Hydroxysteroid Dehydrogenases: Enzymes of the oxidoreductase class that catalyze the dehydrogenation of hydroxysteroids. (From Enzyme Nomenclature, 1992) EC 1.1.-.3-Hydroxysteroid Dehydrogenases: Catalyze the oxidation of 3-hydroxysteroids to 3-ketosteroids.Granulosa Cells: Supporting cells for the developing female gamete in the OVARY. They are derived from the coelomic epithelial cells of the gonadal ridge. Granulosa cells form a single layer around the OOCYTE in the primordial ovarian follicle and advance to form a multilayered cumulus oophorus surrounding the OVUM in the Graafian follicle. The major functions of granulosa cells include the production of steroids and LH receptors (RECEPTORS, LH).Luteinization: Formation of CORPUS LUTEUM. This process includes capillary invasion of the ruptured OVARIAN FOLLICLE, hypertrophy of the GRANULOSA CELLS and the THECA CELLS, and the production of PROGESTERONE. Luteinization is regulated by LUTEINIZING HORMONE.20-Hydroxysteroid Dehydrogenases: A group of enzymes that catalyze the reversible reduction-oxidation reaction of 20-hydroxysteroids, such as from a 20-ketosteroid to a 20-alpha-hydroxysteroid (EC 1.1.1.149) or to a 20-beta-hydroxysteroid (EC 1.1.1.53).17-Hydroxysteroid Dehydrogenases: A class of enzymes that catalyzes the oxidation of 17-hydroxysteroids to 17-ketosteroids. EC 1.1.-.Corpus Luteum: The yellow body derived from the ruptured OVARIAN FOLLICLE after OVULATION. The process of corpus luteum formation, LUTEINIZATION, is regulated by LUTEINIZING HORMONE.Cation Transport Proteins: Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.Iron-Binding Proteins: Proteins that specifically bind to IRON.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Iron: A metallic element with atomic symbol Fe, atomic number 26, and atomic weight 55.85. It is an essential constituent of HEMOGLOBINS; CYTOCHROMES; and IRON-BINDING PROTEINS. It plays a role in cellular redox reactions and in the transport of OXYGEN.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Multidrug Resistance-Associated Proteins: A sequence-related subfamily of ATP-BINDING CASSETTE TRANSPORTERS that actively transport organic substrates. Although considered organic anion transporters, a subset of proteins in this family have also been shown to convey drug resistance to neutral organic drugs. Their cellular function may have clinical significance for CHEMOTHERAPY in that they transport a variety of ANTINEOPLASTIC AGENTS. Overexpression of proteins in this class by NEOPLASMS is considered a possible mechanism in the development of multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although similar in function to P-GLYCOPROTEINS, the proteins in this class share little sequence homology to the p-glycoprotein family of proteins.Amiloride: A pyrazine compound inhibiting SODIUM reabsorption through SODIUM CHANNELS in renal EPITHELIAL CELLS. This inhibition creates a negative potential in the luminal membranes of principal cells, located in the distal convoluted tubule and collecting duct. Negative potential reduces secretion of potassium and hydrogen ions. Amiloride is used in conjunction with DIURETICS to spare POTASSIUM loss. (From Gilman et al., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed, p705)Epithelial Sodium Channels: Sodium channels found on salt-reabsorbing EPITHELIAL CELLS that line the distal NEPHRON; the distal COLON; SALIVARY DUCTS; SWEAT GLANDS; and the LUNG. They are AMILORIDE-sensitive and play a critical role in the control of sodium balance, BLOOD VOLUME, and BLOOD PRESSURE.Sodium Channels: Ion channels that specifically allow the passage of SODIUM ions. A variety of specific sodium channel subtypes are involved in serving specialized functions such as neuronal signaling, CARDIAC MUSCLE contraction, and KIDNEY function.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Diuretics: Agents that promote the excretion of urine through their effects on kidney function.NF-kappa B: Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.Sodium Channel Blockers: A class of drugs that act by inhibition of sodium influx through cell membranes. Blockade of sodium channels slows the rate and amplitude of initial rapid depolarization, reduces cell excitability, and reduces conduction velocity.Buffaloes: Ruminants of the family Bovidae consisting of Bubalus arnee and Syncerus caffer. This concept is differentiated from BISON, which refers to Bison bison and Bison bonasus.Insulin-Like Growth Factor I: A well-characterized basic peptide believed to be secreted by the liver and to circulate in the blood. It has growth-regulating, insulin-like, and mitogenic activities. This growth factor has a major, but not absolute, dependence on GROWTH HORMONE. It is believed to be mainly active in adults in contrast to INSULIN-LIKE GROWTH FACTOR II, which is a major fetal growth factor.Insulin-Like Growth Factor II: A well-characterized neutral peptide believed to be secreted by the LIVER and to circulate in the BLOOD. It has growth-regulating, insulin-like and mitogenic activities. The growth factor has a major, but not absolute, dependence on SOMATOTROPIN. It is believed to be a major fetal growth factor in contrast to INSULIN-LIKE GROWTH FACTOR I, which is a major growth factor in adults.Insulin-Like Growth Factor Binding Proteins: A family of soluble proteins that bind insulin-like growth factors and modulate their biological actions at the cellular level. (Int J Gynaecol Obstet 1992;39(1):3-9)Insulin-Like Growth Factor Binding Protein 3: One of the six homologous soluble proteins that bind insulin-like growth factors (SOMATOMEDINS) and modulate their mitogenic and metabolic actions at the cellular level.Receptor, IGF Type 1: A protein-tyrosine kinase receptor that is closely related in structure to the INSULIN RECEPTOR. Although commonly referred to as the IGF-I receptor, it binds both IGF-I and IGF-II with high affinity. It is comprised of a tetramer of two alpha and two beta subunits which are derived from cleavage of a single precursor protein. The beta subunit contains an intrinsic tyrosine kinase domain.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Tephritidae: A large family of fruit flies in the order DIPTERA, comprising over 4,500 species in about 100 genera. They have patterned wings and brightly colored bodies and are found predominantly in the tropical latitudes.ChitinaseCeratitis capitata: A species of fruit fly originating in sub-Saharan Africa but widely distributed worldwide. One of the most destructive fruit pests, its larvae feed and develop on many different fruits and some vegetables.Chitin: A linear polysaccharide of beta-1->4 linked units of ACETYLGLUCOSAMINE. It is the second most abundant biopolymer on earth, found especially in INSECTS and FUNGI. When deacetylated it is called CHITOSAN.Ecdysterone: A steroid hormone that regulates the processes of MOLTING or ecdysis in insects. Ecdysterone is the 20-hydroxylated ECDYSONE.Pupa: An inactive stage between the larval and adult stages in the life cycle of insects.alpha-Fetoproteins: The first alpha-globulins to appear in mammalian sera during FETAL DEVELOPMENT and the dominant serum proteins in early embryonic life.Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Blood Proteins: Proteins that are present in blood serum, including SERUM ALBUMIN; BLOOD COAGULATION FACTORS; and many other types of proteins.Yolk Sac: The first of four extra-embryonic membranes to form during EMBRYOGENESIS. In REPTILES and BIRDS, it arises from endoderm and mesoderm to incorporate the EGG YOLK into the DIGESTIVE TRACT for nourishing the embryo. In placental MAMMALS, its nutritional function is vestigial; however, it is the source of INTESTINAL MUCOSA; BLOOD CELLS; and GERM CELLS. It is sometimes called the vitelline sac, which should not be confused with the VITELLINE MEMBRANE of the egg.Fetus: The unborn young of a viviparous mammal, in the postembryonic period, after the major structures have been outlined. In humans, the unborn young from the end of the eighth week after CONCEPTION until BIRTH, as distinguished from the earlier EMBRYO, MAMMALIAN.Serum Albumin: A major protein in the BLOOD. It is important in maintaining the colloidal osmotic pressure and transporting large organic molecules.Bilirubin: A bile pigment that is a degradation product of HEME.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.False Positive Reactions: Positive test results in subjects who do not possess the attribute for which the test is conducted. The labeling of healthy persons as diseased when screening in the detection of disease. (Last, A Dictionary of Epidemiology, 2d ed)Polymorphism, Single Nucleotide: A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Case-Control Studies: Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Genetic Predisposition to Disease: A latent susceptibility to disease at the genetic level, which may be activated under certain conditions.Fibroblast Growth Factor 1: A 17-kDa single-chain polypeptide growth factor that plays a significant role in the process of WOUND HEALING and is a potent inducer of PHYSIOLOGIC ANGIOGENESIS. It binds to HEPARIN, which potentiates its biological activity and protects it from proteolysis. The growth factor is an extremely potent inducer of DNA synthesis in a variety of cell types from mesoderm and neuroectoderm lineages, and also has chemotactic and mitogenic activities. It was originally named acidic fibroblast growth factor based upon its chemical properties and to distinguish it from basic fibroblast growth factor (FIBROBLAST GROWTH FACTOR 2).Fibroblast Growth Factor 2: A single-chain polypeptide growth factor that plays a significant role in the process of WOUND HEALING and is a potent inducer of PHYSIOLOGIC ANGIOGENESIS. Several different forms of the human protein exist ranging from 18-24 kDa in size due to the use of alternative start sites within the fgf-2 gene. It has a 55 percent amino acid residue identity to FIBROBLAST GROWTH FACTOR 1 and has potent heparin-binding activity. The growth factor is an extremely potent inducer of DNA synthesis in a variety of cell types from mesoderm and neuroectoderm lineages. It was originally named basic fibroblast growth factor based upon its chemical properties and to distinguish it from acidic fibroblast growth factor (FIBROBLAST GROWTH FACTOR 1).DDT: A polychlorinated pesticide that is resistant to destruction by light and oxidation. Its unusual stability has resulted in difficulties in residue removal from water, soil, and foodstuffs. This substance may reasonably be anticipated to be a carcinogen: Fourth Annual Report on Carcinogens (NTP-85-002, 1985). (From Merck Index, 11th ed)Fibroblast Growth Factors: A family of small polypeptide growth factors that share several common features including a strong affinity for HEPARIN, and a central barrel-shaped core region of 140 amino acids that is highly homologous between family members. Although originally studied as proteins that stimulate the growth of fibroblasts this distinction is no longer a requirement for membership in the fibroblast growth factor family.Receptors, Fibroblast Growth Factor: Specific molecular sites or structures on cell membranes that react with FIBROBLAST GROWTH FACTORS (both the basic and acidic forms), their analogs, or their antagonists to elicit or to inhibit the specific response of the cell to these factors. These receptors frequently possess tyrosine kinase activity.Growth Substances: Signal molecules that are involved in the control of cell growth and differentiation.Heparin: A highly acidic mucopolysaccharide formed of equal parts of sulfated D-glucosamine and D-glucuronic acid with sulfaminic bridges. The molecular weight ranges from six to twenty thousand. Heparin occurs in and is obtained from liver, lung, mast cells, etc., of vertebrates. Its function is unknown, but it is used to prevent blood clotting in vivo and vitro, in the form of many different salts.
... flanking region". J. Biol. Chem. 260 (8): 5055-60. PMID 2580830. Ruoslahti E, Pihko H, Vaheri A, et al. (1975). "Alpha ... 7 (5): 267-9. doi:10.1055/s-2008-1071168. PMID 9402482. Lee PI, Chang MH, Chen DS, Lee CY (January 1989). "Serum alpha- ... 26 (5): 1332-43. doi:10.1021/bi00379a020. PMID 2436661. Sakai M, Morinaga T, Urano Y, et al. (1985). "The human alpha- ... The normal range of AFP for adults and children is variously reported as under 50, under 10, and under 5 ng/mL. At birth, ...
... flanking region of human MRP3". Biochem. Biophys. Res. Commun. 270 (3): 728-32. doi:10.1006/bbrc.2000.2507. PMID 10772892. Nies ... flanking region, genomic organization and alternative splice variants". Biochim. Biophys. Acta. 1415 (2): 369-74. doi:10.1016/ ... 5 (2): R8. doi:10.1186/gb-2004-5-2-r8. PMC 395752 . PMID 14759258. Lang T, Hitzl M, Burk O, Mornhinweg E, Keil A, Kerb R, Klein ... 290 (5): 1427-33. doi:10.1006/bbrc.2002.6367. PMID 11820781. Scheffer GL, Kool M, de Haas M, de Vree JM, Pijnenborg AC, Bosman ...
... flanking region and active promoter". The Journal of Biological Chemistry. 263 (32): 16992-8. PMID 3182828. Abbotts J, SenGupta ... "Two regions in human DNA polymerase beta mRNA suppress translation in Escherichia coli". Nucleic Acids Research. 20 (18): 4859- ... 93 (5): 507-12. doi:10.1007/bf00202813. PMID 8168825. Chyan YJ, Strauss PR, Wood TG, Wilson SH (Aug 1996). "Identification of ... "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library". Gene. 200 (1-2): 149-56. doi: ...
... flanking region by deletion/substitution". J. Biol. Chem. 263 (24): 12020-7. PMID 3042787. Micanovic R, Bailey CA, Brink L, ... untranslated region contains multiple copies of an Alu family repeat. In addition, this gene is polymorphic and three common ... "Complex arrangement of genes within a 220-kb region of double-duplicated DNA on human 2q37.1". Genomics. 73 (1): 50-5. doi: ... 261 (7): 3112-5. PMID 3512548. Ezra E, Blacher R, Udenfriend S (1984). "Purification and partial sequencing of human placental ...
... flanking region element responsible for the low level constitutive expression of the human cytosolic phospholipase A2 gene". ... flanking region surrounding a human cytosolic phospholipase A2 gene". Biochemical and Biophysical Research Communications. 205 ... 19 (4-5): 683-688. PMID 9745929. Hirabayashi T, Murayama T, Shimizu T (2005). "Regulatory mechanism and physiological role of ... 58 (5-6): 328-333. doi:10.1080/15216540600702289. PMID 16754327. Sharp JD, White DL, Chiou XG, et al. (1991). "Molecular ...
... flanking region". J. Biol. Chem. 269 (7): 5279-87. PMID 8106512. Harada H, Kitagawa M, Tanaka N, Yamamoto H, Harada K, Ishihara ... 40 (5): 976-82. PMID 10102295. Whitney LW, Becker KG, Tresser NJ, Caballero-Ramos CI, Munson PJ, Prabhu VV, Trent JM, McFarland ... 35 (5-6): 507-11. doi:10.1080/10428199909169615. PMID 10609788. Staal A, Enserink JM, Stein JL, Stein GS, van Wijnen AJ (2000 ... Intron-exon organization and functional analysis of 5'- ...
... flanking region (> 80%) helps define this region as a CpG island that may be a principal regulator of beta ARK expression. Beta ... flanking/promoter region reveals many features characteristic of mammalian housekeeping genes, i.e. the lack of a TATA box, an ... Functional regions of beta ARK are described with respect to their location within the exon-intron organization of the gene. ... 143 (5): 750-60. doi:10.1016/j.cell.2010.10.018. PMID 21111235. Premont RT, Claing A, Vitale N, Perry SJ, Lefkowitz RJ (July ...
... flanking region of the human PTK6 gene". Biochim. Biophys. Acta. 1574 (3): 365-9. doi:10.1016/s0167-4781(02)00234-8. PMID ... 5 (7): 1767-77. PMID 10430081. Derry JJ, Richard S, Valderrama Carvajal H, et al. (2000). "Sik (BRK) Phosphorylates Sam68 in ... Kang KN, Kim M, Pae KM, Lee ST (2002). "Characterization of the 5'- ...
... flanking region of human aggrecanase-1 (ADAMTS4) gene". Molecular Biology Reports. 27 (3): 167-73. doi:10.1023/A:1007253930568 ... Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region that stacks against the active-site of the ... Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a ... 5 (3): 169-76. doi:10.1093/dnares/5.3.169. PMID 9734811. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, ...
... flanking region". The Journal of Biological Chemistry. 262 (28): 13662-73. PMID 2888762. Stavrou E, Schmaier AH (Mar 2010). " ... flanking region". The Journal of Biological Chemistry. 262 (28): 13662-73. PMID 2888762. Que BG, Davie EW (Apr 1986). " ... and a proline-rich region, and its light chain contains the protease domain. Recently, the structure of the FnI-EGF-like tandem ... 5 (4): 733-41. doi:10.1586/14779072.5.4.733. PMID 17605651. Harris RJ, Ling VT, Spellman MW (Mar 1992). "O-linked fucose is ...
... flanking regulatory region". Gene. 294 (1-2): 259-68. doi:10.1016/S0378-1119(02)00798-9. PMID 12234688. Tiffin N, Williams RD, ... "The genomic organization and the full coding region of the human PAX7 gene". Genomics. 45 (1): 168-74. doi:10.1006/geno. ... 5 (1): 15-21. doi:10.1093/hmg/5.1.15. PMID 8789435. Vorobyov E, Mertsalov I, Dockhorn-Dworniczak B, Dworniczak B, Horst J ( ... "Structural and functional characterization of the human PAX7 5'- ...
... flanking region of human genomic ETA gene". Biochemical and Biophysical Research Communications. 190 (2): 332-9. doi:10.1006/ ... 56 Suppl 5: 1303-7. doi:10.1253/jcj.56.supplementv_1303. PMID 1291713. Hosoda K, Nakao K, Tamura N, Arai H, Ogawa Y, Suga S, ... Yang H, Tabuchi H, Furuichi Y, Miyamoto C (January 1993). "Molecular characterization of the 5'- ...
... flanking region, and chromosomal localization of the human RGS3 gene". Genomics. 45 (2): 429-33. doi:10.1006/geno.1997.4929. ... 2002). "RGS3 interacts with 14-3-3 via the N-terminal region distinct from the RGS (regulator of G-protein signalling) domain ... 36 (1): 40-5. doi:10.1038/ng1285. PMID 14702039. Humphray SJ, Oliver K, Hunt AR, et al. (2004). "DNA sequence and analysis of ... 2002). "Additional 5' exons in the RGS3 locus generate multiple mRNA transcripts, one of which accounts for the origin of human ...
... flanking region of the human beta-glucuronidase gene". Genomics. 10 (4): 1009-18. doi:10.1016/0888-7543(91)90192-H. PMID ... Marathe SV, McEwen JE (February 1995). "Vectors with the gus reporter gene for identifying and quantitating promoter regions in ... 2 (6): 443-5. doi:10.1002/humu.1380020604. PMID 8111412. Wu BM, Sly WS (1994). "Mutational studies in a patient with the ...
... flanking region of the human estrogen receptor gene". DNA Seq. 2 (6): 347-58. doi:10.3109/10425179209020816. PMID 1476547. Piva ... genomic organization of the human ERalpha gene promoter region". Mol. Endocrinol. 15 (12): 2057-63. doi:10.1210/me.15.12.2057. ... 6 (5): 773-85. doi:10.1210/me.6.5.773. PMID 1603086. Keaveney M, Klug J, Dawson MT, Nestor PV, Neilan JG, Forde RC, Gannon F ( ... 70 (5-7): 361-3. doi:10.1016/j.steroids.2005.02.015. PMID 15862818. Wang CL, Tang XY, Chen WQ, Su YX, Zhang CX, Chen YM (2007 ...
... flanking region and structural organization". Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1395 (1): 62 ...
... flanking region of the gene". Genomics. 19 (1): 91-6. doi:10.1006/geno.1994.1017. PMID 8188248. Byrne JA, Smith PJ (1993). "The ... This gene may play a role in malignancies and disease that involve this region. This gene is oriented in a head-to-tail ... It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. ... Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, ...
... flanking region". Genomics. 19 (2): 369-72. doi:10.1006/geno.1994.1072. PMID 8188267. Sparkes RS, Lee RH, Shinohara T, et al. ( ... 2000). "A 6-Mb high-resolution physical and transcription map encompassing the hereditary prostate cancer 1 (HPC1) region". ... Abe T, Kikuchi T, Shinohara T (1994). "The sequence of the human phosducin gene (PDC) and its 5'- ...
... flanking region of the coagulation factor VII gene". J. Thromb. Haemost. 1 (6): 1220-7. doi:10.1046/j.1538-7836.2003.00227.x. ... 5 (12): 1301-10. doi:10.1091/mbc.5.12.1301. PMC 301159 . PMID 7696711. Faulkner NE, Vig B, Echeverri CJ, et al. (1998). " ... 113 (5): 877-86. PMID 10671377. Hartley JL, Temple GF, Brasch MA (2001). "DNA Cloning Using In Vitro Site-Specific ... U.S.A. 92 (5): 1634-8. doi:10.1073/pnas.92.5.1634. PMC 42574 . PMID 7878030. Garces JA, Clark IB, Meyer DI, Vallee RB (1999). " ...
... flanking region of the human corticotropin releasing hormone gene". DNA Seq. 4 (3): 197-206. doi:10.3109/10425179309015632. ... "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Lett. 267 (1): 1-5. doi: ... 11 (7): 980-5. doi:10.1210/me.11.7.980. PMID 9178757. Timpl P, Spanagel R, Sillaber I, Kresse A, Reul JM, Stalla GK, Blanquet V ... 1 (5): 460-3. doi:10.1038/nm0595-460. PMID 7585095. Slominski A, Ermak G, Hwang J, Chakraborty A, Mazurkiewicz JE, Mihm M (1995 ...
... flanking region and structural organization". Biochim. Biophys. Acta. 1395 (1): 62-7. doi:10.1016/S0167-4781(97)00140-1. PMID ... region". Hum. Mutat. 28 (7): 742. doi:10.1002/humu.9500. PMID 17579360. Beier UH; Görögh T (2005). "Implications of ... 5 (9): e12862. doi:10.1371/journal.pone.0012862. PMC 2943476 . PMID 20877624. GeneReviews/NCBI/NIH/UW entry on Krabbe disease ... 1998). "Human galactocerebrosidase gene: promoter analysis of the 5'- ...
... flanking region of the human follicle-stimulating hormone receptor gene". Molecular and Cellular Endocrinology. 102 (1-2): 93- ... Upon initial binding to the LRR region of FSHR, FSH reshapes its conformation to form a new pocket. FSHR then inserts its ... "Structural predictions for the ligand-binding region of glycoprotein hormone receptors and the nature of hormone-receptor ... 8 (5): 413-21. doi:10.1093/humupd/8.5.413. PMID 12398222. Delbaere A, Smits G, Olatunbosun O, Pierson R, Vassart G, Costagliola ...
... flanking region for the human topoisomerase III gene". The Journal of Biological Chemistry. 273 (40): 26130-7. doi:10.1074/jbc. ... "Genes in a refined Smith-Magenis syndrome critical deletion interval on chromosome 17p11.2 and the syntenic region of the mouse ... "Gene for topoisomerase III maps within the Smith-Magenis syndrome critical region: analysis of cell-cycle distribution and ... 12 (5): 713-28. doi:10.1101/gr.73702. PMC 186594 . PMID 11997338. Wang Y, Lyu YL, Wang JC (Sep 2002). "Dual localization of ...
... flanking region of CYP3A5: comparative analysis with CYP3A4 and CYP3A7". Biochemical and Biophysical Research Communications. ... 4 (5): 247-59. doi:10.1097/00008571-199410000-00003. PMID 7894497. Lown KS, Kolars JC, Thummel KE, Barnett JL, Kunze KL, ... 6 (5): 379-85. doi:10.1097/00008571-199610000-00001. PMID 8946469. Anttila S, Hukkanen J, Hakkola J, Stjernvall T, Beaune P, ... Check date values in: ,access-date= (help) "Entrez Gene: CYP3A5 cytochrome P450, family 3, subfamily A, polypeptide 5". " ...
... flanking region of the human GIP receptor (GIPR) gene". Endocr. Res. 28 (4): 577-577. doi:10.1081/ERC-120016843. PMID 12530665 ... 2003). "Analysis of the putative promoter region of the GIP receptor gene (GIPR) in GIP-dependent Cushing's syndrome (CS)". ... 53 (5): 1326-1335. doi:10.2337/diabetes.53.5.1326. PMID 15111503. Gerhard DS, Wagner L, Feingold EA, et al. (2004). "The status ... doi:10.1016/0167-0115(96)00019-5. PMID 8795084. N'Diaye N, Tremblay J, Hamet P, et al. (1998). "Adrenocortical overexpression ...
The hair is longest on the flanks and rump. In the fall, the summer coat is gradually replaced by a thicker, coarse-haired ... Douzery, E.; Randi, E. (November 1997). "The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic ... studies of mitochondrial control region and cytochrome b DNA sequences placed it near Capreolus within an Old World section of ... Commonly 2-5 Bucks: 5-6 months During the annual rut in November and December, the male will seek out and follow females, ...
... flanking region at -1,780-1,287 bp, and at -611 to -208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity ... flanking region at -1,780-1,287 bp, and at -611 to -208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity ... flanking region at -1,780-1,287 bp, and at -611 to -208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity ... flanking region at -1,780-1,287 bp, and at -611 to -208 bp. In Madin-Darby canine kidney (MDCK) cells, MRP7 promoter activity ...
Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... flanking region is a region of DNA that is adjacent to the 5 end of the gene. The 5 flanking region contains the promoter, ... flanking region of eukaryotic genomes. A specific transcription factor called CAAT-binding protein binds to this region and ... untranslated region, this region is neither transcribed into RNA, nor translated into a functional protein. These regions ...
Belted cattle have a circular belt of unpigmented hair and skin around their midsection. The belt is inherited as a monogenic autosomal dominant trait. We mapped the causative variant to a 37 kb segment on bovine chromosome 3. Whole genome sequence data of 2 belted and 130 control cattle yielded only one private genetic variant in the critical interval in the two belted animals. The belt-associated variant was a copy number variant (CNV) involving the quadruplication of a 6 kb non-coding sequence located approximately 16 kb upstream of the TWIST2 gene. Increased copy numbers at this CNV were strongly associated with the belt phenotype in a cohort of 333 cases and 1322 controls. We hypothesized that the CNV causes aberrant expression of TWIST2 during neural crest development, which might negatively affect melanoblasts. Functional studies showed that ectopic expression of bovine TWIST2 in neural crest in transgenic zebrafish led to a decrease in melanocyte numbers. Our results thus implicate an
... flanking region of the rat CYP2B2 gene in transgenic mice.. Ramsden R1, Beck NB, Sommer KM, Omiecinski CJ. ... flanking region of the rat CYP2B2 gene. Protein-DNA interactions at the PBRU domain also were characterized. Using the ... flanking CYP2B2 sequence are not PB responsive. DNA affinity enrichment techniques and immunoblotting and electromobility shift ... gene reporters to assess the functional consequences of specific deletions and site-specific mutations within the 2.5kb 5- ...
... flanking region.. Gomez M., Manzano A., Navarro-Sabate A., Duran J., Obach M., Perales J.C., Bartrons R. ... flanking region by transient transfection assays with different 5-deletion promoter constructs in GC-1spg and mouse sertoli ... Specific expression of pfkfb4 gene in spermatogonia germ cells and analysis of its 5- ...
We have identified a 428 bp fragment of the E8 5-flanking region, from -1528 to -1100,... ... Deikman J, Fischer RL: Interaction of a DNA binding factor with the 50-flanking region of an ethylene-responsive fruit ripening ... Coupe SA, Deikman J: Characterization of a DNA-binding protein that interacts with 50-flanking regions of two fruitripening ... flanking region, from -1528 to -1100, that makes a minimal 35S promoter responsive to ethylene. This fragment confers ethylene- ...
Flanking Region" was a major or minor topic of these publications. To see the data from this visualization as text, click here. ... Flanking Region" by people in Profiles.. * Bruschweiler-Li L, Fuentes Medel YF, Scofield MD, Trang EB, Binke SA, Gardner PD. ... Flanking Region" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus, MeSH (Medical Subject ... Flanking Region" by people in this website by year, and whether "5 ...
... flanking region: Transcriptional control by 17β-estradiol. Authors: Muriach, Borja ; Carrillo, Manuel ; Zanuy, Silvia ; Cerdá- ... flanking region (sbFSHβ 5′ FR) was cloned and characterized in order to study the molecular mechanisms underlying ... Analysis of the ~3.5 kb of this region revealed the presence of several putative cis-acting elements, including steroid hormone ... The sbFSHβ 5′ FR was efficiently expressed under basal conditions in LβT2 but not in HEK 293, pointing to both positive and ...
... flanking region regulate c-fos expression. Message Subject (Your Name) has forwarded a page to you from Molecular and Cellular ... flanking region regulate c-fos expression.. M Z Gilman, R N Wilson, R A Weinberg ... We tested sequences flanking the mouse c-fos gene for the ability to form specific DNA-protein complexes with factors present ... One complex formed in a region necessary for the induction of c-fos expression by serum growth factors. Two additional ...
... flanking region of the chicken ovalbumin gene. Saturation kinetics showed that 2-fold... ... Highly purified hen oviduct progesterone receptor A subunit has been found to interact preferentially with the 5- ... Flanking Regulatory Region of the Ovalbumin Gene. In: Chrousos G.P., Loriaux D.L., Lipsett M.B. (eds) Steroid Hormone ... flanking region of the chicken ovalbumin gene. Saturation kinetics showed that 2-fold less receptor was required for half- ...
Flanking Region is Associated with Essential Hypertension among Japanese Females. Int J Med Sci 2007; 4(3):146-152. doi:10.7150 ... flanking region of natriuretic peptide precursor B (NPPB) gene and assessed the relationship between gene variants and EH. ... Flanking Region is Associated with Essential Hypertension among Japanese Females Kotoko Kosuge1, Masayoshi Soma1,3, Tomohiro ... flanking region of NPPB appears to be a useful genetic marker of EH in females. ...
... flanking region in controlling the expression of homologous and heterologous linked genes. ... regulatory region. These results underline the importance of the 3 downstream regulatory regions, which still need to be ... For 10 years, the regulatory regions of the mouse and rabbit whey acidic protein gene have been used to express heterologous ... Regulatory regions. Transgenic animals. Mammary gland. Milk. Protein expression. Rabbit. Rat. Mouse. Livestock. ...
... flanking region, revealed that the region between −83 and 60 bp upstream of the transcription start site was essential for ... flanking region of the mouse 20α-hydroxysteroid dehydrogenase gene. Keiji HIRABAYASHI, Maho ISHIDA, Masatoshi SUZUKI, Keitaro ... flanking region of the mouse 20α-hydroxysteroid dehydrogenase gene. Keiji HIRABAYASHI, Maho ISHIDA, Masatoshi SUZUKI, Keitaro ... flanking region of the mouse 20α-hydroxysteroid dehydrogenase gene Message Subject (Your Name) has forwarded a page to you from ...
... flanking region of the natural resistance-associated macrophage protein gene (NRAMP1) between humans and great apes, Mammalian ... "Comparative study of the genomic organization of DNA repeats within the 5′- ... These results show that sequence length variants in the Alu-flanking regions as well as nucleotide substitutions are the most ... flanking region of... Roger, M. ; Sánchez, F.O. ; Schurr, E. 1998-06-01 00:00:00 The human NRAMP1 gene located on Chromosome ( ...
... flanking region for the gene expression in activated T lymphocytes ... Haase, A.; Stoffel, W., 1990: The 3'-flanking region shared by the human apolipoprotein AI and CIII gene regulates gene ... Sano, R.; Nakajima, T.; Takahashi, K.; Kubo, R.; Yazawa, S.; Kominato, Y., 2011: The 3' flanking region of the human ABO ... flanking region of the human CGL-1/granzyme B gene targets expression of a reporter gene to activated T-lymphocytes in ...
... flanking region of the human amiloride-sensitive sodium channel (αENaC) gene: role of nuclear factor κB. Deborah L. BAINES, ... flanking regions of the human αENaC gene using luciferase reporter-gene vectors transiently transfected into human adult ... flanking region of the human amiloride-sensitive sodium channel (αENaC) gene: role of nuclear factor κB ... flanking region of the human amiloride-sensitive sodium channel (αENaC) gene: role of nuclear factor κB ...
... flanking region of the common carp IGF-I gene by performing luciferase reporter assays in transfected 293GHR cells. Addition of ... flanking region from a local tropical fish, the common carp (Cyprinus carpio), and characterized its promoter activity by ... However, sequence analysis of the common carp IGF-I promoter region identified several consensus liver-enriched transcription ... we have cloned and completely sequenced the IGF-I gene and the 5- ...
Flanking Region was amplified and subsequently subjected to Single Strand Conformation Polymorphism (SSCP). The results were ... Also, the 265 bp of IGF-1 promoter in the 5 ... Flanking Region and First Exon of Insulin-Like Growth Factor 1 ... Flanking Region was amplified and subsequently subjected to Single Strand Conformation Polymorphism (SSCP). The results were ... Also, the 265 bp of IGF-1 promoter in the 5 ...
... flanking promoter sequence were identified and characterized. Two constructs were generated by placing a bacterial lacZ ... An 8.3-kb and a 5.4-kb fragment containing the 5 ... flanking region drives LacZ expression in podocytes.. @article{ ... flanking region drives LacZ expression in podocytes.}, author={Marcus M{\o}ller and Iulia A. Kovari and Lawrence B. Holzman}, ... Evaluation of a new tool for exploring podocyte biology: mouse Nphs1 5 ...
Polymorphisms and mutations found in the regions flanking exons 5 to 8 of the TP53 gene in a population at high risk for ...
... flanking region of the PAI-1 gene with clinicopathologic features of gastric cancer in Chinese patients and looked for ... We explored a possible correlation of genetic instability and CpG methylation in the 5- ... flanking region of the PAI-1 gene in Chinese patients with gastric cancer. * J. Liu ... flanking region of the PAI-1 gene with clinicopathologic features of gastric cancer in Chinese patients and looked for ...
... flanking promoter regions are conserved to a greater extent than both the entire mature coding and intron regions of these ... Several highly conserved regions in the first 200 base pairs of the 5 flanking DNA have been identified. Additional sequence ... flanking sequences may contain potential cis regulatory elements which are responsible for the coordinate expression of the ... The rat alpha-, beta-, gamma- and bovine alpha s1-casein genes contain similar 5 exon arrangements in which the 5 noncoding, ...
... flanking region of NANOGP8 in a self-renewal environment is associated with increased sphere formation and tumor growth of ... flanking region of NANOGP8 in a self-renewal environment is associated with increased sphere formation and tumor growth of ... flanking region of NANOGP8 exhibited enhanced clonogenicity, sphere formation, and xenograft tumor growth. The sphere culture ... flanking region of NANOGP8. Forced expression of NANOGP8 increased the entry into the cell cycle. ...
... flanking region of the mouse glucagon receptor gene: Comparison with the rat gene. Together they form a unique fingerprint. * ... flanking region of the mouse GR gene was cloned up to 6 kb and the structural organization was compared to the 5 untranslated ... flanking region of the mouse GR gene was cloned up to 6 kb and the structural organization was compared to the 5 untranslated ... flanking region of the mouse GR gene was cloned up to 6 kb and the structural organization was compared to the 5 untranslated ...
... flanking region of GSTP1, previously reported as a minisatellite repeat. ... untranslated region is further degenerated by insertions of CAC, ATT and other motifs, and describe a detailed analysis of the ... untranslated region immediately upstream of an extensively methylated CpG island. Poly AT-rich repeats are implicated as ... Two polymorphisms in GSTP1 are known: a point mutation in exon 5 with a possible functional role, leading to changes in the ...
  • Phenobarbital responsiveness conferred by the 5'-flanking region of the rat CYP2B2 gene in transgenic mice. (nih.gov)
  • For 10 years, the regulatory regions of the mouse and rabbit whey acidic protein gene have been used to express heterologous proteins in the milk of transgenic mice, as well as to produce pharmaceutical proteins, on a large scale, in the milk of transgenic livestock. (csic.es)
  • An extended 5regulatory region (17·6 kb v. 6·3 kb) of the rabbit whey acidic promoter resulted in an increased frequency of rabbit whey acidic protein expression in transgenic mice. (csic.es)
  • However, the expression levels were low compared with the high expression levels achieved in both transgenic mice and rabbits using the heterologous κ-casein in the 6·3 kb rabbit whey acidic protein 5regulatory region. (csic.es)
  • Recent studies showed that the PLZF-RAR α fusion gene is able to induce leukemia in transgenic mice ( 4 , 5 ), and PLZF also may be involved in the pathogenesis of APL with t(15;17) ( 6 ). (pnas.org)
  • The regulation of MUC2 , a major goblet cell mucin gene, was examined by constructing transgenic mice containing bases −2864 to +17 of the human MUC2 5′-flanking region fused into the 5′-untranslated region of a human growth hormone (hGH) reporter gene. (physiology.org)
  • The numbering scheme for nucleotide positions is based on assignment of the (+1) position to the "A" in the translation initiation codon, with nucleotides 5′ to that position assigned negative and those 3′ within the cDNA assigned positive numbers. (aacrjournals.org)
  • The cDNA contains an open reading frame (ORF) of 1449 bp that encodes 483 amino acid residues and 126- and 296-bp non-coding regions at the 5′- and 3′-ends, respectively. (mdpi.com)
  • 5 ) reported truncated TRα1 and TRβ1 cDNA in 53% of human hepatocellular carcinomas (HCC). (aacrjournals.org)
  • Transcriptional start site determination by 5′ rapid amplification of cDNA ends (5′RACE) was performed on total human fetal brain RNA using the GeneRacer kit (Invitrogen, Carlsbad, CA). First-strand cDNA was synthesized using specific primer MC4R-BR (5′ TCCACTGCAATTGAAAGCAG 3′) and avian myeloblastosis virus-reverse transcriptase. (diabetesjournals.org)
  • Polymorphisms in the 5' flanking region of the gene coding for oxytocin have been linked to mutations in promoter function, ultimately leading to potential disorders related to altered oxytocin levels and functionality. (wikipedia.org)
  • Whereas other b -locus mutants with the typical OCA4 phenotype ( b c1 , b d2 , b d4 , b d8 , b g8 , b g21 , and b p ) have mutations in the protein-coding region of slc45a2 , a mutation has not been identified from the b allele. (genetics.org)
  • Systematic screening of 431 obese children and adults for mutations in the coding sequence and the minimal core promoter of MC4R reveals that genetic variation in the transcriptionally essential region of the MC4R promoter is not a significant cause of severe obesity in humans. (diabetesjournals.org)
  • Heterozygous mutations in the coding region of the melanocortin 4 receptor ( MC4R ) gene are the cause of 1-6% of severe early-onset obesity cases ( 3 - 10 ). (diabetesjournals.org)
  • Furthermore, we provide evidence for bidirectional MBS85 promoter activity and demonstrate that the minimal motifs required for AAV site-specific integration are present in the 5′ untranslated region of the gene and play a posttranscriptional role in the regulation of MBS85 expression. (pubmedcentralcanada.ca)
  • Luciferase reporter assay detected strong promoter activity (53-fold higher than vector control) in this region. (nih.gov)