AnatomyOrganismsDiseasesChemicals and DrugsPsychiatry and PsychologyPhenomena and ProcessesInformation Science
Aconitate HydrataseAconitic AcidIsocitratesHydro-LyasesFluorineCitratesEnoyl-CoA HydrataseIsocitrate DehydrogenaseMalatesFumarate Hydratase3-Hydroxyacyl CoA DehydrogenasesLeiomyomatosisPeroxisomal Bifunctional EnzymeRhodococcusDodecenoyl-CoA IsomeraseCarbon-Carbon Double Bond IsomerasesPeroxisomal Multifunctional Protein-2Enoyl-CoA Hydratase 2IsomerasesRacemases and EpimerasesMicrobodiesAcyl Coenzyme ATungstenMitochondrial Trifunctional ProteinCrotonatesMultienzyme ComplexesAcrylonitrileThaueraEpoxide HydrolasesAptamers, NucleotideNeoplastic Syndromes, Hereditary17-Hydroxysteroid DehydrogenasesMolecular Sequence DataBrevibacteriumCarbonic Anhydrase IAmino Acid SequenceDeltaproteobacteriaPeroxisomesFibric AcidsVanillic AcidFumaratesCobaltXenopsyllaIronIron-Regulatory ProteinsIron Regulatory Protein 1Saccharomyces cerevisiaeGlutathioneGlutathione DisulfideOxidation-ReductionOxidative StressGlutathione ReductaseAutistic DisorderGlutathione Peroxidase
Aconitate Hydratase
An enzyme that catalyzes the reversible hydration of cis-aconitate to yield citrate or isocitrate. It is one of the citric acid cycle enzymes. EC 4.2.1.3.
Aconitic Acid
Isocitrates
Hydro-Lyases
Enzymes that catalyze the breakage of a carbon-oxygen bond leading to unsaturated products via the removal of water. EC 4.2.1.
Fluorine
A nonmetallic, diatomic gas that is a trace element and member of the halogen family. It is used in dentistry as flouride (FLUORIDES) to prevent dental caries.
Citrates
Enoyl-CoA Hydratase
An enzyme that catalyzes reversibly the hydration of unsaturated fatty acyl-CoA to yield beta-hydroxyacyl-CoA. It plays a role in the oxidation of fatty acids and in mitochondrial fatty acid synthesis, has broad specificity, and is most active with crotonyl-CoA. EC 4.2.1.17.
Isocitrate Dehydrogenase
An enzyme of the oxidoreductase class that catalyzes the conversion of isocitrate and NAD+ to yield 2-ketoglutarate, carbon dioxide, and NADH. It occurs in cell mitochondria. The enzyme requires Mg2+, Mn2+; it is activated by ADP, citrate, and Ca2+, and inhibited by NADH, NADPH, and ATP. The reaction is the key rate-limiting step of the citric acid (tricarboxylic) cycle. (From Dorland, 27th ed) (The NADP+ enzyme is EC 1.1.1.42.) EC 1.1.1.41.
Malates
Fumarate Hydratase
An enzyme that catalyzes the reversible hydration of fumaric acid to yield L-malic acid. It is one of the citric acid cycle enzymes. EC 4.2.1.2.
3-Hydroxyacyl CoA Dehydrogenases
Enzymes that reversibly catalyze the oxidation of a 3-hydroxyacyl CoA to 3-ketoacyl CoA in the presence of NAD. They are key enzymes in the oxidation of fatty acids and in mitochondrial fatty acid synthesis.
Leiomyomatosis
The state of having multiple leiomyomas throughout the body. (Stedman, 25th ed)
Peroxisomal Bifunctional Enzyme
A monomeric protein found in liver peroxisomes that contains two enzymatically active domains; an enoyl-CoA hydratase/3,2-trans-enoyl-CoA isomerase domain, and an (S)-3-hydroxyacyl-CoA dehydrogenase domain. The enzyme is stereospecific with regards to how cis and trans double bonds are metabolized. It is complemented by PEROXISOMAL MULTIFUNCTIONAL PROTEIN-2, which has the opposite stereospecificity.
Rhodococcus
A bacterial genus of the order ACTINOMYCETALES.
Dodecenoyl-CoA Isomerase
A carbon-carbon double bond isomerase that catalyzes the movement double bond from C3 to C2 of an unsaturated acyl-CoA. The enzyme plays a key role in allowing acyl-CoA substrates to re-enter the beta-oxidation pathway.
Carbon-Carbon Double Bond Isomerases
Enzymes that catalyze the shifting of a carbon-carbon double bond from one position to another within the same molecule. EC 5.3.3.
Peroxisomal Multifunctional Protein-2
A dimeric protein found in liver peroxisomes that plays an important role in FATTY ACID metabolism and steroid metabolism. The dimer is formed by cleavage of a single protein precursor and contains an enoyl-CoA hydratase-2 domain and a second domain that displays (S)-3-hydroxyacyl-CoA dehydrogenase and 17-beta-estradiol dehydrogenase activities. The enzyme is stereospecific with regards to arrangement of the substrate double bonds and position of the 3-hydroxy group of the reaction intermediate. It is complemented by PEROXISOMAL BIFUNCTIONAL ENZYME, which has the opposite reaction stereospecificity.
Enoyl-CoA Hydratase 2
A PEROXISOME-specific enzyme that catalyzes the hydration step of the beta-oxidation pathway.
Isomerases
A class of enzymes that catalyze geometric or structural changes within a molecule to form a single product. The reactions do not involve a net change in the concentrations of compounds other than the substrate and the product.(from Dorland, 28th ed) EC 5.
Racemases and Epimerases
Enzymes that catalyze inversion of the configuration around an asymmetric carbon in a substrate having one (racemase) or more (epimerase) center(s) of asymmetry. (Dorland, 28th ed) EC 5.1.
Microbodies
Electron-dense cytoplasmic particles bounded by a single membrane, such as PEROXISOMES; GLYOXYSOMES; and glycosomes.
Acyl Coenzyme A
S-Acyl coenzyme A. Fatty acid coenzyme A derivatives that are involved in the biosynthesis and oxidation of fatty acids as well as in ceramide formation.
Tungsten
Tungsten. A metallic element with the atomic symbol W, atomic number 74, and atomic weight 183.85. It is used in many manufacturing applications, including increasing the hardness, toughness, and tensile strength of steel; manufacture of filaments for incandescent light bulbs; and in contact points for automotive and electrical apparatus.
Mitochondrial Trifunctional Protein
A mitochondrial protein consisting of four alpha-subunits and four beta-subunits. It contains enoyl-CoA hydratase, long-chain-3-hydroxyacyl-CoA dehydrogenase, and acetyl-CoA C-acyltransferase activities and plays an important role in the metabolism of long chain FATTY ACIDS.
Crotonates
Derivatives of BUTYRIC ACID that include a double bond between carbon 2 and 3 of the aliphatic structure. Included under this heading are a broad variety of acid forms, salts, esters, and amides that include the aminobutryrate structure.
Multienzyme Complexes
Systems of enzymes which function sequentially by catalyzing consecutive reactions linked by common metabolic intermediates. They may involve simply a transfer of water molecules or hydrogen atoms and may be associated with large supramolecular structures such as MITOCHONDRIA or RIBOSOMES.
Acrylonitrile
A highly poisonous compound used widely in the manufacture of plastics, adhesives and synthetic rubber.
Thauera
A genus of gram-negative, rod-shaped bacteria able to anaerobically oxidize and degrade toluene.
Epoxide Hydrolases
Enzymes that catalyze reversibly the formation of an epoxide or arene oxide from a glycol or aromatic diol, respectively.
Aptamers, Nucleotide
Nucleotide sequences, generated by iterative rounds of SELEX APTAMER TECHNIQUE, that bind to a target molecule specifically and with high affinity.
Neoplastic Syndromes, Hereditary
The condition of a pattern of malignancies within a family, but not every individual's necessarily having the same neoplasm. Characteristically the tumor tends to occur at an earlier than average age, individuals may have more than one primary tumor, the tumors may be multicentric, usually more than 25 percent of the individuals in direct lineal descent from the proband are affected, and the cancer predisposition in these families behaves as an autosomal dominant trait with about 60 percent penetrance.
17-Hydroxysteroid Dehydrogenases
A class of enzymes that catalyzes the oxidation of 17-hydroxysteroids to 17-ketosteroids. EC 1.1.-.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Brevibacterium
A gram-positive organism found in dairy products, fresh and salt water, marine organisms, insects, and decaying organic matter.
Carbonic Anhydrase I
A cytosolic carbonic anhydrase isoenzyme primarily expressed in ERYTHROCYTES, vascular endothelial cells, and the gastrointestinal mucosa. EC 4.2.1.-
Amino Acid Sequence
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Deltaproteobacteria
A group of PROTEOBACTERIA represented by morphologically diverse, anaerobic sulfidogens. Some members of this group are considered bacterial predators, having bacteriolytic properties.
Peroxisomes
Microbodies which occur in animal and plant cells and in certain fungi and protozoa. They contain peroxidase, catalase, and allied enzymes. (From Singleton and Sainsbury, Dictionary of Microbiology and Molecular Biology, 2nd ed)
Fibric Acids
Compounds that either share the structure of fibric acid in their molecular arrangement or are considered variants of the fibric acid structure.
Vanillic Acid
A flavoring agent. It is the intermediate product in the two-step bioconversion of ferulic acid to vanillin. (J Biotechnol 1996;50(2-3):107-13).
Fumarates
Compounds based on fumaric acid.
Cobalt
A trace element that is a component of vitamin B12. It has the atomic symbol Co, atomic number 27, and atomic weight 58.93. It is used in nuclear weapons, alloys, and pigments. Deficiency in animals leads to anemia; its excess in humans can lead to erythrocytosis.
Xenopsylla
A genus of fleas in the family Pulicidae which includes the species that serves as the primary vector of BUBONIC PLAGUE, Xenopsylla cheopis.
Iron
A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.
Iron-Regulatory Proteins
Proteins that regulate cellular and organismal iron homeostasis. They play an important biological role by maintaining iron levels that are adequate for metabolic need, but below the toxicity threshold.
Iron Regulatory Protein 1
A multifunctional iron-sulfur protein that is both an iron regulatory protein and cytoplasmic form of aconitate hydratase. It binds to iron regulatory elements found on mRNAs involved in iron metabolism and regulates their translation. Its RNA binding ability and its aconitate hydrolase activity are dependent upon availability of IRON.
Saccharomyces cerevisiae
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Glutathione
A tripeptide with many roles in cells. It conjugates to drugs to make them more soluble for excretion, is a cofactor for some enzymes, is involved in protein disulfide bond rearrangement and reduces peroxides.
Glutathione Disulfide
A GLUTATHIONE dimer formed by a disulfide bond between the cysteine sulfhydryl side chains during the course of being oxidized.
Oxidation-Reduction
A chemical reaction in which an electron is transferred from one molecule to another. The electron-donating molecule is the reducing agent or reductant; the electron-accepting molecule is the oxidizing agent or oxidant. Reducing and oxidizing agents function as conjugate reductant-oxidant pairs or redox pairs (Lehninger, Principles of Biochemistry, 1982, p471).
Oxidative Stress
A disturbance in the prooxidant-antioxidant balance in favor of the former, leading to potential damage. Indicators of oxidative stress include damaged DNA bases, protein oxidation products, and lipid peroxidation products (Sies, Oxidative Stress, 1991, pxv-xvi).
Glutathione Reductase
Catalyzes the oxidation of GLUTATHIONE to GLUTATHIONE DISULFIDE in the presence of NADP+. Deficiency in the enzyme is associated with HEMOLYTIC ANEMIA. Formerly listed as EC 1.6.4.2.
Autistic Disorder
A disorder beginning in childhood. It is marked by the presence of markedly abnormal or impaired development in social interaction and communication and a markedly restricted repertoire of activity and interest. Manifestations of the disorder vary greatly depending on the developmental level and chronological age of the individual. (DSM-V)
Glutathione Peroxidase
An enzyme catalyzing the oxidation of 2 moles of glutathione in the presence of hydrogen peroxide to yield oxidized glutathione and water. EC 1.11.1.9.

Inactivation of both RNA binding and aconitase activities of iron regulatory protein-1 by quinone-induced oxidative stress. (1/505)

Iron regulatory protein-1 (IRP-1) controls the expression of several mRNAs by binding to iron-responsive elements (IREs) in their untranslated regions. In iron-replete cells, a 4Fe-4S cluster converts IRP-1 to cytoplasmic aconitase. IRE binding activity is restored by cluster loss in response to iron starvation, NO, or extracellular H2O2. Here, we study the effects of intracellular quinone-induced oxidative stress on IRP-1. Treatment of murine B6 fibroblasts with menadione sodium bisulfite (MSB), a redox cycling drug, causes a modest activation of IRP-1 to bind to IREs within 15-30 min. However, IRE binding drops to basal levels within 60 min. Surprisingly, a remarkable loss of both IRE binding and aconitase activities of IRP-1 follows treatment with MSB for 1-2 h. These effects do not result from alterations in IRP-1 half-life, can be antagonized by the antioxidant N-acetylcysteine, and regulate IRE-containing mRNAs; the capacity of iron-starved MSB-treated cells to increase transferrin receptor mRNA levels is inhibited, and MSB increases the translation of a human growth hormone indicator mRNA bearing an IRE in its 5'-untranslated region. Nonetheless, MSB inhibits ferritin synthesis. Thus, menadione-induced oxidative stress leads to post-translational inactivation of both genetic and enzymatic functions of IRP-1 by a mechanism that lies beyond the "classical" Fe-S cluster switch and exerts multiple effects on cellular iron metabolism.  (+info)

The aconitase of yeast. IV. Studies on iron and sulfur in yeast aconitase. (2/505)

Chemical analyses were carried out to determine the active components of the crystalline aconitase [EC 4.2.1.3] of Candida lipolytica. The enzyme contained 2 atoms of non-heme iron, 1 atom of labile sulfur, and 6 sulfhydryl groups per molecule. One atom of the non-heme iron was released by the addition of metal-chelating agents such as sodium citrate, sodium nitrilotriacetate (NTA) or sodium ethylenediaminetetraacetate (EDTA) without loss of the enzyme activity. The non-heme iron and labile sulfur were released by the addition of sulfhydryl reagents such as rho-chloromercuribenzoate (PCMB), sodium mersalyl or urea with loss of the enzyme activity. o-Phenanthroline reacted with the iron atoms in the enzyme at pH 6.0 with loss of the activity. These results show that yeast aconitase is an iron-sulfur protein and that only one of the two non-heme iron atoms is essential for enzyme activity.  (+info)

The aconitase of yeast. V. The reconstitution of yeast aconitase. (3/505)

The apoenzyme of yeast aconitase [EC 4.2.1.3] was prepared by treatment of yeast aconitase with sodium mersalyl, followed by passage by passage of the reaction mixture through a column of Dowex A-1 and gel filtration on Sephadex G-25. The apoenzyme had no aconitase activity, but the active enzyme could be reconstituted by treatment of the apoenzyme with ferrous ions and sodium sulfide in the presence of 2-mercapto-ethanol. The reconstituted active enzyme was isolated by DEAE-Sephadex A-50 column chromatography and Sephadex G-100 gel filtration from the reaction mixture. The reconstituted enzyme was identical with the original untreated enzyme in terms of specific activity, iron content and spectral characteristics, but not in terms of labile sulfur content. A significant difference in visible spectra between the holo- and apoenzymes appeared to be due to the difference in iron and labile sulfur contents between the two proteins.  (+info)

Population structure and genetic divergence in Anopheles nuneztovari (Diptera: Culicidae) from Brazil and Colombia. (4/505)

Anopheles nuneztovari is considered an important vector of human malaria in several localities in Venezuela and Colombia. Its status as a vector of human malaria is still unresolved in areas of the Brazilian Amazon, in spite of have been found infected with Plasmodium sp.. For a better understanding of the genetic differentiation of populations of A. nuneztovari, electrophoretic analysis using 11 enzymes was performed on four populations from Brazil and two from Colombia. The results showed a strong differentiation for two loci: alpha-glycerophosphate dehydrogenase (alpha-Gpd) and malate dehydrogenase (Mdh) from 16 loci analyzed. Diagnostic loci were not detected. The populations of A. nuneztovari from the Brazilian Amazon showed little genetic structure and low geographic differentiation, based on the F(IS) (0.029), F(ST) (0.070), and genetic distance (0.001-0.032) values. The results of the isozyme analysis do not coincide with the indication of two lineages in the Amazon Basin by analysis of mitochondrial DNA, suggesting that this evolutionary event is recent. The mean F(ST) value (0.324) suggests that there is considerable genetic divergence among populations from the Brazilian Amazon and Colombia. The genetic distance among populations from the Brazilian Amazon and Colombia is ranges from 0.047 to 0.148, with the highest values between the Brazilian Amazon and Sitronela (SIT) (0.125-0.148). These results are consistent with those observed among members of anopheline species complexes. It is suggested that geographic isolation has reduced the gene flow, resulting in the genetic divergence of the SIT population. Dendrogram analysis showed three large groups: one Amazonian and two Colombia, indicating some genetic structuring. The present study is important because it attempted to clarify the taxonomic status of A. nuneztovari and provide a better understanding of the role of this mosquito in transmission of human malaria in northern South America.  (+info)

Human cytoplasmic aconitase (Iron regulatory protein 1) is converted into its [3Fe-4S] form by hydrogen peroxide in vitro but is not activated for iron-responsive element binding. (5/505)

Iron regulatory protein 1 (IRP1) regulates the synthesis of proteins involved in iron homeostasis by binding to iron-responsive elements (IREs) of messenger RNA. IRP1 is a cytoplasmic aconitase when it contains a [4Fe-4S] cluster and an RNA-binding protein after complete removal of the metal center by an unknown mechanism. Human IRP1, obtained as the pure recombinant [4Fe-4S] form, is an enzyme as efficient toward cis-aconitate as the homologous mitochondrial aconitase. The aconitase activity of IRP1 is rapidly lost by reaction with hydrogen peroxide as the [4Fe-4S] cluster is quantitatively converted into the [3Fe-4S] form with release of a single ferrous ion per molecule. The IRE binding capacity of IRP1 is not elicited with H(2)O(2). Ferrous sulfate (but not other more tightly coordinated ferrous ions, such as the complex with ethylenediamine tetraacetic acid) counteracts the inhibitory action of hydrogen peroxide on cytoplasmic aconitase, probably by replenishing iron at the active site. These results cast doubt on the ability of reactive oxygen species to directly increase IRP1 binding to IRE and support a signaling role for hydrogen peroxide in the posttranscriptional control of proteins involved in iron homeostasis in vivo.  (+info)

Low iron concentration and aconitase deficiency in a yeast frataxin homologue deficient strain. (6/505)

Deletion of the yeast frataxin homologue, YFH1, elicits accumulation of iron in mitochondria and mitochondrial defects. We report here that in the presence of an iron chelator in the culture medium, the concentration of iron in mitochondria is the same in wild-type and YFH1 deletant strains. Under these conditions, the activity of the respiratory complexes is restored. However, the activity of the mitochondrial aconitase, a 4Fe-4S cluster-containing protein, remains low. The frataxin family bears homology to a bacterial protein family which confers resistance to tellurium, a metal closely related to sulfur. Yfh1p might control the synthesis of iron-sulfur clusters in mitochondria.  (+info)

Bacillus subtilis aconitase is an RNA-binding protein. (7/505)

The aconitase protein of Bacillus subtilis was able to bind specifically to sequences resembling the iron response elements (IREs) found in eukaryotic mRNAs. The sequences bound include the rabbit ferritin IRE and IRE-like sequences in the B. subtilis operons that encode the major cytochrome oxidase and an iron uptake system. IRE binding activity was affected by the availability of iron both in vivo and in vitro. In eukaryotic cells, aconitase-like proteins regulate translation and stability of iron metabolism mRNAs in response to iron availability. A mutant strain of B. subtilis that produces an enzymatically inactive aconitase that was still able to bind RNA sporulated 40x more efficiently than did an aconitase null mutant, suggesting that a nonenzymatic activity of aconitase is important for sporulation. The results support the idea that bacterial aconitases, like their eukaryotic homologs, are bifunctional proteins, showing aconitase activity in the presence of iron and RNA binding activity when cells are iron-deprived.  (+info)

Iron-dependent regulation of transferrin receptor expression in Trypanosoma brucei. (8/505)

Transferrin is an essential growth factor for African trypanosomes. Here we show that expression of the trypanosomal transferrin receptor, which bears no structural similarity with mammalian transferrin receptors, is regulated by iron availability. Iron depletion of bloodstream forms of Trypanosoma brucei with the iron chelator deferoxamine resulted in a 3-fold up-regulation of the transferrin receptor and a 3-fold increase of the transferrin uptake rate. The abundance of expression site associated gene product 6 (ESAG6) mRNA, which encodes one of the two subunits of the trypanosome transferrin receptor, is regulated 5-fold by a post-transcriptional mechanism. In mammalian cells the stability of transferrin receptor mRNA is controlled by iron regulatory proteins (IRPs) binding to iron-responsive elements (IREs) in the 3'-untranslated region (UTR). Therefore, the role of a T. brucei cytoplasmic aconitase (TbACO) that is highly related to mammalian IRP-1 was investigated. Iron regulation of the transferrin receptor was found to be unaffected in Deltaaco::NEO/Deltaaco::HYG null mutants generated by targeted disruption of the TbACO gene. Thus, the mechanism of post-transcriptional transferrin receptor regulation in trypanosomes appears to be distinct from the IRE/IRP paradigm. The transferrin uptake rate was also increased when trypanosomes were transferred from medium supplemented with foetal bovine serum to medium supplemented with sera from other vertebrates. Due to varying binding affinities of the trypanosomal transferrin receptor for transferrins of different species, serum change can result in iron starvation. Thus, regulation of transferrin receptor expression may be a fast compensatory mechanism upon transmission of the parasite to a new host species.  (+info)

MGH/HST Martinos Center for Biomedical ImagingMGH/HST Martinos Center for Biomedical Imaging
Abstract Burn injury causes a major systemic catabolic response that is associated with mitochondrial dysfunction in skeletal muscle. We investigated the effects of the mitochondria-targeted peptide antioxidant Szeto-Schiller 31 (SS-31) on skeletal muscle in a mouse burn model using in vivo phosphorus-31 nuclear magnetic resonance ((31)P NMR) spectroscopy to noninvasively measure high-energy phosphate levels; mitochondrial aconitase activity measurements that directly correlate with TCA cycle flux, as measured by gas chromatography mass spectrometry (GC-MS); and electron paramagnetic resonance (EPR) to assess oxidative stress. At 6 h postburn, the oxidative ATP synthesis rate was increased 5-fold in burned mice given a single dose of SS-31 relative to untreated burned mice (P=0.002). Furthermore, SS-31 administration in burned animals decreased mitochondrial aconitase activity back to control levels. EPR revealed a recovery in redox status of the SS-31-treated burn group compared to the ...
http://www.nmr.mgh.harvard.edu/publications/journal_articles/1938
Reduction in Mitochondrial Superoxide Dismutase Modulates Alzheimers Disease-Like Pathology and Accelerates the Onset of...Reduction in Mitochondrial Superoxide Dismutase Modulates Alzheimers Disease-Like Pathology and Accelerates the Onset of...
Most common neurodegenerative disorders likely result from complex interactions between genetic and environmental risk factors (Farrer et al., 1997; Munoz and Feldman, 2000; Lindsay et al., 2002). One such factor may be aging-related alterations in the redox state of mitochondria (Hirai et al., 2001; Eckert et al., 2003; Beal, 2005) Our study shows that partial reduction in the main mitochondrial superoxide scavenger Sod2 accelerates the onset of hAPP/Aβ-dependent behavioral abnormalities and worsens a range of AD-related molecular and pathological alterations.. How might Sod2 reduction modulate the phenotype of hAPP mice or AD? An obvious mechanism is increased mitochondrial levels of superoxide radicals and resultant oxidative damage. To assess this possibility, we measured mitochondrial aconitase activity, a well-established mitochondrial sensor of superoxide that is lower in the heart and liver of adult Sod2+/− mice than in Sod2+/+ controls (Williams et al., 1998; Van Remmen et al., ...
http://www.jneurosci.org/content/26/19/5167.long
Plus itPlus it
Most common neurodegenerative disorders likely result from complex interactions between genetic and environmental risk factors (Farrer et al., 1997; Munoz and Feldman, 2000; Lindsay et al., 2002). One such factor may be aging-related alterations in the redox state of mitochondria (Hirai et al., 2001; Eckert et al., 2003; Beal, 2005) Our study shows that partial reduction in the main mitochondrial superoxide scavenger Sod2 accelerates the onset of hAPP/Aβ-dependent behavioral abnormalities and worsens a range of AD-related molecular and pathological alterations.. How might Sod2 reduction modulate the phenotype of hAPP mice or AD? An obvious mechanism is increased mitochondrial levels of superoxide radicals and resultant oxidative damage. To assess this possibility, we measured mitochondrial aconitase activity, a well-established mitochondrial sensor of superoxide that is lower in the heart and liver of adult Sod2+/− mice than in Sod2+/+ controls (Williams et al., 1998; Van Remmen et al., ...
http://www.jneurosci.org/content/26/19/5167
NCBI Conserved Domain SearchNCBI Conserved Domain Search
Aconitase catalytic domain; Aconitase catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle; Aconitase catalytic domain. Aconitase (aconitate hydratase) catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle. Cis-aconitate is formed as an intermediate product during the course of the reaction. In eukaryotes two isozymes of aconitase are known to exist: one found in the mitochondrial matrix and the other found in the cytoplasm. Aconitase, in its active form, contains a 4Fe-4S iron-sulfur cluster; three cysteine residues have been shown to be ligands of the 4Fe-4S cluster. This is the Aconitase core domain, including structural domains 1, 2 and 3, which binds the Fe-S cluster. The aconitase family also contains the following proteins: - Iron-responsive element binding protein (IRE-BP), a cytosolic protein that binds to iron-responsive elements (IREs). IREs are stem-loop structures found in the 5UTR of ferritin, and delta ...
https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/Structure/cdd/wrpsb.cgi?seqinput=NP_001163030.1
NCBI Conserved Domain SearchNCBI Conserved Domain Search
Aconitase catalytic domain; Aconitase catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle; Aconitase catalytic domain. Aconitase (aconitate hydratase) catalyzes the reversible isomerization of citrate and isocitrate as part of the TCA cycle. Cis-aconitate is formed as an intermediate product during the course of the reaction. In eukaryotes two isozymes of aconitase are known to exist: one found in the mitochondrial matrix and the other found in the cytoplasm. Aconitase, in its active form, contains a 4Fe-4S iron-sulfur cluster; three cysteine residues have been shown to be ligands of the 4Fe-4S cluster. This is the Aconitase core domain, including structural domains 1, 2 and 3, which binds the Fe-S cluster. The aconitase family also contains the following proteins: - Iron-responsive element binding protein (IRE-BP), a cytosolic protein that binds to iron-responsive elements (IREs). IREs are stem-loop structures found in the 5UTR of ferritin, and delta ...
https://0-www-ncbi-nlm-nih-gov.brum.beds.ac.uk/Structure/cdd/wrpsb.cgi?seqinput=NP_524708.1
Dietitians for Men Macon GA - dietitians for men, Macon GA healthy diets, Macon GA supplements for men, Macon GA dietary...Dietitians for Men Macon GA - dietitians for men, Macon GA healthy diets, Macon GA supplements for men, Macon GA dietary...
Dietitians for men provide expert nutrition and dietary advice to men on how to stay healthy. Read on to learn more on dietitians for men in Macon, GA and get access to healthy diets, supplements for men, dietary intake, weight management, and advice on dietary changes, as well as content on how good nutrition can help boost male fertility.
http://localmarket.mypregnancyguide.com/Dietitians_for_Men_Macon_GA-p1567759-Macon_GA.html
Aconitase | Article about aconitase by The Free DictionaryAconitase | Article about aconitase by The Free Dictionary
Looking for aconitase? Find out information about aconitase. An enzyme involved in the Krebs citric acid cycle that catalyzes the breakdown of citric acid to cis -aconitic and isocitric acids Explanation of aconitase
http://encyclopedia2.thefreedictionary.com/aconitase
NIOSHTIC-2 Publications Search - 20000199 - Health hazard evaluation report: HETA-97-0075-2653, Macon County Courthouse, Macon...NIOSHTIC-2 Publications Search - 20000199 - Health hazard evaluation report: HETA-97-0075-2653, Macon County Courthouse, Macon...
On January 16, 1997, the National Institute for Occupational Safety and Health (NIOSH) received an employee request for a health hazard evaluation (HHE) at the Macon County government facilities in Macon, Missouri, NIOSH was asked to determine if health problems experienced by some building occupants were related to exposure to residual pesticide contamination in Buildings 1 (main courthouse) and
https://www.cdc.gov/niosh/nioshtic-2/20000199.html
shows that saturation was reached at around two mishows that saturation was reached at around two mi
Peroxyni trite also disrupts the ferrous sulfur lively internet site in the tri carboxylic acid cycle enzyme aconitase, resulting in ARQ 197 cell in vivo in vi
http://braila.bossforum.net/t3345-shows-that-saturation-was-reached-at-around-two-mi
Metabolic enzyme molecule - Stock Image F009/5998 - Science Photo LibraryMetabolic enzyme molecule - Stock Image F009/5998 - Science Photo Library
Metabolic enzyme. Molecular model of the enzyme aconitase, which is involved in the citric acid (or Krebs) cycle. The citric acid cycle is the process by which mitochondria convert glucose to energy. - Stock Image F009/5998
http://www.sciencephoto.com/media/597053/view
Care Concerns | Macon County SchoolsCare Concerns | Macon County Schools
Macon County Schools is in the process of reviewing its website to ensure compliance with Section 504 of the Rehabilitation Act and Title II of the Americans with Disabilities Act. If you have questions or concerns regarding the accessibility of the website or if you are unable to access a page or document on the website, you may contact the Technology Department via email at [email protected] ...
http://www.macon.k12.nc.us/resources/care/care-concerns/
Cost Of Living In Macon, MSCost Of Living In Macon, MS
View a complete Macon, MS cost of living report and index. Includes average cost of groceries, health care, housing, goods and services as well as average prices of goods in Macon, MS.
http://www.areavibes.com/macon-ms/cost-of-living/
DI49 2832 - Aconitate hydratase, mitochondrial - Saccharomyces eubayanus (Yeast) - DI49 2832 gene & proteinDI49 2832 - Aconitate hydratase, mitochondrial - Saccharomyces eubayanus (Yeast) - DI49 2832 gene & protein
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
http://www.uniprot.org/uniprot/A0A0L8RGC2
Macon, GAMacon, GA
Heart attack, or myocardial infarction, happens when blood flow to the heart is blocked. Symptoms include chest pain, shortness of breath, and nausea. Pain may occur in the neck, jaw, back, or stomach, especially in people designated female at birth. Find a cardiologist in Macon, GA.
https://www.cardiology-doctors.com/macon/ga/heart-attack.html
Lupus Treatment in Macon, GALupus Treatment in Macon, GA
Lupus treatment in Macon, GA. Lupus is a chronic inflammatory disease which can cause muscle pain and hair. Learn more about symptoms and treatment.
https://www.internal-medicine-centers.com/macon/ga/lupus-treatment.html
Childre Nissan Comparison - Comparing 2019 Nissan Maxima To 2019 Cadillac CTS 14 Near Macon, GAChildre Nissan Comparison - Comparing 2019 Nissan Maxima To 2019 Cadillac CTS 14 Near Macon, GA
Childre Nissan Comparison Dated Jun 26th 2019 - 450 days ago - Comparing 2019 Nissan Maxima To 2019 Cadillac CTS 14 Near Macon, GA
http://www.childrenissan.com/Comparing-2019-Nissan-Maxima-To-2019-Cadillac-CTS-14-Near%20Macon,%20GA.php
Fredrick Junior Boyington Jr. Obituary - Macon, GAFredrick Junior Boyington Jr. Obituary - Macon, GA
Celebrate the life of Fredrick Junior Boyington Jr., leave a kind word or memory and get funeral service information care of Macon Memorial Park Funeral Home.
https://www.dignitymemorial.com/obituaries/macon-ga/fredrick-boyington-8942243
Development Coordinator $90,000 Jobs, Employment in Macon County, IL | Indeed.comDevelopment Coordinator $90,000 Jobs, Employment in Macon County, IL | Indeed.com
7 Development Coordinator $90,000 jobs available in Macon County, IL on Indeed.com. Medical Director, Senior Director of Human Resources, Family Medicine Physician and more!
http://www.indeed.com/q-Development-Coordinator-$90,000-l-Macon-County,-IL-jobs.html
Defeating Diabetes Naturally! There is HOPE Registration, Fri, Apr 20, 2018 at 7:00 PM | EventbriteDefeating Diabetes Naturally! There is HOPE Registration, Fri, Apr 20, 2018 at 7:00 PM | Eventbrite
Eventbrite - Dr Vaibhav Patel presents Defeating Diabetes Naturally! There is HOPE - Friday, April 20, 2018 at Macon, Macon, GA. Find event and registration information.
https://www.eventbrite.com/e/defeating-diabetes-naturally-there-is-hope-registration-41738337491
Macon County poverty higher rate than state and national averages | WRSPMacon County poverty higher rate than state and national averages | WRSP
Local social organizations explored the possible link between poverty and human trafficking at a public forum Monday night in Decatur.The organization, Set Free Movement, hosted a 5-person panel and said the realization that poverty is throughout the state
http://foxillinois.com/news/local/macon-county-poverty-higher-rate-than-state-and-national-averages
Selective inhibition of the citrate-to-isocitrate reaction o 2020Selective inhibition of the citrate-to-isocitrate reaction o 2020
Communicated by Helmut Beinert, University of Wisconsin, Madison, WI, June 16, 2004 (received for review April 14, 2004) ArticleFigures SIInfo lane 2, WT; lane 3, S711A; lane 4, S711D; lane 5, S711E; lane 6, S711T. Rate of Conversion of Cit
https://www.lw90.com/LawLegal/technology/20200518/485431.html
anti-Aconitase 1 antibody | GeneTexanti-Aconitase 1 antibody | GeneTex
Aconitase 1 antibody (aconitase 1) for IHC-P, WB. Anti-Aconitase 1 pAb (GTX64472) is tested in Human, Mouse, Rat samples. 100% Ab-Assurance.
http://www.genetex.com/Aconitase-1-antibody-GTX64472.html
Redoxica | Aconitase Assay KitRedoxica | Aconitase Assay Kit
Quantitative 1-mL UV/Vis spectrophotometric assay detection method, kit sufficient for 100 assays, ready-to-use, quick protocol, ultrahigh accuracy, hypersensitive, reliable, and consistent
https://www.redoxica.com/aconitase-assay-kit/100-assays/rdxadi17yn/rs
Anti-Aconitase 2 抗体 [6F12BD9] (ab110321)Anti-Aconitase 2 抗体 [6F12BD9] (ab110321)
マウス・モノクローナル抗体 ab110321 交差種: Ms,Rat,Hu 適用: WB,IP,IHC-P,IHC-Fr,Flow Cyt,ICC/IF,In-Cell ELISA…Aconitase…
http://www.abcam.co.jp/aconitase-2-antibody-6f12bd9-ab110321.html
The interaction between the iron-responsive element binding protein and its cognate rna is highly dependent upon both RNA...The interaction between the iron-responsive element binding protein and its cognate rna is highly dependent upon both RNA...
TY - JOUR. T1 - The interaction between the iron-responsive element binding protein and its cognate rna is highly dependent upon both RNA sequence and structure. AU - Jaffrey, Samie R.. AU - Haile, David J.. AU - Klausner, Richard D.. AU - Harford, Joe B.. PY - 1993/9/25. Y1 - 1993/9/25. N2 - To assess the influence of RNA sequence2.urule;structure on the interaction RNAs with the iron-responsive element binding protein (IRE-BP), twenty eight altered RNAs were tested as competitors for an RNA corresponding to the ferritin H chain IRE. All changes in the loop of the predicted IRE hairpin and in the unpaired cytosine residue characteristically found in IRE stems significantly decreased the apparent affinity of the RNA for the IRE-BP. Similarly, alteration in the spacing and2.urule;or orientation of the loop and the unpaired cytosine of the stem by either increasing or decreasing the number of base pairs separating them significantly reduced efficacy as a competitor. It is inferred that the IRE-BP ...
https://scholars.uthscsa.edu/en/publications/the-interaction-between-the-iron-responsive-element-binding-prote
Iron-responsive element-binding protein - WikipediaIron-responsive element-binding protein - Wikipedia
The iron-responsive element-binding proteins, also known as IRE-BP, IRBP, IRP and IFR , bind to iron-responsive elements (IREs) in the regulation of human iron metabolism. ACO1, or IRP1, is a bifunctional protein that functions as an iron-responsive element (IRE)-binding protein involved in the control of iron metabolism by binding mRNA to repress translation or degradation. It functions also as the cytoplasmic isoform of aconitase. Aconitases are iron-sulfur proteins that require a 4Fe-4S cluster for their enzymatic activity, in which they catalyze conversion of citrate to isocitrate. This structure was based on x-ray crystal diffraction. The resolution was 2.80 Å. This protein was harvested from the species Oryctolagus cuniculus, or more commonly known as a rabbit. This protein has a couple conformational changes associated with it to explain the alternative functions as either mRNA regulator or as an enzyme. This informations was obtained from the RCSB protein data bank website. IRP2 is less ...
https://en.wikipedia.org/wiki/Iron-responsive_element-binding_protein
AtREG645AtREG645
aconitate hydratase/ copper ion binding; FUNCTIONS IN: aconitate hydratase activity, copper ion binding; INVOLVED IN: response to cadmium ion; LOCATED IN: mitochondrion, chloroplast; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 16 growth stages; CONTAINS InterPro DOMAIN/s: Aconitase family, 4Fe-4S cluster binding site (InterPro:IPR018136), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (InterPro:IPR001030), Aconitase A/isopropylmalate dehydratase small subunit, swivel (InterPro:IPR000573), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (InterPro:IPR015932), Aconitase/Iron regulatory protein 2/2-methylisocitrate dehydratase (InterPro:IPR015934), Aconitase-like core (InterPro:IPR015937), Aconitase/3-isopropylmalate dehydratase, swivel (InterPro:IPR015928), Aconitase/iron regulatory protein 2 (InterPro:IPR006249), Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomains 1 and 3 (InterPro:IPR015931); ...
http://ppdb.agr.gifu-u.ac.jp/ppdb/cgi-bin/tag_list.cgi?organism=At&tag=AtREG645
PROMISE: Marylands AGEP | Kristin NoellPROMISE: Marylands AGEP | Kristin Noell
Parasites as an Alternative Model for Lipid Metabolism: Gene Expression Analysis of an Oyster Parasite Perkinsus marinus during Lipid Starvation.. Our laboratory is interested in understanding the regulation of fatty acid biosynthesis in Perkinsus marinus. Previous work has shown that this parasite is capable of synthesizing its own fatty acids, a property that is unique among parasites that usually require the acquisition of certain essential fatty acids from their host. Fatty acid synthesis occurs in the cytosol from Acetyl CoA, which is derived from carbohydrate metabolism via citrate. In the cytosol, citrate can be cleaved into oxaloacetate and Acetyl CoA, or be converted to isocitrate by cytosolic aconitase. We are investigating the role of cytosolic aconitase as a potential branch point in this process, as we have evidence for phosphorylation of this enzyme in favoring citrate production. No one to our knowledge has delineated the role of cytosolic aconitase in fatty acid biosynthesis. We ...
https://promiseagep.com/promise/symposium/kristin-noell/
The Saccharomyces cerevisiae RTG2 Gene Is a Regulator of Aconitase Expression Under Catabolite Repression Conditions | GeneticsThe Saccharomyces cerevisiae RTG2 Gene Is a Regulator of Aconitase Expression Under Catabolite Repression Conditions | Genetics
The ACO1 gene, encoding mitochondrial aconitase of Saccharomyces cerevisiae, is required both for oxidative metabolism and for glutamate prototrophy. This gene is subject to catabolite repression; the ACO1 mRNA level is further reduced when glutamate is supplied with glucose. To further explore regulation of ACO1 expression, we have screened for mutations that reduce expression of an ACO1-lacZ fusion borne on a multicopy vector. We identified a gene required for wild-type expression of ACO1 only under catabolite repression conditions. Sequencing of the corresponding cloned gene revealed that it is identical to RTG2 previously cloned as a pivotal gene in controlling interorganelle retrograde communication. Cells containing either the original rtg2-2 mutation or a null rtg2 allele are not petite but show a residual growth on minimum glucose medium with ammonium sulfate as the sole nitrogen source. This growth defect is partially restored by supplying aspartate or threonine, and fully with ...
http://www.genetics.org/content/144/3/893
Macon Hourly Weather - AccuWeather Forecast for IL 62544Macon Hourly Weather - AccuWeather Forecast for IL 62544
Get the Macon hour-by-hour weather forecast including temperature, RealFeel and chance of precipitation for Macon, IL 62544 from AccuWeather.com
https://www.accuweather.com/en/us/macon-il/62544/hourly-weather-forecast/2241411?hour=43
Macon Outdoors (Macon, GA) | MeetupMacon Outdoors (Macon, GA) | Meetup
Welcome to Macon Outdoors! We are a group of fun, friendly & active members that love outdoor activities such as hiking, biking, caving, rapelling, camping & paddling throughout beautiful Middle Georg
https://www.meetup.com/Macon-Outdoors/
Tableau Training & Certification in Macon, GA Tickets, Tue, Nov 19, 2019 at 9:00 AM | EventbriteTableau Training & Certification in Macon, GA Tickets, Tue, Nov 19, 2019 at 9:00 AM | Eventbrite
Eventbrite - Trainerkart Americas, INC presents Tableau Training & Certification in Macon, GA - Tuesday, November 19, 2019 | Friday, November 22, 2019 at Business Hotel, Macon, GA. Find event and ticket information.
https://www.eventbrite.com/e/tableau-training-certification-in-macon-ga-tickets-41823496203
Diabetes, Metabolism & Endocrinologists near Macon, GA - Diabetes Doctor - EndocrinologistDiabetes, Metabolism & Endocrinologists near Macon, GA - Diabetes Doctor - Endocrinologist
Find and research local Endocrinology, Diabetes & Metabolism Specialists in Macon, GA including ratings, contact information, and more.
https://www.healthgrades.com/diabetes-metabolism-endocrinology-directory/ga-georgia/macon
32 oz. Disinfectant Bottle at Home Depot in Macon - 6545484032 oz. Disinfectant Bottle at Home Depot in Macon - 65454840
Get 32 oz. Disinfectant Bottle On Sale today at Home Depot! Compare Cleaning Supplies prices & check availability for 32 oz. Disinfectant Bottle. Get it right now at your nearest store in Macon.
http://findnsave.macon.com/offer/32-oz-Disinfectant-Bottle/65454840/
Who Is Macon Phillips?Who Is Macon Phillips?
Welcome to the new WhiteHouse.gov. Im Macon Phillips, the Director of New Media for the White House and one of the people who will be contributing to the blog. A new feeling -- to have someone at the White House one friend button away at LinkedIn, Facebook, or Twitter. Also, looks like you cant measure real influence by the number of Twitter followers or other virtual friends after all. As Steve Jobs says, real artists ship ...
http://adverlab.blogspot.com/2009/01/who-is-macon-phillips.html
Dr. James Lennon, DO, Medical Oncology Specialist - Macon, GA | SharecareDr. James Lennon, DO, Medical Oncology Specialist - Macon, GA | Sharecare
Dr. James Lennon, DO is a medical oncology specialist in Macon, GA. He currently practices at Georgia Cancer Specialists and is affiliated with Coliseum Medical Centers. He accepts multiple insurance plans. Dr. Lennon is board certified in Hematology.
https://www.sharecare.com/doctor/dr-james-g-lennon
Health Services - 3 Coupons in Macon, MS | Dental, Eye Care & FitnessHealth Services - 3 Coupons in Macon, MS | Dental, Eye Care & Fitness
There are many health and medical professionals in Macon, MS offering discounts and coupons on plastic surgery, weight loss, dental exams, and pain management.
https://www.valpak.com/coupons/savings/health/macon/ms
Alice Rose House MD | Family Practitioner | Macon, GA | Lifescript.comAlice Rose House MD | Family Practitioner | Macon, GA | Lifescript.com
Alice Rose House MD is a Family Practitioner who practices in Macon, GA. Get a full report about this doctors background by clicking here.
http://www.lifescript.com/doctor-directory/family-practice/macon-georgia-ga-alice-rose-house-md.aspx
Muhammad Sohail Akbar MD | Nephrologist | Macon, GA | Lifescript.comMuhammad Sohail Akbar MD | Nephrologist | Macon, GA | Lifescript.com
Muhammad Sohail Akbar MD is a Nephrologist who practices in Macon, GA. Get a full report about this doctors background by clicking here.
http://www.lifescript.com/doctor-directory/nephrology/macon-georgia-ga-muhammad-sohail-akbar-md.aspx
means that, cymbalta withdrawal using prozac should ceasemeans that, cymbalta withdrawal using prozac should cease
This requires not only cyymbalta of the activity of the glycolytic and citric acid cycle enzymes, but also adequate oxygen and glucose delivery. 89266в270.
http://politvolga.ru/buying-pills-online-no-prescription/cymbalta-withdrawal-using-prozac.html
Publications - Molecular Enzymology - Prof. Dr. Silke Leimkühler - University of PotsdamPublications - Molecular Enzymology - Prof. Dr. Silke Leimkühler - University of Potsdam
Chern Lim, S., Friemel, M., Marum, J.E., Tucker, E.J., Bruno, D.L., Riley, L.G., Christodoulou, J., Kirk, E.P., Boneh, A., DeGennaro, Ch.M., Springer, M., Mootha, V.K., Rouault, T.A., Leimkühler, S., Thorburn, D.R., Compton, A.G. (2013) Mutations in LYRM4, encoding iron-sulfur cluster biogenesis factor ISD11, cause, deficiency of multiple respiratory chain complexes. Human Molecular Genetics, 1-14, doi:10.1093/hmg/ ...
https://www.uni-potsdam.de/en/ibb-enzymology/publications
SAUSA300 1246 - AureoWikiSAUSA300 1246 - AureoWiki
Staphylococcus aureus; strain: USA300_FPR3757; locus tag: SAUSA300_1246 (SAUSA300_RS06765); symbol: citB; product: aconitate hydratase
https://aureowiki.med.uni-greifswald.de/SAUSA300_1246
Nerve Damage Lawyer - The Sessions Law Firm, LLC | Atlanta & MaconNerve Damage Lawyer - The Sessions Law Firm, LLC | Atlanta & Macon
If youre suffering from nerve pain, a nerve damage lawyer at The Sessions Law Firm may be able to help you get the recovery you deserve.
https://www.thesessionslawfirm.com/personal-injury-lawyer/nerve-damage-lawyer/
The Robyns Nest: The News on Baby CThe Robyns Nest: The News on Baby C
The tech said that she was fairly confident that this would turn out to be nothing. And that most of the time, these cysts are gone by 32 weeks. She said that she doesnt seem them weekly, or even monthly, but that theyre not crazy uncommon. After talking with her, she took us to see Vickie for the rest of our appointment. Usually I ONLY see Marie, but she left sick that day, so Vickie was taking her appointments. Ive never met Vickie before. And under a normal visit, I might like her. But I was NOT impressed at this visit. Basically, she told us NOTHING. We learned more from the ultrasound tech than we did from her. She barely said anything to us at all and was not informative or comforting. They do want to refer us to Macon to see a specialist for a level 2 ultrasound. This will give us just a better idea of whats going on in there with Baby C. That appointment has been scheduled and we will be going to Macon on February 20th at 1:30. PLEASE keep this appointment and Baby C in your prayers. ...
http://www.mullicanfamily.com/2012/02/news-on-baby-c.html
Dr. Randall Brown, MD - Macon, GA - General Surgery | Healthgrades.comDr. Randall Brown, MD - Macon, GA - General Surgery | Healthgrades.com
Visit Healthgrades for information on Dr. Randall Brown, MD Find Phone & Address information, medical practice history, affiliated hospitals and more.
https://www.healthgrades.com/physician/dr-randall-brown-xt7dg
Macon County CommissionersMacon County Commissioners
If youre of a mind, and can afford it, a dollar a month (or more) from enough people will make a huge difference in improving the quality of coverage of local meetings and events, as well as allowing remote weather stations and weather cams to be deployed throughout the county that you will be able to access online.. ...
http://thunderpigblog.blogspot.com/2015/04/macon-county-commissioners-april-14.html
Macon County CommissionersMacon County Commissioners
If youre of a mind, and can afford it, a dollar a month (or more) from enough people will make a huge difference in improving the quality of coverage of local meetings and events, as well as allowing remote weather stations and weather cams to be deployed throughout the county that you will be able to access online.. ...
http://thunderpigblog.blogspot.com/2011/10/macon-county-commissioners-october-26.html
Jamie Simpson | Financial Planner | Macon, GA | Prudential AdvisorsJamie Simpson | Financial Planner | Macon, GA | Prudential Advisors
Sometimes you just need some guidance. We all do. And when it comes to finances, helping people plan for the future, whether its retiring in 20 years or buyin
https://www.prudential.com/advisor/james-simpson
HIS BRIDE: 2008-11-02HIS BRIDE: 2008-11-02
Things are still going well with Karis but she has hit a minor bump in the road. Heres the good news: she has come COMPLETELY off of oxygen and her breathing is doing much better! They have also removed the feeding tube from her throat and replaced it with one through her nose that wont gag and aggravate her. Less than good news: shes not progressing quite as quickly as the doctor would like to see. She is still retracting a little when she breathes and the second set of x-rays still show some stuff in her lungs. She also has something going on with her bowels that could be causing some stomach problems and preventing her from digesting her milk like she should. Because of these things, the doctor is keeping her in the nursery another day and feeding her only through IV - no nursing with her mom or even getting milk through the tube. The doctor has consulted with another doctor at the NICU in Macon and they feel that its best to give her another day to move things along through her ...
http://vanessa-hisbride.blogspot.com/2008_11_02_archive.html
Macon County | Macon County, Illinois Nursing Home Abuse LawyersMacon County | Macon County, Illinois Nursing Home Abuse Lawyers
Free Consultation - Call (877) 374-1417 - Levin & Perconti helps victims and their families receive compensation for their injuries in Nursing Home Abuse and Elder Neglect cases. Macon County - Macon County, Illinois Nursing Home Abuse Lawyer
https://www.levinperconti.com/macon-county.html
Macon County (Alabama) - WikipediaMacon County (Alabama) - Wikipedia
Macon County er et fylke i den amerikanske delstaten Alabama. Det ligger i de sentrale delene av delstaten og grenser mot Tallapoosa County i nord, Lee County i nordøst, Russell County i sørøst, Bullock County i sør, Montgomery County i sørvest og mot Elmore County i nordvest. Macon Countys totale areal er 1 588 km² hvorav 7 km² er vann. I 2000 hadde fylket 24 105 innbyggere og administrasjonssenteret ligger i byen Tuskegee som også er fylkets største by. Fylket ble etablert i 1832 og har fått sitt navn etter senator Nathaniel Macon. ...
https://no.wikipedia.org/wiki/Macon_County_
Aco1 - Cytoplasmic aconitate hydratase - Rattus norvegicus (Rat) - Aco1 gene & proteinAco1 - Cytoplasmic aconitate hydratase - Rattus norvegicus (Rat) - Aco1 gene & protein
Iron sensor. Binds a 4Fe-4S cluster and functions as aconitase when cellular iron levels are high. Functions as mRNA binding protein that regulates uptake, sequestration and utilization of iron when cellular iron levels are low. Binds to iron-responsive elements (IRES) in target mRNA species when iron levels are low. Binding of a 4Fe-4S cluster precludes RNA binding.
https://www.uniprot.org/uniprot/Q63270
Macon Juvenile Law Lawyers - Compare Top Juvenile Law Attorneys in Macon, Illinois - JustiaMacon Juvenile Law Lawyers - Compare Top Juvenile Law Attorneys in Macon, Illinois - Justia
Compare juvenile law attorneys serving Macon, Illinois on Justia. Comprehensive profiles including fees, education, jurisdictions, awards, publications and social media.
https://www.justia.com/lawyers/juvenile/illinois/macon
Macon fire chief urges smoke alarms, escape plans | Macon TelegraphMacon fire chief urges smoke alarms, escape plans | Macon Telegraph
After 10 fire deaths made Macon one of Georgias deadliest cities in 2016, Fire Prevention Chief Brenda Thomas urges compliance in 2017.
https://www.macon.com/news/local/article177021846.html
Wireless Sales Representative Jobs in Macon, GA | GlassdoorWireless Sales Representative Jobs in Macon, GA | Glassdoor
Search Wireless Sales Representative jobs in Macon, GA with company ratings & salaries. 106 open jobs for Wireless Sales Representative in Macon.
https://www.glassdoor.com/Job/macon-wireless-sales-representative-jobs-SRCH_IL.0,5_IC1155868_KO6,35.htm
Macon Youth Development Campus Inmate Search | Jones County | Georgia | JailExchangeMacon Youth Development Campus Inmate Search | Jones County | Georgia | JailExchange
Macon Youth Development Campus Inmate Search, Arrest Records, Inmate Roster, Booking Information for Macon, Georgia. Look up any inmate in America on jailexchange.com.
https://www.jailexchange.com/countyjails/georgia/jones/macon_youth_development_campus_inmate_search.aspx
Magnolia Crossing Apartments - Macon, GA 31210Magnolia Crossing Apartments - Macon, GA 31210
Find your new home at Magnolia Crossing located at 461 Forest Hill Road, Macon, GA 31210. Floor plans starting at $705. Check availability now!
https://www.apartmentguide.com/apartments/Georgia/Macon/Magnolia-Crossing/24535/
Basketball - Macon East AcademyBasketball - Macon East Academy
The Macon East varsity boys basketball season was nothing short of a fairy tale. Their 33-0 perfect season was flawless as was their teamwork and devotion to the goal of a state title. After joining the Knights basketball program in 2015, Coach Larry Chapman has made every effort to build a championship team, and players from area schools and Birmingham transferred to play under his leadership. Coaches Chapman and (Lincoln) Glass set out this year to become a more defensive-minded program that no offense could penetrate, and they succeeded beating the majority of their opponents by an average 38.9 point margin. After playing in several tournaments this season and taking home the trophy from them all, only one trophy was still up for grabs. Heading into the Elite 8 as Region Champions, the Knights eliminated South Choctaw with ease with Artavious Billups leading the charge with 30 points followed by Slate Garmany (14), Christian Lewis (13), and Kyle Edwards (12). The Final Four matchup with ...
https://maconeast.net/category/news-and-events/basketball/
Difference between revisions of Macon County, Tennessee Genealogy Genealogy - FamilySearch WikiDifference between revisions of Macon County, Tennessee Genealogy Genealogy - FamilySearch Wiki
Genealogical articles with abstracts of Macon County, Tennessee records have been published in Ansearchin News, the quarterly magazine of the [http://www.tngs.org/ Tennessee Genealogical Society]. To view a list of these articles, visit their [http://www.tngs.org/ansearchin/ByCounty_ndx.html county index]. To read digitized versions of the first 36 years of articles (Vols. 1-36), browse their [http://www.tngs.org/ansearchin/index.html archive] or conduct a [http://www.tngs.org/search.htm surname search]. The Family History Library has a complete collection of the Ansearchin News quarterly [http://www.familysearch.org/eng/library/fhlcatalog/supermainframeset.asp?display=titledetails&titleno=44514 FHL US/CAN Book 976.8 B2a ...
https://www.familysearch.org/wiki/en/index.php?title=Macon_County,_Tennessee&diff=1458509&oldid=452804
Macon | Georgia, United States | Britannica.comMacon | Georgia, United States | Britannica.com
Macon, city, seat (1823) of Bibb county, central Georgia, U.S., on the Ocmulgee River at the fall line. Its incorporated area extends into Jones county to the northeast. The original settlement, Newtown, developed around Fort Hawkins (1806). In 1822 a town was laid out across the river and named
https://www.britannica.com/place/Macon-Georgia
Daily Cold and Flu Weather Forecast for Macon, GADaily Cold and Flu Weather Forecast for Macon, GA
AccuWeather.com provided daily cold and flu weather forecast in Macon, GA. See how the weather will impact the flu and common cold
https://www.accuweather.com/en/us/macon-ga/31210/cold-flu-daily-forecast/13429_pc?day=1
Lymphedema Treatment Macon | Lymphedema Therapy Warner Robins | Vein Specialists of the SouthLymphedema Treatment Macon | Lymphedema Therapy Warner Robins | Vein Specialists of the South
Do you struggle with swelling in your arms or legs due to Lymphedema? Click here to learn more about Lymphedema Therapy that can reduce swelling and increase comfort in patients with Lymphedema. Vein Specialists of the South serves patients in Macon, Warner Robins and throughout Central Georgia.
https://www.veinspecialists.com/lymphedema-therapy/
Macon Georgia nursing programMacon Georgia nursing program
Information about Macon GA nursing program. Seek out accredited healthcare programs for the best training. Given a brief hospital internship or prior work experience, you can expect a great return on your medical education.
http://www.nursing-program.org/Macon-Georgia-nursing-program.php
Summer Camps in Macon, MS - MySummerCampsSummer Camps in Macon, MS - MySummerCamps
Discover and compare 0 Summer Camps in Macon, MS. More than 2 million parents every year book their perfect camp on MySummerCamps. Find your camp today!
https://www.mysummercamps.com/camps/mississippi/macon-summer-camps.html
Causes and Symptoms of a Herniated Disc | Chiropractor in Macon, GA | Erthal ChiropracticCauses and Symptoms of a Herniated Disc | Chiropractor in Macon, GA | Erthal Chiropractic
Erthal Chiropractic is your local Chiropractor in Macon serving all of your needs. Call us today at 478-742-1858 for an appointment.
https://www.erthalchiropractic.com/articles/general/612533-causes-and-symptoms-of-a-herniated-disc
Insurance | Dr. Keisha Robinson MD Reviews | Macon, GA | Vitals.comInsurance | Dr. Keisha Robinson MD Reviews | Macon, GA | Vitals.com
See all insurance polices and plans accepted by Dr. Keisha Robinson. She has 17 years of experience as a Obstetrician & Gynecologist in Macon, GA.
https://www.vitals.com/doctors/Dr_Keisha_L_Robinson/insurance
Difference between revisions of Macon County, Tennessee Genealogy Genealogy - FamilySearch WikiDifference between revisions of Macon County, Tennessee Genealogy Genealogy - FamilySearch Wiki
Genealogical articles with abstracts of Macon County, Tennessee records have been published in Ansearchin News, the quarterly magazine of the [http://www.tngs.org/ Tennessee Genealogical Society]. To view a list of these articles, visit their [http://www.tngs.org/ansearchin/ByCounty_ndx.html county index]. To read digitized versions of the first 36 years of articles (Vols. 1-36), browse their [http://www.tngs.org/ansearchin/index.html archive] or conduct a [http://www.tngs.org/search.htm surname search]. The Family History Library has a complete collection of the Ansearchin News quarterly {{FHL,44514,title-id,disp=FHL US/CAN Book 976.8 B2a ...
https://www.familysearch.org/wiki/en/index.php?title=Macon_County,_Tennessee&diff=1677430&oldid=889652
Nitric Oxide Sensing and Response in Vibrio Cholerae by Andrew SternNitric Oxide Sensing and Response in Vibrio Cholerae by Andrew Stern
Nitric oxide (NO) is a radical capable of inhibiting bacterial growth. Bacteria in turn have multiple mechanisms of resisting the toxic effects of NO, usually encoded by genes under the control of NO-responsive transcription factors. However, our knowledge of the protein targets of NO is limited, as is the function of many NO-regulated genes. We studied two genes in V. cholerae, hmpA and nnrS, which encode a flavohemoglobin and a protein of unknown function, respectively, both predicted to be under control of the NO-responsive transcription factor NorR. We confirmed that both promoters were regulated by NorR and found that all three genes were important for growth in the presence of NO stress. We then performed a metabolomic study on multiple strains of V. cholerae, finding new potential metabolic targets of NO. In particular we found that substrates of iron-sulfur cluster-containing proteins accumulated in strains lacking nnrS, and that aconitase activity was decreased in cell-free extracts of nnrS
https://repository.upenn.edu/edissertations/1457/
Protein: P21399 | MoonDB v2.0Protein: P21399 | MoonDB v2.0
Uniprot: Iron sensor. Binds a 4Fe-4S cluster and functions as aconitase when cellular iron levels are high. Functions as mRNA binding protein that regulates uptake, sequestration and utilization of iron when cellular iron levels are low. Binds to iron-responsive elements (IRES) in target mRNA species when iron levels are low. Binding of a 4Fe-4S cluster precludes RNA binding.Catalyzes the isomerization of citrate to isocitrate via cis-aconitate. more.. ...
http://moondb.hb.univ-amu.fr/protein/P21399
CECA Southern - CITB Temporary Works Co-ordinator Training Course - CECACECA Southern - CITB Temporary Works Co-ordinator Training Course - CECA
This two-day course is designed for potential temporary works co-ordinators who have to co-ordinate the design, the erection and decommission of temporary structures. Please see full programme below.. The course is an approved CITB SSP course and is run by 2020safetysolutions.. Each delegate will gain a CITB certificate that is nationally recognised, the course is also eligible for training grant reclamation from CITB.. Dates: Thursday 27 & Friday 28 August 2020 Cost: The cost of the programme is £215 + VAT per delegate.. If you wish to book a place please contact Leone Donnelly.. ...
https://www.ceca.co.uk/southern/event/ceca-southern-citb-temporary-works-co-ordinator-training-course-2/
Macon | American Lung AssociationMacon | American Lung Association
Learn how to improve your lung health. Make efforts towards clean air and smokefree living. Find facts about lung diseases, such as lung cancer, COPD, asthma.
http://www.lung.org/our-initiatives/healthy-air/sota/city-rankings/states/alabama/macon.html
MIddle Georgia State College (Macon State) - pg.2 | allnursesMIddle Georgia State College (Macon State) - pg.2 | allnurses
Page 2 - Any feedback on this school? How you like the program? I know they have consolidated with MGC. Have anyone been excepted with minimum stats? Any feedback would be appreciated. Thanks
http://allnurses.com/georgia-nursing/middle-georgia-state-879431-page2.html
Esme-Aisling I. | Macon, GA | Rover.comEsme-Aisling I. | Macon, GA | Rover.com
Ive never left my dog with anybody before you. Youre the first person Ive trusted my home and pets with. I cant tell you how happy I am t...
https://www.rover.com/members/esme-aisling-i-love-fun-fenced-yard-runs/
Other Auctions? - TOPICS ON EXOTIC, DOMESTIC, FARM AND REPTILE ANIMALSOther Auctions? - TOPICS ON EXOTIC, DOMESTIC, FARM AND REPTILE ANIMALS
I know there is lolly bros in Macon Mo, the one in Topeka Indiana (last weekend) and I have heard of one in Tn, but not sure where ...
https://sybilsden.com/bb/viewtopic.php?f=43&t=6624&p=54802
help- what is tear-ing?help- what is tear-ing?
While dining in a fabulous B&B last month in a small town just south of Macon, GA. I sampled 2 fine Merlots- a Shafer & a Sterling. We were dining with a large party & the waiter suggested we try a Cab that was bodied similar to that of a Merlot. (I do not remember the name - I was not that impressed with the flavor.)Someone else commented that they could tell it was a CAB by the way the wine tiered - teared sp ...
http://www.wines.com/wineboard/showthread.php?tid=8984&pid=33902
Middle Georgia College - FastwebMiddle Georgia College - Fastweb
|p|Middle Georgia College (MGC) was a four-year state college unit of the University System of Georgia. On Jan. 8, 2013, it was merged with Macon State College into a new institution, known as Midd...
https://www.fastweb.com/directory/college/middle-georgia-college-scholarships
Anti-Aconitase 2 antibody (ab83528) | AbcamAnti-Aconitase 2 antibody (ab83528) | Abcam
Rabbit polyclonal Aconitase 2 antibody validated for WB, ELISA, IHC, ICC/IF and tested in Human and Mouse. Referenced in 2 publications and 2 independent…
http://www.abcam.com/aconitase-2-antibody-ab83528.html
Pinpoint Common Chiropractic Coding Procedure Errors - AAPC Knowledge CenterPinpoint Common Chiropractic Coding Procedure Errors - AAPC Knowledge Center
By Michael D. Miscoe JD, CPC, CASCC, CUC, CCPC, CHCC, CRA Note: This article takes a purely CPT® approach to code selection and ignores the potential for v
https://www.aapc.com/blog/24718-pinpoint-common-chiropractic-coding-procedure-errors/
Management of recurrent cervical cancer: A review of the literature<...Management of recurrent cervical cancer: A review of the literature<...
TY - JOUR. T1 - Management of recurrent cervical cancer. T2 - A review of the literature. AU - Peiretti, M.. AU - Zapardiel, I.. AU - Zanagnolo, V.. AU - Landoni, F.. AU - Morrow, C. P.. AU - Maggioni, A.. PY - 2012/6. Y1 - 2012/6. N2 - Objective: The aim of this narrative review is to update the current knowledge on the treatment of recurrent cervical cancer based on a literature review. Material and methods: A web based search in Medline and CancerLit databases has been carried out on recurrent cervical cancer management and treatment. All relevant information has been collected and analyzed, prioritizing randomized clinical trials. Results: Cervical cancer still represents a significant problem for public health with an annual incidence of about half a million new cases worldwide. Percentages of pelvic recurrences fluctuate from 10% to 74% depending on different risk factors. Accordingly to the literature, it is suggested that chemoradiation treatment (containing cisplatin and/or taxanes) ...
https://moh-it.pure.elsevier.com/en/publications/management-of-recurrent-cervical-cancer-a-review-of-the-literatur
AconitaseAconitase
... (aconitate hydratase; EC 4.2.1.3) is an enzyme that catalyses the stereo-specific isomerization of citrate to ... One theory is that, in the rate-limiting step of the mechanism, the cis-aconitate is released from the enzyme, then reattached ... Another hypothesis is that cis-aconitate stays bound to the enzyme while it flips from the citrate to the isocitrate mode. In ... PDB: 1ACO​; Lauble, H; Kennedy, MC; Beinert, H; Stout, CD (1994). "Crystal Structures of Aconitase with Trans-aconitate and ...
https://en.wikipedia.org/wiki/Aconitase
Methyl fluoroacetateMethyl fluoroacetate
Fluorocitrate can inhibit aconitate hydratase, which is needed for the conversion of citrate, by competitive inhibition. This ...
https://en.wikipedia.org/wiki/Methyl_fluoroacetate
List of MeSH codes (D08)List of MeSH codes (D08)
... aconitate hydratase MeSH D08.811.520.241.300.050.500 - iron regulatory protein 1 MeSH D08.811.520.241.300.050.750 - iron ... enoyl-coa hydratase MeSH D08.811.520.241.300.300 - fumarate hydratase MeSH D08.811.520.241.300.500 - phosphopyruvate hydratase ... urocanate hydratase MeSH D08.811.520.241.300.950 - uroporphyrinogen iii synthetase MeSH D08.811.520.241.700 - polysaccharide- ...
https://en.wikipedia.org/wiki/List_of_MeSH_codes_(D08)
List of EC numbers (EC 4)List of EC numbers (EC 4)
... fumarate hydratase EC 4.2.1.3: aconitate hydratase EC 4.2.1.4: now EC 4.2.1.3 EC 4.2.1.5: arabinonate dehydratase EC 4.2.1.6: ... 2-hydratase EC 4.2.1.132: 2-hydroxyhexa-2,4-dienoate hydratase EC 4.2.1.133: copal-8-ol diphosphate hydratase EC 4.2.1.134: ... 4-oxalmesaconate hydratase EC 4.2.1.84: nitrile hydratase EC 4.2.1.85: dimethylmaleate hydratase EC 4.2.1.86: deleted identical ... 2-methyl-trans-aconitate forming) EC 4.2.1.118: 3-dehydroshikimate dehydratase EC 4.2.1.119: venoyl-CoA hydratase 2 EC 4.2. ...
https://en.wikipedia.org/wiki/List_of_EC_numbers_(EC_4)
Crossover experiment (chemistry)Crossover experiment (chemistry)
... citrate with aconitase in the presence of 2-methyl-cis-aconitate. This reaction produced both unlabeled cis-aconitate and 2- ... Isotope scrambling experiments using tritium, deuterium, and 18O were carried out on the aconitase hydratase reaction by I.A. ...
https://en.wikipedia.org/wiki/Crossover_experiment_(chemistry)
Aco1 - Cytoplasmic aconitate hydratase - Rattus norvegicus (Rat) - Aco1 gene & proteinAco1 - Cytoplasmic aconitate hydratase - Rattus norvegicus (Rat) - Aco1 gene & protein
aconitate hydratase activity Source: RGD ,p>Inferred from Direct Assay,/p> ,p>Used to indicate a direct assay for the function ... Cytoplasmic aconitate hydratase (EC:4.2.1.3*Search proteins in UniProtKB for this EC number. ... "Developmental changes of rat liver cytoplasmic and mitochondrial aconitate hydratases.". Masini A., Guarriero-Bobyleva V., ... sp,Q63270,ACOC_RAT Cytoplasmic aconitate hydratase OS=Rattus norvegicus OX=10116 GN=Aco1 PE=1 SV=1 ...
https://www.uniprot.org/uniprot/Q63270
Synpcc7942 0903 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [Synechococcus elongatus PCC 7942] - Gene -...Synpcc7942 0903 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [Synechococcus elongatus PCC 7942] - Gene -...
bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase. Locus tag. Synpcc7942_0903. Gene type. protein coding. ... bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase. YP_399920.1. *EC 4.2.1.3 ... Synpcc7942_0903 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [ Synechococcus elongatus PCC 7942 ] Gene ID ... YP_399920.1 bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase [Synechococcus elongatus PCC 7942] ...
https://www.ncbi.nlm.nih.gov/gene/3774081
DI49 2832 - Aconitate hydratase, mitochondrial - Saccharomyces eubayanus (Yeast) - DI49 2832 gene & proteinDI49 2832 - Aconitate hydratase, mitochondrial - Saccharomyces eubayanus (Yeast) - DI49 2832 gene & protein
Aconitate hydratase, mitochondrialUniRule annotation. ,p>Information which has been generated by the UniProtKB automatic ... tr,A0A0L8RGC2,A0A0L8RGC2_SACEU Aconitate hydratase, mitochondrial OS=Saccharomyces eubayanus GN=DI49_2832 PE=3 SV=1 ...
http://www.uniprot.org/uniprot/A0A0L8RGC2
Fluoride Action Network | Aconitate hydratase activity and citrate content of heart and kidney in fluoride affected cows.Fluoride Action Network | Aconitate hydratase activity and citrate content of heart and kidney in fluoride affected cows.
Aconitate hydratase activity and citrate content of heart and kidney in fluoride affected cows.. Author: Miller GW, Egyed MN, ... Aconitate hydratase activity in heart tissue showed an increase of about 25% in the heart tissue and a decrease of about 52% in ... cross bred beef cows suffering from chronic fluoride toxicosis were analyzed for citric acid content and aconitate hydratase ( ...
https://fluoridealert.org/studytracker/18924/
AID 558447 - Upregulation of Putative mitochondrial aconitate hydratase expression in Candida albicans SC5314 at 40 uM after 24...AID 558447 - Upregulation of Putative mitochondrial aconitate hydratase expression in Candida albicans SC5314 at 40 uM after 24...
Upregulation of Putative mitochondrial aconitate hydratase expression in Candida albicans SC5314 at 40 uM after 24 hrs by MALDI ...
https://pubchem.ncbi.nlm.nih.gov/bioassay/558447
T3DB: Aconitate hydratase, mitochondrialT3DB: Aconitate hydratase, mitochondrial
lcl,BSEQ0013152,Aconitate hydratase, mitochondrial (ACO2) ATGGCGCCCTACAGCCTACTGGTGACTCGGCTGCAGAAAGCTCTGGGTGTGCGGCAGTAC ...
http://www.t3db.ca/biodb/polypeptides/Q99798
Aconitate hydratase | Article about Aconitate hydratase by The Free DictionaryAconitate hydratase | Article about Aconitate hydratase by The Free Dictionary
Find out information about Aconitate hydratase. An enzyme involved in the Krebs citric acid cycle that catalyzes the breakdown ... Aconitate hydratase, mitochondrial/ 51 Acromyrmex echinatior gi,332018721 (Formicidae) 52 Aconitate hydratase, gi,332018721 ... Aconitate hydratase , Article about Aconitate hydratase by The Free Dictionary https://encyclopedia2.thefreedictionary.com/ ... redirected from Aconitate hydratase). Also found in: Medical. aconitase. [ə′kän·ə‚tās] (biochemistry) An enzyme involved in the ...
https://encyclopedia2.thefreedictionary.com/Aconitate+hydratase
Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism | PNASConstruction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism | PNAS
... aconitate hydratase; acs, acetyl-CoA synthase; 13BPG, 1,3-bisphosphoglycerate; Cra, catabolite repressor activator; CreBC, a ...
http://www.pnas.org/content/115/14/3538
Plants | Free Full-Text | Differential Expression Proteins Contribute to Race-Specific Resistant Ability in Rice (Oryza sativa...Plants | Free Full-Text | Differential Expression Proteins Contribute to Race-Specific Resistant Ability in Rice (Oryza sativa...
Putative aconitate hydratase. 98.6. 5.67. 18. 22. 15. gi,115439655. NADP-dependent malic enzyme. 65.6. 8.59. 9. 23. ...
https://www.mdpi.com/2223-7747/8/2/29/htm
Effect of melaxen and valdoxan on free radical processes intensity, aconitate hydratase activity and citrate content in rats...Effect of melaxen and valdoxan on free radical processes intensity, aconitate hydratase activity and citrate content in rats...
Aconitate hydratase activity and citrate concentration in rats liver and heart, growing at pathological conditions, changed ... Effect of melaxen and valdoxan on free radical processes intensity, aconitate hydratase activity and citrate content in rats ... Abstract: The influence of melaxen and valdoxan on the biochemiluminescence parameters, aconitate hydratase activity and ... aconitate hydratase activity and citrate content in rats tissues under hyperthyroidism, Biomeditsinskaya khimiya, 2014, vol: 60 ...
http://pbmc.ibmc.msk.ru/index.php/en/article/PBMC-2014-60-4-462-en
Evidence of oxidative damage and inflammation associated with low glutathione redox status in the autism brainEvidence of oxidative damage and inflammation associated with low glutathione redox status in the autism brain
Aconitate Hydratase * Glutathione Grant support * R01 HD051873/HD/NICHD NIH HHS/United States ...
https://pubmed.ncbi.nlm.nih.gov/22781167/
The Effects of Artificial Selection on the Maize Genome | ScienceThe Effects of Artificial Selection on the Maize Genome | Science
Aconitate hydratase Aconitate hydratase activity 22 AY107173 0.40 Unknown 23 AY103840 0.39 Ubiquitin/transferase family protein ...
https://science.sciencemag.org/content/308/5726/1310?ijkey=12b3f69d34bfaa1f7859c271cb0405ec7143516e&keytype2=tf_ipsecsha
Plus itPlus it
mitochondrial aconitate hydratase. PNGase F. peptide-N-glycosidase F. PLA1. phospholipase A1. PED-A1. phospholipase A1 ... In contrast, mitochondrial aconitate hydratase (aconitase; ACO2), a TCA cycle enzyme, was the only protein to show an increase ...
https://www.mcponline.org/content/19/11/1860
Preventing the ubiquitin-proteasome-dependent degradation of frataxin, the protein defective in Friedreichs ataxiaPreventing the ubiquitin-proteasome-dependent degradation of frataxin, the protein defective in Friedreich's ataxia
Aconitate Hydratase / genetics * Aconitate Hydratase / metabolism * Adenosine Triphosphate / genetics * Adenosine Triphosphate ...
https://pubmed.ncbi.nlm.nih.gov/21216878/
Aconitase - WikipediaAconitase - Wikipedia
Aconitase (aconitate hydratase; EC 4.2.1.3) is an enzyme that catalyses the stereo-specific isomerization of citrate to ... One theory is that, in the rate-limiting step of the mechanism, the cis-aconitate is released from the enzyme, then reattached ... Another hypothesis is that cis-aconitate stays bound to the enzyme while it flips from the citrate to the isocitrate mode. In ... PDB: 1ACO​; Lauble, H; Kennedy, MC; Beinert, H; Stout, CD (1994). "Crystal Structures of Aconitase with Trans-aconitate and ...
https://en.wikipedia.org/wiki/Aconitase
Frontiers | Novel, Deep-Branching Heterotrophic Bacterial Populations Recovered from Thermal Spring Metagenomes | MicrobiologyFrontiers | Novel, Deep-Branching Heterotrophic Bacterial Populations Recovered from Thermal Spring Metagenomes | Microbiology
... aconitate hydratase; icd, isocitrate dehydrogenase; kor, 2-oxoglutarate:ferredoxin oxidoreductase; suc, succinyl-CoA synthetase ...
https://www.frontiersin.org/articles/10.3389/fmicb.2016.00304/full
Frontiers | Proteomics, metabolomics, and ionomics perspectives of salinity tolerance in halophytes | Plant ScienceFrontiers | Proteomics, metabolomics, and ionomics perspectives of salinity tolerance in halophytes | Plant Science
... aconitate hydratase; AKG, alpha-ketoglutarate; APX, ascorbate peroxidase; CAB, chlorophyll a/b binding protein; CAT, Catalase; ... It has been reported in Aeluropus lagopoides that expression levels of CIT, aconitate, 2-oxoglutarate, SUC and fumarate ...
https://www.frontiersin.org/articles/10.3389/fpls.2015.00537/full
TIGR01342TIGR01342
GO:0003994: aconitate hydratase activity molecular_function. GO:0006099: tricarboxylic acid cycle biological_process. ...
http://www.jcvi.org/cgi-bin/tigrfams/HmmReportPage.cgi?acc=TIGR01342
KEGG PATHWAY: glo00630KEGG PATHWAY: glo00630
aconitate hydratase 2 [KO:K01682] [EC:4.2.1.99 4.2.1.3]. Glov_3258 ... Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria. ...
http://www.genome.jp/dbget-bin/www_bget?pathway+glo00630
Recombinant Anti-Aconitase 2 antibody [EPR8283(B)] (Alexa Fluor® 488) (ab197879)Recombinant Anti-Aconitase 2 antibody [EPR8283(B)] (Alexa Fluor® 488) (ab197879)
Aconitate hydratase antibody. *Aconitate hydratase mitochondrial antibody. *ACONM antibody. *Citrate hydro lyase antibody ...
https://www.abcam.com/aconitase-2-antibody-epr8283b-alexa-fluor-488-ab197879.html
Anti-Aconitase 2 antibody (ab83528) | AbcamAnti-Aconitase 2 antibody (ab83528) | Abcam
Aconitate hydratase antibody. *Aconitate hydratase mitochondrial antibody. *ACONM antibody. *Citrate hydro lyase antibody ...
http://www.abcam.com/aconitase-2-antibody-ab83528.html
KEGG PATHWAY: adk00630KEGG PATHWAY: adk00630
aconitate hydratase 2 [KO:K01682] [EC:4.2.1.99 4.2.1.3]. Alide2_2374 ... Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria. ...
http://www.genome.jp/dbget-bin/www_bget?pathway+adk00630
ACO2 Gene - GeneCards | ACON Protein | ACON AntibodyACO2 Gene - GeneCards | ACON Protein | ACON Antibody
Gene Ontology (GO) annotations related to this gene include iron ion binding and aconitate hydratase activity. ... cDNA FLJ60429, highly similar to Aconitate hydratase, mitochondrial (EC 4.2.1.3) (B4DEC3_HUMAN) ... cDNA FLJ50886, highly similar to Aconitate hydratase, mitochondrial(EC 4.2.1.3) (B4DW08_HUMAN) ... It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA ...
https://www.genecards.org/cgi-bin/carddisp.pl?gene=ACO2
IJMS | Free Full-Text | Developmental Stage- and Genotype-Dependent Regulation of Specialized Metabolite Accumulation in Fruit...IJMS | Free Full-Text | Developmental Stage- and Genotype-Dependent Regulation of Specialized Metabolite Accumulation in Fruit...
Terol, J.; Soler, G.; Talon, M.; Cercos, M. The aconitate hydratase family from Citrus. BMC Plant Biol. 2010, 10, 222. [Google ...
https://www.mdpi.com/1422-0067/20/5/1245/htm
A large-scale analysis of mRNAs expressed by primary mesenchyme cells of the sea urchin embryo | DevelopmentA large-scale analysis of mRNAs expressed by primary mesenchyme cells of the sea urchin embryo | Development
Aconitate hydratase. Acyl-CoA dehydrogenase, long chain. Acyl-CoA oxidase, subunit II ...
https://dev.biologists.org/content/128/13/2615?ijkey=4ef58830b2f824718efb57974f9efdbad0ec700a&keytype2=tf_ipsecsha
Impact of Dietary Resistant Starch on the Human Gut Microbiome, Metaproteome, and Metabolome | mBioImpact of Dietary Resistant Starch on the Human Gut Microbiome, Metaproteome, and Metabolome | mBio
... aconitate hydratase; 12 and 13, isocitrate dehydrogenase; 14, 2-ketoglutarate ferredoxin oxidoreductase; 15, succinyl-CoA ... hydratase (LRS versus baseline, P , 0.0001; LRS versus HRS, P , 0.003). A targeted quantification of butyrate in the samples ... enoyl-CoA hydratase; 7, enoyl-(acyl carrier protein) reductase (NADH); 8, acetate CoA-transferase; 9, butyrate kinase; 10, ... synthetase; 16, succinate dehydrogenase/fumarate reductase; 17, fumarate hydratase; 18, malate dehydrogenase; 19, human enzymes ...
https://mbio.asm.org/content/8/5/e01343-17
Isocitric Acid - DrugBankIsocitric Acid - DrugBank
UAconitate hydratase, mitochondrial. Not Available. Human. UIsocitrate dehydrogenase [NADP], mitochondrial. Not Available. ... Catalyzes the isomerization of citrate to isocitrate via cis-aconitate.. Gene Name. ACO2. Uniprot ID. Q99798. Uniprot Name. ...
https://www.drugbank.ca/drugs/DB01727
Integrating transcriptomics and metabolomics to characterise the response of Astragalus membranaceus Bge. var. mongolicus (Bge....Integrating transcriptomics and metabolomics to characterise the response of Astragalus membranaceus Bge. var. mongolicus (Bge....
In the TCA cycle pathway, genes encoding aconitate hydratase were up-regulated during the three phases of drought stress. Genes ... whereas the genes encoding fumarate hydratase were down-regulated. These changes in gene expression may have increased the ...
https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-016-2554-0
Metabolic Trade-offs in Yeast are Caused by F1F0-ATP synthase | Scientific ReportsMetabolic Trade-offs in Yeast are Caused by F1F0-ATP synthase | Scientific Reports
4a). Aconitate hydratase (ACO) was also strongly unpredicted, possibly because the backwards reaction is thermodynamically ...
https://www.nature.com/articles/srep22264?error=cookies_not_supported&code=7d209a2a-9f75-4b47-8bef-d15cc69b19ac
σ54-Dependent Response to Nitrogen Limitation and Virulence in Burkholderia cenocepacia Strain H111 | Applied and Environmental...σ54-Dependent Response to Nitrogen Limitation and Virulence in Burkholderia cenocepacia Strain H111 | Applied and Environmental...
Aconitate hydratase (EC 4.2.1.3). acnB. 16.7. 1. I35_6014. BCAM2132. 2-Aminomuconate semialdehyde dehydrogenase. nbaE. 21.2. ND ...
https://aem.asm.org/content/81/12/4077/figures-only
AconitaseHydro-lyaseMitochondrial aconitate hydrataseIsocitrateMalate dehydrogenaseEnzymeFumarate hydrataseGeneSulfur clusterConversion of citrateActivityProteinHydrationIntermediateExpression
Aconitase2
  • To improve the reliability of forming the cis -aconitate intermediate, the aconitase genes from Aspergillus terreus have been cloned into the pTrc99a vector. (rice.edu)
  • ACO2(aconitate hydratase, mitochondrial) is also named as citrate hydro-lyase and belongs to the aconitase/IPM isomerase family. (ptglab.com)
Hydro-lyase1
  • Heart and kidney tissues from Holstein, Hereford and cross bred beef cows suffering from chronic fluoride toxicosis were analyzed for citric acid content and aconitate hydratase (citrate (isocitrate) hydro-lyase, EC 4.2.1.3) activity and the results were compared with those obtained with tissues from healthy cattle. (fluoridealert.org)
Mitochondrial aconitate hydratase1
  • Medvedeva L.V., Popova T.N., Artyukhov V.G., Matasova L.V. Catalytic and regulatory properties of cytoplasmic and mitochondrial aconitate hydratase of rat cardiomyocytes // Izvestiya RAN. (vsu.ru)
Isocitrate8
  • Catalyzes the isomerization of citrate to isocitrate via cis-aconitate. (uniprot.org)
  • SXSM-enhanced TCA cycle due to increased aconitate hydratase , succinyl-CoA ligase (GDP-forming) subunit alpha and beta (SUCLG1/2) and succinyl-CoA ligase (ADP-forming) subunit beta (SUCLGA2), isocitrate dehydrogenase2, and dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex (DLAT, PDHB). (thefreedictionary.com)
  • EC 4.2.1.3) is an enzyme that catalyses the stereo-specific isomerization of citrate to isocitrate via cis-aconitate in the tricarboxylic acid cycle, a non-redox-active process. (wikipedia.org)
  • One theory is that, in the rate-limiting step of the mechanism, the cis-aconitate is released from the enzyme, then reattached in the isocitrate mode to complete the reaction. (wikipedia.org)
  • Another hypothesis is that cis-aconitate stays bound to the enzyme while it flips from the citrate to the isocitrate mode. (wikipedia.org)
  • To complete the reaction, the serine and histidine residues reverse their original catalytic actions: the histidine, now basic, abstracts a proton from water, priming it as a nucleophile to attack at C2, and the protonated serine is deprotonated by the cis-aconitate double bond to complete the hydration, producing isocitrate. (wikipedia.org)
  • It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. (genecards.org)
  • Medvedeva L.V., Popova T.N., Artyukhov V.G., Matasova L.V., Akatova R.V. Oxidative status and distribution of the activity of NADP-isocitrate dehydrogenase and aconitate hydratase in cardiomyocytes of rats at normal conditions and ischemia // // Bull. (vsu.ru)
Malate dehydrogenase1
  • In parotid, the proteins ATP synthase subunit alpha (F1LP05) and ATP synthase subunit beta, mitocondrial (P10719), were downregulated and malate dehydrogenase, cytoplasmic (O88989), and aconitate hydratase (G3V6S2) were unique in the control group. (thefreedictionary.com)
Enzyme2
  • Mesaconyl-coenzyme A hydratase, a new enzyme of two central carbon metabolic pathways in bacteria. (genome.jp)
  • Engineering Escherichia coli can provide a reliable route for IA production, where cis -aconitate decarboxylase (CAD) is one essential enzyme in the process. (rice.edu)
Fumarate hydratase1
  • Fumarate hydratase and succinate dehydrogenase were shown to play a role in tumorigenesis ( 16 - 18 ). (mcponline.org)
Gene1
  • Gene Ontology (GO) annotations related to this gene include iron ion binding and aconitate hydratase activity . (genecards.org)
Sulfur cluster1
  • Predicted to have 4 iron, 4 sulfur cluster binding activity and aconitate hydratase activity. (zfin.org)
Conversion of citrate1
  • Generally, fluoroacetates are toxic because they are converted to fluorocitrate from fluoroacetyl coenzyme A. Fluorocitrate can inhibit aconitate hydratase, which is needed for the conversion of citrate, by competitive inhibition. (wikipedia.org)
Activity5
  • Aconitate hydratase activity and citrate content of heart and kidney in fluoride affected cows. (fluoridealert.org)
  • Aconitate hydratase activity in heart tissue showed an increase of about 25% in the heart tissue and a decrease of about 52% in the kidneys. (fluoridealert.org)
  • The influence of melaxen and valdoxan on the biochemiluminescence parameters, aconitate hydratase activity and citrate level in rats heart and liver during development of experimental hyperthyroidism has been investigated. (msk.ru)
  • Aconitate hydratase activity and citrate concentration in rats liver and heart, growing at pathological conditions, changed towards control value after administration of the drugs correcting melatonin level. (msk.ru)
  • Its RNA binding ability and its aconitate hydrolase activity are dependent upon availability of IRON. (umassmed.edu)
Protein1
  • A multifunctional iron-sulfur protein that is both an iron regulatory protein and cytoplasmic form of aconitate hydratase. (umassmed.edu)
Hydration1
  • In either case, flipping cis-aconitate allows the dehydration and hydration steps to occur on opposite faces of the intermediate. (wikipedia.org)
Intermediate1
  • His-101 protonates the hydroxyl group on C3 of citrate, allowing it to leave as water, and Ser-642 concurrently abstracts the proton on C2, forming a double bond between C2 and C3, forming a cis-aconitate intermediate. (wikipedia.org)
Expression1
  • The expression of aconitate hydratase leads to a peak at 10.3 min in the HPLC spectra after 4 hours incubation. (rice.edu)
Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism | PNAS
Construction and evolution of an Escherichia coli strain relying on nonoxidative glycolysis for sugar catabolism | PNAS (pnas.org)
Plants | Free Full-Text | Differential Expression Proteins Contribute to Race-Specific Resistant Ability in Rice (Oryza sativa...
Plants | Free Full-Text | Differential Expression Proteins Contribute to Race-Specific Resistant Ability in Rice (Oryza sativa... (mdpi.com)
KEGG PATHWAY: glo00630
KEGG PATHWAY: glo00630 (genome.jp)
Recombinant Anti-Aconitase 2 antibody [EPR8283(B)] (Alexa Fluor® 488) (ab197879)
Recombinant Anti-Aconitase 2 antibody [EPR8283(B)] (Alexa Fluor® 488) (ab197879) (abcam.com)
Anti-Aconitase 2 antibody (ab83528) | Abcam
Anti-Aconitase 2 antibody (ab83528) | Abcam (abcam.com)
IJMS | Free Full-Text | Developmental Stage- and Genotype-Dependent Regulation of Specialized Metabolite Accumulation in Fruit...
IJMS | Free Full-Text | Developmental Stage- and Genotype-Dependent Regulation of Specialized Metabolite Accumulation in Fruit... (mdpi.com)
Frontiers | Dimming the Powerhouse: Mitochondrial Dysfunction in the Liver and Skeletal Muscle of Intrauterine Growth...
Frontiers | Dimming the Powerhouse: Mitochondrial Dysfunction in the Liver and Skeletal Muscle of Intrauterine Growth... (frontiersin.org)
A large-scale analysis of mRNAs expressed by primary mesenchyme cells of the sea urchin embryo | Development
A large-scale analysis of mRNAs expressed by primary mesenchyme cells of the sea urchin embryo | Development (dev.biologists.org)
Impact of Dietary Resistant Starch on the Human Gut Microbiome, Metaproteome, and Metabolome | mBio
Impact of Dietary Resistant Starch on the Human Gut Microbiome, Metaproteome, and Metabolome | mBio (mbio.asm.org)
Integrating transcriptomics and metabolomics to characterise the response of Astragalus membranaceus Bge. var. mongolicus (Bge....
Integrating transcriptomics and metabolomics to characterise the response of Astragalus membranaceus Bge. var. mongolicus (Bge.... (bmcgenomics.biomedcentral.com)
Metabolic Trade-offs in Yeast are Caused by F1F0-ATP synthase | Scientific Reports
Metabolic Trade-offs in Yeast are Caused by F1F0-ATP synthase | Scientific Reports (nature.com)
Σ54-Dependent Response to Nitrogen Limitation and Virulence in Burkholderia cenocepacia Strain H111 | Applied and Environmental...
Σ54-Dependent Response to Nitrogen Limitation and Virulence in Burkholderia cenocepacia Strain H111 | Applied and Environmental... (aem.asm.org)
Php4 Is a Key Player for Iron Economy in Meiotic and Sporulating Cells | G3: Genes | Genomes | Genetics
Php4 Is a Key Player for Iron Economy in Meiotic and Sporulating Cells | G3: Genes | Genomes | Genetics (g3journal.org)
Pierre Rustin's Research on Cytochrome-c Oxidase Deficiency | CureHunter
Pierre Rustin's Research on Cytochrome-c Oxidase Deficiency | CureHunter (curehunter.com)
Anti-Aconitase 1 Primary Antibodies
Anti-Aconitase 1 Primary Antibodies (antibodies-online.com)
Autoantibody signatures defined by serological proteome analysis in sera from patients with cholangiocarcinoma | Journal of...
Autoantibody signatures defined by serological proteome analysis in sera from patients with cholangiocarcinoma | Journal of... (translational-medicine.biomedcentral.com)
Transcript profiles uncover temporal and stress-induced changes of metabolic pathways in germinating sugar beet seeds | BMC...
Transcript profiles uncover temporal and stress-induced changes of metabolic pathways in germinating sugar beet seeds | BMC... (bmcplantbiol.biomedcentral.com)
The SAV1322 gene from Staphylococcus aureus: genomic and proteomic approaches to identification and characterization of gene...
The SAV1322 gene from Staphylococcus aureus: genomic and proteomic approaches to identification and characterization of gene... (bmcmicrobiol.biomedcentral.com)
Frontiers | Comprehensive Flux Modeling of Chlamydia trachomatis Proteome and qRT-PCR Data Indicate Biphasic Metabolic...
Frontiers | Comprehensive Flux Modeling of Chlamydia trachomatis Proteome and qRT-PCR Data Indicate Biphasic Metabolic... (frontiersin.org)
Cranberry proanthocyanidins have anti-biofilm properties against Pseudomonas aeruginosa | BMC Complementary and Alternative...
Cranberry proanthocyanidins have anti-biofilm properties against Pseudomonas aeruginosa | BMC Complementary and Alternative... (bmccomplementalternmed.biomedcentral.com)
Frontiers | Neuroproteomics and Systems Biology Approach to Identify Temporal Biomarker Changes Post Experimental Traumatic...
Frontiers | Neuroproteomics and Systems Biology Approach to Identify Temporal Biomarker Changes Post Experimental Traumatic... (frontiersin.org)
Iron Regulatory Protein 2 | Profiles RNS
Iron Regulatory Protein 2 | Profiles RNS (profiles.umassmed.edu)
Cross-Species Hybridization with Fusarium verticillioides Microarrays Reveals New Insights into Fusarium fujikuroi Nitrogen...
Cross-Species Hybridization with Fusarium verticillioides Microarrays Reveals New Insights into Fusarium fujikuroi Nitrogen... (ec.asm.org)
ACO2 polyclonal antibody - (PAB29305) - Products - Abnova
ACO2 polyclonal antibody - (PAB29305) - Products - Abnova (abnova.com)
Recombinant Human ACO1 cell lysate ACO1-510HCL - Creative BioMart
Recombinant Human ACO1 cell lysate ACO1-510HCL - Creative BioMart (creativebiomart.net)
Frontiers | Urine Organic Acids as Potential Biomarkers for Autism-Spectrum Disorder in Chinese Children | Cellular Neuroscience
Frontiers | Urine Organic Acids as Potential Biomarkers for Autism-Spectrum Disorder in Chinese Children | Cellular Neuroscience (frontiersin.org)
TCA cycle
TCA cycle (enzyme-database.org)
Interrupted coding sequences in Mycobacterium smegmatis : authentic mutations or sequencing errors? | Genome Biology | Full Text
Interrupted coding sequences in Mycobacterium smegmatis : authentic mutations or sequencing errors? | Genome Biology | Full Text (genomebiology.biomedcentral.com)