Methylophilus methylotrophus: A species of METHYLOPHILUS which is motile by single flagella. In addition to growth on methanol as a sole carbon source, growth also occurs on glucose. (From Bergey's Manual of Determinative Bacteriology, 9th ed)DNA Restriction-Modification Enzymes: Systems consisting of two enzymes, a modification methylase and a restriction endonuclease. They are closely related in their specificity and protect the DNA of a given bacterial species. The methylase adds methyl groups to adenine or cytosine residues in the same target sequence that constitutes the restriction enzyme binding site. The methylation renders the target site resistant to restriction, thereby protecting DNA against cleavage.Deoxyribonucleases, Type II Site-Specific: Enzyme systems containing a single subunit and requiring only magnesium for endonucleolytic activity. The corresponding modification methylases are separate enzymes. The systems recognize specific short DNA sequences and cleave either within, or at a short specific distance from, the recognition sequence to give specific double-stranded fragments with terminal 5'-phosphates. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC 3.1.21.4.DNA-Cytosine Methylases: Methylases that are specific for CYTOSINE residues found on DNA.Methylophilus: A genus of straight or slightly curved gram-negative rods occurring singly or in pairs and isolated from sludge, mud, and river and pond water. (From Bergey's Manual of Determinative Bacteriology, 9th ed)DNA Cleavage: A reaction that severs one of the covalent sugar-phosphate linkages between NUCLEOTIDES that compose the sugar phosphate backbone of DNA. It is catalyzed enzymatically, chemically or by radiation. Cleavage may be exonucleolytic - removing the end nucleotide, or endonucleolytic - splitting the strand in two.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Gram-Negative Aerobic Bacteria: A large group of aerobic bacteria which show up as pink (negative) when treated by the gram-staining method. This is because the cell walls of gram-negative bacteria are low in peptidoglycan and thus have low affinity for violet stain and high affinity for the pink dye safranine.Deoxyribonucleases, Type I Site-Specific: Enzyme systems containing three different subunits and requiring ATP, S-adenosylmethionine, and magnesium for endonucleolytic activity to give random double-stranded fragments with terminal 5'-phosphates. They function also as DNA-dependent ATPases and modification methylases, catalyzing the reactions of EC 2.1.1.72 and EC 2.1.1.73 with similar site-specificity. The systems recognize specific short DNA sequences and cleave at sites remote from the recognition sequence. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC 3.1.21.3.S-Adenosylmethionine: Physiologic methyl radical donor involved in enzymatic transmethylation reactions and present in all living organisms. It possesses anti-inflammatory activity and has been used in treatment of chronic liver disease. (From Merck, 11th ed)5,10-Methylenetetrahydrofolate Reductase (FADH2): An FAD-dependent oxidoreductase found primarily in BACTERIA. It is specific for the reduction of 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate. This enzyme was formerly listed as EC 1.1.1.68 and 1.1.99.15.Methylenetetrahydrofolate Reductase (NADPH2): A flavoprotein amine oxidoreductase that catalyzes the reversible conversion of 5-methyltetrahydrofolate to 5,10-methylenetetrahydrofolate. This enzyme was formerly classified as EC 1.1.1.171.Oxidoreductases Acting on CH-NH Group Donors: Enzymes catalyzing the dehydrogenation of secondary amines, introducing a C=N double bond as the primary reaction. In some cases this is later hydrolyzed.5-Methyltetrahydrofolate-Homocysteine S-Methyltransferase: An enzyme that catalyzes the formation of methionine by transfer of a methyl group from 5-methyltetrahydrofolate to homocysteine. It requires a cobamide coenzyme. The enzyme can act on mono- or triglutamate derivatives. EC 2.1.1.13.Methylenetetrahydrofolate Dehydrogenase (NADP): An NADP-dependent oxidoreductase that catalyses the conversion of 5,10-methyleneterahydrofolate to 5,10-methenyl-tetrahydrofolate. In higher eukaryotes a trifunctional enzyme exists with additional METHENYLTETRAHYDROFOLATE CYCLOHYDROLASE and FORMATE-TETRAHYDROFOLATE LIGASE activity. The enzyme plays an important role in the synthesis of 5-methyltetrahydrofolate, the methyl donor for the VITAMIN B12-dependent remethylation of HOMOCYSTEINE to METHIONINE via METHIONINE SYNTHETASE.Methylenetetrahydrofolate Dehydrogenase (NAD+)Homocysteine: A thiol-containing amino acid formed by a demethylation of METHIONINE.Folic Acid: A member of the vitamin B family that stimulates the hematopoietic system. It is present in the liver and kidney and is found in mushrooms, spinach, yeast, green leaves, and grasses (POACEAE). Folic acid is used in the treatment and prevention of folate deficiencies and megaloblastic anemia.Vitamin B 12: A cobalt-containing coordination compound produced by intestinal micro-organisms and found also in soil and water. Higher plants do not concentrate vitamin B 12 from the soil and so are a poor source of the substance as compared with animal tissues. INTRINSIC FACTOR is important for the assimilation of vitamin B 12.Methionine: A sulfur-containing essential L-amino acid that is important in many body functions.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Search Engine: Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.Quaternary Ammonium Compounds: Derivatives of ammonium compounds, NH4+ Y-, in which all four of the hydrogens bonded to nitrogen have been replaced with hydrocarbyl groups. These are distinguished from IMINES which are RN=CR2.Mallory Bodies: Cytoplasmic hyaline inclusions in HEPATOCYTES. They are associated with ALCOHOLIC STEATOHEPATITIS and non-alcoholic STEATOHEPATITIS, but are also present in benign and malignant hepatocellular neoplasms, and metabolic, toxic, and chronic cholestatic LIVER DISEASES.Chloride Peroxidase: An enzyme that catalyzes the chlorination of a range of organic molecules, forming stable carbon-chloride bonds. EC 1.11.1.10.Retroperitoneal Space: An area occupying the most posterior aspect of the ABDOMINAL CAVITY. It is bounded laterally by the borders of the quadratus lumborum muscles and extends from the DIAPHRAGM to the brim of the true PELVIS, where it continues as the pelvic extraperitoneal space.Ammonia: A colorless alkaline gas. It is formed in the body during decomposition of organic materials during a large number of metabolically important reactions. Note that the aqueous form of ammonia is referred to as AMMONIUM HYDROXIDE.CobamidesFree Radicals: Highly reactive molecules with an unsatisfied electron valence pair. Free radicals are produced in both normal and pathological processes. They are proven or suspected agents of tissue damage in a wide variety of circumstances including radiation, damage from environment chemicals, and aging. Natural and pharmacological prevention of free radical damage is being actively investigated.Ammonium Sulfate: Sulfuric acid diammonium salt. It is used in CHEMICAL FRACTIONATION of proteins.Cations: Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.Ammonium Chloride: An acidifying agent that has expectorant and diuretic effects. Also used in etching and batteries and as a flux in electroplating.
*  ETF
... may refer to: Exchange-traded fund, a financial investment vehicle Early termination fee, the total fee that will be charged for early termination of a contract or agreement Employees' Trust Fund (ETF) A social security programme conducted by the Sri Lankan government. European Training Foundation, a vocational training organization European Transport Workers' Federation, federation of transport worker's trade unions Emergency Task Force, a tactical unit of the Toronto Police ETF Ride Systems, a Dutch amusement ride manufacturer European triode festival, an annual gathering of audio aficionados, mostly from Europe Escape the Fate, a post-hardcore band Evangelical Theological Faculty, a private university of theology in Leuven, Belgium Enriched text format Electron-transferring flavoprotein, a metabolic macromolecule Electrothermal ...
*  Electron-transferring-flavoprotein dehydrogenase
... (ETF dehydrogenase or electron transfer flavoprotein-ubiquinone oxidoreductase, EC 1.5.5.1) is an enzyme that transfers electrons from electron-transferring flavoprotein in the mitochondrial matrix, to the ubiquinone pool in the inner mitochondrial membrane. It is part of the electron transport chain. The enzyme is found in both prokaryotes and eukaryotes and contains a flavin and FE-S cluster. In humans, it is encoded by the ETFDH gene. Deficiency in ETF dehydrogenase causes the human genetic disease multiple acyl-CoA dehydrogenase deficiency. ETQ-QO links the oxidation of fatty acids and some amino acids to oxidative phosphorylation in the mitochondria. Specifically, it catalyzes the transfer of electrons from electron transferring flavoprotein (ETF) to ubiquinone, reducing it to ubiquinol. The entire sequence of transfer reactions is as follows: Acyl-CoA → Acyl-CoA dehydrogenase → ETF → ETF-QO → UQ → Complex III. The overall reaction ...
*  Grete Kellenberger-Gujer
... (1919-2011) was a Swiss molecular biologist known for her discoveries on genetic recombination and restriction modification system of DNA. She was a pioneer in the genetic analysis of bacteriophages and contributed to the early development of molecular biology. After earning her matura in classics at the Töchterschule in Zürich, Grete Gujer studied chemistry at the Swiss Federal Institute of Technology in Zurich. There, she met Eduard Kellenberger, a physics student. The couple married in 1945. In 1946 they moved to Geneva, where Eduard Kellenberger began his doctoral work thesis under the supervision of Jean Weigle, professor of physics at the University of Geneva. Grete Kellenberger contributed to the development of new methods to prepare and analyse biological samples using an electron microscope, a new technique at the time. After Jean Weigle left for the California Institute of Technology in 1948, Grete Kellenberger took on an increasingly important role in the ...
*  Hok/sok system
The hok/sok system is a postsegregational killing mechanism employed by the R1 plasmid in Escherichia coli. It was the first type I toxin-antitoxin pair to be identified through characterisation of a plasmid-stabilising locus. It is a type I system because the toxin is neutralised by a complementary RNA, rather than a partnered protein (type II toxin-antitoxin). The hok/sok system involves three genes: hok, host killing - a long lived (half-life 20 minutes) toxin sok, suppression of killing - a short lived (half-life 30 seconds) RNA antitoxin mok, modulation of killing - required for hok translation When E. coli undergoes cell division, the two daughter cells inherit the long-lived hok toxin from the parent cell. Due to the short half-life of the sok antitoxin, daughter cells inherit only small amounts and it quickly degrades. If a daughter cell has inherited the R1 plasmid, it has inherited the sok gene and a strong promoter which brings about high levels of transcription. So much so that in an ...
*  List of restriction enzyme cutting sites: Ba-Bc
This article contains a list of the most studied restriction enzymes whose names start with Ba to Bc inclusive. It contains approximately 120 enzymes. The following information is given: Enzyme: Accepted name of the molecule, according to the internationally adopted nomenclature, and bibliographical references. (Further reading: see the section "Nomenclature" in the article "Restriction enzyme".) PDB code: Code used to identify the structure of a protein in the PDB database of protein structures. The 3D atomic structure of a protein provides highly valuable information to understand the intimate details of its mechanism of action. Source: Organism that naturally produces the enzyme. Recognition sequence: Sequence of DNA recognized by the enzyme and to which it specifically binds. Cut: Cutting site and DNA products of the cut. The recognition sequence and the cutting site usually match, but sometimes the cutting site can be dozens of nucleotides away from the recognition site. Isoschizomers and ...
*  Restriction site
... s, or restriction recognition sites, are locations on a DNA molecule containing specific (4-8 base pairs in length) sequences of nucleotides, which are recognized by restriction enzymes. These are generally palindromic sequences (because restriction enzymes usually bind as homodimers), and a particular restriction enzyme may cut the sequence between two nucleotides within its recognition site, or somewhere nearby. For example, the common restriction enzyme EcoRI recognizes the palindromic sequence GAATTC and cuts between the G and the A on both the top and bottom strands, leaving an overhang (an end-portion of a DNA strand with no attached complement) known as a sticky end on each end of AATT. This overhang can then be used to ligate in (see DNA ligase) a piece of DNA with a complementary overhang (another EcoRI-cut piece, for example). Some restriction enzymes cut DNA at a restriction site in a manner which leaves no overhang, called a blunt end. Blunt ends are much less likely ...
*  Restriction map
A restriction map is a map of known restriction sites within a sequence of DNA. Restriction mapping requires the use of restriction enzymes. In molecular biology, restriction maps are used as a reference to engineer plasmids or other relatively short pieces of DNA, and sometimes for longer genomic DNA. There are other ways of mapping features on DNA for longer length DNA molecules, such as mapping by transduction. One approach in constructing a restriction map of a DNA molecule is to sequence the whole molecule and to run the sequence through a computer program that will find the recognition sites that are present for every restriction enzyme known. Before sequencing was automated, it would have been prohibitively expensive to sequence an entire DNA strand. To find the relative positions of restriction sites on a plasmid, a technique involving single and double restriction digests is used. Based on the sizes of the resultant DNA fragments the positions of the sites can be inferred. Restriction ...
*  HpaII
... (IntEnz: EC 3.1.21.4) is a restriction enzyme obtained from the microorganism called Haemophilus parainfluenzae. It is a DNA restriction enzyme, therefore it has the ability to cut the DNA from certain region as demonstrated below. It has the ability to produce cohesive ends, which are rather useful in constructing plasmids. HpaII will not cut sites that have been methylated by SssI methyltransferase or HpaII methyltransferase. When the sites have been methylated by MspI methyltransferase, the enzyme will cut 300 times slower than unmethylated DNA and 50 times slower if the DNA is hemi-methylated. This feature is exploited for determination of the clonal origin of a mammalian female tumor through HUMARA assay. InterPro: IPR019062 McClelland, M., Nelson, M., Raschke, E. (1994). Nucleic Acids Research 22, No. 17, 3640-3659 ...
*  Grete Kellenberger-Gujer
... (1919-2011) was a Swiss molecular biologist known for her discoveries on genetic recombination and restriction modification system of DNA. She was a pioneer in the genetic analysis of bacteriophages and contributed to the early development of molecular biology. After earning her matura in classics at the Töchterschule in Zürich, Grete Gujer studied chemistry at the Swiss Federal Institute of Technology in Zurich. There, she met Eduard Kellenberger, a physics student. The couple married in 1945. In 1946 they moved to Geneva, where Eduard Kellenberger began his doctoral work thesis under the supervision of Jean Weigle, professor of physics at the University of Geneva. Grete Kellenberger contributed to the development of new methods to prepare and analyse biological samples using an electron microscope, a new technique at the time. After Jean Weigle left for the California Institute of Technology in 1948, Grete Kellenberger took on an increasingly important role in the ...
*  HpaII
... (IntEnz: EC 3.1.21.4) is a restriction enzyme obtained from the microorganism called Haemophilus parainfluenzae. It is a DNA restriction enzyme, therefore it has the ability to cut the DNA from certain region as demonstrated below. It has the ability to produce cohesive ends, which are rather useful in constructing plasmids. HpaII will not cut sites that have been methylated by SssI methyltransferase or HpaII methyltransferase. When the sites have been methylated by MspI methyltransferase, the enzyme will cut 300 times slower than unmethylated DNA and 50 times slower if the DNA is hemi-methylated. This feature is exploited for determination of the clonal origin of a mammalian female tumor through HUMARA assay. InterPro: IPR019062 McClelland, M., Nelson, M., Raschke, E. (1994). Nucleic Acids Research 22, No. 17, 3640-3659 ...
*  Mothers Club
O Mothers Club (ex- Carlton Ballroom) foi um clube em Erdington, distrito de Birmingham, West Midlands, que esteve em funcionamento entre o final da década de 1960 e início da de 1970. O clube estava localizado por cima de uma loja de mobiliário antigo, e abriu em 9 de Agotos de 1968. O Mothers, gerido por John 'Spud' Taylor e pelo promotor Phil Myatt, encerrou a sua actividade em3 de Janeiro de 1971. Entre estas datas, actuaram mais de 400 artistas, muitos dos quais continuaram as suas carreiras com muito sucesso. Algumas das gravações mais conhecidas que aqui tiveram lugar foram as de Ummagumma, dos Pink Floyd, 27 de Abril de April 1969, e partes de Facelift dos Soft Machine, incluída no álbum Third, em 11 de Janeiro de 1970. Os Who toaram Tommy e a estreia dos Traffic aconteceu neste clube: Também os primeiros concertos dos Black Sabbath tiveram aqui lugar. Outras bandas e artistas conhecidos que actuaram no clube incluem: Family, Fleetwood Mac, John Mayall & the Bluesbreakers, ...
*  Grete Kellenberger-Gujer
... (1919-2011) was a Swiss molecular biologist known for her discoveries on genetic recombination and restriction modification system of DNA. She was a pioneer in the genetic analysis of bacteriophages and contributed to the early development of molecular biology. After earning her matura in classics at the Töchterschule in Zürich, Grete Gujer studied chemistry at the Swiss Federal Institute of Technology in Zurich. There, she met Eduard Kellenberger, a physics student. The couple married in 1945. In 1946 they moved to Geneva, where Eduard Kellenberger began his doctoral work thesis under the supervision of Jean Weigle, professor of physics at the University of Geneva. Grete Kellenberger contributed to the development of new methods to prepare and analyse biological samples using an electron microscope, a new technique at the time. After Jean Weigle left for the California Institute of Technology in 1948, Grete Kellenberger took on an increasingly important role in the ...
*  Lista de primatas fósseis
Esta é uma lista de primatas fósseis - primatas extintos pelos quais são conhecidos fósseis. Primatas evoluíram de mamíferos não especializados, pequenos, e que se alimentavam de insetos e frutos. Entretanto, a origem dos primatas é controversa, inclusive, se sua origem provém de um ancestral arborícola é questionável. Como tem sido sugerido, muitos outras ordens de mamíferos são arborícolas e não desenvolveram as mesmas características dos primatas. Atualmente, alguns gêneros bem conhecidos, como Plesiadapis e Purgatorius, embora considerados como mais antigos primatas, não têm sido considerados como tal por alguns autores recentes, que tendem a inclui-los em uma outra ordem, Plesiadapiformes, dentro da superordem Euarchontoglires. Alguns, para evitar confusão, utilizam o termo Euprimata, excluindo Plesiadapiformes. Tal denominação não é usada aqui. Há um debate também de quando os primeiros primatas surgiram. Um dos provavelmente mais antigos fósseis de primatas é ...
Indian Patents. 235777:ISOLATED DNA OBTAINABLE FROM METHYLOPHILUS METHYLOTROPHUS CODING FOR AN MMEI-LIKE ENDONCLEASE AND A...  Indian Patents. 235777:'ISOLATED DNA OBTAINABLE FROM METHYLOPHILUS METHYLOTROPHUS CODING FOR AN MMEI-LIKE ENDONCLEASE AND A...
Other nucleotides outside the MmeI recognition sequence were also methylated for other studies/ but since MmeI does not have any sequence specifity for these nucleotides this does affect MmeI activity and these other methylations are omitted here for clarity.) Duplex DNA was formed by mixing 100µl top strand oligo (14µM stock) with 100µl bottom strand oligo (14µM stock), heating to 85°C and cooling slowly to 30°C over a time of 20 minutes. MmeI was then used to cleave the oligo pairs in a 30 µl reaction of 1X NEBuffer4, 2.5 µM oligo, 100 µM SAM and 2.5 units MmeI. As a control, restriction endonuclease Hpyl88I was also used to cleave the oligo DNA. The Hpyl88I recognition sequence overlaps the first 5 nucleotides of the MmeI recognition sequence in this DNA, 5'-TCNGA-3' and is blocked by methylation at the adenine in either strand of the DNA. MmeI was found to cleave unmethylated DNA as expected. In contrast to previous teaching (Tucholski, Gene 223:293-302 (1998)) MmeI did not cleave ...
more infohttp://www.allindianpatents.com/patents/235777-isolated-dna-obtainable-from-methylophilus-methylotrophus-coding-for-an-mmei-like-endonclease-and-a-method-for-producing-the-same
MEDLINE - Resultado p gina 1  MEDLINE - Resultado p gina 1
MmeI from Methylophilus methylotrophus belongs to the type II restriction-modification enzymes. It recognizes an asymmetric DNA sequence, 5'-TCCRAC-3' (R indicates G or A), and cuts both strands at fixed positions downstream of the specific site. This particular feature has been exploited in transcript profiling of complex genomes (using serial analysis of gene expression technology). We have shown previously that the endonucleolytic activity of MmeI is strongly dependent on the presence of S-adenosyl-l-methionine (J. Nakonieczna, J. W. Zmijewski, B. Banecki, and A. J. Podhajska, Mol. Biotechnol. 37:127-135, 2007), which puts MmeI in subtype IIG. The same cofactor is used by MmeI as a methyl group donor for modification of an adenine in the upper strand of the recognition site to N(6)-methyladenine. Both enzymatic activities reside in a single polypeptide (919 amino acids [aa]), which puts MmeI also in subtype IIC of the restriction-modification systems. Based on a molecular model, generated ...
more infohttp://bases.bireme.br/cgi-bin/wxislind.exe/iah/online/?IsisScript=iah/iah.xis&nextAction=lnk&base=MEDLINE&lang=p&format=standard.pft&indexSearch=EX&exprSearch=B03.440.400.425.525.520.500
Beroccas Night on Full Blast at Hyve | MZine.TV Multi-Media Magazine  Berocca's Night on Full Blast at Hyve | MZine.TV Multi-Media Magazine
To top off last year's hugely successful Berocca Night on Full Blast, Berroca this year "Did it three times!". This year Berocca teamed up with Magic's Boys Night out: Sam YG, Slick Rick and Toni Tony for a three party series on absolute full blast. Not only did they elevate Berocca's Night on Full Blast from awesome party to epic party series, this year Berocca Night on Full Blast's first two legs were in Davao and Cebu before the big finish in Manila.. The boys of Boys Night Out don't host events in Davao or Cebu often, but this time around they came to party on full blast. To give a little twist to the series, Berocca's avid fans had to guess each of the party venues. Those who got VIP passes to the Davao leg guessed which city is known for Durian and Mangosteen. The Davao leg was the first stop on August 9, at the Starr Club Bar. The Clue for the Cebu leg was 'Sinulog', the Cebu party crowd rocked the Pent House last September 13. The final leg of the epic party trilogy was of course in ...
more infohttp://www.mzine.tv/beroccas-night-on-full-blast-at-hyve/
Watch Pressures On Full Episode - Swamp People | HISTORY  Watch Pressure's On Full Episode - Swamp People | HISTORY
Watch the Pressure's On full episode from Season 8, Episode 7 of HISTORY's series Swamp People. Get more of your favorite full episodes only on HISTORY.
more infohttp://www.history.com/shows/swamp-people/season-8/episode-7
Lucas Tafur: May 2011  Lucas Tafur: May 2011
Electrons carried by NADH+ are transferred to Complex I, also called NADH dehydrogenase. Complex II, succinate dehydrogenase, is the same enzyme encountered in the Krebs Cycle, which oxidizes succinate and transfers electrons to FADH2. Studies have shown that Complex I and complex III are the main producers of ROS in the electron transport chain (1, 2, 3, 4)*. So, the ratio of NADH+:FADH2 is important for the potential ROS production in the mitochondria. Because glucose generates 5 times more NADH+ than FADH2, complex I activity is increased. Fatty acid oxidation produces only twice the amount of NADH+ than FADH2, shifting to a more balanced utilization between complex I and complex II. There are other ways to pass electrons into the respiratory chain. In the first step of the beta oxidation pathway, catalyzed by acyl-CoA dehydrogenase, electrons from the substrate are transferred to the FAD of the dehydrogenase, then to ...
more infohttp://lucastafur.blogspot.com/2011/05/
Metal ion binding to peptides: oxygen or nitrogen sites?  Metal ion binding to peptides: oxygen or nitrogen sites?
Infrared multiple-photon dissociation (IRMPD) spectroscopy was used to probe the conformations of gas-phase metal-ion complexes between a series of five metal ions and six small peptide ligands. This report is presented in recognition and tribute for the Armentrout group's long and hugely productive interest in metal-ion binding to gas-phase ligands. The metal ions (K+, Ba2+, Ca2+, Mg2+, Ni2+) span a range of ligand binding strengths, and the ligands include several dipeptides and tripeptides, and one tetrapeptide. The weaker metal ions generally form charge-solvated (CS) complexes binding amide carbonyl oxygen, while the strongest metal ion, nickel, deprotonates the amide nitrogens, probably through iminol tautomerization, and binds to the amide nitrogens. The Amide II vibrational mode (1500-1550 cm−1) is found to be an excellent marker for the presence or absence of protons on amide nitrogens in a complex. The magnesium ion marks a boundary between these two structural motifs, forming iminol ...
more infohttp://dare.uva.nl/search?metis.record.id=381413
Find great deals on full mouth dental implants   - The Perfect Smile UK  Find great deals on full mouth dental implants - The Perfect Smile UK
Outstanding results that our patients are looking for. The Perfect Smile offers dental customers full mouth dental implants and full dentures in Wandsworth, London and across local area - find a dentist or dental information quickly and easily.
more infohttps://www.theperfectsmile.co.uk/uk/london/wandsworth/find-great-deals-on-full-mouth-dental-implants.php
Restriction Map of SWP82/YFL049W  Restriction Map of SWP82/YFL049W
seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21419. MboII , Tsp4CI* , , TspDTI Hin4II* Hin4II* , , , Hpy178III* MmeI ,MnlI \ \ \ \ \ \ \\ ATGCTTGGCGAAGATGAAGGGAATACCGTTCTTGAAAAGGGAAATAATCCTTCTGTAAAA 10 20 30 40 50 60 ----:----,----:----,----:----,----:----,----:----,----:----, TACGAACCGCTTCTACTTCCCTTATGGCAAGAACTTTTCCCTTTATTAGGAAGACATTTT / / // / / // Hin4II* , ,, Hpy178III* MmeI ,MnlI , ,TspDTI Hin4II* , Tsp4CI* MboII M L G E D E G N T V L E K G N N P S V K C L A K M K G I P F L K R E I I L L * N A W R R * R E Y R S * K G K * S F C K T ----:----,----:----,----:----,----:----,----:----,----:----, X S P S S S P F V T R S F P F L G E T F X A Q R L H L S Y R E Q F P F Y D K Q L H K A F I F P I G N K F L S I I R R Y F Hpy188I AluI , FatI CviJI Csp6I , ,CviAII SetI , SetI ,RsaI , ,, NlaIII \ \ \ \\ \ \\ \ CAAGGAGAGGTTGGAGCTGTATTTATAGTACCCAAAATACTTATCAGAGAACATGAAAGA 70 80 90 100 110 120 ----:----,----:----,----:----,----:----,----:----,----:----, ...
more infohttps://www.yeastgenome.org/cgi-bin/getSeq?seq=YFL049W&flankl=0&flankr=0&map=rmap
VelocityShares 3x financial ratios analysis | UGAZ - Macroaxis  VelocityShares 3x financial ratios analysis | UGAZ - Macroaxis
VelocityShares 3x Long Natural Gas ETN (UGAZ) Etf fundamentals including VelocityShares 3x financial ratios analysis. VelocityShares 3x Etf fundamentals VelocityShares 3x financial ratios analysis | UGAZ - Macroaxis,fundamentals of VelocityShares 3x and UGAZ financial ratio
more infohttp://www.macroaxis.com/invest/market/UGAZ--fundamentals--VelocityShares-3x-Long-Natural-Gas-ETN
Full Creel | Grove Atlantic  Full Creel | Grove Atlantic
'Nick Lyons's impressive narrative skills are on full display, making readers not only see but feel the nuances of the angler's art and the watery stages on which they're played out.' -The Wall Street Journal
more infohttp://groveatlantic.com/book/full-creel/
Crop Factor Explained  Crop Factor Explained
2. Some lenses are made specifically for crop-sensor cameras, but "standard" lenses still work on crop-sensor bodies.. 3a. A camera's "sensor" is really a grid of millions of individual sensors, evenly spaced out in an x-y grid. Like, 18Million, or 22Million individual sensors, or pixels. Pixels that make up your image.. 3b. There often isn't really that much difference in sheer number of pixels between Full and Crop sensors. In fact, let's say they are exactly the same number of pixels between Full Frame and Crop Sensors, for argument's sake. Hold onto this point.. 4. On Full Frame sensors, the pixels are spaced out more, have more room to breathe, they are less dense. And this gives better image in low light, especially. Sensor sites, pixels, create less noise when they are spread out farther. (Read on, if you want to understand more. Otherwise skip to point 5.) Keeping sensors away from each other reduces the noise from the sensor. Take that as a scientific property of sensors, a fact. This ...
more infohttps://digital-photography-school.com/crop-factor-explained/
DSLR for Beginners - Aperture Priority Mode | TaPhotos  DSLR for Beginners - Aperture Priority Mode | TaPhotos
Once you get a fancy new camera, you just cannot stick to the automatic settings. Something makes you get the best out of it, but where to start from? Taking up online photography course is a good idea to help you dip toes in the water. If you don't have enough time because, for example, you are about to go on vacation, we'll give you suggestions how to test on your DSLR.. When you are on vacation, many sights you want to capture are static: buildings, landscapes etc. However, most sights are fleeting, challenging to capture. For this reason, most DSLR beginners keep a camera on full automatic mode in order to concentrate only on the composition. However, Program mode is usually not enough to face all the challenges, so it's better to use Aperture Priority - AV mode. What you choose in this mode is, obviously, the aperture. So, your camera will adjust the shutter speed for the right exposure, depending on your choice of how much light you would like to let into the shot. Typically, lenses have ...
more infohttp://taphotos.com/photography-tips/dslr-for-beginners-aperture-priority-mode/
Thermaltake Frio OCK Review | APH Networks  Thermaltake Frio OCK Review | APH Networks
I guess it is easy to tell which one is stock, and running at 77 degrees isn't exactly something I'd be comfortable with. Then again, it is expected with the stock fan running on stock settings. The Thermaltake Frio OCK offered a temperature delta of only 2 degrees over a range of 900rpm. With the fan speed set to 2100rpm, we got a reading of 45c, and with the fan speed set to 1200rpm, we got a reading of 47c. The best way to put this, running the Frio OCK on full speed isn't very practical, and offers only marginal gains from tests. The NH-D14 sat right in the middle of the two Frio OCK tests at 46 degrees, giving it almost equivalent performance to the Frio OCK at full speed.. From the temperature perspective, the Frio OCK did a very good job, but how about from the noise perspective? As we all know, loudness is subjective, and varies to the individual -- but let's rank the Frio OCK on the standardized APH perception scale. Let 0.0 be silent and 10.0 be the sound of a tornado blowing up a ...
more infohttp://aphnetworks.com/reviews/thermaltake_frio_ock
Disoriented Neurons: 2008  Disoriented Neurons: 2008
To get off at Kurla is no-job at all! You just have to stand amongst the fellow passengers; even if you don't wanna get off, you shall find yourself on the platform. When my train has just stopped at the station, the other central line train is about to enter the station in just about a minute. So, I have to go through the over-bridge full of people from platform no. 7 to platform no. 3 in that much time, reach the ladies compartment and also board the fully crowded - over-flowing train! I put the volume of my player on full and run for my life, through the 1000 odd people coming from all direction! The only time ever when I regret being short is this. You see, my nose just reaches the arm-pits of majority men, ahem. Well, but there is also a bright side. I am also lucky for not having considerable height, I can act jerry and run through all these people just by a little excessive use of my elbows :- ...
more infohttp://randomtalkfest.blogspot.com/2008/
HDCN:  Review of article by Minutolo et al.
 <B>Postdialytic rebound of serum phosphorus</B>: Pathogenetic and clinical
...  HDCN: Review of article by Minutolo et al. <B>Postdialytic rebound of serum phosphorus</B>: Pathogenetic and clinical ...
The abstract of this article is available from JASN online. Full text access is now restricted to ASN members and JASN subscribers. Go to this link (click on FULL TEXT links at the upper right box on this page ...
more infohttp://www.hdcn.com/02/004jami.htm
Preparing for an Interview - A Guide by Parity Consulting | Parity Consulting  Preparing for an Interview - A Guide by Parity Consulting | Parity Consulting
As part of our Parity Plus value-add offering to our clients and candidates, we have put together a comprehensive Interview Guide to assist those who may have an interview coming up, want to brush up on their skills or to understand how to deal with a counter offer.. We have put this into a flipbook for some light reading for those looking to start preparing themselves for a change in 2018! Click on "Full screen" option to view it in full!. ...
more infohttp://www.parityconsulting.com.au/news_events/preparing-interview-guide-parity-consulting/
Read Walk Hard Oscar Advertisment  Read Walk Hard Oscar Advertisment
The last few months of any year, the trade papers are full of "For Your Consideration" advertisements. All the little artsy films being plastered on full page ads by the mini majors in hopes of Oscar gold.. Columbia Pictures has released a clever "For Your Consideration" advertisement for the Judd Apatow-produced musical comedy Walk Hard: The Dewey Cox Story. But I don't think John C Reilly is going to take home any gold this year after flipping off Academy members, but that's probably the whole point.. Walk Hard: The Dewey Cox Story hits theaters on December 21st 2007.. via: DeadlineHollywood ...
more infohttp://www.slashfilm.com/walk-hard-oscar-advertisment/
Cheap Curacne Interaction (Page 1) - Test forum - My site  Cheap Curacne Interaction (Page 1) - Test forum - My site
Not even finished with my first set of doses(probably around 80% of the way there), I started seeing major results. My skin is smoother and less breakouts even after eating fried chicken. Only side effects were trouble sleeping and breathing. I also had chapped lips. Not really much pyschological effects like depression or loss of interest.. accutane order otc. accutane mail order shopping. cheap accutane tabs. accutane price rite aid. claravis high street. nimegen 10mg for skin health generic name brand name. nimegen 20mg aid. All weekend orders will be processed on Monday.. on full stomach accutane. Providing our clients with the best possible services available online we aim the steady development of our business, and that is why we work hard to enlarge our audience by stimulating seasonal sales and special offers for our regular customers.. To order a product online, you just have to place your order on our site.. accutane 30mg 20 pills $73.68. cost of accutane cream. time black list check ...
more infohttp://genesishosting456.com/PunBB/viewtopic.php?pid=161238
Temperature Rising | Readers Digest  Temperature Rising | Reader's Digest
Even though it was warm outside, the heat was on full blast in my office at the hospital. So I asked our nursing unit secretary to get someone to fix it. This was a one-man job, so I could not figure out why two guys showed up - until I was handed the maintenance request form. It read 'Head nurse is hot.'. ...
more infohttps://www.rd.com/joke/temperature-rising/
EpiPen debacle is symptom of sick health care under Obama | New York Post  EpiPen debacle is symptom of sick health care under Obama | New York Post
Last week all the things that ail our crummy, screwed-up health care system were on full display. The linchpin of the problem is the EpiPen debacle and the...
more infohttps://nypost.com/2016/08/27/epipen-debacle-is-symptom-of-sick-healthcare-under-obama/
CPU temperature always high  CPU temperature always high
Hy. I just changed my motherboard,earlier i had an msi motherboard all was ok my AMD Athlon XP overclocked from 1800+ to 2400+ temperature was fine between 40 and 50 Celsius only on full use it gone up to 50+. The problem is now with the new mot...
more infohttps://www.computing.net/answers/cpus/cpu-temperature-always-high/16318.html
An Ancient Japanese Aesthetic, Revived in Milan  An Ancient Japanese Aesthetic, Revived in Milan
Designers are rebelling against the notion of pristine objects. This year at Milan's Furniture Fair, that trend is on full display. But it's actually an ancient idea. For hundreds of years, Japan's dominant aesthetic has been wabi sabi, which values the impermanent, imperfect, and incomplete. You know wabi sabi, if you've ever been to Japan or seen Japanese design-it's the rationale behind the mottled, asymmetric design in traditional houses, pottery, and gardens.
more infohttps://www.fastcompany.com/1272935/ancient-japanese-aesthetic-revived-milan
The Stevie Times: The DC Trip  The Stevie Times: The DC Trip
We left Thursday morning... which there was a torrential down pour of rain. It rained 2 1/2 inches in a 20 minute time frame (which is a lot!)... needless to say driving to DC was pretty crazy. Even with the wipers on full blast we could barely see! All of this rain caused...POWER OUTAGES... which included the temple. Ugh! So we headed right to the hotel, got settled, and then hit the pool. Sarah's FAVORITE part of the trip. I think she would live in a pool if we let her, so it was a very fun night ...
more infohttp://thestevietimes.blogspot.com/2010/08/dc-trip.html
My Crazy Week  My Crazy Week
Hi All -- this post might be somewhat off-topic for some of the groups I am emailing but I wanted to get the news out in just one shot so please bear with me.......No I did NOT YET have the baby......... I have, however been offline most of the time as I am now on full bedrest -- technically
more infohttp://www.budget101.com/showthread.php/13114-My-Crazy-Week
SPCR • View topic - The silent beast: PC-C34F-based 8-HDD HTPC  SPCR • View topic - The silent beast: PC-C34F-based 8-HDD HTPC
So for now I reverted to the good old dual-ball Verax Ventilatoren Typ 80KPE with the NTC placed between two heatpipes, it seems to work well, min speed in idle and max speed on full load (which on a HTPC will be rare). For aux fan, the original Lian-li 80 placed near the PSU and spun down to 850 RPM via Q-fan. I swapped the UCEV12 in the HDD cage (same problem as the UCEV8: max speed at 35 °C...) with a Noctua NF-P12, undervolted with a combo of LNA (black) adapter and Q-fan: 710 RPM ...
more infohttp://www.silentpcreview.com/forums/viewtopic.php?p=528241

No FAQ available that match "5 10 methylenetetrahydrofolate reductase fadh2"