & protein
Aconitate hydratase, mitochondrial (ACO2). This subpathway is part of the pathway tricarboxylic acid cycle, which is itself ...
more infohttps://www.uniprot.org/uniprot/O75390
ACO2 Gene - GeneCards | ACON Protein | ACON Antibody  ACO2 Gene - GeneCards | ACON Protein | ACON Antibody
Gene Ontology (GO) annotations related to this gene include iron ion binding and aconitate hydratase activity. ... cDNA FLJ60429, highly similar to Aconitate hydratase, mitochondrial (EC 4.2.1.3) (B4DEC3_HUMAN) ... cDNA FLJ50886, highly similar to Aconitate hydratase, mitochondrial(EC 4.2.1.3) (B4DW08_HUMAN) ... It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA ...
more infohttps://www.genecards.org/cgi-bin/carddisp.pl?gene=ACO2
KEGG PATHWAY: glo00630  KEGG PATHWAY: glo00630
aconitate hydratase 2 [KO:K01682] [EC:4.2.1.99 4.2.1.3]. Glov_3258 ... Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria. ...
more infohttp://www.genome.jp/dbget-bin/www_bget?pathway+glo00630
Anti-Aconitase 2 antibody (ab83528) | Abcam  Anti-Aconitase 2 antibody (ab83528) | Abcam
Aconitate hydratase antibody. *Aconitate hydratase mitochondrial antibody. *ACONM antibody. *Citrate hydro lyase antibody ...
more infohttp://www.abcam.com/aconitase-2-antibody-ab83528.html
KEGG PATHWAY: adk00630  KEGG PATHWAY: adk00630
aconitate hydratase 2 [KO:K01682] [EC:4.2.1.99 4.2.1.3]. Alide2_2374 ... Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria. ...
more infohttp://www.genome.jp/dbget-bin/www_bget?pathway+adk00630
Isocitric Acid - DrugBank  Isocitric Acid - DrugBank
UAconitate hydratase, mitochondrial. Not Available. Human. UIsocitrate dehydrogenase [NADP], mitochondrial. Not Available. ... Catalyzes the isomerization of citrate to isocitrate via cis-aconitate.. Gene Name. ACO2. Uniprot ID. Q99798. Uniprot Name. ...
more infohttps://www.drugbank.ca/drugs/DB01727
Integrating transcriptomics and metabolomics to characterise the response of Astragalus membranaceus Bge. var. mongolicus (Bge....  Integrating transcriptomics and metabolomics to characterise the response of Astragalus membranaceus Bge. var. mongolicus (Bge....
In the TCA cycle pathway, genes encoding aconitate hydratase were up-regulated during the three phases of drought stress. Genes ... whereas the genes encoding fumarate hydratase were down-regulated. These changes in gene expression may have increased the ...
more infohttps://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-016-2554-0
ACO2 (human)  ACO2 (human)
Aconitate hydratase, mitochondrial Show on y-axis - References (HTP + LTP). References (LTP). References (HTP). ...
more infohttps://www.phosphosite.org/proteinAction.action?id=9180&showAllSites=true
IJMS  | Free Full-Text | Developmental Stage- and Genotype-Dependent Regulation of Specialized Metabolite Accumulation in Fruit...  IJMS | Free Full-Text | Developmental Stage- and Genotype-Dependent Regulation of Specialized Metabolite Accumulation in Fruit...
Terol, J.; Soler, G.; Talon, M.; Cercos, M. The aconitate hydratase family from Citrus. BMC Plant Biol. 2010, 10, 222. [Google ...
more infohttps://www.mdpi.com/1422-0067/20/5/1245/htm
Autoantibody signatures defined by serological proteome analysis in sera from patients with cholangiocarcinoma | Journal of...  Autoantibody signatures defined by serological proteome analysis in sera from patients with cholangiocarcinoma | Journal of...
Seven proteins corresponding to six spots were stained by five (38 %) of the 13 CC sera: aconitate hydratase, bifunctional ATP- ... Aconitate hydratase (NH16), bifunctional ATP-dependant dihydroxyacetone kinase (NH13), electron transfer-flavoprotein α (NH15 ...
more infohttps://translational-medicine.biomedcentral.com/articles/10.1186/s12967-015-0751-2
  • One theory is that, in the rate-limiting step of the mechanism, the cis-aconitate is released from the enzyme, then reattached in the isocitrate mode to complete the reaction. (wikipedia.org)
  • To complete the reaction, the serine and histidine residues reverse their original catalytic actions: the histidine, now basic, abstracts a proton from water, priming it as a nucleophile to attack at C2, and the protonated serine is deprotonated by the cis-aconitate double bond to complete the hydration, producing isocitrate. (wikipedia.org)