4-Hydroxyphenylpyruvate Dioxygenase: An enzyme that catalyzes the conversion of 4-hydroxyphenylpyruvate plus oxygen to homogentisic acid and carbon dioxide. EC 1.13.11.27.Homogentisic AcidTyrosinemias: A group of disorders which have in common elevations of tyrosine in the blood and urine secondary to an enzyme deficiency. Type I tyrosinemia features episodic weakness, self-mutilation, hepatic necrosis, renal tubular injury, and seizures and is caused by a deficiency of the enzyme fumarylacetoacetase. Type II tyrosinemia features INTELLECTUAL DISABILITY, painful corneal ulcers, and keratoses of the palms and plantar surfaces and is caused by a deficiency of the enzyme TYROSINE TRANSAMINASE. Type III tyrosinemia features INTELLECTUAL DISABILITY and is caused by a deficiency of the enzyme 4-HYDROXYPHENYLPYRUVATE DIOXYGENASE. (Menkes, Textbook of Child Neurology, 5th ed, pp42-3)Delftia acidovorans: A species of gram-negative rod-shaped bacteria found ubiquitously and formerly called Comamonas acidovorans and Pseudomonas acidovorans. It is the type species of the genus DELFTIA.Homogentisate 1,2-Dioxygenase: A mononuclear Fe(II)-dependent oxygenase, this enzyme catalyzes the conversion of homogentisate to 4-maleylacetoacetate, the third step in the pathway for the catabolism of TYROSINE. Deficiency in the enzyme causes ALKAPTONURIA, an autosomal recessive disorder, characterized by homogentisic aciduria, OCHRONOSIS and ARTHRITIS. This enzyme was formerly characterized as EC 1.13.1.5 and EC 1.99.2.5.Calorimetry: The measurement of the quantity of heat involved in various processes, such as chemical reactions, changes of state, and formations of solutions, or in the determination of the heat capacities of substances. The fundamental unit of measurement is the joule or the calorie (4.184 joules). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Cyclohexanones: Cyclohexane ring substituted by one or more ketones in any position.Search Engine: Software used to locate data or information stored in machine-readable form locally or at a distance such as an INTERNET site.Hematoporphyrins: Iron-free derivatives of heme with 4 methyl groups, 2 hydroxyethyl groups and 2 propionic acid groups attached to the pyrrole rings. Some of these PHOTOSENSITIZING AGENTS are used in the PHOTOTHERAPY of malignant NEOPLASMS.Agrochemicals: Chemicals used in agriculture. These include pesticides, fumigants, fertilizers, plant hormones, steroids, antibiotics, mycotoxins, etc.Chitin: A linear polysaccharide of beta-1->4 linked units of ACETYLGLUCOSAMINE. It is the second most abundant biopolymer on earth, found especially in INSECTS and FUNGI. When deacetylated it is called CHITOSAN.Chitin Synthase: An enzyme that converts UDP glucosamine into chitin and UDP. EC 2.4.1.16.Electrophoresis, Capillary: A highly-sensitive (in the picomolar range, which is 10,000-fold more sensitive than conventional electrophoresis) and efficient technique that allows separation of PROTEINS; NUCLEIC ACIDS; and CARBOHYDRATES. (Segen, Dictionary of Modern Medicine, 1992)Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Pesticides: Chemicals used to destroy pests of any sort. The concept includes fungicides (FUNGICIDES, INDUSTRIAL); INSECTICIDES; RODENTICIDES; etc.Biomass: Total mass of all the organisms of a given type and/or in a given area. (From Concise Dictionary of Biology, 1990) It includes the yield of vegetative mass produced from any given crop.Amino Acids, Peptides, and Proteins: Amino acids and chains of amino acids connected by peptide linkages.Lipid Metabolism, Inborn Errors: Errors in the metabolism of LIPIDS resulting from inborn genetic MUTATIONS that are heritable.Metabolism, Inborn Errors: Errors in metabolic processes resulting from inborn genetic mutations that are inherited or acquired in utero.Peroxisomal Disorders: A heterogeneous group of inherited metabolic disorders marked by absent or dysfunctional PEROXISOMES. Peroxisomal enzymatic abnormalities may be single or multiple. Biosynthetic peroxisomal pathways are compromised, including the ability to synthesize ether lipids and to oxidize long-chain fatty acid precursors. Diseases in this category include ZELLWEGER SYNDROME; INFANTILE REFSUM DISEASE; rhizomelic chondrodysplasia (CHONDRODYSPLASIA PUNCTATA, RHIZOMELIC); hyperpipecolic acidemia; neonatal adrenoleukodystrophy; and ADRENOLEUKODYSTROPHY (X-linked). Neurologic dysfunction is a prominent feature of most peroxisomal disorders.Acyl-CoA Dehydrogenase, Long-Chain: A flavoprotein oxidoreductase that has specificity for long-chain fatty acids. It forms a complex with ELECTRON-TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.Acyl-CoA Dehydrogenase: A flavoprotein oxidoreductase that has specificity for medium-chain fatty acids. It forms a complex with ELECTRON TRANSFERRING FLAVOPROTEINS and conveys reducing equivalents to UBIQUINONE.Gene Rearrangement: The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.OregonPregnancy Outcome: Results of conception and ensuing pregnancy, including LIVE BIRTH; STILLBIRTH; SPONTANEOUS ABORTION; INDUCED ABORTION. The outcome may follow natural or artificial insemination or any of the various ASSISTED REPRODUCTIVE TECHNIQUES, such as EMBRYO TRANSFER or FERTILIZATION IN VITRO.Pregnancy: The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.Pregnancy Complications: Conditions or pathological processes associated with pregnancy. They can occur during or after pregnancy, and range from minor discomforts to serious diseases that require medical interventions. They include diseases in pregnant females, and pregnancies in females with diseases.Ascorbic Acid: A six carbon compound related to glucose. It is found naturally in citrus fruits and many vegetables. Ascorbic acid is an essential nutrient in human diets, and necessary to maintain connective tissue and bone. Its biologically active form, vitamin C, functions as a reducing agent and coenzyme in several metabolic pathways. Vitamin C is considered an antioxidant.Diabetes Mellitus, Type 2: A subclass of DIABETES MELLITUS that is not INSULIN-responsive or dependent (NIDDM). It is characterized initially by INSULIN RESISTANCE and HYPERINSULINEMIA; and eventually by GLUCOSE INTOLERANCE; HYPERGLYCEMIA; and overt diabetes. Type II diabetes mellitus is no longer considered a disease exclusively found in adults. Patients seldom develop KETOSIS but often exhibit OBESITY.Vitamin A: Retinol and derivatives of retinol that play an essential role in metabolic functioning of the retina, the growth of and differentiation of epithelial tissue, the growth of bone, reproduction, and the immune response. Dietary vitamin A is derived from a variety of CAROTENOIDS found in plants. It is enriched in the liver, egg yolks, and the fat component of dairy products.Pseudomonas aeruginosa: A species of gram-negative, aerobic, rod-shaped bacteria commonly isolated from clinical specimens (wound, burn, and urinary tract infections). It is also found widely distributed in soil and water. P. aeruginosa is a major agent of nosocomial infection.Pseudomonas: A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.Pseudomonas Infections: Infections with bacteria of the genus PSEUDOMONAS.Pseudomonas putida: A species of gram-negative, aerobic bacteria isolated from soil and water as well as clinical specimens. Occasionally it is an opportunistic pathogen.Pseudomonas fluorescens: A species of nonpathogenic fluorescent bacteria found in feces, sewage, soil, and water, and which liquefy gelatin.JapanBacterial Proteins: Proteins found in any species of bacterium.MedlinePlus: NATIONAL LIBRARY OF MEDICINE service for health professionals and consumers. It links extensive information from the National Institutes of Health and other reviewed sources of information on specific diseases and conditions.trans-1,4-Bis(2-chlorobenzaminomethyl)cyclohexane Dihydrochloride: An anticholesteremic agent that inhibits sterol biosynthesis in animals.Consumer Health Information: Information intended for potential users of medical and healthcare services. There is an emphasis on self-care and preventive approaches as well as information for community-wide dissemination and use.Sodium: A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.Graves Ophthalmopathy: An autoimmune disorder of the EYE, occurring in patients with Graves disease. Subtypes include congestive (inflammation of the orbital connective tissue), myopathic (swelling and dysfunction of the extraocular muscles), and mixed congestive-myopathic ophthalmopathy.Social Media: Platforms that provide the ability and tools to create and publish information accessed via the INTERNET. Generally these platforms have three characteristics with content user generated, high degree of interaction between creator and viewer, and easily integrated with other sites.Alkaptonuria: An inborn error of amino acid metabolism resulting from a defect in the enzyme HOMOGENTISATE 1,2-DIOXYGENASE, an enzyme involved in the breakdown of PHENYLALANINE and TYROSINE. It is characterized by accumulation of HOMOGENTISIC ACID in the urine, OCHRONOSIS in various tissues, and ARTHRITIS.Ochronosis: The yellowish discoloration of connective tissue due to deposition of HOMOGENTISIC ACID (a brown-black pigment). This is due to defects in the metabolism of PHENYLALANINE and TYROSINE. Ochronosis occurs in ALKAPTONURIA, but has also been associated with exposure to certain chemicals (e.g., PHENOL, trinitrophenol, BENZENE DERIVATIVES).Phenylalanine: An essential aromatic amino acid that is a precursor of MELANIN; DOPAMINE; noradrenalin (NOREPINEPHRINE), and THYROXINE.Metabolome: The dynamic collection of metabolites which represent a cell's or organism's net metabolic response to current conditions.Metabolomics: The systematic identification and quantitation of all the metabolic products of a cell, tissue, organ, or organism under varying conditions. The METABOLOME of a cell or organism is a dynamic collection of metabolites which represent its net response to current conditions.Canada: The largest country in North America, comprising 10 provinces and three territories. Its capital is Ottawa.British Columbia: A province of Canada on the Pacific coast. Its capital is Victoria. The name given in 1858 derives from the Columbia River which was named by the American captain Robert Gray for his ship Columbia which in turn was named for Columbus. (From Webster's New Geographical Dictionary, 1988, p178 & Room, Brewer's Dictionary of Names, 1992, p81-2)Genomics: The systematic study of the complete DNA sequences (GENOME) of organisms.Alberta: A province of western Canada, lying between the provinces of British Columbia and Saskatchewan. Its capital is Edmonton. It was named in honor of Princess Louise Caroline Alberta, the fourth daughter of Queen Victoria. (From Webster's New Geographical Dictionary, 1988, p26 & Room, Brewer's Dictionary of Names, 1992, p12)Academies and Institutes: Organizations representing specialized fields which are accepted as authoritative; may be non-governmental, university or an independent research organization, e.g., National Academy of Sciences, Brookings Institution, etc.

Characterization and subcellular compartmentation of recombinant 4-hydroxyphenylpyruvate dioxygenase from Arabidopsis in transgenic tobacco. (1/55)

4-Hydroxyphenylpyruvate dioxygenase (4HPPD) catalyzes the formation of homogentisate (2,5-dihydroxyphenylacetate) from p-hydroxyphenylpyruvate and molecular oxygen. In plants this enzyme activity is involved in two distinct metabolic processes, the biosynthesis of prenylquinones and the catabolism of tyrosine. We report here the molecular and biochemical characterization of an Arabidopsis 4HPPD and the compartmentation of the recombinant protein in chlorophyllous tissues. We isolated a 1508-bp cDNA with one large open reading frame of 1338 bp. Southern analysis strongly suggested that this Arabidopsis 4HPPD is encoded by a single-copy gene. We investigated the biochemical characteristics of this 4HPPD by overproducing the recombinant protein in Escherichia coli JM105. The subcellular localization of the recombinant 4HPPD in chlorophyllous tissues was examined by overexpressing its complete coding sequence in transgenic tobacco (Nicotiana tabacum), using Agrobacterium tumefaciens transformation. We performed western analyses for the immunodetection of protein extracts from purified chloroplasts and total leaf extracts and for the immunocytochemistry on tissue sections. These analyses clearly revealed that 4HPPD was confined to the cytosol compartment, not targeted to the chloroplast. Western analyses confirmed the presence of a cytosolic form of 4HPPD in cultured green Arabidopsis cells.  (+info)

Crystal structure of Pseudomonas fluorescens 4-hydroxyphenylpyruvate dioxygenase: an enzyme involved in the tyrosine degradation pathway. (2/55)

BACKGROUND: In plants and photosynthetic bacteria, the tyrosine degradation pathway is crucial because homogentisate, a tyrosine degradation product, is a precursor for the biosynthesis of photosynthetic pigments, such as quinones or tocophenols. Homogentisate biosynthesis includes a decarboxylation step, a dioxygenation and a rearrangement of the pyruvate sidechain. This complex reaction is carried out by a single enzyme, the 4-hydroxyphenylpyruvate dioxygenase (HPPD), a non-heme iron dependent enzyme that is active as a homotetramer in bacteria and as a homodimer in plants. Moreover, in humans, a HPPD deficiency is found to be related to tyrosinemia, a rare hereditary disorder of tyrosine catabolism. RESULTS: We report here the crystal structure of Pseudomonas fluorescens HPPD refined to 2.4 A resolution (Rfree 27.6%; R factor 21.9%). The general topology of the protein comprises two barrel-shaped domains and is similar to the structures of Pseudomonas 2,3-dihydroxybiphenyl dioxygenase (DHBD) and Pseudomonas putida catechol 2,3-dioxygenase (MPC). Each structural domain contains two repeated betaalpha betabeta betaalpha modules. There is one non-heme iron atom per monomer liganded to the sidechains of His161, His240, Glu322 and one acetate molecule. CONCLUSIONS: The analysis of the HPPD structure and its superposition with the structures of DHBD and MPC highlight some important differences in the active sites of these enzymes. These comparisons also suggest that the pyruvate part of the HPPD substrate (4-hydroxyphenylpyruvate) and the O2 molecule would occupy the three free coordination sites of the catalytic iron atom. This substrate-enzyme model will aid the design of new inhibitors of the homogentisate biosynthesis reaction.  (+info)

A mouse model of renal tubular injury of tyrosinemia type 1: development of de Toni Fanconi syndrome and apoptosis of renal tubular cells in Fah/Hpd double mutant mice. (3/55)

Hereditary tyrosinemia type 1 (HT1) (McKusick 276700), a severe autosomal recessive disorder of tyrosine metabolism, is caused by mutations in the fumarylacetoacetate hydrolase gene Fah (EC 3.7.1.2), which encodes the last enzyme in the tyrosine catabolic pathway. HT1 is characterized by severe progressive liver disease and renal tubular dysfunction. Homozygous disruption of the gene encoding Fah in mice causes neonatal lethality (e.g., lethal Albino deletion c14CoS mice), an event that limits use of this animal as a model for HT1. A new mouse model was developed with two genetic defects, Fah and 4-hydroxyphenylpyruvate dioxygenase (Hpd). The Fah-/- Hpd-/- mice grew normally without evidence of liver and renal disease, and the phenotype is similar to that in Fah+/+ Hpd-/- mice. The renal tubular cells of Fah-/- Hpd-/- mice, particularly proximal tubular cells, underwent rapid apoptosis when homogentisate, the intermediate metabolite between HPD and FAH, was administered to the Fah-/- Hpd-/- mice. Simultaneously, renal tubular function was impaired and Fanconi syndrome occurred. Apoptotic death of renal tubular cells, but not renal dysfunction, was prevented by pretreatment of the animals with YVAD, a specific inhibitor of caspases. In the homogentisate-treated Fah-/- Hpd-/- mice, massive amounts of succinylacetone were excreted into the urine, regardless of treatment with inhibitors. It is suggested that apoptotic death of renal tubular cells, as induced by administration of homogentisate to Fah-/- Hpd-/- mice, was caused by an intrinsic process, and that renal apoptosis and tubular dysfunctions in tubular cells occurred through different pathways. These observations shed light on the pathogenesis of renal tubular injury in subjects with FAH deficiency. These Fah-/- Hpd-/- mice can serve as a model in experiments related to renal tubular damage.  (+info)

The phytotoxic lichen metabolite, usnic acid, is a potent inhibitor of plant p-hydroxyphenylpyruvate dioxygenase. (4/55)

The lichen secondary metabolite usnic acid exists as a (-) and a (+) enantiomer, indicating a alpha or beta projection of the methyl group at position 9b, respectively. (-)-Usnic caused a dose-dependent bleaching of the cotyledonary tissues associated with a decrease of both chlorophylls and carotenoids in treated plants whereas no bleaching was observed with the (+) enantiomer. (-)-Usnic acid inhibited protophorphyrinogen oxidase activity (I50 = 3 microM), but did not lead to protoporphyrin IX accumulation. Bleaching appears to be caused by irreversible inhibition of the enzyme 4-hydroxyphenylpyruvate dioxygenase by (-)-usnic acid (apparent IC50 = 50 nM).  (+info)

Gene genealogies, cryptic species, and molecular evolution in the human pathogen Coccidioides immitis and relatives (Ascomycota, Onygenales). (5/55)

Previous genealogical analyses of population structure in Coccidioides immitis revealed the presence of two cryptic and sexual species in this pathogenic fungus but did not clarify their origin and relationships with respect to other taxa. By combining the C. immitis data with those of two of its closest relatives, the free-living saprophytes Auxarthron zuffianum and Uncinocarpus reesii, we show that the C. immitis species complex is monophyletic, indicating a single origin of pathogenicity. Cryptic species also were found in both A. zuffianum and U. reesii, indicating that they can be found in both pathogenic and free-living fungi. Our study, together with a few others, indicates that the current list of known fungal species might be augmented by a factor of at least two. However, at least in the C. immitis, A. zuffianum, and U. reesii complexes, cryptic species represent subdivisions at the tips of deep monophyletic clades and thus well within the existing framework of generic classification. An analysis of silent and expressed divergence and polymorphism values between and within the taxa identified by genealogical concordance did not reveal faster evolution in C. immitis as a consequence of adaptation to the pathogenic habit, nor did it show positive Darwinian evolution in a region of a dioxygenase gene (tcrP gene coding for 4-HPPD) known to cause antigenic responses in humans. Instead, the data suggested relative stasis, indicative of purifying selection against mostly deleterious mutations. Two introns in the same gene fragment were considerably more divergent than exons and were unalignable between species complexes but had very low polymorphism within taxa.  (+info)

Pharmacokinetics and pharmacodynamics of NTBC (2-(2-nitro-4-fluoromethylbenzoyl)-1,3-cyclohexanedione) and mesotrione, inhibitors of 4-hydroxyphenyl pyruvate dioxygenase (HPPD) following a single dose to healthy male volunteers. (6/55)

AIMS: NTBC (2-(2-nitro-4-fluoromethylbenzoyl)-1,3-cyclohexanedione) and mesotrione (2-(4-methylsulphonyl-2-nitrobenzoyl)-1,3-cyclohexanedione) are inhibitors of 4-hydroxyphenyl pyruvate dioxygenase (HPPD). NTBC has been successfully used as a treatment for hereditary tyrosinaemia type 1 (HT-1), while mesotrione has been developed as an herbicide. The pharmacokinetics of the two compounds were investigated in healthy male volunteers following single oral administration. The aim of the NTBC study was to assess the bioequivalence of two different formulations and to determine the extent of the induced tyrosinaemia. The mesotrione study was performed to determine the magnitude and duration of the effect on tyrosine catabolism. Additionally, the urinary excretion of unchanged mesotrione was measured to assess the importance of this route of clearance and to help develop a strategy for monitoring occupational exposure. METHODS: A total of 28 volunteers participated in two separate studies with the compounds. In the first study, the relative bioavailability of NTBC from liquid and capsule formulations was compared and the effect on plasma tyrosine concentrations measured. In the second study the pharmacokinetics of mesotrione were determined at three doses. Plasma tyrosine concentrations were monitored and the urinary excretion of mesotrione and tyrosine metabolites was measured. RESULTS: Both compounds were well tolerated at the dose levels studied. Peak plasma concentrations of NTBC were rapidly attained following a single oral dose of 1 mg x kg(-1) body weight of either formulation and the half-life in plasma was approximately 54 h. There were no statistical differences in mean (+/- s.d.) AUC(0,infinity) (capsule 602 +/- 154 vs solution 602 +/- 146 microg x ml(-1) h) or t1/2 (capsule 55 +/- 13 vs solution 54 +/- 8 h) and these parameters supported the bioequivalence of the two formulations. Mesotrione was also rapidly absorbed, with a significant proportion of the dose eliminated unchanged in urine. The plasma half-life was approximately 1 h and was independent of dose and AUC(0,infinity) and Cmax increased linearly with dose. Following administration of 1 mg NTBC x kg(-1) in either formulation, the concentrations of tyrosine in plasma increased to approximately 1100 nmol x ml(-1). Concentrations were still approximately 8 times those of background at 14 days after dosing, but had returned to background levels within 2 months of the second dose. Administration of mesotrione resulted in an increase in tyrosine concentrations which reached a maximum of approximately 300 nmol x ml(-1) following a dose of 4 mg x kg(-1) body weight. Concentrations returned to those of background within 2 days of dosing. Urinary excretion of tyrosine metabolites was increased during the 24 h immediately following a dose of 4 mg mesotrione x kg(-1), but returned to background levels during the following 24 h period. CONCLUSIONS: NTBC and mesotrione are both inhibitors of HPPD, although the magnitude and duration of their effect on tyrosine concentrations are very different. When normalized for dose, the extent of the induced tyrosinaemia after administration of NTBC and over the duration of these studies, was approximately 400 fold greater than that following administration of mesotrione. The persistent and significant effect on HPPD following administration of NTBC make it suitable for the treatment of patients with hereditary tyrosinaemia type 1 (HT-1), whilst the minimal and transient effects of mesotrione minimize the likelihood of a clinical effect in the event of systemic exposure occurring during occupational use.  (+info)

Purification and properties of avian liver p-hydroxyphenylpyruvate hydroxylase. (7/55)

Avian liver p-hydroxyphenylpyruvate hydroxylase (EC 1.13.11.27) was purified to a 1000-fold increase in specific activity over crude supernatant, utilizing a substrate analogue, o-hydroxyphenylpyruvate, to stabilize the enzyme. The preparation was homogeneous with respect to sedimentation with a sedimentation velocity (s20,w) of 5.3 S. The molecular weight of the enzyme was determined to be 97,000 +/- 5,000 by sedimentation equilibrium, and the molecular weight of the subunits was determined to be 49,000 +/- 3,000 by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Polyacrylamide gel electrophoresis revealed heterogeneity of the purified enzyme. The multiple molecular forms were separable by isoelectric focusing, and their isoelectric points ranged from pH 6.8 to 6.0. The amino acid compositions and tryptic peptide maps of the three forms isolated by isoelectric focusing were very similar. The forms of the enzyme had the same relative activity toward p-hydroxyphenylpyruvate and phenylpyruvate. Conditions which are known to accelerate nonenzymic deamidation of proteins caused interconversion of the multiple molecular forms. Iron was the only transition metal found to be associated with the purified enzyme at significant levels. The amount of enzyme-bound iron present in equilibrium-dialyzed samples was equivalent to 1 atom of iron per enzyme subunit. Purification of the enzyme activity correlated with the purification of the enzyme-bound iron. An EPR scan of the purified enzyme gave a signal at g equal 4.33, which is characteristic of ferric iron in a rhombic ligand field.  (+info)

A specific role for tocopherol and of chemical singlet oxygen quenchers in the maintenance of photosystem II structure and function in Chlamydomonas reinhardtii. (8/55)

alpha-Tocopherol concentrations were determined at low and high light intensities and compared with the rate of photosynthesis, photosystem II (PS II) and its reaction center D1 protein. Blocking of tocopherol biosynthesis at the 4-hydroxyphenylpyruvate dioxygenase by the herbicide pyrazolynate led to a quick disappearance of alpha-tocopherol in high light, as well as of PS II activity and the D1 protein. Homogentisic acid rescued all activities. It is concluded that alpha-tocopherol has a continuous turnover as a scavenger of the singlet oxygen that arises from the quenching by oxygen of the triplet of the PS II reaction center and triggers the degradation of the D1 protein. Thus tocopherols are essential to keep photosynthesis active. We suggest that this is why plants make and need tocopherols. Chemical quenchers of singlet oxygen, notably diphenylamines, completely protect PS II, prevent D1 protein degradation and keep tocopherol levels even at very high light intensities. This supports the notion that 1O2 is the intermediate in light triggered D1 protein turnover.  (+info)

Compare 4-hydroxyphenylpyruvate dioxygenase ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
4-Hydroxylphenylpyruvate dioxygenase (HPPD) is a non-haem iron(II)-dependent oxygenase that catalyzes the conversion of 4-hydroxylphenylpyruvate (HPP) to homogentisate (HG). In the active site, a strictly conserved 2-His-1-Glu facial triad coordinates the iron ready for catalysis. Substitution of these residues resulted in about a 10-fold decrease in the metal binding affinity, as measured by isothermal titration calorimetry, and a large reduction in enzyme catalytic efficiencies. This study revealed the vital role of the ligand E349 in enzyme function. Substitution of this residue by alanine resulted in loss of activity. The E349G variant retained 5% activity for the coupled reaction, suggesting that coordinating water may be able to support activation of the trans bound dioxygen upon substrate binding. The reaction catalyzed by the H183A variant was fully uncoupled. H183A variant catalytic activity resulted in protein cleavage between Ile267 Ala268 and the production of an N-terminal fragment. ...
Aspergillus fumigatus is the most important airborne fungal pathogen of immunosuppressed humans. A. fumigatus is able to produce dihydroxynaphthalene melanin, which is predominantly present in the conidia. Its biosynthesis is an important virulence determinant. Here, we show that A. fumigatus is able to produce an alternative melanin, i.e., pyomelanin, by a different pathway, starting from L-tyrosine. Proteome analysis indicated that the l-tyrosine degradation enzymes are synthesized when the fungus is grown with L-tyrosine in the medium. To investigate the pathway in detail, we deleted the genes encoding essential enzymes for pigment production, homogentisate dioxygenase (hmgA) and 4-hydroxyphenylpyruvate dioxygenase (hppD). Comparative Fourier transform infrared spectroscopy of synthetic pyomelanin and pigment extracted from A. fumigatus cultures confirmed the identity of the observed pigment as pyomelanin. In the hmgA deletion strain, HmgA activity was abolished and the accumulation of ...
Complete information for HPD gene (Protein Coding), 4-Hydroxyphenylpyruvate Dioxygenase, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Tyrosinemia, Type III (TYR-III) is an inborn error of metabolism, an inherited condition in which an enzyme, 4-hydroxyphenylpyruvate dioxygenase, in the body is either missing or not working well. Tyrosinemia Type III is considered an amino acid condition because the body is unable to break down the amino acid (part of protein), known as tyrosine, when this enzyme is not working properly. This condition is rare and the signs and symptoms of TYR-III can be variable and are not yet well defined.. For more information about Tyrosinemia, Type III, go to Babys First Test: Tyrosinemia, Type III. A listing of contact information for Minnesota inborn errors of metabolism medical specialty providers/clinics serving children affected with or undergoing evaluation for conditions that can be detected through Minnesota Newborn Screening is available upon request. ...
Gene target information for Hpd - 4-hydroxyphenylpyruvate dioxygenase (Norway rat). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Tyrosine is derived from the diet, from metabolism of phenylalanine, and from the bodys proteins during catabolic stress. Tyrosine degradation is catalyzed by a series of five enzymatic reactions, with end products being acetoacetate and fumarate. The hepatocyte and renal proximal tubules are the only two cell types that express the complete pathway and contain sufficient quantities of all enzymes required for tyrosine catabolism (Figure 17-1). Normal plasma tyrosine concentrations are between 30 and 120 μmol/L. Increased concentrations of tyrosine in plasma are common and may be the result of a primary inherited metabolic disorder, but they may also be secondary. The most common causes are listed in Table 17-1. The primary disorders are all defects in the tyrosine degradation pathway. The first is tyrosine aminotransferase deficiency (tyrosinemia type 2) and the second is 4-hydroxy-phenylpyruvate dioxygenase deficiency (tyrosinemia type 3). The most common disorder in the pathway, however, is ...
Hallucinogen Persisting Perception Disorder (HPPD) Support Forum - support for HPPD, flashbacks, drug-induced visual snow syndrome and depersonalization/derealization.
Hallucinogen Persisting Perception Disorder (HPPD) Support Forum - support for HPPD, flashbacks, drug-induced visual snow syndrome and depersonalization/derealization.
Phenylalanine (abbreviated as Phe or F) is an alpha-amino acid. The L-isomer is one of the 22 proteinogenic amino acids, i.e., the building blocks of proteins. It is classified as a nonpolar, aromatic amino acid, because of the hydrophobic nature of the benzyl side chain. L-Phenylalanine (LPA) is an electrically neutral amino acid. It is used in the manufacture of food and drink products and sold as a nutritional supplement for its reputed analgesic and antidepressant effects. Biosynthesis of phenylalanine, tyrosine, and tryptophan proceeds via a common pathway to chorismate, at which point the pathway branches. One branch proceeds to phenylalanine and tyrosine, and the other to tryptophan. The phenylalanine and tyrosine branch has one reaction in common, rearrangement of chorismate to prephenate, at which point, the pathway branches again to either phenylalanine or tyrosine. S. cerevisiae, similar to E. coli, synthesizes phenylalanine and tyrosine via the intermediate 4-hydroxyphenylpyruvate ...
Professor Zhaos team developed the artificial biosynthesis of salvianic acid A. Guided by catalytic mechanisms of bio-enzymes and retrosynthetic analysis and by mining big bioinformation databases, the team discovered that a P450 enzyme can hydroxylate by meta-position hydroxyphenylpyruvic acid, the precursor of salvianic acid A. A D-lactic dehydrogenase can reduce keto in the hydroxyl group, which generates salvianic acid A ...
Synonyms: HPPD, flashbacks This condition occurs in those who have previously taken hallucinogenic recreational drugs, usually on a number of occasions....
Although rare, some people whove taken hallucinogenic substances develop hallucinogen persisting perception disorder (HPPD), a sensory disorder. Learn more.
TY - JOUR. T1 - TATN-1 Mutations Reveal a Novel Role for Tyrosine as a Metabolic Signal That Influences Developmental Decisions and Longevity in Caenorhabditis elegans. AU - Ferguson, Annabel A.. AU - Roy, Sudipa. AU - Kormanik, Kaitlyn N.. AU - Kim, Yongsoon. AU - Dumas, Kathleen J.. AU - Ritov, Vladimir B.. AU - Matern, Dietrich. AU - Hu, Patrick J.. AU - Fisher, Alfred L.. PY - 2013. Y1 - 2013. N2 - Recent work has identified changes in the metabolism of the aromatic amino acid tyrosine as a risk factor for diabetes and a contributor to the development of liver cancer. While these findings could suggest a role for tyrosine as a direct regulator of the behavior of cells and tissues, evidence for this model is currently lacking. Through the use of RNAi and genetic mutants, we identify tatn-1, which is the worm ortholog of tyrosine aminotransferase and catalyzes the first step of the conserved tyrosine degradation pathway, as a novel regulator of the dauer decision and modulator of the daf-2 ...
TY - JOUR. T1 - The Influence of Thyroxine and Thiouracil on Rats Fed Excess Tyrosine (34572). AU - Boctor, Amal M.. AU - Rogers, Quinton. AU - Harper, A. E.. PY - 1970/1/1. Y1 - 1970/1/1. N2 - Addition of thiouracil to a high tyrosine diet alleviated signs of tyrosine toxicity in the rat, whereas, daily injections of thyroxine aggravated them. Plasma tyrosine concentration and liver tyrosine transaminase activity were high in rats fed a high tyrosine diet; thyroxine administration increased them further, but depressed slightly the activity of liver p-hydroxyphenylpyruvate hydroxylase.. AB - Addition of thiouracil to a high tyrosine diet alleviated signs of tyrosine toxicity in the rat, whereas, daily injections of thyroxine aggravated them. Plasma tyrosine concentration and liver tyrosine transaminase activity were high in rats fed a high tyrosine diet; thyroxine administration increased them further, but depressed slightly the activity of liver p-hydroxyphenylpyruvate hydroxylase.. UR - ...
The protein synthesis inhibitor anisomycin features a unique benzylpyrrolidine system and exhibits diverse biological and pharmacologic activities. Its biosynthetic origin has remained obscure for more than 60 y, however. Here we report the identification of the biosynthetic gene cluster (BGC) of anisomycin in Streptomyces hygrospinosus var. beijingensis by a bioactivity-guided high-throughput screening method. Using a combination of bioinformatic analysis, reverse genetics, chemical analysis, and in vitro biochemical assays, we have identified a core four-gene ensemble responsible for the synthesis of the pyrrolidine system in anisomycin: aniQ, encoding a aminotransferase that catalyzes an initial deamination and a later reamination steps; aniP, encoding a transketolase implicated to bring together an glycolysis intermediate with 4-hydroxyphenylpyruvic acid to form the anisomycin molecular backbone; aniO, encoding a glycosyltransferase that catalyzes a cryptic glycosylation crucial for ...
215281DNAartificialsynthetic chimeric gene 1ctagtggcgc cacgcgtgat atcatgcatg ttaacatcga tccatgggcg cgccttaatt 60aaatttaaat cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 120tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 180agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 240aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 300gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 360tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 420cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 480ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt 540cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 600atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 660tgccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 720gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 780gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg ...
Accepted name: aspartate phenylpyruvate transaminase. Reaction: L-aspartate + phenylpyruvate = oxaloacetate + L-phenylalanine. For diagram click here (mechanism).. Other name(s): aspartate-phenylpyruvate aminotransferase. Systematic name: L-aspartate:phenylpyruvate aminotransferase. Comments: The enzyme from Pseudomonas putida also acts on 4-hydroxy-phenylpyruvate and, more slowly, on L-glutamate and L-histidine.. Links to other databases: BRENDA, EXPASY, KEGG, Metacyc, CAS registry number: 99533-45-6. References: 1. Holger, Z. and Kula, M.-R. Isolation and characterization of a highly inducible L-aspartate-phenylpyruvate transaminase from Pseudomonas putida. J. Biotechnol. 3 (1985) 19-31.. ...
Der bør foretages øjenundersøgelse med spaltelampe inden behandlingsstart og derefter mindst én gang årligt. Plasma-tyrosin kan stige under behandlingen. Da højt plasma-tyrosin er forbundet med oftalmologiske komplikationer, bør øjengener følges op med måling af plasma-tyrosin med evt. efterfølgende regulering af diæt. I tilfælde af plasma-tyrosin > 400 mikromol/l bør kostens indhold af tyrosin og phenylalanin begrænses ...
GenBank) Acireductone dioxygenase; 1,2-dihydroxy-3-keto-5-methylthiopentene dioxygenase; DHK-MTPene dioxygenase; Acireductone ...
putative 3,5-dihydroxyphenylacetyl-CoA 1,2-dioxygenase [hydroxyacyl-dehydrogenase] GTGACCACGGATTCCCCGACGCTGTCGCTTTCGCCGGGGCTCGACCATCGAGCCCTGGCG AAGGCGGCACAGCGTGTCGACGAGCTGCTCGACGGGTTGCCGTCGCCCTCGGCCAGGACG CCCGCGCAGCGTGAGGCCGCGTCCTCGGCGCTGGACGAGATCAGGGCGGCGCGGACGGAG TACGTGGAAGCGCACGCCGAGGAGATCTACGACCGGCTCACCGACGGCCGCACCCGCTAT CTACGCCTCGACGAACTCGTCCGGGCCGCCGCGTCGGCCTATCCCGGCCTGGTGCCCACG GAGGCGCAGATGGCGGCCGAGCGGTCCCGACGGCAGGCGGAGAAGGAAGGCCGTGAGATC GATCAGGGCATTTTCCTGCGCGGGATCCTGAGCGCGCCGAAAGCCGGGCCGCATCTGCTC GACGCCATGCTCAGGCCCACCGCCAGGGCGCTGGAGCTGCTGCCGGAGTTCGTCGAGACC GGTGTGGTGCGGATGGAGGCCGCCTCCCTGGAGCGCCGTGACGGCGTCGCGTACCTGACC CTGTGCCGGGACGACTGCCTGAACGCCGAGGACGCCCAGCAGGTCGACGACATGGAGACC GCGGTCGATCTGGCGCTGCTCGACCCGGCCGTCCGGGTGGGGATGCTGCGGGGCGGCGTG ATGAGCCATCCCCGGTACGCGGGGCGCCGGGTGTTCTGCGCGGGGATCAACCTCAAGAAG CTGAGTTCGGGCGACATCCCGCTCGTCGATTTCCTCCTGCGGCGGGAATTGGGCTATATC CACAAGATCGTGCGCGGGGTGGCCACGGACGGTTCGTGGCGAGCACGGGTGATCGACAAG CCCTGGCTGGCGGCCGTCGATTCCTTCGCCATCGGGGGCGGGGCCCAGCTCCTGCTGGTC ...
Homogentisate 1,2-dioxygenase (homogentisic acid oxidase, homogentisicase) is an enzyme which catalyzes the conversion of homogentisate to 4-maleylacetoacetate. Homogentisate 1,2-dioxygenase or HGD is involved in the catabolism of aromatic rings, more specifically in the breakdown of the amino acids tyrosine and phenylalanine. HGD appears in the metabolic pathway of tyrosine and phenylalanine degradation once the molecule homogentisate is produced. Homogentisate reacts with HGD to produce maleylacetoacetate, which then is further used in the metabolic pathway. HGD requires the use of Fe2+ and O2 in order to cleave the aromatic ring of homogentisate. homogentisate 4-maleylacetoacetate The active site of Homogentisate 1,2-dioxygenase was determined through the crystal structure, which was captured through the work of Titus et al. Through the crystal structure the active site was found to contain the following residues; His292, His335, His365, His371, and Glu341. Homogentisate binds in the active ...
Human skin-derived mesenchymal stromal cells do not rescue hereditary tyrosinemia type 1 mice after permanent nitisinone withdrawal ...
The defective gene results in a disruption of the final step of metabolism of tyrosine (absence of fumarylacetoacetate hydrolase (FAH) enzyme).. As a result, high levels of tyrosine build up in the blood, forming a toxic substance called succinylacetone.. Left untreated, HT-1 can cause hepatic, renal and peripheral nerve damage. The disease is characterized by progressive liver disease with increased risk of hepatocellular carcinoma (the liver), renal tubular dysfunction with hypophosphatemic rickets (kidneys) and a porphyria-like syndrome (nervous system).. In conjunction with a controlled diet, treatment with Nitisinone Tablets can prevent the formation of succinylacetone further preventing liver and kidney damage. Regular blood and urine tests are used to monitor succinylacetone levels in the body to ensure nitisinone levels are appropriate for treatment.. ...
Pain management information for pain medicine healthcare professionals in treating and caring for their patients. Clinical Pain Advisor offers news, case studies and more.
Alfa Aesar™ 1,3-Cyclohexanedione, 97+%, may cont. up to 1% NaCl 100g Alfa Aesar™ 1,3-Cyclohexanedione, 97+%, may cont. up to 1% NaCl Cyanofluor...
In the second post on ADHD and tyrosine, we focused on the first step of the process, the conversion of tyrosine to L-DOPA. This step heavily utilizes a specific enzyme called tyrosine hydroxylase. Tyrosine Hydroxylase is dependent on adequate supplies of certain nutrients such as iron, magnesium, zinc, tetrahydrobiopterin, and adequate levels of vitamin C (and antioxidants in general). While rampant supplementation is not necessary, inadequate levels of any of these agents (as well as a few others, such as copper) could potentially compromise the function of the tyrosine hydroxylase enzyme. It is important to note that the conversion of tyrosine to L-DOPA is typically the slowest and rate-limiting step of the whole tyrosine metabolism and conversion process to dopamine and norepinephrine. Thus, compromising this first conversion step can be potentially the most devastating with regards to impaired tyrosine metabolism for ADHD. This was why the post was a bit lengthy with regards to advocating ...
Looking for TCI AMERICAS 1,4-cyclohexanedione monoethyleneketal (29LU08)? Graingers got your back. Price:$50.25. Easy ordering & convenient delivery. Log-in or register for your pricing.
Rio de Janeiro, RJ, Brazil. Tel.: +55-21-2562-1222. This e-mail address is being protected from spambots. You need JavaScript enabled to view it. ...
The page you are looking for cannot be found. The page may have been removed or moved, or it is temporarily unavailable. Search for content using the search function or go to the homepage.
Dalam kehidupan sehari-hari, banyak orang, demi kemudahan, menggunakan sumpit sekali pakai untuk makan, tapi sumpit sekali pakai yang dugunakan untuk makan juga akan menyebabkan
TY - JOUR. T1 - The occurrence of hepatoma in the chronic form of hereditary tyrosinemia. AU - Weinberg, Arthur G.. AU - Mize, Charles E.. AU - Worthen, Howard G.. PY - 1976/3. Y1 - 1976/3. N2 - A 5 1/2-year-old child with hepatocarcinoma complicating hereditary tyrosinemia is presented. A review of the literature and an attempted follow-up of previously reported patients with the chronic form of hereditary tyrosinemia have disclosed 16 cases of hepatocarcinoma occurring in 43 patients surviving beyond 2 years of age (37%). This incidence is considerably higher than that generally given for the occurrence of hepatoma in adults with macronodular cirrhosis. Females and males are equally at risk. Additional factors beyond the development of cirrhosis are likely operative in the induction of hepatocarcinoma in patients with this metabolic disorder; those surviving beyond infancy are at considerable risk for the development of fatal hepatic neoplasms.. AB - A 5 1/2-year-old child with hepatocarcinoma ...
... definition, an intermediate compound in the metabolism of tyrosine and of phenylalanine, found in excess in the blood and urine of persons affected with alkaptonuria. See more.
TY - JOUR. T1 - Tissue-specific FAH deficiency alters sleep-wake patterns and results in chronic tyrosinemia in mice. AU - Yang, Shuzhang. AU - Siepka, Sandra M.. AU - Cox, Kimberly H.. AU - Kumar, Vivek. AU - De Groot, Marleen. AU - Chelliah, Yogarany. AU - Chen, Jun. AU - Tu, Benjamin. AU - Takahashi, Joseph S.. PY - 2019/10/29. Y1 - 2019/10/29. N2 - Fumarylacetoacetate hydrolase (FAH) is the last enzyme in tyrosine catabolism, and mutations in the FAH gene are associated with hereditary tyrosinemia type I (HT1 or TYRSN1) in humans. In a behavioral screen of N-ethyl-N-nitrosourea mutagenized mice we identified a mutant line which we named "swingshift" (swst, MGI:3611216) with a nonsynonymous point mutation (N68S) in Fah that caused age-dependent disruption of sleep-wake patterns. Mice homozygous for the mutation had an earlier onset of activity (several hours before lights off) and a reduction in total activity and body weight when compared with wild-type or heterozygous mice. Despite abnormal ...
A screen positive result means that more tests are needed to know whether or not a baby has tyrosinemia. It does not mean that a baby has Tyrosinemia. Babies identified at a young age through screening can be treated early to help prevent health problems ...
Hager said theyve already discovered one waterhemp biotype thats resistant to four different herbicide families. He said growers may see five-way resistance in the future. Fortunately, there are very few annual weed species in the United States that have shown this level of multiple resistance. Waterhemp is a dioecious species and ideally suited for evolving herbicide resistance by sharing resistance genes among populations and biotypes. "For example, you can have HPPD resistance evolving in field A, and in adjacent field B you can have selection for glyphosate resistance," Tranel said. "Pollen is always moving in the air, allowing pollen from field A to mix with resistant plants from field B resulting in HPPD and glyphosate resistance in the same progeny. Thats how easy it is to stack resistance.". The pressure is on for industry to develop new options and for growers to change their practices of how they use products to control the weed spectrum, he added.. Hager, Tranel and Dean Riechers, ...
Involved in the catabolism of homogentisate (2,5-dihydroxyphenylacetate or 2,5-OH-PhAc), a central intermediate in the degradation of phenylalanine and tyrosine. Catalyzes the oxidative ring cleavage of the aromatic ring of homogentisate to yield maleylacetoacetate.
Factory Supply 99% 1,4-Cyclohexanedione mono CAS: 69225-59-8 Basic Info. Name:1,4-Cyclohexanedione mono(2,2-dimethyltrimethylene ketal) CAS: 69225-59-8 MF: C11H18O3 MW: 198.26 EINECS: 273-918-4 mp 45-50...
Mutations in human and/or mouse homologs are associated with this disease. Synonyms: Oculocutaneous tyrosinemia; Richner-Hanhart syndrome
When a section of mouse chromosome 7 containing the coat color c gene is deleted by exposing mice to radiation, albino mice are born with a white, hairless coat.
Hickey RD, Mao SA, Glorioso J, Elgilani F, Amiot B, Chen H, Rinaldo P, Marler R, Jiang H, DeGrado TR, Suksanpaisan L, OConnor MK, Freeman BL, Ibrahim SH, Peng KW, Harding CO, Ho CS, Grompe M, Ikeda Y, Lillegard JB, Russell SJ, Nyberg SL. Curative ex vivo liver-directed gene therapy in a pig model of hereditary tyrosinemia type 1. Sci Transl Med. 2016 Jul 27; 8 (349):349ra99 ...
Diagnoised with Adrenal Fatigue back in Sept. 09. Have been avoiding all stimulants ever since and started taking hydrocortisone and adrenal support(a
Shop Flavanone 3-dioxygenase ELISA Kit, Recombinant Protein and Flavanone 3-dioxygenase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
This enzyme catalyses a step in the pathway of phenylpropanoid compounds degradation. It catalyses the insertion of both atoms of molecular oxygen into positions 2 and 3
3.0.CO;2-9. PMID 9101289. Phaneuf D, Lambert M, Laframboise R, Mitchell G, Lettre F, Tanguay RM (1992). "Type 1 hereditary tyrosinemia. Evidence for molecular heterogeneity and identification of a causal mutation in a French Canadian patient". J. Clin. Invest. 90 (4): 1185-92. doi:10.1172/JCI115979. PMC 443158 . PMID 1401056. Tanguay RM, Valet JP, Lescault A, Duband JL, Laberge C, Lettre F, Plante M (1990). "Different molecular basis for fumarylacetoacetate hydrolase deficiency in the two clinical forms of hereditary tyrosinemia (type I)". Am. J. Hum. Genet. 47 (2): 308-16. PMC 1683717 . PMID 2378356. Laberge C, Grenier A, Valet JP, Morissette J (1990). "Fumarylacetoacetase measurement as a mass-screening procedure for hereditary tyrosinemia type I". Am. J. Hum. Genet. 47 (2): 325-8. PMC 1683713 . PMID 2378358. Kvittingen EA, Halvorsen S, Jellum E (1983). "Deficient fumarylacetoacetate fumarylhydrolase activity in lymphocytes and fibroblasts from patients with hereditary tyrosinemia". Pediatr. ...
Usnic acid is a dibenzo-furandione which is uniquely found in lichen (Usnea) species, which are distributed worldwide. In vitro usnic acid has antibacterial, antifungal and antiviral activities, and lichen extracts containing usnic acid have been used in folk medicine externally for wound healing and athletes foot and internally for sore throat, toothache and fever. Usnic acid has also found several commercial uses, largely in perfumery and cosmetic products, but also in medicinal creams. However, usnic acid appears to be toxic when taken orally in high doses and, for instance, can cause ataxia and paralysis in animals grazing on lichen contaminated crops and grains. Usnic acid has been purified and extensively studied in vitro and has been shown to uncouple oxidative phosphorylation in isolated mitochondria, which may account for its broad antimicrobial activity. Uncoupling of oxidative phosphorylation by decreasing the efficacy of energy use and causing increased thermogenesis has been ...
The defects in tyrosine metabolism lead to albinism which is a group of diseases as result of deficiency in melanin. These result in either partial or full absence of pigments from the skin, eye, and hair. There may be vision defects and photophobia. This disease occurs due to deficiency of tyrosinase enzyme.. Alkaptonuria is another disease due to deficiency of homogentisic acid oxidase that results in accumulation of homogentisic acid. Patient may have homogentic aciduria, arthritis of large joints, and black pigmentation of cartilage and collagenous tissues.. Tyrosine interacts with monoamine oxidase inhibitors so patient should avoid foods containing tyrosine.. Thus, tyrosine has many beneficial effects. It supplementation is also available for the persons deficient of this amino acid. It is a useful amino acid during periods of cold, stress of any kind either emotional or physical and fatigues.. ...
The purpose of this study is to gain a better understanding of alkaptonuria and collect medical data on patients who may later participate in new drug trials for this rare genetic disease. In alkaptonuria, a pigment called homogentisic acid collects in bone and connective tissue, causing arthritis and eventually bone fractures, and also causes discoloration in the ears and whites of the eyes. Some patients also develop kidney stones and heart valve problems. Alkaptonuria has not been studied for decades; and scientists expect to gain comprehensive clinical information using current medical techniques.. Patients with alkaptonuria who are at least one month old may be eligible for this study. Participants will be evaluated at NIH s Clinical Center for 5 days every 2 to 3 years. They will have a medical history, physical examination, routine blood and urine tests. Blood may also be collected to measure a type of collagen that indicates new bone formation and to analyze DNA for genetic studies. ...
This is a proposal to develop the orphan designated drug, nitisinone, for the treatment of a rare Mendelian disease, Alkaptonuria (AKU). Thanks to our existing successful fundamental and clinical research (cell models, animal models, natural history studies), we are now ready for this final stage of clinical development of nitisinone for AKU: a phase 3 clinical trial to prove efficacy. The results of DevelopAKUre will allow us to make the case to the European Medicines Agency for marketing authorisation of nitisinone for AKU, thereby contributing to the goal of the International Rare Diseases Research Consortium of developing 200 new therapies by 2020 ...
According to a study published in Nature Biotechnology, a more efficient delivery of a CRISPR/Cas9 therapeutic to adult mice with the metabolic disease Tyrosinemia type I developed by Wen Xue, PhD, may also prove to be safer for use in humans.
... is a member of the class of HPPD inhibitors, which all work by inhibiting the plant enzyme 4-hydroxyphenylpyruvate ... dioxygenase. In plants, HPPD is necessary for carotenoid biosynthesis; carotenoids in turn protect chlorophyll from being ... Moran, GR (Jan 2005). "4-Hydroxyphenylpyruvate dioxygenase" (PDF). Arch Biochem Biophys. 433 (1): 117-28. doi:10.1016/j.abb. ...
2,4-D is a broadleaf herbicide in the phenoxy group used in turf and no-till field crop production. Now, it is mainly used in a ... 2,4,5-T was withdrawn from use in the USA in 1983, at a time of heightened public sensitivity about chemical hazards in the ... 146 (4): 579-600. doi:10.1111/j.1474-919X.2004.00375.x. Robbins, C.S.; Dowell, B.A.; Dawson, D.K.; Colon, J.A.; Estrada, R.; ... 2,4,5-T has since largely been replaced by dicamba and triclopyr. Agent Orange was a herbicide blend used by the British ...
The cytosolic dioxygenase has been characterized extensively and differs from the mitochondrial form in that the dioxygenase ... In the first, HMB is produced from [α-KIC] by the cytosolic enzyme KIC dioxygenase (Sabourin and Bieber 1983). ... KIC dioxygenase), which converts α-KIC to HMB. In healthy individuals, this minor pathway - which involves the conversion of L- ... this route of HMB formation is direct and completely dependent of liver KIC dioxygenase. Following this pathway, HMB in the ...
"The mechanism of enzymic formation of homogentisate from p-hydroxyphenylpyruvate". Journal of the American Chemical Society. 92 ... 43 (4): 680-5. PMID 9105273. Svirbely JL, Szent-Györgyi A (1932). "The chemical nature of vitamin C". The Biochemical Journal. ... 67 (4): 1643-8. Bibcode:1970PNAS...67.1643P. doi:10.1073/pnas.67.4.1643. PMC 283405 . PMID 5275366. Mandl J, Szarka A, Bánhegyi ... 29 (4): 711-26. doi:10.3233/JAD-2012-111853. PMC 3727637 . PMID 22366772. Rosenbaum CC, O'Mathúna DP, Chavez M, Shields K (2010 ...
Alkaptonuria is caused when an enzyme called homogentisic dioxygenase (HGD) is faulty, leading to a buildup of homogenisate. ... pyruvate Dioxygenase with the Specific Inhibitor 2-[2-Nitro-4-(trifluoromethyl)benzoyl]-1,3-cyclohexanedione†". Biochemistry. ... Ellis, M.K.; Whitfield, A.C.; Gowans, L.A.; Auton, T.R.; Provan, W.M.; Lock, E.A.; Smith, L.L. (1995). "Inhibition of 4- ... Hydroxyphenylpyruvate Dioxygenase by 2-(2-Nitro-4-trifluoromethylbenzoyl)-cyclohexane-1,3-dione and 2-(2-Chloro-4- ...
18 (4): 641-651. doi:10.1007/s00792-014-0645-x. ISSN 1433-4909. Rajput, Rinky; Verma, Ved Vrat; Chaudhary, Vishal; Gupta, Rani ... "Structural and functional characterization of 4-hydroxyphenylpyruvate dioxygenase from the thermoacidophilic archaeon ...
... is a rare disorder caused by a deficiency of the enzyme 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27 ... Specifically, 4-hydroxyphenylpyruvate dioxygenase converts a tyrosine byproduct called 4-hydroxyphenylpyruvate to homogentisic ...
doi:10.1007/978-94-011-4173-4_7. ISBN 978-94-010-5817-9. Achkar J, Xian M, Zhao H, Frost JW (2005). "Biosynthesis of ... "Herbicidal 4-hydroxyphenylpyruvate dioxygenase inhibitors -- A review of the triketone chemistry story from a Syngenta ...
The intermediate then spontaneously reacts with glutathione to form 2-L-cystein-S-yl-1,4-dihydroxy-cyclohex-5-en-1-yl acetic ... Hawkinsinuria, also called 4-Alpha-hydroxyphenylpyruvate hydroxylase deficiency, is an autosomal dominant metabolic disorder ... Normally, the breakdown of the amino acid tyrosine involves the conversion of 4-hydroxyphenylpyruvate to homogentisate by 4- ... Hydroxyphenylpyruvate dioxygenase. Complete deficiency of this enzyme would lead to tyrosinemia III. In rare cases, however, ...
From toxicological problem to therapeutic use: the discovery of the mode of action of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3- ... Nitisinone inhibits the conversion of 4-OH phenylpyruvate to homogentisic acid by 4-Hydroxyphenylpyruvate dioxygenase, the ...
It is caused by a mutation in the HGD gene for the enzyme homogentisate 1,2-dioxygenase (EC 1.13.11.5); if a person inherits ... 2-dioxygenase (HGD) which can normally be found in numerous tissues in the body (liver, kidney, small intestine, colon and ... 75 (4): 221-31. PMC 2588790 . PMID 12784973. Garrod AE (1908). "The Croonian lectures on inborn errors of metabolism: lecture ... 27 (4): 512-24. doi:10.1111/pcmr.12235. PMID 24612852. Lindner, Moritz; Bertelmann, Thomas (2014-01-30). "On the ocular ...
... including 4-hydroxyphenylpyruvate dioxygenase and the tetrahydrobiopterin dependent hydroxylases. The name NIH shift arises ...
... involvement of an unusual dioxygenase in the pathway to (S)-4-hydroxyphenylglycine". J. Am. Chem. Soc. 122 (22): 5389-5390. doi ... In enzymology, a 4-hydroxymandelate synthase (EC 1.13.11.46) is an enzyme that catalyzes the chemical reaction 4- ... hydroxyphenylpyruvate + O2 ⇌ {\displaystyle \rightleftharpoons } 4-hydroxymandelate + CO2 Thus, the two substrates of this ... The systematic name of this enzyme class is 4-hydroxyphenylpyruvate:oxygen oxidoreductase (decarboxylating). This enzyme is ...
Additionally, 4-HPPA can be converted to homogentisic acid which is one of the precursors to ochronotic pigment. It is an ... 4-Hydroxyphenylpyruvic acid (4-HPPA) is an intermediate in the metabolism of the amino acid phenylalanine. The aromatic side ... 4-Hydroxyphenylpyruvate dioxygenase Brand, Larry; Harper, Alfred (1974). "Effect of glucagon on phenylalanine metabolism and ... Denoya, Claudio; Skinner, Deborah; Morgenstern, Margaret (September 1994). "A Streptomyces avermitilis gene encoding a 4- ...
26 (4): 460-7. doi:10.3109/14756366.2010.526769. PMID 21028940. Douglas KT (1987). "Mechanism of action of glutathione- ... 113 (4-5): 234-58. doi:10.1080/13813450701661198. PMID 18158646. Board PG (May 2011). "The omega-class glutathione transferases ... Most mammalian isoenzymes have affinity for the substrate 1-chloro-2,4-dinitrobenzene, and spectrophotometric assays utilising ... and 4-hydroxyphenyl-pyruvate dioxygenase" (PDF). Toxicological Sciences. 130 (2): 229-44. doi:10.1093/toxsci/kfs243 . PMID ...
... at kumakatawan sa pagitan ng 4 at 4.5 porsiyento ng kabuuang DNA sa selula ng tao. Ang pagtukoy sa mga gene sa bawat ... Genet. 76 (4): 647-51. doi:10.1086/429226. . PMID 15714404. http://linkinghub.elsevier.com/retrieve/pii/S0002-9297(07)62875-4. ...
KIC dioxygenase), which converts α-KIC to HMB. In healthy individuals, this minor pathway - which involves the conversion of L- ... The first reported chemical syntheses of HMB were: the oxidation of 2-methylpent-4-en-2-ol with chromic acid (CrO4H2) in 1877 ... A relatively small amount of α-KIC is metabolized in the liver by the cytosolic enzyme 4-hydroxyphenylpyruvate dioxygenase ( ... A cycloaddition reaction between acetone and ketene depending on the conditions produce β-isovalerolactone or 4,4- ...
It is a 4-hydroxyphenylpyruvate dioxygenase inhibitor indicated for the treatment of hereditary tyrosinemia type 1 (HT-1) in ...
EC 1.14.12 Nitric oxide dioxygenase Category:EC 1.14.13 Nitric oxide synthase EC 1.14.13.39 Category:EC 1.14.14 Aromatase EC ... EC 1.6.4 now Category:EC 1.8.1 Category:EC 1.6.5 (with a quinone or similar compound as acceptor) NADH dehydrogenase EC 1.6.5.3 ... EC 1.1.4 (with a disulfide as acceptor) Category:EC 1.1.5 (with a quinone or similar compound as acceptor) Category:EC 1.1.99 ( ... EC 1.5.4 (with a disulfide as acceptor) Category:EC 1.5.5 (with a quinone or similar compound as acceptor) Category:EC 1.5.7 ( ...
4 (3): 319-33. doi:10.1089/10906570050501588. PMID 11142767. Montgomery KT, Lee E, Miller A, Lau S, Shim C, Decker J, Chiu D, ... 76 (4): 647-51. doi:10.1086/429226. PMC 1199301 . PMID 15714404. Genome Decoration Page, NCBI. Ideogram data for Homo sapience ... Chromosome 12 spans about 133 million base pairs (the building material of DNA) and represents between 4 and 4.5 percent of the ... Cytoskeleton associated protein 4 CNOT2: encoding protein CCR4-NOT transcription complex subunit 2 CNPY2: encoding protein ...
2-dioxygenase, catechol 2,3-dioxygenase, 3,4-dihydroxyphenylacetate 2,3-dioxygenase and 4-hydroxyphenylpyruvate dioxygenase all ... 3-demethylubiquinone-9 3-O-methyltransferase and numerous dioxygenases such as biphenyl-2,3-diol 1, ... 170 (4): 209-219. doi:10.1007/s002030050635. Oya T, Hattori N, Mizuno Y, Miyata S, Maeda S, Osawa T, Uchida K (Jun 1999). " ... 4 (3): e4649. doi:10.1371/journal.pone.0004649. PMC 2650792 . PMID 19266052. Distler MG, Plant LD, Sokoloff G, Hawk AJ, Aneas I ...
2-dioxygenase (HGD), maleylacetoacetate isomerase (GSTZ1), fumarylacetoacetase (FAH) The protein has a number of conserved co- ... 4 (2): 319-20. doi:10.1093/hmg/4.2.319. PMID 7757089. Kato S, Sekine S, Oh SW, Kim NS, Umezawa Y, Abe N, Yokoyama-Kobayashi M, ... 9 (4): 291-9. doi:10.1002/(SICI)1098-1004(1997)9:4. 3.0.CO;2-9. PMID 9101289. Phaneuf D, Lambert M, Laframboise R, Mitchell G, ... 90 (4): 1185-92. doi:10.1172/JCI115979. PMC 443158 . PMID 1401056. Tanguay RM, Valet JP, Lescault A, Duband JL, Laberge C, ...
"Engineering p-hydroxyphenylpyruvate dioxygenase to a p-hydroxymandelate synthase and evidence for the proposed benzene oxide ... Hydroxyphenylpyruvate dioxygenase is responsible for converting 4- Hydroxyphenylpyruvate into homogentisate. This conversion is ... also known as α-ketoisocaproate dioxygenase (KIC dioxygenase), is an Fe(II)-containing non-heme oxygenase that catalyzes the ... Knox WE, LeMay-Knox M (Oct 1951). "The oxidation in liver of l-tyrosine to acetoacetate through p-hydroxyphenylpyruvate and ...
These results suggested that 'p-hydroxyphenylpyruvate dioxygenase (HPPD) was the enzyme that was inhibited, a fact which was ... The Discovery and Structural Requirements of Inhibitors of p-hydroxyphenylpyruvate Dioxygenase. Weed Science,45(5),p.601-609 (9 ... He furthermore found that the urine of rats treated with III showed elevated levels of both p-hydroxyphenylpyruvate and p- ... The 4-methylsulfonyl group was then prepared to test this hypothesis, and what was to become the commercial herbicide Mikado ( ...
Given the important biological roles that 2OG-dependent dioxygenase play, many 2OG-dependent dioxygenase inhibitors were ... 2OG-dependent dioxygenases share a common catalytic mechanism. The first step involves the binding of 2OG and substrate to the ... All 2OG-dependent dioxygenases contain a conserved double-stranded β-helix (DSBH, also known as cupin) fold, which is formed ... Many 2OG-dependent dioxygenase are also capable of uncoupled turnover, in which oxidative decarboxylation of 2OG into succinate ...
Indoleamine 2,3-dioxygenase/Tryptophan 2,3-dioxygenase. *Arylformamidase. *Kynureninase. *3-hydroxyanthranilate oxidase ...
Compare 4-hydroxyphenylpyruvate dioxygenase ELISA Kits from leading suppliers on Biocompare. View specifications, prices, ... 4-Hydroxyphenylpyruvate Dioxygenase (HPD) BioAssay™ ELISA Kit (Rat) *Detection Target: 4-Hydroxyphenylpyruvate Dioxygenase (HPD ... 4-Hydroxyphenylpyruvate Dioxygenase (HPD) BioAssay™ ELISA Kit (Rat) *Detection Target: 4-Hydroxyphenylpyruvate Dioxygenase (HPD ... Your search returned 69 4-hydroxyphenylpyruvate dioxygenase ELISA ELISA Kit across 8 suppliers. ...
The different catalytic roles of the metal binding ligands in human 4-hydroxyphenylpyruvate dioxygenase. Chih-Wei Huang, Hsiu- ... 4-Hydroxylphenylpyruvate dioxygenase (HPPD) is a non-haem iron(II)-dependent oxygenase that catalyzes the conversion of 4- ... The H266A variant was able to produce 4-hydroxyphenylacetate (HPA), demonstrating that decarboxylation had occurred but that ... The different catalytic roles of the metal binding ligands in human 4-hydroxyphenylpyruvate dioxygenase ...
4-Hydroxyphenylpyruvate Dioxygenase, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards ... p-Hydroxyphenyl)pyruvate. *(p-Hydroxyphenyl)pyruvic acid. *3-(4-Hydroxyphenyl)-2-oxo-propanoate ... Human 4-hydroxyphenylpyruvate dioxygenase gene (HPD). (PMID: 9325050) Rüetschi U … Lindstedt S (Genomics 1997) 3 4 22 60 ... 4-hydroxyphenylpyruvate + O(2) = homogentisate + CO(2). *HPPD_HUMAN,P32754. UniProtKB/Swiss-Prot Function: Key enzyme in the ...
It is caused by a mutation in the HGD gene for the enzyme homogentisate 1,2-dioxygenase (EC 1.13.11.5); if a person inherits ... 2-dioxygenase (HGD) which can normally be found in numerous tissues in the body (liver, kidney, small intestine, colon and ... 75 (4): 221-31. PMC 2588790 . PMID 12784973. Garrod AE (1908). "The Croonian lectures on inborn errors of metabolism: lecture ... 27 (4): 512-24. doi:10.1111/pcmr.12235. PMID 24612852. Lindner, Moritz; Bertelmann, Thomas (2014-01-30). "On the ocular ...
Tyrosinemia, Type III (TYR-III) is an inborn error of metabolism, an inherited condition in which an enzyme, 4- ... hydroxyphenylpyruvate dioxygenase, in the body is either missing or not working well. Tyrosinemia Type III is considered an ...
4] There is an underlying defect of tyrosine metabolism causing accumulation of homogentisic acid. This is rapidly cleared by ... 4] Autopsy findings show that early changes include chondrocyte necrosis, pigment deposition in the cardiovascular system and ... Nitisinone is an inhibitor of the enzyme 4-hydroxyphenylpyruvate dioxygenase, which mediates formation of homogentisic acid. ...
... homogentisate dioxygenase (hmgA) and 4-hydroxyphenylpyruvate dioxygenase (hppD). Comparative Fourier transform infrared ...
4-hydroxyphenylpyruvate dioxygenase (Norway rat). Find diseases associated with this biological target and compounds tested ...
"Engineering p-hydroxyphenylpyruvate dioxygenase to a p-hydroxymandelate synthase and evidence for the proposed benzene oxide ... Hydroxyphenylpyruvate dioxygenase is responsible for converting 4- Hydroxyphenylpyruvate into homogentisate. This conversion is ... also known as α-ketoisocaproate dioxygenase (KIC dioxygenase), is an Fe(II)-containing non-heme oxygenase that catalyzes the ... Knox WE, LeMay-Knox M (Oct 1951). "The oxidation in liver of l-tyrosine to acetoacetate through p-hydroxyphenylpyruvate and ...
These results suggested that p-hydroxyphenylpyruvate dioxygenase (HPPD) was the enzyme that was inhibited, a fact which was ... The Discovery and Structural Requirements of Inhibitors of p-hydroxyphenylpyruvate Dioxygenase. Weed Science,45(5),p.601-609 (9 ... He furthermore found that the urine of rats treated with III showed elevated levels of both p-hydroxyphenylpyruvate and p- ... The 4-methylsulfonyl group was then prepared to test this hypothesis, and what was to become the commercial herbicide Mikado ( ...
3-(4-hydroxyphenyl)pyruvate*Search proteins in UniProtKB for this molecule.. *Search chemical reactions in Rhea for this ... 3-(4-hydroxyphenyl)pyruvate*Search proteins in UniProtKB for this molecule.. *Search chemical reactions in Rhea for this ... 4-hydroxyphenylpyruvate dioxygenase (EC:1.13.11.27*Search proteins in UniProtKB for this EC number. ... sp,Q9ARF9,HPPD_PLESU 4-hydroxyphenylpyruvate dioxygenase OS=Plectranthus scutellarioides OX=4142 PE=2 SV=1 ...
Gunsior M, Ravel J, Challis GL, Townsend CA (Jan 2004). "Engineering p-hydroxyphenylpyruvate dioxygenase to a p- ... α-ketoisocaproate dioxygenase (KIC dioxygenase), is an Fe(II)-containing non-heme oxygenase that catalyzes the second reaction ... Hydroxyphenylpyruvate dioxygenase is responsible for converting 4- Hydroxyphenylpyruvate into homogentisate. [13]This ... A model for the action of p-hydroxyphenylpyruvate hydroxylase". Journal of the American Chemical Society. 97 (18): 5272-7. doi: ...
... is an autosomal recessive disorder caused by the deficiency of 4-hydroxyphenylpyruvate dioxygenase (HPD), the second enzyme in ... Mutations in the 4-hydroxyphenylpyruvate dioxygenase gene (HPD) in patients with tyrosinemia type III. ... Tyrosinemia type III (OMIM 276710) is an autosomal recessive disorder caused by the deficiency of 4-hydroxyphenylpyruvate ... dioxygenase (HPD), the second enzyme in the tyrosine catabolic pathway. The enzyme deficiency results in an accumulation and ...
A hydroxyphenylpyruvate dioxygenase inhibitor used as an adjunct to dietary restrictions for the treatment of hereditary ... 4-Hydroxyphenylpyruvate Dioxygenase, antagonists & inhibitors. Accession Number. DBCAT000778. Description. Not Available. Drugs ...
... hydroxyphenylpyruvate dioxygenase (HPPD), an enzyme important in tyrosine catabolism. Today, nitisinone is successfully used to ... Ward, JP, Dunster, JL, Derks, G., Mistry, P and Salazar, JD (2016) Predicting tyrosinaemia: a mathematical model of 4- ... hydroxyphenylpyruvate dioxygenase inhibition by nitisinone in rats Mathematical Medicine and Biology, 34 (3). pp. 335-390. ... nitisinone, 4-hydroxyphenylpyruvate dioxygenase, tyrosinaemia, rat, mathematical model, PBPK/PD, asymptotic analysis. ...
... pyruvate dioxygenase (HPPD) is an alpha-keto-acid-dependent dioxygenase which catalyzes the conversion of (4-hydroxyphenyl) ... 2-nitro-4-(trifluoromethyl)benzoyl]-1,3-cyclohexanedione (NTBC), has also been used therapeutically to treat type I tyrosinemia ... p-Hydroxyphenylpyruvate dioxygenase is a herbicidal target site for beta-triketones from Leptospermum scoparium.. *Franck E ... pyruvate dioxygenase (HPPD) is an alpha-keto-acid-dependent dioxygenase which catalyzes the conversion of (4-hydroxyphenyl) ...
Characterization of 4-hydroxyphenylpyruvate dioxygenase. Primary structure of the Pseudomonas enzyme.. Artikel i vetenskaplig ... 4-Hydroxyphenylpyruvate Dioxygenase, chemistry, Amino Acid Sequence, Chromatography, Gel, Chromatography, High Pressure Liquid ... The primary structure of Pseudomonas 4-hydroxyphenylpyruvate dioxygenase was determined. Sequence degradation of the intact ...
55 (4): 334-358. doi:10.1111/wre.12153.. *^ a b Beckie, H. J.; Harker, L. M.; Hall, S. I.; et al. (2006). "A decade of ... 146 (4): 579-600. doi:10.1111/j.1474-919X.2004.00375.x.. *^ Robbins, C.S.; Dowell, B.A.; Dawson, D.K.; Colon, J.A.; Estrada, R ... 86 (4): 1243-1264. doi:10.4141/P05-193.. *^ "A New Way to Use Herbicides: To Sterilize, Not Kill Weeds". USDA Agricultural ... ISBN 0-7167-2009-4.. *^ Moran GR (Jan 2005). "4-Hydroxyphenylpyruvate dioxygenase" (PDF). Arch Biochem Biophys. 433 (1): 117-28 ...
Herbicides that inhibit hydroxyphenylpyruvate dioxygenase (HPPD) such as mesotrione are widely used to control a broad spectrum ... Herbicides that inhibit hydroxyphenylpyruvate dioxygenase (HPPD) such as mesotrione are widely used to control a broad spectrum ... However, the resistant populations showed 4-12 fold increase in HPPD gene expression. This increase in HPPD transcript levels ... However, the resistant populations showed 4-12 fold increase in HPPD gene expression. This increase in HPPD transcript levels ...
The HPD gene provides instructions for making an enzyme called 4-hydroxyphenylpyruvate dioxygenase. Learn about this gene and ... P-hydroxyphenylpyruvate oxidase. *PPD. Additional Information & Resources. Tests Listed in the Genetic Testing Registry. *Tests ... Tomoeda K, Awata H, Matsuura T, Matsuda I, Ploechl E, Milovac T, Boneh A, Scott CR, Danks DM, Endo F. Mutations in the 4- ... hydroxyphenylpyruvic acid dioxygenase gene are responsible for tyrosinemia type III and hawkinsinuria. Mol Genet Metab. 2000 ...
[ChEMBL Compound Description] ID:, InChI_Key:, Tradenames:TOLECTIN | TOLECTIN 600 | TOLMETIN SODIUM | TOLECTIN DS, Synonyms:TOLECTIN | TOLMETIN | MCN-2559 | MCN-2559-21-98 | Tolectin | TOLECTIN DS | TOLECTIN 600 | TOLMETIN SODIUM
HGD: homogentisate 1,2-dioxygenase. *HGSNAT: heparan-alpha-glucosaminide N-acetyltransferase. *HINT1: histidine triad ...
0,1,2,3,4 - explained in the License Agreement.. TFR. Term Frequency. The number of terms for this source in RXNCONSO.RRF, e.g ... Examples of these include a 14 digit "6-4-2" format, 10 digit "5-3-2", "4-4-2" or "5-4-1" formats, 12 digits with no dashes ... The populate_oracle_rxn_db.bat file contains 4 parameters, which should be customized for your particular environment. They are ... The populate_oracle_rxn_db.bat file contains 4 parameters, which should be customized for your particular environment. They are ...
Herbicides, Inhibiting 4-Hydroxyphenylpyruvate Dioxygenase (HPPD).. Herbicides, Inhibitors of Photosynthesis at Photosystem II. ...
4-Hydroxyphenylpyruvate Dioxygenase Inhibitor. Pharmacology. In patients with HT-1, tyrosine metabolism is interrupted due to a ... Nitisinone competitively inhibits 4-hydroxyphenyl-pyruvate dioxygenase, an enzyme present early in the tyrosine degradation ... Increase to 0.75 mg/kg twice daily if succinylacetone is detectable 4 weeks after initiation. Further increase may be needed ... Increase to 0.75 mg/kg twice daily if succinylacetone is detectable 4 weeks after initiation. Further increase may be needed ...
  • Every person carries in their DNA two copies (one received from each parent) of the gene HGD, which contains the genetic information to produce the enzyme homogentisate 1,2-dioxygenase (HGD) which can normally be found in numerous tissues in the body (liver, kidney, small intestine, colon and prostate). (wikipedia.org)
  • Akaterpin ( 25 ) inhibits hydrolysis of phosphatidylinositol by phospholipase C, a key step in eukaryotic signaling pathways by its production of diacylglycerol and inositol triphosphate [ 4 ]. (mdpi.com)
  • Indoleamine 2,3-dioxygenase, whose activity mediates T-cell activation and whose overexpression in cancer may prevent tumor rejection, is inhibited by halicloic acids A and B ( 15 , 16 ) [ 5 ]. (mdpi.com)
  • Taurine/α-ketoglutarate (αKG) dioxygenase, or TauD, catalyzes the conversion of taurine (2-aminoethanesulfonic acid) to sulfite and aminoacetaldehyde in the presence of O 2 , αKG, and Fe(II) as shown in Scheme S1 ( 1 ). (pnas.org)
  • We review the mechanism and function of nonheme iron halogenases and hydroxylases and show recent computational modelling studies of our group on the hectochlorin biosynthesis enzyme and prolyl-4-hydroxylase as examples of nonheme iron halogenases and hydroxylases. (mdpi.com)
  • Taurine/α-ketoglutarate (αKG) dioxygenase, or TauD, is a mononuclear non-heme iron hydroxylase that couples the oxidative decarboxylation of αKG to the decomposition of taurine, forming sulfite and aminoacetaldehyde. (pnas.org)
  • Further classification into mono- and dioxygenases in based on whether the enzyme causes transfer of just one atom to the substrate (S) (eq. 1) or whether the whole molecule is incorporated into a single substrate (eq. 2a) or is shared by a pair of substrates (S, S′) (eq. 2b) ( 1, 2 ) 1 . (springer.com)
  • Instead, some 4-hydroxyphenylpyruvate forms an unusual sulfur-containing amino acid called hawkinsin. (medlineplus.gov)
  • Aromatic compounds such as 4-hydroxybenzoic acid are broadly applied in industry for a myriad of applications used in everyday life. (frontiersin.org)
  • The therapeutic agent 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC) interrupts the pathway after formation of 4-OH-phenylpyruvic acid. (medscape.com)
  • Genes encoding a 4-hydroxybenzoate production pathway were integrated into the host genome and the flux toward the central precursor tyrosine was enhanced by overexpressing genes encoding key enzymes of the shikimate pathway. (frontiersin.org)
  • Quantitative RT-PCR confirmed the downregulation of three high-interest candidate genes which are all components of the extracellular matrix: proteoglycan 4 (PRG4), fibulin-1 (FBLN-1) transcript variant D, and type XV collagen alpha 1 chain. (biomedcentral.com)
  • In addition, the expression levels of tyrosine aminotransferase (TAT) and 4-hydroxyphenylpyruvate dioxygenase (HPD) genes were remarkably elevated in mice feeding on TAL-egg white than other groups. (scialert.net)
  • In addition to dietary treatment, the standard of care now requires use of 2-(2-nitro-4-trifluoromethylbenzoyl)-1,3-cyclohexanedione (NTBC), which prevents the formation of fumarylacetoacetate from tyrosine. (medscape.com)
  • In addition, the compound 2-(2-nitro-4-trifluoro-methylbenzoyl)-1,3-cyclohexanedione (NTBC) blocks the enzyme hydroxyphenylpyruvate dioxygenase upstream of FAH and therefore prevents the accumulation of hepatotoxic metabolites. (pnas.org)
  • Currently, 4-hydroxybenzoate is produced commercially via the Kolbe-Schmitt-reaction from potassium phenoxide and carbon dioxide ( Lindsey and Jeskey, 1957 ). (frontiersin.org)
  • The H266A variant was able to produce 4-hydroxyphenylacetate (HPA), demonstrating that decarboxylation had occurred but that there was no subsequent product formation. (biochemj.org)
  • The first modern herbicide, 2,4-D , was first discovered and synthesized by W. G. Templeman at Imperial Chemical Industries . (wikipedia.org)
  • When 2,4-D was commercially released in 1946, it triggered a worldwide revolution in agricultural output and became the first successful selective herbicide. (wikipedia.org)
  • [4] Credit for its discovery is given to "the herbicide discovery teams at the Ongar Research Station of Aventis CropScience . (sourcewatch.org)
  • Lloyd, W. G.: In "Methods in Free-Radical Chemistry", Vol. 4 ( E. S. Huyser, ed.), pp. 2-131. (springer.com)