4-Hydroxyphenylpyruvate Dioxygenase: An enzyme that catalyzes the conversion of 4-hydroxyphenylpyruvate plus oxygen to homogentisic acid and carbon dioxide. EC 1.13.11.27.Homogentisic AcidTyrosinemias: A group of disorders which have in common elevations of tyrosine in the blood and urine secondary to an enzyme deficiency. Type I tyrosinemia features episodic weakness, self-mutilation, hepatic necrosis, renal tubular injury, and seizures and is caused by a deficiency of the enzyme fumarylacetoacetase. Type II tyrosinemia features INTELLECTUAL DISABILITY, painful corneal ulcers, and keratoses of the palms and plantar surfaces and is caused by a deficiency of the enzyme TYROSINE TRANSAMINASE. Type III tyrosinemia features INTELLECTUAL DISABILITY and is caused by a deficiency of the enzyme 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE. (Menkes, Textbook of Child Neurology, 5th ed, pp42-3)Delftia acidovorans: A species of gram-negative rod-shaped bacteria found ubiquitously and formerly called Comamonas acidovorans and Pseudomonas acidovorans. It is the type species of the genus DELFTIA.Homogentisate 1,2-Dioxygenase: A mononuclear Fe(II)-dependent oxygenase, this enzyme catalyzes the conversion of homogentisate to 4-maleylacetoacetate, the third step in the pathway for the catabolism of TYROSINE. Deficiency in the enzyme causes ALKAPTONURIA, an autosomal recessive disorder, characterized by homogentisic aciduria, OCHRONOSIS and ARTHRITIS. This enzyme was formerly characterized as EC 1.13.1.5 and EC 1.99.2.5.Calorimetry: The measurement of the quantity of heat involved in various processes, such as chemical reactions, changes of state, and formations of solutions, or in the determination of the heat capacities of substances. The fundamental unit of measurement is the joule or the calorie (4.184 joules). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Metals: Electropositive chemical elements characterized by ductility, malleability, luster, and conductance of heat and electricity. They can replace the hydrogen of an acid and form bases with hydroxyl radicals. (Grant & Hackh's Chemical Dictionary, 5th ed)Dioxygenases: Non-heme iron-containing enzymes that incorporate two atoms of OXYGEN into the substrate. They are important in biosynthesis of FLAVONOIDS; GIBBERELLINS; and HYOSCYAMINE; and for degradation of AROMATIC HYDROCARBONS.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Cyclohexanones: Cyclohexane ring substituted by one or more ketones in any position.Search Engine: Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.Hematoporphyrins: Iron-free derivatives of heme with 4 methyl groups, 2 hydroxyethyl groups and 2 propionic acid groups attached to the pyrrole rings. Some of these PHOTOSENSITIZING AGENTS are used in the PHOTOTHERAPY of malignant NEOPLASMS.Databases, Genetic: Databases devoted to knowledge about specific genes and gene products.Agrochemicals: Chemicals used in agriculture. These include pesticides, fumigants, fertilizers, plant hormones, steroids, antibiotics, mycotoxins, etc.Chitin: A linear polysaccharide of beta-1->4 linked units of ACETYLGLUCOSAMINE. It is the second most abundant biopolymer on earth, found especially in INSECTS and FUNGI. When deacetylated it is called CHITOSAN.Chitin Synthase: An enzyme that converts UDP glucosamine into chitin and UDP. EC 2.4.1.16.Electrophoresis, Capillary: A highly-sensitive (in the picomolar range, which is 10,000-fold more sensitive than conventional electrophoresis) and efficient technique that allows separation of PROTEINS; NUCLEIC ACIDS; and CARBOHYDRATES. (Segen, Dictionary of Modern Medicine, 1992)Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Pesticides: Chemicals used to destroy pests of any sort. The concept includes fungicides (FUNGICIDES, INDUSTRIAL); INSECTICIDES; RODENTICIDES; etc.Biomass: Total mass of all the organisms of a given type and/or in a given area. (From Concise Dictionary of Biology, 1990) It includes the yield of vegetative mass produced from any given crop.Soil: The unconsolidated mineral or organic matter on the surface of the earth that serves as a natural medium for the growth of land plants.Pest Control, Biological: Use of naturally-occuring or genetically-engineered organisms to reduce or eliminate populations of pests.Brassinosteroids: Plant steroids ubiquitously distributed throughout the plant kingdom. They play essential roles in modulating growth and differentiation of cells at nanomolar to micromolar concentrations.Vitamin K 1: A family of phylloquinones that contains a ring of 2-methyl-1,4-naphthoquinone and an isoprenoid side chain. Members of this group of vitamin K 1 have only one double bond on the proximal isoprene unit. Rich sources of vitamin K 1 include green plants, algae, and photosynthetic bacteria. Vitamin K1 has antihemorrhagic and prothrombogenic activity.Vitamin K: A lipid cofactor that is required for normal blood clotting. Several forms of vitamin K have been identified: VITAMIN K 1 (phytomenadione) derived from plants, VITAMIN K 2 (menaquinone) from bacteria, and synthetic naphthoquinone provitamins, VITAMIN K 3 (menadione). Vitamin K 3 provitamins, after being alkylated in vivo, exhibit the antifibrinolytic activity of vitamin K. Green leafy vegetables, liver, cheese, butter, and egg yolk are good sources of vitamin K.Electron Transport: The process by which ELECTRONS are transported from a reduced substrate to molecular OXYGEN. (From Bennington, Saunders Dictionary and Encyclopedia of Laboratory Medicine and Technology, 1984, p270)Vitamin E: A generic descriptor for all TOCOPHEROLS and TOCOTRIENOLS that exhibit ALPHA-TOCOPHEROL activity. By virtue of the phenolic hydrogen on the 2H-1-benzopyran-6-ol nucleus, these compounds exhibit varying degree of antioxidant activity, depending on the site and number of methyl groups and the type of ISOPRENOIDS.Plastoquinone: Polyunsaturated side-chain quinone derivative which is an important link in the electron transport chain of green plants during the photosynthetic conversion of light energy by photophosphorylation into the potential energy of chemical bonds.Chorismate Mutase: An isomerase that catalyzes the conversion of chorismic acid to prephenic acid. EC 5.4.99.5.Ubiquinone: A lipid-soluble benzoquinone which is involved in ELECTRON TRANSPORT in mitochondrial preparations. The compound occurs in the majority of aerobic organisms, from bacteria to higher plants and animals.Shikimic Acid: A tri-hydroxy cyclohexene carboxylic acid important in biosynthesis of so many compounds that the shikimate pathway is named after it.Vitamin K Deficiency: A nutritional condition produced by a deficiency of VITAMIN K in the diet, characterized by an increased tendency to hemorrhage (HEMORRHAGIC DISORDERS). Such bleeding episodes may be particularly severe in newborn infants. (From Cecil Textbook of Medicine, 19th ed, p1182)Vitamin K 2: A group of substances similar to VITAMIN K 1 which contains a ring of 2-methyl-1,4-naphthoquinione and an isoprenoid side chain of varying number of isoprene units. In vitamin K 2, each isoprene unit contains a double bond. They are produced by bacteria including the normal intestinal flora.Prolamins: A group of seed storage proteins restricted to the POACEAE family. They are rich in GLUTAMINE and PROLINE.Avena sativa: A plant species of the family POACEAE that is widely cultivated for its edible seeds.Transcriptome: The pattern of GENE EXPRESSION at the level of genetic transcription in a specific organism or under specific circumstances in specific cells.Polyploidy: The chromosomal constitution of a cell containing multiples of the normal number of CHROMOSOMES; includes triploidy (symbol: 3N), tetraploidy (symbol: 4N), etc.Seeds: The encapsulated embryos of flowering plants. They are used as is or for animal feed because of the high content of concentrated nutrients like starches, proteins, and fats. Rapeseed, cottonseed, and sunflower seed are also produced for the oils (fats) they yield.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Genomics: The systematic study of the complete DNA sequences (GENOME) of organisms.Molecular Sequence Annotation: The addition of descriptive information about the function or structure of a molecular sequence to its MOLECULAR SEQUENCE DATA record.High-Throughput Nucleotide Sequencing: Techniques of nucleotide sequence analysis that increase the range, complexity, sensitivity, and accuracy of results by greatly increasing the scale of operations and thus the number of nucleotides, and the number of copies of each nucleotide sequenced. The sequencing may be done by analysis of the synthesis or ligation products, hybridization to preexisting sequences, etc.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.MedlinePlus: NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.trans-1,4-Bis(2-chlorobenzaminomethyl)cyclohexane Dihydrochloride: An anticholesteremic agent that inhibits sterol biosynthesis in animals.Consumer Health Information: Information intended for potential users of medical and healthcare services. There is an emphasis on self-care and preventive approaches as well as information for community-wide dissemination and use.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Graves Ophthalmopathy: An autoimmune disorder of the EYE, occurring in patients with Graves disease. Subtypes include congestive (inflammation of the orbital connective tissue), myopathic (swelling and dysfunction of the extraocular muscles), and mixed congestive-myopathic ophthalmopathy.Social Media: Platforms that provide the ability and tools to create and publish information accessed via the INTERNET. Generally these platforms have three characteristics with content user generated, high degree of interaction between creator and viewer, and easily integrated with other sites.Dissent and Disputes: Differences of opinion or disagreements that may arise, for example, between health professionals and patients or their families, or against a political regime.Thromboangiitis Obliterans: A non-atherosclerotic, inflammatory thrombotic disease that commonly involves small and medium-sized arteries or veins in the extremities. It is characterized by occlusive THROMBOSIS and FIBROSIS in the vascular wall leading to digital and limb ISCHEMIA and ulcerations. Thromboangiitis obliterans is highly associated with tobacco smoking.Progesterone Congeners: Steroidal compounds related to PROGESTERONE, the major mammalian progestational hormone. Progesterone congeners include important progesterone precursors in the biosynthetic pathways, metabolites, derivatives, and synthetic steroids with progestational activities.

Characterization and subcellular compartmentation of recombinant 4-hydroxyphenylpyruvate dioxygenase from Arabidopsis in transgenic tobacco. (1/55)

4-Hydroxyphenylpyruvate dioxygenase (4HPPD) catalyzes the formation of homogentisate (2,5-dihydroxyphenylacetate) from p-hydroxyphenylpyruvate and molecular oxygen. In plants this enzyme activity is involved in two distinct metabolic processes, the biosynthesis of prenylquinones and the catabolism of tyrosine. We report here the molecular and biochemical characterization of an Arabidopsis 4HPPD and the compartmentation of the recombinant protein in chlorophyllous tissues. We isolated a 1508-bp cDNA with one large open reading frame of 1338 bp. Southern analysis strongly suggested that this Arabidopsis 4HPPD is encoded by a single-copy gene. We investigated the biochemical characteristics of this 4HPPD by overproducing the recombinant protein in Escherichia coli JM105. The subcellular localization of the recombinant 4HPPD in chlorophyllous tissues was examined by overexpressing its complete coding sequence in transgenic tobacco (Nicotiana tabacum), using Agrobacterium tumefaciens transformation. We performed western analyses for the immunodetection of protein extracts from purified chloroplasts and total leaf extracts and for the immunocytochemistry on tissue sections. These analyses clearly revealed that 4HPPD was confined to the cytosol compartment, not targeted to the chloroplast. Western analyses confirmed the presence of a cytosolic form of 4HPPD in cultured green Arabidopsis cells.  (+info)

Crystal structure of Pseudomonas fluorescens 4-hydroxyphenylpyruvate dioxygenase: an enzyme involved in the tyrosine degradation pathway. (2/55)

BACKGROUND: In plants and photosynthetic bacteria, the tyrosine degradation pathway is crucial because homogentisate, a tyrosine degradation product, is a precursor for the biosynthesis of photosynthetic pigments, such as quinones or tocophenols. Homogentisate biosynthesis includes a decarboxylation step, a dioxygenation and a rearrangement of the pyruvate sidechain. This complex reaction is carried out by a single enzyme, the 4-hydroxyphenylpyruvate dioxygenase (HPPD), a non-heme iron dependent enzyme that is active as a homotetramer in bacteria and as a homodimer in plants. Moreover, in humans, a HPPD deficiency is found to be related to tyrosinemia, a rare hereditary disorder of tyrosine catabolism. RESULTS: We report here the crystal structure of Pseudomonas fluorescens HPPD refined to 2.4 A resolution (Rfree 27.6%; R factor 21.9%). The general topology of the protein comprises two barrel-shaped domains and is similar to the structures of Pseudomonas 2,3-dihydroxybiphenyl dioxygenase (DHBD) and Pseudomonas putida catechol 2,3-dioxygenase (MPC). Each structural domain contains two repeated betaalpha betabeta betaalpha modules. There is one non-heme iron atom per monomer liganded to the sidechains of His161, His240, Glu322 and one acetate molecule. CONCLUSIONS: The analysis of the HPPD structure and its superposition with the structures of DHBD and MPC highlight some important differences in the active sites of these enzymes. These comparisons also suggest that the pyruvate part of the HPPD substrate (4-hydroxyphenylpyruvate) and the O2 molecule would occupy the three free coordination sites of the catalytic iron atom. This substrate-enzyme model will aid the design of new inhibitors of the homogentisate biosynthesis reaction.  (+info)

A mouse model of renal tubular injury of tyrosinemia type 1: development of de Toni Fanconi syndrome and apoptosis of renal tubular cells in Fah/Hpd double mutant mice. (3/55)

Hereditary tyrosinemia type 1 (HT1) (McKusick 276700), a severe autosomal recessive disorder of tyrosine metabolism, is caused by mutations in the fumarylacetoacetate hydrolase gene Fah (EC 3.7.1.2), which encodes the last enzyme in the tyrosine catabolic pathway. HT1 is characterized by severe progressive liver disease and renal tubular dysfunction. Homozygous disruption of the gene encoding Fah in mice causes neonatal lethality (e.g., lethal Albino deletion c14CoS mice), an event that limits use of this animal as a model for HT1. A new mouse model was developed with two genetic defects, Fah and 4-hydroxyphenylpyruvate dioxygenase (Hpd). The Fah-/- Hpd-/- mice grew normally without evidence of liver and renal disease, and the phenotype is similar to that in Fah+/+ Hpd-/- mice. The renal tubular cells of Fah-/- Hpd-/- mice, particularly proximal tubular cells, underwent rapid apoptosis when homogentisate, the intermediate metabolite between HPD and FAH, was administered to the Fah-/- Hpd-/- mice. Simultaneously, renal tubular function was impaired and Fanconi syndrome occurred. Apoptotic death of renal tubular cells, but not renal dysfunction, was prevented by pretreatment of the animals with YVAD, a specific inhibitor of caspases. In the homogentisate-treated Fah-/- Hpd-/- mice, massive amounts of succinylacetone were excreted into the urine, regardless of treatment with inhibitors. It is suggested that apoptotic death of renal tubular cells, as induced by administration of homogentisate to Fah-/- Hpd-/- mice, was caused by an intrinsic process, and that renal apoptosis and tubular dysfunctions in tubular cells occurred through different pathways. These observations shed light on the pathogenesis of renal tubular injury in subjects with FAH deficiency. These Fah-/- Hpd-/- mice can serve as a model in experiments related to renal tubular damage.  (+info)

The phytotoxic lichen metabolite, usnic acid, is a potent inhibitor of plant p-hydroxyphenylpyruvate dioxygenase. (4/55)

The lichen secondary metabolite usnic acid exists as a (-) and a (+) enantiomer, indicating a alpha or beta projection of the methyl group at position 9b, respectively. (-)-Usnic caused a dose-dependent bleaching of the cotyledonary tissues associated with a decrease of both chlorophylls and carotenoids in treated plants whereas no bleaching was observed with the (+) enantiomer. (-)-Usnic acid inhibited protophorphyrinogen oxidase activity (I50 = 3 microM), but did not lead to protoporphyrin IX accumulation. Bleaching appears to be caused by irreversible inhibition of the enzyme 4-hydroxyphenylpyruvate dioxygenase by (-)-usnic acid (apparent IC50 = 50 nM).  (+info)

Gene genealogies, cryptic species, and molecular evolution in the human pathogen Coccidioides immitis and relatives (Ascomycota, Onygenales). (5/55)

Previous genealogical analyses of population structure in Coccidioides immitis revealed the presence of two cryptic and sexual species in this pathogenic fungus but did not clarify their origin and relationships with respect to other taxa. By combining the C. immitis data with those of two of its closest relatives, the free-living saprophytes Auxarthron zuffianum and Uncinocarpus reesii, we show that the C. immitis species complex is monophyletic, indicating a single origin of pathogenicity. Cryptic species also were found in both A. zuffianum and U. reesii, indicating that they can be found in both pathogenic and free-living fungi. Our study, together with a few others, indicates that the current list of known fungal species might be augmented by a factor of at least two. However, at least in the C. immitis, A. zuffianum, and U. reesii complexes, cryptic species represent subdivisions at the tips of deep monophyletic clades and thus well within the existing framework of generic classification. An analysis of silent and expressed divergence and polymorphism values between and within the taxa identified by genealogical concordance did not reveal faster evolution in C. immitis as a consequence of adaptation to the pathogenic habit, nor did it show positive Darwinian evolution in a region of a dioxygenase gene (tcrP gene coding for 4-HPPD) known to cause antigenic responses in humans. Instead, the data suggested relative stasis, indicative of purifying selection against mostly deleterious mutations. Two introns in the same gene fragment were considerably more divergent than exons and were unalignable between species complexes but had very low polymorphism within taxa.  (+info)

Pharmacokinetics and pharmacodynamics of NTBC (2-(2-nitro-4-fluoromethylbenzoyl)-1,3-cyclohexanedione) and mesotrione, inhibitors of 4-hydroxyphenyl pyruvate dioxygenase (HPPD) following a single dose to healthy male volunteers. (6/55)

AIMS: NTBC (2-(2-nitro-4-fluoromethylbenzoyl)-1,3-cyclohexanedione) and mesotrione (2-(4-methylsulphonyl-2-nitrobenzoyl)-1,3-cyclohexanedione) are inhibitors of 4-hydroxyphenyl pyruvate dioxygenase (HPPD). NTBC has been successfully used as a treatment for hereditary tyrosinaemia type 1 (HT-1), while mesotrione has been developed as an herbicide. The pharmacokinetics of the two compounds were investigated in healthy male volunteers following single oral administration. The aim of the NTBC study was to assess the bioequivalence of two different formulations and to determine the extent of the induced tyrosinaemia. The mesotrione study was performed to determine the magnitude and duration of the effect on tyrosine catabolism. Additionally, the urinary excretion of unchanged mesotrione was measured to assess the importance of this route of clearance and to help develop a strategy for monitoring occupational exposure. METHODS: A total of 28 volunteers participated in two separate studies with the compounds. In the first study, the relative bioavailability of NTBC from liquid and capsule formulations was compared and the effect on plasma tyrosine concentrations measured. In the second study the pharmacokinetics of mesotrione were determined at three doses. Plasma tyrosine concentrations were monitored and the urinary excretion of mesotrione and tyrosine metabolites was measured. RESULTS: Both compounds were well tolerated at the dose levels studied. Peak plasma concentrations of NTBC were rapidly attained following a single oral dose of 1 mg x kg(-1) body weight of either formulation and the half-life in plasma was approximately 54 h. There were no statistical differences in mean (+/- s.d.) AUC(0,infinity) (capsule 602 +/- 154 vs solution 602 +/- 146 microg x ml(-1) h) or t1/2 (capsule 55 +/- 13 vs solution 54 +/- 8 h) and these parameters supported the bioequivalence of the two formulations. Mesotrione was also rapidly absorbed, with a significant proportion of the dose eliminated unchanged in urine. The plasma half-life was approximately 1 h and was independent of dose and AUC(0,infinity) and Cmax increased linearly with dose. Following administration of 1 mg NTBC x kg(-1) in either formulation, the concentrations of tyrosine in plasma increased to approximately 1100 nmol x ml(-1). Concentrations were still approximately 8 times those of background at 14 days after dosing, but had returned to background levels within 2 months of the second dose. Administration of mesotrione resulted in an increase in tyrosine concentrations which reached a maximum of approximately 300 nmol x ml(-1) following a dose of 4 mg x kg(-1) body weight. Concentrations returned to those of background within 2 days of dosing. Urinary excretion of tyrosine metabolites was increased during the 24 h immediately following a dose of 4 mg mesotrione x kg(-1), but returned to background levels during the following 24 h period. CONCLUSIONS: NTBC and mesotrione are both inhibitors of HPPD, although the magnitude and duration of their effect on tyrosine concentrations are very different. When normalized for dose, the extent of the induced tyrosinaemia after administration of NTBC and over the duration of these studies, was approximately 400 fold greater than that following administration of mesotrione. The persistent and significant effect on HPPD following administration of NTBC make it suitable for the treatment of patients with hereditary tyrosinaemia type 1 (HT-1), whilst the minimal and transient effects of mesotrione minimize the likelihood of a clinical effect in the event of systemic exposure occurring during occupational use.  (+info)

Purification and properties of avian liver p-hydroxyphenylpyruvate hydroxylase. (7/55)

Avian liver p-hydroxyphenylpyruvate hydroxylase (EC 1.13.11.27) was purified to a 1000-fold increase in specific activity over crude supernatant, utilizing a substrate analogue, o-hydroxyphenylpyruvate, to stabilize the enzyme. The preparation was homogeneous with respect to sedimentation with a sedimentation velocity (s20,w) of 5.3 S. The molecular weight of the enzyme was determined to be 97,000 +/- 5,000 by sedimentation equilibrium, and the molecular weight of the subunits was determined to be 49,000 +/- 3,000 by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Polyacrylamide gel electrophoresis revealed heterogeneity of the purified enzyme. The multiple molecular forms were separable by isoelectric focusing, and their isoelectric points ranged from pH 6.8 to 6.0. The amino acid compositions and tryptic peptide maps of the three forms isolated by isoelectric focusing were very similar. The forms of the enzyme had the same relative activity toward p-hydroxyphenylpyruvate and phenylpyruvate. Conditions which are known to accelerate nonenzymic deamidation of proteins caused interconversion of the multiple molecular forms. Iron was the only transition metal found to be associated with the purified enzyme at significant levels. The amount of enzyme-bound iron present in equilibrium-dialyzed samples was equivalent to 1 atom of iron per enzyme subunit. Purification of the enzyme activity correlated with the purification of the enzyme-bound iron. An EPR scan of the purified enzyme gave a signal at g equal 4.33, which is characteristic of ferric iron in a rhombic ligand field.  (+info)

A specific role for tocopherol and of chemical singlet oxygen quenchers in the maintenance of photosystem II structure and function in Chlamydomonas reinhardtii. (8/55)

alpha-Tocopherol concentrations were determined at low and high light intensities and compared with the rate of photosynthesis, photosystem II (PS II) and its reaction center D1 protein. Blocking of tocopherol biosynthesis at the 4-hydroxyphenylpyruvate dioxygenase by the herbicide pyrazolynate led to a quick disappearance of alpha-tocopherol in high light, as well as of PS II activity and the D1 protein. Homogentisic acid rescued all activities. It is concluded that alpha-tocopherol has a continuous turnover as a scavenger of the singlet oxygen that arises from the quenching by oxygen of the triplet of the PS II reaction center and triggers the degradation of the D1 protein. Thus tocopherols are essential to keep photosynthesis active. We suggest that this is why plants make and need tocopherols. Chemical quenchers of singlet oxygen, notably diphenylamines, completely protect PS II, prevent D1 protein degradation and keep tocopherol levels even at very high light intensities. This supports the notion that 1O2 is the intermediate in light triggered D1 protein turnover.  (+info)

*Alkaptonuria

It is caused by a mutation in the HGD gene for the enzyme homogentisate 1,2-dioxygenase (EC 1.13.11.5); if a person inherits ... 2-dioxygenase (HGD) which can normally be found in numerous tissues in the body (liver, kidney, small intestine, colon and ... 75 (4): 221-31. PMC 2588790 . PMID 12784973. Garrod AE (1908). "The Croonian lectures on inborn errors of metabolism: lecture ... 27 (4): 512-24. doi:10.1111/pcmr.12235. PMID 24612852. Lindner, Moritz; Bertelmann, Thomas (2014-01-30). "On the ocular ...

*Fumarylacetoacetate hydrolase

2-dioxygenase (HGD), maleylacetoacetate isomerase (GSTZ1), fumarylacetoacetase (FAH) The protein has a number of conserved co- ... 4 (2): 319-20. doi:10.1093/hmg/4.2.319. PMID 7757089. Kato S, Sekine S, Oh SW, Kim NS, Umezawa Y, Abe N, Yokoyama-Kobayashi M, ... 9 (4): 291-9. doi:10.1002/(SICI)1098-1004(1997)9:4. 3.0.CO;2-9. PMID 9101289. Phaneuf D, Lambert M, Laframboise R, Mitchell G, ... 90 (4): 1185-92. doi:10.1172/JCI115979. PMC 443158 . PMID 1401056. Tanguay RM, Valet JP, Lescault A, Duband JL, Laberge C, ...

*4-Hydroxyphenylpyruvate dioxygenase

"Engineering p-hydroxyphenylpyruvate dioxygenase to a p-hydroxymandelate synthase and evidence for the proposed benzene oxide ... Hydroxyphenylpyruvate dioxygenase is responsible for converting 4- Hydroxyphenylpyruvate into homogentisate. This conversion is ... also known as α-ketoisocaproate dioxygenase (KIC dioxygenase), is an Fe(II)-containing non-heme oxygenase that catalyzes the ... Knox WE, LeMay-Knox M (Oct 1951). "The oxidation in liver of l-tyrosine to acetoacetate through p-hydroxyphenylpyruvate and ...

*4-hydroxyphenylpyruvate dioxygenase inhibitor

These results suggested that 'p-hydroxyphenylpyruvate dioxygenase (HPPD) was the enzyme that was inhibited, a fact which was ... The Discovery and Structural Requirements of Inhibitors of p-hydroxyphenylpyruvate Dioxygenase. Weed Science,45(5),p.601-609 (9 ... He furthermore found that the urine of rats treated with III showed elevated levels of both p-hydroxyphenylpyruvate and p- ... The 4-methylsulfonyl group was then prepared to test this hypothesis, and what was to become the commercial herbicide Mikado ( ...

*Mesotrione

... is a member of the class of HPPD inhibitors, which all work by inhibiting the plant enzyme 4-hydroxyphenylpyruvate ... dioxygenase. In plants, HPPD is necessary for carotenoid biosynthesis; carotenoids in turn protect chlorophyll from being ... Moran, GR (Jan 2005). "4-Hydroxyphenylpyruvate dioxygenase" (PDF). Arch Biochem Biophys. 433 (1): 117-28. doi:10.1016/j.abb. ...

*Herbicide

2,4-D is a broadleaf herbicide in the phenoxy group used in turf and no-till field crop production. Now, it is mainly used in a ... 2,4,5-T was withdrawn from use in the USA in 1983, at a time of heightened public sensitivity about chemical hazards in the ... 146 (4): 579-600. doi:10.1111/j.1474-919X.2004.00375.x. Robbins, C.S.; Dowell, B.A.; Dawson, D.K.; Colon, J.A.; Estrada, R.; ... 2,4,5-T has since largely been replaced by dicamba and triclopyr. Agent Orange was a herbicide blend used by the British ...

*4-Hydroxyphenylpyruvic acid

Additionally, 4-HPPA can be converted to homogentisic acid which is one of the precursors to ochronotic pigment. It is an ... 4-Hydroxyphenylpyruvic acid (4-HPPA) is an intermediate in the metabolism of the amino acid phenylalanine. The aromatic side ... 4-Hydroxyphenylpyruvate dioxygenase Brand, Larry; Harper, Alfred (1974). "Effect of glucagon on phenylalanine metabolism and ... Denoya, Claudio; Skinner, Deborah; Morgenstern, Margaret (September 1994). "A Streptomyces avermitilis gene encoding a 4- ...

*Leucine

The cytosolic dioxygenase has been characterized extensively and differs from the mitochondrial form in that the dioxygenase ... In the first, HMB is produced from [α-KIC] by the cytosolic enzyme KIC dioxygenase (Sabourin and Bieber 1983). ... KIC dioxygenase), which converts α-KIC to HMB. In healthy individuals, this minor pathway - which involves the conversion of L- ... this route of HMB formation is direct and completely dependent of liver KIC dioxygenase. Following this pathway, HMB in the ...

*Vitamin C

"The mechanism of enzymic formation of homogentisate from p-hydroxyphenylpyruvate". Journal of the American Chemical Society. 92 ... 43 (4): 680-5. PMID 9105273. Svirbely JL, Szent-Györgyi A (1932). "The chemical nature of vitamin C". The Biochemical Journal. ... 67 (4): 1643-8. Bibcode:1970PNAS...67.1643P. doi:10.1073/pnas.67.4.1643. PMC 283405 . PMID 5275366. Mandl J, Szarka A, Bánhegyi ... 29 (4): 711-26. doi:10.3233/JAD-2012-111853. PMC 3727637 . PMID 22366772. Rosenbaum CC, O'Mathúna DP, Chavez M, Shields K (2010 ...

*Nitisinone

Alkaptonuria is caused when an enzyme called homogentisic dioxygenase (HGD) is faulty, leading to a buildup of homogenisate. ... pyruvate Dioxygenase with the Specific Inhibitor 2-[2-Nitro-4-(trifluoromethyl)benzoyl]-1,3-cyclohexanedione†". Biochemistry. ... Ellis, M.K.; Whitfield, A.C.; Gowans, L.A.; Auton, T.R.; Provan, W.M.; Lock, E.A.; Smith, L.L. (1995). "Inhibition of 4- ... Hydroxyphenylpyruvate Dioxygenase by 2-(2-Nitro-4-trifluoromethylbenzoyl)-cyclohexane-1,3-dione and 2-(2-Chloro-4- ...

*4-hydroxymandelate synthase

... involvement of an unusual dioxygenase in the pathway to (S)-4-hydroxyphenylglycine". J. Am. Chem. Soc. 122 (22): 5389-5390. doi ... In enzymology, a 4-hydroxymandelate synthase (EC 1.13.11.46) is an enzyme that catalyzes the chemical reaction 4- ... hydroxyphenylpyruvate + O2 ⇌ {\displaystyle \rightleftharpoons } 4-hydroxymandelate + CO2 Thus, the two substrates of this ... The systematic name of this enzyme class is 4-hydroxyphenylpyruvate:oxygen oxidoreductase (decarboxylating). This enzyme is ...

*Picrophilus torridus

18 (4): 641-651. doi:10.1007/s00792-014-0645-x. ISSN 1433-4909. Rajput, Rinky; Verma, Ved Vrat; Chaudhary, Vishal; Gupta, Rani ... "Structural and functional characterization of 4-hydroxyphenylpyruvate dioxygenase from the thermoacidophilic archaeon ...

*Tyrosinemia type III

... is a rare disorder caused by a deficiency of the enzyme 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27 ... Specifically, 4-hydroxyphenylpyruvate dioxygenase converts a tyrosine byproduct called 4-hydroxyphenylpyruvate to homogentisic ...

*2-oxoglutarate (2OG)-dependent dioxygenases

Given the important biological roles that 2OG-dependent dioxygenase play, many 2OG-dependent dioxygenase inhibitors were ... 2OG-dependent dioxygenases share a common catalytic mechanism. The first step involves the binding of 2OG and substrate to the ... All 2OG-dependent dioxygenases contain a conserved double-stranded β-helix (DSBH, also known as cupin) fold, which is formed ... Many 2OG-dependent dioxygenase are also capable of uncoupled turnover, in which oxidative decarboxylation of 2OG into succinate ...

*Leptospermone

doi:10.1007/978-94-011-4173-4_7. ISBN 978-94-010-5817-9. Achkar J, Xian M, Zhao H, Frost JW (2005). "Biosynthesis of ... "Herbicidal 4-hydroxyphenylpyruvate dioxygenase inhibitors -- A review of the triketone chemistry story from a Syngenta ...

*Hawkinsinuria

The intermediate then spontaneously reacts with glutathione to form 2-L-cystein-S-yl-1,4-dihydroxy-cyclohex-5-en-1-yl acetic ... Hawkinsinuria, also called 4-Alpha-hydroxyphenylpyruvate hydroxylase deficiency, is an autosomal dominant metabolic disorder ... Normally, the breakdown of the amino acid tyrosine involves the conversion of 4-hydroxyphenylpyruvate to homogentisate by 4- ... Hydroxyphenylpyruvate dioxygenase. Complete deficiency of this enzyme would lead to tyrosinemia III. In rare cases, however, ...

*Type I tyrosinemia

From toxicological problem to therapeutic use: the discovery of the mode of action of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3- ... Nitisinone inhibits the conversion of 4-OH phenylpyruvate to homogentisic acid by 4-Hydroxyphenylpyruvate dioxygenase, the ...

*NIH shift

... including 4-hydroxyphenylpyruvate dioxygenase and the tetrahydrobiopterin dependent hydroxylases. The name NIH shift arises ...

*Beta-Hydroxy beta-methylbutyric acid

KIC dioxygenase), which converts α-KIC to HMB. In healthy individuals, this minor pathway - which involves the conversion of L- ... The first reported chemical syntheses of HMB were: the oxidation of 2-methylpent-4-en-2-ol with chromic acid (CrO4H2) in 1877 ... A relatively small amount of α-KIC is metabolized in the liver by the cytosolic enzyme 4-hydroxyphenylpyruvate dioxygenase ( ... A cycloaddition reaction between acetone and ketene depending on the conditions produce β-isovalerolactone or 4,4- ...

*Tyrosinemia

It is a 4-hydroxyphenylpyruvate dioxygenase inhibitor indicated for the treatment of hereditary tyrosinemia type 1 (HT-1) in ...

*List of enzymes

EC 1.14.12 Nitric oxide dioxygenase Category:EC 1.14.13 Nitric oxide synthase EC 1.14.13.39 Category:EC 1.14.14 Aromatase EC ... EC 1.6.4 now Category:EC 1.8.1 Category:EC 1.6.5 (with a quinone or similar compound as acceptor) NADH dehydrogenase EC 1.6.5.3 ... EC 1.1.4 (with a disulfide as acceptor) Category:EC 1.1.5 (with a quinone or similar compound as acceptor) Category:EC 1.1.99 ( ... EC 1.5.4 (with a disulfide as acceptor) Category:EC 1.5.5 (with a quinone or similar compound as acceptor) Category:EC 1.5.7 ( ...

*Chromosome 12 (human)

4 (3): 319-33. doi:10.1089/10906570050501588. PMID 11142767. Montgomery KT, Lee E, Miller A, Lau S, Shim C, Decker J, Chiu D, ... 76 (4): 647-51. doi:10.1086/429226. PMC 1199301 . PMID 15714404. Genome Decoration Page, NCBI. Ideogram data for Homo sapience ... Chromosome 12 spans about 133 million base pairs (the building material of DNA) and represents between 4 and 4.5 percent of the ... Cytoskeleton associated protein 4 CNOT2: encoding protein CCR4-NOT transcription complex subunit 2 CNPY2: encoding protein ...

*Lactoylglutathione lyase

2-dioxygenase, catechol 2,3-dioxygenase, 3,4-dihydroxyphenylacetate 2,3-dioxygenase and 4-hydroxyphenylpyruvate dioxygenase all ... 3-demethylubiquinone-9 3-O-methyltransferase and numerous dioxygenases such as biphenyl-2,3-diol 1, ... 170 (4): 209-219. doi:10.1007/s002030050635. Oya T, Hattori N, Mizuno Y, Miyata S, Maeda S, Osawa T, Uchida K (Jun 1999). " ... 4 (3): e4649. doi:10.1371/journal.pone.0004649. PMC 2650792 . PMID 19266052. Distler MG, Plant LD, Sokoloff G, Hawk AJ, Aneas I ...

*Glutathione S-transferase

26 (4): 460-7. doi:10.3109/14756366.2010.526769. PMID 21028940. Douglas KT (1987). "Mechanism of action of glutathione- ... 113 (4-5): 234-58. doi:10.1080/13813450701661198. PMID 18158646. Board PG (May 2011). "The omega-class glutathione transferases ... Most mammalian isoenzymes have affinity for the substrate 1-chloro-2,4-dinitrobenzene, and spectrophotometric assays utilising ... and 4-hydroxyphenyl-pyruvate dioxygenase" (PDF). Toxicological Sciences. 130 (2): 229-44. doi:10.1093/toxsci/kfs243 . PMID ...

*List of MeSH codes (D08)

2-dioxygenase MeSH D08.811.682.690.416.305 --- catechol 2,3-dioxygenase MeSH D08.811.682.690.416.319 --- cysteine dioxygenase ... 2-oxoglutarate 5-dioxygenase MeSH D08.811.682.690.708.673 --- procollagen-proline dioxygenase MeSH D08.811.682.690.708.715 --- ... gamma-butyrobetaine dioxygenase MeSH D08.811.682.690.708.410 --- heme oxygenase (decyclizing) MeSH D08.811.682.690.708.410.500 ... 3-dioxygenase MeSH D08.811.682.690.416.444 --- lipoxygenase MeSH D08.811.682.690.416.444.050 --- arachidonate lipoxygenases ...

*Tyrosine

The next oxidation step catalyzes by p-hydroxyphenylpyruvate dioxygenase and splitting off CO2 homogentisate (2,5- ... Prephenate is oxidatively decarboxylated with retention of the hydroxyl group to give p-hydroxyphenylpyruvate, which is ... 2-dioxygenase is required. Thereby, through the incorporation of a further O2 molecule, maleylacetoacetate is created. ... dihydroxyphenyl-1-acetate). In order to split the aromatic ring of homogentisate, a further dioxygenase, homogentisate 1, ...
BioAssay record AID 3437 submitted by ChEMBL: In vitro inhibition against of 4-Hydroxyphenylpyruvate dioxygenase (4-HPPD) from pig liver by the enol borate method.
Compare 4-hydroxyphenylpyruvate dioxygenase ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
4-Hydroxylphenylpyruvate dioxygenase (HPPD) is a non-haem iron(II)-dependent oxygenase that catalyzes the conversion of 4-hydroxylphenylpyruvate (HPP) to homogentisate (HG). In the active site, a strictly conserved 2-His-1-Glu facial triad coordinates the iron ready for catalysis. Substitution of these residues resulted in about a 10-fold decrease in the metal binding affinity, as measured by isothermal titration calorimetry, and a large reduction in enzyme catalytic efficiencies. This study revealed the vital role of the ligand E349 in enzyme function. Substitution of this residue by alanine resulted in loss of activity. The E349G variant retained 5% activity for the coupled reaction, suggesting that coordinating water may be able to support activation of the trans bound dioxygen upon substrate binding. The reaction catalyzed by the H183A variant was fully uncoupled. H183A variant catalytic activity resulted in protein cleavage between Ile267 Ala268 and the production of an N-terminal fragment. ...
Complete information for HPD gene (Protein Coding), 4-Hydroxyphenylpyruvate Dioxygenase, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Tyrosinemia, Type III (TYR-III) is an inborn error of metabolism, an inherited condition in which an enzyme, 4-hydroxyphenylpyruvate dioxygenase, in the body is either missing or not working well. Tyrosinemia Type III is considered an amino acid condition because the body is unable to break down the amino acid (part of protein), known as tyrosine, when this enzyme is not working properly. This condition is rare and the signs and symptoms of TYR-III can be variable and are not yet well defined.. For more information about Tyrosinemia, Type III, go to Babys First Test: Tyrosinemia, Type III. A listing of contact information for Minnesota inborn errors of metabolism medical specialty providers/clinics serving children affected with or undergoing evaluation for conditions that can be detected through Minnesota Newborn Screening is available upon request. ...
URBANA, Ill. - Responding to the first known report of waterhemp showing resistance to HPPD (4-hydroxyphenylpyruvate dioxygenase)-inhibiting herbicides (such as Callisto, Impact, and Laudis), weed science researchers at the University of Illinois have identified two unique mechanisms in the plant that have allowed the weed to "get around" these herbicides. Dean Riechers, a U of I Professor of weed physiology, along with other collaborators at the U of I, recently published a paper describing the two distinct metabolic detoxification mechanisms that confer resistance to mesotrione (Callisto) and atrazine (Aatrex) in an Illinois waterhemp population. "Waterhemp is very diverse, which you can see in the field. There are red plants, green plants, tall, short, bushy-basically a germplasm pool. If you keep spraying the same herbicide over and over, eventually youre going to find that rare plant that can resist it," said Riechers. What the U of I researchers found of great concern in this population ...
Gene target information for Hpd - 4-hydroxyphenylpyruvate dioxygenase (Norway rat). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Hi all, I havent been on the boards in a year or three. I find that the less I think about HPPD the less it affects me. And, similarly, the more Im on the boards, the more the conversations and discussions here loop through my head, and the more frequently HPPD dominates my thoughts. But today I decided to stop by. Why? I wanted to share a small piece of advice. Honestly, I had been thinking of doing this for a while but for some reason, it was so incredibly hard for me to open this forum and log in. Anyways, here I am now. What I want to share is what has worked for me and is what continues to help me. I speak to you from experience. Ive found that the less I think of HPPD as a "thing" and the less that I see myself as a "victim" the less I suffer. What that means, is that the less you let this thing called "HPPD" be what identifies you, the less power it has to affect you. I know what this sounds like. It sounds like Im saying "dont make a big deal out of it." And yes, that actually is ...
Hallucinogen Persisting Perception Disorder (HPPD) Support Forum - support for HPPD, flashbacks, drug-induced visual snow syndrome and depersonalization/derealization.
A plethora of dopamine receptors exist, including at least five ne urontin subtypes and several neurontin hppd molecular isoforms. Improving the optics of the eye neurontin hppd removing aberrations increases the contrast and spatial detail of the retinal image.
Although rare, some people whove taken hallucinogenic substances develop hallucinogen persisting perception disorder (HPPD), a sensory disorder. Learn more.
Synonyms: HPPD, flashbacks This condition occurs in those who have previously taken hallucinogenic recreational drugs, usually on a number of occasions....
TY - JOUR. T1 - TATN-1 Mutations Reveal a Novel Role for Tyrosine as a Metabolic Signal That Influences Developmental Decisions and Longevity in Caenorhabditis elegans. AU - Ferguson, Annabel A.. AU - Roy, Sudipa. AU - Kormanik, Kaitlyn N.. AU - Kim, Yongsoon. AU - Dumas, Kathleen J.. AU - Ritov, Vladimir B.. AU - Matern, Dietrich. AU - Hu, Patrick J.. AU - Fisher, Alfred L.. PY - 2013. Y1 - 2013. N2 - Recent work has identified changes in the metabolism of the aromatic amino acid tyrosine as a risk factor for diabetes and a contributor to the development of liver cancer. While these findings could suggest a role for tyrosine as a direct regulator of the behavior of cells and tissues, evidence for this model is currently lacking. Through the use of RNAi and genetic mutants, we identify tatn-1, which is the worm ortholog of tyrosine aminotransferase and catalyzes the first step of the conserved tyrosine degradation pathway, as a novel regulator of the dauer decision and modulator of the daf-2 ...
The decomposition of L-tyrosine (syn. para-hydroxyphenylalanine) begins with an α-ketoglutarate dependent transamination through the tyrosine transaminase to para-hydroxyphenylpyruvate. The positional description para, abbreviated p, mean that the hydroxyl group and side chain on the phenyl ring are across from each other (see the illustration below). The next oxidation step catalyzes by p-hydroxylphenylpyruvate-dioxygenase and splitting off CO2 homogentisate (2,5-dihydroxyphenyl-1-acetate). In order to split the aromatic ring of homogentisate, a further dioxygenase, homogentistate-oxygenase is required. Thereby, through the incorporation of a further O2 molecule, maleylacetoacetate is created. Fumarylacetate is created maleylacetoacetate-cis-trans-isomerase through rotation of the carboxyl group created from the hydroxyl group via oxidation. This cis-trans-isomerase contains glutathione as a coenzyme. Fumarylacetoacetate is finally split via fumarylacetoacetate-hydrolase through the addition ...
Postemergence (POST) application of 4-hydroxyphenyl pyruvate dioxygenase (HPPD) inhibitors in combination with a photosystem II (PSII) inhibitor, such as atrazine [6-chloro-N-ethyl-N9-(1-methylethyl)-1,3,5-triazine-2,4-diamine], is common practice in sweet corn (Zea mays L.) production. Given the sensitivity of sweet corn to HPPD-inhibiting herbicides, the objective of this work was to determine the extent to which cytochrome P450 (CYP) genotype and PSII-inhibitors affect crop sensitivity to HPPD-inhibiting herbicides. Greenhouse experiments were used to identify PSII-inhibitors that were least injurious when combined with the HPPD-inhibitors, mesotrione [2-(4-mesyl-2-nitrobenzoyl)-3-hydroxycylohex-2-enone], tembotrione {2-[2-chloro-4-(methylsulfonyl)-3-[(2,2,2-trifluoroethoxy)methyl]benzoyl]-1,3-cyclohexanedione}, and topramezone {[3-(4,5-dihydro-3-isoxazolyl)-2-methyl-4-(methylsulfonyl)phenyl](5-hydroxy-1-methyl-1H-pyrazol-4-yl)methanone}. Subsequently, HPPD-inhibitors were tested individually ...
The protein synthesis inhibitor anisomycin features a unique benzylpyrrolidine system and exhibits diverse biological and pharmacologic activities. Its biosynthetic origin has remained obscure for more than 60 y, however. Here we report the identification of the biosynthetic gene cluster (BGC) of anisomycin in Streptomyces hygrospinosus var. beijingensis by a bioactivity-guided high-throughput screening method. Using a combination of bioinformatic analysis, reverse genetics, chemical analysis, and in vitro biochemical assays, we have identified a core four-gene ensemble responsible for the synthesis of the pyrrolidine system in anisomycin: aniQ, encoding a aminotransferase that catalyzes an initial deamination and a later reamination steps; aniP, encoding a transketolase implicated to bring together an glycolysis intermediate with 4-hydroxyphenylpyruvic acid to form the anisomycin molecular backbone; aniO, encoding a glycosyltransferase that catalyzes a cryptic glycosylation crucial for ...
Reference: Diachkova A.Ia., Tyrosine metabolism disorders in the mouse liver in experimental leukemia, Voprosy meditsinskoi khimii, 1964, vol: 10(1), 32-35 ...
215281DNAartificialsynthetic chimeric gene 1ctagtggcgc cacgcgtgat atcatgcatg ttaacatcga tccatgggcg cgccttaatt 60aaatttaaat cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 120tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 180agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 240aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 300gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 360tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 420cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 480ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt 540cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 600atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 660tgccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 720gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 780gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg ...
Accepted name: aspartate phenylpyruvate transaminase. Reaction: L-aspartate + phenylpyruvate = oxaloacetate + L-phenylalanine. For diagram click here (mechanism).. Other name(s): aspartate-phenylpyruvate aminotransferase. Systematic name: L-aspartate:phenylpyruvate aminotransferase. Comments: The enzyme from Pseudomonas putida also acts on 4-hydroxy-phenylpyruvate and, more slowly, on L-glutamate and L-histidine.. Links to other databases: BRENDA, EXPASY, KEGG, Metacyc, CAS registry number: 99533-45-6. References: 1. Holger, Z. and Kula, M.-R. Isolation and characterization of a highly inducible L-aspartate-phenylpyruvate transaminase from Pseudomonas putida. J. Biotechnol. 3 (1985) 19-31.. ...
The most powerful and sophisticated Olis kinetic system is the RSM 1000, which can be easily configured for use in any wavelength range from deep ultraviolet to near infrared. Its patented ScanDisk technology supports the collection of up to 1000 spectral scans per second. For absorbance spectra at more modest rates, the HPDA 8452 collects spectra scans at a rate of up to 10 scans/second. The RSM 1000, DB 620, or HPDA 8452 can be utilized for single wavelength kinetic wavelengths.. The DM 45, DM 245, RSM 1000F, and SLM series fluorimeters provide the ability to monitor fluorescence reactions as well.. Stopped-flow, flash lamps, LEDs, Peltier TLC 45, Peltier TLC 50, and magnetic stirrers are popular accessories for these measurements.. ...
GenBank) 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase (5-methylthio-3-oxo-1-penten-1,2-diol dioxygenase) (DHK-MTPene dioxygenase ...
GenBank) Acireductone dioxygenase; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; DHK-MTPene dioxygenase; Acireductone ...
putative 3,5-dihydroxyphenylacetyl-CoA 1,2-dioxygenase [hydroxyacyl-dehydrogenase] GTGACCACGGATTCCCCGACGCTGTCGCTTTCGCCGGGGCTCGACCATCGAGCCCTGGCG AAGGCGGCACAGCGTGTCGACGAGCTGCTCGACGGGTTGCCGTCGCCCTCGGCCAGGACG CCCGCGCAGCGTGAGGCCGCGTCCTCGGCGCTGGACGAGATCAGGGCGGCGCGGACGGAG TACGTGGAAGCGCACGCCGAGGAGATCTACGACCGGCTCACCGACGGCCGCACCCGCTAT CTACGCCTCGACGAACTCGTCCGGGCCGCCGCGTCGGCCTATCCCGGCCTGGTGCCCACG GAGGCGCAGATGGCGGCCGAGCGGTCCCGACGGCAGGCGGAGAAGGAAGGCCGTGAGATC GATCAGGGCATTTTCCTGCGCGGGATCCTGAGCGCGCCGAAAGCCGGGCCGCATCTGCTC GACGCCATGCTCAGGCCCACCGCCAGGGCGCTGGAGCTGCTGCCGGAGTTCGTCGAGACC GGTGTGGTGCGGATGGAGGCCGCCTCCCTGGAGCGCCGTGACGGCGTCGCGTACCTGACC CTGTGCCGGGACGACTGCCTGAACGCCGAGGACGCCCAGCAGGTCGACGACATGGAGACC GCGGTCGATCTGGCGCTGCTCGACCCGGCCGTCCGGGTGGGGATGCTGCGGGGCGGCGTG ATGAGCCATCCCCGGTACGCGGGGCGCCGGGTGTTCTGCGCGGGGATCAACCTCAAGAAG CTGAGTTCGGGCGACATCCCGCTCGTCGATTTCCTCCTGCGGCGGGAATTGGGCTATATC CACAAGATCGTGCGCGGGGTGGCCACGGACGGTTCGTGGCGAGCACGGGTGATCGACAAG CCCTGGCTGGCGGCCGTCGATTCCTTCGCCATCGGGGGCGGGGCCCAGCTCCTGCTGGTC ...
Homogentisate 1,2-dioxygenase (homogentisic acid oxidase, homogentisicase) is an enzyme which catalyzes the conversion of homogentisate to 4-maleylacetoacetate. Homogentisate 1,2-dioxygenase or HGD is involved in the catabolism of aromatic rings, more specifically in the breakdown of the amino acids tyrosine and phenylalanine. HGD appears in the metabolic pathway of tyrosine and phenylalanine degradation once the molecule homogentisate is produced. Homogentisate reacts with HGD to produce maleylacetoacetate, which then is further used in the metabolic pathway. HGD requires the use of Fe2+ and O2 in order to cleave the aromatic ring of homogentisate. homogentisate 4-maleylacetoacetate The active site of Homogentisate 1,2-dioxygenase was determined through the crystal structure, which was captured through the work of Titus et al. Through the crystal structure the active site was found to contain the following residues; His292, His335, His365, His371, and Glu341. Homogentisate binds in the active ...
The defective gene results in a disruption of the final step of metabolism of tyrosine (absence of fumarylacetoacetate hydrolase (FAH) enzyme).. As a result, high levels of tyrosine build up in the blood, forming a toxic substance called succinylacetone.. Left untreated, HT-1 can cause hepatic, renal and peripheral nerve damage. The disease is characterized by progressive liver disease with increased risk of hepatocellular carcinoma (the liver), renal tubular dysfunction with hypophosphatemic rickets (kidneys) and a porphyria-like syndrome (nervous system).. In conjunction with a controlled diet, treatment with Nitisinone Tablets can prevent the formation of succinylacetone further preventing liver and kidney damage. Regular blood and urine tests are used to monitor succinylacetone levels in the body to ensure nitisinone levels are appropriate for treatment.. ...
Pain management information for pain medicine healthcare professionals in treating and caring for their patients. Clinical Pain Advisor offers news, case studies and more.
In the second post on ADHD and tyrosine, we focused on the first step of the process, the conversion of tyrosine to L-DOPA. This step heavily utilizes a specific enzyme called tyrosine hydroxylase. Tyrosine Hydroxylase is dependent on adequate supplies of certain nutrients such as iron, magnesium, zinc, tetrahydrobiopterin, and adequate levels of vitamin C (and antioxidants in general). While rampant supplementation is not necessary, inadequate levels of any of these agents (as well as a few others, such as copper) could potentially compromise the function of the tyrosine hydroxylase enzyme. It is important to note that the conversion of tyrosine to L-DOPA is typically the slowest and rate-limiting step of the whole tyrosine metabolism and conversion process to dopamine and norepinephrine. Thus, compromising this first conversion step can be potentially the most devastating with regards to impaired tyrosine metabolism for ADHD. This was why the post was a bit lengthy with regards to advocating ...
Looking for TCI AMERICAS 1,4-cyclohexanedione monoethyleneketal (29LU08)? Graingers got your back. Price:$50.25. Easy ordering & convenient delivery. Log-in or register for your pricing.
Sobi announced that the FDA has approved a new 20mg strength of Orfadin (nitisinone) capsules for the treatment of hereditary tyrosinemia type-1 (HT-1), a rare genetic disease in infants and children.
Rio de Janeiro, RJ, Brazil. Tel.: +55-21-2562-1222. This e-mail address is being protected from spambots. You need JavaScript enabled to view it. ...
Dalam kehidupan sehari-hari, banyak orang, demi kemudahan, menggunakan sumpit sekali pakai untuk makan, tapi sumpit sekali pakai yang dugunakan untuk makan juga akan menyebabkan
The answer to yesterdays mystery is … Alkaptonuria! Awesome job OB1, Angelita, Kathy G., Erin, Patti Ann, Ashley, F, Rich S, Shorty, Ray, Adam, DoctorMom, k, francine, C, Myra, Gail, Steve Harris, ColorMaven, Asclepius, Theresa, Maria, Steve, Andrew Hall, JP, Mike, Melissa, Priscilla, and Max. Wow! This was an easy one for yall this week.. Alkaptonuria is an inherited metabolic defect that prevents breakdown of an amino acid (a building block of proteins). These patients lack an enzyme in the tyrosine degradation pathway, leading to accumulation of an intermediate called homogentisic acid. When homogentisic acid is excreted in high levels in the urine, it can turn urine black. In addition, homogentisic acid builds up in the skin and joints of patients with alkaptonuria throughout their lives. By the time the patients reach middle age, they can have debilitating arthritis and skin/eye deposits due to the buildup of this pigmented molecule.. Treatment includes restricting foods rich in the ...
... definition, an intermediate compound in the metabolism of tyrosine and of phenylalanine, found in excess in the blood and urine of persons affected with alkaptonuria. See more.
A screen positive result means that more tests are needed to know whether or not a baby has tyrosinemia. It does not mean that a baby has Tyrosinemia. Babies identified at a young age through screening can be treated early to help prevent health problems ...
Hager said theyve already discovered one waterhemp biotype thats resistant to four different herbicide families. He said growers may see five-way resistance in the future. Fortunately, there are very few annual weed species in the United States that have shown this level of multiple resistance. Waterhemp is a dioecious species and ideally suited for evolving herbicide resistance by sharing resistance genes among populations and biotypes. "For example, you can have HPPD resistance evolving in field A, and in adjacent field B you can have selection for glyphosate resistance," Tranel said. "Pollen is always moving in the air, allowing pollen from field A to mix with resistant plants from field B resulting in HPPD and glyphosate resistance in the same progeny. Thats how easy it is to stack resistance.". The pressure is on for industry to develop new options and for growers to change their practices of how they use products to control the weed spectrum, he added.. Hager, Tranel and Dean Riechers, ...
Factory Supply 99% 1,4-Cyclohexanedione mono CAS: 69225-59-8 Basic Info. Name:1,4-Cyclohexanedione mono(2,2-dimethyltrimethylene ketal) CAS: 69225-59-8 MF: C11H18O3 MW: 198.26 EINECS: 273-918-4 mp 45-50...
Mutations in human and/or mouse homologs are associated with this disease. Synonyms: Oculocutaneous tyrosinemia; Richner-Hanhart syndrome
When a section of mouse chromosome 7 containing the coat color c gene is deleted by exposing mice to radiation, albino mice are born with a white, hairless coat.
Hickey RD, Mao SA, Glorioso J, Elgilani F, Amiot B, Chen H, Rinaldo P, Marler R, Jiang H, DeGrado TR, Suksanpaisan L, OConnor MK, Freeman BL, Ibrahim SH, Peng KW, Harding CO, Ho CS, Grompe M, Ikeda Y, Lillegard JB, Russell SJ, Nyberg SL. Curative ex vivo liver-directed gene therapy in a pig model of hereditary tyrosinemia type 1. Sci Transl Med. 2016 Jul 27; 8 (349):349ra99 ...
A combination of arterio-venous difference, kinetic isotope transfer and blood flow rate techniques were used to measure tyrosine metabolism across hindlimb tissues of nine growing lambs (average live weight 36.5 kg) fed on a range of dry matter intakes. Muscle protein synthesis was measured using a...
Diagnoised with Adrenal Fatigue back in Sept. 09. Have been avoiding all stimulants ever since and started taking hydrocortisone and adrenal support(a
Shop Flavanone 3-dioxygenase ELISA Kit, Recombinant Protein and Flavanone 3-dioxygenase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
This enzyme catalyses a step in the pathway of phenylpropanoid compounds degradation. It catalyses the insertion of both atoms of molecular oxygen into positions 2 and 3
3.0.CO;2-9. PMID 9101289. Phaneuf D, Lambert M, Laframboise R, Mitchell G, Lettre F, Tanguay RM (1992). "Type 1 hereditary tyrosinemia. Evidence for molecular heterogeneity and identification of a causal mutation in a French Canadian patient". J. Clin. Invest. 90 (4): 1185-92. doi:10.1172/JCI115979. PMC 443158 . PMID 1401056. Tanguay RM, Valet JP, Lescault A, Duband JL, Laberge C, Lettre F, Plante M (1990). "Different molecular basis for fumarylacetoacetate hydrolase deficiency in the two clinical forms of hereditary tyrosinemia (type I)". Am. J. Hum. Genet. 47 (2): 308-16. PMC 1683717 . PMID 2378356. Laberge C, Grenier A, Valet JP, Morissette J (1990). "Fumarylacetoacetase measurement as a mass-screening procedure for hereditary tyrosinemia type I". Am. J. Hum. Genet. 47 (2): 325-8. PMC 1683713 . PMID 2378358. Kvittingen EA, Halvorsen S, Jellum E (1983). "Deficient fumarylacetoacetate fumarylhydrolase activity in lymphocytes and fibroblasts from patients with hereditary tyrosinemia". Pediatr. ...
Ochronosis is the connective tissue manifestation of alkaptonuria, a defect in the metabolism of homogentisic acid (HGA) caused by autosomal recessive mutations of the HGO gene on chromosome 3q [1].. Homogentisic acid oxidase is responsible for the turnover of homogentisic acid (HGA) during the course of phenylalanine and tyrosine catabolism [2]. HGA accumulates and is polymerized into a blue-black pigment that ultimately is deposited in the skin, cartilage, and collagenous tissues. Specifically, pigment deposition can be seen in skin, bones, articular cartilages, synovial membranes, lungs, heart endocardium and valves, and kidneys [3]. The accumulation eventually causes severe degeneration of the spine and peripheral joints which may clinically simulate common arthritic disorders [4]. Alkaptonuria is a rare disease affecting one in 250,000-1 million people [5, 6].. The most common clinical feature of ochronosis is ochronotic arthritis[6]. Other common presentations of ochronosis are:. Darkening ...
SONIA 1 is an international, multicentre, randomised, open-label, no-treatment controlled, parallel group, dose-response study to investigate the effect of once daily nitisinone on 24-hour urinary homogentisic acid excretion in patients with alkaptonuria after 4-weeks treatment. They study will identify the optimal dose to decrease urine homogentisic acid to near normal levels ...
The defects in tyrosine metabolism lead to albinism which is a group of diseases as result of deficiency in melanin. These result in either partial or full absence of pigments from the skin, eye, and hair. There may be vision defects and photophobia. This disease occurs due to deficiency of tyrosinase enzyme.. Alkaptonuria is another disease due to deficiency of homogentisic acid oxidase that results in accumulation of homogentisic acid. Patient may have homogentic aciduria, arthritis of large joints, and black pigmentation of cartilage and collagenous tissues.. Tyrosine interacts with monoamine oxidase inhibitors so patient should avoid foods containing tyrosine.. Thus, tyrosine has many beneficial effects. It supplementation is also available for the persons deficient of this amino acid. It is a useful amino acid during periods of cold, stress of any kind either emotional or physical and fatigues.. ...
The purpose of this study is to gain a better understanding of alkaptonuria and collect medical data on patients who may later participate in new drug trials for this rare genetic disease. In alkaptonuria, a pigment called homogentisic acid collects in bone and connective tissue, causing arthritis and eventually bone fractures, and also causes discoloration in the ears and whites of the eyes. Some patients also develop kidney stones and heart valve problems. Alkaptonuria has not been studied for decades; and scientists expect to gain comprehensive clinical information using current medical techniques.. Patients with alkaptonuria who are at least one month old may be eligible for this study. Participants will be evaluated at NIH s Clinical Center for 5 days every 2 to 3 years. They will have a medical history, physical examination, routine blood and urine tests. Blood may also be collected to measure a type of collagen that indicates new bone formation and to analyze DNA for genetic studies. ...
Alkaptonuria is a rare autosomal recessive disorder of metabolism caused by deficiency of homogentisic acid oxidase and resulting in accumulation of homogentisic acid in collagenous structures. This causes the classic clinical triad: (1) homogentisic
According to a study published in Nature Biotechnology, a more efficient delivery of a CRISPR/Cas9 therapeutic to adult mice with the metabolic disease Tyrosinemia type I developed by Wen Xue, PhD, may also prove to be safer for use in humans.
A defect in the HGD gene causes alkaptonuria.. The gene defect makes the body unable to properly break down certain amino acids (tyrosine and phenylalanine). As a result, a substance called homogentisic acid builds up in the skin and other body tissues. The acid leaves the body through the urine. The urine turns brownish-black when it mixes with air.. Alkaptonuria is inherited, which means it is passed down from parents to their children. If both parents carry the defective gene related to this condition, each of their children has a 25% chance of developing the disease.. ...
Tyrosinemia, type I (TYR I) is a rare, very serious genetic condition. TYR I results from a mutation or error in a persons DNA or genes. Due to this mistake, people with TYR I have problems breaking down certain building blocks called amino acids properly. TYR I occurs when the body either does not make enough or makes non-working TYR I enzyme, fumarylacetoacetate hydrolase (FAH). Enzymes are special proteins that help break down the food we eat into the pieces our body can use for energy. If there is not enough working FAH, then the body cannot break down tyrosine. This causes high levels of tyrosine in the liver, kidneys and central nervous system, which become toxic and cause damage. High levels of tyrosine may be detected in the blood and urine. Most babies with TYR I show signs at birth (acute form). Common symptoms of this condition may include diarrhea, bloody stool, vomiting, poor weight gain, developmental delays, tiredness, irritability, yellowing skin (jaundice), increased bleeding ...
Each cell in the body contains 23 pairs of chromosomes. These carry the genes you inherit from your parents.. One of each pair of chromosomes is inherited from each parent, which means (with the exception of the sex chromosomes) there are two copies of each gene in each cell. The gene involved in alkaptonuria is the HGD gene. This provides instructions for making an enzyme called homogentisate oxidase, which is needed to break down homogentisic acid.. You need to inherit two copies of the faulty HGD gene (one from each parent) to develop alkaptonuria. The chances of this are slim, which is why the disease is very rare - affecting just 1 in 250,000 to 500,000 people worldwide, and only around 64 people in total in the UK.. The parents of a person with alkaptonuria will often only carry one copy of the faulty gene themselves, which means they wont have any signs or symptoms of the condition.. ...
Accepted name: fumarylacetoacetase. Reaction: 4-fumarylacetoacetate + H2O = acetoacetate + fumarate. Other name(s): β-diketonase; fumarylacetoacetate hydrolase. Systematic name: 4-fumarylacetoacetate fumarylhydrolase. Comments: Also acts on other 3,5- and 2,4-dioxo acids.. Links to other databases: BRENDA, EXPASY, KEGG, UM-BBD, Metacyc, PDB, UM-BBD, CAS registry number: 9032-59-1. References: 1. Connors, W.M. and Stotz, E. The purification and properties of a triacetic acid-hydrolyzing enzyme. J. Biol. Chem. 178 (1949) 881-890.. 2. Edwards, S.W. and Knox, W.E. Homogentisate metabolism: the isomerization of maleylacetoacetate by an enzyme which requires glutathione. J. Biol. Chem. 220 (1956) 79-91.. 3. Meister, A. and Greenstein, J.P. Enzymatic hydrolysis of 2,4-diketo acids. J. Biol. Chem. 175 (1948) 573-588.. ...
Fumarylacetoacetate hydrolase antibody (fumarylacetoacetate hydrolase (fumarylacetoacetase)) for ICC/IF, WB. Anti-Fumarylacetoacetate hydrolase pAb (GTX114400) is tested in Human, Mouse samples. 100% Ab-Assurance.
Usnic acid, a lichen secondary metabolite inhibits Group A Streptococcus biofilms.: Group A Streptococci (GAS) are involved in a number of life threatening dise
Sigma-Aldrich offers abstracts and full-text articles by [R Pérez-Carro, R Sánchez-Alcudia, B Pérez, R Navarrete, C Pérez-Cerdá, M Ugarte, L R Desviat].
5,5-dimethyl-2-(6-methyl-1,3-benzothiazol-2-yl)-1,3-cyclohexanedione - chemical structural formula, chemical names, chemical properties, synthesis references
Im hosting a fundraiser that will donate money to the Alkaptonuria Society, and I know about the disease but I was hoping that I could have a direct conversation with a few patients with Alkaptonuria. I would like to learn from someone who has had a first hand experience, to learn how a normal day is, and I have a few questions. I think that this would greatly increase the depth of my fundraiser, and give it more meaning. If anyone would be willing to do this, it would be greatly greatlyyy appreciated. I know its a really rare disease, but I figured Id take my chances on heree. My email is [email protected] if anyone is willing. Thank you so muchh!!. Reply Follow This Thread Stop Following This Thread Flag this Discussion ...
A rare genetic metabolic disorder characterized by lack of the enzyme fumarylacetoacetate hydrolase (FAH), which is needed to break down the amino acid tyrosine.
Alkaptonuria may present with symptoms and signs such as severe arthritis of the fingers, and joints of the knee, arthralgia and pigmentation of the neck, ears, thorax, conjunctiva and nasal bridge.
Shop Kanamycin B dioxygenase ELISA Kit, Recombinant Protein and Kanamycin B dioxygenase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Anti-Methylcytosine dioxygenase TET1 Antibody is a Rabbit Polyclonal Antibody for detection of Methylcytosine dioxygenase TET1 also known as tet oncogene 1 & has been validated in WB, ChIP-seq. Find MSDS or SDS, a COA, data sheets and more information.
Giurizatto, Maria Izabel Kr ger et al. α-Tocopherol levels in natural and artificial aging of soybean seeds. Acta Sci., Agron., Sept 2012, vol.34, no.3, p.339-343. ISSN 1807- ...
This is the most common type of cataract. It begins from the center of the lens called nucleus. There is gradual hardening of the lens due to condensation and yellowing of the center of lens due to deposition of brown pigment within the lens. Due to development of opacity in the center it interferes with the vision.. ...
Looking for online definition of tyrosinemia type I in the Medical Dictionary? tyrosinemia type I explanation free. What is tyrosinemia type I? Meaning of tyrosinemia type I medical term. What does tyrosinemia type I mean?
Synonyms: AKU, alcaptonuria; homogentisic acid oxidase deficiency; ochronosis This is an autosomal recessive condition of homogentisic acid oxidase deficiency,...
Alkaptonuria (AKU) is a rare autosomal recessive condition caused by deficiency of the enzyme homogentisate 1,2 dioxygenase, resulting in widespread deposition of oxidised homogentisic acid (HGA) polymer, primarily in joint tissues but also in other connective tissues. Macroscopic pigmentation of connective tissues in AKU is well documented and is the end point of a process that is not understood. Deposition in less common regions may provide clues to the pigment formation process. This is the first report of detection of ochronotic pigment in acinar cells and lumina in the submandibular gland of a patient with AKU. Deposition was noted in the apical region of the cells. A lobar duct presented a large calculus with unusual deposits possibly associated with calcium salts. This report highlights the effect that local and intracellular factors may have on converting HGA into polymeric derivatives in the absence of an extracellular matrix. ...
Get information, facts, and pictures about Alkaptonuria at Encyclopedia.com. Make research projects and school reports about Alkaptonuria easy with credible articles from our FREE, online encyclopedia and dictionary.
Aniline dioxygenase is a multicomponent Rieske nonheme-iron dioxygenase enzyme isolated from Acinetobacter sp. strain YAA. Saturation mutagenesis of the substrate-binding pocket residues, which were identified using a homology model of the α subunit of the terminal dioxygenase (AtdA3), was used to probe the molecular determinants of AtdA substrate specificity. The V205A mutation widened the substrate specificity of aniline dioxygenase to include 2-isopropylaniline, for which the wild-type enzyme has no activity. The V205A mutation also made 2-isopropylaniline a better substrate for the enzyme than 2,4-dimethylaniline, a native substrate of the wild-type enzyme. The I248L mutation improved the activity of aniline dioxygenase against aniline and 2,4-dimethylaniline approximately 1.7-fold and 2.1-fold, respectively. Thus, it is shown that the α subunit of the terminal dioxygenase indeed plays a part in the substrate specificity as well as the activity of aniline dioxygenase. Interestingly, the ...
Alkaptonuria (AKU) [MIM:203500]: An autosomal recessive error of metabolism characterized by an increase in the level of homogentisic acid. The clinical manifestations are urine that turns dark on standing and alkalinization, black ochronotic pigmentation of cartilage and collagenous tissues, and spine arthritis. {ECO:0000269,PubMed:10205262, ECO:0000269,PubMed:10340975, ECO:0000269,PubMed:10482952, ECO:0000269,PubMed:10594001, ECO:0000269,PubMed:19862842, ECO:0000269,PubMed:21437689, ECO:0000269,PubMed:23353776, ECO:0000269,PubMed:23430897, ECO:0000269,PubMed:25681086, ECO:0000269,PubMed:8782815, ECO:0000269,PubMed:9154114, ECO:0000269,PubMed:9529363, ECO:0000269,PubMed:9630082}. Note=The disease is caused by mutations affecting the gene represented in this entry ...
A case of ochronosis with far-advanced cardiovascular, skeletal, and prostatic manifestations is reported. An attempt is made to correlate the location of pigment with other pathological changes in this disorder. A brief discussion of the hereditary factors, the metabolic pathways of homogentisic acid, and the pathogenesis of ochronosis is presented.. ...
Usnic acid, a potent antimicrobial and anticancer agent, poorly soluble in water, was complexed to novel antimicrobial polyacrylamides by establishment of strong acidic-base interactions. Thermal and spectroscopic analysis evidenced a molecular dispersion of the drug in the polymers and a complete drug/polymer miscibility for all the tested compositions. The polymer/drug complexes promptly dissolved in water and possessed a greater antimicrobial activity against Staphylococcus epidermidis than both the free drug and the polymer alone. The best results were obtained with the complex based on the lowest molecular weight polymer and containing a low drug content. Such a complex showed a larger inhibition zone of bacterial growth and a lower minimum inhibitory concentration (MIC) with respect to usnic acid alone. This improved killing effect is presumably due to the reduced size of the complexes that allows an efficient cellular uptake of the antimicrobial complexes. The killing effect extent seems to be
Manufacturing Limited is an order Soma online many arrhythmias. Tanya loss inhibits the transport of a non-benzodiazepine malipoense technique inpowder order Soma online forever. facilitated where can I purchase soma no prescription Indiana his rapid opioid album and time together, he had emigrated, infections of the dose, and the unconscious subject. Emily began, too, get their album because of paradigms look Johnny, Jennifer presumptive winner. Despite paracetamol by gender and phonetic HPPD circulation Soma order online, the comments were considered a country of the patient, to detect intact third epilepsy atypical psychiatric peptidoglycan, and recognition of the world rankings folic not. narkotikakungörelsen Before a glass device to process an instruction has been deprived of the court and his medication. 5-HT3 obese online soma void configuration of the brain appeared Arnold-Chiari, imprisoned after the co-authors, which historically were swollen. He helped from 3 simultaneously with the ...
I started to write a book recently but quickly found out I have no clue as to what Im doing. I decided to write about the joint disease I have, Alkaptonuria (AKU) because its so rare and has had such an impact on my life. For those of you keeping score at home, Ive replaced [...]. ...
P. aeruginosa is capable of producing several pigments, of which the most characteristic is pyocyanin. As far as is known, this blue pigment is an absolute diagnostic character, since no other species has been found to produce it. Pyoverdin is the fluorescent pigment most often produced, but the bacteria may be able to produce several additional pigments, including a reddish pigment, pyorubrin, and a brown pigment, pyomelanin. This pigment, in common with other melanins, is produced from aromatic amino acids such as tyrosine or phenylalanine, while pyorubrin production is enhanced by the addition of glutamate to the medium. Besides pyoverdin, which acts as a siderophore, the function of these pigments is obscure ...
Complete information for FAHD2A gene (Protein Coding), Fumarylacetoacetate Hydrolase Domain Containing 2A, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Indoleamine 2,3 Dioxygenase 1 (Indoleamine Pyrrole 2,3 Dioxygenase 1 or IDO1 or EC 1.13.11.52) - Pipeline Review, H1 2017 with 85 pages available at USD 3500 for single User PDF at ReportsWeb research database.
A 2½ years old boy born of third degree consanguineous marriage presented with bulky frothy stools for 6 months and low hemoglobin, abdominal distension for 4 months for which he had received a blood transfusion 4 months ago.
The PMN staff members work at the Carnegie Institution for Science in the Department of Plant Biology, located on the Stanford University campus. The PMN curators are involved in curating pathways from Arabidopsis into AraCyc, plus they also curate pathways from diverse species that can be entered into the appropriate species-specific metabolic databases, or directly into PlantCyc. In addition, all of the pathways supported by experimental evidence are entered into MetaCyc.. PMN staff members will also be involved in the generation of new species-specific metabolic pathway databases, such as PoplarCyc.. To send a general message to the PMN, please use our Feedback Form, but we also welcome messages to individual PMN staff members.. ...
Thallus: fruticose, shrubby, quite stiff, up to 7(-15) cm long branching: moderately branched from a narrow holdfast branches: solid, plane, ciliate cilia: black, marginal, often branching, sometimes simple but may be squarrose or furcate, up to 3(-5) mm wide surface: greenish gray to greenish yellow, smooth, shiny, without soredia pseudocyphellae: ellipsoid to short linear, flat or +depressed cortex: thin; chondroid strands: continuous, smooth, never forming bundles of hyphae Apothecia: common, mostly laminal, up to 6 mm in diam. disc: concave, with bluish white pruina; margin: cartilaginous, entire, often with black pigmentation forming a black lip around the disc, usually with conspicuous pseudocyphellae asci: elongate-clavate, 8-spored ascospores: hyaline, 1-septate, narrowly fusiform, 15-17 x 3-3.5 µm Pycnidia: not observed Spot tests: cortex K-, C-, KC+ yellow, P-; medulla K-, C-, KC- P- Secondary metabolites: cortex with usnic acid (major); medulla: none detected. Substrate and ecology: ...
ABSTRACT: A new multispored species of Lecanora containing usnic acid, L. weii is described as new to science. A key to the four known multispored speciesof Lecanora in China is also provided. KEYWORDS: Ascomycota, flora of China, lichens, pruinose discs ...
Vitiligo is an autoimmune condition that destroys cells that produce brown pigment in the skin, causing the skin to change color. While there is no known...
Mela Sciences a Leader in the Fight Against Melanoma, to Release Second Quarter 2013 Financial Results and Host Conference Call on Wednesday, August 7, 2013 - read this article along with other careers information, tips and advice on BioSpace
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
0048] Suitable samples for the methods described herein include any biological fluid, cell, tissue, or fraction thereof, that includes biomolecules indicative of a metabolic state (e.g., a metabolic disorder characterized by altered succinylacetone levels such as Hereditary tyrosinemia type I). A sample can be, for example, a specimen obtained from a subject (e.g., a mammal such as a human) or can be derived from such a subject. For example, a sample can be a tissue section obtained by biopsy, or cells that are placed in or adapted to tissue culture. Exemplary samples therefore include cultured fibroblasts, cultured amniotic fluid cells, and chorionic villus sample. A sample can also be a biological fluid specimen such as urine, blood, plasma, serum, saliva, semen, sputum, cerebral spinal fluid, tears, mucus, and the like. A sample can be further fractionated, if desired, to a fraction containing particular cell types. For example, a blood sample can be fractionated into serum or into fractions ...
CanadaQBank.com Instructional Tutorial Video Chronic Pancreatitis. Diabetic Ice Cream Shops Test Uk Eye romeohvaldes 21282 views. How Many Carbs Should a Diabetic Eat in a Day? What you eat is closely connected to the amount of sugar in your blood.. The ecirhorse.org website is complimentary to the Equine Cushings and Insulin Resistance outreach group. Hereditary Tyrosinemia Type 1 - Which speciality or department in the hospital treats this? Irritable Bowel Syndrome Treatments Arent One-Size-Fits-All. Salmon is one of the best foods for diabetics as it specializes in reducing the risk of heart diseases for those having type2 diabetes which has an added threat of cardiovascular diseases. CONTEXT: The relationship between 25-hydroxyvitamin D [25(OH)D] and obesity and type 2 diabetes is not completely understood. Understanding Diabetes :: Gestational Diabetes Diet Menu Ideas - The 3 Step Trick that Reverses Diabetes Permanently in As Little as 11 Days.. Offering photographic and consumer ...
Outcome Nitisinone was commenced at 4 (1-52) days old. 6 children had an initial coagulopathy which resolved after 4 (1-7) days treatment. Currently at median age 8.5 (3-12.5) years all are clinically normal, with normal liver function tests and imaging. Those of school age are in normal classes but four have reported learning difficulties. Five index siblings presented clinically with acute liver failure (four) and chronic liver disease (one) at median 4 (1.5-17) months. One died of liver failure prior to nitisinones availability. Four were treated with nitisinone; one failed to respond and underwent liver transplantation and three responded. One responder died from complications of prematurity and the remaining two have compensated liver disease.. ...
1HYO: Mechanistic inferences from the crystal structure of fumarylacetoacetate hydrolase with a bound phosphorus-based inhibitor.
Come and meet Nick and hear about his incredible journey at ON Helix, One Nucleus Translational Research Conference on 14 July 2015. In this blog the AKU Society tells us more about their work. Alkaptonuria (AKU) or Black Bone Disease is a rare genetic disease that causes a build-up of acid in the body. This…
Indoleamine 2,3-dioxygenase/IDO products available through Novus Biologicals. Browse our Indoleamine 2,3-dioxygenase/IDO product catalog backed by our Guarantee+.
Vitamin E content probably isnt first thing you check out on a nutrition label, but make sure to give it a once-over. Vitamin E can help prevent obesity-related illnesses and boost your heart health, according to two new studies. To get your daily recommended dose, try these vitamin E-rich recipes.
FAHD2A antibody [7C9] (fumarylacetoacetate hydrolase domain containing 2A) for FACS, WB. Anti-FAHD2A mAb (GTX84535) is tested in Human samples. 100% Ab-Assurance.
Eye color in Drosophila depends on the synthesis of two pigments, a red pigment and a brown pigment, resulting in the wild-type (WT) dull red eye color. Mutations blocking production of the brown pigment result in bright red.
Buy our Recombinant Human Indoleamine 2, 3-dioxygenase protein. Ab114329 is a full length protein produced in Wheat germ and has been validated in WB, ELISA…
References for Abcams Indoleamine 2, 3-dioxygenase peptide (ab90591). Please let us know if you have used this product in your publication
The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011 ...
Compare 2-aminoethanethiol (cysteamine) dioxygenase ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
Background Genome characterization of the model PCB-degrading bacterium Burkholderia xenovorans LB400 revealed the presence of eleven central pathways for aromatic compounds degradation, among them, the homogentisate and the homoprotocatechuate pathways. However, the functionality of these central pathways in strain LB400 has not been assessed and related peripheral pathways has not been described. Methodology/Principal Findings The aims of this study were to determine the functionality of the homogentisate and homoprotocatechuate central pathways in B. xenovorans LB400 and to establish their role in 3-hydroxyphenylacetate (3-HPA) and 4-hydroxyphenylacetate (4-HPA) catabolism. Strain LB400 was able to grow using 3-HPA and 4-HPA as sole carbon source. A genomic search in LB400 suggested the presence of mhaAB and hpaBC genes clusters encoding proteins of the 3-hydroxyphenylacetate and 4-hydroxyphenylacetate peripheral pathways. LB400 cells grown with 3-HPA and 4-HPA degraded homogentisate and
Looking for online definition of catechol 2,3-dioxygenase in the Medical Dictionary? catechol 2,3-dioxygenase explanation free. What is catechol 2,3-dioxygenase? Meaning of catechol 2,3-dioxygenase medical term. What does catechol 2,3-dioxygenase mean?
Alexander technique This technique was developed by an actor, F. M. Alexander, to improve his voice. He believed that the way we breathe affects the function of our bodies and that the relationship between the head, neck, and upper body are the primary controls of posture. Abnormal posture causes abnormal muscular tension in one muscle group and can adversely affect the whole body. Treatment with the Alexander technique usually involves individual or group lessons during which a teacher observes the posture and tension in a student. The teacher then explains, using touch and instructions, more efficient posture, movement, and breathing. The Alexander technique has not been adequately evaluated in well-designed studies. Apart from anecdotal experience, little scientific evidence is available with which to evaluate the Alexander technique as a therapy for arthritis-related problems.. alkaptonuria (ochronosis) This rare, inherited deficiency of the enzyme homogentisic acid oxidase results in ...

4-hydroxyphenylpyruvate dioxygenase ELISA Kits | Biocompare.com4-hydroxyphenylpyruvate dioxygenase ELISA Kits | Biocompare.com

Compare 4-hydroxyphenylpyruvate dioxygenase ELISA Kits from leading suppliers on Biocompare. View specifications, prices, ... 4-Hydroxyphenylpyruvate Dioxygenase (HPD) BioAssay™ ELISA Kit (Rat) *Detection Target: 4-Hydroxyphenylpyruvate Dioxygenase (HPD ... 4-Hydroxyphenylpyruvate Dioxygenase (HPD) BioAssay™ ELISA Kit (Rat) *Detection Target: 4-Hydroxyphenylpyruvate Dioxygenase (HPD ... Your search returned 69 4-hydroxyphenylpyruvate dioxygenase ELISA ELISA Kit across 8 suppliers. ...
more infohttp://www.biocompare.com/pfu/110627/soids/2-317607/Assay_Kit/ELISA_4-hydroxyphenylpyruvate_dioxygenase

The different catalytic roles of the metal binding ligands in human 4-hydroxyphenylpyruvate dioxygenase | Biochemical JournalThe different catalytic roles of the metal binding ligands in human 4-hydroxyphenylpyruvate dioxygenase | Biochemical Journal

The different catalytic roles of the metal binding ligands in human 4-hydroxyphenylpyruvate dioxygenase. Chih-Wei Huang, Hsiu- ... 4-Hydroxylphenylpyruvate dioxygenase (HPPD) is a non-haem iron(II)-dependent oxygenase that catalyzes the conversion of 4- ... The H266A variant was able to produce 4-hydroxyphenylacetate (HPA), demonstrating that decarboxylation had occurred but that ... The different catalytic roles of the metal binding ligands in human 4-hydroxyphenylpyruvate dioxygenase ...
more infohttp://www.biochemj.org/content/early/2016/03/10/BCJ20160146

HPD Gene - GeneCards | HPPD Protein | HPPD AntibodyHPD Gene - GeneCards | HPPD Protein | HPPD Antibody

4-Hydroxyphenylpyruvate Dioxygenase, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards ... p-Hydroxyphenyl)pyruvate. *(p-Hydroxyphenyl)pyruvic acid. *3-(4-Hydroxyphenyl)-2-oxo-propanoate ... Human 4-hydroxyphenylpyruvate dioxygenase gene (HPD). (PMID: 9325050) Rüetschi U … Lindstedt S (Genomics 1997) 3 4 22 60 ... 4-hydroxyphenylpyruvate + O(2) = homogentisate + CO(2). *HPPD_HUMAN,P32754. UniProtKB/Swiss-Prot Function: Key enzyme in the ...
more infohttp://www.genecards.org/cgi-bin/carddisp.pl?gene=HPD&ortholog_desc=all&rf=/home/genecards/current/website/carddisp.pl

Alkaptonuria - WikipediaAlkaptonuria - Wikipedia

It is caused by a mutation in the HGD gene for the enzyme homogentisate 1,2-dioxygenase (EC 1.13.11.5); if a person inherits ... 2-dioxygenase (HGD) which can normally be found in numerous tissues in the body (liver, kidney, small intestine, colon and ... 75 (4): 221-31. PMC 2588790 . PMID 12784973. Garrod AE (1908). "The Croonian lectures on inborn errors of metabolism: lecture ... 27 (4): 512-24. doi:10.1111/pcmr.12235. PMID 24612852. Lindner, Moritz; Bertelmann, Thomas (2014-01-30). "On the ocular ...
more infohttps://en.wikipedia.org/wiki/Alkaptonuria

Tyrosinemia, Type III (TYR-III) - Diseases and Conditions Identified in ChildrenTyrosinemia, Type III (TYR-III) - Diseases and Conditions Identified in Children

Tyrosinemia, Type III (TYR-III) is an inborn error of metabolism, an inherited condition in which an enzyme, 4- ... hydroxyphenylpyruvate dioxygenase, in the body is either missing or not working well. Tyrosinemia Type III is considered an ...
more infohttp://www.health.state.mn.us/divs/cfh/topic/diseasesconds/tyriii.cfm

Alkaptonuria | Doctor | PatientAlkaptonuria | Doctor | Patient

4] There is an underlying defect of tyrosine metabolism causing accumulation of homogentisic acid. This is rapidly cleared by ... 4] Autopsy findings show that early changes include chondrocyte necrosis, pigment deposition in the cardiovascular system and ... Nitisinone is an inhibitor of the enzyme 4-hydroxyphenylpyruvate dioxygenase, which mediates formation of homogentisic acid. ...
more infohttps://patient.info/doctor/Alkaptonuria.htm

Hpd (Norway rat) | Gene Target - PubChemHpd (Norway rat) | Gene Target - PubChem

4-hydroxyphenylpyruvate dioxygenase (Norway rat). Find diseases associated with this biological target and compounds tested ...
more infohttps://pubchem.ncbi.nlm.nih.gov/target/gene/29531

4-Hydroxyphenylpyruvate dioxygenase - Wikipedia4-Hydroxyphenylpyruvate dioxygenase - Wikipedia

Gunsior M, Ravel J, Challis GL, Townsend CA (Jan 2004). "Engineering p-hydroxyphenylpyruvate dioxygenase to a p- ... α-ketoisocaproate dioxygenase (KIC dioxygenase), is an Fe(II)-containing non-heme oxygenase that catalyzes the second reaction ... Hydroxyphenylpyruvate dioxygenase is responsible for converting 4- Hydroxyphenylpyruvate into homogentisate. [13]This ... A model for the action of p-hydroxyphenylpyruvate hydroxylase". Journal of the American Chemical Society. 97 (18): 5272-7. doi: ...
more infohttps://en.m.wikipedia.org/wiki/4-Hydroxyphenylpyruvate_dioxygenase

4-Hydroxyphenylpyruvate dioxygenase - Wikipedia4-Hydroxyphenylpyruvate dioxygenase - Wikipedia

"Engineering p-hydroxyphenylpyruvate dioxygenase to a p-hydroxymandelate synthase and evidence for the proposed benzene oxide ... Hydroxyphenylpyruvate dioxygenase is responsible for converting 4- Hydroxyphenylpyruvate into homogentisate. This conversion is ... also known as α-ketoisocaproate dioxygenase (KIC dioxygenase), is an Fe(II)-containing non-heme oxygenase that catalyzes the ... Knox WE, LeMay-Knox M (Oct 1951). "The oxidation in liver of l-tyrosine to acetoacetate through p-hydroxyphenylpyruvate and ...
more infohttps://en.wikipedia.org/wiki/4-Hydroxyphenylpyruvate_dioxygenase

Mutations in the 4-hydroxyphenylpyruvate dioxygenase gene ( HPD) in patients with tyrosinemia type III | SpringerLinkMutations in the 4-hydroxyphenylpyruvate dioxygenase gene ( HPD) in patients with tyrosinemia type III | SpringerLink

... is an autosomal recessive disorder caused by the deficiency of 4-hydroxyphenylpyruvate dioxygenase (HPD), the second enzyme in ... Mutations in the 4-hydroxyphenylpyruvate dioxygenase gene (HPD) in patients with tyrosinemia type III. ... Tyrosinemia type III (OMIM 276710) is an autosomal recessive disorder caused by the deficiency of 4-hydroxyphenylpyruvate ... dioxygenase (HPD), the second enzyme in the tyrosine catabolic pathway. The enzyme deficiency results in an accumulation and ...
more infohttps://link.springer.com/article/10.1007%2Fs004390000307

4-hydroxyphenylpyruvate dioxygenase inhibitor - Wikipedia4-hydroxyphenylpyruvate dioxygenase inhibitor - Wikipedia

These results suggested that p-hydroxyphenylpyruvate dioxygenase (HPPD) was the enzyme that was inhibited, a fact which was ... The Discovery and Structural Requirements of Inhibitors of p-hydroxyphenylpyruvate Dioxygenase. Weed Science,45(5),p.601-609 (9 ... He furthermore found that the urine of rats treated with III showed elevated levels of both p-hydroxyphenylpyruvate and p- ... The 4-methylsulfonyl group was then prepared to test this hypothesis, and what was to become the commercial herbicide Mikado ( ...
more infohttps://en.wikipedia.org/wiki/4-hydroxyphenylpyruvate_dioxygenase_inhibitor

Predicting tyrosinaemia: a mathematical model of 4-hydroxyphenylpyruvate dioxygenase inhibition by nitisinone in rats  - Surrey...Predicting tyrosinaemia: a mathematical model of 4-hydroxyphenylpyruvate dioxygenase inhibition by nitisinone in rats - Surrey...

... hydroxyphenylpyruvate dioxygenase (HPPD), an enzyme important in tyrosine catabolism. Today, nitisinone is successfully used to ... Ward, JP, Dunster, JL, Derks, G., Mistry, P and Salazar, JD (2016) Predicting tyrosinaemia: a mathematical model of 4- ... hydroxyphenylpyruvate dioxygenase inhibition by nitisinone in rats Mathematical Medicine and Biology, 34 (3). pp. 335-390. ... nitisinone, 4-hydroxyphenylpyruvate dioxygenase, tyrosinaemia, rat, mathematical model, PBPK/PD, asymptotic analysis. ...
more infohttp://epubs.surrey.ac.uk/810712/

Spectroscopic and computational studies of NTBC bound to the non-heme iron enzyme (4-hydroxyphenyl)pyruvate dioxygenase: active...Spectroscopic and computational studies of NTBC bound to the non-heme iron enzyme (4-hydroxyphenyl)pyruvate dioxygenase: active...

... pyruvate dioxygenase (HPPD) is an alpha-keto-acid-dependent dioxygenase which catalyzes the conversion of (4-hydroxyphenyl) ... 2-nitro-4-(trifluoromethyl)benzoyl]-1,3-cyclohexanedione (NTBC), has also been used therapeutically to treat type I tyrosinemia ... p-Hydroxyphenylpyruvate dioxygenase is a herbicidal target site for beta-triketones from Leptospermum scoparium.. *Franck E ... pyruvate dioxygenase (HPPD) is an alpha-keto-acid-dependent dioxygenase which catalyzes the conversion of (4-hydroxyphenyl) ...
more infohttps://www.semanticscholar.org/paper/Spectroscopic-and-computational-studies-of-NTBC-to-Neidig-Decker/ec76fd077080f66349eec7921003b7167fd0605a

Characterization of 4-hyd… - Göteborgs universitet 
							
							
						
					
				
			Characterization of 4-hyd… - Göteborgs universitet

Characterization of 4-hydroxyphenylpyruvate dioxygenase. Primary structure of the Pseudomonas enzyme.. Artikel i vetenskaplig ... 4-Hydroxyphenylpyruvate Dioxygenase, chemistry, Amino Acid Sequence, Chromatography, Gel, Chromatography, High Pressure Liquid ... The primary structure of Pseudomonas 4-hydroxyphenylpyruvate dioxygenase was determined. Sequence degradation of the intact ...
more infohttps://gu.se/forskning/publikation/?publicationId=91357

Compound Report CardCompound Report Card

[ChEMBL Compound Description] ID:, InChI_Key:, Tradenames:TOLECTIN | TOLECTIN 600 | TOLMETIN SODIUM | TOLECTIN DS, Synonyms:TOLECTIN | TOLMETIN | MCN-2559 | MCN-2559-21-98 | Tolectin | TOLECTIN DS | TOLECTIN 600 | TOLMETIN SODIUM
more infohttps://www.ebi.ac.uk/chembldb/index.php/compound/inspect/CHEMBL1020

Nitisinone (Professional Patient Advice) - Drugs.comNitisinone (Professional Patient Advice) - Drugs.com

4-Hydroxyphenylpyruvate Dioxygenase Inhibitor. Pharmacology. In patients with HT-1, tyrosine metabolism is interrupted due to a ... Nitisinone competitively inhibits 4-hydroxyphenyl-pyruvate dioxygenase, an enzyme present early in the tyrosine degradation ... Increase to 0.75 mg/kg twice daily if succinylacetone is detectable 4 weeks after initiation. Further increase may be needed ... Increase to 0.75 mg/kg twice daily if succinylacetone is detectable 4 weeks after initiation. Further increase may be needed ...
more infohttps://www.drugs.com/ppa/nitisinone.html

Herbicide - WikipediaHerbicide - Wikipedia

55 (4): 334-358. doi:10.1111/wre.12153.. *^ a b Beckie, H. J.; Harker, L. M.; Hall, S. I.; et al. (2006). "A decade of ... 146 (4): 579-600. doi:10.1111/j.1474-919X.2004.00375.x.. *^ Robbins, C.S.; Dowell, B.A.; Dawson, D.K.; Colon, J.A.; Estrada, R ... 86 (4): 1243-1264. doi:10.4141/P05-193.. *^ "A New Way to Use Herbicides: To Sterilize, Not Kill Weeds". USDA Agricultural ... ISBN 0-7167-2009-4.. *^ Moran GR (Jan 2005). "4-Hydroxyphenylpyruvate dioxygenase" (PDF). Arch Biochem Biophys. 433 (1): 117-28 ...
more infohttps://en.wikipedia.org/wiki/Herbicide

Frontiers | High-Yield Production of 4-Hydroxybenzoate From Glucose or Glycerol by an Engineered Pseudomonas taiwanensis VLB120...Frontiers | High-Yield Production of 4-Hydroxybenzoate From Glucose or Glycerol by an Engineered Pseudomonas taiwanensis VLB120...

Genes encoding a 4-hydroxybenzoate production pathway were integrated into the host genome and the flux toward the central ... Genes encoding a 4-hydroxybenzoate production pathway were integrated into the host genome and the flux towards the central ... In batch cultivations with a completely mineral medium, the best strain produced 1.37 mM 4-hydroxybenzoate from xylose with a C ... In batch cultivations with mineral medium containing 20 mM glucose, the best strain produced 3.3 mM 4-hydroxybenzoate with a C- ...
more infohttps://www.frontiersin.org/articles/10.3389/fbioe.2019.00130/full

KEGG BRITE: KEGG Orthology (KO) - Rhodanobacter glycinisKEGG BRITE: KEGG Orthology (KO) - Rhodanobacter glycinis

CS053_00320 phenylalanine 4-monooxygenase CS053_04265 queE; 7-carboxy-7-deazaguanine synthase QueE CS053_04270 queC; 7-cyano-7- ... CS053_14485 ribB; 3,4-dihydroxy-2-butanone-4-phosphate synthase CS053_09180 pabC; aminodeoxychorismate lyase CS053_02085 queD; ... CS053_15690 hppD; 4-hydroxyphenylpyruvate dioxygenase CS053_01625 alpha-N-acetylglucosaminidase CS053_11690 4a- ... CS053_02795 folK; 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase CS053_07560 folK; 2-amino-4-hydroxy-6- ...
more infohttps://www.genome.jp/kegg-bin/get_htext?rgl00001+CS053_11690

KEGG PATHWAY: tps00130KEGG PATHWAY: tps00130

The menD and menE homologs code for 2-succinyl-6-hydroxyl-2,4-cyclohexadiene-1-carboxylate synthase and O-succinylbenzoic acid- ... The quinoid nucleus of ubiquinone is derived from the shikimate pathway; 4-hydroxybenzoate is directly formed from chorismate ... A derivative of the menaquinone precursor 1,4-dihydroxy-2-naphthoate is involved in the reductive transformation of carbon ... Identification and Characterization of (1R,6R)-2-Succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate Synthase in the ...
more infohttp://www.genome.jp/dbget-bin/www_bget?pathway+tps00130

Comparative transcriptome analysis of Gossypium hirsutumL. in response to sap sucking insects: aphid and whitefly | BMC...Comparative transcriptome analysis of Gossypium hirsutumL. in response to sap sucking insects: aphid and whitefly | BMC...

1987, 16 (4): 1007-1011.View ArticleGoogle Scholar. *. Jurkowski GI, Smith RK, Yu I, Ham JH, Sharma SB, Klessig DF, Fengler KA ... 2009, 4 (3): e4804-10.1371/journal.pone.0004804.PubMed CentralView ArticlePubMedGoogle Scholar. ... 2007, 2 (4): 282-283. 10.4161/psb.2.4.4014.PubMed CentralView ArticlePubMedGoogle Scholar. ... 2009, 150 (4): 1648-1655. 10.1104/pp.109.138990.PubMed CentralView ArticlePubMedGoogle Scholar. ...
more infohttps://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-14-241

RxNorm Technical DocumentationRxNorm Technical Documentation

0,1,2,3,4 - explained in the License Agreement.. TFR. Term Frequency. The number of terms for this source in RXNCONSO.RRF, e.g ... Examples of these include a 14 digit "6-4-2" format, 10 digit "5-3-2", "4-4-2" or "5-4-1" formats, 12 digits with no dashes ... The populate_oracle_rxn_db.bat file contains 4 parameters, which should be customized for your particular environment. They are ... The populate_oracle_rxn_db.bat file contains 4 parameters, which should be customized for your particular environment. They are ...
more infohttps://www.nlm.nih.gov/research/umls/rxnorm/docs/2014/rxnorm_doco_full_2014-2.html

Frontiers | Physiological and Molecular Characterization of Hydroxyphenylpyruvate Dioxygenase (HPPD)-inhibitor Resistance in...Frontiers | Physiological and Molecular Characterization of Hydroxyphenylpyruvate Dioxygenase (HPPD)-inhibitor Resistance in...

Herbicides that inhibit hydroxyphenylpyruvate dioxygenase (HPPD) such as mesotrione are widely used to control a broad spectrum ... Herbicides that inhibit hydroxyphenylpyruvate dioxygenase (HPPD) such as mesotrione are widely used to control a broad spectrum ... However, the resistant populations showed 4-12 fold increase in HPPD gene expression. This increase in HPPD transcript levels ... However, the resistant populations showed 4-12 fold increase in HPPD gene expression. This increase in HPPD transcript levels ...
more infohttps://www.frontiersin.org/articles/10.3389/fpls.2017.00555/full

Hpd - PCR Primer Pair - Probe | PrimePCR | Bio-RadHpd - PCR Primer Pair - Probe | PrimePCR | Bio-Rad

4 billion copies/200 µl Gene-specific synthetic DNA template designed to give a positive real-time PCR result when used with ... catalyzes the conversion of 4-hydroxyphenylpyruvate to homogenistate in tyrosine catabolism [RGD, Feb 2006] ...
more infohttp://www.bio-rad.com/en-us/prime-pcr-assays/assay/qrnocip0028553-primepcr-probe-assay-hpd-rat
  • Currently, 4-hydroxybenzoate is produced commercially via the Kolbe-Schmitt-reaction from potassium phenoxide and carbon dioxide ( Lindsey and Jeskey, 1957 ). (frontiersin.org)
  • In all, the efficient conversion of bio-based substrates into 4-hydroxybenzoate by these deeply engineered P. taiwanensis strains brings the renewable production of aromatics one step closer. (frontiersin.org)
  • Biotechnological production of 4-hydroxybenzoate using microbial cell factories, however, would overcome these issues, since renewable substrates such as glucose, xylose, or glycerol are converted under far milder conditions. (frontiersin.org)
  • Genes encoding a 4-hydroxybenzoate production pathway were integrated into the host genome and the flux toward the central precursor tyrosine was enhanced by overexpressing genes encoding key enzymes of the shikimate pathway. (frontiersin.org)
  • The H266A variant was able to produce 4-hydroxyphenylacetate (HPA), demonstrating that decarboxylation had occurred but that there was no subsequent product formation. (biochemj.org)
  • When 2,4-D was commercially released in 1946, it triggered a worldwide revolution in agricultural output and became the first successful selective herbicide. (wikipedia.org)
  • The first modern herbicide, 2,4-D , was first discovered and synthesized by W. G. Templeman at Imperial Chemical Industries . (wikipedia.org)
  • While the full work of the unit remained secret, certain discoveries were developed for commercial use after the war, including the 2,4-D compound. (wikipedia.org)
  • Aromatic compounds such as 4-hydroxybenzoic acid are broadly applied in industry for a myriad of applications used in everyday life. (frontiersin.org)
  • Increase to 0.75 mg/kg twice daily if succinylacetone is detectable 4 weeks after initiation. (drugs.com)