The presence of DNA from a source foreign to the sample being analysed.
A polysaccharide-producing species of STREPTOCOCCUS isolated from human dental plaque.
Gram-negative gas-producing rods found in feces of humans and other animals, sewage, soil, water, and dairy products.
Cells derived from the BLASTOCYST INNER CELL MASS which forms before implantation in the uterine wall. They retain the ability to divide, proliferate and provide progenitor cells that can differentiate into specialized cells.
A method used to study the lateral movement of MEMBRANE PROTEINS and LIPIDS. A small area of a cell membrane is bleached by laser light and the amount of time necessary for unbleached fluorescent marker-tagged proteins to diffuse back into the bleached site is a measurement of the cell membrane's fluidity. The diffusion coefficient of a protein or lipid in the membrane can be calculated from the data. (From Segen, Current Med Talk, 1995).
A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment.
Antigenic determinants recognized and bound by the B-cell receptor. Epitopes recognized by the B-cell receptor are located on the surface of the antigen.
The Alu sequence family (named for the restriction endonuclease cleavage enzyme Alu I) is the most highly repeated interspersed repeat element in humans (over a million copies). It is derived from the 7SL RNA component of the SIGNAL RECOGNITION PARTICLE and contains an RNA polymerase III promoter. Transposition of this element into coding and regulatory regions of genes is responsible for many heritable diseases.
A polypeptide that is secreted by the adenohypophysis (PITUITARY GLAND, ANTERIOR). Growth hormone, also known as somatotropin, stimulates mitosis, cell differentiation and cell growth. Species-specific growth hormones have been synthesized.
A 191-amino acid polypeptide hormone secreted by the human adenohypophysis (PITUITARY GLAND, ANTERIOR), also known as GH or somatotropin. Synthetic growth hormone, termed somatropin, has replaced the natural form in therapeutic usage such as treatment of dwarfism in children with growth hormone deficiency.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
A plant genus of the family BETULACEAE. The tree has smooth, resinous, varicolored or white bark, marked by horizontal pores (lenticels), which usually peels horizontally in thin sheets.
A degenerative disease of the BRAIN characterized by the insidious onset of DEMENTIA. Impairment of MEMORY, judgment, attention span, and problem solving skills are followed by severe APRAXIAS and a global loss of cognitive abilities. The condition primarily occurs after age 60, and is marked pathologically by severe cortical atrophy and the triad of SENILE PLAQUES; NEUROFIBRILLARY TANGLES; and NEUROPIL THREADS. (From Adams et al., Principles of Neurology, 6th ed, pp1049-57)
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
A single nucleotide variation in a genetic sequence that occurs at appreciable frequency in the population.
Nonrandom association of linked genes. This is the tendency of the alleles of two separate but already linked loci to be found together more frequently than would be expected by chance alone.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
The genetic constitution of individuals with respect to one member of a pair of allelic genes, or sets of genes that are closely linked and tend to be inherited together such as those of the MAJOR HISTOCOMPATIBILITY COMPLEX.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
A family of high molecular weight Maf transcription factors that contain distinct activation domains.
Irregular microscopic structures consisting of cords of endocrine cells that are scattered throughout the PANCREAS among the exocrine acini. Each islet is surrounded by connective tissue fibers and penetrated by a network of capillaries. There are four major cell types. The most abundant beta cells (50-80%) secrete INSULIN. Alpha cells (5-20%) secrete GLUCAGON. PP cells (10-35%) secrete PANCREATIC POLYPEPTIDE. Delta cells (~5%) secrete SOMATOSTATIN.
A republic in central Africa, east of NIGER, west of SUDAN and south of LIBYA. Its capital is N'Djamena.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
An enzyme that catalyzes the hydrolysis of ADENOSINE to INOSINE with the elimination of AMMONIA.
Exclusive legal rights or privileges applied to inventions, plants, etc.
Catalyze the hydrolysis of nucleosides with the elimination of ammonia.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A 36-amino acid pancreatic hormone that is secreted mainly by endocrine cells found at the periphery of the ISLETS OF LANGERHANS and adjacent to cells containing SOMATOSTATIN and GLUCAGON. Pancreatic polypeptide (PP), when administered peripherally, can suppress gastric secretion, gastric emptying, pancreatic enzyme secretion, and appetite. A lack of pancreatic polypeptide (PP) has been associated with OBESITY in rats and mice.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
A C-type lectin that is a cell surface receptor for ASIALOGLYCOPROTEINS. It is found primarily in the LIVER where it mediates the endocytosis of serum glycoproteins.
Cell surface molecules on cells of the immune system that specifically bind surface molecules or messenger molecules and trigger changes in the behavior of cells. Although these receptors were first identified in the immune system, many have important functions elsewhere.
Intracellular receptors that can be found in the cytoplasm or in the nucleus. They bind to extracellular signaling molecules that migrate through or are transported across the CELL MEMBRANE. Many members of this class of receptors occur in the cytoplasm and are transported to the CELL NUCLEUS upon ligand-binding where they signal via DNA-binding and transcription regulation. Also included in this category are receptors found on INTRACELLULAR MEMBRANES that act via mechanisms similar to CELL SURFACE RECEPTORS.
Proteins prepared by recombinant DNA technology.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A family of RNA plant viruses with flexuous, filamentous particles and consisting of six genera: POTYVIRUS; Ipomovirus; Macluravirus; Rymovirus; Tritimovirus; and Bymovirus. All members of the family form cytoplasmic cylindrical inclusion bodies during infection.
A large genus of plant viruses of the family POTYVIRIDAE which infect mainly plants of the Solanaceae. Transmission is primarily by aphids in a non-persistent manner. The type species is potato virus Y.
A plant species of the genus SOLANUM, family SOLANACEAE. The starchy roots are used as food. SOLANINE is found in green parts.
A genus of the family BROMOVIRIDAE which infects mainly woody plants. Species are divided into ten subgroups. Tobacco streak virus is the type species.
The apparent tendency of certain diseases to appear at earlier AGE OF ONSET and with increasing severity in successive generations. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
Diseases of plants.
A concept, developed in 1983 under the aegis of and supported by the National Library of Medicine under the name of Integrated Academic Information Management Systems, to provide professionals in academic health sciences centers and health sciences institutions with convenient access to an integrated and comprehensive network of knowledge. It addresses a wide cross-section of users from administrators and faculty to students and clinicians and has applications to planning, clinical and managerial decision-making, teaching, and research. It provides access to various types of clinical, management, educational, etc., databases, as well as to research and bibliographic databases. In August 1992 the name was changed from Integrated Academic Information Management Systems to Integrated Advanced Information Management Systems to reflect use beyond the academic milieu.
Glycoprotein hormone, secreted chiefly by the KIDNEY in the adult and the LIVER in the FETUS, that acts on erythroid stem cells of the BONE MARROW to stimulate proliferation and differentiation.
Time period from 1901 through 2000 of the common era.
Time period from 1801 through 1900 of the common era.
... flanking region of the human aortic smooth muscle actin gene". Nucleic Acids Research. 18 (5): 1318. doi:10.1093/nar/18.5.1318 ... Analysis of a cDNA and 5' upstream region". The Journal of Biological Chemistry. 265 (3): 1683-7. PMID 2295650. Kamada S, ... upstream and first intron regions of the human smooth muscle (aortic type) alpha-actin-encoding gene". Gene. 99 (2): 285-9. doi ... 99 ( Pt 3) (3): 627-36. PMID 1939373. Ueyama H, Ohsugi R (March 1990). "TaqI polymorphism in the 3' ...
... flanking region of the human uncoupling protein 3 (UCP3) gene". Biochemical and Biophysical Research Communications. 258 (2): ... Mitochondrial uncoupling protein 3 is a protein that in humans is encoded by the UCP3 gene. The gene is located in chromosome ( ... 86 (3): 372-5. doi:10.1038/sj.bjc.6600074. PMC 2375209. PMID 11875702. Hu X, Murphy F, Karwautz A, Li T, Freeman B, Franklin D ... 47 (3): 425-6. doi:10.1006/geno.1997.5135. PMID 9480760. Vidal-Puig A, Solanes G, Grujic D, Flier JS, Lowell BB (June 1997). " ...
... flanking region of this gene allows glucocorticoids to induce expression of RASD1. This protein is a small GTPase belonging to ... flanking region of the human Dexras1 gene". Biochimica et Biophysica Acta. 1627 (2-3): 85-9. doi:10.1016/s0167-4781(03)00079-4 ... As a GTPase, RASD1 also shares motifs, such as in the regions G-1 to G-3, with other GTPases. The full-length RASD1 cDNA ... the phosphate/magnesium binding regions GXXXXGK(S/T) (domain Σ1), DXXG (domain Σ2), and the guanine base binding loops NKXD ( ...
... flanking region with the interaction of the miR-200c family of micro-RNA. MiR-200c is in turn modulated by the protein HuR ( ... flanking region". Gene. 409 (1-2): 100-8. doi:10.1016/j.gene.2007.11.015. PMID 18178340. Raspaglio G, De Maria I, Filippetti F ... flanking region at +168 nucleotides. This site binds basic helix-loop-helix (bHLH) hypoxia induced transcription factors Hif-1α ... and class III β-tubulin are limited to only 13aa within region 1-429aa, while all amino acids in region 430-450aa are divergent ...
Primers bound to the regions flanking the target DNA provide 3'-hydroxyl groups for DNA polymerase catalyzed extension. The ... This means that each newly synthesized strand of DNA will have a region complementary to a primer. There is an exponential ... terminal region (5'-NTR) as well as a 3'-poly-A tail. The positive sense genome contains a single extended open reading frame ... terminal region of potato virus YN RNA. J. Gen. Virol., 70: 229-233. Dallaire, B.J., Charest, P.J., Devantier., Y. and ...
... nontranslated region, and localization of gene to chromosome 15". Journal of Experimental Pathology. 3 (1): 1-17. PMID 3681487 ... The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. CYP1A2 also ... 8 (3): 305-13. doi:10.1111/1753-0407.12358. PMID 26621325. Wagner K, Vito S, Inceoglu B, Hammock BD (Oct 2014). "The role of ... doi:10.1210/mend-3-9-1399. PMID 2575218. Butler MA, Iwasaki M, Guengerich FP, Kadlubar FF (Oct 1989). "Human cytochrome P-450PA ...
Shimizu T, Kobayashi T, Ba-Thein W, Ohtani K, Hayashi H (1995). "Sequence analysis of flanking regions of the pfoA gene of ... flanking region". Microbiology and Immunology. 39 (9): 677-86. doi:10.1111/j.1348-0421.1995.tb03256.x. PMID 8577281. S2CID ... 3 (9): 853-9. doi:10.1016/S0969-2126(01)00220-9. PMID 8535779. Henrissat B, Bairoch A (June 1996). "Updating the sequence-based ... Clostridium perfringens: beta-galactosidase gene (pbg) is located in the 3'- ...
Its binding site is a GC-rich sequence that is present in the cis-regulatory regions of several viral and cellular genes. AP2- ... flanking IRF6 were screened by direct sequencing for potential causative variants in 184 NSCL/P cases. The rare allele of the ... A search of NSCL/P cases for potential regulatory elements for IRF6 gene was made aligning genomic sequences to a 500 Kb region ... Sequencing of candidate genes in that region in 4 additional unrelated BOFS patients revealed 4 different de novo missense ...
... flanking regions of the NADH-dependent hydroxypyruvate reductase gene from Cucumis sativus L". Plant Molecular Biology. 28 (5 ... 103 (3): 933-941. doi:10.1104/pp.103.3.933. PMC 159066. PMID 8022942.CS1 maint: uses authors parameter (link) Sloan, J. S., B. ... 3 (6): 867-874. doi:10.1111/j.1365-313X.1993.00867.x.CS1 maint: uses authors parameter (link) "Wayne Becker , Fulbright Scholar ...
2000). "Characterization of the 5'-flanking and 5'-untranslated regions of the cyclic adenosine 3',5'-monophosphate-responsive ... untranslated region of human type 2 iodothyronine deiodinase mRNA contains a functional selenocysteine insertion sequence ... The 3' UTR of Sec-containing genes have a common stem-loop structure, the Sec insertion sequence (SECIS), which is necessary ... 144 (3): 937-946. doi:10.1210/en.2002-220960. PMID 12586771. Ambroziak M, Pachucki J, Chojnowski K, et al. (2003). "Pax-8 ...
... flanking region of the human ABO-secretor gene (FUT2) and association between FUT2 and FUT2/01 loci". Hum. Biol. 76 (5): 789-95 ... 1995). "Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H ... 34 (3): 314-8. PMID 15487706. Pang H, Soejima M, Koda Y, Kimura H (2005). "A novel tetrameric short tandem repeat located in ... 246 (3): 750-5. doi:10.1111/j.1432-1033.1997.t01-1-00750.x. PMID 9219535. Koda Y; Soejima M; Johnson PH; et al. (1997). " ...
... flanking region of the beta-globin gene. The CoTC core is highly conserved in the 3' UTR of other primate beta-globin genes. ... The CoTC process in the human beta-globin gene was proposed to involve an RNA self-cleaving activity located in the 3' ...
The 5′-flanking region of a gene often denotes a region of DNA which is not transcribed into RNA. The 5′-flanking region ... flanking region is a region of DNA that is not copied into the mature mRNA, but which is present adjacent to 3′-end of the gene ... The 5′-untranslated region (5′-UTR) is a region of a gene which is transcribed into mRNA, and is located at the 5′-end of the ... flanking region often contains sequences that affect the formation of the 3′-end of the message. It may also contain enhancers ...
... flanking region - 5' end - 5' flanking region - 5'-ribose- 3' - acrylamide gels - adenine - adenosine deaminase deficiency - ... Contents: Top 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 3' end - 3' ...
Only the region between the start and stop codons encodes the final protein product. The flanking untranslated regions (UTRs) ... Indeed, the intron regions of a gene can be considerably longer than the exon regions. Once spliced together, the exons form a ... These sequence regions can either be next to the transcribed region (the promoter) or separated by many kilobases (enhancers ... Exon regions are retained in the final mature mRNA molecule, while intron regions are spliced out (excised) during post- ...
The SARS-CoV genome is ∼29.7 kb long and contains 14 open reading frames (ORFs) flanked by 5′ and 3′-untranslated regions of ... 100 (3): 605-14. doi:10.1016/j.antiviral.2013.09.028. PMC 3889862. PMID 24121034. See Figure 2. Heurich A, Hofmann-Winkler H, ... doi:10.1007/978-3-642-03683-5. ISBN 978-3-642-03682-8. Fehr AR, Perlman S (2015). "Coronaviruses: an overview of their ... 17 (3): 181-192. doi:10.1038/s41579-018-0118-9. PMC 7097006. PMID 30531947. Different SARS-CoV strains isolated from several ...
The form Reinders is more common in the Eastern Netherlands and the flanking regions of Germany.[3] The Dutch given name ...
Additionally, flanking regions outside this immunostimulatory hexamer must be guanine-rich to ensure binding and uptake into ... Accessory regions pertaining to the plasmid backbone may engage in a wide range of structural instability phenomena. Well-known ... Because these proteins contain regions of amino acid sequences that are characteristic of bacteria or viruses, they are ... The optimal immunostimulatory sequence is an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines. ...
Helens, which had a volume of 0.24 cu mi (1.0 km3). The region on the volcano's northeastern flank destroyed by the eruptions, ... Within the region, most if not all of the volcanic rock has erupted in the past 3 million years. During this period, at least ... No lava erupted, but parts of the dome fell on the upper flanks of the mountain, which were covered in more than 30 ft (9.1 m) ... The region is also affected geologically by the Cascadia subduction zone, which dips eastward beneath the western coast of ...
There is a non coding regions: the 5′ region of 40 nt and the 3region of 137 nt. This open reading frame encodes several ... The M segment RNA is 4,818 nucleotides in length and contains one open reading frame flanked by 5′ and 3′ non coding regions of ... It contains a unique potential N-gly site in the Gn and Gc glycoprotein regions at amino acids 612 and 1514 respectively. The S ... noncoding regions are 49 nt and 193 nt in length respectively. Sang R, Onyango C, Gachoya J, Mabinda E, Konongoi S, Ofula V, ...
... flanking region". Journal of Biochemistry. 101 (3): 591-9. doi:10.1093/jb/101.3.591. PMID 3648024. Kawashima I, Tani T, Mita- ... 44 (1): 210-3. doi:10.1023/A:1026691209094. PMID 9952246. S2CID 1137506. Borowitz D, Baker SS, Duffy L, Baker RD, Fitzpatrick L ... 44 (1): 210-3. doi:10.1023/A:1026691209094. PMID 9952246. S2CID 1137506. Gullo L, Ventrucci M, Tomassetti P, Migliori M, ... 145 (3): 322-6. doi:10.1016/j.jpeds.2004.04.049. PMID 15343184. Edelstein C, Italia JA, Scanu AM (April 1997). " ...
Mizui Y, Yamazaki K, Kuboi Y, Sagane K, Tanaka I (Sep 2000). "Characterization of 5'-flanking region of human aggrecanase-1 ( ... Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region that stacks against the active-site of the ... Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a ... 5 (3): 169-76. doi:10.1093/dnares/5.3.169. PMID 9734811. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, ...
Apr 2013). "Genomic Regions Flanking E-Box Binding Sites Influence DNA Binding Specificity of bHLH Transcription Factors ... The CT-Rich Regions(CTRR) located about 23 nucleotides upstream of the E-box is important in E-box binding, transactivation ( ... Besides, each bHLH monomer has a basic region, which helps mediate recognition between the bHLH monomer and the E-box (the ... Furthermore, the sequence constraints on the region around the circadian E-box are not fully understood: it is believed to be ...
Vamvakopoulos NC, Chrousos GP (1994). "Structural organization of the 5' flanking region of the human corticotropin releasing ... "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Lett. 267 (1): 1-5. doi: ... 47 (3): 113-6. doi:10.1159/000132525. PMID 3259914. Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SB, Sato S, ... Retrieved 3 August 2008. Arató M, Bánki CM, Bissette G, Nemeroff CB (1989). "Elevated CSF CRF in suicide victims". Biol. ...
... core protein is mediated by a novel structural motif in the transmembrane domain and ectodomain flanking region". The Journal ... which contains two constant regions that are separated by a variable region. The extracellular domain can be cleaved (shed) ... cleaves off heparan sulfate to expose a binding site in the N-terminal region of syndecan-1's core protein. Three SDC1 elements ... "The mapping and visual ordering of the human syndecan-1 and N-myc genes near the telomeric region of chromosome 2p". Human ...
... core protein is mediated by a novel structural motif in the transmembrane domain and ectodomain flanking region". J. Biol. Chem ... Promoter region and chromosomal localization". J. Biol. Chem. 267 (36): 26011-6. PMID 1464612. Tezuka K, Takeshita S, Hakeda Y ... Asundi VK, Carey DJ (1995). "Self-association of N-syndecan (syndecan-3) ... syndecan-3)". J. Biol. Chem. 269 (17): 12999-3004. PMID 8175719. Fabri L, Maruta H, Muramatsu H, et al. (1993). "Structural ...
The coding region in an mRNA is flanked by the 5' untranslated region (5'-UTR) and 3' untranslated region (3'-UTR), the 5' cap ... In DNA, the coding region is flanked by the promoter sequence on the 5' end of the template strand and the termination sequence ... The coding region is thought to contain a higher GC-content than non-coding regions. There is further research that discovered ... untranslated regions of the RNA, which do not code for protein, are termed non-coding regions and are not discussed on this ...
... flanking region". Genomics. 42 (3): 378-387. doi:10.1006/geno.1997.4770. PMID 9205108. Glatt K, Glatt H, Lalande M (1997). " ... Ritchie RJ, Mattei MG, Lalande M (1998). "A large polymorphic repeat in the pericentromeric region of human chromosome 15q ... within the Angelman and Prader-Willi syndrome chromosomal regions". Hum. Mol. Genet. 2 (2): 183-189. doi:10.1093/hmg/2.2.183. ... 202 (1-3): 207-223. doi:10.1007/s00213-008-1357-7. PMID 18936916. Chambers MS, Atack JR, Bromidge FA, et al. (2002). "6,7- ...
The 5′ flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5′ flanking region contains the ... Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... 5′ flanking regions are categorized between prokaryotes and eukaryotes. In eukaryotes, the 5′ flanking region has a complex set ... flanking region of the insulin gene have been associated with type 2 diabetes. Polymorphisms in the 5′ flanking region of the ...
The hair is longest on the flanks and rump. In the fall, the summer coat is gradually replaced by a thicker, coarse-haired ... Douzery, E.; Randi, E. (November 1997). "The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic ... studies of mitochondrial control region and cytochrome b DNA sequences placed it near Capreolus within an Old World section of ... 2.4-3 in 20-31 lbs The water deer has narrow pectoral and pelvic girdles, long legs, and a long neck. The powerful hind legs ...
In July 1979, Pol Pot established a new headquarters, Office 131, on the western flank of Mount Thom.[360] He dropped the name ... The Khmer Rouge converted a disused secondary school in Phnom Penh's Tuol Sleng region into a security prison, S-21. It was ... with the war to begin in the North-West Zone and then spread to other regions.[144] As communication across Cambodia was slow, ... Pol Pot was born in the village of Prek Sbauv, outside the city of Kampong Thom.[3] He was named Saloth Sâr (Khmer: សាឡុត ស ...
The young have the malar region pink, and somewhat clear eyes. The tail is much shorter than the adults.[19] ... The loose feathers of the flanks are brought over the primaries, and the shoulder patch is spread so the white is conspicuous, ... 9, 3-56. ISBN 978-0-306-47727-0.. *^ Gesner, Conrad (1555). Historiæ animalium liber III qui est de auium natura. Adiecti sunt ... They also protect the chicks from predators, as their ability to fly is poor, making them vulnerable.[35] On average, only 3 or ...
Inflectional suffixes in the morphology of Bengali vary from region to region, along with minor differences in syntax. ... Native Bengali words do not allow initial consonant clusters;[61] the maximum syllabic structure is CVC (i.e. one vowel flanked ... Besides the native region it is also spoken by the Bengalis living in Tripura, southern Assam and the Bengali population in the ... Bengali language is native to the region of Bengal, which comprises Indian states of West Bengal and the present-day nation of ...
Donar's Oak was a sacred tree located in an unclear location around what is now the region of Hesse, Germany. According to the ... The tree is flanked on both sides by large hearths. Völsunga saga ...
... es inhabit various regions of the ocean, including coral reefs, pelagic waters, and the seabed; some live in the ... Coleoids rely mostly on ADAR enzymes for RNA editing, which requires large double-stranded RNA structures to flank to the ... ISBN 978-3-925919-32-9.. *^ Seibel, B. "Vampyroteuthis infernalis, Deep-sea Vampire squid". The Cephalopod Page. Retrieved 31 ... 9 (3): 997-1010. doi:10.1093/icb/9.3.997.. *^ Crowfoot, Thomas. "Octopuses and Relatives: Prey handling and drilling". A ...
westerly past the region around Albany, NY to the Susquehanna River side of the Catskills, then ... historic territories inside the divides of the frequently mountainous landforms flanking the Delaware River's drainage basin. ... In 1828, Mexican General Manuel de Mier y Terán made an inspection of eastern Mexican Texas and estimated that the region ... The Lenape practiced large-scale agriculture to augment a mobile hunter-gatherer society in the regions around the Delaware ...
Paul M. Markowski (April 2002). "Hook Echoes and Rear-Flank Downdrafts: A Review". Mon. Wea. Rev. 130 (4): 852-76. Bibcode: ... They typically look to its rear, the main region of updraft and inflow. Under that updraft is a rain-free base, and the next ... Anatomy of May 3's F5 tornado, The Oklahoman Newspaper, May 1, 2009 ... As the mesocyclone lowers below the cloud base, it begins to take in cool, moist air from the downdraft region of the storm. ...
Amazon Gold Rush, Amazon region, Brazil[clarification needed][16]. *Mount Kare Gold Rush, Enga Province, Papua New Guinea[17][ ... The main goldfield was along the south flank of the Klondike River near its confluence with the Yukon River near what was to ... Gold rushes by region[edit]. Australia[edit]. Main article: Australian gold rushes ... Gold rushes helped spur a huge immigration that often led to permanent settlement of new regions. Activities propelled by gold ...
After their defeat, the Ottoman Army gave Mustafa Kemal the organization of the defense of the region in August. The region was ... By November 12, the Turkish IX Corps with Ahmet Fevzi Pasha had reinforced the XI Corps on the left flank. The 3rd Army began ... The region south of Lake Van was extremely vulnerable. The Turks had to defend a line of more than 600 kilometers with only ... A success in this region would mean a diversion of Russian forces to this front from the Polish and Galician fronts.[7] A ...
... these guns were positioned at the flanks at it was speculated that they might still serve to fire rocks and canister shots at ... Köslin Region. *Stettin Region. *Stralsund Region. *Posen-West Prussia Region. *List of placenames ... 978-3-486-58110-2. .. *^ a b c d e f g h i Digby Smith, The Greenhill Napoleonic Wars Data Book , Greenhill Books, 1998 ISBN 1- ... 978-3-412-20340-5. .. *^ a b c d e f g h i Kroczyński, Hieronim (2009). "Ferdinand von Schills Mitwirkung an der Verteidigung ...
It is found in West Papua, Indonesia and Papua New Guinea[2] in montane forest regions.[3] They are "widespread along the ... Black-flanked rock-wallaby (P. lateralis). *Mareeba rock-wallaby (P. mareeba). *Brush-tailed rock-wallaby (P. penicillata) ... Pygmy ringtails are herbivores or "arboreal folivores" that eat pollen, lichen, fungus and "epiphytic moss."[3] P. mayeri also ... "3] They have "an enlarged cecum that acts as a fermentation chamber"[5] and allows "gut bacteria to breakdown [sic] plant ...
Britain denied this, claiming the resolution did not apply to Britain and that the troops were not new to the region as they ... Britain's Middle East policy had been centered around protecting the flanks of its sea lines of communication to India. After ... At the request of the United States, the ban was extended to the whole region. A French amendment allowed immigration so long ... In the Tel Aviv region, the operation was codenamed Operation Hippo while in Jerusalem it was codenamed Operation Elephant. Up ...
The Pribnow box has a 6 bp region centered around the -10 position and an 8-12 bp sequence around the -35 region that are both ... Additionally, binding of TBP is facilitated by stabilizing interactions with DNA flanking the TATA box, which consists of G-C ... One study found less than 30% of 1031 potential promoter regions contain a putative TATA box motif in humans.[9] In Drosophila, ... In bacteria, promoter regions may contain a Pribnow box, which serves an analogous purpose to the eukaryotic TATA box. ...
... taken as a region there is likely to be fewer than 30 breeding pairs in this region.[1][9] In the Middle East, the white-tailed ... underparts and flanks. The legs and cere at this young nestling age can range from pinkish to pale yellow.[3] By about 30 days ... AMBIO: A Journal of the Human Environment, 35(3), 98-104. *^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae ... Slovak Raptor Journal, 3, 35-39. *^ a b c d e f g h i j k l m n o p q r s t Vrezec, A. (2016). Prehranska niša orla belorepca ( ...
The Japanese thrust into the Pacific region had begun in early December 1941 with attacks against British and Commonwealth ... platoons withdrew back across the creek while elements of another company that was in support moved to the northern flank. ... Strategically, as a result of the fighting around Milne Bay, Japanese operations within the region were constrained. The defeat ... as the Allies gained the ascendency in the region throughout late 1942 and the Japanese were forced to fall back to the ...
T is used for turns, featuring hydrogen bonds typical of helices, S is used for regions of high curvature (where the angle ... In 2011, it was shown that DSSP failed to annotate many "cryptic" π helices, which are commonly flanked by α helices [4]. In ... The 310 helix, α helix and π helix have symbols G, H and I and are recognized by having a repetitive sequence of hydrogen bonds ... is at least 70°), and a blank (or space) is used if no other rule applies, referring to loops.[3] These eight types are usually ...
Martiniuk F, Mehler M, Tzall S, Meredith G, Hirschhorn R (March 1990). "Sequence of the cDNA and 5'-flanking region for human ... 6 (3): 371-80. doi:10.1089/aid.1990.6.371. PMID 2187500.. *. Martiniuk F, Bodkin M, Tzall S, Hirschhorn R (September 1990). " ... 43 (3): 75-87. doi:10.7883/yoken1952.43.75. PMID 2283726.. *. Leonard CK, Spellman MW, Riddle L, Harris RJ, Thomas JN, Gregory ... 49 (3): 635-45. PMC 1683123. PMID 1652892.. *. Fenouillet E, Gluckman JC (August 1991). "Effect of a glucosidase inhibitor on ...
... and were said to have inhabited the region of Magnesia and Mount Pelion in Thessaly, the Foloi oak forest in Elis, and the ... Female centaurs flanking Venus (Mosaic from Roman Tunisia, 2nd century AD). Though female centaurs, called centaurides or ... 3] Centaurs are thought of in many Greek myths as being as wild as untamed horses, ...
One, known today as Lake McConnell, covered almost all of the western NWT as well as adjacent regions of what is now Alberta ... to south southwest is a narrow belt of dacite flanked by two gabbro sills (one of which forms the largest island), with some ... Human use of the lake began with the Dene, the First Nations in the region, whose ancestors settled there around 7,500 years ... "Frame Lake had the most peculiar species assemblage for the region", the two wrote of the results of their zooplankton findings ...
Lists of birds by region. References[edit]. *. Lepage, Denis. "Checklist of birds of Malaysia". Bird Checklists of the World. ... and several have buff flanks. As their name suggests, many species have a white ring around each eye. ... They nest on the ground in temperate and arctic regions and are long-distance migrants. There are 7 species worldwide and 2 ... The Cisticolidae are warblers found mainly in warmer southern regions of the Old World. They are generally very small birds of ...
The bombers were to be delivered to the Netherlands East Indies to help deter any Japanese aggression into the region. ... four in the flank-mount conformal gun pod packages, two in the dorsal turret, one each in the pair of waist positions, and a ... conformal gun pods each flanking the lower cockpit, each pod containing two Browning M2s. By 1945, however, combat squadrons ... Dorr Wings of Fame Volume 3, pp. 125-126. *^ "Factsheets: North American B-25B." National Museum of the U.S. Air Force, 26 June ...
The vacuum allowed pirates to flourish in the region. After being conquered by Majapahit in 1375 AD, the Palembang region was ... caused by the simultaneous pressure on its two flanks of Siam and Java."[24]:204,243 However, there was virtually a power ... An example is the rumah limas traditional house, this house has been adopted by many people in various regions because the ... This region has a tropical monsoon climate, similar to most other Indonesian provinces. Throughout the year the province is ...
Drower, Margaret S. (1973). "Syria c. 1550-1400 BC". The Cambridge Ancient History: The Middle East and the Aegean Region c. ... In defence cavalry were used to attack and harass the enemy's infantry flanks as they advanced. Cavalry were frequently used ... The best-known current examples are the Janjaweed, militia groups seen in the Darfur region of Sudan, who became notorious for ... The Middle East and the Aegean Region c. 1800-1380 BC Volume II Part I (Third ed.). Cambridge, UK: Cambridge University Press. ...
When the western flank of the Mongols plundered Polish cities, a European alliance among the Poles, the Moravians, and the ... Mongol forces would spread out in a line, surround an entire region, and then drive all of the game within that area together. ... Genghis Khan ascended the throne in the Ikh Khuraldai region in the Onan river, from the Jami' al-tawarikh. ... The Mongol Empire - at its height of the largest contiguous empire in history - had a lasting impact, unifying large regions. ...
Flanking Regions". International Journal of Primatology. 18 (2): 261-295. doi:10.1023/A:1026328804319.. ... Retrieved August 3, 2017.. *^ a b c "Vitamin C: MedlinePlus Medical Encyclopedia". medlineplus.gov. Archived from the original ... 3 (3): CD007176. doi:10.1002/14651858.CD007176.pub2. PMID 22419320.. *^ a b Lind J (1753). A Treatise of the Scurvy. London: A ... 4 (2-3): 95-100. doi:10.1079/BJN19500024. PMID 14801407.. *^ a b "Safety (MSDS) data for ascorbic acid". Oxford University. ...
... was pushed hard on his left flank with the situation so dangerous that he and his men were pushed right up against the ... in the region. These machinations caused calls for Metellus's removal; despite delaying tactics by Metellus, in 107 BC Marius ... This destabilized the Pontic army, slewing it towards its right flank. Sulla dashed back to his own right wing and ordered the ... Crassus' forces, fighting on Sulla's right however, managed to turn the opposition's flank and drive them back. The Samnites ...
... is partitioned into six administrative regions, with Djibouti city representing one of the official regions. It is ... The structures are associated with graves of rectangular shape flanked by vertical slabs, as also found in Tiya, central ... Wildlife is spread over three main regions, namely from the northern mountain region of the country to the volcanic plateaux in ... Islam entered the region very early on, as a group of persecuted Muslims had sought refuge across the Red Sea in the Horn of ...
During this period, the region that is now the park was near the equator on the southwestern edge of the supercontinent Pangaea ... and its climate was humid and sub-tropical.[12] What later became northeastern Arizona was a low plain flanked by mountains to ... The dominant plants in the park include more than 100 grass species, many native to the region. Growing among the grasses are ... However, the park's oldest Spanish inscriptions, left by descendants of the region's early Spanish colonists, date only to the ...
Thousands were captured from Oka region.[7]:76 This was the last deep raid into Muscovy.[11] :26 ... crossed the Ugra River and rounded the flank of the 6,000-man Russian army. The sentry troops of Russians were crushed by the ... To protect from invasions by the Nogai Horde in the region between the Volga and Irtysh rivers, the Volga cities of Samara ( ... Later, the Russian expansion turned to the Black Sea region and Crimean khanate was invaded several times in the 18th century ...
Localization of Genetic Elements and Characterization of Unknown Flanking DNA, Lateral Diffusion and Exocytosis of Membrane ... Video articles in JoVE about 3 flanking region include Generation of Marked and Markerless Mutants in Model Cyanobacterial ... Flanking Region: The region of DNA which borders the 3 end of a transcription unit and where a variety of regulatory sequences ... Linear Amplification Mediated PCR - Localization of Genetic Elements and Characterization of Unknown Flanking DNA. Richard ...
... flanking genomic region in three different MON810 maize varieties. Genetic characterization of the cry1Ab coding region allowed ... flanking genomic region in MON810 maize using next-generation sequencing. ... In conclusion, the variation in the coding region is either due to the increased age of the seeds from the tested maize ... Specifically, position 71 of the analyzed region varied in 15 of 600 samples tested and thus appears to be a mutational hotspot ...
... with the data presented as recovery of the indicated region (region 1, regions 2 and 3, regions 4 and 5, or region 6), as a ... Islet β-Cell-Specific MafA Transcription Requires the 5′-Flanking Conserved Region 3 Control Domain. Jeffrey C. Raum, Chad S. ... Flanking Conserved Region 3 Control Domain. Jeffrey C. Raum, Chad S. Hunter, Isabella Artner, Eva Henderson, Min Guo, Lynda ... Flanking Conserved Region 3 Control Domain. Jeffrey C. Raum, Chad S. Hunter, Isabella Artner, Eva Henderson, Min Guo, Lynda ...
... flanking SHOX region in order to determine the relevance of the regulatory sequences in this region.Design. We collected DNA ... flanking region. Recently, a 47.5 kb recurrent PAR1 deletion downstream of SHOX was reported, but its frequency and clinical ... PAR1 region. Clinical data were available from 23 index patients and 21 relatives.Results. In 9 families (20 individuals) a ... PAR1 region is remarkably variable. Height, sitting height/height ratio and the presence of Madelung deformity were not ...
... flanking region. Together they form a unique fingerprint. * 3 Flanking Region Medicine & Life Sciences ... flanking region. / Trujillo, Miguel A.; Sakagashira, Michiko; Eberhardt, Norman L.. In: Molecular Endocrinology, Vol. 20, No. ... flanking region. Deletion of the Sx Alu repeat in reporter constructs containing hGH-1 3′-flanking sequences increased reporter ... flanking region of the hGH-1 gene revealed a strong orientation- and position-independent silencing activity mapping between ...
... flanking regions strongly enhance gene expression in plants. Together they form a unique fingerprint. * Sort by ... Fingerprint Dive into the research topics of Chimeric 3 ... flanking regions strongly enhance gene expression in plants. ...
... a larger PCR product that includes the flanking regions, we have to choose a larger region to be used for primer design. To see ... covering ONLY the mRNA coding region and a bit of the downstream flanking region. (See LepR3mRNA.gen). Therefore, if we want ... This approach is especially useful if the target is a complete copy of the gene, including the flanking regions which may ... For simplicity, lets say that the region to be searched by PrimerBLAST should include 1000 bp flanking the desired product. ...
... flanking region 1. (B) Depletion of CDK12 has little effect on levels of RNAPII at the c-FOS gene. ChIPs were performed using ... flanking regions 1 and 2, respectively. (B) CDK12 depletion does not affect c-FOS RNA splicing. CDK12-depleted or control cells ... A) Knockdown of eIF4A3 reduces CDK12 enrichment at the c-FOS exon 2/intron 2 region and the polyadenylation site. ChIPs were ... Horizontal lines below transcripts represent regions amplified by RT-qPCR. Primers span exon-exon junctions, as follows: exons ...
... flanking region of IL-6 gene (IL-6vntr) and delayed initial onset and reduced AD risk. A novel G/C polymorphism at position - ... flanking region haplotype and reduced Alzheimers disease risk in a German population. Neuroscience letters, Vol. 283, H. 2. pp ... flanking region haplotype and reduced Alzheimers disease risk in a German population ... edoc is powered by EPrints 3 which is developed by the School of Electronics and Computer Science at the University of ...
Islet β-cell-specific MafA transcription requires the 5′-Flanking conserved region 3 control domain. In: Molecular and cellular ... Islet β-cell-specific MafA transcription requires the 5′-Flanking conserved region 3 control domain. / Raum, Jeffrey C.; Hunter ... Islet β-cell-specific MafA transcription requires the 5′-Flanking conserved region 3 control domain. Molecular and cellular ... title = "Islet β-cell-specific MafA transcription requires the 5′-Flanking conserved region 3 control domain", ...
... flanking region GAAGAAAATCTTGTTGGGAGTGTCAATGGATCCTGCAGAGTGCGACTCGG SNP nucleotide TC SNPdb format ...
... flanking region CATTTTTGCTCTTAATTTTTGTACTCTTCTCTGGCCTCTTAGGAATATAC SNP nucleotide AG SNPdb format ...
... flanking region TCTGATTGAGATATTGATTGCCCCCGTAGCTGCAAAAATTTAGCCCTCTG SNP nucleotide AC SNPdb format ... 3 Position 60.59 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region for the gene expression in activated T lymphocytes ... flanking region of the human gene. Analysis of nucleotide sequences in the 5'-flanking region of the human elastin gene ... Hanson, R.D.; Sclar, G.M.; Kanagawa, O.; Ley, T.J., 1991: The 5'-flanking region of the human CGL-1/granzyme B gene ... Inoue, H.; Higashi, Y.; Morohashi, K.; Fujii-Kuriyama, Y., 1988: The 5'-flanking region of the human P-450(SCC) gene shows ...
The coding region in some flanking 5′ and 3′ UTR have been sequenced. The protein has a predicted molecular weight of 13,293; ... it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) ... 7A-7B show the full length nucleotide sequence (SEQ ID NO:7) of TNFR AF1 C1, the complete coding sequence region of the full ... An example of a screen comprises isolating the coding region of one of the genes by using the known DNA sequence to synthesize ...
Primers flanking the region of the mutation detected 3 distinct transcripts. In addition to the wild-type product, a larger ... Genomic DNA was obtained from family members, and the 25 factor V exons and flanking intronic regions were sequenced in the ... Two deletion mutants mapped a gE binding region in gI to residues 105 to 125. A glycosylation site, N116, in this region did ... and framework I and 2 regions of the immunoglobulin heavy chain V region gene. This method is able to detect a clonal ...
... flanking region of the human Dexras1 gene". Biochimica et Biophysica Acta. 1627 (2-3): 85-9. doi:10.1016/s0167-4781(03)00079-4 ... flanking region of this gene allows glucocorticoids to induce expression of RASD1.[12] ... perinuclear region of cytoplasm. • plasma membrane. • cell nucleus. • sarcoplasmic reticulum. • membrane. Biological process. • ... As a GTPase, RASD1 also shares motifs, such as in the regions G-1 to G-3, with other GTPases. The full-length RASD1 cDNA ...
Analysis of sequences flanking the vap regions of Dichelobacter nodosus: evidence for multiple integration events, a killer ... An overlapping region of 21 nt was identified as the att core region (att OXC) (5′-CTTTTTCATAATAATCTCCCT-3′). Two additional ... 1A) showed a conserved region in this module for all genomes studied. The region contains one conserved gene, cg1 or cg2 ( ... terminal flanking region of the replication module, and the high similarity shared between them make these sequences good ...
... a DNA fragment bearing the ftsZTB coding region and its 1-kb upstream flanking region was amplified, cloned in integrating ... First, a 2.1-kb DNA fragment bearing the 5′ end of ftsZTB and its upstream flanking region and a 1.6-kb fragment bearing the 3 ... Gray box, ftsZTB coding region; black box, deleted region in ftsZTB; white box, 5′ and 3flanking regions of ftsZTB. SCO, ... flanking regions (Table 1) in integrating plasmids. Plasmid pJFR41 was created by cloning the ftsZTB-gfp fusion (9) downstream ...
The 5′ flanking region is a region of DNA that is adjacent to the 5′ end of the gene. The 5′ flanking region contains the ... Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... 5′ flanking regions are categorized between prokaryotes and eukaryotes. In eukaryotes, the 5′ flanking region has a complex set ... flanking region of the insulin gene have been associated with type 2 diabetes. Polymorphisms in the 5′ flanking region of the ...
5′ Flanking region. Novel. AAGGATTAGC. [A/-]. ATAGAAACGG. 0.0033. -. −1652C→T HGF5-5b 5′ Flanking region rs3735520 AAAATAGATC [ ... 5′ Flanking region. Novel. AAGGATTAGC. [A/-]. ATAGAAACGG. 0.0033. -. −1652C→T HGF5-5b 5′ Flanking region rs3735520 AAAATAGATC [ ... Flanking region rs5745787 AATCTCTATG [C/T] ACTTTAGTTT 0.2295 1.00 71207G→A HGF3-12b 3Flanking region rs5745788 TTCTCCCACC [A/ ... Flanking region rs5745787 AATCTCTATG [C/T] ACTTTAGTTT 0.2295 1.00 71207G→A HGF3-12b 3Flanking region rs5745788 TTCTCCCACC [A/ ...
2005 Feb;3(2):e42. Epub 2005 Jan 25. Research Support, Non-U.S. Govt ... The 5′ flanking regions are shown left of the origin, and 3flanking regions, right. Segments of 500 bases starting from the ... Selective Constraint Plotted against Distance from the Coding Sequence in 5′ Flanking Regions and 3Flanking Regions ... Evidence for widespread degradation of gene control regions in hominid genomes.. Keightley PD1, Lercher MJ, Eyre-Walker A. ...
... flanking regions was subcloned and sequenced in its entirety. This sequence has been submitted to GenBank. As diagrammed in FIG ... flanking region of the gene, hybridized only to the three larger species. Thus, these larger species were presumably generated ... flanking region. The 8th exon deleted in mCAR2 is indicated by a star. ... This C-terminal region of mCAR1 included both the heterodimerization interface referred to as the 9th heptad (Forman et al., ...
A typical mRNA-coding eukaryotic gene has three major parts: a transcribed region, a 5′-flanking region, and a 3′-flankng ... untranslated regions (UTRs) of the mRNA. In most mRNAs, the last exon (at the 3′-end) is usually the longest of all exons, and ... That region of the antisense DNA probe will have the sequence 3′-TAC ACA TCT AGC TAC T-5′. Following convention, the DNA probe ... 1.5.1 Transcribed Region The nucleotide sequence of a gene that is transcribed into mRNA is composed of discrete sequences ...
... flanking region of the human aortic smooth muscle actin gene". Nucleic Acids Research. 18 (5): 1318. doi:10.1093/nar/18.5.1318 ... Analysis of a cDNA and 5 upstream region". The Journal of Biological Chemistry. 265 (3): 1683-7. PMID 2295650. Kamada S, ... upstream and first intron regions of the human smooth muscle (aortic type) alpha-actin-encoding gene". Gene. 99 (2): 285-9. doi ... 99 ( Pt 3) (3): 627-36. PMID 1939373. Ueyama H, Ohsugi R (March 1990). "TaqI polymorphism in the 3 ...
Primers bound to the regions flanking the target DNA provide 3-hydroxyl groups for DNA polymerase catalyzed extension. The ... This means that each newly synthesized strand of DNA will have a region complimentary to a primer. There is an exponential ... terminal region (5-NTR) as well as a 3-poly-A tail. The positive sense genome contains a single extended open reading frame ... terminal region of potato virus YN RNA. J. Gen. Virol., 70: 229-233. Dallaire, B.J., Charest, P.J., Devantier., Y. and ...
18 RNA-dependent RNA polymerases and one nucleoprotein region. Most of the glycoproteins (263 out of 409) are associated ... We identified 428 EVEs belonging to the Chuviridae family confirming the wide discrepancy among the chuvirus genomic regions ... identified 428 EVEs belonging to the Chuviridae family confirming the wide discrepancy among the chuvirus genomic regions ... endogenized: 409 glycoproteins, 18 RNA-dependent RNA polymerases and one nucleoprotein region. Most of the glycoproteins (263 ...
These primers amplify 7.1 kb which contain the Balat_1410S89L gene (Hidalgo-Cantabrana et al., 2015) and its flanking regions: ... When needed, a 2.50 optical zoom was used to acquire images of detailed regions. Image captures were reordered and processed ... was replaced by the upstream region of the tuf gene of B. animalis subsp. lactis DSM10140, containing Ptuf, yielding the ... that includes the regions immediately located upstream and downstream of the gene Balat_1410 as well as the mutated gene Balat_ ...
... flanking region controls transcriptional response to hypoxia in the human erythropoietin gene. J Biol Chem 266, 15563-15566. ... Semenza and colleagues first demonstrated that a 4 kilobase region covering the EPO-coding sequence, plus some small 5 and 3 ... flanking DNA that bound several nuclear factors, at least two of which were induced in liver and kidney by anemia; this small ... flanking DNA was able to confer inducible EPO expression in the kidney (Semenza et al., 1990). This work pointed to a complex ...
  • The region of DNA which borders the 3' end of a transcription unit and where a variety of regulatory sequences are located. (jove.com)
  • Leri-Weill dyschondrosteosis is a clinically variable skeletal dysplasia, caused by SHOX deletion or mutations, or a deletion of enhancer sequences in the 3'-flanking region. (peerj.com)
  • This study aims to compare the clinical features of different sizes of deletions in the 3'-flanking SHOX region in order to determine the relevance of the regulatory sequences in this region. (peerj.com)
  • Deletion of the Sx Alu repeat in reporter constructs containing hGH-1 3′-flanking sequences increased reporter activity in transfected pituitary GC cells, suggesting this region contained a repressor element. (elsevier.com)
  • This approach is especially useful if the target is a complete copy of the gene, including the flanking regions which may contain important regulatory sequences that may be found in a genomic sequence. (umanitoba.ca)
  • Since to goal is to clone the genomic copy of the gene for use in plant transformation, we want not only the coding region, but also the flanking regions that are likely to contain important regulatory sequences. (umanitoba.ca)
  • Here we demonstrate the presence of unique DNA sequences in the 5' flanking region of the human IL-2 gene that control induced T-cell-specific gene expression. (eurekamag.com)
  • The DNA, which spans about 200 bp, contains regions with sequence homology to LTR sequences of HTLV-III (or LAV) and the 5' upstream region of the IL-2 receptor and interferon-gamma genes. (eurekamag.com)
  • Evolutionary conservation is particularly apparent upstream of coding sequences and in first introns, regions that are enriched for regulatory elements. (nih.gov)
  • A number of the conventional and orphan members of the superfamily share identical or very similar amino acid sequences in an important region of the first zinc finger. (google.com)
  • Only about 170-200 bp of the upstream sequences of Est-5B and Est-6 can be aligned to determine similarity, and this alignment requires numerous substitutions and deletions/insertions, indicating that these regions are quite different. (nap.edu)
  • Transgenic mice that carried lacZ and MBH1 -flanking genome sequences demonstrated that MBH1 was expressed by commissural neurons. (jneurosci.org)
  • In this paper, we made transgenic mice carrying lacZ with the MBH1 -flanking sequences and examined the cell types of MBH1 -expressing cells in the developing mouse spinal cord. (jneurosci.org)
  • The MBH1 -flanking sequences were obtained by screening a 129/SvJ mouse genomic library (Stratagene, La Jolla, CA) using the entire sequence of the MBH1 cDNA (GenBank accession number AB004056 ) as a probe. (jneurosci.org)
  • The hypothesis was tested that in Tca2, gag stop codon flanking sequences direct translational readthrough and synthesis of a gag-pol fusion protein. (nih.gov)
  • However, in contrast to most other retroelement and viral readthrough signals, immediate gag UGA-flanking sequences were insufficient to direct stop readthrough in S. cerevisiae, indicating non-canonical mechanisms direct gag UGA bypass in Tca2. (nih.gov)
  • Enhancers are DNA sequences found in 5′ flanking regions of eukaryotic genes that affect transcription. (wikipedia.org)
  • Silencers are DNA sequences found in the 5′ flanking region of eukaryotic genes, assisting in the silencing of a gene. (wikipedia.org)
  • Using homologous recombination in mice, we reveal the modest contribution of proximal 5′ flanking sequences to species differences in V1aR distribution, and confirm that variation in V1aR distribution impacts stress-coping in the forced swim test. (prolekare.cz)
  • Sequences in the 5′ flanking region of genes regulate tissue-specific expression in many cases, and are thus likely candidates for contributing to species-specific expression patterns. (prolekare.cz)
  • No mutation was identified in 60, 23, and 33 bp of intron sequences of 3′-acceptor site of intron 1 or the 5′-donar and 3′-acceptor sites of intron 2, respectively. (diabetesjournals.org)
  • The recombinant sequences show highly contrasted level of divergence in the 5'- and 3'- regions of the gene, leading to significantly different tree topologies depending on the gene segment (5'- or 3'-) used for tree reconstruction. (pubmedcentralcanada.ca)
  • In addition, we sequenced 99 ospC flanking sequences from different lineages and compared the complete cp26 sequences of 11 strains as well as the cp26 bbb02 loci of 56 samples. (cdc.gov)
  • 4. The method of claim 2 , wherein said 3′ nucleic acid sequence and said 5′ nucleic acid sequence are synthesized using phosphotriester chemistry while non-identical sequences are synthesized using light-directed polymer synthesis. (google.com.au)
  • Small, Ian 2004-10-06 00:00:00 A comparison of 5′-flanking sequences from 68 different nuclear plant tRNA genes was analyzed to find consensus sequences. (deepdyve.com)
  • GC-rich 5′-flanking sequences were found to be generally incompatible with high levels of expression. (deepdyve.com)
  • In addition to the conserved AAUAAA hexanucleotide, GU- and U-rich sequences in the 3'-flanking region are thought to be critical for efficient polyadenylation. (eurekamag.com)
  • Though the BGH 3'-flanking sequence contains a portion of the putative GU efficiency element, we find that mutation of this element leads to a marginal decrease in efficiency similar to that from mutation of other sequences that do not contain recognizable GU- or U-rich motifs. (eurekamag.com)
  • We have also determined that a region from 18 to 27 nucleotides downstream of the cleavage site contains sequences required for correctly positioning the cleavage site. (eurekamag.com)
  • An Sx Alu repeat lies in close proximity to the hGH-1 and hGH-2 genes in the 3′-flanking region. (elsevier.com)
  • PI-2 is a 7-kb region located between the genes that in PI-2-containing isolates and the fi nding that isolates of encode peptidase T (PepT) and ferrochelatase (HemH) ( 9 ). (cdc.gov)
  • all identifi ed serotypes expressed highly conserved PI-2 pili The region is composed of 5 genes, which encode 2 sur- supports their potential as a vaccine candidate. (cdc.gov)
  • In contrast, the 5' and 3' flanking regions of these genes have very little similarity. (nap.edu)
  • The genes are transcribed convergently and are separated by a 5.7-kb intergenic region. (pnas.org)
  • Utilizing this map information, we have analyzed the structure of the flanking regions of amplified EGF receptor genes which are found in various squamous carcinoma cells. (elsevier.com)
  • Among seven cell lines tested, four cell lines carrying EGF receptor genes in amounts more than 20 times that of normal cells showed amplification together with large 5′‐ and 3′‐ flanking regions. (elsevier.com)
  • those that alter protein structure and function (e.g. coding region mutations) and those that alter the expression of genes [7] , [8] . (prolekare.cz)
  • Over time, OspC genes were transferred between strains through recombinations involving the whole or parts of the gene and one or both flanks. (cdc.gov)
  • Acquisitions of OspC genes that are novel for the region confer to recipients unique identities to host immune systems and, presumably, selective advantage when immunity to existing types is widespread among hosts. (cdc.gov)
  • The results indicate that the UTF1 gene is one of the target genes of an embryonic octamer binding transcription factor, Oct-3/4. (asm.org)
  • Clonally specific deletion of CRISPR-flanking genes also was observed, including deletion of at least cas2 and cas1 genes. (biomedcentral.com)
  • We report for the first time negative spoligotype-associated total loss of CRISPR region spacers and repeats, with accompanying clonally specific loss of flanking genes, including at least CRISPR-associated genes cas2 and cas1 . (biomedcentral.com)
  • Binds the sterol regulatory element 1 (SRE-1) (5'-ATCACCCCAC-3') found in the flanking region of the LDRL and HMG-CoA synthase genes. (uniprot.org)
  • This study examined the relationship between high myopia and three myopia candidate genes-matrix metalloproteinase 2 ( MMP2 ) and tissue inhibitor of metalloproteinase-2 and -3 ( TIMP2 and TIMP3 )-involved in scleral remodeling. (arvojournals.org)
  • Animal and plant genomes contain hundreds of microRNA genes [ 2 , 3 ] that control fundamental cellular processes and are implicated in severe diseases. (biomedcentral.com)
  • Genetic characterization of the cry1Ab coding region allowed us to identify and quantify several sequence variants. (springer.com)
  • Hernandez M, Pla M, Esteve T, Prat S, Puigdomenech P, Ferrando A (2003) A specific real-time quantitative PCR detection system for event MON810 in maize YieldGard based on the 3′-transgene integration sequence. (springer.com)
  • 3. The isolated protein of claim 2 wherein said amino acid sequence is fused to a heterologous polypeptide. (google.com)
  • Both genetic analyses and X-ray crystallography indicate that this region, termed the P box, makes sequence specific contacts with the DNA. (google.com)
  • No intron was detected within the region of genomic sequence corresponding to zaa ( Zantedeschia aethiopica agglutinin) full-length cDNA, which is typical of other mannose-binding lectin gene that have been reported. (portlandpress.com)
  • The deduced amino acid sequence of the lectin gene coding region shares 49-54% homology with other known lectins. (portlandpress.com)
  • However, in other retroelements, translational readthrough of the gag stop codon can be directed by its flanking sequence, including a 3' pseudoknot. (nih.gov)
  • 10. The method of claim 3, wherein said rat steroid 5α-reductase has the sequence of SEQ ID NO: 2. (google.co.uk)
  • In addition, we have identified the minimal sequence of the Ad35-E1B region (molecular weight, 55,000 [55K]), pivotal for complementation of fully E1-lacking Ad35 vector on PER.C6 cells. (asm.org)
  • Our biochemical analyses, however, also reveal one distinct difference between these two regulatory elements: unlike the FGF-4 enhancer, the UTF1 regulatory element can, by its one-base difference from the canonical octamer-binding sequence, selectively recruit the complex comprising Oct-3/4 and Sox-2 and preclude the binding of the transcriptionally inactive complex containing Oct-1 or Oct-6. (asm.org)
  • Variation in the structure of CRISPR and CRISPR-flanking regions of these negative spoligotype MTBC isolates was observed when NGS reads were mapped on reference whole genome sequence H37Rv NC_000962.3. (biomedcentral.com)
  • 7. The method of claim 2 , wherein said 3′ terminal nucleic acid sequence and said 5′ terminal nucleic acid sequence each range in length from about 4 to about 30 nucleotides. (google.com.au)
  • 9. The method of claim 2 , wherein said 3′ terminal nucleic acid sequence and said 5′ terminal nucleic acid sequence include a recognition site of a restriction endonuclease. (google.com.au)
  • The 3'-flanking sequence requirements for efficient and accurate polyadenylation of the bovine growth hormone (bGH) gene were determined by quantitative S1 nuclease analysis of transcripts derived from various BGH 3' deletions and block mutations transiently transfected into COS-1 cells. (eurekamag.com)
  • described a cohort of patients with different deletions in the downstream enhancer region, where various deletion sizes all resulted in LWD or idiopathic short stature. (peerj.com)
  • There is limited information about the phenotype of patients with a deletion in the enhancer region downstream of SHOX . (peerj.com)
  • If you were to click on the GenBank link, you would see a GenBank report encompassing 3441 bp, covering ONLY the mRNA coding region and a bit of the downstream flanking region. (umanitoba.ca)
  • Although downstream of UGA, luc was expressed, but its expression was unaffected by inserting additional stop codons at the 3' end of lacZ. (nih.gov)
  • In fact, the Tca2 gag-pol junction region did allow expression of the downstream luc reporter, but to a far greater extent than anticipated. (nih.gov)
  • Other promoter elements found in eukaryotic 5′ flanking regions include initiator elements, downstream core promoter element, CAAT box, and the GC box. (wikipedia.org)
  • Each Akt isoform is a downstream effector of the growth factor signaling pathway and functions as a mediator of the phosphoinositide-3 kinase (PI3K-Akt) pathway [ 5 ]. (hindawi.com)
  • The amplified 3′‐flanking regions were at least 540 kb in size and common to all the cell lines, except that A431 had rearrangement points within 540 kb downstream of the HTF island. (elsevier.com)
  • 6 Two important regulatory domains include the promoter found in the 1.2-kb region immediately upstream of the first exon and an enhancer found immediately downstream of the second polyadenylation site in the 3′ flanking region. (ahajournals.org)
  • Genotypes of the rs2498794 SNP, which is located in the fifth intron region of the AKT1 gene, were marginally but significantly associated with smoking duration in the total 999 samples of former and current smokers. (hindawi.com)
  • The gene has an intron of 80 bp which is located in the region corresponding to the C-terminus of LTP3. (nih.gov)
  • 1999, PI-2-containing isolates were of the same serotypes kb genetic region present in 21%-27% of clinical isolates, but accounted for only 3.6% of all invasive isolates. (cdc.gov)
  • There have not been any rigorous studies on migration and reproductive gene flow between the subspecies although some authors suggest that each subspecies may have distinct genetic or behavioral adaptations to their local environments [ 3 , 12 ]. (hindawi.com)
  • While the 27 markers throughout the genome suggested a C57BL/6 genetic background, at least 3 of 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. (jax.org)
  • Top row shows poliovirus genetic organization, with the main open reading frame flanked by the 5′ and 3′ untranslated regions (UTRs). (cdc.gov)
  • Primary biliary cirrhosis is associated with a genetic variant in the 3' flanking region of the CTLA4 gene. (snpedia.com)
  • 3 Consequently, researchers must attempt to tease out what must be a dynamic interplay among heterogeneous genetic backgrounds, diverse environmental factors, and differential etiologies in the pathogenesis of this disorder, all of which make attempts to understand the genetic basis of hypertension a challenge. (ahajournals.org)
  • In conclusion, the variation in the coding region is either due to the increased age of the seeds from the tested maize varieties, which is known to increase the mutation rate, or due to the presence of a second (non-functional) cry1Ab fragment in the genome of the MON810 maize variety. (springer.com)
  • C) Similarity plot drawn by comparing the sole genome of pattern 5 with genomes of patterns 3 (green), 4 (red), and 6 (blue) in the 3′ half of the genome. (cdc.gov)
  • 8]]] Located in the 3' NCR are 428 nucleotides that may play a part in translation, RNA packaging, cyclization, genome stabilization, and recognition. (kenyon.edu)
  • 3]]] The 3' NCR forms a loop structure and the 5' NCR allows translation via a methylated nucleotide cap or a genome-linked protein. (kenyon.edu)
  • We identified 428 EVEs belonging to the Chuviridae family confirming the wide discrepancy among the chuvirus genomic regions endogenized: 409 glycoproteins, 18 RNA-dependent RNA polymerases and one nucleoprotein region. (frontiersin.org)
  • CRISPR and CRISPR-flanking genomic regions are important for molecular epidemiology of Mycobacterium tuberculosis complex (MTBC) strains, and potentially for adaptive immunity to phage and plasmid DNA, and endogenous roles in the bacterium. (biomedcentral.com)
  • Single nucleotide polymorphisms (SNPs) were screened and identified in the HGF gene region with denaturing high-performance liquid chromatography, and their linkage disequilibrium pattern was established in a Han Chinese population ( n = 150). (arvojournals.org)
  • Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. (wikipedia.org)
  • A study including both European (4,248 patients) and African-Americans (1,569 patients) with lupus focusing on the IL2 / IL21 gene region on chromosome 4q27 concluded that 2 tightly linked SNPs were associated with increased risk for the disease, rs907715 and rs6835457 , with odds ratios of 1.16 (CI: 1.1-1.22, p=2x10e-8) and 1.11 (CI:1.05-1.17, p=9x10e-5), respectively. (snpedia.com)
  • We found that 2 promoter region SNPs, −1811 A/G and −2835 A/C, a 3′ untranslated region SNP, +3726 T/C, and a common haplotype are associated with more aggressive prostate cancer. (aacrjournals.org)
  • We previously reported on an association between the C allele of a variable number of tandem repeat polymorphism in the 3' flanking region of IL-6 gene (IL-6vntr) and delayed initial onset and reduced AD risk. (unibas.ch)
  • By combining data on polymorphism levels in human noncoding DNA and the corresponding human-chimpanzee divergence, we show that the proportion of adaptive substitutions in these regions in hominids is very low. (nih.gov)
  • T polymorphism in 3′ untranslated region (rs2552). (aacrjournals.org)
  • A 1.7-kb HindIII/EcoRI fragment from the 3' flanking region of human carboxypeptidase detects a DNA polymorphism with BglIII. (nih.gov)
  • Our aim was to study the relationship between interleukin 1B ( IL-1B ) polymorphism, Helicobacter pylori infection, and gastric cancer in high prevalent (Shanxi) and low prevalent (Guangdong) regions in China. (bmj.com)
  • Cell vol. 98, Issue 3, Aug. 6, 1999, pp. 387-396 The Protein CTCF Is Required for the Enhancer Blocking Activity of Vertebrate Insulators. (freepatentsonline.com)
  • If a transcription factor binds to an enhancer in a 5′ flanking region, the DNA strand bends in a way that the transcription factor that is bound to the enhancer can also bind the promoter of a gene. (wikipedia.org)
  • UTF1 expression is, like the FGF-4 gene, regulated by the synergistic action of Oct-3/4 and another embryonic factor, Sox-2, implying that the requirement for Sox-2 by Oct-3/4 is not limited to the FGF-4 enhancer but is rather a general mechanism of activation for Oct-3/4. (asm.org)
  • Region 3 (base pairs −8118 to −7750 relative to the transcription start site), one of six conserved 5′ cis domains of the MafA promoter, is capable of directing β-cell-line-selective expression. (asm.org)
  • These regions primarily function in the regulation of gene transcription. (wikipedia.org)
  • It is typically 10 nucleotides long, and is present -30 to -20 nucleotides upstream from the transcription start site, in the core promoter region. (wikipedia.org)
  • A specific transcription factor called CAAT-binding protein binds to this region and aids in transcription in eukaryotes. (wikipedia.org)
  • Bacterial RNA polymerase binds to these regions to align itself and begin transcription. (wikipedia.org)
  • Polymorphisms in this region can lead to changes in the regulation of transcription. (wikipedia.org)
  • 3) a CAA triplet in the region of the presumed transcription start. (deepdyve.com)
  • These floxed mutant mice possess loxP sites flanking the exon 3-6 region of the Rorc gene. (jax.org)
  • These mice possess loxP sites on either side of the exon 3-6 region of the targeted gene. (jax.org)
  • One possible polyadenylation signal is found in the 3′-flanking region. (portlandpress.com)
  • 13] They investigated a 40 bp variable number tandem repeats (VNTR) located in the 3' untranslated region (3'UTR) of the dopamine transporter gene (DAT1) in ADHD families. (thefreelibrary.com)
  • We used next-generation sequencing to investigate the genetics and epigenetics of the cry1Ab coding region and its 3′ flanking genomic region in three different MON810 maize varieties. (springer.com)
  • The coding regions of Est-5B and Est-6 are about 80% similar at both the nucleotide and protein levels ( 3 ). (nap.edu)
  • and 3 ) an A-to-C substitution at nucleotide 748 led to amino acid substitution from histidine to proline at position 241 (H241P). (diabetesjournals.org)
  • Eight single nucleotide polymorphisms (SNP) in the NAT2 coding region and a variant in the 3′ flanking region were analyzed in 290 unrelated Kyrgyz and 140 unrelated Romanians by SNP-specific PCR analysis. (aacrjournals.org)
  • In virtually all organisms, copper is an essential cofactor in various enzymatic processes, such as oxidative phosphorylation, nucleotide biosynthesis, and reactive oxidative species detoxification, and harmful effects occur when these metals are limited [ 1 - 3 ]. (biochemj.org)
  • Polymorphisms in the 5′ flanking region of the DRD4 gene have been linked to ADHD, schizophrenia and methamphetamine abuse. (wikipedia.org)
  • Polymorphisms in the 5′ flanking region of the gene coding for oxytocin have been linked to mutations in promoter function, ultimately leading to potential disorders related to altered oxytocin levels and functionality. (wikipedia.org)
  • Abstract -We analyzed the distal promoter region of the thrombomodulin (TM) gene (nucleotides −300 to −2052) in subjects from the Paris Thrombosis Study (PATHROS), a French case-control study of venous thrombosis, to identify polymorphisms that might modify TM gene expression. (ahajournals.org)
  • All AGXT exons and 3 common polymorphisms which might synergistically interact with mutations, including P11L, I340 M and IVSI+74 bp were analyzed by direct sequencing in all family members. (nature.com)
  • 3. The method of claim 1 , wherein said CAR receptor polypeptide binding site is GGGTAGGGTTCACCGAAAGTTCACTCG (SEQ ID NO: 5). (google.com)
  • We have established a mega base scale physical map of the 5′‐ and 3′‐ flanking regions of the epidermal growth factor (EGF) receptor gene using CpG‐recognition rare‐cutting restriction enzymes and pulsed‐field gel electrophoresis. (elsevier.com)
  • Previous work has suggested that both the proximal 5′ flanking region and a polymorphic microsatellite element within that region of the vole Avpr1a gene are associated with variation in V1a receptor (V1aR) distribution and behavior, but neither has been causally linked. (prolekare.cz)
  • C-C chemokine ligand 2 (CCL2), also known as monocyte chemoattractant protein-1 (MCP-1), is a member of the C-C beta chemokine family that is produced by macrophages, fibroblasts, and endothelial cells to stimulate chemotaxis of monocyte/macrophages and other inflammatory cells through its receptor, CCR2 ( 2, 3 ). (aacrjournals.org)
  • The CAAT box is a crucial element of the 5′ flanking region of eukaryotic genomes. (wikipedia.org)
  • Combine the regions of NOS plant gene (eukaryote) with bacterial gene ( NPT II gene ) * NOS = nopaline opiant synthase * protein coding region is responsible for resistance to Kanaycin, coming from bacteria * Why we can use a protein coding region from a bacteria and has it being expressed by eukaryotic promoter? (coursehero.com)
  • The c-myc Insulator Element and Matrix Attachment Regions Define the c-myc Chromosomal Domain Molecular and Cellular Biology, Dec. 2003, p. 9338-9348, vol. 23, No. 24. (freepatentsonline.com)
  • Due to its central and essential role in bacterial cytokinesis, and its absence in higher eukaryotes, the FtsZ protein is considered an attractive antimicrobial drug target ( 3 , 19 , 21 , 22 , 25 , 44 ). (asm.org)
  • The 5′ flanking region contains the promoter, and may contain enhancers or other protein binding sites. (wikipedia.org)
  • Not to be confused with the 5′ untranslated region, this region is not transcribed into RNA or translated into a functional protein. (wikipedia.org)
  • 3. The hybrid molecule of claim 1, wherein said protein of (b) is a naturally-occurring toxin. (google.com.au)
  • Why does the protein coding region give rise to the protein of interest? (coursehero.com)
  • Dexras1/AGS-1, a steroid hormone-induced guanosine triphosphate-binding protein, inhibits 3′, 5′-cyclic adenosine monophosphate-stimulated secretion in AtT-20 corticotroph cells 1. (springer.com)
  • There are two putative TATA boxes and eight possible CAAT boxes lie in the 5′ flanking region. (portlandpress.com)
  • Anti-HA antibodies immunoprecipitated HA epitope-tagged SRSF4 (lanes 4 and 8), SRSF5 (lanes 2 and 6), and SRSF6 (lanes 3 and 7) (h:SRSF) proteins from HEK293T cells (lower panels). (nih.gov)
  • [11] As a Ras superfamily member, RASD1 shares several motifs characteristic of Ras proteins, including four highly conserved GTP binding pocket domains: the phosphate/magnesium binding regions GXXXXGK(S/T) (domain Σ1), DXXG (domain Σ2), and the guanine base binding loops NKXD (domain Σ3) and EXSAK (domain Σ4). (wikipedia.org)
  • This synergistic effect is likely the result of both passive DNA demethylation by DNMTi and active conversion of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) by ten-eleven translocation (TET) enzymes at LTR regions of ERVs, because vitamin C acts as a cofactor for TET proteins. (pnas.org)
  • The open reading frame of the Zika virus reads as follows: 5′-C-prM-E-NS1-NS2A-NS2B-NS3-NS4A-NS4B-N​S5-3′ and codes for a polyprotein that is subsequently cleaved into capsid (C), precursor membrane (prM), envelope (E), and non-structural proteins (NS). (kenyon.edu)
  • Analysis of multiple deletion fragments from the 3′-flanking region of the hGH-1 gene revealed a strong orientation- and position-independent silencing activity mapping between nucleotides 2158 and 2572 encompassing the Sx Alu repeat. (elsevier.com)
  • Garzon D, Yu G, Fahnestock M. A new brain-derived neurotrophic factor transcript and decrease in brain-derived neurotrophic factor transcripts 1, 2 and 3 in Alzheimer's disease parietal cortex. (springer.com)
  • These polymorphic sites include promoter regions of IL-1B at positions +3954, −511 (C-T transition), and −31 (T-C transition), and IL-1RN variable tandem repeats. (bmj.com)
  • From this HTF island, a 390‐kb NotI fragment was identified as the longest 5'‐flanking region and a 540‐kb MluI fragment as the longest 3′‐flanking region. (elsevier.com)
  • These 3 mutations were screened for in the entire study population of 327 patients and 398 controls. (ahajournals.org)
  • This is the case of PC and PS gene mutations, as well as the FV Leiden mutation (which modifies the activated PC cleavage site at position 506 of FVa 3 ) and the prothrombin gene 20210G/A mutation associated with high levels of circulating prothrombin. (ahajournals.org)
  • Primary hyperoxaluria type 3 (PH3), which represents the least severe PH form with good preservation of kidney function in most patients, is induced by gene mutations relevant with 4-hydroxy-2-oxoglutarate aldolase 1 (HOGA1) 6 . (nature.com)
  • Although a strong correlation between tubulin point mutation and resistance to taxane-containing therapy was detected in lung cancer patients ( 3 ), other studies have failed to confirm the presence of tubulin point mutations in patients with taxane-resistant lung cancer and ovarian cancer or have found this to be a rare clinical occurrence ( 4 - 6 ). (aacrjournals.org)
  • Trujillo, MA, Sakagashira, M & Eberhardt, NL 2006, ' The human growth hormone gene contains a silencer embedded within an Alu repeat in the 3′-flanking region ', Molecular Endocrinology , vol. 20, no. 10, pp. 2559-2575. (elsevier.com)
  • Evidence for widespread degradation of gene control regions in hominid genomes. (nih.gov)
  • By comparing the human and chimpanzee genomes, we show here that there is almost no evidence for conservation in these regions in hominids. (nih.gov)
  • A large EVE content has been found in Aedes aegypti and Aedes albopictus genomes among which a recently described Chuviridae viral family is of particular interest, owing to the abundance of EVEs derived from it, the discrepancy among the chuvirus endogenized gene regions and the frequent association with retrotransposons from the BEL-Pao superfamily. (frontiersin.org)
  • However, our results suggest that many features of species-specific expression patterns are mediated by elements outside of the immediate 5′ flanking region of the gene. (prolekare.cz)
  • In this paper we focus on the most common and commercially important laminarialean species, Saccharina japonica [ 4 , 5 , 15 ] and its morphological forms, inhabiting contrasting depths of the northwest Pacific region. (pubmedcentralcanada.ca)
  • The D. b. michaeli (eastern black rhino) is found in Kenya and Tanzania while D. b. minor is found in Tanzania to South Africa [ 3 , 11 ]. (hindawi.com)
  • We found that AfMac1 specifically bound to the promoter region of ctrC based on EMSA. (biochemj.org)
  • NAT2 is a gene with a 870-bp coding region mapped to chromosome 8p22. (aacrjournals.org)
  • First, the union of unbalanced complementary gametes in intercrosses of mice carrying reciprocal or Robertsonian translocations yield, at low frequency, embryos with maternal duplication and paternal deficiency for particular Chr regions as defined by the translocation breakpoint [11] - [13] . (plos.org)
  • In Saccharomyces cerevisiae , iron deficiency leads to activation and cytosol-to-nucleus translocation of two iron-regulatory activators, Aft1 and Aft2 ( 3 , 13 , 65 , 76 , 90 ). (asm.org)
  • Exons 3-6 of the targeted gene were flanked by loxP sites. (jax.org)
  • The regions containing identity to the rat gene were sequenced and shown to be 82% identical to exons 9 and 10 of the rat gene. (nih.gov)
  • This cassette contains all the introns, promoter regulatory elements, exons, and 2.5 kb of 5' and 2 kb of 3' flanking regions of Gfap . (jax.org)
  • We collected DNA from 28 families with deletions in the 3'-PAR1 region. (peerj.com)
  • The phenotype of patients with deletions in the 3'-PAR1 region is remarkably variable. (peerj.com)
  • Insertions and deletions in the 5′ flanking region of the insulin gene have been associated with type 2 diabetes. (wikipedia.org)
  • Furthermore, our analyses reveal that these properties are dictated by the unique ability of the Oct-3/4 POU-homeodomain that recognizes a variant of the Octamer motif in the UTF1 regulatory element. (asm.org)
  • 5'-flanking DNA to attempt to reveal conserved elements regulating tissue-specific expression in adults. (nap.edu)
  • The amplified 5′‐flanking regions were rearranged in different forms but were distinct in each cell line. (elsevier.com)
  • Three overlapping but distinct populations of B. burgdorferi corresponded to the geographic regions. (cdc.gov)
  • Luc expression was instead being driven by a previously unknown minor promoter activity within the gag-pol junction region. (nih.gov)
  • In eukaryotes, the 5′ flanking region has a complex set of regulatory elements such as enhancers, silencers, and promoters. (wikipedia.org)
  • The AfMac1-binding motif 5′-TGTGCTCA-3′ was identified from the promoter region of ctrC , and the addition of mutant ctrC lacking the AfMac1-binding motif failed to up-regulate ctrC in A. fumigatus . (biochemj.org)
  • To examine the role of misexpressions determined by two maternal copies of the Igf2 / H19 imprinting control region (ICR)-a chromatin insulator, we introduced a mutant ICR (ICR Δ ) into MatDup.dist7 fetuses. (plos.org)
  • The stimuli that emanate from activated growth factor receptors activate this kinase cascade through PI3K and a second messenger, phosphatidylinositol (3,4,5)-trisphosphate, which then binds to Akt. (hindawi.com)
  • Mac1 binds to a copper response element (5′-TTTGC(T/G)C(A/G)-3′), and copper binds to the C-terminal Cys-X2-His metal-binding domain of yeast Mac1 [ 14 , 15 , 17 ]. (biochemj.org)
  • Two types of deglycation enzymes have been identified: fructosyl-amino acid oxidases (FAODs) (EC 1.5.3) ( 9 ) and fructosamine kinases (FNKs) ( 5 , 26 ). (asm.org)
  • The corresponding amino acid and 3-deoxyglucosone are formed from fructosyl-amino acid by the mammalian enzyme, whereas another hydrolase is needed for deglycation of the phosphorylated compound produced by bacterial FNK. (asm.org)
  • Cyclin-dependent kinase 12 increases 3' end processing of growth factor-induced c-FOS transcripts. (nih.gov)
  • These effects impaired 3' end processing of c-FOS transcripts. (nih.gov)
  • Functional Phosphorylation Sites in the C-Terminal Region of the Multivalent Multifunctional Transcriptional Factor CTCF Mol Cell Biol. (freepatentsonline.com)
  • We have defined conserved and unconserved features of NepR structure that determine its function as an anti-σ factor and uncovered a functional role for intrinsically disordered regions of NepR in partner binding events required for GSR activation. (asm.org)
  • Analysis of a 2233 bp segment revealed a gene including a 1169 bp 5′ flanking region, a 417 bp open reading frame (ORF) and a 649 bp 3′ flanking region. (portlandpress.com)
  • The most common and the most severe one is PH1 accounting for approximately 80% of all patients, caused by insufficiency or loss of activity of liver-specific peroxisomal alanine-glyoxylate aminotransferase (AGT) 2 , which is a compact homodimer and belongs to the aspartate aminotransferase family of pyridoxal-phosphate (PLP) dependent enzymes 3 . (nature.com)
  • Between 1960s and 1980s wanton illegal poaching and loss of habitat due to increased human developments in areas that were formerly wilderness resulted in approximately 96% decline (65,000 to 3,800 individuals) in population black rhinoceros across their range in Africa [ 3 , 4 ]. (hindawi.com)
  • Identification of a glucocorticoid response element in the 3′-flanking region of the human Dexras1 gene. (springer.com)
  • 3]]] In 1968, isolation from human hosts occurred in residents of Nigeria. (kenyon.edu)