3-Phosphoinositide-Dependent Protein Kinases: Highly conserved protein-serine threonine kinases that phosphorylate and activate a group of AGC protein kinases, especially in response to the production of the SECOND MESSENGERS, phosphatidylinositol 3,4,-biphosphate (PtdIns(3,4)P2) and phosphatidylinositol 3,4,5-triphosphate (PtdIns(3,4,5)P3).Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.Peroxisome Proliferators: A class of nongenotoxic CARCINOGENS that induce the production of hepatic PEROXISOMES and induce hepatic neoplasms after long-term administration.Apigenin: 5,7,4'-trihydroxy-flavone, one of the FLAVONES.Proto-Oncogene Proteins c-akt: A protein-serine-threonine kinase that is activated by PHOSPHORYLATION in response to GROWTH FACTORS or INSULIN. It plays a major role in cell metabolism, growth, and survival as a core component of SIGNAL TRANSDUCTION. Three isoforms have been described in mammalian cells.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Cell Line, Tumor: A cell line derived from cultured tumor cells.Enzyme Activation: Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.Threonine: An essential amino acid occurring naturally in the L-form, which is the active form. It is found in eggs, milk, gelatin, and other proteins.Protein-Tyrosine Kinases: Protein kinases that catalyze the PHOSPHORYLATION of TYROSINE residues in proteins with ATP or other nucleotides as phosphate donors.Bone Resorption: Bone loss due to osteoclastic activity.Cytoskeleton: The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.Cell Movement: The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.Macrophages: The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)Receptors, Collagen: Collagen receptors are cell surface receptors that modulate signal transduction between cells and the EXTRACELLULAR MATRIX. They are found in many cell types and are involved in the maintenance and regulation of cell shape and behavior, including PLATELET ACTIVATION and aggregation, through many different signaling pathways and differences in their affinities for collagen isoforms. Collagen receptors include discoidin domain receptors, INTEGRINS, and glycoprotein VI.src-Family Kinases: A PROTEIN-TYROSINE KINASE family that was originally identified by homology to the Rous sarcoma virus ONCOGENE PROTEIN PP60(V-SRC). They interact with a variety of cell-surface receptors and participate in intracellular signal transduction pathways. Oncogenic forms of src-family kinases can occur through altered regulation or expression of the endogenous protein and by virally encoded src (v-src) genes.Actins: Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.Protein Tyrosine Phosphatase, Non-Receptor Type 6: A Src-homology domain-containing protein tyrosine phosphatase found in the CYTOSOL of hematopoietic cells. It plays a role in signal transduction by dephosphorylating signaling proteins that are activated or inactivated by PROTEIN-TYROSINE KINASES.Protein Tyrosine Phosphatase, Non-Receptor Type 11: A subtype of non-receptor protein tyrosine phosphatases that contain two SRC HOMOLOGY DOMAINS. Mutations in the gene for protein tyrosine phosphatase, non-receptor type 11 are associated with NOONAN SYNDROME.Protein Tyrosine Phosphatases: An enzyme group that specifically dephosphorylates phosphotyrosyl residues in selected proteins. Together with PROTEIN-TYROSINE KINASE, it regulates tyrosine phosphorylation and dephosphorylation in cellular signal transduction and may play a role in cell growth control and carcinogenesis.Dendritic Cells: Specialized cells of the hematopoietic system that have branch-like extensions. They are found throughout the lymphatic system, and in non-lymphoid tissues such as SKIN and the epithelia of the intestinal, respiratory, and reproductive tracts. They trap and process ANTIGENS, and present them to T-CELLS, thereby stimulating CELL-MEDIATED IMMUNITY. They are different from the non-hematopoietic FOLLICULAR DENDRITIC CELLS, which have a similar morphology and immune system function, but with respect to humoral immunity (ANTIBODY PRODUCTION).Protein Phosphatase 1: A eukayrotic protein serine-threonine phosphatase subtype that dephosphorylates a wide variety of cellular proteins. The enzyme is comprised of a catalytic subunit and regulatory subunit. Several isoforms of the protein phosphatase catalytic subunit exist due to the presence of multiple genes and the alternative splicing of their mRNAs. A large number of proteins have been shown to act as regulatory subunits for this enzyme. Many of the regulatory subunits have additional cellular functions.src Homology Domains: Regions of AMINO ACID SEQUENCE similarity in the SRC-FAMILY TYROSINE KINASES that fold into specific functional tertiary structures. The SH1 domain is a CATALYTIC DOMAIN. SH2 and SH3 domains are protein interaction domains. SH2 usually binds PHOSPHOTYROSINE-containing proteins and SH3 interacts with CYTOSKELETAL PROTEINS.Histocompatibility Antigens Class II: Large, transmembrane, non-covalently linked glycoproteins (alpha and beta). Both chains can be polymorphic although there is more structural variation in the beta chains. The class II antigens in humans are called HLA-D ANTIGENS and are coded by a gene on chromosome 6. In mice, two genes named IA and IE on chromosome 17 code for the H-2 antigens. The antigens are found on B-lymphocytes, macrophages, epidermal cells, and sperm and are thought to mediate the competence of and cellular cooperation in the immune response. The term IA antigens used to refer only to the proteins encoded by the IA genes in the mouse, but is now used as a generic term for any class II histocompatibility antigen.Genes, MHC Class II: Genetic loci in the vertebrate major histocompatibility complex that encode polymorphic products which control the immune response to specific antigens. The genes are found in the HLA-D region in humans and in the I region in mice.Mice, Inbred C57BLMolecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Staurosporine: An indolocarbazole that is a potent PROTEIN KINASE C inhibitor which enhances cAMP-mediated responses in human neuroblastoma cells. (Biochem Biophys Res Commun 1995;214(3):1114-20)Alkaloids: Organic nitrogenous bases. Many alkaloids of medical importance occur in the animal and vegetable kingdoms, and some have been synthesized. (Grant & Hackh's Chemical Dictionary, 5th ed)Phosphatidylinositol Phosphates: Phosphatidylinositols in which one or more alcohol group of the inositol has been substituted with a phosphate group.Serine: A non-essential amino acid occurring in natural form as the L-isomer. It is synthesized from GLYCINE or THREONINE. It is involved in the biosynthesis of PURINES; PYRIMIDINES; and other amino acids.
(1/431) Intracellular signalling: PDK1--a kinase at the hub of things.

Phosphoinositide-dependent kinase 1 (PDK1) is at the hub of many signalling pathways, activating PKB and PKC isoenzymes, as well as p70 S6 kinase and perhaps PKA. PDK1 action is determined by colocalization with substrate and by target site availability, features that may enable it to operate in both resting and stimulated cells.  (+info)

(2/431) Functional counterparts of mammalian protein kinases PDK1 and SGK in budding yeast.

BACKGROUND: In animal cells, recruitment of phosphatidylinositol 3-kinase by growth factor receptors generates 3-phosphoinositides, which stimulate 3-phosphoinositide-dependent protein kinase-1 (PDK1). Activated PDK1 then phosphorylates and activates downstream protein kinases, including protein kinase B (PKB)/c-Akt, p70 S6 kinase, PKC isoforms, and serum- and glucocorticoid-inducible kinase (SGK), thereby eliciting physiological responses. RESULTS: We found that two previously uncharacterised genes of Saccharomyces cerevisiae, which we term PKH1 and PKH2, encode protein kinases with catalytic domains closely resembling those of human and Drosophila PDK1. Both Pkh1 and Pkh2 were essential for cell viability. Expression of human PDK1 in otherwise inviable pkh1Delta pkh2Delta cells permitted growth. In addition, the yeast YPK1 and YKR2 genes were found to encode protein kinases each with a catalytic domain closely resembling that of SGK; both Ypk1 and Ykr2 were also essential for viability. Otherwise inviable ypk1Delta ykr2Delta cells were fully rescued by expression of rat SGK, but not mouse PKB or rat p70 S6 kinase. Purified Pkh1 activated mammalian SGK and PKBalpha in vitro by phosphorylating the same residue as PDK1. Pkh1 activated purified Ypk1 by phosphorylating the equivalent residue (Thr504) and was required for maximal Ypk1 phosphorylation in vivo. Unlike PKB, activation of Ypk1 and SGK by Pkh1 did not require phosphatidylinositol 3,4,5-trisphosphate, consistent with the absence of pleckstrin homology domains in these proteins. The phosphorylation consensus sequence for Ypk1 was similar to that for PKBalpha and SGK. CONCLUSIONS: Pkh1 and Pkh2 function similarly to PDK1, and Ypk1 and Ykr2 to SGK. As in animal cells, these two groups of yeast kinases constitute two tiers of a signalling cascade required for yeast cell growth.  (+info)

(3/431) Primary structure, tissue distribution, and expression of mouse phosphoinositide-dependent protein kinase-1, a protein kinase that phosphorylates and activates protein kinase Czeta.

Phosphoinositide-dependent protein kinase-1 (PDK1) is a recently identified serine/threonine kinase that phosphorylates and activates Akt and p70(S6K), two downstream kinases of phosphatidylinositol 3-kinase. To further study the potential role of PDK1, we have screened a mouse liver cDNA library and identified a cDNA encoding the enzyme. The predicted mouse PDK1 (mPDK1) protein contained 559 amino acids and a COOH-terminal pleckstrin homology domain. A 7-kilobase mPDK1 mRNA was broadly expressed in mouse tissues and in embryonic cells. In the testis, a high level expression of a tissue-specific 2-kilobase transcript was also detected. Anti-mPDK1 antibody recognized multiple proteins in mouse tissues with molecular masses ranging from 60 to 180 kDa. mPDK1 phosphorylated the conserved threonine residue (Thr402) in the activation loop of protein kinase C-zeta and activated the enzyme in vitro and in cells. Our findings suggest that there may be different isoforms of mPDK1 and that the protein is an upstream kinase that activates divergent pathways downstream of phosphatidylinositol 3-kinase.  (+info)

(4/431) p70 S6 kinase is regulated by protein kinase Czeta and participates in a phosphoinositide 3-kinase-regulated signalling complex.

p70 S6 kinase (p70S6K) is an important regulator of cell proliferation. Its activation by growth factor requires phosphorylation by various inputs on multiple sites. Data accumulated thus far support a model whereby p70S6K activation requires sequential phosphorylations at proline-directed residues in the putative autoinhibitory pseudosubstrate domain, as well as threonine 389. Threonine 229, a site in the catalytic loop is phosphorylated by phosphoinositide-dependent kinase 1 (PDK-1). Experimental evidence suggests that p70S6K activation requires a phosphoinositide 3-kinase (PI3-K)-dependent signal(s). However, the intermediates between PI3-K and p70S6K remain unclear. Here, we have identified PI3-K-regulated atypical protein kinase C (PKC) isoform PKCzeta as an upstream regulator of p70S6K. In coexpression experiments, we found that a kinase-inactive PKCzeta mutant antagonized activation of p70S6K by epidermal growth factor, PDK-1, and activated Cdc42 and PI3-K. While overexpression of a constitutively active PKCzeta mutant (myristoylated PKCzeta [myr-PKCzeta]) only modestly activated p70S6K, this mutant cooperated with PDK-1 activation of p70S6K. PDK-1-induced activation of a C-terminal truncation mutant of p70S6K was also enhanced by myr-PKCzeta. Moreover, we have found that p70S6K can associate with both PDK-1 and PKCzeta in vivo in a growth factor-independent manner, while PDK-1 and PKCzeta can also associate with each other, suggesting the existence of a multimeric PI3-K signalling complex. This work provides evidence for a link between a phorbol ester-insensitive PKC isoform and p70S6K. The existence of a PI3-K-dependent signalling complex may enable efficient activation of p70S6K in cells.  (+info)

(5/431) Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2.

The PtdIns(3,4,5)P3-dependent activation of protein kinase B (PKB) by 3-phosphoinositide-dependent protein kinases-1 and -2 (PDK1 and PDK2 respectively) is a key event in mediating the effects of signals that activate PtdIns 3-kinase. The catalytic domain of serum- and glucocorticoid-regulated protein kinase (SGK) is 54% identical with that of PKB and, although lacking the PtdIns(3,4, 5)P3-binding pleckstrin-homology domain, SGK retains the residues that are phosphorylated by PDK1 and PDK2, which are Thr256 and Ser422 in SGK. Here we show that PDK1 activates SGK in vitro by phosphorylating Thr256. We also show that, in response to insulin-like growth factor-1 (IGF-1) or hydrogen peroxide, transfected SGK is activated in 293 cells via a PtdIns 3-kinase-dependent pathway that involves the phosphorylation of Thr256 and Ser422. The activation of SGK by PDK1 in vitro is unaffected by PtdIns(3,4,5)P3, abolished by the mutation of Ser422 to Ala, and greatly potentiated by mutation of Ser422 to Asp (although this mutation does not activate SGK itself). Consistent with these findings, the Ser422Asp mutant of SGK is activated by phosphorylation (probably at Thr256) in unstimulated 293 cells, and activation is unaffected by inhibitors of PtdIns 3-kinase. Our results are consistent with a model in which activation of SGK by IGF-1 or hydrogen peroxide is initiated by a PtdIns(3,4, 5)P3-dependent activation of PDK2, which phosphorylates Ser422. This is followed by the PtdIns(3,4,5)P3-independent phosphorylation at Thr256 that activates SGK, and is catalysed by PDK1. Like PKB, SGK preferentially phosphorylates serine and threonine residues that lie in Arg-Xaa-Arg-Xaa-Xaa-Ser/Thr motifs, and SGK and PKB inactivate glycogen synthase kinase-3 similarly in vitro and in co-transfection experiments. These findings raise the possibility that some physiological roles ascribed to PKB on the basis of the overexpression of constitutively active PKB mutants might be mediated by SGK.  (+info)

(6/431) The Croonian Lecture 1998. Identification of a protein kinase cascade of major importance in insulin signal transduction.

Diabetes affects 3% of the European population and 140 million people worldwide, and is largely a disease of insulin resistance in which the tissues fail to respond to this hormone. This emphasizes the importance of understanding how insulin signals to the cell's interior. We have recently dissected a protein kinase cascade that is triggered by the formation of the insulin 'second messenger' phosphatidylinositide (3,4,5) trisphosphate (PtdIns (3,4,5)P3) and which appears to mediate many of the metabolic actions of this hormone. The first enzyme in the cascade is termed 3-phosphoinositide-dependent protein kinase-1 (PDK1), because it only activates protein kinase B (PKB), the next enzyme in the pathway, in the presence of PtdIns (3,4,5)P3. PKB then inactivates glycogen synthase kinase-3 (GSK3). PDK1, PKB and GSK3 regulate many physiological events by phosphorylating a variety of intracellular proteins. In addition, PKB plays an important role in mediating protection against apoptosis by survival factors, such as insulin-like growth factor-1.  (+info)

(7/431) PDK1 acquires PDK2 activity in the presence of a synthetic peptide derived from the carboxyl terminus of PRK2.

BACKGROUND: Protein kinase B (PKB) is activated by phosphorylation of Thr308 and of Ser473. Thr308 is phosphorylated by the 3-phosphoinositide-dependent protein kinase-1 (PDK1) but the identity of the kinase that phosphorylates Ser473 (provisionally termed PDK2) is unknown. RESULTS: The kinase domain of PDK1 interacts with a region of protein kinase C-related kinase-2 (PRK2), termed the PDK1-interacting fragment (PIF). PIF is situated carboxy-terminal to the kinase domain of PRK2, and contains a consensus motif for phosphorylation by PDK2 similar to that found in PKBalpha, except that the residue equivalent to Ser473 is aspartic acid. Mutation of any of the conserved residues in the PDK2 motif of PIF prevented interaction of PIF with PDK1. Remarkably, interaction of PDK1 with PIF, or with a synthetic peptide encompassing the PDK2 consensus sequence of PIF, converted PDK1 from an enzyme that could phosphorylate only Thr308 of PKBalpha to one that phosphorylates both Thr308 and Ser473 of PKBalpha in a manner dependent on phosphatidylinositol (3,4,5) trisphosphate (PtdIns(3,4,5)P3). Furthermore, the interaction of PIF with PDK1 converted the PDK1 from a form that is not directly activated by PtdIns(3,4,5)P3 to a form that is activated threefold by PtdIns(3,4,5)P3. We have partially purified a kinase from brain extract that phosphorylates Ser473 of PKBalpha in a PtdIns(3,4,5)P3-dependent manner and that is immunoprecipitated with PDK1 antibodies. CONCLUSIONS: PDK1 and PDK2 might be the same enzyme, the substrate specificity and activity of PDK1 being regulated through its interaction with another protein(s). PRK2 is a probable substrate for PDK1.  (+info)

(8/431) Mutational analysis of the coding regions of the genes encoding protein kinase B-alpha and -beta, phosphoinositide-dependent protein kinase-1, phosphatase targeting to glycogen, protein phosphatase inhibitor-1, and glycogenin: lessons from a search for genetic variability of the insulin-stimulated glycogen synthesis pathway of skeletal muscle in NIDDM patients.

The finding of a reduced insulin-stimulated glucose uptake and glycogen synthesis in the skeletal muscle of glucose-tolerant first-degree relatives of patients with NIDDM, as well as in cultured fibroblasts and skeletal muscle cells isolated from NIDDM patients, has been interpreted as evidence for a genetic involvement in the disease. The mode of inheritance of the common forms of NIDDM is as yet unclear, but the prevailing hypothesis supports a polygenic model. In the present study, we tested the hypothesis that the putative inheritable defects of insulin-stimulated muscle glycogen synthesis might be caused by genetic variability in the genes encoding proteins shown by biochemical evidence to be involved in insulin-stimulated glycogen synthesis in skeletal muscle. In 70 insulin-resistant Danish NIDDM patients, mutational analysis by reverse transcription-polymerase chain reaction-single strand conformation polymorphism-heteroduplex analysis was performed on genomic DNA or skeletal muscle-derived cDNAs encoding glycogenin, protein phosphatase inhibitor-1, phophatase targeting to glycogen, protein kinase B-alpha and -beta, and the phosphoinositide-dependent protein kinase-1. Although a number of silent variants were identified in some of the examined genes, we found no evidence for the hypothesis that the defective insulin-stimulated glycogen synthesis in skeletal muscle in NIDDM is caused by structural changes in the genes encoding the known components of the insulin-sensitive glycogen synthesis pathway of skeletal muscle.  (+info)

*  Phosphoinositide-dependent kinase-1
... has been shown to interact with: AKT1, PKN2, PRKACA, PRKCD, PRKCI, Protein kinase Mζ, ... "Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and ... "Identification of regulatory phosphorylation sites in mitogen-activated protein kinase (MAPK)-activated protein kinase-1a/ ... "Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1". Science. 281 (5385): 2042-5 ...
*  Mir-375
... phosphoinositide-dependent protein kinase-1 and regulates glucose-induced biological responses in pancreatic beta-cells". ... miR-375 has been shown to target the MTPN gene, which encodes the myotrophin protein, that regulates hormone release and ... protein expression". Int J Clin Exp Pathol. 3 (3): 254-64. PMC 2836503 . PMID 20224724. El Ouaamari A, Baroukh N, Martens GA, ... 394 (3): 623-7. doi:10.1016/j.bbrc.2010.03.036. PMID 20226166. Poy MN, Hausser J, Trajkovski M, Braun M, Collins S, Rorsman P, ...
*  Eisosome
These two paralogue proteins self-assemble in higher order structure helices and bind preferentially to phosphoinositide- ... BAR) Bin-Amphiphysin-RVS Slm1 Phosphoinositide PI4,5P(2) binding protein, forms a complex with Slm2p; acts downstream of Mss4p ... These are large protein complexes composed primarily of subunits of two Bin-Amphiphysin-RVS (BAR) domain containing proteins ... phosphorylated by the TORC2 complex Slm2 Phosphoinositide PI4,5P(2) binding protein, forms a complex with Slm1p; acts ...
*  Protein kinase N1
... has been shown to interact with: AKAP9, Actinin, alpha 1, CCDC85B, NEFL, NEUROD2 Phosphoinositide-dependent ... This kinase is activated by Rho family of small G proteins and may mediate the Rho-dependent signaling pathway. This kinase can ... "A novel protein kinase with leucine zipper-like sequences: its catalytic domain is highly homologous to that of protein kinase ... Serine/threonine-protein kinase N1 is an enzyme that in humans is encoded by the PKN1 gene. The protein encoded by this gene ...
*  Protein kinase C zeta type
"Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1". Science. 281 (5385): 2042-5 ... "Protein kinase M zeta synthesis from a brain mRNA encoding an independent protein kinase C zeta catalytic domain. Implications ... Protein kinase C, zeta (PKCζ), also known as PRKCZ, is a protein that in humans is encoded by the PRKCZ gene. The PRKCZ gene ... of the Caenorhabditis elegans UNC-76 protein involved in axonal outgrowth is a protein kinase C zeta-interacting protein". J. ...
*  Protein kinase C
... through a protein kinase C-dependent mechanism". The Biochemical Journal. 466 (2): 379-90. doi:10.1042/BJ20140881. PMID ... membrane-bound receptor for activated protein kinase C proteins). The protein kinase C enzymes are known for their long-term ... Protein kinase C, commonly abbreviated to PKC (EC 2.7.11.13), is a family of protein kinase enzymes that are involved in ... The consensus sequence of protein kinase C enzymes is similar to that of protein kinase A, since it contains basic amino acids ...
*  Sphingolipid
Hetz CA, Hunn M, Rojas P, Torres V, Leyton L, Quest AF (December 2002). "Caspase-dependent initiation of apoptosis and necrosis ... Snider AJ, Orr Gandy KA, Obeid LM (June 2010). "Sphingosine kinase: Role in regulation of bioactive sphingolipid mediators in ... These sphingolipid-based microdomains, or "lipid rafts" were originally proposed to sort membrane proteins along the cellular ... It may be phosphorylated by ceramide kinase to form ceramide-1-phosphate. Alternatively, it may be glycosylated by ...
*  BIM-1
"Rab2 interacts directly with atypical protein kinase C (aPKC) iota/lambda and inhibits aPKCiota/lambda-dependent glyceraldehyde ... protein kinase C inhibitor bisindolyl maleimide 2 binds with reversed orientations to different conformations of protein kinase ... a novel protein that specifically interacts with the zinc finger domain of the atypical protein kinase C isotype lambda/iota ... "Crystal structure of the catalytic subunit of cyclic adenosine monophosphate-dependent protein kinase". Science. 253 (5018): ...
*  RPS6KA2
Lizcano JM, Morrice N, Cohen P (2001). "Regulation of BAD by cAMP-dependent protein kinase is mediated via phosphorylation of a ... a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase ... This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine and threonine kinases. This kinase contains 2 non- ... Ribosomal protein S6 kinase alpha-2 is an enzyme that in humans is encoded by the RPS6KA2 gene. ...
*  Sodium-hydrogen exchange regulatory cofactor 2
Phosphoinositide-dependent kinase-1, EZR, PODXL, Cystic fibrosis transmembrane conductance regulator and PLCB3. Solute carrier ... also known as tyrosine kinase activator protein 1 (TKA-1) or SRY-interacting protein 1 (SIP-1) is a protein that in humans is ... "NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ... "NHE3 kinase A regulatory protein E3KARP binds the epithelial brush border Na+/H+ exchanger NHE3 and the cytoskeletal protein ...
*  PDK2
... protein kinase B)/glycogen synthase kinase-3 signaling pathway via phosphatidylinositol 3-kinase". Journal of Immunology. 163 ( ... Additionally, inhibition of PDK2 subsequently inhibits HIF1A in cancer cells by both a prolyl-hydroxylase (PHD)-dependent ... "Structure of pyruvate dehydrogenase kinase. Novel folding pattern for a serine protein kinase". The Journal of Biological ... PDK2 is an isozyme of pyruvate dehydrogenase kinase. The protein encoded by the PDK2 gene has two sites, an active site and an ...
*  AKT2
The encoded protein is a general protein kinase capable of phosphorylating several known proteins. The gene was shown to be ... OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase". Proc. ... Delcommenne M, Tan C, Gray V, Rue L, Woodgett J, Dedhar S (1998). "Phosphoinositide-3- ... "Inhibition of insulin-induced activation of Akt by a kinase-deficient mutant of the epsilon isozyme of protein kinase C". J. ...
*  AKT3
The protein encoded by this gene is a member of the AKT subfamily of serine/threonine protein kinases. AKT kinases are known to ... AKT-dependent survival pathways in Kaposi's sarcoma cells". J. Biol. Chem. 277 (28): 25195-202. doi:10.1074/jbc.M200921200. ... protein kinase B, gamma)". Hodgkinson CP, Sale EM, Sale GJ (2002). "Characterization of PDK2 activity against protein kinase B ... Walker KS, Deak M, Paterson A, Hudson K, Cohen P, Alessi DR (1998). "Activation of protein kinase B beta and gamma isoforms by ...
*  NEK6
NIMA-related kinases (NEKs) are a group of protein kinases that are homologous to NIMA. Evidence suggests that NEKs perform ... "Identification and characterization of Nek6 protein kinase, a potential human homolog of NIMA histone H3 kinase". Biochem. ... Serine/threonine-protein kinase Nek6 is an enzyme that in humans is encoded by the NEK6 gene. The Aspergillus nidulans 'never ... It is a protein kinase which plays an important role in mitotic cell cycle progression. Required for chromosome segregation at ...
*  PRKCI
This protein kinase is calcium-independent and phospholipid-dependent. It is not activated by phorbolesters or diacylglycerol. ... Phosphoinositide-dependent kinase-1, SMG1 (gene), Sequestosome 1, KRAS. Vimentin GRCh38: Ensembl release 89: ENSG00000163558 - ... This gene encodes a member of the protein kinase C (PKC) family of serine/threonine protein kinases. The PKC family comprises ... Lim YP, Low BC, Lim J, Wong ES, Guy GR (Jul 1999). "Association of atypical protein kinase C isotypes with the docker protein ...
*  YWHAH
... a protein kinase-dependent activator of tyrosine and tryptophan hydroxylases". Proceedings of the National Academy of Sciences ... Phosphoinositide-dependent kinase-1, RIMS1, RIMS2, TLX2, TNFAIP3, and ZFP36. GRCh38: Ensembl release 89: ENSG00000128245 - ... A member of a protein family that has been involved in the protein kinase C signalling pathway". Journal of Molecular Biology. ... This highly conserved protein family is found in both plants and mammals, and this protein is 99% identical to the mouse, rat ...
*  Protein kinase B
... phosphoinositide dependent kinase 1 (PDPK1 at threonine 308) and the mammalian target of rapamycin complex 2 (mTORC2 at serine ... including integrin-linked kinase (ILK) and mitogen-activated protein kinase-activated protein kinase-2 (MAPKAPK2) can also ... Protein kinase B (PKB), also known as Akt, is a serine/threonine-specific protein kinase that plays a key role in multiple ... Yang ZZ, Tschopp O, Baudry A, Dümmler B, Hynx D, Hemmings BA (April 2004). "Physiological functions of protein kinase B/Akt". ...
*  GRB14
"The adapter protein ZIP binds Grb14 and regulates its inhibitory action on insulin signaling by recruiting protein kinase Czeta ... This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor ... Growth factor receptor-bound protein 14 is a protein that in humans is encoded by the GRB14 gene. The product of this gene ... belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and ...
*  S1PR1
... and the lipid dependent protein kinase B (PKB) signaling pathway increases the survival of lymphocytes and other immune cells ... Phosphoinositide 3-kinase (PI3K) and the GTPase RAC are responsible of the lymphocytes migration and their interactions with ... All the intracellular functions occur via the interaction with Gαi and Gαo: these two proteins recruit other proteins for ... mitogen-activated protein kinase pathway". J. Biol. Chem. 271 (19): 11272-9. doi:10.1074/jbc.271.19.11272. PMID 8626678. " ...
*  PIK3C2G
... and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain ... The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling ... C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may ... kinase and mitogen-activated protein (MAP) kinase pathways". J. Leukoc. Biol. 78 (4): 1016-23. doi:10.1189/jlb.0105056. PMID ...
*  PIK3C2B
... and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels ... The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling ... C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, ... "Extracellular HIV-1 Tat protein induces a rapid and selective activation of protein kinase C (PKC)-alpha, and -epsilon and - ...
*  PIK3C2A
... and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels ... This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. GRCh38: ... The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling ... "Extracellular HIV-1 Tat protein induces a rapid and selective activation of protein kinase C (PKC)-alpha, and -epsilon and - ...
*  Lipoteichoic acid
Its activation also induces mitogen-activated protein kinases (MAPK) activation along with Phosphoinositide 3-kinase activation ... showed that LTA causes an IL-10-dependent inhibition of CD4 T-cell expansion and function by up-regulating PD-1 levels on ...
*  Phosphoinositide 3-kinase
DNA-dependent protein kinase (DNA-PK) and mammalian target of rapamycin (mTOR). They are protein serine/threonine kinases. The ... Likewise, the phosphoinositide-dependent kinase-1 (PDK1 or, rarely referred to as PDPK1) also contains a pleckstrin homology ... leading to the discovery that this phosphoinositide kinase had the unprecedented ability to phosphorylate phosphoinositides on ... Full activation of AKT occurs upon phosphorylation of serine 473 by the TORC2 complex of the mTOR protein kinase. The "PI3-k/ ...
*  Integrin-linked kinase
"Regulation of cell adhesion and anchorage-dependent growth by a new beta 1-integrin-linked protein kinase". Nature. 379 (6560 ... Phosphoinositide binding motif and extreme N-terminus of kinase catalytic domain. Integrins lack enzymatic activity and depend ... "Regulation of protein kinase B/Akt-serine 473 phosphorylation by integrin-linked kinase: critical roles for kinase activity and ... "Inhibition of insulin-induced activation of Akt by a kinase-deficient mutant of the epsilon isozyme of protein kinase C". The ...
*  Rocky Mountain spotted fever
CDC42, protein tyrosine kinase, phosphoinositide 3-kinase, and Src-family kinases then activate Arp2/3. This causes the ... Clathrin and Caveolin 2-Dependent Manner". Cellular Microbiology. 11 (4): 629-644. doi:10.1111/j.1462-5822.2008.01279.x. Walker ... This species of Rickettsia uses an abundant cell surface protein called OmpB to attach to a host cell membrane protein called ... Both rOmpA and rOmpB are members of a family of surface cell antigens (Sca) which are autotransporter proteins; they act as ...
NAC, a common dietary supplement and an antioxidant membrane-permeable metal-binding compound, has been shown to inhibit inflammatory responses, tumor growth including lung cancer [13, 14]. However, the mechanisms by which this reagent in control of NSCLC cell growth has not been well elucidated. We have found that NAC inhibited NSCLC cell proliferation through reduction of PDK1, a kinase and master regulator of a number of downstream signal cascades that are involved in suppression of apoptosis and promotion of tumor growth including lung cancer [4, 15]. High expression of PDK1 has been detected in invasive cancers including lung [5] and inhibition of PDK1 in several cancer cells results in significant cell growth inhibition [6]. These observations suggest that PDK1 can be considered as a target for therapies. This result, together with the finding that exogenous PDK1 diminishes the inhibitory effect of NAC on cell growth, indicates an important role of targeting PDK1 in mediating the ...
doi: 10.1016/j.abb.2005.08.012, 10.1002/0471264180.or025.02 oph: A organo-phosphate (P-O) hydroxyl bound to a ketone or aldehyde. Synthetic intermediate and precursor to organo-phosphate agents known as AChE inhibitors. Reaction is catalyzed by the Organo-Phosphate Hydrolase enzyme, thus a (Mg)ATP-dependent ligase. See related DOIs above. dfp (Isoflurophate): http://www.drugbank.ca/drugs/DB00677, Wikipedia EC 3.1.8.2 (DFPase) http://www.genome.jp/dbget-bin/www_bget?ec:3.1.8.2 EC 3.1.8.1 (Parathion hydrolase) http://www.uniprot.org/uniprot/P0A433, http://www.drugbank.ca/drugs/DB02138 HMDB keywords: functionalized diphosphine, chim trills, DFP, Paraoxon Reaction type: oxidative desulfuration (BioCyc) Related: 3-phosphoinositide-dependent protein kinase 1, Serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B beta isoform Regulation of 3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) by Src Involves Tyrosine Phosphorylation of PDK1 and Src Homology 2 Domain Binding ...
The serum- and glucocorticoid-induced protein kinase (Sgk) functions in regulation of transepithelial sodium transport in the kidney. Sodium transport is regulated by numerous hormones including aldosterone, vasopressin, and insulin. Sgk appears to contribute to such regulation as a point of convergence for various signals generated by the hormonal stiumui. As its name suggsts, expression of Sgk is regulated by serum, glucocorticoids, and aldosterone. But Sgk activity is also regulated posttranslationally, for example by insulin and insulin-like growth factors, in a manner that requires activation of phosphatidylinositol 3-kinase (PI3K) and the phosphoinositide-dependent protein kinases PDK-1 and PDK-2, which directly phosphorylate and activate Sgk. Perrotti et al. now report that Sgk is also a direct target for phosphorylation and activation by the cAMP-dependent protein kinase (PKA). Such activation of Sgk appears to require previous phosphorylation by one of the PDKs. The complex regulation ...
Insulin binding to its receptor results in the tyrosine phosphorylation of insulin receptor substrates (IRS) by the insulin receptor tyrosine kinase (INSR). This allows association of IRSs with the regulatory subunit of phosphoinositide 3-kinase (PI3K). PI3K activates 3-phosphoinositide-dependent protein kinase 1 (PDK1), which activates Akt, a serine kinase. Akt in turn deactivates glycogen synthase kinase 3 (GSK-3), leading to activation of glycogen synthase (GYS) and thus glycogen synthesis. Activation of Akt also results in the translocation of GLUT4 vesicles from their intracellular pool to the plasma membrane, where they allow uptake of glucose into the cell. Akt also leads to mTOR-mediated activation of protein synthesis by eIF4 and p70S6K. The translocation of GLUT4 protein is also elicited through the CAP/Cbl/TC10 pathway, once Cbl is phosphorylated by INSR. Other signal transduction proteins interact with IRS including GRB2. GRB2 is part of the cascade including SOS, RAS, RAF and MEK ...
Molecular association of cancer cell metastasis with signaling pathways has been explicated so as to aid in the development of new prognostic models for better cancer therapies. However, those metastatic signaling pathways are barely explored to take account of the functions of enzymes involved in cellular metabolism. Particularly, the metabolic enzymes in de novo purine biosynthesis have been overlooked for their potential roles in cancer cell metastasis even though they have been successfully validated anti-cancer drug targets. Meanwhile, several lines of recent discoveries on de novo purine biosynthesis suggest that the spatiotemporal assembly of purine biosynthetic enzymes, the purinosome, is under controls of signaling pathways in cancer cells. The results of the inquiry reveal an unanticipated mechanism of action of 3-phosphoinositide-dependent protein kinase 1 (PDK1) signaling pathways in regulation of purine biosynthesis in an Akt-independent manner. Considering the biological action of ...
The 3-phosphoinositide-dependent protein kinase-1 (PDK1) is an imminent target for discovering novel anticancer drugs. In order to understand the structure-activity correlation of naphthyridine-based PDK-1 inhibitors, we have carried out a combined pharmacophore, three-dimensional quantitative structure-activity relationship (3D-QSAR), and molecular docking studies. The study has resulted in six point pharmacophore models with four hydrogen bond acceptors (A), one hydrogen bond donor (D), and one aromatic ring (R) are used to derive a predictive atom-based 3D-QSAR model. The generated 3D-QSAR model shows that the alignment has good correlation coefficient for the training set compounds which comprises the values of R2 = 0.96, SD = 0.2, and F = 198.2. Test set compounds shows Q2 = 0.84, RMSE = 0.56, and Pearson-R = 0.84. The external validation was carried out to validate the predicted QSAR model which shows good predictive power of \( r_{m}^{2} \) = 0.83 and k = 1.01, respectively. The external ...
We first evaluated the phosphorylation state of Akt at Ser-473, the site of phosphorylation by MAPKAPK-2, which has been shown to be critical for the generation of high levels of Akt enzyme activity. 15 32 33 Several other kinases have also been reported to phosphorylate Akt at Ser-473, including integrin-linked kinase (ILK), 34 35 36 3-phosphoinositide-dependent kinase-1 (PDK-1) 35 and DNA-dependent protein kinase (DNA-PK). 37 Our data showed two distinct phases of Ser-473 Akt modulation during photoreceptor degeneration: the first one was characterized by the inactivation of Akt, and extended from early onset (13 days) to the peak of photoreceptor apoptosis (15 days), and the following one displayed a striking Akt activation during the period when most photoreceptors have degenerated. The fact that Akt activation levels were decreased and no immunoreactivity of the active form was detected at the photoreceptor level, strongly suggests that the Akt survival signaling pathway was inhibited ...
The results of our study demonstrate that the adhesion complex protein ILK regulates the expression of smooth muscle-specific genes in intact differentiated tracheal smooth muscle tissues. This is the first demonstration that ILK mediates signaling pathways that regulate the phenotype of smooth muscle. We found that ILK modulates its effects on airway smooth muscle gene transcription by activating the phosphoinositide-dependent kinase Akt/PKB, a downstream effector and substrate of ILK (1, 8, 29, 33), and that the activation of Akt suppresses gene transcription by inhibiting activity of the transcriptional regulator SRF. ILK binds to the cytoplasmic tails of β-integrin proteins where it regulates the organization of macromolecular signaling complexes at extracellular matrix/cytoskeletal junctions in tracheal smooth muscle tissues (38). Thus our results suggest that ILK may regulate nuclear signaling pathways that control the differentiation and phenotype of airway smooth muscle in response to ...
(2003) Bögre et al. Trends in Plant Science. Lipid-derived signals are central to regulating a multitude of cellular processes but, in plants, little is known of the downstream signalling pathways. The Arabidopsis 3-phosphoinositide-dependent...
As the study by Wambolt et al. (1) shows, adaptation turns into maladaptation when an acute stress (ischemia and reperfusion) is superimposed on an adaptive response. The excess production of protons from enhanced glycolytic metabolism results in contractile dysfunction by mechanisms that are not completely understood. The deleterious effects on contraction that accompany enhanced glycolytic flux are prevented by the addition of a drug that promotes pyruvate oxidation, thereby reducing its conversion to lactate. Dichloroacetate, like ranolazine, and probably also l-carnitine, activate the pyruvate dehydrogenase (PDH) complex by inhibiting pyruvate dehydrogenase kinase (PDK) (29-32). Restoring carbon flux through PDH may be all that is necessary to improve postischemic contractile function (30). Dichloroacetate, although not a specific inhibitor of PDK (33), is one member of the growing group of drugs that target metabolism and metabolic efficiency in the normal, stressed, ischemic or ...
Hu X, Xu X, Lu Z, Zhang P, Fassett J, Zhang Y, Xin Y, Hall JL, Viollet B, Bache RJ, et al. AMP activated protein kinase-α2 regulates expression of estrogen-related receptor-α, a metabolic transcription factor related to heart failure development. Hypertension [Internet]. 2011;(4):696-703.
Looking for online definition of Protein-kinase C-related kinase 2 in the Medical Dictionary? Protein-kinase C-related kinase 2 explanation free. What is Protein-kinase C-related kinase 2? Meaning of Protein-kinase C-related kinase 2 medical term. What does Protein-kinase C-related kinase 2 mean?
PDK1 is one of the most extensively investigated anticancer targets in the aerobic glycolysis pathway, although most inhibitors are still at early stage preclinical research. The discovery of these PDK1 inhibitors has benefited from the mechanistic insights into the enzymatic regulation of PDK1. Phosphorylation of PDHA1 by PDK1 occurs in the PDC, where PDK1 is recruited to the complex through binding to E2 subunit (8, 39). Disrupting the interaction between PDK1 and E2 via binding to the lipoyl-binding pocket in the PDK1 N-terminal has given rise to the discovery of AZD7545 (23, 40). Despite its remarkable glucose-lowering effect, the anticancer efficacy of AZD7545 seems obscure (23). Like other kinases, binding to ATP-binding pocket of PDK1, also known as GHKL (gyrase, Hsp90, histidine kinase, and MutL) domain, to block ATP entry also results in PDK1 inhibition (41). However, the fact that GHKL domain widely exists in several other kinases compromised the specificity of ATP-completive PDK1 ...
Complete information for PDK4 gene (Protein Coding), Pyruvate Dehydrogenase Kinase 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
What does Computing & IT PDK stand for? Hop on to get the meaning of PDK. The Computing & IT Acronym /Abbreviation/Slang PDK means Portal Development Kit. by AcronymAndSlang.com
Pdpk1 - Pdpk1 (untagged ORF) - Rat 3-phosphoinositide dependent protein kinase-1 (Pdpk1), (10 ug) available for purchase from OriGene - Your Gene Company.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
GSK690693 is a pan-Akt inhibitor targeting Akt1, 2, 3 with IC50 values of 2, 13 and 9 nM, respectively [1, 2]. In addition, it also inhibits AMPK (IC50=50 nM), DAPK3 (IC50=81 nM), PAK4, 5, and 6 (IC50=10, 52, 6 nM), as well as the members of AGC kinase fa
PDK Selayang (Pusat Pemulihan Dalam Komuniti Selayang) telah ditubuhkan pada 1hb Sept 1991, oleh sekumpulan ibubapa kepada kanak-kanak kurang upaya (pada masa tersebut dipanggil sebagai kanak-kanak istimewa) yang anak-anak mereka telah dikeluarkan dari pembelajaran wajib di sekolah-sekolah aliran perdana di Selayang, dengan alasan mereka (OKU tersebut) "tidak boleh belajar". Alasan sebenar Guru Besar sekolah-sekolah tersebut ialah mereka takut graf pencapaian sekolah akan menurun ...
Phosphorylates and activates not only PKB/AKT, but also PKA, PKC-zeta, RPS6KA1 and RPS6KB1. May play a general role in signaling processes and in development. Scheid MP,et al. (2005)Mol Cell Biol; 25(6): 2347- ...
Gentaur molecular products has all kinds of products like :search , AGC \ MC Cellufine PB Media \ 202-15 for more molecular products just contact us
Do you really want to delete this prezi? Neither you, nor the coeditors you shared it with will be able to recover it again. DeleteCancel ...
10 20 30 40 50 60 # 123456789,123456789,123456789,123456789,123456789,123456789, $ 1 GGUUCGCUUGACUGUUCACCUCCCCGUGGUGCGAGCUGGACACUAUCCACUCGCAUUUUU=60 % 1 (((((((::[[[[[[[[(((:[[::::))))))))))]]:((((((((((::(((((((: 70 80 90 100 # 123456789,123456789,123456789,123456789,123456 $ 61 CACCCAUUGUAUUGAUUUGCUUGUGGAUGGUGACUGAGAAACAGUC=106 % 61 ...
Mitogen-activated protein kinases (MAPKs) constitute a major signaling pathway in cells, and are involved in processes controlling gene expression, cell division, cell survival, apoptosis, metabolism, differentiation and motility [1]. The conventional mammalian pathway consists of a cascade of three serine/threonine kinases referred to as MAPK kinase kinase, MAPK kinase and MAPK. The MAPKs are divided into four different subfamilies; the extracellular signal-regulated kinases 1/2 (ERK1/2), the c-JUN N-terminal kinases 1-3 (JNK1-3) or stress-activated protein kinases (SAPKα, β and γ), the p38 MAPKs (p38 α, β, γ and δ), and the big MAPKs (BMK1/ERK5). The atypical MAPK pathway is not organized in the normal three tier cascade, and includes ERK3/4, ERK7/8 and Nemo-like kinase (NLK) [1]. Both the conventional and the unconventional pathway can phosphorylate protein substrates and other protein kinases called mitogen-activated protein kinase-activated protein kinases (MAPKAPK). The MAPKAPK ...
Before Its News). Publishers, "Serine/Threonine-Specific Protein Kinase Inhibitors-Pipeline Insights, 2016″, report provides in depth insights on the pipeline drugs and their development activities around the Serine/Threonine-Specific Protein Kinase Inhibitors. The Publishers Report covers the product profiles in various stages of development including Discovery, Pre-clinical, IND, Phase I, Phase II, Phase III and Preregistration. Report covers the product clinical trials information and other development activities including technology, licensing, collaborations, acquisitions, fundings, patent and USFDA & EMA designations details. Publishers Report also provides detailed information on the discontinued and dormant drugs that have gone inactive over the years for Serine/Threonine-Specific Protein Kinase Inhibitors. Publishers Report also assesses the Serine/Threonine-Specific Protein Kinase Inhibitors therapeutics by Monotherapy, Combination products, Molecule type and Route of ...
Protein kinases have become central in the efforts to understand the nature of various diseases, and a lot is invested into creating effective therapeutic strategies and finding effective and selective protein kinase inhibitors. In order to succeed it is also important to focus on the structure of the kinases, their exact biological role, and how they interact and cooperate in the signaling. The exact structure of MAPKAPK5 is still unknown, and selective inhibitors are yet to be identified. Even though some of its biological roles are starting to emerge more work is required, including searching for selective inhibitors, analyzing its structure and interactions with its interaction partners. In order to analyze the structure of MAPKAPK5, homology models were generated and their ability to discriminate between binders and non-binders were analyzed. Based on the results, one model was found satisfactory and may be used as a working tool for further experimental studies and possibly structure aided ...
The metabolic programs of functionally distinct T cell subsets are tailored to their immunologic activities. While quiescent T cells use oxidative phosphorylation (OXPHOS) for energy production, and effector T cells (Teffs) rely on glycolysis for proliferation, the distinct metabolic features of regulatory T cells (Tregs) are less well established. Here we show that the metabolic sensor LKB1 is critical to maintain cellular metabolism and energy homeostasis in Tregs. Treg-specific deletion of Lkb1 in mice causes loss of Treg number and function, leading to a fatal, early-onset autoimmune disorder. Tregs lacking Lkb1 have defective mitochondria, compromised OXPHOS, depleted cellular ATP, and altered cellular metabolism pathways that compromise their survival and function. Furthermore, we demonstrate that the function of LKB1 in Tregs is largely independent of the AMP-activated protein kinase, but is mediated by the MAP/microtubule affinity-regulating kinases and salt-inducible kinases. Our ...
TGR3L_HUMAN » Transforming growth factor-beta receptor type 3-like protein » TGF-beta receptor type-3-like protein;TGFR-3L; Transforming growth factor-beta receptor type III-like protein;TGF-beta receptor type III-like protein ...
Liver kinase B1 (LKB1), known as a serine/threonine kinase, has been identified as a critical cancer suppressor in many cancer cells. It is a master upstream kinase of 13 AMP-activated protein kinase (AMPK)-related protein kinases, and possesses versatile biological functions. LKB1 gene is mutated in many cancers, and its protein can form different protein complexes with different cellular localizations in various cell types. The expression of LKB1 can be regulated through epigenetic modification, transcriptional regulation and post-translational modification. LKB1 dowcnstream pathways mainly include AMPK, microtubule affinity regulating kinase (MARK), salt-inducible kinase (SIK), sucrose non-fermenting protein-related kinase (SNRK) and brain selective kinase (BRSK) signalings, etc. This review, therefore, mainly discusses recent studies about the expression, regulation, downstream signaling and cancer suppressive function of LKB1, which can be helpful for better understanding of this molecular and
Zwijsen A., Goumans M.J., Lawson K.A., Van Rooijen M.A., Mummery C.L.. Transforming growth factor beta (TGFbeta) regulates the cell cycle and extracellular matrix (ECM) deposition of many cells in vitro. We have analysed chimaeric mouse embryos generated from embryonic stem cells with abnormal receptor expression to study the effect of TGFbeta on these processes in vivo and the consequences for normal development. The binding receptor for TGFbeta, TbetaRII, is first detected in the embryo proper around day 8.5 in the heart. Ectopic expression of TbetaRII from the blastocyst stage onward resulted in an embryonic lethal around 9.5 dpc. Analysis of earlier stages revealed that the primitive streak of TbetaRII chimaeras failed to elongate. Furthermore, although cells passed through the streak and initially formed mesoderm, they tended to accumulate within the streak. These defects temporally and spatially paralleled the expression of the TGFbeta type I receptor, which is first expressed in the node ...
Myotonin-protein kinase (MT-PK) also known as myotonic dystrophy protein kinase (MDPK) or dystrophia myotonica protein kinase (DMK) is an enzyme that in humans is encoded by the DMPK gene. The dmpk gene product is a Ser/Thr protein kinase homologous to the MRCK p21-activated kinases and the Rho family of kinases. Data obtained by using antibodies that detect specific isoforms of DMPK indicate that the most abundant isoform of DMPK is an 80-kDa protein expressed almost exclusively in smooth, skeletal, and cardiac muscles. This kinase exists both as a membrane-associated and as a soluble form in human left ventricular samples. The different C termini of DMPK that arise from alternative splicing determine its localization to the endoplasmic reticulum, mitochondria, or cytosol in transfected COS-1 cells. Among the substrates for DMPK proposed by in vitro studies are phospholemman, the dihydropyridine receptor, and the myosin phosphatase targeting subunit. However, an in vivo demonstration of the ...
Materials. CEP-1347, also known as KT7515, is a semisynthetic derivative of K-252a provided by Kyowa-Hakko Kogyo (Tokyo, Japan) (Kaneko et al., 1997). CEP-1347 was dissolved in cell culture grade dimethylsulfoxide (DMSO) and stored in the dark at 4°C. All dilutions of CEP-1347 were made in DMEM containing 1% bovine serum albumin. c-Jun N-terminal kinase 1 (JNK1) antibody (catalog #sc-474-G) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA). ERK1 antibody (catalog #06-182), mitogen-activated protein kinase-activated protein kinase 2 (MAPKAP2) antibody (catalog #06-534), and MAPKAP2 peptide substrate (catalog #12-240) were purchased from Upstate Biotechnology (Lake Placid, NY). HA antibody was purchased from Babco (Richmond, CA). AP-1 (c-jun) substrate was purchased from Promega (Madison, WI). Myelin basic protein substrate, Hoechst dye, and tunicamycin were purchased from Sigma (St. Louis, MO). SB203580 was custom-synthesized by RIT International Technology (Snellville, GA). ...
In a differential gene experiment, a cell perturbation can be measured on a microarray before and after the perturbation. The information from these microarrays can then be used to inference genetic pathways and protein-protein interaction networks. In this paper we reverse this idea somewhat and measure a cell perturbation through microarrays and then rely on a protein interaction map to assess which proteins are most likely influenced by the specific perturbation. This in turn helps to elucidate the functional effect the perturbation has on the cell system. The first part of the paper focuses on the propagation model we developed to obtain this information. The second part of the paper reports on a specific experiment that was driven by the interpretation we obtained through such a gene influence network. We applied a PC12 cell line that allows doxocyclin-dependent expression of constitutive active mitogen-activated protein kinase-activated protein kinase (MAPKAPK5 or MK5) to compare the
Regulation of hepatic gluconeogenesis by hormones insulin and glucagon is central to glucose homeostasis. Recent work has proposed that amongst the salt inducible kinase isoforms (SIK1, 2 and 3), members of the AMPK-related kinase family, the SIK2 isoform may play a role as signalling mediator in the control of insulin- and glucagon-regulated hepatic gluconeogenesis. However, the mechanisms of the hormonal-regulation of SIK2 in liver remain controversial, with much of the data based on the studies in non-hepatic tissues/cells. Therefore, the exact molecular regulation of SIK2 by these hormones in the liver required robust and intensive molecular/biochemical research coupled to physiological readout (e.g. gluconeogenesis). My studies with phosphopeptide mapping by mass spectrometry followed by verification with well-characterised phospho-specific antibodies revealed that SIK2 was phosphorylated on Ser343, Ser358, Thr484 and Ser587 in response to glucagon and fasting but not following insulin ...
PRAK antibody [N3C3] (mitogen-activated protein kinase-activated protein kinase 5) for ICC/IF, WB. Anti-PRAK pAb (GTX107938) is tested in Human samples. 100% Ab-Assurance.
Protein kinase B (PKB) isoforms became activated [and glycogen synthase kinase-3 (GSK3) became inhibited] when mouse Swiss 3T3 fibroblasts were exposed to oxidative stress (H2O2) or heat shock, but not when they were exposed to osmotic shock (0.5 M sorbitol or 0.7 M NaCl), chemical stress (sodium arsenite), the protein-synthesis inhibitor anisomycin, or UV radiation. In contrast, all seven stimuli activated mitogen-activated protein kinase-activated protein kinase-2 (MAPKAP-K2). The activation of MAPKAP-K2 was suppressed by the drug SB 203580, but not by inhibitors of phosphoinositide (phosphatidylinositide, PI) 3-kinase. In contrast, the activation of PKB isoforms and the inhibition of GSK3 by oxidative stress or heat shock were prevented by inhibitors of PI 3-kinase, but not by SB 203580. Thus the activation of PKB by oxidative stress or heat shock is mediated by PI 3-kinase and not by MAPKAP-K2. PKBα and PKBγ were also activated by heat shock and oxidative stress in human embryonic kidney ...
Shop Mitogen-activated protein kinase kinase kinase ELISA Kit, Recombinant Protein and Mitogen-activated protein kinase kinase kinase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Serum and glucocorticoid-inducible kinase 1 (SGK1) is a serine/threonine kinase whose activity and expression is up-regulated in vascular neointimal lesions in association with restenosis. Our previous studies show that vascular smooth muscle cell (VSMC) proliferation is augmented upon activation of SGK1. However, the molecular mechanism(s) was not fully examined. Thus, to identify proteins that participate in SGK1-mediated stimulation of VSMC proliferation, we performed a kinase substrate protein array with activated SGK1. We identified sirtuin3 (Sirt3), a class III histone deacetylase as a novel putative substrate for SGK1 in this screen. Preliminary studies from two-dimensional SDS-PAGE indicate that expression of active SGK1 (S422D-SGK1) is associated with a shift in Sirt3 to a more acidic profile, consistent with an increase in phosphorylation. Moreover, S422D-SGK1 expression resulted in a 2- and 1.6-fold increase in Sirt3 mRNA and protein; respectively, compared to empty vector or a ...
The serine/threonine kinase Akt (PKB/Rac) has been implicated as playing a role in the insulin-signaling pathway to glucose transport. Little is known regarding the regulation of Akt kinase activity in insulin-sensitive tissues, such as skeletal muscle, or whether this regulation is altered in insulin-resistant states such as NIDDM. We examined the effect of insulin on Akt kinase activity in skeletal muscle from six NIDDM patients and six healthy subjects. Whole-body insulin sensitivity, assessed by the euglycemic-hyperinsulinemic clamp, was significantly lower in NIDDM subjects (P , 0.001), and this was accompanied by impaired in vitro insulin-stimulated glucose transport in skeletal muscle. In both groups, insulin induced a significant increase in Akt kinase activity, but the response to maximal insulin (60 nmol/1) was markedly reduced in skeletal muscle from NIDDM subjects (66% of control levels, P , 0.01). Impaired Akt kinase activity was not accompanied by decreased protein expression of ...
RAC Gamma Serine/Threonine Protein Kinase (Protein Kinase Akt 3 or Protein Kinase B Gamma or RAC PK Gamma or STK 2 or AKT3 or EC 2.7.11.1) - Pipeline Review, H2 2017 Size and Share Published in 2017-08-29 Available for US$ 3500 at Researchmoz.us
[35 Pages Report] Check for Discount on Dual Specificity Tyrosine Phosphorylation Regulated Kinase 1A (Serine/Threonine Kinase MNB or MNB/DYRK Protein Kinase or Dual specificity YAK1 Related Kinase or HP86 or Protein Kinase Minibrain Homolog or DYRK1A or EC 2.7.12.1) - Pipeline Review, H2 2017 report by Global Markets Direct. Dual Specificity Tyrosine Phosphorylation Regulated Kinase 1A (Serine/Threonine Kinase...
TY - JOUR. T1 - Signal transduction pathways regulated by mitogen-activated/extracellular response kinase kinase kinase induce cell death. AU - Johnson, Nancy Lassignal. AU - Gardner, Anne M.. AU - Diener, Katrina M.. AU - Lange-Carter, Carol A.. AU - Gleavy, Janice. AU - Jarpe, Matthew B.. AU - Minden, Audrey. AU - Karin, Michael. AU - Zon, Leonard I.. AU - Johnson, Gary L.. PY - 1996/2/9. Y1 - 1996/2/9. N2 - Mitogen-activated/extracellular response kinase kinase (MEK) kinase (MEKK) is a serine-threonine kinase that regulates sequential protein phosphorylation pathways, leading to the activation of mitogen-activated protein kinases (MAPK), including members of the Jun kinase (JNK)/stress- activated protein kinase (SAPK) family. In Swiss 3T3 and REF52 fibroblasts, activated MEKK induces cell death involving cytoplasmic shrinkage, nuclear condensation, and DNA fragmentation characteristic of apoptosis. Expression of activated MEKK enhanced the apoptotic response to ultraviolet irradiation, ...
Mitogen Activated Protein Kinase 1 (ERT1 or MAP Kinase Isoform p42 or Extracellular Signal Regulated Kinase 2 or Mitogen Activated Protein Kinase 2 or MAPK1 or EC 2.7.11.24)-Pipeline Review, H2 2016. Summary. Global Markets Directs, Mitogen Activated Protein Kinase 1 (ERT1 or MAP Kinase Isoform p42 or Extracellular Signal Regulated Kinase 2 or Mitogen Activated Protein Kinase 2 or MAPK1 or EC 2.7.11.24)-Pipeline Review, H2 2016, provides in depth analysis on Mitogen Activated Protein Kinase 1 (ERT1 or MAP Kinase Isoform p42 or Extracellular Signal Regulated Kinase 2 or Mitogen Activated Protein Kinase 2 or MAPK1 or EC 2.7.11.24) targeted pipeline therapeutics.. The report provides comprehensive information on the Mitogen Activated Protein Kinase 1 (ERT1 or MAP Kinase Isoform p42 or Extracellular Signal Regulated Kinase 2 or Mitogen Activated Protein Kinase 2 or MAPK1 or EC 2.7.11.24) , targeted therapeutics, complete with analysis by indications, stage of development, mechanism of action ...
Looking for online definition of Serine/Threonine Kinase 9 in the Medical Dictionary? Serine/Threonine Kinase 9 explanation free. What is Serine/Threonine Kinase 9? Meaning of Serine/Threonine Kinase 9 medical term. What does Serine/Threonine Kinase 9 mean?
Dr. Bin Zhao s group published a research article on the Journal of Biological Chemistry online on November 28, 2017 with the title Deubiquitylase USP9X suppresses tumorigenesis by stabilizing large tumor suppressor kinase 2 (LATS2) in the Hippo pathway . Dr. Bin Zhao is the corresponding author and a PhD candidate Chu Zhu is the first author.. The Hippo tumor suppressor pathway plays important roles in organ size control, tumorigenesis, tissue regeneration, and stem cell self-renewal. At the center stage of this pathway is the MST1/2-LATS1/2 kinase cascade. The activity of LATS1/2 is regulated by phosphorylation and ubiquitination. However, the mechanism that removes the ubiquitin modification from LATS2 and thereby stabilizes the protein is not well understood. In this study, using tandem affinity purification (TAP), Dr. Bin Zhao s group found that a deubiquitylase USP9X specifically interacts with LATS2. USP9X knockout drastically diminished LATS2 protein levels. Further investigations ...
Mammalian AMP-activated protein kinase presents strong structural and functional similarities with the yeast sucrose non-fermenting 1 (Snf1) kinase involved in the derepression of glucose-repressed genes. It is now clearly established that AMP-activated protein kinase in the liver decreases glycolytic/lipogenic gene expression as well as genes involved in hepatic glucose production. This is achieved through a decreased transcriptional efficiency of transcription factors such as sterol-regulatory-element-binding protein-1c, carbohydrate-response-element-binding protein, hepatocyte nuclear factor 4α or forkhead-related protein. Clearly, the long-term consequences of AMP-activated protein kinase activation have to be taken into account if activators of this enzyme are to be designed as anti-diabetic drugs.. ...
The most common type of DM is called DM1, which is caused by a mutation in a gene called myotonic dystrophy protein kinase (DMPK). The DMPK gene is located on chromosome 19. The specific mutation that causes DM1 is called a trinucleotide repeat expansion. In people who have DM1, a particular unit of the gene is repeated too many times-more than the normal range of five to 38 times-and thus this section of the gene is too big and is unstable. The enlarged section of the gene is called a trinucleotide repeat expansion. People who have repeat numbers in the normal range will not develop DM1 and cannot pass it to their children. Having more than 50 repeats causes DM1. People who have 38-49 repeats have what is called a premutation. They do not develop DM1, but can pass DM1 on to their children. Myotonic dystrophy has an effect called anticipation. This means that when a person with repeat numbers in the affected or premutation range (above 38) has children, the expansion grows larger, and the ...
Recently, Aurora kinases (A, B, and C/serine threonine kinases) gained much attention due to their implication in several types of cancers. Aurora kinases are involved in multiple functions in mitosis. Aurora A is involved in mitotic entry, separation of centriole pairs, accurate bipolar spindle assembly, alignment of metaphase chromosomes and completion of cytokinesis. Aurora B is a chromosomal passenger protein involved in the regulation of chromosomal orientation, and regulating the association between kinetochores and microtubules, and cytokinesis. Aurora C exhibits similar functions to those assigned to Aurora B and is required for cytokinesis. The above mentioned functions are directly involved in maintaining genomic stability. The relation between Aurora kinases overexpression and transformation has been reported in many cancers. Aurora A was shown to overexpress in colorectal, renal, melanoma, and breast cancers. Mainly Aurora B was shown to overexpress in colorectal cancer. Aurora B was ...
To develop RNAi therapy against cancers, it is essential that suitable gene targets are selected. Such targets include antiapoptotic proteins, cell cycle regulators, transcription factors, signal transduction proteins, and factors associated with malignant biological behaviors of cancer cells. All of these genes are associated with the poor prognosis of cancer patients. PLKs belong to the family of serine/threonine kinases and are highly conserved among eukaryotes. PLK family has identified PLK-1, PLK-2 (SNK), PLK-3 (FNK), and PLK-4 (SAK) in mammalians so far and PLKs function as regulators of both cell cycle progression and cellular response to DNA damage [19, 39-41]. PLK-1 has an N-terminal serine/threonine protein kinase domain and two polo box domains at the C-terminal region. Polo box domains regulate the kinase activity of PLK-1 [21, 42]. PLK-1 regulates cell division at several points in the mitotic phase: mitotic entry through CDK1 activation, bipolar spindle formation, chromosome ...
Fatty acids constitute an important energy source for various tissues. The mechanisms that mediate and control uptake of free fatty acids from the circulation, however, are poorly understood. Here we show that efficient fatty-acid uptake by yeast cells requires the protein kinase Ypk1, the orthologue of the human serum- and glucocorticoid-induced kinase Sgk1. ypk1Δ mutant cells fail to grow under conditions that render cells auxotrophic for fatty acids, show a reduced uptake of radiolabelled or fluorescently labelled fatty acids, lack the facilitated component of the uptake activity, and have elevated levels of fatty acids in a bovine serum albumin (BSA) back-extractable compartment. Efficient fatty-acid uptake and/or incorporation requires the protein-kinase activity of Ypk1, because a kinase-dead point-mutant allele of YPK1 is defective in this process. This function of Ypk1 in fatty-acid uptake and/or incorporation is functionally conserved, because expression of the human Sgk1 kinase ...
We have isolated a novel protein kinase cDNA, PfPK6, by differential display RT-PCR (DDRT-PCR) of mRNA obtained from different asexual erythrocytic stages of Plasmodium falciparum, which shows sequence similarity to both cyclin-dependent kinase (CDK) and mitogen-activated protein kinase (MAPK) family members. The 915 bp open reading frame (ORF) is interrupted by seven introns and encodes a 305-residue polypeptide with a predicted molecular mass of 35848 Da. Several cDNA clones with some of the intron sequences were isolated, indicating alternate or defective splicing of PfPK6 transcripts because the gene seems to be a single copy located on chromosome 13. The similarity of the catalytic domain of PfPK6 to those of CDK2 and MAPK is 57.3% and 49.6%, respectively. The signature PSTAIRE (single-letter amino acid codes) CDK motif is changed to SKCILRE in PfPK6. The TXY residues that are phosphorylated in MAPKs for their activation are T(173)PT in PfPK6. Three size classes of PfPK6 transcripts of 6.5, ...
Background: The yeast SNF1 protein kinase and the mammalian AMP-activated protein kinase are highly conserved heterotrimeric complexes that are "metabolic master switches" involved in the switch from fermentative/anaerobic to oxidative metabolism. They are activated by cellular stresses that deplete cellular ATP, and SNF1 is essential in the response to glucose starvation. In both cases, activation requires phosphorylation at a conserved threonine residue within the activation loop of the kinase domain, but identifying the upstream kinase(s) responsible for this has been a challenging, unsolved problem. Results: Using a library of strains that express 119 yeast protein kinases as GST fusions, we identified Elm1p as the sole kinase that could activate the kinase domain of AMP-activated protein kinase in vitro. Elm1p also activated the purified SNF1 complex, and this correlated with phosphorylation of Thr210 in the activation loop. Removal of the C-terminal domain increased the Elm1p kinase ...
Aurora B kinase activity is known to be required for chromosome alignment, segregation and cytokinesis. Its function in vivo has been characterized with small-molecule inhibitors, such as ZM447439, Hesperadin and VX-680. Since the inhibition of Aurora B kinase often results in a premature exit of mitosis without chromosome alignment, the events after chromosome segregation have yet to be fully analyzed. To monitor the typical events of mitosis and cytokinesis in the living state, we constructed two fluorescent human melanoma MDA-MB-435S cell lines, expressing mPlum-histoneH3/EGFP-survivin or mPlum-histone-H3/mOrange-actin. We examined the effect of the Aurora B kinase inhibitor AZD1152-HQPA on the entire process from the initiation of mitosis to the completion of cytokinesis. We extensively captured live cell images using a multi-point time lapse imaging system equipped with a PlanApo 60x objective. Although most of the mitotic cells showed premature mitotic exit, some populations of the cells ...
Fluid and HCO3- secretion are fundamental functions of epithelia and determine bodily fluid volume and ionic composition, among other things. Secretion of ductal fluid and HCO3- in secretory glands is fueled by Na+/HCO3- cotransport mediated by basolateral solute carrier family 4 member 4 (NBCe1-B) and by Cl-/HCO3- exchange mediated by luminal solute carrier family 26, member 6 (Slc26a6) and CFTR. However, the mechanisms governing ductal secretion are not known. Here, we have shown that pancreatic ductal secretion in mice is suppressed by silencing of the NBCe1-B/CFTR activator inositol-1,4,5-trisphosphate (IP3) receptor-binding protein released with IP3 (IRBIT) and by inhibition of protein phosphatase 1 (PP1). In contrast, silencing the with-no-lysine (WNK) kinases and Ste20-related proline/alanine-rich kinase (SPAK) increased secretion. Molecular analysis revealed that the WNK kinases acted as scaffolds to recruit SPAK, which phosphorylated CFTR and NBCe1-B, reducing their cell surface ...
Cyclin-dependent kinase-like kinases (CLKs) are dual specificity protein kinases that phosphorylate Serine/Arginine-rich (SR) proteins involved in pre-mRNA processing. Four CLKs, termed PfCLK-1-4, can be identified in the human malaria parasite Plasmodium falciparum, which show homology with the yeast SR protein kinase Sky1p. The four PfCLKs are present in the nucleus and cytoplasm of the asexual blood stages and of gametocytes, sexual precursor cells crucial for malaria parasite transmission from humans to mosquitoes. We identified three plasmodial SR proteins, PfSRSF12, PfSFRS4 and PfSF-1, which are predominantly present in the nucleus of blood stage trophozoites, PfSRSF12 and PfSF-1 are further detectable in the nucleus of gametocytes. We found that recombinantly expressed SR proteins comprising the Arginine/Serine (RS)-rich domains were phosphorylated by the four PfCLKs in in vitro kinase assays, while a recombinant PfSF-1 peptide lacking the RS-rich domain was not phosphorylated. Since it ...
Lung cancer results when normal check and balance system of cell division is disrupted and ultimately the cells divide and proliferate in an uncontrollable manner forming a mass of cells in our body, known as tumor. Frequent mutations in Protein Kinase Domain alter the process of phosphorylation which results in abnormality in regulations of cell apoptosis and differentiation. Tyrosine Protein kinases and Serine/Threonine Protein Kinases are the two broad classes of protein kinases in accordance to their substrate specificity. The study of Tyrosine protein kinase and serine Kinase coding regions have the importance of sequence and structure determinants of cancer-causing mutations from mutation-dependent activation process. In the present study, we analyzed huge amounts of data extracted from various biological databases and NCBI. Out of the 534 proteins that may play a role in lung cancer, 71 proteins were selected that are likely to be actively involved in lung cancer. These proteins were evaluated by
The 5′ adenosine monophosphate-activated protein kinase (AMPK) is a heterotrimeric, evolutionary conserved enzyme which has emerged as a critical regulator of skeletal muscle cellular bioenergetics. AMPK is activated by both chemical (adipokines) and mechanical (stretch, contraction) stimuli leading to metabolic changes within muscle cells that include increased fatty acid oxidation, glucose uptake and glycolysis, as well as the stimulation and regulation of mitochondrial biogenesis. Collectively these acute responses and chronic adaptations act to reduce cellular disturbances, resulting in tighter metabolic control and maintenance of energy homeostasis. This brief review will describe the structure, function and activation of AMPK in skeletal muscle and how this ubiquitous molecule may be a plausible target for the treatment of several lifestyle-related metabolic disorders.
Complement factor C3, recently found to contain covalently bound phosphate, was phosphorylated in vitro by cyclic AMP-dependent protein kinase (protein kinase A) and Ca2+-activated, phospholipid-dependent protein kinase (protein kinase C). Both protein kinases phosphorylated the same serine residue(s) located in the C3a portion of the alpha-chain. In addition, protein kinase C phosphorylated the beta-chain to a lesser extent. Protein kinase A gave a maximal incorporation of 1 mol of phosphate/mol of C3 while that value with protein kinase C was 1.5 mol of phosphate/mol of C3. The velocity in pmol of [32P]phosphate/(min x unit kinase) was 20 times higher for protein kinase C than for protein kinase A although a 10 times lower ratio of protein kinase to C3 was used in the former case. The apparent Kmfor C3 was 2.6 µM when protein kinase C was used. The phosphorylated C3 was found to be more resistant to partial degradation by trypsin than unphosphorylated C3. It was also found that ...
90 kDa ribosomal protein S6 kinase 3; CLS; Coffin-Lowry syndrome; HU-3; ISPK-1; MAP kinase-activated protein kinase 1b; MAPK-activated protein kinase 1b; MAPKAP kinase 1b; MAPKAPK-1b; MAPKAPK1B; MRX19; RSK; RSK-2; RSK2; S6K-alpha-3; S6K-alpha3; insulin-stimulated protein kinase 1; mental retardation, X-linked 19; p90-RSK 3; p90-RSK2; p90RSK3; pp90RSK2; ribosomal S6 kinase 2; ribosomal protein S6 kinase alpha-3; ribosomal protein S6 kinase, 90kD, polypeptide 3; ribosomal protein S6 kinase, 90kDa, polypeptide ...
Saccharomyces cerevisiae is the micro-organism of choice for the conversion of fermentable sugars during beverage or bioethanol fermentations. These fermentations are characterised by high osmotic stress on a yeast cell, with selected brewing fermentations beginning at 20-25% fermentable sugars and bioethanol fermentations at 13% fermentable sugars. RCK2 encodes for a MAPKAP (MAPK-activated protein kinase) enzyme and was identified on a locus by QTL analysis in yeast cells under osmotic stress, RCK2 expression was placed under a tetracycline regulatable vector and rescued glucose, sorbitol or glycerol induced osmotic stress in an rck2 null strain. A strain overexpressing RCK2 had significantly faster fermentation rates when compared
Aurora kinases are essential for regulation of chromosome segregation and cytokinesis during mitosis and play a role in growth and progression of human tumors, including ovarian cancer. Aurora A and Aurora B are frequently overexpressed in high-grade and low-grade ovarian cancers. Targeting Aurora kinases has great potential for improving the efficacy of chemotherapies of ovarian cancer. In this study, we investigated whether the Aurora kinase inhibitor, VE 465, can enhance the antitumor activity of carboplatin in human ovarian cancer cells. The antitumor activity of VE 465 was tested by MTT proliferative assay in multiple established human epithelial ovarian cancer cell lines of varying p53 status. VE 465 and carboplatin had a synergistic effect on cell viability in both platinum-sensitive and -resistant ovarian cancers. The growth-inhibitory effect was accompanied by reduction in expression of histone 3 and an increase in apoptosis. We conclude that VE 465 enhances the efficacy of carboplatin ...
The transforming growth factor-beta (TGF-beta) receptor type III is a low abundance cell surface component that binds TGF-beta 1 and TGF-beta 2 with high affinity and specificity, and is present in many mammalian and avian cell types. Type III TGF-beta receptors affinity-labeled with 125I-TGF-beta migrate in sodium dodecyl sulfate-polyacrylamide electrophoresis gels as diffuse species of 250-350 kDa. Here we show that type III receptors deglycosylated by the action of trifluoromethanesulfonic acid yield affinity-labeled receptor cores of 110-130 kDa. This marked decrease in molecular weight is also achieved by combined treatment of type III receptors with heparitinase and chondroitinase ABC. Digestion of receptor-linked glycosaminoglycans by treatment of intact cell monolayers with heparitinase and chondroitinase does not prevent TGF-beta binding to the type III receptor core polypeptide and does not release the receptor polypeptide from the membrane. The type III TGF-beta receptor binds tightly to DEAE
Background: It is known that aurora B, a chromosomal passenger protein responsible for the proper progression of mitosis and cytokinesis, is overexpressed throughout the cell cycle in cancer cells. Overexpression of aurora B produced multinuclearity and induced aggressive metastasis, suggesting that overexpressed aurora B has multiple functions in cancer development. However, the detailed dynamics and functions of overexpressed aurora B are poorly understood. Results: We overexpressed GFP fused aurora B kinase in normal rat kidney epithelial cells. Using spinning disk confocal microscopy, we found that overexpressed aurora B-GFP was predominantly localized in the nucleus and along the cortex as a dot-like or short filamentous structure during interphase. Time-lapse imaging revealed that a cytoplasmic fraction of overexpressed aurora B-GFP was incorporated into the nucleus after cell division. Immunofluorescence showed that the nuclear fraction of overexpressed aurora B did not induce ectopic ...
The mitogen-activated protein kinase kinase (MEK) kinase 1 (MEKK1) mediates activin B signals required for eyelid epithelium morphogenesis during mouse fetal development. The present study investigates the role of MEKK1 in epithelial wound healing, another activin-regulated biological process. In a skin wound model, injury markedly stimulates MEKK1 expression and activity, which are in turn required for the expression of genes involved in extracellular matrix (ECM) homeostasis. MEKK1 ablation or down-regulation by interfering RNA significantly delays skin wound closure and impairs activation of Jun NH2-terminal kinases, induction of plasminogen activator inhibitor (PAI)-1, and restoration of cell-cell junctions of the wounded epidermis. Conversely, expression of wild-type MEKK1 accelerates reepithelialization of full-thickness skin and corneal debridement wounds by mechanisms involving epithelial cell migration, a cell function that is partially abolished by neutralizing antibodies for PAI-1 and
The DNA replication checkpoint is a complex signal transduction pathway, present in all eukaryotic cells, that functions to maintain genomic integrity and cell viability when DNA replication is perturbed. In Schizosaccharomyces pombe the major effector of the replication checkpoint is the protein kinase Cds1. Activation of Cds1 is known to require the upstream kinase Rad3 and the mediator Mrc1, but the biochemical mechanism of activation is not well understood. We report that the replication checkpoint is activated in two stages. In the first stage, Mrc1 recruits Cds1 to stalled replication forks by interactions between the FHA domain of Cds1 and specific phosphorylated Rad3 consensus sites in Mrc1. Cds1 is then primed for activation by Rad3-dependent phosphorylation. In the second stage, primed Cds1 molecules dimerize via phospho-specific interactions mediated by the FHA domains and are activated by autophosphorylation. This two-stage activation mechanism for the replication checkpoint allows for rapid
Cell cycle checkpoints were initially presumed to function as a regulator of cell cycle machinery in response to different genotoxic stresses, and later found to play an important role in the process of tumorigenesis by acting as a guard against DNA over-replication. As a counterpart of checkpoint activation, the checkpoint recovery machinery is working in opposition, aiming to reverse the checkpoint activation and resume the normal cell cycle. The DNA damage response (DDR) and oncogene induced senescence (OIS) are frequently found in precancerous lesions, and believed to constitute a barrier to tumorigenesis, however, the DDR and OIS have been observed to be diminished in advanced cancers of most tissue origins. These findings suggest that when progressing from pre-neoplastic lesions to cancer, DNA damage checkpoint barriers are overridden. How the DDR checkpoint is bypassed in this process remains largely unknown. Activated cytokine and growth factor-signaling pathways were very recently shown ...
The metabolic sensor, AMP-activated protein kinase (AMPK) is a serine/threonine protein kinase existing as a heterotrimer of catalytic (α1/α2) and regulatory subunits (β1/β2 and γ1/γ2/γ3). The 12 possible heterotrimers exhibit tissue and potentially functional specificity [8], and all can be activated by binding of AMP/ADP to the AMPKγ subunit and phosphorylation by one of two upstream kinases, liver kinase B (LKB)1 or calcium/calmodulin-dependent protein kinase kinase (CaMKK)β. AMPK is activated in response to depletion of ATP or alterations in intracellular calcium concentrations, and acts to shut down ATP-consuming, anabolic pathways and promoting ATP-generating, catabolic pathways [9].. As a monitor of cellular and whole body energy status [10], it is probably unsurprising that a recent elegant study in Science from Reuben Shaws laboratory places AMPK at the heart of the regulation of mitochondrial dynamics. Using CRISPR modification to delete AMPKα1 and/or AMPKα2 in vitro, they ...
Further observations on LKB1/STK11 status and cancer risk in Peutz-Jeghers syndrome. Germline mutations in the LKB1/STK11 tumour suppressor gene cause Peutz-Jeghers syndrome (PJS), a rare dominant disorder. In addition to typical hamartomatous gastrointestinal polyps and pigmented perioral lesions, PJS is associated with an increased risk of tumours at multiple sites. Follow-up information on carriers is limited and genetic heterogeneity makes counselling and management in PJS difficult. Here we report the analysis of the LKB1/STK11 locus in a series of 33 PJS families, and estimation of cancer risks in carriers and noncarriers. Germline mutations of LKB1/STK11 were identified in 52% of cases. This observation reinforces the hypothesis of a second PJS locus. In carriers of LKB1/STK11 mutations, the risk of cancer was markedly elevated. The risk of developing any cancer in carriers by age 65 years was 47% (95% CI: 27 - 73%) with elevated risks of both gastrointestinal and breast cancer. PJS with ...
It has been suggested that phosphorylation of the histone variant H2AX after ultraviolet light (UV) irradiation is triggered by DNA double-strand breaks induced as replication forks collide with UV-induced bulky lesions. More recently, it has been shown that UV-induced H2AX phosphorylation can also occur outside of S-phase, but the mechanism for this replication-independent induction is not well understood. In this study, we show that H2AX phosphorylation after UV irradiation is triggered by DNA repair intermediates and is induced in all phases of the cell cycle. Accumulation of DNA repair intermediates by inhibition of DNA repair synthesis resulted in a marked increase of H2AX phosphorylation in repair proficient but not repair-deficient xeroderma pigmentosum-A cells. Using chemical inhibitors of the PI(3)-like kinase family of protein kinases as well as ataxia telangiectasia mutated and Rad-3 related (ATR)-deficient Seckel syndrome cells and ataxia telangiectasia mutated-deficient ataxia ...
The cellular response to DNA damage is critical for maintenance of genomic integrity and inhibition of tumorigenesis. Mutations or aberrant expression of the E3 ubiquitin ligase EDD have been observed in a number of carcinomas and we recently reported that EDD modulates activity of the DNA damage checkpoint kinase, CHK2. Here, we demonstrate that EDD is necessary for G(1)/S and intra S phase DNA damage checkpoint activation and for the maintenance of G(2)/M arrest after double strand DNA breaks. Defective checkpoint activation in EDD-depleted cells led to radio-resistant DNA synthesis, premature entry into mitosis, accumulation of polyploid cells, and cell death via mitotic catastrophe. In addition to decreased CHK2 activation in EDD-depleted cells, the expression of several key cell cycle mediators including Cdc25A/C and E2F1 was altered, suggesting that these checkpoint defects may be both CHK2-dependent and -independent. These data support a role for EDD in the maintenance of genomic stability,
Peutz-Jeghers Syndrome The risk for breast and ovarian cancer is increased with Peutz-Jeghers syndrome (PJS), a rare early-onset autosomal dominant disorder, associated with specific physical characteristics in addition to increased cancer risks. The features associated with Peutz-Jeghers syndrome may include the following: melanocytic macules (dark blue or brown moles) These moles may be located around and/or in the mouth (including the lips), and around the eyes, nostrils, and anus. Dark moles may als...
Roles of Rho-associated Kinase in Cytokinesis; Mutations in Rho-associated Kinase Phosphorylation Sites Impair Cytokinetic Segregation of Glial ...
Diffuse large B-cell lymphoma (DLBCL) is the most common subtype of non-Hodgkin lymphoma (NHL), yet 40-50% of patients will eventually succumb to their disease demonstrating a pressing need for novel therapeutic options. Gene expression profiling has identified messenger RNAs that lead to transformation, but critical events transforming cells are normally executed by kinases. Therefore, we hypothesized that previously unrecognized kinases may contribute to DLBCL pathogenesis. We performed the first comprehensive analysis of global kinase activity in DLBCL, to identify novel therapeutic targets, and discovered that Germinal Center Kinase (GCK) was extensively activated. GCK RNA interference and small molecule inhibition induced cell cycle arrest and apoptosis in DLBCL cell lines and primary tumors in vitro and decreased the tumor growth rate in vivo, resulting in a significantly extended lifespan of mice bearing DLBCL xenografts. GCK expression was also linked to adverse clinical outcome in a ...
Basal breast cancer cells feature high expression of the Src family kinase Lyn that has been implicated in the pathogenicity of this disease. In this study, we identified novel Lyn kinase substrates, the most prominent of which was the atypical kinase SgK269 (PEAK1). In breast cancer cells, SgK269 expression associated with the basal phenotype. In primary breast tumors, SgK269 overexpression was detected in a subset of basal, HER2-positive, and luminal cancers. In immortalized MCF-10A mammary epithelial cells, SgK269 promoted transition to a mesenchymal phenotype and increased cell motility and invasion. Growth of MCF-10A acini in three-dimensional (3D) culture was enhanced upon SgK269 overexpression, which induced an abnormal, multilobular acinar morphology and promoted extracellular signal-regulated kinase (Erk) and Stat3 activation. SgK269 Y635F, mutated at a major Lyn phosphorylation site, did not enhance acinar size or cellular invasion. We show that Y635 represents a Grb2-binding site that ...
The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012 ...
Mammalian Ste20-like proline/alanine-rich kinase (SPAK) and oxidative stress-responsive 1 (OSR1) kinases phosphorylate and regulate cation-coupled Cl? cotransporter activity in response to cell quantity changes. activity of CLH-3b expressed in worm oocytes endogenously. Earlier yeast 2-cross research suggested that ERK kinases may function of GCK-3 upstream. Meclizine 2HCl Pharmacological inhibition of ERK signaling disrupted CLH-3b activity in HEK cells inside a GCK-3-reliant Meclizine 2HCl way. RNAi silencing from the ERK kinase MPK-1 or the ERK phosphorylating/activating kinase MEK-2 constitutively triggered native CLH-3b. MEK-2 and MPK-1 play important roles in regulating the meiotic cell cycle in oocytes. Cell cycle-dependent changes in MPK-1 correlate with the pattern of CLH-3b activation observed during oocyte meiotic maturation. We postulate that MEK-2/MPK-1 functions upstream from GCK-3 to regulate its activity during cell volume and meiotic cell cycle changes. oocyte is activated by ...
0004] BRAF is a member of the Raf kinase family of serine/threonine-specific protein kinases. BRAF plays an important role in regulating the MAPK/ERK signaling pathway, which affects cell division, proliferation, differentiation, and secretion. The RAS/RAF/MEK/ERK pathway acts as a signal transducer to send extracellular signals such as hormones, cytokines, and various growth factors into cell nucleus, directing a range of biochemical and physiological processes including cell differentiation, proliferation, growth, and apoptosis (McCubrey, J. A., et al., Biochim. Biophys. Acta, 2007, 1773 (8): 1263-84). The RAS/RAF/MEK/ERK pathway is frequently mutated in many human cancers (Downward, J., Nat. Rev. Cancer, 2003, 3 (1): 11-22). The finding that mutations in BRAF caused a wide range of human cancers and many of these tumors are dependent on the constitutive activation of BRAF/MEK/ERK pathway fueled drug discovery efforts in searching for small molecule inhibitors targeting BRAF mutants ...
MAPK8 [ENSP00000378974]. Stress-activated protein kinase JNK1; Serine/threonine-protein kinase involved in various processes such as cell proliferation, differentiation, migration, transformation and programmed cell death. Extracellular stimuli such as proinflammatory cytokines or physical stress stimulate the stress-activated protein kinase/c-Jun N-terminal kinase (SAP/JNK) signaling pathway. In this cascade, two dual specificity kinases MAP2K4/MKK4 and MAP2K7/MKK7 phosphorylate and activate MAPK8/JNK1. In turn, MAPK8/JNK1 phosphorylates a number of transcription factors, primarily components of AP-1 such as JUN, JDP2 and ATF2 and thus regulates AP-1 transcriptional activity. Phosphorylates the replication licensing factor CDT1, inhibiting the interaction between CDT1 and the histone H4 acetylase HBO1 to replication origins. Loss of this interaction abrogates the acetylation required for replication initiation. Promotes stressed cell apoptosis by phosphorylating key regulatory factors including ...
immune Uncategorized Dinaciclib (SCH 727965) manufacture, Rabbit polyclonal to NFKBIZ. Activation from the RNA-dependent proteins kinase (PKR) continues to be implicated in the pathogenesis of several neurodegenerative illnesses. not really mediated by PKR inhibition. Using kinase assays we looked into whether PKRi impacts any other proteins kinase. These analyses proven that PKRi does not Dinaciclib (SCH 727965) manufacture have any major inhibitory influence on pro-apoptotic kinases like the c-Jun N-terminal kinases (JNKs), the p38 MAP kinases as well as the death-associated proteins kinases (DAPKs), or on additional kinases including c-Raf, MEK1, MKK7 and MKK6. PKRi does, nevertheless, inhibit the experience of particular cyclin-dependent kinases (CDKs) including CDK2 and CDK5 both and in LK-treated neurons. In keeping with its inhibitory actions on mitotic CDKs, the treating HT-22 and HEK293T cell lines with PKRi decreases the pace of cell cycle progression sharply. Taken alongside the ...
Among the GTP-binding proteins, Rho is known to function as a molecular switch in various cellular functions. Among the Rho effectors, the cellular function and signal transduction of Rho-kinase have been extensively studied. However, information about its in vivo functions is still limited. With the recent development of a specific Rho-kinase inhibitor such as Y-27632 and fasudil, the understanding of the role of the Rho/Rho-kinase pathway in vitro and in vivo has advanced. However, to date, there have been few studies investigating the role of Rho-kinase in renal disease. Recent studies have shown that Rho-kinase inhibitor significantly attenuated the tubulointerstitial fibrosis in kidney induced by unilateral ureteral obstruction. However, there have been few studies investigating the role of the Rho/Rho-kinase pathway in hypertensive glomerular sclerosis. In this review, we described the role of the Rho/Rho-kinase pathway in the progression of renal glomerulosclerosis in several forms of ...
This unit describes immunocytochemical detection of phosphorylated histone H2AX for revealing the presence of DNA double-strand breaks. Double-strand breaks indicate DNA damage induced by ionizing radiation or by treatment with antitumor drugs such as DNA topoisomerase inhibitors. However, double-strand breaks can also be intrinsic, occurring in healthy, nontreated cells for a variety of reasons, and are generated in the course of DNA fragmentation in apoptotic cells. The unit presents strategies to distinguish radiation- or drug-induced breaks from those intrinsically formed in untreated cells or associated with apoptosis. The protocol describes the immunocytochemical detection of histone H2AX phosphorylated on Ser-139 combined with measurement of DNA content to identify cells that have DNA double-strand breaks and to concurrently assess their cell cycle phase. The detection is based on indirect immunofluorescence using a FITC-labeled secondary antibody, and DNA is counterstained with propidium ...
Aromatase inhibitors (AIs) are effective endocrine therapeutics for postmenopausal women with estrogen receptor (ER)α‑positive breast cancer. However, the efficacy of the treatment is often limited by the onset of AI resistance, owing to the phosphorylation of ERα serine 167 (Ser167). Previous studies have indicated that hyperactivation of the phosphoinositide‑3 kinase/RAC serine/threonine‑protein kinase signaling pathway occurs in AI‑resistant breast cancer models, which coincides with elevated levels of ERα phosphorylation at Ser167. The tumor suppressor serine/threonine‑protein phosphatase 2A (PP2A) regulates the phosphatidylinositol 3‑kinase/RAC serine/threonine‑protein kinase signaling pathway. A previous study indicated that PP2A inhibition decreased ERα Ser167 phosphorylation and estradiol (E2)‑independent cell growth. The present study investigated the potential relevance of PP2A in E2 deprivation‑resistant MCF‑7 cells. E2 depletion reduced the susceptibility of ...
We show here that CIN colon cancer cells undergo transient mitotic arrest in response to spindle damage. However, the maximum mitotic indices achieved by the CIN cells is lower than that of the MIN cells. Thus, we argue that the aneuploid colon cancer cells examined here have a robust spindle checkpoint. Consistently, it now appears that mutations in known spindle checkpoint genes are extremely rare in human tumours (Cahill et al., 1998, 1999a; Imai et al., 1999; Yamaguchi et al., 1999; Myrie et al., 2000; Sato et al., 2000). The reason for the apparent lack of such mutations may be that they are lethal. Although spindle checkpoint genes are non‐essential in yeast (reviewed in Taylor, 1999) mutations in MAD2 and BUB3 result in embryonic lethality in mice (Dobles et al., 2000; Kalitsis et al., 2000). Furthermore, disrupting Bub1 and Mad2 function accelerates mitotic exit in human cells suggesting that spindle checkpoint function may be required to complete normal somatic cell divisions (Taylor ...
Peroxisome proliferator-activated receptor (PPAR) alpha is a member of the nuclear receptor superfamily of ligand-activated transcription factors. PPARalpha is activated by peroxisome proliferators and fatty acids and has been shown to be involved in the transcriptional regulation of genes involved in fatty acid metabolism. In rodents, the PPARalpha-mediated change in such genes results in peroxisome proliferation and can lead to the induction of hepatocarcinogenesis. Using the mRNA differential display technique and Northern blot analysis, we have shown that chronic exposure of the prostate cancer epithelial cell line LNCaP to the synthetic androgen mibolerone results in the down-regulation of PPARalpha mRNA. Levels of PPARalpha mRNA are reduced to approximately 40% of control levels in LNCaP cells exposed to 10 nM mibolerone for 96 h. PPARalpha-responsive reporter plasmids derived from human ApoA-II and muscle carnitine palmitoyl-transferase I genes were stimulated by the PPARalpha-activating ligand
Peroxisome proliferator-activated receptors (PPARs) are ligand-activated nuclear receptors that are widely involved in various physiological functions. They are widely expressed through the reproductive system. Their roles in the metabolism and function of sex steroids and thus the etiology of reproductive disorders receive great concern. Various kinds of exogenous chemicals, especially environmental pollutants, exert their adverse impact on the reproductive system through disturbing the PPAR signaling pathway. Chemicals could bind to PPARs and modulate the transcription of downstream genes containing PPRE (peroxisome proliferator response element). This will lead to altered expression of genes related to metabolism of sex steroids and thus the abnormal physiological function of sex steroids. In this review, various kinds of environmental ligands are summarized and discussed. Their interactions with three types of PPARs are classified by various data from transcript profiles, PPRE reporter in ...
PPAR delta, 0.1 ml. Peroxisome proliferators are non-genotoxic carcinogens which are purported to exert their effect on cells through their interaction with members of the nuclear hormone receptor family, termed peroxisome proliferator activated
Congratulations! You have found the Peroxisome proliferator-activated receptor Forum on Forum Jar. This forum is a place where people who are interested in Peroxisome proliferator-activated receptor come together and discuss about Peroxisome proliferator-activated receptor. Please use the message board below to post anything related to Peroxisome proliferator-activated receptor . If you are interested in other similar forums, please check out the Related Forums section on the right. If you like this forum, please dont forget to tell your friends about Forum Jar ...
Peroxisome proliferators include hypolipidemic drugs, herbicides, leukotriene antagonists, and plasticizers; this term arises because they induce an increase in the size and number of peroxisomes. Peroxisomes are subcellular organelles found in plants and animals that contain enzymes for respiration and for cholesterol and lipid metabolism. The action of peroxisome proliferators is thought to be mediated via specific receptors, called PPARs, which belong to the steroid hormone receptor superfamily. PPARs affect the expression of target genes involved in cell proliferation, cell differentiation and in immune and inflammation responses. Three closely related subtypes (alpha, beta/delta, and gamma) have been identified. This gene encodes the subtype PPAR-alpha, which is a nuclear transcription factor. Multiple alternatively spliced transcript variants have been described for this gene, although the full-length nature of only two has been determined. [provided by RefSeq, Jul 2008 ...
Inductions of FABP in hepatic cytosol by administration of tiadenol and clofibric acid were studied in rats, mice and guinea-pigs. In rats and mice, [1-14C]oleic acid-binding capacity of hepatic cytosol was increased, in association with induction of
Peroxisome Proliferator Receptor alpha Agonist drug class usage statistics for the United States (2004 - 2014). Statistics include a comparison of all drugs within the drug class of Peroxisome Proliferator Receptor alpha Agonist.
Peroxisome proliferator-activated receptor a and estrogen are believed to he involved in metabolic changes leading to obesity. To test this relationship, we divided female wildtype and PPAR alpha-deficient mice fed on a high fat diet into the following groups: mock-operated, ovariectomized (OVX), and E(2)-treated. The visceral white adipose tissue and plasma cholesterol levels were increased significantly in wild type OVX and decreased in the E(2)-treated group, but interestingly not in PPAR alpha-deficient mice. The mRNA levels of lipoprotein lipase in adipose tissue were also increased in only wild type OVX and decreased significantly in E(2)-treated mice. These novel results suggest the possibility of signaling crosstalk between PPAR alpha and E(2), causing obesity in vivo. [BMB reports 2009; 42(2): 91-95 ...
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
Reactivity: Chicken, Cow, Dog and more. Compare 67 different PPARA ELISA Kits & buy the right one directly at antibodies-online.com!
Bhattacharya, Nandini, Jannette M Dufour, My-Nuong Vo, Janice Okita, Richard Okita, and Kwan Hee Kim. 2005. "Differential Effects of Phthalates on the Testis and the Liver." Biology of Reproduction 72 (3) (March): 745-54. doi:10.1095/biolreprod.104.031583. Bility, Moses T, Jerry T Thompson, Richard H McKee, Raymond M David, John H Butala, John P Vanden Heuvel, and Jeffrey M Peters. 2004. "Activation of Mouse and Human Peroxisome Proliferator-Activated Receptors (PPARs) by Phthalate Monoesters." Toxicological Sciences : An Official Journal of the Society of Toxicology 82 (1) (November): 170-82. doi:10.1093/toxsci/kfh253. Dufour, Jannette M, My-Nuong Vo, Nandini Bhattacharya, Janice Okita, Richard Okita, and Kwan Hee Kim. 2003. "Peroxisome Proliferators Disrupt Retinoic Acid Receptor Alpha Signaling in the Testis." Biology of Reproduction 68 (4) (April): 1215-24. doi:10.1095/biolreprod.102.010488. Feige, Jérôme N, Laurent Gelman, Daniel Rossi, Vincent Zoete, Raphaël Métivier, Cicerone Tudor, ...
In atherosklerotischen Gefäßabschnitten kommt es durch Migration von Endothelzellen zur Neovaskularisation atherosklerotischer Plaques. Die Adhäsionsmoleküle E-Selectin, VCAM-1 und ICAM-1, die sowohl von luminalen, als auch von neovaskulären Endothelzellen exprimiert werden, vermitteln die Adhäsion von Leukozyten, die so durch die Endothel-Barriere hindurch an den Entzündungsort migrieren können. Peroxisome Proliferator-Activated Receptors (PPARs) sind ligand-aktivierte Kernrezeptoren, die als Transkriptionsfaktoren hauptsächlich an der Genregulation im Fett- und Glukosestoffwechsel beteiligt sind und zudem Wirkungen im kardiovaskulären System haben. In der vorliegenden Arbeit wurden die Effekte der PPAR-alpha-Liganden WY-14,643 und Fenofibrat und der PPAR-gamma-Liganden Troglitazon und Ciglitazon auf die Migration von Endothelzellen sowie die Beeinflussung der dabei involvierten Komponenten der Signaltransduktion und die Wirkung der PPAR-Liganden auf die Expression der endothelialen ...
Studies suggested that your genes determine up to 80% of your weight and body shape. A new genetic test may help pinpoint those genes that inappropriately metabolize certain nutrients and lead dieters toward the best weight loss program to reach a healthy body weight.. Interleukin Genetics Inc presented their research Wednesday at the American Heart Association meeting, conducted at Stanford University in California. The small study included about 140 overweight or obese women who were assigned to certain diets based upon testing for certain mutations in three genes, FABP2, PPARG, and ADRB2. The DNA was collected using a simple cheek swab.. The FABP2 gene, which stands for Fatty Acid Binding Protein 2, affects the absorption of fat from the intestine. People with a mutation in this gene absorb more fat from their food, and should stick to low-fat diets. The PPARG (Peroxisome Proliferators Activated Receptor Gamma) gene affects insulin response. Those with a defect on this gene store more ...
Glass, C.K. (2001) Potential roles of the peroxisome proliferator-activated receptorγ in macrophage biology and atherosclerosis. Journal of Endo-crinology, 169, 461-464. doi10.1677/joe.0.1690461
BioAssay record AID 156127 submitted by ChEMBL: Transactivation of human Peroxisome proliferator activated receptor alpha expressed in CHO-K1 cells.
Thus given the great expense and difficulty of plutonium extraction from used reactor fuel, which Makhijan himself outlines, the reliability problems associated with RGP weapons, and the questionable yield, even if such a weapon worked at all, would be nuclear proliferators are likely to prefer lower cost, more predictable and reliable nuclear options. South Afriuica demonstrated in the 1970s and 80s that a low cost uranium enrichment program was possible, and could lead to the development of of reliable and predictable nuclear weapons. The successful South African proliferation model, as well as those followed by Pakistan and North Korea, suggest that focus on plutonium in used nuclear fuel as a proliferation too is highly misguided. Rather than focusing on the unlikely proliferation path that plutonium isotopes in used nuclear fuel provide, proliferation prevention efforts should focus on successful proliferation paths that are already in place. if we are incapable of stopping proliferation ...
Thank you for your interest in spreading the word on Hypertension.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
These reference sequences exist independently of genome builds. Explain. These reference sequences are curated independently of the genome annotation cycle, so their versions may not match the RefSeq versions in the current genome build. Identify version mismatches by comparing the version of the RefSeq in this section to the one reported in Genomic regions, transcripts, and products above. ...
Thank you for your interest in spreading the word on Arteriosclerosis, Thrombosis, and Vascular Biology.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
Background & Aims: It has been shown that some drugs such as Pentoxifylline (PTX) have immunomodulatory and anti-inflammatory activity that might represent a potential preventive therapy for autoimmune diseases. The purpose of this study was to investigate the therapeutic effects of pentoxifylline on the treatment of autoimmune diabetes in mice and ...
GW 590735, a peroxisome proliferator activated receptor (PPAR) alpha agonist, was in development with GlaxoSmithKline and Ligand Pharmaceuticals for the
This page provides useful content and local businesses that can help with your search for Alzheimers Medication. You will find helpful, informative articles about Alzheimers Medication, including Anti-Hypertensive Drugs May Help Prevent and Treat Alzheimers Disease. You will also find local businesses that provide the products or services that you are looking for. Please scroll down to find the local resources in Laramie, WY that will answer all of your questions about Alzheimers Medication.
This page provides relevant content and local businesses that can help with your search for information on Ptosis Treatment. You will find informative articles about Ptosis Treatment, including Drooping Eyelids. Below you will also find local businesses that may provide the products or services you are looking for. Please scroll down to find the local resources in Laramie, WY that can help answer your questions about Ptosis Treatment.
Hego Amerika Amerikaren azpikontinente bat da, 17.870.218 km² luze-zabal. Hego hemisferioan dago kokaturik parte handiena. Wy/eu/Ozeano Barea eta Wy/eu/Ozeano Atlantikoaren artean kokaturik dago. XVI. mendetik XIX. mendera, Wy/eu/Espainia eta Wy/eu/Portugalen menpe zegoen Hego Amerika guztia.. ...
Looking for Breast Pumps in Sheridan? We have compiled a list of businesses and services around Sheridan that should help you with your search. We hope this page helps you find Breast Pumps in Sheridan.
2F4B: Indol-1-yl Acetic Acids as Peroxisome Proliferator-Activated Receptor Agonists: Design, Synthesis, Structural Biology, and Molecular Docking Studies
KROMOSOM Kromosom manusia merupakan struktur kompleks yang terdiri dari asam deoksiribonukleat - DNA dan asam ribonukleat - RNA serta protein. Setiap helix tunggal DNA terikat dengan telomer pada masing masing ujungnya, dan memiliki sentromer disuatu tempat sepanjang kromosom. Telomer melindungi ujung kromosom selama replikasi DNA. Pemendekan telomer berhubungan dengan penuaan ...
pep:known chromosome:VEGA66:15:85735564:85802163:1 gene:OTTMUSG00000023590 transcript:OTTMUST00000057582 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Ppara description:peroxisome proliferator activated receptor alpha ...
Abcam provides specific protocols for Anti-Catalase antibody [12C2DB9] - Peroxisome Marker (ab110292) : Flow cytometry protocols, Immunoprecipitation…
Researchers from the University of Albertas Faculty of Medicine and Dentistry have discovered a link between flaviviruses and peroxisome production.
mapping. Gene Expr. 4:28l-299 ( l 995). ll. JD Tugwood. l. lsseman. RG Anderson. KR Bundell, WL Mepheat and S. Green. The mouse peroxisome proliferator activated receptor recognizes a response element in the 5-flanking sequence of the rat acyl CoA oxidase gene. EMBOJ. ll : 433-439 (l992). l2. B. Zhang. SL ...
5 Healthcare jobs available in Evanston, WY. See salaries, compare reviews, easily apply, and get hired. New Healthcare careers in Evanston, WY are added daily on SimplyHired.com. The low-stress way to find your next Healthcare job opportunity is on Simply Hired. There are over 5 Healthcare careers in Evanston, WY waiting for you to apply!
Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Internacjonalizacja studiów wyższych Redakcja Waldemar Martyniuk Fundacja
Welcome to the Himsitry Local Pages. Here you will find local information about Mens Grooming Products in Cheyenne, WY and other products that may be of interest to you. In addition to a number of relevant products you can purchase online, we have compiled a list of businesses and services around Cheyenne, including Cosmetic Retailers, Department Stores, and Pharmacies & Drug Stores that should help with your local search. Before you take a look at the local resources, please browse through our competitively priced products that you could order from the comfort of your own home. We hope this page satisfies your local needs.
Find an Asthma Specialist in Laramie, WY 82072. Asthma Specialist reviews, phone number, address and map. Find the best Allergy Specialist in Laramie, WY 82072
Catalase兔单克隆抗体可与小鼠, 人样本反应并经WB, IHC, ICC, Flow Cyt实验严格验证,被2篇文献引用。所有产品均提供质保服务,中国75%以上现货。
At Ramada by Wyndham Laramie, our welcoming atmosphere and convenient amenities, such as free WiFi, offer an ideal stay in Laramie, WY.
Save $7,556 on a 2003 Ford Mustang. Search over 36,400 listings to find the best Cheyenne, WY deals. CarGurus analyzes over 6 million cars daily.
Visit Ahmad Alqaqaa, MD at 2301 House Avenue, Cheyenne, WY. Cheyenne Regional Medical Group offers convenient, compassionate care for Southeast Wyoming, Northern Colorado and Western Nebraska.
Home for Sale: 3,250 sq. ft., 2 full bath house located at 129 Avenue C, Rock River, WY 82083 on sale for $110,000. MLS# N/A. LITERALLY ~~ HERE IS YOUR
Looking for SPECTRUM Picolylamine,250g (26WY86)? Graingers got your back. Price:$564.00. Easy ordering & convenient delivery. Log-in or register for your pricing.
Find the best Glass Coating, Casper, WY around and get detailed driving directions with road conditions, live traffic updates, and reviews of local business along the way.
View local Mountain View, WY prices for the 2017 Nissan JUKE on TrueCar. The average price paid for a 2017 JUKE in Mountain View is $18,634. Get a price quote on a new JUKE today!
Tytu patentu: Spos b wytwarzania estr w etylowych wy szych kwas w t uszczowych przeznaczonych zw aszcza na biopaliwo do silnik w z zap onem samoczynnym. ...
Jeśli jesteś właścicielem tej strony, możesz wyłączyć reklamę poniżej zmieniając pakiet na PRO lub VIP w panelu naszego hostingu już od 4zł ...
Jeśli jesteś właścicielem tej strony, możesz wyłączyć reklamę poniżej zmieniając pakiet na PRO lub VIP w panelu naszego hostingu już od 4zł ...
Algonquin Park Region, Ontario: Serwis TripAdvisor oferuje 12 015 bezstronnych recenzji i artykułów - najlepsze źródło informacji gdy planujesz podróż na wakacje, rezerwacje, wczasy i rekreację, wyżywienie i pobyt w tym miejscu.
Targeting 3-phosphoinositide-dependent protein kinase 1 by N-acetyl-cysteine through activation of peroxisome proliferators...  Targeting 3-phosphoinositide-dependent protein kinase 1 by N-acetyl-cysteine through activation of peroxisome proliferators...
... p65 protein expression in a dose-dependent manner (Figure 4B). Note that NAC had no effect on p50 protein (Figure 4B). ... protein kinase-1 regulates proliferation and survival of cancer cells with an activated mitogen-activated protein kinase ... As shown in Figure 2A-B, NAC induced PPARα protein expression in a dose- and time-dependent manner with a maximal induction ... Cells exposed to NAC resulted in significant decrease in PDK1 protein expression in a dose- and time-dependent manner with ...
more infohttps://jeccr.biomedcentral.com/articles/10.1186/1756-9966-32-43
The Phosphatase Src Homology Region 2 Domain-Containing Phosphatase-1 Is an Intrinsic Central Regulator of Dendritic Cell...  The Phosphatase Src Homology Region 2 Domain-Containing Phosphatase-1 Is an Intrinsic Central Regulator of Dendritic Cell...
Protein-tyrosine phosphatase Shp-1 is a negative regulator of IL-4- and IL-13-dependent signal transduction. J. Biol. Chem. 273 ... Src family protein-tyrosine kinases alter the function of PTEN to regulate phosphatidylinositol 3-kinase/AKT cascades. J. Biol ... Functionally, the ability of SHP-1 to inhibit CCR7 signaling and protein upregulation resulted in reduced CCL21-dependent BMDC ... Downstream of TLR4, SHP-1 showed increased interaction with several proteins including IL-1R-associated kinase-4, and modulated ...
more infohttp://www.jimmunol.org/content/186/7/3934.full
RCSB PDB 









- 1OKZ: Structure of human PDK1 kinase domain in complex with UCN-01 Macromolecule Annotations Page  RCSB PDB - 1OKZ: Structure of human PDK1 kinase domain in complex with UCN-01 Macromolecule Annotations Page
Alpha and beta proteins (a+b) Protein kinase-like (PK-like) Protein kinase-like (PK-like) Protein kinases, catalytic subunit 3- ... phosphoinositide dependent protein kinase- 1 Pdk1 Human (Homo sapiens) [TaxId: 9606] Domain Annotation: CATH CATH Database ( ... Protein Family Annotation Pfam Database Homepage. Chains. Pfam Accession. Pfam Identifier. Pfam Description. Type. Source. ...
more infohttp://www.rcsb.org/pdb/explore/derivedData.do?structureId=1OKZ
KEGG PATHWAY: Insulin signaling pathway - Danio rerio (zebrafish)  KEGG PATHWAY: Insulin signaling pathway - Danio rerio (zebrafish)
GRB2 is part of the cascade including SOS, RAS, RAF and MEK that leads to activation of mitogen-activated protein kinase (MAPK ... by the insulin receptor tyrosine kinase (INSR). This allows association of IRSs with the regulatory subunit of phosphoinositide ... Akt also leads to mTOR-mediated activation of protein synthesis by eIF4 and p70S6K. The translocation of GLUT4 protein is also ... a serine kinase. Akt in turn deactivates glycogen synthase kinase 3 (GSK-3), leading to activation of glycogen synthase (GYS) ...
more infohttp://www.genome.jp/kegg-bin/show_pathway?dre04910+406339
Difference between revisions of User:Etienne Robillard/Notebook/DFP - OpenWetWare  Difference between revisions of "User:Etienne Robillard/Notebook/DFP" - OpenWetWare
Turning a protein kinase on or off from a single allosteric site via disulfide trapping ... Reaction is catalyzed by the Organo-Phosphate Hydrolase enzyme, thus a (Mg)ATP-dependent ligase. See related DOIs above. ... Turning a protein kinase on or off from a single allosteric site via disulfide trapping]. ... Reaction is catalyzed by the Organo-Phosphate Hydrolase enzyme, thus a (Mg)ATP-dependent ligase. See related DOIs above. ...
more infohttps://openwetware.org/wiki/?title=User:Etienne_Robillard/Notebook/OPH&diff=752593&oldid=662421
Plus it  Plus it
The results of the inquiry reveal an unanticipated mechanism of action of 3-phosphoinositide-dependent protein kinase 1 (PDK1) ...
more infohttp://mcr.aacrjournals.org/content/14/1_Supplement/B13
From the Cyclooxygenase-2 Inhibitor Celecoxib to a Novel Class of 3-Phosphoinositide-Dependent Protein Kinase-1 Inhibitors |...  From the Cyclooxygenase-2 Inhibitor Celecoxib to a Novel Class of 3-Phosphoinositide-Dependent Protein Kinase-1 Inhibitors |...
... kinase (e.g., LY294002; Ref. 27 ), protein kinase C (staurosporine; Ref. 28 ), cyclin-dependent kinases (29) , and vascular ... Tsichlis PN AKT/PKB and other D3 phosphoinositide-regulated kinases: kinase activation by phosphoinositide-dependent ... phosphoinositide-dependent protein kinase-1. J Biol Chem, 275: 40400-6, 2000. ... phosphoinositide-dependent kinase-1 (PDK-1) in PI 3- kinase signaling. Front Biosci, 7: d886-902, 2002. ...
more infohttps://cancerres.aacrjournals.org/content/64/12/4309?ijkey=a99415953fe3d0f230442ab81bf0342033226b11&keytype2=tf_ipsecsha
From the Cyclooxygenase-2 Inhibitor Celecoxib to a Novel Class of 3-Phosphoinositide-Dependent Protein Kinase-1 Inhibitors |...  From the Cyclooxygenase-2 Inhibitor Celecoxib to a Novel Class of 3-Phosphoinositide-Dependent Protein Kinase-1 Inhibitors |...
... kinase (e.g., LY294002; Ref. 27 ), protein kinase C (staurosporine; Ref. 28 ), cyclin-dependent kinases (29) , and vascular ... Tsichlis PN AKT/PKB and other D3 phosphoinositide-regulated kinases: kinase activation by phosphoinositide-dependent ... phosphoinositide-dependent protein kinase-1. J Biol Chem, 275: 40400-6, 2000. ... phosphoinositide-dependent kinase-1 (PDK-1) in PI 3- kinase signaling. Front Biosci, 7: d886-902, 2002. ...
more infohttps://cancerres.aacrjournals.org/content/64/12/4309?ijkey=790b00c4787a6cb1373bc265d0a0b9963280d9c1&keytype2=tf_ipsecsha
Activation of protein kinase B β and γ isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in...  Activation of protein kinase B β and γ isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in...
Activation of protein kinase B β and γ isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in ... comparison with protein kinase B α. Kay S. WALKER, Maria DEAK, Andrew PATERSON, Kevin HUDSON, Philip COHEN, Dario R. ALESSI ... Activation of protein kinase B β and γ isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in ... Activation of protein kinase B β and γ isoforms by insulin in vivo and by 3-phosphoinositide-dependent protein kinase-1 in ...
more infohttp://www.biochemj.org/content/331/1/299
2PE1: Crystal Structure Of Human Phosphoinositide-Dependent Protein Kinase 1 (Pdk1) {2-Oxo-3-[1-(1h-Pyrrol-2-Yl)-Eth-(Z)...  2PE1: Crystal Structure Of Human Phosphoinositide-Dependent Protein Kinase 1 (Pdk1) {2-Oxo-3-[1-(1h-Pyrrol-2-Yl)-Eth-(Z)...
3-PHOSPHOINOSITIDE-DEPENDENT PROTEIN KINASE 11-{2-Oxo-3-[(1r)-1-(1h-Pyrrol-2-Yl)ethyl]-2h-Indol-5-Yl}ureaGlycerin; Propane-1,2, ... 2PE1: Crystal Structure Of Human Phosphoinositide-Dependent Protein Kinase 1 (Pdk1) {2-Oxo-3-[1-(1h-Pyrrol-2-Yl)-Eth-(Z)- ... 1-{2-Oxo-3-[(1r)-1-(1h-Pyrrol-2-Yl)ethyl]-2h-Indol-5-Yl}urea. ... Ylidene]-2,3-Dihydro-1h- Indol-5-Yl}-Urea {bx-517} Complex. ...
more infohttps://www.ncbi.nlm.nih.gov/Structure/pdb/2PE1
Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle...  Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle...
Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle ... Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle ... Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle ... Normal insulin-dependent activation of Akt/protein kinase B, with diminished activation of phosphoinositide 3-kinase, in muscle ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/10491408?access_num=10491408&link_type=MED&dopt=Abstract
3-phosphoinositide dependent protein kinase 1 | PDK1 family | IUPHAR Guide to IMMUNOPHARMACOLOGY  3-phosphoinositide dependent protein kinase 1 | PDK1 family | IUPHAR Guide to IMMUNOPHARMACOLOGY
3-phosphoinositide dependent protein kinase 1 - PDK1 family. Detailed annotation on the structure, function, physiology, ... Phosphoinositide-dependent protein kinase 1 (PDK1) mediates potent inhibitory effects on eosinophils. Eur. J. Immunol., 45 (5 ... PkB kinase , protein kinase B kinase , 3-phosphoinositide dependent protein kinase-1 ... 2010) Molecular pharmacology and antitumor activity of PHT-427, a novel Akt/phosphatidylinositide-dependent protein kinase 1 ...
more infohttp://guidetoimmunopharmacology.org/GRAC/ObjectDisplayForward?objectId=1519
3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) promotes invasion and activation of matrix metalloproteinases | BMC Cancer...  3-Phosphoinositide-dependent Protein Kinase-1 (PDK1) promotes invasion and activation of matrix metalloproteinases | BMC Cancer...
PDK1 mediates its effect in part by MT1-MMP induction, which in turn activates MMP-2 and modulates the ECM proteins decorin and ... We now present evidence showing that PDK1-expressing cells exhibit enhanced anchorage-dependent and -independent cell growth ... Filippa N, Sable CL, Hemmings BA, Van Obberghen E: Effect of phosphoinositide-dependent kinase 1 on protein kinase B ... Dutil EM, Toker A, Newton AC: Regulation of conventional protein kinase C isozymes by phosphoinositide-dependent kinase 1 (PDK- ...
more infohttps://bmccancer.biomedcentral.com/articles/10.1186/1471-2407-6-77
Table of Contents - October 26, 2010, 3 (145) | Science Signaling  Table of Contents - October 26, 2010, 3 (145) | Science Signaling
The protein kinase ATM is a sensor for reactive oxygen species.. *Abstract ... Online Cover This week features a Research Article that identifies ARAP3 as the downstream effector of phosphoinositide 3- ... Intrinsic differences in mTORC2-dependent Akt activation underlie the region-specific effects of neurofibromatosis-1 on glial ... Membrane fusion proteins cooperate to promote rapid secretory vesicle exocytosis from neuroendocrine cells. ...
more infohttp://stke.sciencemag.org/content/3/145
Sodium Antimony Gluconate Induces Generation of Reactive Oxygen Species and Nitric Oxide via Phosphoinositide 3-Kinase and...  Sodium Antimony Gluconate Induces Generation of Reactive Oxygen Species and Nitric Oxide via Phosphoinositide 3-Kinase and...
... which might contribute to dysregulation of protein tyrosine kinase-dependent signaling events and Mφ deactivation (44). SHP1 ... protein kinase C, and Ras activation and p38 mitogen-activated protein kinase (MAPK) phosphorylation through PI3K and Akt ... protein kinase C (PKC), and mitogen-activated protein kinases (MAPKs) coupled with the activation of the microbicidal mechanism ... Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281:2042-2045. ...
more infohttps://aac.asm.org/content/50/5/1788?ijkey=c4996544d1d85e8a3e59547d160c496107e33690&keytype2=tf_ipsecsha
Ptk2b - Protein-tyrosine kinase 2-beta - Mus musculus (Mouse) - Ptk2b gene & protein  Ptk2b - Protein-tyrosine kinase 2-beta - Mus musculus (Mouse) - Ptk2b gene & protein
Promotes activation of the MAP kinase signaling cascade, including activation of MAPK1/ERK2, MAPK3/ERK1 and MAPK8/JNK1. ... Functions in signaling downstream of integrin and collagen receptors, immune receptors, G-protein coupled receptors (GPCR), ... Phosphorylates SRC; this increases SRC kinase activity. Phosphorylates ASAP1, NPHP1, KCNA2 and SHC1. Promotes phosphorylation ... creating binding sites for scaffold proteins, effectors and substrates. Regulates numerous signaling pathways. Promotes ...
more infohttp://www.uniprot.org/uniprot/Q9QVP9
Background Neutrophils are key-players in the innate host defense and their - Aurora Kinases as Druggable Targets in Cancer...  Background Neutrophils are key-players in the innate host defense and their - Aurora Kinases as Druggable Targets in Cancer...
... belongs to the family of NLR proteins. Upon activation NALP3 assembles with the adaptor protein ASC to form a protein-complex ... operates in cells in response to phosphoinositide 3-kinase activation and phosphatidylinositol-3,4,5-trisphosphate [PtdIns(3,4, ... Aurora Kinases as Druggable Targets in Cancer Therapy » GLAST Menu Not Found. Skip to content *Home ... 3-Phosphoinositide-dependent protein kinase 1 (PDK1) operates in cells in response to. 3-Phosphoinositide-dependent protein ...
more infohttp://www.exposed-skin-care.net/2016/07/05/background-neutrophils-are-key-players-in-the-innate-host-defense-and-their/
Phospho-threonine [T258] protein kinase interferon-inducible double stranded RNA dependent (PRKR) polyclonal antibody - Allele...  Phospho-threonine [T258] protein kinase interferon-inducible double stranded RNA dependent (PRKR) polyclonal antibody - Allele...
Fluorescent Proteins, RNAi, Viral Packaging and Protein expression. ... Phospho-threonine [T258] protein kinase interferon-inducible double stranded RNA dependent (PRKR) polyclonal antibody. Orbigen ... Phospho-threonine [T414] protein kinase interferon-inducible double stranded RNA dependent (Prkr) polyclonal antibody $210.00 ... Phospho-threonine [T414] protein kinase interferon-inducible double stranded RNA dependent (Prkr) polyclonal antibody $210.00 ...
more infohttp://www.allelebiotech.com/phospho-threonine-t258-protein-kinase-interferon-inducible-double-stranded-rna-dependent-prkr-polyclonal-antibody/
Gene Expression Literature Detail  Gene Expression Literature Detail
2003 May;3(2):173-7 Detailed expression data for these assays: 27 results Indicates gene expression was analyzed but not ...
more infohttp://www.informatics.jax.org/gxdlit/key/31280
Three-amino-acid-loop-extension homeodomain factor Meis3 regulates cell survival via PDK1.  Three-amino-acid-loop-extension homeodomain factor Meis3 regulates cell survival via PDK1.
... homeodomain proteins including Meis and Pbx families are generally recognized for their roles in growth and differentiation ... Protein-Serine-Threonine Kinases / genetics, metabolism*. RNA, Small Interfering / genetics. Reverse Transcriptase Polymerase ... 11746767 - Progesterone and the oligodendroglial lineage: stage-dependent biosynthesis and metabol.... Publication Detail: Type ... 0/DNA Primers; 0/Homeodomain Proteins; 0/Meis3 protein, mouse; 0/RNA, Small Interfering; 0/Transcription Factors; EC 2.7.1.-/3- ...
more infohttp://www.biomedsearch.com/nih/Three-amino-acid-loop-extension/21059917.html
  • While PPARα ligand enhanced, PPARα antagonist and siRNA abrogated the effect of NAC on PDK1 promoter activity, protein expression and cell growth. (biomedcentral.com)
  • Silencing of p53 and overexpression of p65 blocked the effect of NAC on PDK1 promoter activity and protein expression. (biomedcentral.com)
  • Our results show that NAC inhibits PDK1 expression through PPARα-mediated induction of p53 and inhibition of p65 protein expression. (biomedcentral.com)
  • a and d ) Akt kinase activity was measured in muscle lysates (500 μg) that were subjected to immunoprecipitation with either an antibody that recognizes both Akt1 and Akt2, or an Akt3 antibody. (nih.gov)
  • Functions in signaling downstream of integrin and collagen receptors, immune receptors, G-protein coupled receptors (GPCR), cytokine, chemokine and growth factor receptors, and mediates responses to cellular stress. (uniprot.org)
  • Note that the 'protein existence' evidence does not give information on the accuracy or correctness of the sequence(s) displayed. (uniprot.org)
  • The regulatory and catalytic properties of the three mammalian isoforms of protein kinase B (PKB) have been compared. (biochemj.org)
  • SIRT1 (silent information regulator 1), a member of mammalian sirtuin family protein (SIRT1-SIRT7), functions as a conserved nicotinamide adenine dinucleotide (NAD)+-dependent deacetylase to implicate in the modulation of transcriptional silencing and cell survival. (springer.com)
  • These receptors are heteromeric protein complexes with multiple subunits, each possessing transmembrane regions, and all arranged to form a ligand-gated ion channel. (antibodies-online.com)
  • The guanosine triphosphatase-activating protein ARAP3 may be a target for antiangiogenic therapies. (sciencemag.org)
  • The encoded protein is a nuclear phosphoprotein that binds and inhibits transactivation by tumor protein p53, as part of an autoregulatory negative feedback loop. (antibodies-online.com)
  • Expect a band ~60 kDa in size corresponding to human PDK-1 protein by western blotting in the appropriate cell lysate or extract. (novusbio.com)