The 5′ flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5′ flanking region contains the ... Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... 5′ flanking regions are categorized between prokaryotes and eukaryotes. In eukaryotes, the 5′ flanking region has a complex set ... flanking region of the insulin gene have been associated with type 2 diabetes. Polymorphisms in the 5′ flanking region of the ...
... flanking region of the human aortic smooth muscle actin gene". Nucleic Acids Research. 18 (5): 1318. doi:10.1093/nar/18.5.1318 ... Analysis of a cDNA and 5' upstream region". The Journal of Biological Chemistry. 265 (3): 1683-7. doi:10.1016/S0021-9258(19) ... upstream and first intron regions of the human smooth muscle (aortic type) alpha-actin-encoding gene". Gene. 99 (2): 285-9. doi ... 99 ( Pt 3) (3): 627-36. doi:10.1242/jcs.99.3.627. PMID 1939373. Ueyama H, Ohsugi R (March 1990). "TaqI polymorphism in the 3' ...
... flanking region of the human uncoupling protein 3 (UCP3) gene". Biochemical and Biophysical Research Communications. 258 (2): ... Mitochondrial uncoupling protein 3 is a protein that in humans is encoded by the UCP3 gene. The gene is located in chromosome ( ... 86 (3): 372-5. doi:10.1038/sj.bjc.6600074. PMC 2375209. PMID 11875702. Hu X, Murphy F, Karwautz A, Li T, Freeman B, Franklin D ... 47 (3): 425-6. doi:10.1006/geno.1997.5135. PMID 9480760. Vidal-Puig A, Solanes G, Grujic D, Flier JS, Lowell BB (June 1997). " ...
... flanking region of this gene allows glucocorticoids to induce expression of RASD1. This protein is a small GTPase belonging to ... flanking region of the human Dexras1 gene". Biochimica et Biophysica Acta. 1627 (2-3): 85-9. doi:10.1016/s0167-4781(03)00079-4 ... As a GTPase, RASD1 also shares motifs, such as in the regions G-1 to G-3, with other GTPases. The full-length RASD1 cDNA ... the phosphate/magnesium binding regions GXXXXGK(S/T) (domain Σ1), DXXG (domain Σ2), and the guanine base binding loops NKXD ( ...
... flanking region with the interaction of the miR-200c family of micro-RNA. MiR-200c is in turn modulated by the protein HuR ( ... flanking region". Gene. 409 (1-2): 100-8. doi:10.1016/j.gene.2007.11.015. PMID 18178340. Raspaglio G, De Maria I, Filippetti F ... flanking region at +168 nucleotides. This site binds basic helix-loop-helix (bHLH) hypoxia induced transcription factors Hif-1α ... and class III β-tubulin are limited to only 13aa within region 1-429aa, while all amino acids in region 430-450aa are divergent ...
Primers bound to the regions flanking the target DNA provide 3'-hydroxyl groups for DNA polymerase catalyzed extension. The ... This means that each newly synthesized strand of DNA will have a region complementary to a primer. There is an exponential ... terminal region (5'-NTR) as well as a 3'-poly-A tail. The positive sense genome contains a single extended open reading frame ... terminal region of potato virus YN RNA. J. Gen. Virol., 70: 229-233. Dallaire, B.J., Charest, P.J., Devantier., Y. and ...
... nontranslated region, and localization of gene to chromosome 15". Journal of Experimental Pathology. 3 (1): 1-17. PMID 3681487 ... The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. CYP1A2 also ... 8 (3): 305-313. doi:10.1111/1753-0407.12358. PMID 26621325. Wagner K, Vito S, Inceoglu B, Hammock BD (October 2014). "The role ... doi:10.1210/mend-3-9-1399. PMID 2575218. Butler MA, Iwasaki M, Guengerich FP, Kadlubar FF (October 1989). "Human cytochrome P- ...
Shimizu T, Kobayashi T, Ba-Thein W, Ohtani K, Hayashi H (1995). "Sequence analysis of flanking regions of the pfoA gene of ... flanking region". Microbiology and Immunology. 39 (9): 677-86. doi:10.1111/j.1348-0421.1995.tb03256.x. PMID 8577281. S2CID ... 3 (9): 853-9. doi:10.1016/S0969-2126(01)00220-9. PMID 8535779. Henrissat B, Bairoch A (June 1996). "Updating the sequence-based ... Clostridium perfringens: beta-galactosidase gene (pbg) is located in the 3'- ...
A search of NSCL/P cases for potential regulatory elements for IRF6 gene was made aligning genomic sequences to a 500 Kb region ... flanking IRF6 were screened by direct sequencing for potential causative variants in 184 NSCL/P cases. The rare allele of the ... Sequencing of candidate genes in that region in 4 additional unrelated BOFS patients revealed 4 different de novo missense ... Human sequence as reference and searched for multispecies conserved sequences (MCSs). Regions contained in introns 5' and 3' ...
... flanking regions of the NADH-dependent hydroxypyruvate reductase gene from Cucumis sativus L". Plant Molecular Biology. 28 (5 ... 103 (3): 933-941. doi:10.1104/pp.103.3.933. PMC 159066. PMID 8022942. Sloan, J. S.; B. W. Schwartz; W. M. Becker (1993). " ... 3 (6): 867-874. doi:10.1111/j.1365-313X.1993.00867.x. "Wayne Becker , Fulbright Scholar Program". "Professor Wayne M. Becker". ... Daniel, S.G.; W.M. Becker (1995). "Transgenic analysis of the 5' and 3'- ...
2000). "Characterization of the 5'-flanking and 5'-untranslated regions of the cyclic adenosine 3',5'-monophosphate-responsive ... untranslated region of human type 2 iodothyronine deiodinase mRNA contains a functional selenocysteine insertion sequence ... The 3' UTR of Sec-containing genes have a common stem-loop structure, the Sec insertion sequence (SECIS), which is necessary ... 144 (3): 937-946. doi:10.1210/en.2002-220960. PMID 12586771. Ambroziak M, Pachucki J, Chojnowski K, et al. (2003). "Pax-8 ...
... flanking region of the human ABO-secretor gene (FUT2) and association between FUT2 and FUT2/01 loci". Hum. Biol. 76 (5): 789-95 ... 1995). "Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H ... 34 (3): 314-8. PMID 15487706. Pang H, Soejima M, Koda Y, Kimura H (2005). "A novel tetrameric short tandem repeat located in ... 246 (3): 750-5. doi:10.1111/j.1432-1033.1997.t01-1-00750.x. PMID 9219535. Koda Y; Soejima M; Johnson PH; et al. (1997). " ...
The 5′-flanking region of a gene often denotes a region of DNA which is not transcribed into RNA. The 5′-flanking region ... flanking region is a region of DNA that is not copied into the mature mRNA, but which is present adjacent to 3′-end of the gene ... The 5′-untranslated region (5′-UTR) is a region of a gene which is transcribed into mRNA, and is located at the 5′-end of the ... flanking region often contains sequences that affect the formation of the 3′-end of the message. It may also contain enhancers ...
... flanking region of the beta-globin gene. The CoTC core is highly conserved in the 3' UTR of other primate beta-globin genes. ... The CoTC process in the human beta-globin gene was proposed to involve an RNA self-cleaving activity located in the 3' ...
... flanking region MeSH G14.340.024.340.137.295 - 5' flanking region MeSH G14.340.024.340.137.430 - immunoglobulin switch region ... flanking region MeSH G14.340.024.220.282 - 5' flanking region MeSH G14.340.024.220.400 - introns MeSH G14.340.024.220.760 - ... locus control region MeSH G14.080.689.650 - operator regions (genetics) MeSH G14.080.689.675 - promoter regions (genetics) MeSH ... locus control region MeSH G14.340.024.630 - nucleolus organizer region MeSH G14.340.024.686 - operon MeSH G14.340.024.686.545 ...
... flanking region and morning/evening preference in adults found a correlation between subjects with the 3111C allele and ... This region is well conserved between mice and humans and polymorphisms have been shown to affect mRNA stability, indicating ... It was found that in women with breast cancer, there was significantly less methylation of the Clock promoter region. It was ... Polymorphisms in the gene mainly affect the length of the PolyQ domain region, providing an example of divergent evolution ...
... flanking region - 3-hydroxy-2-methylpyridinecarboxylate dioxygenase - 3-Ketosteroid 9alpha-monooxygenase - 3-oxoacyl-(acyl- ... flanking region - 5-pyridoxate dioxygenase - 6-endo-hydroxycineole dehydrogenase - 7-deoxyloganin 7-hydroxylase - 7beta- ... beta-carotene 3-hydroxylase - beta-cyclopiazonate dehydrogenase - beta-glucan-transporting ATPase - beta2-adaptin C-terminal ... juglone 3-monooxygenase - junk DNA - k+-transporting ATPase - karyotype - KduI/IolB isomerase family - kilobase - kinase - ...
Only the region between the start and stop codons encodes the final protein product. The flanking untranslated regions (UTRs) ... Indeed, the intron regions of a gene can be considerably longer than the exon regions. Once spliced together, the exons form a ... These sequence regions can either be next to the transcribed region (the promoter) or separated by many kilobases (enhancers ... Exon regions are retained in the final mature mRNA molecule, while intron regions are spliced out (excised) during post- ...
The SARS-CoV genome is ~29.7 kb long and contains 14 open reading frames (ORFs) flanked by 5′ and 3′-untranslated regions of ... 19 (3): 141-154. doi:10.1038/s41579-020-00459-7. PMC 7537588. PMID 33024307. Zhou H, Ji J, Chen X, Bi Y, Li J, Wang Q, et al. ( ... 35 (3): 1313-1326. doi:10.21873/invivo.12384. PMC 8193286. PMID 33910809. Lu R, Zhao X, Li J, Niu P, Yang B, Wu H; et al. (2020 ... 8 (3: The COVID Crisis and Cultural Sociology: Alone Together): 451-461. doi:10.1057/s41290-020-00118-7. eISSN 2049-7121. ISSN ...
The form Reinders is more common in the Eastern Netherlands and the flanking regions of Germany.[3] The Dutch given name ...
Additionally, flanking regions outside this immunostimulatory hexamer must be guanine-rich to ensure binding and uptake into ... Accessory regions pertaining to the plasmid backbone may engage in a wide range of structural instability phenomena. Well-known ... Because these proteins contain regions of amino acid sequences that are characteristic of bacteria or viruses, they are ... The optimal immunostimulatory sequence is an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines. ...
... interacts with the extreme C-terminal region of connectin, a unique region flanked by two immunoglobulin C2 motifs". Arch. ... Calpain-3 is a protein that in humans is encoded by the CAPN3 gene. Calpain, a heterodimer consisting of a large and a small ... Huang Y, de Morrée A, van Remoortere A, Bushby K, Frants RR, den Dunnen JT, van der Maarel SM (2008). "Calpain 3 is a modulator ... 61 (1): 231-3. doi:10.1016/S0002-9297(07)64296-7. PMC 1715865. PMID 9246005. Dinçer P, Leturcq F, Richard I, Piccolo F, ...
Helens, which had a volume of 0.24 cu mi (1.0 km3). The region on the volcano's northeastern flank destroyed by the eruptions, ... Within the region, most if not all of the volcanic rock has erupted in the past 3 million years. During this period, at least ... No lava erupted, but parts of the dome fell on the upper flanks of the mountain, which were covered in more than 30 ft (9.1 m) ... The region is also affected geologically by the Cascadia subduction zone, which dips eastward beneath the western coast of ...
There is a non coding regions: the 5′ region of 40 nt and the 3region of 137 nt. This open reading frame encodes several ... The M segment RNA is 4,818 nucleotides in length and contains one open reading frame flanked by 5′ and 3′ non coding regions of ... It contains a unique potential N-gly site in the Gn and Gc glycoprotein regions at amino acids 612 and 1514 respectively. The S ... noncoding regions are 49 nt and 193 nt in length respectively. "Virus Taxonomy: 2020 Release". International Committee on ...
... flanking region". Journal of Biochemistry. 101 (3): 591-9. doi:10.1093/jb/101.3.591. PMID 3648024. Kawashima I, Tani T, Mita- ... 44 (1): 210-3. doi:10.1023/A:1026691209094. PMID 9952246. S2CID 1137506. Borowitz D, Baker SS, Duffy L, Baker RD, Fitzpatrick L ... 44 (1): 210-3. doi:10.1023/A:1026691209094. PMID 9952246. S2CID 1137506. Gullo L, Ventrucci M, Tomassetti P, Migliori M, ... 145 (3): 322-6. doi:10.1016/j.jpeds.2004.04.049. PMID 15343184. Edelstein C, Italia JA, Scanu AM (April 1997). " ...
Mizui Y, Yamazaki K, Kuboi Y, Sagane K, Tanaka I (Sep 2000). "Characterization of 5'-flanking region of human aggrecanase-1 ( ... Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region that stacks against the active-site of the ... Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a ... 5 (3): 169-76. doi:10.1093/dnares/5.3.169. PMID 9734811. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, ...
Apr 2013). "Genomic Regions Flanking E-Box Binding Sites Influence DNA Binding Specificity of bHLH Transcription Factors ... The CT-Rich Regions (CTRR) located about 23 nucleotides upstream of the E-box is important in E-box binding, transactivation ( ... Besides, each bHLH monomer has a basic region, which helps mediate recognition between the bHLH monomer and the E-box (the ... Furthermore, the sequence constraints on the region around the circadian E-box are not fully understood: it is believed to be ...
Vamvakopoulos NC, Chrousos GP (1994). "Structural organization of the 5' flanking region of the human corticotropin releasing ... "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Letters. 267 (1): 1-5. ... 47 (3): 113-116. doi:10.1159/000132525. PMID 3259914. Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SB, et al. ( ... Retrieved 3 August 2008. Lye S, Challis JR (2001). "Chapter 12: Parturition". In Bocking AD, Harding R (eds.). Fetal growth and ...
... core protein is mediated by a novel structural motif in the transmembrane domain and ectodomain flanking region". The Journal ... which contains two constant regions that are separated by a variable region. The extracellular domain can be cleaved (shed) ... cleaves off heparan sulfate to expose a binding site in the N-terminal region of syndecan-1's core protein. Three SDC1 elements ... "The mapping and visual ordering of the human syndecan-1 and N-myc genes near the telomeric region of chromosome 2p". Human ...
... core protein is mediated by a novel structural motif in the transmembrane domain and ectodomain flanking region". J. Biol. Chem ... Promoter region and chromosomal localization". J. Biol. Chem. 267 (36): 26011-6. doi:10.1016/S0021-9258(18)35709-0. PMID ... Asundi VK, Carey DJ (1995). "Self-association of N-syndecan (syndecan-3) ... syndecan-3)". J. Biol. Chem. 269 (17): 12999-3004. doi:10.1016/S0021-9258(18)99975-8. PMID 8175719. Fabri L, Maruta H, ...
The 5′ flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5′ flanking region contains the ... Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... 5′ flanking regions are categorized between prokaryotes and eukaryotes. In eukaryotes, the 5′ flanking region has a complex set ... flanking region of the insulin gene have been associated with type 2 diabetes. Polymorphisms in the 5′ flanking region of the ...
... flanking region AGTCGTTATCGATAAGAAACATCACATAGTAACACTGAAAGAATTAACAA SNP nucleotide TG SNPdb format ...
... flanking region TCTTCTTYTTTTTTGCAGGTATAGGCAGC Indel CCTTTC Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589 ...
... flanking region ATAACATATATAAGGATTTCTAGATGAAGTTAATACTTAAGAAGCGATGA SNP nucleotide AC SNPdb format ...
... flanking region TGGCCTTCTTTTTTTCTTCTTATGGGGATTGTAATTCTATTATGGATTTT SNP nucleotide TC SNPdb format ...
... flanking region TAACAAAGGCGAAGTACTTCAAAGGCTTTTTCTCAACCGTAGGTGCAGGATTGATGTTCGCTCTTTACCTCCCTGTCATGGAGAAGATATACCAAANAGT SNP ...
... and provide evidence for recent horizontal transfers of a large genomic region. ... Figure 4: Schematic representation of the flanking regions of Wallaby in P. roqueforti compared with homologous regions in ... The region flanking Wallaby in P. roqueforti may be a hotspot for DNA insertions, as other unrelated fragments appear to be ... The P. camemberti and P. rubens Wallaby regions are fragmented and located in non-homologous regions and are therefore not ...
... regulatory regions have been identified and validated so far, many studies have shown that plant 3 regulatory regions have a ... regulatory regions have been identified and validated so far, many studies have shown that plant 3 regulatory regions have a ... regulatory regions, such as NOS and OCS from Agrobacterium tumefaciens and 35S from cauliflower mosaic virus. In this review, ... regulatory regions, such as NOS and OCS from Agrobacterium tumefaciens and 35S from cauliflower mosaic virus. In this review, ...
... flanking region controls transcriptional response to hypoxia in the human erythropoietin gene. J Biol Chem 266, 15563-15566. ... Semenza and colleagues first demonstrated that a 4 kilobase region covering the EPO-coding sequence, plus some small 5 and 3 ... flanking DNA that bound several nuclear factors, at least two of which were induced in liver and kidney by anemia; this small ... flanking DNA was able to confer inducible EPO expression in the kidney (Semenza et al., 1990). This work pointed to a complex ...
Regions flanking dropouts or low coverage masked regions are ambiguated except at the 5 or 3 end. *Insertions are added back ... The sequence in this file pads putative amplicon dropout regions with N. versus the amended consensus alignment. An algorithm ... Regions still containing the mask have zero coverage and are not necessarily due to deletion events. ... It can be useful to differentiate these regions from deletions in the amended consensus. If one sets PADDED_CONSENSUS=1. ( ...
... size of loxP-flanked region: 1.5 kb).. *The positive selection marker (Puromycin resistance - PuroR) has been flanked by FRT ... The remaining recombination sites will be located in non-conserved regions of the genome. ... Deletion of exons 2 and 3 should result in in-frame splicing from exon 1 to exon 4 and in expression of a Pdcd1 protein lacking ... Exons 2 and 3 have been flanked by loxP sites ( ...
TABLE 9. JUKES-CANTOR DISTANCES IN INTRON, FLANKING REGION, PROMOTER AND PSEUDOGENE SEQUENCES BETWEEN HUMAN AND CHIMPANZEE.51. ... flanking, promoter, and pseudogene regions are 1.47%, 1.41%, 1.68%, 0.75% and 1.39%, respectively. It is not clear why the ... autosomal intergenic regions, X-linked noncoding regions, introns, and nonsynonymous sites.. The neighbor-joining tree derived ... TABLE 6. CODING REGION DISTANCES BETWEEN HUMAN (H), CHIMPANZEE (C), GORILLA (G) AND ORANGUTAN (O).46. TABLE 7. JUKES-CANTOR (JC ...
Top: Primers which bind to the flanking regions and span the deleted region. Middle: Gene specific primers for celA (indicates ... Grey shaded area signifies the amplified region using primers spanning the region of interest. A. Amplification of flanking ... Bottom: Primers which bind to the flanking regions and span the region deleted. Lanes are products from the reactions including ... For testing the system in C. michiganensis CASJ002, ~1.5 kB regions within two permissive regions, hit region 1 (HR1) and 3 ( ...
Analysis of the 2365 bp segment revealed a gene including a 905 bp 5 flanking region, a 924 bp open reading frame (ORF) and a ... Region-Specific Induction of FosB/ΔFosB by Voluntary Alcohol Intake: Effects of Naltrexone ... Using RNA extracted from Zantedeschia aethiopica young leaves and primers designed according to the conservative regions of ... Using RNA extracted from Zingiber officinale rhizomes and primers designed according to the conservative regions of monocot ...
... regions, exons, or introns (FASTA format). Download Region Data. For any specified genomic region, download genomic DNA (FASTA ... Search for any CsGDBgene or aligned sequence by ID or keyword, and download complete sequence or flanking 5 or 3 ... View a sample region of scaffold 1001 Genome / Gene Models. The genome assembly displayed at CsGDB is version JGI v1.0; gene ... Sequence analysis tools accessed from the Genome Context View menu use the current genomic region as input. Or, to access the ...
Difference in G + C content between the target site and the upstream flanking region. ... To analyze whether this is due to the chosen flanking sequences, we tested other flanking settings and found 30 nt upstream and ... flanking regions was taken to be 20 nucleotides, unless otherwise stated.. Compactness. We reasoned that hybrids that are more ... seed region) are present all other structures with the same anchor point and no seed region are discarded. Subsequently the ...
... and flanked by highly conserved regions (6). In contrast, the V2 region is flanked on both sides and the V4 region is flanked ... 2). Variable regions were, in general, more accurately classified than more-conserved regions. Variable regions V2 and V4 (20) ... These regions likely account for both the increased accuracy for and the broadened peaks around these variable regions. These ... In general, accuracy was greater for regions mapping to the 16S hypervariable regions (Fig. 2A). The average bootstrap ...
Nine sequences were discarded because the flanking regions of the repeat sequences were too short in length and therefore not ... For all taxa, DNA quality was confirmed by the successful PCR amplification of algal ITS region with ITS1T and ITS4T primers ( ... Francesco Dal Grande,1 Andreas Beck,2,* Garima Singh,3 Imke Schmitt2,4 12Biodiversity and Climate Research Centre (BiK-F), ... 3. F. Dal Grande 2011. Phylogeny and co-phylogeography of a photobiontmediated guild in the lichen family Lobariaceae. PhD ...
Matrix attachment region regulates basal beta-lactoglobulin transgene expression. Whitelaw, C.B., Grolli, S., Accornero, P., ... flanking sequences of the ovine beta-lactoglobulin (betalg) gene that interacts with the nuclear matrix in vitro [14]. ... The minimal 5 regulatory region of the sheep beta-lactoglobulin gene (BLG), as defined in transgenic mice, was used to ... We have identified a region within the proximal 3- ...
... flanking regions of the expansion, we will also carry out PacBio long-read sequencing of 400 FRDA patients.. The group is keen ... Further testing showed that the ability of the PCs and nerve cells in a region of the cerebellum called the dentate nuclei to ... 3) Key preliminary data of direct relevance to FA (no more than 2 pages); 4) References; 5) Estimate of budget request with ... 50,000 per year up to 3 years. FARA offers a Graduate Research Fellowship. This competitive fellowship provides 1 to 3 years of ...
A primary analysis of the 42 ORFs identified in this 43 kb region is presented. The region included a high proportion of genes ... The region between yvsA (293°) and yvqA (289°) of the Bacillus subtilis chromosome has been sequenced within the framework of ... flanking region of the perfringolysin O (pfoA) locus in Clostridium perfringens.. Fems Microbiology Letters, 146,:155-159 ... A primary analysis of the 42 ORFs identified in this 43 kb region is presented. The region included a high proportion of genes ...
The fragment contains the transcribed region plus 11.5 kb 5-flanking and 5.5 kb 3-flanking sequences including all known cis- ... Promoter Regions (Genetics), RNA, Messenger/genetics, Restriction Mapping, Spleen/enzymology, Support, Non-U.S. Govt, ... regulatory elements and the 5 and 3 attachment elements (A-elements) which define the borders of the DNase I sensitive ...
2013). Genomic regions flanking E-box binding sites influence DNA binding specificity of bHLH transcription factors through DNA ... However, even closely related TFs may have distinct DNA-binding profiles (Badis et al., 2009). The positions of the flanking ... It has been reported that the flanking sequence of the ACGT core motif is responsible for differential distribution of the ... Gaurav Agarwal1,3† Rupesh K. Deshmukh1 Li Lin1 Biao Wang1,4 Yongqin Wang1 Silvas J. Prince1 Li Song1 Dong Xu2 Yongqiang C. An5 ...
... flanking region, then the regional limits were expanded by 1000bp to approximate flanking UTRs. Of note, given that the ... A simple statistical significance test was developed to assign a p-value to each alignment and its flanking region. The score ... Region of all elements co-mapping to a LINE. B. Region of all elements co-mapping to SINE28. ... exons and flanking regions, the vast majority of gene annotations do not have such a well defined structure and therefore we ...
... flanking region of the PrP gene. TaqI and HhaI were also found to show polymorphisms in the inbred mouse strains studied. The ... flanking regions of the polyhedrin gene. The resulting plasmid and the wild-type BmNPV genomic DNA were cotransfected into BM-N ... The coding region of the carboxy- terminal half of polyhedrin was removed and the remainder was ligated with the IGF II gene in ... In LOTC-2, LOTC-4 and LOTC-5, the introduction of at least part of HindIII D of LO into the corresponding HindIII D region of ...
A loop region of BAFF controls B cell survival and regulates recognition by different inhibitors. Nat Commun. 2018;9:1199 ... These regions seem to be enriched with BAFF expression [18, 31]. Additionally, BAFF is also increased, up to lymphatic tissue ... This region is responsible for the Nogo related signals that inhibit neurite outgrowth and promote growth cone collapse [79, 81 ... it is not uncommon for 20 BAFF trimers to assemble through a loop region (flap) into a 60-mer [45, 46]. There is also delta- ...
Alu elements in circRNA sequences and flanking regions were obtained using BEDTools (Quinlan & Hall, 2010, versions 2.26.0 and ... For flanking introns, *P = 0.02 and 0.040 for AMG and MTG and P = 0.34 for SN, Wilcoxon test. n = 8 for amygdala control, 15 ... D. Alu editing index in circRNAs and flanking introns, in 3 different intron windows: 1,000, 5,000, and 10,000 nucleotides, n ... Figure 2. CircRNA abundance is brain region-dependent and PD-modified. *A. mRNA processing either involves unidirectional ...
the region to display in the LocusZoom plot in one of three ways; 1) an index SNP and a flanking region, 2) the chromosome ... If users specify the region to display using an index SNP and flanking region, LD of all data points will be relative to the ... If users specify the region to display using an index SNP and flanking region, LD of all data points will be relative to the ... If users specify the region to display using an index SNP and flanking region, LD of all data points will be relative to the ...
  • Enhancers are DNA sequences found in 5′ flanking regions of eukaryotic genes that affect transcription. (wikipedia.org)
  • Silencers are DNA sequences found in the 5′ flanking region of eukaryotic genes, assisting in the silencing of a gene. (wikipedia.org)
  • The availability of multiple PAS in the same 3' regulatory region enables the inclusion or exclusion of 3' untranslated region (3'UTR) sequences, resulting in transcripts that may differ in particularities involving post-transcriptional processes such as stability, transport and translation ( Mayr, 2016 ), and even protein localization ( Berkovits and Mayr, 2015 ). (frontiersin.org)
  • The non-coding regions downstream of coding sequences (CDS) is usually termed terminators. (frontiersin.org)
  • The fragment contains the transcribed region plus 11.5 kb 5'-flanking and 5.5 kb 3'-flanking sequences including all known cis-regulatory elements and the 5' and 3' attachment elements (A-elements) which define the borders of the DNase I sensitive chromatin domain. (eur.nl)
  • In addition, we sequenced 99 ospC flanking sequences from different lineages and compared the complete cp26 sequences of 11 strains as well as the cp26 bbb02 loci of 56 samples. (cdc.gov)
  • TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. (lookformedical.com)
  • The region of DNA which borders the 3' end of a transcription unit and where a variety of regulatory sequences are located. (lookformedical.com)
  • Mycobacterium genus-specific primers derived from highly conserved sequences in the ITS region and the flanking 16S rRNA gene were used. (cdc.gov)
  • PI-2 is a 7-kb region located between the genes that in PI-2-containing isolates and the fi nding that isolates of encode peptidase T (PepT) and ferrochelatase (HemH) ( 9 ). (cdc.gov)
  • all identifi ed serotypes expressed highly conserved PI-2 pili The region is composed of 5 genes, which encode 2 sur- supports their potential as a vaccine candidate. (cdc.gov)
  • The region included a high proportion of genes that did not show homology with genes in other bacteria. (microbiologyresearch.org)
  • Over time, OspC genes were transferred between strains through recombinations involving the whole or parts of the gene and one or both flanks. (cdc.gov)
  • Acquisitions of OspC genes that are novel for the region confer to recipients unique identities to host immune systems and, presumably, selective advantage when immunity to existing types is widespread among hosts. (cdc.gov)
  • Transposition of this element into coding and regulatory regions of genes is responsible for many heritable diseases. (lookformedical.com)
  • 2017). Promoter Variation and Expression Levels of Inflammatory Genes IL1A, IL1B, IL6 and TNF in Blood of Spinocerebellar Ataxia Type 3 (SCA3) Patients . (up.pt)
  • Briefly, the 5' and 3' flanking regions of the open reading frame (ORF) of target genes were amplified by PCR. (pberghei.eu)
  • The loss of other genes in the deleted region may also influence the signs and symptoms that can occur in 17q12 deletion syndrome. (medlineplus.gov)
  • Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. (wikipedia.org)
  • gzipped]] text table including key columns (marker name, p-value and sample size) for up to ~3 million SNPs. (umich.edu)
  • 2012). Transcript Diversity of Machado-Joseph Disease Gene (ATXN3) Is Not Directly Determined by SNPs in Exonic or Flanking Intronic Regions . (up.pt)
  • Search for any CsGDBgene or aligned sequence by ID or keyword , and download complete sequence or flanking 5' or 3' regions, exons, or introns (FASTA format). (plantgdb.org)
  • Sequence analysis tools accessed from the Genome Context View menu use the current genomic region as input. (plantgdb.org)
  • Sequence features in the 1 Mb region from map positions 64% to 92% of the genome. (microbiologyresearch.org)
  • 2012). Sequence analysis of 5′ regulatory regions of the Machado-Joseph disease gene (ATXN3) . (up.pt)
  • If you have a sequence containing a complete gene, 5'- or 3'-exons, you can use gene structure prediction program FGENEH or exons recognition program FGENEH from the server. (bio.net)
  • In this library, the V3 loop sequence, IGPGRAFYTTKN, was flanked by 0-3 randomized residues on each side and inserted between Ala 159 and Asn 160 of viral protein 2. (usda.gov)
  • RAN-mediated pRb-inactivation induced securin upregulation, a putative E2F1 target, by inducing misregulation in chromatin remodeling in its promoter region, which led to transcriptional activation and subsequent development of chromosomal instability. (biomedcentral.com)
  • a promoter region responsible for the negative transcriptional regulation by ABA. (biomedcentral.com)
  • Exons 2 and 3 have been flanked by loxP sites (size of loxP-flanked region: 1.5 kb). (taconic.com)
  • Deletion of exons 2 and 3 should result in in-frame splicing from exon 1 to exon 4 and in expression of a Pdcd1 protein lacking the ligand binding and transmembrane domain. (taconic.com)
  • Other promoter elements found in eukaryotic 5′ flanking regions include initiator elements, downstream core promoter element, CAAT box, and the GC box. (wikipedia.org)
  • ChIP-qPCR assays were performed to evaluate the recruitment of different histone modifications in the core promoter region of securin gene as well as its upstream and downstream regions. (biomedcentral.com)
  • ChIP-qPCR data revealed that the quantity of DNA fragments retrieved from the immunoprecipitated samples was maximum in the -83 to -192 region than further upstream and the downstream of the promoter for H3K4Me3, H3K9ac, H3K18ac and H3K9me3. (biomedcentral.com)
  • The CAAT box is a crucial element of the 5′ flanking region of eukaryotic genomes. (wikipedia.org)
  • In addition, after transcription, a wide array of RNA-binding proteins interacts with cis -acting elements located mainly in the 3' untranslated region, determining the fate of mRNAs in eukaryotic cells. (frontiersin.org)
  • the flanking regions cloned along with protease include the 3' end of gag with the gag cleavage site, and the 5' end of RT. (hivreagentprogram.org)
  • The region between yvsA (293°) and yvqA (289°) of the Bacillus subtilis chromosome has been sequenced within the framework of the B. subtilis 168 international sequencing programme. (microbiologyresearch.org)
  • If you have a slow connection or would like to save time, you can upload results for a region or chromosome of interest only. (umich.edu)
  • Chromosome 17 spans about 83 million DNA building blocks (base pairs) and represents between 2.5 and 3 percent of the total DNA in cells. (medlineplus.gov)
  • It is the same region of chromosome 17 that is abnormally copied (duplicated) in people with a 17q12 duplication (described below). (medlineplus.gov)
  • It is the same region of chromosome 17 that is deleted in people with 17q12 deletion syndrome (described above). (medlineplus.gov)
  • Regions still containing the mask have zero coverage and are not necessarily due to deletion events. (cdc.gov)
  • In most cases, the syndrome is due to a 3 million base pair (Mb) deletion on the chromosomal region 22q11.2 that is flanked by low copy number repeats. (cdc.gov)
  • The remaining recombination sites will be located in non-conserved regions of the genome. (taconic.com)
  • For any specified genomic region , download genomic DNA (FASTA format), all aligned/computed transcripts or proteins (FASTA format), or all genome annotations (GenBank, GFF3 or EMBL format). (plantgdb.org)
  • To specify the region to be plotted, you will have to specify the name of a key marker in the region (typically, as an rs-number), name a gene of interest or provide appropriate genome coordinates. (umich.edu)
  • The viral genome is located inside the capsid of the virion, having a positive-sense polarity and a long open reading frame, which is flanked by untranslated regions at the 5' and 3' ends. (spandidos-publications.com)
  • The length of the human genome is about 3 billion base pairs. (lookformedical.com)
  • This RNA molecule of about 11k nucleotides in length encodes a polyprotein in a single open reading frame that is flanked by two non-coding regions (NCRs) located at the 5' and 3' ends of the genome. (slideshare.net)
  • The 3' regulatory regions have a great diversity of cis -regulatory elements directly involved in polyadenylation, stability, transport and mRNA translation, essential to achieve the desired levels of gene expression. (frontiersin.org)
  • Additionally, the 5′ and 3′ UTRs flanking the coding region regulate mRNA translation, half-life, and subcellular localization [2]. (researchgate.net)
  • Nuclear poly(A) binding protein 2 (NAB2), THO complex subunit 4 (THO4), nucleolar protein 3 (NPL3), G-strand binding protein 2 (GBP2) and serine/arginine-rich splicing factor 1 (SR1) are involved in nuclear mRNA export in malaria parasites. (pberghei.eu)
  • If a transcription factor binds to an enhancer in a 5′ flanking region, the DNA strand bends in a way that the transcription factor that is bound to the enhancer can also bind the promoter of a gene. (wikipedia.org)
  • These elements may be found in both promoter and enhancer regions. (lookformedical.com)
  • The latter region of NS proteins, at the C-terminal part of the polyprotein, has a great contribution in the RNA replication process. (spandidos-publications.com)
  • Approximately 3-4 hours after the onset of ischemia, the integrity of the blood-brain barrier becomes compromised, and plasma proteins are able to pass into the extracellular space. (medscape.com)
  • It is typically 10 nucleotides long, and is present -30 to -20 nucleotides upstream from the transcription start site, in the core promoter region. (wikipedia.org)
  • Since the molecular mechanism underlying securin upregulation remains unclear, this study intended to investigate the association of securin upregulation with the Rb-E2F1 circuit and epigenetic histone (H3) modification patterns both globally and in the promoter region of the securin gene. (biomedcentral.com)
  • Increased trimethylation of H3 lysine 4 and acetylation of H3 lysine 9 and 18 both globally and in the promoter region of the securin gene were observed by increasing the levels of lysine-N-methyltransferase 2A, lysine-acetyltransferase, EP-300 and PCAF after RAN treatment. (biomedcentral.com)
  • 1999, PI-2-containing isolates were of the same serotypes kb genetic region present in 21%-27% of clinical isolates, but accounted for only 3.6% of all invasive isolates. (cdc.gov)
  • The vector pSelAct-KO is a recombination based, markerless knockout system that uses dual selection to engineer seamless deletions of a region of interest, providing opportunities for repeated higher-order genetic knockouts. (biorxiv.org)
  • A genetic variant in buffalo OLR1 at position 8,232 in the 3′-UTR has been affected by fat content and yield in the Mehsana breed [13]. (researchsquare.com)
  • Not to be confused with the 5′ untranslated region, this region is not transcribed into RNA or translated into a functional protein. (wikipedia.org)
  • Although a small number of 3' regulatory regions have been identified and validated so far, many studies have shown that plant 3' regulatory regions have a higher potential to regulate gene expression in plants compared to widely used 3' regulatory regions, such as NOS and OCS from Agrobacterium tumefaciens and 35S from cauliflower mosaic virus. (frontiersin.org)
  • Specificity of the primers was verified using the MCC member species, 11 non-MCC RGM species, 3 slow-growing mycobacterial (SGM) species (two strains each), and 19 field isolates, including 18 MCC isolates (from in-use MWF) and one non-MCC isolate (from reverse osmosis water). (cdc.gov)
  • Microscopic examination of the specimen from the anal ulcer was positive for acid-fast bacilli and Mycobacterium tuberculosis was confirmed at the time by polymerase chain reaction to amplify polymorphic DNA regions flanking IS6110 by PCR with oligonucleotide primers to the end of IS6110. (who.int)
  • Bacterial RNA polymerase binds to these regions to align itself and begin transcription. (wikipedia.org)
  • The positive selection marker (Puromycin resistance - PuroR) has been flanked by FRT sites and inserted into intron 1. (taconic.com)
  • An SNP within the exon and intron regions of the OLR1 gene is associated with phenotypic traits in cattle, according to Komisarek and Dorynek [6] and Fonseca et al . (researchsquare.com)
  • Prediction is performed by linear discriminant function combining characteristics describing donor and acceptor splice sites, 5'- and 3'-intron regions and also coding region for each open reading frames flanked by GT and AG base pairs. (bio.net)
  • Besides recombinations with traces limited to the ospC gene itself, there was evidence of lateral gene transfers that involved (i) part of the ospC gene and one of the two flanks or (ii) the entire ospC gene and different lengths of both flanks. (cdc.gov)
  • The viral RNA helicases are attributed to the NS3 region of the viral polyprotein, and they are involved in duplex unwinding, during viral RNA replication. (spandidos-publications.com)
  • Insertions and deletions in the 5′ flanking region of the insulin gene have been associated with type 2 diabetes. (wikipedia.org)
  • Amplicon dropouts can sometimes leave zero coverage regions where no in-read deletions were detected. (cdc.gov)
  • It can be useful to differentiate these regions from deletions in the amended consensus. (cdc.gov)
  • The SAM file is processed and deleted regions spanned by reads are restored to deletions. (cdc.gov)
  • Vav3 contains a calponin homology (CH) domain, an acidic domain (AC), the Dbl homology (DH) and pleckstrin homology (PH) domains which are common to all Rho GEFs, an atypical cysteine-rich zinc finger (C1) domain, a proline rich domain, a Src homology-2 (SH2) domain, and two Src homology-3 (SH3) domains flanking the single SH2 region. (cytoskeleton.com)
  • The A/C SNP in the 3′-UTR fragment of the OLR1 gene has been linked to lactational traits in Iranian Holstein cattle [15]. (researchsquare.com)
  • Microscopic examination of sputum smear (repeated 3 times) was negative for Mycobacterium tuberculosis bacilli. (who.int)
  • 3 times) was negative for Mycobacterium thology results were available from those operations. (who.int)
  • Involvement of the perianal region in tu- men from the anal ulcer was positive for berculosis is a rare extrapulmonary form acid-fast bacilli and Mycobacterium tub of this disease. (who.int)
  • Method description: ********************** The method is based on the discriminant analysis of open reading frames flanked by GT and AG base pairs. (bio.net)
  • Direct evidence for the presence of these viruses in human genital tumours is the finding that a small proportion (about 10%) retain fragments of virus DNA from different regions of the virus genomes. (microbiologyresearch.org)
  • Only 3 presented a clinical picture of Löwenstein-Jensen medium later. (who.int)
  • A specific transcription factor called CAAT-binding protein binds to this region and aids in transcription in eukaryotes. (wikipedia.org)
  • The coding region of the carboxy- terminal half of polyhedrin was removed and the remainder was ligated with the IGF II gene in phase to create a fusion protein gene consisting of the coding region of the amino-terminal half of polyhedrin and the IGF II gene. (microbiologyresearch.org)
  • This fusion protein gene was combined in a plasmid with the promoter and 5′ and 3′ flanking regions of the polyhedrin gene. (microbiologyresearch.org)
  • The silkworm larvae infected with the recombinant virus produced 3·6 mg of the fusion protein per larva and the infected BM-N cells produced 0·3 mg per ml of culture. (microbiologyresearch.org)
  • This gene encodes OLR1 protein and belongs to the C-type lectin family that functions to absorb and degrade low-density lipoproteins [5], which impacts energy balance, in turn influencing reproductive characteristics [3]. (researchsquare.com)
  • It encodes a protein that prevents separin from promoting sister chromatid separation during mitosis [ 3 ]. (biomedcentral.com)
  • FGFR 3 encodes a transmembrane tyrosine kinase receptor involved in signaling via interaction with the family of fibroblast growth factors. (aacrjournals.org)
  • Spliced alignment of user-specified transcript datasets to genomic DNA from any region in CsGDB. (plantgdb.org)
  • Journal of Molecular Neuroscience, 49 (3), 539 - 543. (up.pt)
  • In another report from Madagascar, 14% of 64 patients with extrapulmonary tuberculosis had tubercular anal fistula [3]. (who.int)
  • from Madagascar, 14% of 64 patients with Abdominal sonography showed mul- extrapulmonary tuberculosis had tubercular tiple lymphadenopathies in the para-aor- anal fistula [ 3 ]. (who.int)
  • A 12 base pair insertion in the 5′ flanking region of the Cystatin B gene has been linked to some individuals with Unverricht-Lundborg disease. (wikipedia.org)
  • The depending on the geographic region analyzed. (cdc.gov)
  • Three overlapping but distinct populations of B. burgdorferi corresponded to the geographic regions. (cdc.gov)
  • MS is a heterogeneous disease but presentation of characteristic symptoms generally follow stages of neurological deficits (relapses) and these can be reversed during periods of total or partial recovery (remissions) [ 2 , 3 ]. (medsci.org)
  • In eukaryotes, the 5′ flanking region has a complex set of regulatory elements such as enhancers, silencers, and promoters. (wikipedia.org)
  • A stable complex between homopyrimidine oligomers and the homologous regions of duplex DNAs. (wikidata.org)
  • Finally, the inflammatory and demyelinating findings in clinically isolated syndrome (CIS) and the evidence in radiologically isolated syndrome (RIS) are supportive of MS in undiagnosed individuals [ 2 , 3 ]. (medsci.org)
  • At age 3, the patient had kyphosis, and an abnormal gait was present by age 5. (medscape.com)
  • In an attempt to address this problem we have created designer "common cold" or rhinoviruses that present a specific region of the HIV important for entry of the virus to the cell on the surface of the human rhinovirus (HRV14). (usda.gov)
  • You can upload summary results of your own genomewide scan or genomewide meta-analysis and request plots of regions of interest using a web-based form. (umich.edu)
  • Annals of Human Biology, 38 (3), 354 - 359. (up.pt)
  • Lyme borreliosis is a vector-borne zoonosis with multiple reservoir hosts within sylvatic cycles in temperate regions of the northern hemisphere ( 1 ). (cdc.gov)
  • Abdominal sonography showed multiple lymphadenopathies in the para-aortic and mesenteric regions as well as the hilar portion of the liver. (who.int)