Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5flanking region contains the promoter, ... flanking region of eukaryotic genomes. A specific transcription factor called CAAT-binding protein binds to this region and ... untranslated region, this region is not transcribed into RNA or translated into a functional protein. These regions primarily ...
... flanking region". Journal of Biological Chemistry. 260 (8): 5055-60. doi:10.1016/S0021-9258(18)89178-5. PMID 2580830. Ruoslahti ... 7 (5): 267-9. doi:10.1055/s-2008-1071168. PMID 9402482. Lee PI, Chang MH, Chen DS, Lee CY (January 1989). "Serum alpha- ... The normal range of AFP for adults and children is variously reported as under 50, under 10, or under 5 ng/mL. At birth, normal ... 26 (5): 1332-43. doi:10.1021/bi00379a020. PMID 2436661. Sakai M, Morinaga T, Urano Y, et al. (1985). "The human alpha- ...
... flanking region of human MRP3". Biochem. Biophys. Res. Commun. 270 (3): 728-32. doi:10.1006/bbrc.2000.2507. PMID 10772892. Nies ... flanking region, genomic organization and alternative splice variants". Biochim. Biophys. Acta. 1415 (2): 369-74. doi:10.1016/ ... 5 (2): R8. doi:10.1186/gb-2004-5-2-r8. PMC 395752. PMID 14759258. Lang T, Hitzl M, Burk O, Mornhinweg E, Keil A, Kerb R, Klein ... 290 (5): 1427-33. doi:10.1006/bbrc.2002.6367. PMID 11820781. Scheffer GL, Kool M, de Haas M, de Vree JM, Pijnenborg AC, Bosman ...
... flanking region and active promoter". The Journal of Biological Chemistry. 263 (32): 16992-8. doi:10.1016/S0021-9258(18)37488-X ... "Two regions in human DNA polymerase beta mRNA suppress translation in Escherichia coli". Nucleic Acids Research. 20 (18): 4859- ... 93 (5): 507-12. doi:10.1007/bf00202813. PMID 8168825. S2CID 34824853. Chyan YJ, Strauss PR, Wood TG, Wilson SH (August 1996). " ... 243 (5408): 441-5. Bibcode:1973Natur.243..441O. doi:10.1038/243441a0. PMID 4591306. S2CID 4153800. Cabelof DC, Raffoul JJ, ...
... flanking region by deletion/substitution". J. Biol. Chem. 263 (24): 12020-7. doi:10.1016/S0021-9258(18)37887-6. PMID 3042787. ... untranslated region contains multiple copies of an Alu family repeat. In addition, this gene is polymorphic and three common ... "Complex arrangement of genes within a 220-kb region of double-duplicated DNA on human 2q37.1". Genomics. 73 (1): 50-5. doi: ... 261 (7): 3112-5. doi:10.1016/S0021-9258(17)35755-1. PMID 3512548. Ezra E, Blacher R, Udenfriend S (1984). "Purification and ...
... flanking region element responsible for the low level constitutive expression of the human cytosolic phospholipase A2 gene". ... flanking region surrounding a human cytosolic phospholipase A2 gene". Biochemical and Biophysical Research Communications. 205 ... 19 (4-5): 683-688. PMID 9745929. Hirabayashi T, Murayama T, Shimizu T (2005). "Regulatory mechanism and physiological role of ... 58 (5-6): 328-333. doi:10.1080/15216540600702289. PMID 16754327. S2CID 36287675. Sharp JD, White DL, Chiou XG, et al. (1991). " ...
... flanking region". J. Biol. Chem. 269 (7): 5279-87. doi:10.1016/S0021-9258(17)37685-8. PMID 8106512. Harada H, Kitagawa M, ... 40 (5): 976-82. PMID 10102295. Whitney LW, Becker KG, Tresser NJ, Caballero-Ramos CI, Munson PJ, Prabhu VV, Trent JM, McFarland ... 35 (5-6): 507-11. doi:10.1080/10428199909169615. PMID 10609788. Staal A, Enserink JM, Stein JL, Stein GS, van Wijnen AJ (2000 ... Intron-exon organization and functional analysis of 5'- ...
... flanking region of the human PTK6 gene". Biochim. Biophys. Acta. 1574 (3): 365-9. doi:10.1016/s0167-4781(02)00234-8. PMID ... 5 (7): 1767-77. PMID 10430081. Derry JJ, Richard S, Valderrama Carvajal H, et al. (2000). "Sik (BRK) Phosphorylates Sam68 in ... Kang KN, Kim M, Pae KM, Lee ST (2002). "Characterization of the 5'- ...
... flanking region of human aggrecanase-1 (ADAMTS4) gene". Molecular Biology Reports. 27 (3): 167-73. doi:10.1023/A:1007253930568 ... Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region that stacks against the active-site of the ... Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a ... 5 (3): 169-76. doi:10.1093/dnares/5.3.169. PMID 9734811. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, ...
... flanking region". The Journal of Biological Chemistry. 262 (28): 13662-13673. doi:10.1016/S0021-9258(19)76478-3. PMID 2888762. ... flanking region". The Journal of Biological Chemistry. 262 (28): 13662-13673. doi:10.1016/S0021-9258(19)76478-3. PMID 2888762. ... and a proline-rich region, and its light chain contains the protease domain. The structure of the FnI-EGF-like tandem domain of ... 2 (5): 549-558. doi:10.1182/bloodadvances.2018016337. PMC 5851424. PMID 29519898. Pathak M, Wilmann P, Awford J, Li C, Hamad BK ...
... flanking regulatory region". Gene. 294 (1-2): 259-68. doi:10.1016/S0378-1119(02)00798-9. PMID 12234688. Tiffin N, Williams RD, ... "The genomic organization and the full coding region of the human PAX7 gene". Genomics. 45 (1): 168-74. doi:10.1006/geno. ... 5 (1): 15-21. doi:10.1093/hmg/5.1.15. PMID 8789435. Vorobyov E, Mertsalov I, Dockhorn-Dworniczak B, Dworniczak B, Horst J ( ... "Structural and functional characterization of the human PAX7 5'- ...
... flanking region of the human beta-glucuronidase gene". Genomics. 10 (4): 1009-18. doi:10.1016/0888-7543(91)90192-H. PMID ... Marathe SV, McEwen JE (February 1995). "Vectors with the gus reporter gene for identifying and quantitating promoter regions in ... 274 (33): 23451-5. doi:10.1074/jbc.274.33.23451. PMID 10438523. Wong AW, He S, Grubb JH, Sly WS, Withers SG (December 1998). " ... 2 (6): 443-5. doi:10.1002/humu.1380020604. PMID 8111412. S2CID 46432543. Wu BM, Sly WS (1994). "Mutational studies in a patient ...
... flanking regulatory region of the murine serotonin transporter". Brain Research. Molecular Brain Research. 44 (2): 286-92. doi: ... 4 (5): 645. doi:10.1021/cn4001044. PMC 3656756. PMID 23862750. Alivisatos AP, Andrews AM, Boyden ES, Chun M, Church GM, ... Bengel D, Heils A, Petri S, Seemann M, Glatz K, Andrews A, Murphy DL, Lesch KP (March 1997). "Gene structure and 5'- ...
... flanking region of human genomic ETA gene". Biochemical and Biophysical Research Communications. 190 (2): 332-9. doi:10.1006/ ... 56 Suppl 5: 1303-7. doi:10.1253/jcj.56.supplementv_1303. PMID 1291713. Hosoda K, Nakao K, Tamura N, Arai H, Ogawa Y, Suga S, ... Yang H, Tabuchi H, Furuichi Y, Miyamoto C (January 1993). "Molecular characterization of the 5'- ...
... flanking region, and chromosomal localization of the human RGS3 gene". Genomics. 45 (2): 429-33. doi:10.1006/geno.1997.4929. ... 2002). "RGS3 interacts with 14-3-3 via the N-terminal region distinct from the RGS (regulator of G-protein signalling) domain ... 36 (1): 40-5. doi:10.1038/ng1285. PMID 14702039. Humphray SJ, Oliver K, Hunt AR, et al. (2004). "DNA sequence and analysis of ... 2002). "Additional 5' exons in the RGS3 locus generate multiple mRNA transcripts, one of which accounts for the origin of human ...
... flanking region of the human estrogen receptor gene". DNA Sequence. 2 (6): 347-358. doi:10.3109/10425179209020816. PMID 1476547 ... genomic organization of the human ERalpha gene promoter region". Molecular Endocrinology. 15 (12): 2057-2063. doi:10.1210/mend. ... 70 (5-7): 361-363. doi:10.1016/j.steroids.2005.02.015. PMID 15862818. S2CID 54297122. Wang CL, Tang XY, Chen WQ, Su YX, Zhang ... 6 (5): 773-785. doi:10.1210/mend.6.5.1603086. PMID 1603086. S2CID 25208340. Keaveney M, Klug J, Dawson MT, Nestor PV, Neilan JG ...
... flanking region of the Pigr gene contains a response element to glucocorticoids. This class of hormones increases the steady ... Cleavage occurs at the junction of the transmembrane region of the receptor and domain 5. pIgRs are capable of capturing IgA ... The quite long intracellular domain of the receptor, along with the transmembrane region, is responsible for the transduction ... Evidence for the involvement of multiple complementarity determining region (CDR)-like loops in receptor domain I". The Journal ...
... flanking region and structural organization". Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1395 (1): 62 ... 42 (Database issue): D490-5. doi:10.1093/nar/gkt1178. PMC 3965031. PMID 24270786. "Glycoside Hydrolase Family 59". CAZypedia. ...
... flanking region of the gene". Genomics. 19 (1): 91-6. doi:10.1006/geno.1994.1017. PMID 8188248. Byrne JA, Smith PJ (1993). "The ... This gene may play a role in malignancies and disease that involve this region. This gene is oriented in a head-to-tail ... It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. ... Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, ...
... flanking region". Genomics. 19 (2): 369-72. doi:10.1006/geno.1994.1072. PMID 8188267. Sparkes RS, Lee RH, Shinohara T, et al. ( ... 2000). "A 6-Mb high-resolution physical and transcription map encompassing the hereditary prostate cancer 1 (HPC1) region". ... doi:10.1016/S0021-9258(18)43955-5. PMID 7961975. Abe T, Kikuchi T, Shinohara T (1994). "The sequence of the human phosducin ...
... flanking region of the coagulation factor VII gene". J. Thromb. Haemost. 1 (6): 1220-7. doi:10.1046/j.1538-7836.2003.00227.x. ... 113 (5): 877-86. doi:10.1242/jcs.113.5.877. PMID 10671377. Hartley JL, Temple GF, Brasch MA (2001). "DNA Cloning Using In Vitro ... 5 (12): 1301-10. doi:10.1091/mbc.5.12.1301. PMC 301159. PMID 7696711. Faulkner NE, Vig B, Echeverri CJ, et al. (1998). " ... U.S.A. 92 (5): 1634-8. Bibcode:1995PNAS...92.1634W. doi:10.1073/pnas.92.5.1634. PMC 42574. PMID 7878030. Garces JA, Clark IB, ...
... flanking region of the human corticotropin releasing hormone gene". DNA Sequence. 4 (3): 197-206. doi:10.3109/10425179309015632 ... "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Letters. 267 (1): 1-5. ... 2 (5): 775-779. doi:10.1002/j.1460-2075.1983.tb01499.x. PMC 555184. PMID 6605851. Behan DP, Heinrichs SC, Troncoso JC, Liu XJ, ... 5 (2): 137-141. doi:10.1038/sj.mp.4000720. PMID 10822340. Saeed B, Fawcett M, Self C (February 2001). "Corticotropin-releasing ...
... flanking region and structural organization". Biochim. Biophys. Acta. 1395 (1): 62-67. doi:10.1016/S0167-4781(97)00140-1. PMID ... region". Hum. Mutat. 28 (7): 742. doi:10.1002/humu.9500. PMID 17579360. S2CID 1705020. Beier UH; Görögh T (2005). "Implications ... 5 (9): e12862. doi:10.1371/journal.pone.0012862. PMC 2943476. PMID 20877624. GeneReviews/NCBI/NIH/UW entry on Krabbe disease ... 1998). "Human galactocerebrosidase gene: promoter analysis of the 5'- ...
... flanking region of the human follicle-stimulating hormone receptor gene". Molecular and Cellular Endocrinology. 102 (1-2): 93- ... Upon initial binding to the LRR region of FSHR, FSH reshapes its conformation to form a new pocket. FSHR then inserts its ... "Structural predictions for the ligand-binding region of glycoprotein hormone receptors and the nature of hormone-receptor ... 8 (5): 413-21. doi:10.1093/humupd/8.5.413. PMID 12398222. Delbaere A, Smits G, Olatunbosun O, Pierson R, Vassart G, Costagliola ...
... flanking region for the human topoisomerase III gene". The Journal of Biological Chemistry. 273 (40): 26130-7. doi:10.1074/jbc. ... "Genes in a refined Smith-Magenis syndrome critical deletion interval on chromosome 17p11.2 and the syntenic region of the mouse ... "Gene for topoisomerase III maps within the Smith-Magenis syndrome critical region: analysis of cell-cycle distribution and ... 12 (5): 713-28. doi:10.1101/gr.73702. PMC 186594. PMID 11997338. Wang Y, Lyu YL, Wang JC (Sep 2002). "Dual localization of ...
... flanking region of CYP3A5: comparative analysis with CYP3A4 and CYP3A7". Biochemical and Biophysical Research Communications. ... 4 (5): 247-59. doi:10.1097/00008571-199410000-00003. PMID 7894497. Lown KS, Kolars JC, Thummel KE, Barnett JL, Kunze KL, ... 6 (5): 379-85. doi:10.1097/00008571-199610000-00001. PMID 8946469. Anttila S, Hukkanen J, Hakkola J, Stjernvall T, Beaune P, ... doi:10.1016/S0021-9258(18)81632-5. PMID 2732228. Schuetz JD, Molowa DT, Guzelian PS (November 1989). "Characterization of a ...
... flanking region of the human GIP receptor (GIPR) gene". Endocr. Res. 28 (4): 577. doi:10.1081/ERC-120016843. PMID 12530665. ... 2003). "Analysis of the putative promoter region of the GIP receptor gene (GIPR) in GIP-dependent Cushing's syndrome (CS)". ... 53 (5): 1326-1335. doi:10.2337/diabetes.53.5.1326. PMID 15111503. Gerhard DS, Wagner L, Feingold EA, et al. (2004). "The status ... doi:10.1016/0167-0115(96)00019-5. PMID 8795084. S2CID 42462407. N'Diaye N, Tremblay J, Hamet P, et al. (1998). "Adrenocortical ...
... flanking region of the transforming growth factor alpha gene". Mol. Endocrinol. 5 (12): 1955-63. doi:10.1210/mend-5-12-1955. ... 2 (5): 355-358. doi:10.1038/sj.mp.4000307. PMID 9322223. Ferrer, I.; Alcantara, S.; Ballabriga, J.; Olive, M.; Blanco, R.; ... 33 (5): 628-31. doi:10.1136/gut.33.5.628. PMC 1379291. PMID 1612477. Bean MF, Carr SA (1992). "Characterization of disulfide ... TGF-α has also been observed to be highly expressed in the suprachiasmatic nucleus (SCN) (5). This finding suggests a role for ...
... flanking region gene contains a "CAAT" consensus promoter sequence but no "TATA" sequence. The transcription start site is an ... 85 (1): 41-5. Bibcode:1988PNAS...85...41K. doi:10.1073/pnas.85.1.41. PMC 279477. PMID 3422424. Koike K, Urata Y, Koike M (Aug ... 284 (5): E855-62. doi:10.1152/ajpendo.00526.2002. PMID 12676647. Suzuki Y, Yoshitomo-Nakagawa K, Maruyama K, Suyama A, Sugano S ... There was an Alu family found in introns 2 and 8. The 5' ... and characterization of a full length-enriched and a 5'-end- ...
... flanking region". Mol. Endocrinol. 3 (9): 1448-54. doi:10.1210/mend-3-9-1448. PMID 2608068. Loric S, Egloff M, Domingo M, et al ... The gene localizes to a chromosomal region containing several closely related serine protease inhibitors (serpins). Transcortin ... 97 (1): E151-5. doi:10.1210/jc.2011-2022. PMID 22013108. Rosen MI, Shnider SM, Levinson G, Hughes (2002). Shnider and ... 1997). "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library". Gene. 200 (1-2): 149- ...
Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5flanking region contains the promoter, ... flanking region of eukaryotic genomes. A specific transcription factor called CAAT-binding protein binds to this region and ... untranslated region, this region is not transcribed into RNA or translated into a functional protein. These regions primarily ...
... flanking region for the human topoisomerase III gene. / Kim, Jun Chul; Yoon, Jong Bok; Koo, Hyeon Sook et al. In: Journal of ... flanking region for the human topoisomerase III gene, Journal of Biological Chemistry, vol. 273, no. 40, pp. 26130-26137. ... flanking region for the human topoisomerase III gene. In: Journal of Biological Chemistry. 1998 ; Vol. 273, No. 40. pp. 26130- ... flanking region for the human topoisomerase III gene. Journal of Biological Chemistry. 1998 Oct 2;273(40):26130-26137. doi: ...
... flanking region of IL12RB2 were examined in subjects with several types of periodontal disease and in healthy controls. Serum ... flanking region of IL12RB2, whose variants are frequently detected in lepromatous leprosy patients, in which the very weak ... flanking region of IL12RB2 are associated with susceptibility to periodontal diseases in the Japanese population.. Takeuchi- ...
... flanking region of HLA-B and HLA-C.. AB - Two DNA probes isolated from the region 5′ to the HLA-B gene are described. One of ... flanking region of the HLA-B gene to examine polymorphism at the HLA-B locus, Human Immunology, vol. 16, no. 2, pp. 137-147. ... flanking region of the HLA-B gene to examine polymorphism at the HLA-B locus. In: Human Immunology. 1986 ; Vol. 16, No. 2. pp. ... flanking region of the HLA-B gene to examine polymorphism at the HLA-B locus. Human Immunology. 1986 Jun;16(2):137-147. doi: ...
3 flanking region TCTTCTTYTTTTTTGCAGGTATAGGCAGC Indel CCTTTC Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589 ...
... flanking region CTACTGCACATGATGCCAAGAACTCTATTACATTGTTACAAAAGAACCAA 3 flanking region ...
Total - Total depth of deletion variants (must have flanking states in read) ... 5. 21023. 0.000237834752414023. 0.000301575681676824. A_MP. 668. 1. CATCC-AGTTC. FALSE. 2. 21411. 9.34099294755033e-05. ...
... flanking region AGTTTGTATCATATGTTTAGTGTGGAATTTTGAGTGTTTTTTCTTTGGCC 3 flanking region ...
3 flanking region TAACAAAGGCGAAGTACTTCAAAGGCTTTTTCTCAACCGTAGGTGCAGGATTGATGTTCGCTCTTTACCTCCCTGTCATGGAGAAGATATACCAAANAGT SNP ...
... flanking region TACAAGCACACCCCTCAATATTTAATACTCATCTCGTATTTGAAATTGAA 3 flanking region ...
... flanking region. Genomics. 1 December 1996. 38:155-165. [QxMD MEDLINE Link]. [Full Text]. ... A single-base deletion in the 3-coding region of glycogen-debranching enzyme is prevalent in glycogen storage disease type ... 5] Over 200 mutations-including missense, nonsense, splice site, small frame shift deletions and insertions, and large gene ... Human glycogen debranching enzyme gene (AGL): complete structural organization and characterization of the 5 ...
We find 116 887 and 137 557 nucleosome-depleted regions (NDRs) in human and mouse FGCs, covering a large set of germline- ... D) Endogenous DNA methylation distribution along the gene body regions and their flanking regions in mouse PGCs and somatic ... This allows the open chromatin regions, closed chromatin regions and undetected chromatin regions to be discriminated. Moreover ... Endogenous DNA methylation distribution along the gene body regions and their flanking regions in human fetal germ cells and ...
... flanking region, to identify any new SNPs.. As shown in Table 5, 11 of the 16 samples analyzed had the same SNP profile, which ... flanking region to exon 5 was carried out using primers 5′-F1 and Exon 5R (Zhang et al., 2003), generating a 4592-bp fragment. ... flanking region (Table 5). However, the sequences of these new *1 haplotypes (i.e., the linkages between the contributing SNPs ... flanking region of human CYP1A2 gene: effect on the CYP1A2 inducibility in humans. J Biochem 125: 803-808. ...
... flanking region of the human DNA helicase B (. HELB. ) gene and its response to trans. -resveratrol. Scientific Reports. 2016; ... flanking region of the human TP53. gene and its response to the natural compound, resveratrol. Journal of Biochemistry. 2016;. ... The bHLH proteins contain a basic region and HLH motif, which is comprised of two α-helices separated by a loop [9]. The bHLH ... Hot spot somatic mutations are observed in the promoter regions of the human cancer genomes [35]. Binding of the TFs on the ...
... flanking region common to both CYP2D6Ch genes were found. To evaluate the origin of the detrimental mutation in the genes, ... flanking regions were introduced into a Hep G2/simian virus 40 expression system with chloramphenicol acetyltransferase as a ... A part of the upstream region of base pairs -1407 to -1068 was found to constitute an enhancer element, but the CYP2D6Ch- ... The ability of the upstream regions to bind nuclear factors was also evaluated using gel-shift analysis. Furthermore, several ...
... flanking region. The 5′-flanking sequence was analyzed online by PlantCare7 and PLACE8 at default settings. ... The basic region, helixes, loop and zip regions were marked. (D) Alignment of the BIF/ACT-like domain. The secondary structure ... The coding region of TcMYC2a was inserted into the pCAMBIA1303 vector with Nco I and BstE II restriction sites under control of ... TcMYC2a-pGADT7R2 and pGADT7 were digested by EcoR I and Xma I, the coding region of TcMYC2a were inserted into pGADT7 to ...
... flanking region". Genomics. 38 (2): 155-65. doi:10.1006/geno.1996.0611. PMID 8954797.. ... untranslated region. Exons 4-35 encode the remaining 1505 amino acids of the AGL gene.[3] Studies produced by the department of ... ISBN 0-7167-8724-5.. *↑ 6.0 6.1 6.2 Hondoh H, Saburi W, Mori H, et al. (May 2008). "Substrate recognition mechanism of alpha-1, ... 141 (5): 627-34. doi:10.1093/jb/mvm065. PMID 17317688.. *↑ Zhai, Liting; Feng, Lingling; Xia, Lin; Yin, Huiyong; Xiang, Song ( ...
Upstream and downstream flanking regions of gene nadA (AFUA_6G14470) were amplified by PCR using primer pairs 6G14470_5for ( ... end of the upstream flanking region and at the 5-end of the downstream flanking region of the nadA gene. The ptrA resistance ... The palm domain consists of a seven-stranded central β-sheet flanked by two short α-helices and two 310 helices. As described ... The residues are found in three distinct regions and are coloured according to their location in the sequence. C Comparison of ...
... flanking region of the CYP3A4 gene. Here, the chromatin status of three regions in the 5′-flanking region of the CYP3A4 gene ... A reporter plasmid containing the CYP3A4 proximal promoter region and distal enhancer region (Fig. 4B, pGL3/CYP3A4-362-7.7k; ... B) The structure of pGL3/CYP3A4-362-7.7k plasmid containing CYP3A4 proximal promoter region and distal enhancer region. siNEAT1 ... flanking region of the CYP3A4 gene is relaxed by treatment with PXR ligands (Kurosawa et al., 2023). We surmised the ...
... size of loxP-flanked region is 5.0 kb).. *A polyadenylation signal (hGHpA: human Growth Hormone polyadenylation signal) has ... The remaining recombination sites are located in non-conserved regions of the genome. ... Cre mediated deletion of exons 2 to 5 should result in loss of function of the Nfe2l2 gene by deleting most of the gene. ... Exons 2 to 5 have been flanked by loxP sites ( ...
Top: Primers which bind to the flanking regions and span the deleted region. Middle: Gene specific primers for celA (indicates ... Grey shaded area signifies the amplified region using primers spanning the region of interest. A. Amplification of flanking ... Bottom: Primers which bind to the flanking regions and span the region deleted. Lanes are products from the reactions including ... For testing the system in C. michiganensis CASJ002, ~1.5 kB regions within two permissive regions, hit region 1 (HR1) and 3 ( ...
... flanking region of the human PDGF alpha R gene. This 5 flanking region is a functional promoter of the PDGF alpha R gene as ... This effect is mediated through specific transcription factor binding within the -52/+118 region of the PDGF alpha R gene. ... promoter deletion mutants revealed that the region from -441 to +118, relative to the transcription initiation site, is ... This study describes the molecular cloning of the non-coding exon 1 and approximately 2 kb of 5 ...
... flanking region, respectively. A reaction mixture (total volume of 20 μl) consisted of 1xPCR buffer, dNTPs (200 μM), Taq DNA ... Finally, the cDNA including the entire coding region of the ayu rhodopsin was obtained by PCR amplification with a pair of ... The cDNA probe for ayu rhodopsin (396 bp: from nucleotide 701 in the open reading frame to 1095 in the 3′-untranslated region) ... untranslated regions (rv2). The reverse transcriptase treatment for total RNA purified from ayu brain was omitted in lane 3 (N. ...
... flanking region, a 924 bp open reading frame (ORF) and a 536 bp 3 flanking region. The deduc... ... Region-Specific Induction of FosB/ΔFosB by Voluntary Alcohol Intake: Effects of Naltrexone ... Using RNA extracted from Zantedeschia aethiopica young leaves and primers designed according to the conservative regions of ... Using RNA extracted from Zingiber officinale rhizomes and primers designed according to the conservative regions of monocot ...
Download Region Data. For any specified genomic region, download genomic DNA (FASTA format), all aligned/computed transcripts ... Search for any CsGDBgene or aligned sequence by ID or keyword, and download complete sequence or flanking 5 or 3 regions, ... View a sample region of scaffold 1001 Genome / Gene Models. The genome assembly displayed at CsGDB is version JGI v1.0; gene ... Sequence analysis tools accessed from the Genome Context View menu use the current genomic region as input. Or, to access the ...
... flanking region. Biochim Biophys Acta. 2000 Mar 17. 1500 (3):323-34. [QxMD MEDLINE Link]. ... Updated birth prevalence and relative frequency of mucopolysaccharidoses across Brazilian regions. Genet Mol Biol. 2021. 44 (1 ... flanking region. Genomics. 1994 Mar 1. 20 (1):99-104. [QxMD MEDLINE Link]. ... 3, 4, 5, 6, 8, 9, 10, 11] The severity of bone and cartilage damage differs by the severity of the phenotype (mild, ...
... seed match to the 5 end of the microRNA. Recently however, it has been shown that this requirement might be too stringent, ... Difference in G + C content between the target site and the upstream flanking region. ... To analyze whether this is due to the chosen flanking sequences, we tested other flanking settings and found 30 nt upstream and ... flanking regions was taken to be 20 nucleotides, unless otherwise stated.. Compactness. We reasoned that hybrids that are more ...
... flanking region efficiently directed the expression of the luciferase reporter gene in Y79 cells [22]. Our promoter studies ... Kanya Moolsuwan,1 Tiravut Permpoon,2 Chanachai Sae-Lee,3 Mongkol Uiprasertkul,4 Viroj Boonyaratanakornkit,5 Pa-thai ... 2013; 45:580-5. [PMID: 23715323] * Tsukamoto K, Jackson IJ, Urabe K, Montague PM, Hearing VJ. A second tyrosinase-related ... RB-associated mortality rates are relatively high in developing countries [4]. The 5-year overall survival rate is 73% for Thai ...
  • The 5′ flanking region is a region of DNA that is adjacent to the 5′ end of the gene. (wikipedia.org)
  • These regions primarily function in the regulation of gene transcription. (wikipedia.org)
  • If a transcription factor binds to an enhancer in a 5′ flanking region, the DNA strand bends in a way that the transcription factor that is bound to the enhancer can also bind the promoter of a gene. (wikipedia.org)
  • Silencers are DNA sequences found in the 5′ flanking region of eukaryotic genes, assisting in the silencing of a gene. (wikipedia.org)
  • A 12 base pair insertion in the 5′ flanking region of the Cystatin B gene has been linked to some individuals with Unverricht-Lundborg disease. (wikipedia.org)
  • Polymorphisms in the 5′ flanking region of the DRD4 gene have been linked to ADHD, schizophrenia and methamphetamine abuse. (wikipedia.org)
  • Insertions and deletions in the 5′ flanking region of the insulin gene have been associated with type 2 diabetes. (wikipedia.org)
  • Polymorphisms in the 5′ flanking region of the gene coding for oxytocin have been linked to mutations in promoter function, ultimately leading to potential disorders related to altered oxytocin levels and functionality. (wikipedia.org)
  • In this study, we focused on well-conserved binding elements for the transcription factors for ATF6, NF-Y and YY1 and the Sp1 and Ets families in the 5'-flanking region of the mouse ALG12 gene. (nih.gov)
  • Hybrid hGH-N, hGH-V and hCS-A genes containing 5'-flanking sequences, including the endogenous promoter, are preferentially expressed in rat pituitary tumor (GC) cells, after gene transfer. (nih.gov)
  • The gene polymorphisms of the 5' flanking region of IL12RB2 were examined in subjects with several types of periodontal disease and in healthy controls. (bvsalud.org)
  • We transfected a human liver-derived cell line (HepG2) with various CYP3A4 -luciferase reporter gene constructs containing a nested set of 5′-deletions of the CYP3A4 5′-flanking region. (aspetjournals.org)
  • Pathogenic Escherichia coli , but not nonpathogenic E. coli , activate a p50/p65 NF-κB complex that binds to oligonucleotides corresponding to a recognition site located within the 5′ flanking region of the human GAL1R gene. (jci.org)
  • Organization of the human corticosteroid binding globulin gene and analysis of its 5'-flanking region. (wikipedia.org)
  • Human glycogen debranching enzyme gene (AGL): complete structural organization and characterization of the 5' flanking region. (medscape.com)
  • Polymorphisms rs4795895 and rs3744508 were located in the 5′ flanking region and the coding region of the eotaxin 1 gene, respectively. (medscape.com)
  • [ 23 ] Polymorphism CCR5 rs1799987 is located at position 59,029 in the promoter region of CCR5 gene. (medscape.com)
  • Involvement of 5'-flanking kB-like sites within bcl-x gene in silica-induced bcl-x expression. (cdc.gov)
  • DNA sequence analysis revealed that there are several kappaB-like sites within the 5'-flanking region of the bcl-x gene. (cdc.gov)
  • Loss of hGR mRNA expression resulted from 5′-deletion of the hGR gene and nonsense mutations in exon 6. (aacrjournals.org)
  • MADH4 mutated in a combined syndrome of juvenile polyposis and HHT (JPHT), and an unidentified HHT3 gene linked to chromosome 5. (bmj.com)
  • Additional screens for MMTV provirus entry sites in tumors revealed several other upregulated genes that are associated with other gene development pathways such as INT2, INT3, and INT4 [4,5,6]. (chemdiv.com)
  • Using DGS we were able to determine the sequence of the 5'- and 3'-termini and flanking regions, as well as the sequence of the gene itself. (go.jp)
  • The gm-hra gene expression cassette is composed of the promoter sequence of soybean S-adenosyl-L-methionine synthetase (P-SAMS), the 5' untranslated region of the soybean SAMS gene ( 5'UTR-SAMS ) flanking an intron (I-SAMS), a modified version of the acetolactate synthase gene from soybean ( gm-hra ), and the terminator region of the acetolactate synthase gene from soybean ( T-als ). (sourcewatch.org)
  • The segment of DNA that controls the regulation of transcription of a gene is known as the promoter region. (biomedcentral.com)
  • Changes that occur in a promoter region may alter the binding of a transcription activating or suppressing factor, altering the rate of transcription of the gene. (biomedcentral.com)
  • Therefore, gene X -505 indicates that the SNP is 505 bp upstream of the X gene, potentially in the promoter region. (biomedcentral.com)
  • Gene X +505 indicates the SNP is 505 bp downstream of the transcription activating site, potentially in an exon or intronic region. (biomedcentral.com)
  • Intron/exon gene organization and analysis of the 5'-flanking region. (smpdb.ca)
  • D'Alessio M, Bernard M, Pretorius PJ, de Wet W, Ramirez F: Complete nucleotide sequence of the region encompassing the first twenty-five exons of the human pro alpha 1(I) collagen gene (COL1A1) Gene. (smpdb.ca)
  • Enhancers are DNA sequences found in 5′ flanking regions of eukaryotic genes that affect transcription. (wikipedia.org)
  • In order to calculate the sequence identity between human and chimpanzee homologs, we constructed 5'-end consensus sequences of 226 chimpanzee genes by aligning at least three sequences for individual genes. (nih.gov)
  • PI-2 is a 7-kb region located between the genes that in PI-2-containing isolates and the fi nding that isolates of encode peptidase T (PepT) and ferrochelatase (HemH) ( 9 ). (cdc.gov)
  • all identifi ed serotypes expressed highly conserved PI-2 pili The region is composed of 5 genes, which encode 2 sur- supports their potential as a vaccine candidate. (cdc.gov)
  • The coding region is very similar to that of the retroviral genome, consisting of genes closely related to the gag and pol of retroviruses. (jove.com)
  • Furthermore, MTG-Link was able to fully characterize large insertion variants and deletion breakpoints in a human genome and to reconstruct dark regions in clinically-relevant human genes. (biomedcentral.com)
  • Direct genomic DNA sequencing (DGS) of Butyrivibrio fibrisolvens 16S rDNA genes, and of regions 3' and 5' to the genes, was achieved using a linear amplification sequencing reaction with a single oligonucleotide primer, without prior cloning or amplification of the target sequence. (go.jp)
  • The rate at which genes are transcribed is controlled by a variety of nuclear proteins that bind to different areas of DNA in the 5' (upstream) region from the first exon. (biomedcentral.com)
  • For promoter polymorphisms we will sequence 500-bp of 5'-flanking region. (usda.gov)
  • The nucleotide sequence of the coding region predicts a 620-amino acid protein with a calculated M(r) of 69,853. (tcdb.org)
  • We report here the genomic structure of ABCG1 along with the 5' flanking sequence using library screening and BLAST search analysis. (lih.lu)
  • The interaction between miR-281 and its predicted target sequence, the DENV-2 genomic 5 ' -untranslated region (UTR), is confirmed in the context of a plasmid-based reporter system. (biomedcentral.com)
  • The region of DNA which borders the 5' end of a transcription unit and where a variety of regulatory sequences are located. (nih.gov)
  • The only known information is its location on a genome and therefore its left and right flanking sequences. (biomedcentral.com)
  • 3. Characterization of the promoter region and genomic organization of GLI, a member of the Sonic hedgehog-Patched signaling pathway. (nih.gov)
  • Using 2 genomic probes extending into the 5-prime and 3-prime flanking regions, respectively, Cox et al. (coriell.org)
  • sfRNA is a product of incomplete degradation of genomic RNA by the cell 5'-3' exoribonuclease XRN1 which stalls at highly ordered secondary RNA structures at the beginning of the 3'UTR. (mdpi.com)
  • 12. Expression of MUC5AC, an early marker of pancreatobiliary cancer, is regulated by DNA methylation in the distal promoter region in cancer cells. (nih.gov)
  • A first-generation array that measured methylation levels at 22,290 CpG dinucleotides in 77 lymphoblastoid cell lines was used to detect associations between genome-wide SNPs and CpG methylation 5 . (nature.com)
  • We investigated methylation status of 5' flanking region of DAPK by combined bisulfite restriction analysis and bisulfited DNA sequencing. (nih.gov)
  • Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. (wikipedia.org)
  • Polymorphisms in this region can lead to changes in the regulation of transcription. (wikipedia.org)
  • Polymorphisms in the 5' flanking region of IL12RB2 are associated with susceptibility to periodontal diseases in the Japanese population. (bvsalud.org)
  • Deletion and restriction enzyme analyses of this domain have now identified two separate enhancer regions that respond to phenobarbital (from 5900 to 4550 and from 1956 to 1400). (edu.au)
  • Finally, we demonstrate cooperativity between elements within the distal enhancer region and cis -acting elements in the proximal promoter of CYP3A4 . (aspetjournals.org)
  • 1999, PI-2-containing isolates were of the same serotypes kb genetic region present in 21%-27% of clinical isolates, but accounted for only 3.6% of all invasive isolates. (cdc.gov)
  • A region of DNA that encodes a protein product is called an exon. (biomedcentral.com)
  • The responsive region was functional regardless of its position or orientation relative to the proximal promoter of CYP3A4 and was capable of conferring rifampicin-inducible expression on a heterologous promoter. (aspetjournals.org)
  • To elucidate the role of the cell -mediated immune (CMI) response in the pathogenesis of periodontitis , Japanese periodontal patients were subjected to single nucleotide polymorphism (SNP) analyses of the 5' flanking region of IL12RB2, whose variants are frequently detected in lepromatous leprosy patients , in which the very weak cellular immune response is caused by low expression of IL-12Rbeta2. (bvsalud.org)
  • A novel 5'-flanking region polymorphism of macrophage migration inhibitory factor is associated with systemic-onset juvenile idiopathic arthritis. (cdc.gov)
  • Two non-coding regions, referred to as the 5'-untranslated region (UTR) and the 3'-UTR, flank the protein-coding regions of the genome. (aacc.org)
  • The internal coding region of LTR retrotransposons and their mechanism of transposition closely resembles a retroviral genome. (jove.com)
  • Here, we define local assembly as the de novo assembly of a specific region of the genome using the sequencing reads coming from whole genome shotgun sequencing. (biomedcentral.com)
  • We found a novel polymorphic short tandem repeat (FUT2/01), 3.8 kb downstream of the coding region of FUT2. (wayne.edu)
  • Arthritis and rheumatism 2001 Aug 44 (8): 1782-5. (cdc.gov)
  • A specific transcription factor called CAAT-binding protein binds to this region and aids in transcription in eukaryotes. (wikipedia.org)
  • Bacterial RNA polymerase binds to these regions to align itself and begin transcription. (wikipedia.org)
  • First, the host cell RNA Polymerase II binds to the 5' LTR and starts transcribing the retrotransposon into a single RNA strand. (jove.com)
  • Other promoter elements found in eukaryotic 5′ flanking regions include initiator elements, downstream core promoter element, CAAT box, and the GC box. (wikipedia.org)
  • 2011. NADPH oxidase overexpression in human colon cancers and rat colon tumors induced by 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). . (oregonstate.edu)
  • We identified a single tick-specific amino acid variant in the viral glycoprotein region that dramatically reduces its fusion activity in human cells, providing evidence that a glycoprotein precursor variant, present in ticks, has severely impaired function in human cells. (elifesciences.org)
  • The LTR retrotransposons consist of a 5-7kb long protein-coding region flanked at both ends by long terminal repeats, typically 250-600 bp in length. (jove.com)
  • In vitro DNase I footprint analysis of this region revealed four protected sites (FP1, FP2, FP3, and FP4). (aspetjournals.org)
  • 2003. Mutational analysis of Ctnnb1 and Apc in tumors from rats given 1,2-dimethylhydrazine or 2-amino-3-methylimidazo[4,5-f]quinoline: mutational 'hotspots' and the relative expression of beta-catenin and c-jun. . (oregonstate.edu)
  • Whereas galanin increases short-circuit current (Isc) approximately 5-fold in uninfected T84 cells, exposure to pathogenic, but not nonpathogenic, E. coli results in galanin increasing Isc approximately 20-fold. (jci.org)
  • Furthermore, children born to HCV-infected mothers, as well as healthcare, emergency medical, and public safety workers who may have been exposed to HCV-positive blood from a needle stick injury or mucosal exposure should be screened ( 5 ). (aacc.org)
  • The 5′ flanking region contains the promoter, and may contain enhancers or other protein binding sites. (wikipedia.org)
  • SNP locations will be mapped onto conserved regions and likely transcription factor binding sites to predict possible functional significance. (usda.gov)
  • In eukaryotes, the 5′ flanking region has a complex set of regulatory elements such as enhancers, silencers, and promoters. (wikipedia.org)
  • Molecular diagnosis & therapy 2014 Oct 18 (5): 549-57. (cdc.gov)
  • Treatment with 5-aza-2'-deoxycytidine restored DAPK expression in heavily methylated cell lines tested, and histone deacetylase inhibitor trichostatin A alone restored DAPK expression in some methylated cell lines as well. (nih.gov)
  • 5%) in at least one of two independent data sets. (nature.com)
  • It is typically 10 nucleotides long, and is present -30 to -20 nucleotides upstream from the transcription start site, in the core promoter region. (wikipedia.org)
  • Not to be confused with the 5′ untranslated region, this region is not transcribed into RNA or translated into a functional protein. (wikipedia.org)
  • The 5'-UTR is the main target detected in nucleic acid-based assays, while serologic assays detect HCV antibodies directed against peptides c22-3, c33c, and c100-3 that are derived from the various viral proteins. (aacc.org)
  • Extensive linkage disequilibrium was found with the PI Z allele throughout the probe region, but not with the normal PI M allele. (coriell.org)
  • Since then, the variant has spread through Europe with a frequency gradient extending from north to south: 5% of Scandinavians, 4% of Britains, 1 to 2% of southern Europeans, and 3% of the heterogeneous white population in the United States are MZ heterozygotes. (coriell.org)
  • A single-base deletion in the 3'-coding region of glycogen-debranching enzyme is prevalent in glycogen storage disease type IIIA in a population of North African Jewish patients. (medscape.com)
  • At age 3 years, the patient had kyphosis, and an abnormal gait was present by age 5 years. (medscape.com)
  • 2002. Response of Apc(min) and A33 (delta N beta-cat) mutant mice to treatment with tea, sulindac, and 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). . (oregonstate.edu)
  • The epitope of 3E7 was mapped between alpha o amino acids 13-88, a region which has been implicated in the interaction between alpha- and beta gamma-subunits. (researchgate.net)
  • LTR retrotransposons are class I transposable elements with long terminal repeats flanking an internal coding region. (jove.com)
  • The clone consists of a coding region 1863 bp long (including the termination codon), flanked by a 376 bp-long 5' non-coding region and a 625 bp-long 3' non-coding region. (tcdb.org)
  • A stem cell filtering screening enrichment and quickly compounding device, comprises a filter (1), a dual three-way board (2), an elongate pipe (3), a blood circulation driver (4) and a piece of porous material (5). (onacademic.com)
  • Scandinavian journal of rheumatology 0 36 (5): 390-3. (cdc.gov)
  • Curiously, there is a reciprocal distribution of the S variant form: 10% in southern Europe to 5% in the north. (coriell.org)
  • Arginine (R) in hos15-3, and the target region for the CRISPR system (hos15CRISPR). (konkuk.ac.kr)
  • In fact, only two mild cases of illness have been associated with Europe 2 strains, while other CCHF virus strains circulating in this region have caused thousands of more severe illnesses. (elifesciences.org)
  • [ 24 ] Chemokine receptor 5 ( CCR5 ) is the receptor for expressed on regulated on activation, normal T cell expressed and secreted (RANTES). (medscape.com)
  • fi ned area, we examined 590 S. pneumoniae isolates from Pili have recently been identifi ed on several gram- population-based surveillance of invasive pneumococcal positive bacteria ( 5 - 7 ). (cdc.gov)
  • A minimum prevalence rate of HHT is estimated to be 1 in 10 000 1 and higher in some geographically isolated regions. (bmj.com)
  • A higher prevalence (1:2351) is reported in the Haut Jura region of France. (bmj.com)