... flanking region". Journal of Biological Chemistry. 260 (8): 5055-60. doi:10.1016/S0021-9258(18)89178-5. PMID 2580830. Ruoslahti ... 7 (5): 267-9. doi:10.1055/s-2008-1071168. PMID 9402482. Lee PI, Chang MH, Chen DS, Lee CY (January 1989). "Serum alpha- ... The normal range of AFP for adults and children is variously reported as under 50, under 10, or under 5 ng/mL. At birth, normal ... 26 (5): 1332-43. doi:10.1021/bi00379a020. PMID 2436661. Sakai M, Morinaga T, Urano Y, et al. (1985). "The human alpha- ...
... flanking region of human MRP3". Biochem. Biophys. Res. Commun. 270 (3): 728-32. doi:10.1006/bbrc.2000.2507. PMID 10772892. Nies ... flanking region, genomic organization and alternative splice variants". Biochim. Biophys. Acta. 1415 (2): 369-74. doi:10.1016/ ... 5 (2): R8. doi:10.1186/gb-2004-5-2-r8. PMC 395752. PMID 14759258. Lang T, Hitzl M, Burk O, Mornhinweg E, Keil A, Kerb R, Klein ... 290 (5): 1427-33. doi:10.1006/bbrc.2002.6367. PMID 11820781. Scheffer GL, Kool M, de Haas M, de Vree JM, Pijnenborg AC, Bosman ...
... flanking region and active promoter". The Journal of Biological Chemistry. 263 (32): 16992-8. doi:10.1016/S0021-9258(18)37488-X ... "Two regions in human DNA polymerase beta mRNA suppress translation in Escherichia coli". Nucleic Acids Research. 20 (18): 4859- ... 93 (5): 507-12. doi:10.1007/bf00202813. PMID 8168825. S2CID 34824853. Chyan YJ, Strauss PR, Wood TG, Wilson SH (August 1996). " ... 243 (5408): 441-5. Bibcode:1973Natur.243..441O. doi:10.1038/243441a0. PMID 4591306. S2CID 4153800. Cabelof DC, Raffoul JJ, ...
... flanking region by deletion/substitution". J. Biol. Chem. 263 (24): 12020-7. doi:10.1016/S0021-9258(18)37887-6. PMID 3042787. ... untranslated region contains multiple copies of an Alu family repeat. In addition, this gene is polymorphic and three common ... "Complex arrangement of genes within a 220-kb region of double-duplicated DNA on human 2q37.1". Genomics. 73 (1): 50-5. doi: ... 261 (7): 3112-5. doi:10.1016/S0021-9258(17)35755-1. PMID 3512548. Ezra E, Blacher R, Udenfriend S (1984). "Purification and ...
... flanking region element responsible for the low level constitutive expression of the human cytosolic phospholipase A2 gene". ... flanking region surrounding a human cytosolic phospholipase A2 gene". Biochemical and Biophysical Research Communications. 205 ... 19 (4-5): 683-688. PMID 9745929. Hirabayashi T, Murayama T, Shimizu T (2005). "Regulatory mechanism and physiological role of ... 58 (5-6): 328-333. doi:10.1080/15216540600702289. PMID 16754327. S2CID 36287675. Sharp JD, White DL, Chiou XG, et al. (1991). " ...
... flanking region". J. Biol. Chem. 269 (7): 5279-87. doi:10.1016/S0021-9258(17)37685-8. PMID 8106512. Harada H, Kitagawa M, ... 40 (5): 976-82. PMID 10102295. Whitney LW, Becker KG, Tresser NJ, Caballero-Ramos CI, Munson PJ, Prabhu VV, Trent JM, McFarland ... 35 (5-6): 507-11. doi:10.1080/10428199909169615. PMID 10609788. Staal A, Enserink JM, Stein JL, Stein GS, van Wijnen AJ (2000 ... Intron-exon organization and functional analysis of 5'- ...
... flanking region of the human PTK6 gene". Biochim. Biophys. Acta. 1574 (3): 365-9. doi:10.1016/s0167-4781(02)00234-8. PMID ... 5 (7): 1767-77. PMID 10430081. Derry JJ, Richard S, Valderrama Carvajal H, et al. (2000). "Sik (BRK) Phosphorylates Sam68 in ... Kang KN, Kim M, Pae KM, Lee ST (2002). "Characterization of the 5'- ...
... flanking region of human aggrecanase-1 (ADAMTS4) gene". Molecular Biology Reports. 27 (3): 167-73. doi:10.1023/A:1007253930568 ... Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region that stacks against the active-site of the ... Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a ... 5 (3): 169-76. doi:10.1093/dnares/5.3.169. PMID 9734811. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, ...
... flanking region". The Journal of Biological Chemistry. 262 (28): 13662-13673. doi:10.1016/S0021-9258(19)76478-3. PMID 2888762. ... flanking region". The Journal of Biological Chemistry. 262 (28): 13662-13673. doi:10.1016/S0021-9258(19)76478-3. PMID 2888762. ... and a proline-rich region, and its light chain contains the protease domain. The structure of the FnI-EGF-like tandem domain of ... 2 (5): 549-558. doi:10.1182/bloodadvances.2018016337. PMC 5851424. PMID 29519898. Pathak M, Wilmann P, Awford J, Li C, Hamad BK ...
... flanking region of the human beta-glucuronidase gene". Genomics. 10 (4): 1009-18. doi:10.1016/0888-7543(91)90192-H. PMID ... Marathe SV, McEwen JE (February 1995). "Vectors with the gus reporter gene for identifying and quantitating promoter regions in ... 274 (33): 23451-5. doi:10.1074/jbc.274.33.23451. PMID 10438523. Wong AW, He S, Grubb JH, Sly WS, Withers SG (December 1998). " ... 2 (6): 443-5. doi:10.1002/humu.1380020604. PMID 8111412. S2CID 46432543. Wu BM, Sly WS (1994). "Mutational studies in a patient ...
... flanking regulatory region". Gene. 294 (1-2): 259-68. doi:10.1016/S0378-1119(02)00798-9. PMID 12234688. Tiffin N, Williams RD, ... "The genomic organization and the full coding region of the human PAX7 gene". Genomics. 45 (1): 168-74. doi:10.1006/geno. ... 5 (1): 15-21. doi:10.1093/hmg/5.1.15. PMID 8789435. Vorobyov E, Mertsalov I, Dockhorn-Dworniczak B, Dworniczak B, Horst J ( ... "Structural and functional characterization of the human PAX7 5'- ...
... flanking regulatory region of the murine serotonin transporter". Brain Research. Molecular Brain Research. 44 (2): 286-92. doi: ... 4 (5): 645. doi:10.1021/cn4001044. PMC 3656756. PMID 23862750. Alivisatos AP, Andrews AM, Boyden ES, Chun M, Church GM, ... Bengel D, Heils A, Petri S, Seemann M, Glatz K, Andrews A, Murphy DL, Lesch KP (March 1997). "Gene structure and 5'- ...
... flanking region of human genomic ETA gene". Biochemical and Biophysical Research Communications. 190 (2): 332-9. doi:10.1006/ ... 56 Suppl 5: 1303-7. doi:10.1253/jcj.56.supplementv_1303. PMID 1291713. Hosoda K, Nakao K, Tamura N, Arai H, Ogawa Y, Suga S, ... Yang H, Tabuchi H, Furuichi Y, Miyamoto C (January 1993). "Molecular characterization of the 5'- ...
... flanking region, and chromosomal localization of the human RGS3 gene". Genomics. 45 (2): 429-33. doi:10.1006/geno.1997.4929. ... 2002). "RGS3 interacts with 14-3-3 via the N-terminal region distinct from the RGS (regulator of G-protein signalling) domain ... 36 (1): 40-5. doi:10.1038/ng1285. PMID 14702039. Humphray SJ, Oliver K, Hunt AR, et al. (2004). "DNA sequence and analysis of ... 2002). "Additional 5' exons in the RGS3 locus generate multiple mRNA transcripts, one of which accounts for the origin of human ...
... flanking region of the human estrogen receptor gene". DNA Sequence. 2 (6): 347-358. doi:10.3109/10425179209020816. PMID 1476547 ... genomic organization of the human ERalpha gene promoter region". Molecular Endocrinology. 15 (12): 2057-2063. doi:10.1210/mend. ... 70 (5-7): 361-363. doi:10.1016/j.steroids.2005.02.015. PMID 15862818. S2CID 54297122. Wang CL, Tang XY, Chen WQ, Su YX, Zhang ... 6 (5): 773-785. doi:10.1210/mend.6.5.1603086. PMID 1603086. S2CID 25208340. Keaveney M, Klug J, Dawson MT, Nestor PV, Neilan JG ...
... flanking region of the Pigr gene contains a response element to glucocorticoids. This class of hormones increases the steady ... Cleavage occurs at the junction of the transmembrane region of the receptor and domain 5. pIgRs are capable of capturing IgA ... The quite long intracellular domain of the receptor, along with the transmembrane region, is responsible for the transduction ... Evidence for the involvement of multiple complementarity determining region (CDR)-like loops in receptor domain I". The Journal ...
... flanking region and structural organization". Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1395 (1): 62 ... 42 (Database issue): D490-5. doi:10.1093/nar/gkt1178. PMC 3965031. PMID 24270786. "Glycoside Hydrolase Family 59". CAZypedia. ...
... flanking region of the gene". Genomics. 19 (1): 91-6. doi:10.1006/geno.1994.1017. PMID 8188248. Byrne JA, Smith PJ (1993). "The ... This gene may play a role in malignancies and disease that involve this region. This gene is oriented in a head-to-tail ... It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. ... Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, ...
... flanking region". Genomics. 19 (2): 369-72. doi:10.1006/geno.1994.1072. PMID 8188267. Sparkes RS, Lee RH, Shinohara T, et al. ( ... 2000). "A 6-Mb high-resolution physical and transcription map encompassing the hereditary prostate cancer 1 (HPC1) region". ... doi:10.1016/S0021-9258(18)43955-5. PMID 7961975. Abe T, Kikuchi T, Shinohara T (1994). "The sequence of the human phosducin ...
... flanking region of the coagulation factor VII gene". J. Thromb. Haemost. 1 (6): 1220-7. doi:10.1046/j.1538-7836.2003.00227.x. ... 113 (5): 877-86. doi:10.1242/jcs.113.5.877. PMID 10671377. Hartley JL, Temple GF, Brasch MA (2001). "DNA Cloning Using In Vitro ... 5 (12): 1301-10. doi:10.1091/mbc.5.12.1301. PMC 301159. PMID 7696711. Faulkner NE, Vig B, Echeverri CJ, et al. (1998). " ... U.S.A. 92 (5): 1634-8. Bibcode:1995PNAS...92.1634W. doi:10.1073/pnas.92.5.1634. PMC 42574. PMID 7878030. Garces JA, Clark IB, ...
... flanking region of the human corticotropin releasing hormone gene". DNA Sequence. 4 (3): 197-206. doi:10.3109/10425179309015632 ... "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Letters. 267 (1): 1-5. ... 2 (5): 775-779. doi:10.1002/j.1460-2075.1983.tb01499.x. PMC 555184. PMID 6605851. Behan DP, Heinrichs SC, Troncoso JC, Liu XJ, ... 5 (2): 137-141. doi:10.1038/sj.mp.4000720. PMID 10822340. Saeed B, Fawcett M, Self C (February 2001). "Corticotropin-releasing ...
... flanking region and structural organization". Biochim. Biophys. Acta. 1395 (1): 62-67. doi:10.1016/S0167-4781(97)00140-1. PMID ... region". Hum. Mutat. 28 (7): 742. doi:10.1002/humu.9500. PMID 17579360. S2CID 1705020. Beier UH; Görögh T (2005). "Implications ... 5 (9): e12862. doi:10.1371/journal.pone.0012862. PMC 2943476. PMID 20877624. GeneReviews/NCBI/NIH/UW entry on Krabbe disease ... 1998). "Human galactocerebrosidase gene: promoter analysis of the 5'- ...
... flanking region of the human follicle-stimulating hormone receptor gene". Molecular and Cellular Endocrinology. 102 (1-2): 93- ... Upon initial binding to the LRR region of FSHR, FSH reshapes its conformation to form a new pocket. FSHR then inserts its ... "Structural predictions for the ligand-binding region of glycoprotein hormone receptors and the nature of hormone-receptor ... 8 (5): 413-21. doi:10.1093/humupd/8.5.413. PMID 12398222. Delbaere A, Smits G, Olatunbosun O, Pierson R, Vassart G, Costagliola ...
... flanking region for the human topoisomerase III gene". The Journal of Biological Chemistry. 273 (40): 26130-7. doi:10.1074/jbc. ... "Genes in a refined Smith-Magenis syndrome critical deletion interval on chromosome 17p11.2 and the syntenic region of the mouse ... "Gene for topoisomerase III maps within the Smith-Magenis syndrome critical region: analysis of cell-cycle distribution and ... 12 (5): 713-28. doi:10.1101/gr.73702. PMC 186594. PMID 11997338. Wang Y, Lyu YL, Wang JC (Sep 2002). "Dual localization of ...
... flanking region of CYP3A5: comparative analysis with CYP3A4 and CYP3A7". Biochemical and Biophysical Research Communications. ... 4 (5): 247-59. doi:10.1097/00008571-199410000-00003. PMID 7894497. Lown KS, Kolars JC, Thummel KE, Barnett JL, Kunze KL, ... 6 (5): 379-85. doi:10.1097/00008571-199610000-00001. PMID 8946469. Anttila S, Hukkanen J, Hakkola J, Stjernvall T, Beaune P, ... doi:10.1016/S0021-9258(18)81632-5. PMID 2732228. Schuetz JD, Molowa DT, Guzelian PS (November 1989). "Characterization of a ...
... flanking region of the human GIP receptor (GIPR) gene". Endocr. Res. 28 (4): 577. doi:10.1081/ERC-120016843. PMID 12530665. ... 2003). "Analysis of the putative promoter region of the GIP receptor gene (GIPR) in GIP-dependent Cushing's syndrome (CS)". ... 53 (5): 1326-1335. doi:10.2337/diabetes.53.5.1326. PMID 15111503. Gerhard DS, Wagner L, Feingold EA, et al. (2004). "The status ... doi:10.1016/0167-0115(96)00019-5. PMID 8795084. S2CID 42462407. N'Diaye N, Tremblay J, Hamet P, et al. (1998). "Adrenocortical ...
... flanking region of the transforming growth factor alpha gene". Mol. Endocrinol. 5 (12): 1955-63. doi:10.1210/mend-5-12-1955. ... 2 (5): 355-358. doi:10.1038/sj.mp.4000307. PMID 9322223. Ferrer, I.; Alcantara, S.; Ballabriga, J.; Olive, M.; Blanco, R.; ... 33 (5): 628-31. doi:10.1136/gut.33.5.628. PMC 1379291. PMID 1612477. Bean MF, Carr SA (1992). "Characterization of disulfide ... TGF-α has also been observed to be highly expressed in the suprachiasmatic nucleus (SCN) (5). This finding suggests a role for ...
... flanking region gene contains a "CAAT" consensus promoter sequence but no "TATA" sequence. The transcription start site is an ... 85 (1): 41-5. Bibcode:1988PNAS...85...41K. doi:10.1073/pnas.85.1.41. PMC 279477. PMID 3422424. Koike K, Urata Y, Koike M (Aug ... 284 (5): E855-62. doi:10.1152/ajpendo.00526.2002. PMID 12676647. Suzuki Y, Yoshitomo-Nakagawa K, Maruyama K, Suyama A, Sugano S ... There was an Alu family found in introns 2 and 8. The 5' ... and characterization of a full length-enriched and a 5'-end- ...
... flanking region". Mol. Endocrinol. 3 (9): 1448-54. doi:10.1210/mend-3-9-1448. PMID 2608068. Loric S, Egloff M, Domingo M, et al ... The gene localizes to a chromosomal region containing several closely related serine protease inhibitors (serpins). Transcortin ... 97 (1): E151-5. doi:10.1210/jc.2011-2022. PMID 22013108. Rosen MI, Shnider SM, Levinson G, Hughes (2002). Shnider and ... 1997). "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library". Gene. 200 (1-2): 149- ...
... flanking region of the human MYPT1 gene". Biochim. Biophys. Acta. 1517 (3): 424-9. doi:10.1016/s0167-4781(00)00285-2. PMID ... doi:10.1007/3-540-64753-8_5. ISBN 978-3-540-64753-9. PMID 10087910. Ziter FA, Wiser WC, Robinson A (1977). "Three-generation ...
Again the archers were positioned on the flank of the men-at-arms, in this case the right.[115][116] The Black Prince took ... Instead the English army spread out and for six months devastated much of the region.[211] Both countries were finding it ... The right flank was under William, Earl of Salisbury, deputised by Robert, Earl of Suffolk, and Maurice, Baron Berkeley. ... There would be approximately 40 miles (64 km) between the flanking units, enabling them to devastate a band of French territory ...
The project was mapped near the Maya Biosphere Reserve in the Petén region of Guatemala.[134][135][136][137][138][139][140][141 ... The Great Plaza lies at the core of the site; it is flanked on the east and west sides by two great temple-pyramids. On the ... By the end of the Late Preclassic this pyramid was one of the largest structures in the Maya region.[98] It attained its final ... It is located in the archeological region of the Petén Basin in what is now northern Guatemala. Situated in the department of ...
... (/ˈsuːmər/) is the earliest known civilization in the historical region of southern Mesopotamia (south-central Iraq), ... Flanking the aisles would be rooms for the priests. At one end would stand the podium and a mudbrick table for animal and ... "Sumer (ancient region, Iraq)". Britannica Online Encyclopedia. Britannica.com. Retrieved 2012-03-29.. ... A prehistoric people who lived in the region before the Sumerians have been termed the "Proto-Euphrateans" or "Ubaidians",[28] ...
SH2 domains are structurally composed by three-stranded twisted beta sheet sandwiched flanked by two alpha-helices. The ... The most prevalent form of interaction is between the N-terminal regions of the interacting proteins. Dimer formation appears ... Interactions between intrinsically disordered protein regions to globular protein domains (i.e. MoRFs) are transient ... doi:10.1016/S0021-9258(19)85311-5. PMID 8349601.. *^ Hanukoglu I (2017). "Conservation of the Enzyme-Coenzyme Interfaces in FAD ...
in "Cold Regions Science and Technology, 2007". Archived from the original (PDF) on August 18, 2011. Retrieved September 6, ... Between 1850 and 1950, the Boulder Glacier on the southeast flank of Mount Baker retreated 8,700 feet (2,700 m). William Long ... In this region of the Cascades, winter snowpack has declined 25% since 1946, and summer temperatures have risen 0.7 °C (1.2 °F ... A large region of population surrounding the central and southern Andes of Argentina and Chile reside in arid areas that are ...
... including but not limited to the Atlas Mountain regions of Morocco, the Aurès and M'zab regions of Algeria, and southern ... However, due to the Berber revolt, the Umayyad governors were forced to protect their southern flank and were unable to mount ... The Maghreb region in northwestern Africa is believed to have been inhabited by Berbers from at least 10,000 BC.[50] Cave ... A further Arabization of the region was in large part due to the arrival of the Banu Hilal, a tribe sent by the Fatimids of ...
Ahermatypic corals are either colonial or solitary and are found in all regions of the ocean and do not build reefs. Some live ... Each of these plates is flanked by a pair of mesenteries.[5] ... 978-90-481-2638-5. .. *^ a b c d Veron, John Edward Norwood ( ... The overwhelming majority of scleractinian taxa are hermaphroditic in their adult colonies.[16] In temperate regions, the usual ... In tropical regions, reproduction may occur throughout the year. In many cases, as in the genus Acropora, the eggs and sperm ...
Hoffman informed them of his plans to shift part of the 8th Army south to attack the exposed left flank of the advancing ... sandy region near the Baltic coast. The cavalry's gains were held by Hindenburg's new Nieman army, named after the river. ... On 11 November, in a raging snowstorm, his forces surprised the Russian flank in the fierce Battle of Łódź, which ended the ... flanks before ultimately encircling and annihilating them.[18] On the eve of the ensuing battle, Hindenburg reportedly strolled ...
This variety of Persian Turkish must have been also spoken in the Caucasian and Transcaucasian regions, which during the 16th ... flanked at either side by all the prominent institutions of the city, such as the residences of all foreign dignitaries. And ... Furthermore, the Safavids maintained a sizeable sphere of influence overseas, particularly in the Deccan region of India. The ... A Study of the Migration of Shiʻi Works from Arab Regions to Iran at the Early Safavid Era. ...
The city is part of the Hamburg Metropolitan Region, and is the southwesternmost city on the Baltic, as well as the closest ... This shock surprised the French so much that they were invaded by their flank. They fled to the Fougeu place and were kicked ... The cathedral, finished around 1230, was the first large brickwork church in the Baltic region. St Mary's, finished in 1351, ... 5 Shared with Albania, Austria, Belgium, Bosnia and Herzegovina, Bulgaria, Croatia, Czech Republic, France, Italy, North ...
Instead, the gametes are released into the coelom until they find their way to the posterior end of the caudal region, whereby ... copious quantities of a milky and fibrous slime or mucus from about 100 glands or invaginations running along their flanks.[10] ... 5 (3): 1-8. Bibcode:2010BiBi....5c5002F. doi:10.1088/1748-3182/5/3/035002. PMID 20729569.. [permanent dead link] ... 446 (7136): 672-5. Bibcode:2007Natur.446..672O. doi:10.1038/nature05633. PMID 17377535. S2CID 4414164.. ...
The regions of higher friction along a fault plane, where it becomes locked, are called asperities. Stress builds up when a ... Normal fault and drag folds (eastern flanks of the Bighorn Mountains, Wyoming, USA) ... "Structural Geology of Rocks and Regions (2nd ed.). John Wiley & Sons. pp. 372-424. ISBN 0-471-52621-5. .. ... 978-0-19-965306-5. .. *^ Park, R.G. (2004). Foundation of Structural Geology (3 ed.). Routledge. p. 11. ISBN 978-0-7487-5802-9 ...
The Surya pada is flanked by the padas of Satya, the deity of Truth, on one side and Indra, the king of the demigods, on other ... In the Malaprabha river basin, South India, this period is credited with some of the earliest stone temples of the region: the ... The temple space is laid out in a series of courts (mandapas). The outermost regions may incorporate the negative and suffering ... When present, this outer region diffuse into the next inner layer that bridges as human space, followed by another inner Devika ...
The artistic carving in stone is in the form of identical pair of makaras flanked by two Nāgas (snake gods) along with a crown ... Makaras are also a characteristic motif of the religious Khmer architecture of the Angkor region of Cambodia which was the ... The intricate stone carving of twin makaras flanking the lower level of stairs with its bodies forming the stair's railings. ... often took place on the top of the entrance with makaras projected on either sides of kala's head flanking the portal or ...
One branch of the road leads to the Yeongnam region. The other branch leads to the Honam region. ... The city is flanked to the east by the Charyeong Mountains, and spills out over plains and rolling hills to the west. Some of ... In 1975 the city renamed 10 branch offices to 10 dongs, representing the major administrative regions of the city.[5] The city ... Including all of its administrative regions (see below), the city now covers a total area of 636.25 km2.[1] ...
... s bind to either enhancer or promoter regions of DNA adjacent to the genes that they regulate. Depending on ... Furthermore, genes are often flanked by several binding sites for distinct transcription factors, and efficient expression of ... They are ubiquitous and interact with the core promoter region surrounding the transcription start site(s) of all class II ... Other transcription factors differentially regulate the expression of various genes by binding to enhancer regions of DNA ...
Domesticated; Central Asia, including the historical region of Bactria. Dromedary / Arabian camel. Camelus dromedarius. ... Red-flanked duiker (C. rufilatus). *Red forest duiker (C. natalensis). *Ruwenzori duiker (C. rubidis) ... Bactrian camels were used by Romanian forces during World War II in the Caucasian region.[107] At the same period the Soviet ... The coincidence of this event with a major reorganization of the copper industry of the region-attributed to the results of the ...
Pinatubo is flanked on the west by the Zambales Ophiolite Complex, which is an easterly-dipping section of Eocene oceanic crust ... and left a caldera in the former summit region. Later dubbed Black Saturday, the day of darkness stretched for 36 hours. ... Huge pyroclastic flows roared down the flanks of Mount Pinatubo, filling once-deep valleys with fresh volcanic deposits as much ... "Two Years of Lahars on the Western Flank of Mount Pinatubo: Initiation, Flow Processes, Deposits, and Attendant Geomorphic and ...
Only the sternal and axillary regions of the body were rubbed with the mix of saliva and plant material. There was a lack of ... He rubs the side of his face, his chest, stomach, legs, and flanks, which all become caked with mud. During wallowing, the ... Retrieved 5 July 2013.. *^ Towsley, Bryce (13 August 2008). Big Bucks The Benoit Way: Secrets From America's First Family of ... Retrieved 5 July 2013.. *^ Beck, Benjamin B.; Wemmer, Christen M. (1983). The Biology and management of an extinct species: ...
For many individuals the interest with edge cities lies in what they can show about new trends across city regions. Tysons is a ... As recently as the 1950s, Tysons was a quiet rural intersection flanked by a few small stores, and a fruit stand operated by ... also one of the largest malls in the region) and Fairfax Square, which neighbor it to the north and south respectively. The ... Retrieved July 5, 2019.. *^ Hopko, Ashley. "County Officials Celebrate Finished Jones Branch Connector in Tysons". Tysons ...
Attitudes split by region: In texts from the Eastern Roman Empire, Pilate was portrayed as a positive figure. He and his wife ... is flanked by a life-sized sculpture of Christ and Pilate in the Ecce homo scene made in the nineteenth century by the Italian ... ˈpɒnʃəs ˈpaɪlət, -tiəs/ PON-shəs PY-lət, -⁠tee-əs[4][5][6] ... Syria's legate Lucius Aelius Lamia was absent from the region, something which Helen Bond believes may have presented ...
First undergraduate chapter chartered in South Atlantic Region Kappa Alpha Psi. Gamma Kappa (ΓΚ). November 23, 1948. Active. ... North Hall is the middle building, flanked by South Hall (left) and North Hall. South Hall was later demolished by Morris Brown ...
Statues of the regions[edit]. The staircase leading to the terrace of the redeemed cities is the best point of observation of ... and finally to the terraces of the two propylaea flanked by the portico constituting the two entrances.[12][3][8] ... with statues representing the regions of Italy. In front of stylobate, towards the equestrian statue of Victor Emmanuel II , ... Above the pediment of the colonnade you can see the statues of the Italian regions ...
... who returned to their cantons in order to defend their own region following the capture of the town of Chiavenna by Milanese ... whilst the remainder of the Imperial army moved from their camp to flank the brook that separated the two armies. Ahead of them ... 978-03133-3-312-5. .. *. Tarver, H. Micheal, ed. (2016). The Spanish Empire: A Historical Encyclopedia. Empires of the World. ... 978-18510-9-672-5. .. *. Urzainqui, Tomas (2013). La conquista de Navarra y la reforma europea (in Spanish). Navarra: Pamplona- ...
"Other movies shot in our region - who knew?!".. *^ "In Case You're Wondering What Hayao Miyazaki Is Up To..." Kotaku.com.au. 2 ... The figure is some 23 feet (7.0 m) tall and stands on a massive base incorporating a flight of steps flanked by four cannons ... protecting the northern flank of the mouth of the Tyne. It has a broad walkway on top, popular with Sunday strollers. On the ... 978-0-446-54606-5. .. *^ a b Knorr, Wilbur R. (2004). "Tynemouth, John of". Oxford Dictionary of National Biography (online ed ...
The stately goddess seated on a throne flanked by two lionesses was found in a grain bin, which Mellaart suggests might have ... Region. Anatolia. Coordinates. .mw-parser-output .geo-default,.mw-parser-output .geo-dms,.mw-parser-output .geo-dec{display: ... 978-0-226-31126-5. .. Page 420-422 *^ Maynes, Mary Jo; Waltner, Ann (2012). The Family: A World History. New York City: Oxford ... 9 (5): Appendix S1. Bibcode:2014PLoSO...995714G. doi:10.1371/journal.pone.0095714. ISSN 1932-6203. PMC 4012948. PMID 24806472. ...
Though heavily hunted in some regions, the undulated tinamou remains common in most parts of its range.[8][10] The IUCN ... and the remainders of its underparts are olive-grey to buff with dark vermiculation on its lower flanks and vent. Its bill is ... C. u. undulatus occurs in southeastern Peru, eastern and northern Bolivia, the Pantanal region in Brazil, Paraguay, and ... vermiculatus is in the Cerrado region).[3][10] Though generally considered resident, minor seasonal movements between habitats ...
These regions feature a semi-arid climate and are less extreme than regular deserts.[33] Like arid deserts, temperatures can ... The repeated fluctuations put a strain on exposed rock and the flanks of mountains crack and shatter. Fragmented strata slide ... A desert is a region of land that is very dry because it receives low amounts of precipitation (usually in the form of rain, ... 2008). The biology of polar regions. Oxford University Press. p. 64. ISBN 978-0-19-929813-6. .. ...
According to Alfred Thayer Mahan, "The immediate effect was to close a haven of privateers, which flanked the route of all ... While technology and defense are the largest employment sector in the region, seasonal tourism is a major economic engine of ... 5) 35. (2) 26. (−3) 11. (−12) −5. (−21) −9. (−23) Average precipitation inches (mm) 4.03. (102) 3.57. (91) 4.61. (117) 4.73. ( ... 5. (−15) −8. (−22) Average precipitation inches (mm) 3.21. (82) 2.81. (71) 4.57. (116) 3.81. (97) 3.03. (77) 3.41. (87) 2.93. ( ...
Its range may once have extended as far as western Venezuela, but it has long been extirpated from that region. It commonly ... especially on the underside and flanks, reaching 3.5 cm (1.4 in) or more in some individuals.[7] ... The fur becomes noticeably paler on the underside, around the anal region, and on the cheeks. A distinct white band runs around ... "La Pinchaque", an imaginary beast said to inhabit the same regions as the mountain tapir.[5] ...
... flanking region of the TWIST2 gene for the belted phenotype in cattle. Our functional data further support the hypothesis of a ... flanking region of the TWIST2 gene as most likely causative variant for the belted phenotype in cattle. The haplotype analysis ... flanking region of TWIST2. TWIST2 is a basic helix loop helix (bHLH) transcription factor with a postulated role in early ... flanking region of the TWIST2 gene affects melanocyte development in belted cattle. *Nivedita Awasthi Mishra, ...
... flanking region of androgen receptor gene. Methods in Neurosciences. 1995 Jan 1;26(C):324-336. doi: 10.1016/S1043-9471(06)80100 ... flanking region of the androgen receptor, we have used the PCR technique extensively to create mutations. The 5′ and 3′ end ... flanking region of the androgen receptor, we have used the PCR technique extensively to create mutations. The 5′ and 3′ end ... flanking region of the androgen receptor, we have used the PCR technique extensively to create mutations. The 5′ and 3′ end ...
... flanking region of the ornithine transcarbamylase gene contains DNA sequences regulating tissue-specific expression (English) ... flanking region of the ornithine transcarbamylase gene contains DNA sequences regulating tissue-specific expression.. ...
... flanking region in 1.5 kb size of human ACL showed 60% homology with those of rat; however, no homology was found in the exon 1 ... flanking region in 1.5 kb size of human ACL showed 60% homology with those of rat; however, no homology was found in the exon 1 ... flanking region in 1.5 kb size of human ACL showed 60% homology with those of rat; however, no homology was found in the exon 1 ... flanking region in 1.5 kb size of human ACL showed 60% homology with those of rat; however, no homology was found in the exon 1 ...
... flanking region of the human insulin gene and diabetes in American blacks. / Elbein, S.; Rotwein, P.; Permutt, M. A. et al. ... flanking region of the human insulin gene and diabetes in American blacks. In: Diabetes. 1985 ; Vol. 34, No. 5. pp. 433-439. ... flanking region of the human insulin gene and diabetes in American blacks. Diabetes. 1985;34(5):433-439. doi: 10.2337/diab.34.5 ... flanking region of the human insulin gene and diabetes in American blacks. Together they form a unique fingerprint. ...
... flanking repeat region. Increased activity after ethanol exposure. 135,136. CYP3A4. Steroid-inducible P450 ...
3 gene flanking region. 1851 to 2000. (*221 to *370). - Legend:. Reference sequence of imaginary gene used for the exaples ... large deletions (promoter region, 3-terminal exon, fused transcripts) *uncertainties (exact position not known; Southern blot ... coding region. 1601 to 1630. 301 to 330. 101 to 109. 3 UTR, containing a (CA)7-stretch from nts 1700 to 1713 (coding DNA *71 ... Large deletions involving the promoter region of the gene or the genes 3-end usually have an unpredictable effect on ...
Total - Total depth of deletion variants (must have flanking states in read) ... 5. 21023. 0.000237834752414023. 0.000301575681676824. A_MP. 668. 1. CATCC-AGTTC. FALSE. 2. 21411. 9.34099294755033e-05. ...
... flanking region TCTATCCTGTTCCAACTGCCAAAATAGAGCAGTAGCACGACTTTTTTCAT 3 flanking region ...
... flanking region of the human brain-derived neurotrophic factor gene.. Biochem. Biophys. Res. Commun. 1992; 182: 325-332. * ... flanking region of the S14 gene confer responsiveness to glucose in primary hepatocytes. ... Structural and functional identification of regulatory regions and cis elements surrounding the nerve growth factor gene ... Do the poly(A) tail and 3′ untranslated region control mRNA translation?. ...
... flanking region CATGGGAAAGTGAATGGTGCAGTTGAAACCTGTGGTCAGAGTTTTCATCG 3 flanking region ...
We identify large genomic regions that are differentially methylated during cardiomyocyte development and maturation. ... a,b) Heat maps of gene expression (a) and CpG methylation (b) of gene bodies and flanking regions5 kbp) with differential ... c-f) CpG methylation profiles of grouped genes with selected biological function and flanking regions5 kbp). Coloured ... Genomic annotation of cardiomyocyte DMRs showed a predominance for intragenic and CpG island-flanking regions (Supplementary ...
... flanking region of human MRP3 (Takada et al., 2000). Third, in vitro data indicate that MRP3 expression is also induced by β- ... flanking region of the human multidrug resistance protein 2 (MRP2) gene and its regulation in comparison with the multidrug ... flanking region of human MRP3. Biochem Biophys Res Commun 270:728-732. ... Figure 5 Induction of MRP3 protein by omeprazole in in vitro studies. After 48 h of incubation of HepG2 cells with vehicle (0.1 ...
... flanking region of the myostatin-1b gene is associated with harvest traits in Atlantic salmon (Salmo salar). Peñaloza, C., ... Testing for the Footprint of Sexually Antagonistic Polymorphisms in the Pseudoautosomal Region of a Plant Sex Chromosome Pair. ... Expansion of the Pseudo-autosomal Region and Ongoing Recombination Suppression in the Silene latifolia Sex Chromosomes. Bergero ... Osborne, O. G., Batstone, T. E., Hiscock, S. J. & Filatov, D. A., 23 Aug 2013, In: Genome Biology and Evolution. 5, 9, p. 1704- ...
... flanking region of the gene for the cAMP-inducible protein kinase A subunit, RIIbeta, in Sertoli cells. Molecular and Cellular ... Adenosine 3,5-monophosphate-dependent stabilization of messenger ribonucleic acids (mRNAs) for protein kinase-A (PKA) ... Biphasic regulation of the messenger ribonucleic acid coding for the estrogen receptor by cyclic adenosine 3`:5`-monophosphate ... Biphasic response to 3,5-cyclic adenosine monophosphate (cAMP) at the messenger ribonucleic acid level for a regulatory ...
The flanking regions of the MOR28, MOR10, and MOR83 genes are enlarged. Boxesindicate exons, and hatched portions depict coding ... Probes for the exon 1 regions of the MOR28 and MOR10 genes and for the coding regions of the MOR83, MOR18, and A16 genes were ... 1). We have sequenced the 43 kb DNA region encompassing the MOR28 and MOR10 genes to search for novel coding regions or highly ... the MOR28 and MOR10 genes are highly homologous not only in the coding region, but also in two noncoding regions: a 250 bp ...
... flanking region of the human corticotropin releasing hormone gene". DNA Seq. 4 (3): 197-206. PMID 8161822. doi:10.3109/ ... ekstracelularni region. • rastvorna frakcija. Biološki proces. • imunski respons. • prenos signal. • sinaptička transmisija. • ... 1990). „Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Lett. 267 (1): 1- ... 2 (5): 775-9. PMC 555184 . PMID 6605851.. *. Behan DP; Heinrichs SC; Troncoso JC; et al. (1995). „Displacement of corticotropin ...
... flanking region. (E) Transient transfection of GLA promoter constructs in EA.hy926 cells revealed two regions with significant ... flanking region with strong transcriptional activity. A proximal region was located between positions -110 and -425 and a ... Identification of GLAregulatory promoter regions. Due to the localization of the -10T allele within the GLA 5′-UTR, we ... EMSA experiments with probes resembling the region containing GLA position −10 resulted in specific binding patterns with ...
... flanking region. It has been documented that at −126 to −120 bp, there is a putative AP-1 binding site, and the region from −94 ... flanking regions of IL-8 gene, HIF-1 seems an unlikely candidate to play a direct role in hypoxic regulation of IL-8 (27). ... flanking region of the VEGF gene. Because no similar hypoxia-responsive elements have been identified in the known 5′- ... The diffusion limitations and temporal and spatial changes in blood flow produce hypoxic regions in solid tumors. The increased ...
... flanking region of torafugu MYH(M)₇₄₃₋₂ showed no homology with the corresponding regions of zebrafish and medaka orthologous ... flanking region of torafugu MYH(M)₇₄₃₋₂ showed no homology with the corresponding regions of zebrafish and medaka orthologous ... flanking region of MYH(M)₇₄₃₋₂ contains essential cis-regulatory sequences for myogenesis that are conserved among torafugu, ... flanking region of MYH(M)₇₄₃₋₂ contains essential cis-regulatory sequences for myogenesis that are conserved among torafugu, ...
SSR regions were identified at the 3′-end of a read. Primers were then designed in the flanking regions (i.e., 5′-end of read ... Long-read platforms are commonly used because reads of 300 to 500 bp in length may contain both the SSR motif and flanking ... paired-end reads from short-read platforms also contain the SSR motif and flanking sequence for primer design at a lower cost ... Contigs were screened for SSR regions using the search function described above. To develop and optimize a suite of SSR markers ...
... flanking region, limiting the DNA binding activity of NF-κB and inhibiting NOS2 expression. E1A is thus able to deactivate a ... flanking region, limiting the DNA binding activity of NF-κB and inhibiting NOS2 expression. E1A is thus able to deactivate a ... flanking region, limiting the DNA binding activity of NF-κB and inhibiting NOS2 expression. E1A is thus able to deactivate a ... flanking region, limiting the DNA binding activity of NF-κB and inhibiting NOS2 expression. E1A is thus able to deactivate a ...
... flanking region, and chromosomal localization of the human RGS3 gene. Genomics 45:429-433. ... "switch regions" in Giα 1 (Tesmer et al., 1997). These regions undergo the greatest conformational change during GTP hydrolysis ... The specificity of RGS4 protein for the Giα and Gqα subfamilies likely relies on the structure of the switch regions. Based on ... To approach the importance of this region and the N-terminal portions of RGS2 and RGS3 in general, fusion proteins between the ...
... flanking region of the bcl-x gene. Electrophoretic mobility shift assay suggested differences in binding of the NF-kappaB ... flanking kB-like sites within bcl-x gene in silica-induced bcl-x expression. ... DNA sequence analysis revealed that there are several kappaB-like sites within the 5- ...
In addition, most differentially CHH-hypomethylated regions were distributed in repeat and promoter regions. Based on ... In addition, most differentially CHH-hypomethylated regions were distributed in repeat and promoter regions. Based on ... flanking region, genebody, and 3′ flanking region of miRNA were analyzed to identify whether there were regulation of DNA ... DNA methylation region occurred mainly in the repeat region followed by the promoter region. Methylation was low in the intron ...
... flanking regions has identified the aroB promoter and possible 3 terminator sequences. The aroL gene encoding the tyrR ... Discrete non-overlapping regions of the fungal polypeptide are homologous with both E. coli DHQ synthase (aroB), shikimate ... The amino acid sequence contains a region with some homology to sequences found in other kinases and ATP-requiring enzymes. ... Analysis of the 3 flanking sequences has identified possible terminator elements. The bacterial sequences for the aroB and ...
coding flanking regions and the introns.. The particular site(s) to which the anti-sense. sequence binds and the length of the ... the non-coding region, may bridge the non-coding and. coding region, be complementary to all or part of the. coding region, ... region freed of the regulatory region, or a combination. of an RNA ploymerase binding region from one gene and. regulatory ... RNA polymerase binding region, or a different termina-. tion region. Various termination regions are available. and the choice ...
... were found in their flanking regions. Both molecular evolution and population genetics support the hypothesis that conservation ... flanking regions. Of the 29 duplicated gene pairs, 17 have only one paralog been targeted by a miRNA. This could be due to ... flanking region, the miRNA binding site and the 3 flanking region. To detect sequence divergence of each parts in each gene ... flanking regions. For each region, the synonymous (Ks) and non-synonymous (Ka) substitution rates between the two duplicated ...
... flanking region of the PCAN1 gene which represented promoter activity and was regulated by NKX3.1, p53, Sp1, Pten and 9-cis-RA ... Genomic regions, transcripts, and products Go to the top of the page Help ... a 1.5 kb prostate-specific promoter from the proximal region of the GDEP gene was identified. A smaller 0.5 kb promoter ... Identify version mismatches by comparing the version of the RefSeq in this section to the one reported in Genomic regions, ...
  • Abbreviations used: nt = nucleotide, nts = nucleotides, UTR = untranslated region of the mRNA. (hgvs.org)
  • Analysis of the aroB nucleotide sequence and its 5' and 3' flanking regions has identified the aroB promoter and possible 3' terminator sequences. (bl.uk)
  • n = 15) rice populations, no segregating site was observed in six miRNA binding sites whereas 0.12-0.20 SNPs per 21-nt or 1.53-1.80 × 10 -3 of the average pairwise nucleotide diversity (π) were found in their flanking regions. (biomedcentral.com)
  • 1%. This study confirmed that nucleotide substitutions of this region are transition mutations in outbreak cases, that insertion was observed only in non-severe cases, and that these nucleotide substitutions were different from those of the sporadic case. (medsci.org)
  • The sensitivity of Sanger sequencing is over 99% for the detection of nucleotide base changes, small deletions and insertions in the regions analyzed. (cincinnatichildrens.org)
  • The GTP is placed "backward" on the 5′ end of the mRNA, so that the 5′ carbons of the GTP and the terminal nucleotide are linked through three phosphates. (lumenlearning.com)
  • Recent studies showed that a polymorphism (T to C nucleotide substitution) in the 3′ flanking region of the human CLOCK gene is associated with diurnal preferences of human healthy subjects, with higher " eveningness" in subjects carrying at least one copy of the C allele. (elsevier.com)
  • Here we show that the rat BDNF gene consists of four short 5′ exons and one 3′ exon encoding the mature BDNF protein. (cell.com)
  • Several transcription initiation sites were mapped upstream of the four 5′ exons, and transfection of promoter-reporter gene constructs confirmed that these sequences act as promoters. (cell.com)
  • The regions of RNA that code for protein are called exons (Figure 1). (lumenlearning.com)
  • Exons 3 through 14 are contained in a genomic region of only 4.2 kbp with introns ranging in size from 80 to 554 bp. (ubc.ca)
  • The multiple regions found in the coding sequence of FXII that are homologous to putative domains in fibronectin and tissue-type plasminogen activator are contained on separate exons in the factor XII gene. (ubc.ca)
  • The NKX2-5 gene on chromosome 5q34 consists of two exons which encode a 324 amino acid protein. (cdc.gov)
  • The coding region contained five exons encoding 376 aminoacids and four introns ranging in size from 109 - 190bp. (who.int)
  • The 5′ and 3′ end primers were designed to contain 16-17 nucleotides homologous to the template sequence, with restriction enzyme sites and flanking nucleotides upstream of the homologous sequences. (elsevier.com)
  • The 5′ end oligonucleotide contained 18 nucleotides corresponding to sequences upstream of the putative suppressor element and another 18 nucleotides corresponding to sequences downstream of the putative suppressor element. (elsevier.com)
  • The 5' flanking region of the ornithine transcarbamylase gene contains DNA sequences regulating tissue-specific expression. (wikidata.org)
  • Several consensus sequences, including four Sp1 binding sites, were found in the 5' flanking region of this gene. (elsevier.com)
  • In contrast to mutations in coding regions affecting peptide sequences and possibly modifying protein structure and function, the consequences of intronic sequences are not predictable. (biomedcentral.com)
  • The amino acid sequence contains a region with some homology to sequences found in other kinases and ATP-requiring enzymes. (bl.uk)
  • Analysis of the 3' flanking sequences has identified possible terminator elements. (bl.uk)
  • The immediate 5'-flanking region is dominated by a dense cluster of Alu repeats in which are embedded several promoter consensus sequences. (elsevier.com)
  • Analysis of the 5' flanking region of the gene shows that it does not contain the typical TATA and CAAT sequences found in other genes. (ubc.ca)
  • The region of DNA which borders the 5' end of a transcription unit and where a variety of regulatory sequences are located. (bvsalud.org)
  • The swquences around the 5' and 3' splice sites were fairly conserved when compared to the eukaryotic consensus sequences and those of parasitic nematodes. (who.int)
  • DNA sequence analysis revealed that there are several kappaB-like sites within the 5'-flanking region of the bcl-x gene. (cdc.gov)
  • Sequence substitution analysis indicated that the synonymous substitution rate was significantly lower in the miRNA binding sites than their 5' and 3' flanking regions. (biomedcentral.com)
  • Deletion analysis of the 1,058 bp of rat FGF-2 5'-flanking DNA showed that an increase in FGF-2 transcription using phenylephrine (PE, an _1-specific agonist) for 48 h could be elicited with only 313 bp of upstream sequence. (umanitoba.ca)
  • These oligonucleotides encoded regions of β-factor Xlla as predicted from the amino acid sequence. (ubc.ca)
  • DNA sequence analysis of these overlapping clones showed that they contained DNA coding for the signal peptide sequence, the complete amino acid sequence of plasma factor XII, a TGA stop codon, a 3' untranslated region of 150 nucleotides, and a poly A⁺ tail. (ubc.ca)
  • Comparison of the structure of factor XII with other proteins revealed extensive sequence identity with regions of tissue-type plasminogen activator (the epidermal growth factor-like region and the kringle region) and fibronectin (type I and type II homologies). (ubc.ca)
  • The carboxyl-terminal region of factor XII shares considerable amino acid sequence homology with other serine proteases including trypsin and many clotting factors. (ubc.ca)
  • 10 13 These sequence variants were primarily identified within malformed regions and not in unaffected regions taken from the same heart, indicating a somatic and mosaic nature for these variants. (cdc.gov)
  • At the 5' flanking region, a putative mRNA initiation site and a potential `TATA' box with the sequence TATAAA could be identified, though a sequence similar to the ` CAAT ` box could not be identified. (who.int)
  • At the 3' flanking region, a potential polyadenylation signal with the sequence ATTAAA could be identified. (who.int)
  • During the analysis of the 5′ flanking region of the androgen receptor, we have used the PCR technique extensively to create mutations. (elsevier.com)
  • Analysis of UDPSs detected low-prevalence HAV variations in 5 ' UTR, but no specific mutations associated with severity in these outbreak cases. (medsci.org)
  • Mutations in regulatory regions or other untranslated regions are not detected by this test. (cincinnatichildrens.org)
  • Heterozygous deletions, insertions, genetic recombination events, as well as mutations in regulatory regions or other untranslated regions are not detected by this test. (cincinnatichildrens.org)
  • Somatic mutations in NKX2-5 do not represent an important aetiologic pathway in pathologic cardiac development in patients with cardiac septal defects. (cdc.gov)
  • Somatic mutations were identified in NXK2-5 and its molecular partners, TBX5 and GATA4 , as well as the transcription factor HEY2 in formalin fixed tissue taken from a collection of hearts with atrial septal defects (ASD), 8 ventricular septal defects (VSD), and atrioventricular canal defects (AVCD). (cdc.gov)
  • however, no homology was found in the exon 1 and intron 1 region. (elsevier.com)
  • The 5′ cap , which is placed on the 5′ end of the mRNA, is usually composed of a methylated guanosine triphosphate molecule (GTP). (lumenlearning.com)
  • The specificity of RGS4 protein for the G iα and G qα subfamilies likely relies on the structure of the switch regions. (aspetjournals.org)
  • The A/G-rich region does carry enhancer activity and does bind nuclear protein with high affinity and specificity. (umanitoba.ca)
  • FUS3 protein physically interact with two RY elements present in the AtGA3ox promoter;RY repeats are conserved in the 5 prime-flanking region of legume seed protein genes. (ugent.be)
  • Reverse transcriptase-polymerase chain reaction (RT-PCR) assay of the stop codon region of the outer membrane protein A ( ompA ) gene of Rickettsia felis using primer set 3 (nucleotides 1836-2180). (ajtmh.org)
  • Annals of human genetics 2010 Sep 74 (5): 387-98. (cdc.gov)
  • The 5' flanking region of ACL had the CAAT box on -92 bp from the transcription initiation site (+ 1), however, the TATA box was not found. (elsevier.com)
  • The cDNA and the entire 10 kb gene have been sequenced including the 5′ regulatory, 3′ regulatory, and intronic regions. (hindawi.com)
  • PI-2 is a 7-kb region located between the genes that in PI-2-containing isolates and the fi nding that isolates of encode peptidase T (PepT) and ferrochelatase (HemH) ( 9 ). (cdc.gov)
  • all identifi ed serotypes expressed highly conserved PI-2 pili The region is composed of 5 genes, which encode 2 sur- supports their potential as a vaccine candidate. (cdc.gov)
  • Demethylated regions in neonatal and adult cardiomyocytes are localized in cell type-specific enhancer regions and in gene bodies of cardiomyocyte genes. (nature.com)
  • In addition to these four well-conserved "core PKS genes", the neighboring regions encode additional genes, some of which are highly syntenic and conserved between genomes ( Figure 1 ). (cdc.gov)
  • The loss of other genes in the deleted region may also influence the signs and symptoms that can occur in 17q12 deletion syndrome. (medlineplus.gov)
  • As the type II region of fibronectin contains a collagen-binding site, the homologous region in factor XII may be responsible for the binding of factor XII to collagen. (ubc.ca)
  • The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively. (or.jp)
  • Study reports cloning a 2.6-kb fragment of the 5' flanking region of the PCAN1 gene which represented promoter activity and was regulated by NKX3.1, p53, Sp1, Pten and 9-cis-RA in the luciferase reporter assay. (nih.gov)
  • 5 We used data of all cases that were confirmed at the National Reference Laboratory of NCZD by enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay (IFA) and polymerase chain reaction (PCR). (who.int)
  • The genome codes a large open reading frame (ORF), which is flanked by 5'-untranslated region (5'UTR) and 3'UTR. (medsci.org)
  • The putative promoter region is also far different from that reported for GDN/PN-1. (elsevier.com)
  • Analysis of the 5-flanking region of human relb gene indicates that RelB transcription is dependent on a TATA-less promoter containing two kB sites. (atlasgeneticsoncology.org)
  • Microscopic examination of the specimen from the anal ulcer was positive for acid-fast bacilli and Mycobacterium tuberculosis was confirmed at the time by polymerase chain reaction to amplify polymorphic DNA regions flanking IS6110 by PCR with oligonucleotide primers to the end of IS6110. (who.int)
  • In the human brain, the first 5-HT-releasing neurons are present from the fifth week and their numbers increase markedly by the tenth week of gestation 6 . (bvsalud.org)
  • Thursday, 20 August - Friday, 21 August 2020 , 8:00 a.m.-5:00 p.m. (aapg.org)
  • The armies of India and China are locked in a bitter standoff in the mountainous Ladakh region since 2020. (kdvr.com)
  • The rat FGF-2 promoter has no TATA box and instead contains G/C-rich regions typical of a housekeeping gene. (umanitoba.ca)
  • Eight different BDNF mRNAs with four different 5′ ends and two alternative polyadenylation sites are transcribed from this gene. (cell.com)
  • It is the same region of chromosome 17 that is abnormally copied (duplicated) in people with a 17q12 duplication (described below). (medlineplus.gov)
  • It is the same region of chromosome 17 that is deleted in people with 17q12 deletion syndrome (described above). (medlineplus.gov)
  • NCU-G1 "knockout" musen ble skapt ved innsetting av en "gene-trap" i første intron som fører til stopp i transkripsjonen etter første ekson. (uio.no)
  • A polymorphic region 5' to the human insulin gene has been associated with diabetes in earlier studies. (elsevier.com)
  • This polymorphic region is composed of tandem repeats that fall into 3 general size classes, designated class 1 (600 base pairs), class 2 (1300 base pairs), and class 3 (2500 base pairs). (elsevier.com)
  • The promoter activity was assayed by transfecting the 3' or 5' deletion clones of ACL- chloramphenicol acetyl transferase (CAT) plasmid into PLC/PRF5 cells. (elsevier.com)
  • This deletion excluded an A/G-rich region containing a tandem repeat of an 8 bp element (5'-AGGGAGGG-3 ') which is similar to a phenylephrine-responsive element in the rat ANF promoter. (umanitoba.ca)
  • Signs and symptoms of 17q12 deletion syndrome can include abnormalities of the kidneys and urinary system, a form of diabetes called maturity-onset diabetes of the young type 5 (MODY5), delayed development, intellectual disability, and behavioral or psychiatric disorders. (medlineplus.gov)
  • Physical examination revealed a moderate tenderness in the epigastric and right upper quadrant region. (who.int)
  • Explore the Andes from the comfort of your desk with content from the Andean Basins Virtual Research Symposium organized by AAPG's Latin America and Caribbean Region with support from the Argentine Association of Petroleum Geologists and Geophysicists, the Argentine Geological Society, the Colombian Association of Petroleum Geologists and Geophysicists, the Colombian Geological Society and the Geological Society of Peru. (aapg.org)
  • The bedrock of the other network parks consists of sedimentary deposits shed from uplifted mountains into intermountain basins or along the flanks of the mountain ranges. (nps.gov)
  • The Denver-Cheyenne and North Park sedimentary basins flank Rocky Mountain National Park and contain vast sediments shed from uplifted rock associated with the Laramide orogeny. (nps.gov)
  • The amino-terminal portion of E1A decreases transactivation of the NOS2 5′-flanking region, limiting the DNA binding activity of NF-κB and inhibiting NOS2 expression. (elsevier.com)
  • These regions undergo the greatest conformational change during GTP hydrolysis, and specific amino acids in RGS4 appear to stabilize them in a transition state facilitating the hydrolysis reaction. (aspetjournals.org)
  • The 5-HT neurotransmitter regulates important pathways of mammalian metabolism and is synthesized from the phenylalanine, tyrosine and tryptophan amino acids 5 . (bvsalud.org)
  • Involvement of 5'-flanking kB-like sites within bcl-x gene in silica-induced bcl-x expression. (cdc.gov)
  • Involvement of the perianal region in tuberculosis is a rare extrapulmonary form of this disease. (who.int)
  • Our cohort included patients with atrial septal defects (ASD, n = 13), ventricular septal defects (VSD, n = 5), and atrioventricular canal defects (AVCD, n = 10). (cdc.gov)
  • Amplify the targeted genomic region with PCR. (idtdna.com)
  • However, most herds range from 5 to 15 individuals (Sowls, 1997) and, in the Brazilian Pantanal, the herds usually range from 5 to 10 individuals (Desbiez et al. (bvsalud.org)
  • In the present study we have used a new strategy, involving molecular analysis of a DNA site hypermethylated in tumour DNA, to identify a candidate gene in this region (17p13.3). (elsevier.com)
  • Multiple characteristics of this gene, including the presence of a p53 binding site in the 5' flanking region, activation of the gene by expression of a wild-type pS3 gene and suppression of G418 selectability of cultured brain, breast and colon cancer cells following insertion of the gene, make HIC-1 gene a strong candidate for a tumour suppressor gene in region 17pl3.3. (elsevier.com)
  • Removal of DNA methylation involves oxidation of 5-methyl-cytosine. (nature.com)
  • In order to mature this area, we have integrated around 150 km of 2D seismic data, 3 wells, and outcropping sections to provide an improved structural interpretation and stratigraphic of the flank within an assigned area. (aapg.org)
  • 2 - 4 Because of its critical role in cardiogenesis, NKX2-5 has been a prime candidate in studies to identify the genetic basis of structural congenital heart defects. (cdc.gov)
  • Diabetes , 34 (5), 433-439. (elsevier.com)
  • Diabetes 2007 May 56 (5): 1460-7. (cdc.gov)
  • [ 5 ] In 2014, the ADA released a position statement on the diagnosis and management of type 1 diabetes in all age groups. (medscape.com)
  • Whereas most regions of the genome are depleted for CpGs, they are clustered in CpG islands. (nature.com)
  • [18] The genome has the usual 5′ methylated cap and a 3′ polyadenylated tail . (wikizero.com)
  • The 5' methylated cap and 3' polyadenylated tail allows the positive-sense RNA genome to be directly translated by the host cell's ribosome on viral entry . (wikizero.com)
  • In conclusion, these studies demonstrated that 1,058 bp of rat FGF-2 5' flanking DNA was sufficient to invoke a positive response in cardiac myocytes to catecholamine stimulation specifically through _1-adrenergic receptors, and that this response occurred ' in vitro,' independently of myocyte contraction and Ca2+ influx, as well as 'in vivo' in the adult heart. (umanitoba.ca)
  • He was found to be HIV positive 5 months before admission. (who.int)
  • Schweinsburg and Sowls (1972) found that the most severe injuries of the fighting collared peccaries were caused by reciprocal biting of flanks and hindquarters. (bvsalud.org)
  • 136] found a clear curvilinear relationship between 5-HT 2A receptor occupancy and plasma QTP concentrations, but only a weak relationship between plasma QTP concentrations and D 2 receptor occupancy. (researchgate.net)
  • The Rocky Mountain Inventory and Monitoring Network consists of six parks located within the central and northern Rocky Mountain region of the United States in the states of Colorado and Montana. (nps.gov)
  • Two phage clones, λhgACL21 and λhgACL28, harboring the 5' flanking region of human ATP-citrate lyase (ACL) gene were identified by screening about 1.5 X 10 6 recombinant plaques from the λEMBL3-human placental genomic DNA library. (elsevier.com)
  • Neuroendocrine mechanisms, particularly those related to 5-HT, are associated with the differentiation and activation of osteoblasts and osteoclasts. (bvsalud.org)
  • As the two sides are constrained into one region as opposed to being spread out into little pockets of activity. (install-game.com)
  • A beaver, over the inscription "CANADA", is surrounded with the facial value, flanked on both sides by a maple leaf. (obscurefinds.com)
  • Immunohistochemical analysis of tumor lesions indicated that IL-8 overexpression was predominant in the regions surrounding necrotic areas, where cells were exposed to low oxygen tension (hypoxia) and acidic pH. (aacrjournals.org)
  • they were then removed from the water and allowed to freely absorb oxygen for 5 min. (bvsalud.org)
  • Interdecadal-decadal climate variability from multicoral oxygen isotope records in the South Pacific Convergence Zone region since 1650 A.D. (columbia.edu)
  • a new species of cichlid fish from the Río de La Plata region in Argentina, Brazil, and Uruguay. (mnhn.fr)
  • Subsequently, the offspring of these animals was subdivided into subgroups according to age of tooth germ development to be studied: 1 and 5 days of life. (bvsalud.org)
  • This is the second shootout with police in 5 days, last week another man was killed, 26 year old Eli Morillo. (wordpress.com)
  • PI3K proteins modifies specific phosphatidylinositides in phosphorylate phosphatidylinositol-4,5-bisphosphate to phosphatidylinositol-3,4,5-trisphosphate (PIP3). (mingsheng88.org)
  • 1999, PI-2-containing isolates were of the same serotypes kb genetic region present in 21%-27% of clinical isolates, but accounted for only 3.6% of all invasive isolates. (cdc.gov)
  • HAV IRES derived from clinical isolates have shown various activities in in vitro cell culture [ 5 , 12 ]. (medsci.org)
  • Clinical Gastroenterology 24(5): 541-53. (cincinnatichildrens.org)