DNA Contamination: The presence of DNA from a source foreign to the sample being analysed.Streptococcus mutans: A polysaccharide-producing species of STREPTOCOCCUS isolated from human dental plaque.Enterobacter: Gram-negative gas-producing rods found in feces of humans and other animals, sewage, soil, water, and dairy products.Embryonic Stem Cells: Cells derived from the BLASTOCYST INNER CELL MASS which forms before implantation in the uterine wall. They retain the ability to divide, proliferate and provide progenitor cells that can differentiate into specialized cells.Fluorescence Recovery After Photobleaching: A method used to study the lateral movement of MEMBRANE PROTEINS and LIPIDS. A small area of a cell membrane is bleached by laser light and the amount of time necessary for unbleached fluorescent marker-tagged proteins to diffuse back into the bleached site is a measurement of the cell membrane's fluidity. The diffusion coefficient of a protein or lipid in the membrane can be calculated from the data. (From Segen, Current Med Talk, 1995).Streptococcus: A genus of gram-positive, coccoid bacteria whose organisms occur in pairs or chains. No endospores are produced. Many species exist as commensals or parasites on man or animals with some being highly pathogenic. A few species are saprophytes and occur in the natural environment.Epitopes, B-Lymphocyte: Antigenic determinants recognized and bound by the B-cell receptor. Epitopes recognized by the B-cell receptor are located on the surface of the antigen.Menu PlanningDNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Betula: A plant genus of the family BETULACEAE. The tree has smooth, resinous, varicolored or white bark, marked by horizontal pores (lenticels), which usually peels horizontally in thin sheets.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Adenosine Deaminase: An enzyme that catalyzes the hydrolysis of ADENOSINE to INOSINE with the elimination of AMMONIA.Patents as Topic: Exclusive legal rights or privileges applied to inventions, plants, etc.Nucleoside Deaminases: Catalyze the hydrolysis of nucleosides with the elimination of ammonia.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Pancreatic Polypeptide: A 36-amino acid pancreatic hormone that is secreted mainly by endocrine cells found at the periphery of the ISLETS OF LANGERHANS and adjacent to cells containing SOMATOSTATIN and GLUCAGON. Pancreatic polypeptide (PP), when administered peripherally, can suppress gastric secretion, gastric emptying, pancreatic enzyme secretion, and appetite. A lack of pancreatic polypeptide (PP) has been associated with OBESITY in rats and mice.Peptides: Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.Potyviridae: A family of RNA plant viruses with flexuous, filamentous particles and consisting of six genera: POTYVIRUS; Ipomovirus; Macluravirus; Rymovirus; Tritimovirus; and Bymovirus. All members of the family form cytoplasmic cylindrical inclusion bodies during infection.Potyvirus: A large genus of plant viruses of the family POTYVIRIDAE which infect mainly plants of the Solanaceae. Transmission is primarily by aphids in a non-persistent manner. The type species is potato virus Y.Solanum tuberosum: A plant species of the genus SOLANUM, family SOLANACEAE. The starchy roots are used as food. SOLANINE is found in green parts.Ilarvirus: A genus of the family BROMOVIRIDAE which infects mainly woody plants. Species are divided into ten subgroups. Tobacco streak virus is the type species.Anticipation, Genetic: The apparent tendency of certain diseases to appear at earlier AGE OF ONSET and with increasing severity in successive generations. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Plant Diseases: Diseases of plants.Iodide Peroxidase: A hemeprotein that catalyzes the oxidation of the iodide radical to iodine with the subsequent iodination of many organic compounds, particularly proteins. EC 1.11.1.8.Selenocysteine: A naturally occurring amino acid in both eukaryotic and prokaryotic organisms. It is found in tRNAs and in the catalytic site of some enzymes. The genes for glutathione peroxidase and formate dehydrogenase contain the TGA codon, which codes for this amino acid.Triiodothyronine, Reverse: A metabolite of THYROXINE, formed by the peripheral enzymatic monodeiodination of T4 at the 5 position of the inner ring of the iodothyronine nucleus.Selenoproteins: Selenoproteins are proteins that specifically incorporate SELENOCYSTEINE into their amino acid chain. Most selenoproteins are enzymes with the selenocysteine residues being responsible for their catalytic functions.Triiodothyronine: A T3 thyroid hormone normally synthesized and secreted by the thyroid gland in much smaller quantities than thyroxine (T4). Most T3 is derived from peripheral monodeiodination of T4 at the 5' position of the outer ring of the iodothyronine nucleus. The hormone finally delivered and used by the tissues is mainly T3.Thyroxine: The major hormone derived from the thyroid gland. Thyroxine is synthesized via the iodination of tyrosines (MONOIODOTYROSINE) and the coupling of iodotyrosines (DIIODOTYROSINE) in the THYROGLOBULIN. Thyroxine is released from thyroglobulin by proteolysis and secreted into the blood. Thyroxine is peripherally deiodinated to form TRIIODOTHYRONINE which exerts a broad spectrum of stimulatory effects on cell metabolism.Fucosyltransferases: Enzymes catalyzing the transfer of fucose from a nucleoside diphosphate fucose to an acceptor molecule which is frequently another carbohydrate, a glycoprotein, or a glycolipid molecule. Elevated activity of some fucosyltransferases in human serum may serve as an indicator of malignancy. The class includes EC 2.4.1.65; EC 2.4.1.68; EC 2.4.1.69; EC 2.4.1.89.Lewis Blood-Group System: A group of dominantly and independently inherited antigens associated with the ABO blood factors. They are glycolipids present in plasma and secretions that may adhere to the erythrocytes. The phenotype Le(b) is the result of the interaction of the Le gene Le(a) with the genes for the ABO blood groups.ABO Blood-Group System: The major human blood type system which depends on the presence or absence of two antigens A and B. Type O occurs when neither A nor B is present and AB when both are present. A and B are genetic factors that determine the presence of enzymes for the synthesis of certain glycoproteins mainly in the red cell membrane.Guanosine Diphosphate Fucose: A nucleoside diphosphate sugar formed from GDPmannose, which provides fucose for lipopolysaccharides of bacterial cell walls, and for blood group substances and other glycoproteins.Norovirus: A genus in the family CALICIVIRIDAE, associated with epidemic GASTROENTERITIS in humans. The type species, NORWALK VIRUS, contains multiple strains.Blood Group Antigens: Sets of cell surface antigens located on BLOOD CELLS. They are usually membrane GLYCOPROTEINS or GLYCOLIPIDS that are antigenically distinguished by their carbohydrate moieties.Autoimmune Lymphoproliferative Syndrome: Rare congenital lymphoid disorder due to mutations in certain Fas-Fas ligand pathway genes. Known causes include mutations in FAS, TNFSF6, NRAS, CASP8, and CASP10 proteins. Clinical features include LYMPHADENOPATHY; SPLENOMEGALY; and AUTOIMMUNITY.Alagille Syndrome: A multisystem disorder that is characterized by aplasia of intrahepatic bile ducts (BILE DUCTS, INTRAHEPATIC), and malformations in the cardiovascular system, the eyes, the vertebral column, and the facies. Major clinical features include JAUNDICE, and congenital heart disease with peripheral PULMONARY STENOSIS. Alagille syndrome may result from heterogeneous gene mutations, including mutations in JAG1 on CHROMOSOME 20 (Type 1) and NOTCH2 on CHROMOSOME 1 (Type 2).Lymphoproliferative Disorders: Disorders characterized by proliferation of lymphoid tissue, general or unspecified.Antigens, CD95: A tumor necrosis factor receptor subtype found in a variety of tissues and on activated LYMPHOCYTES. It has specificity for FAS LIGAND and plays a role in regulation of peripheral immune responses and APOPTOSIS. Multiple isoforms of the protein exist due to multiple ALTERNATIVE SPLICING. The activated receptor signals via a conserved death domain that associates with specific TNF RECEPTOR-ASSOCIATED FACTORS in the CYTOPLASM.Vaccines, DNA: Recombinant DNA vectors encoding antigens administered for the prevention or treatment of disease. The host cells take up the DNA, express the antigen, and present it to the immune system in a manner similar to that which would occur during natural infection. This induces humoral and cellular immune responses against the encoded antigens. The vector is called naked DNA because there is no need for complex formulations or delivery agents; the plasmid is injected in saline or other buffers.Vaccination: Administration of vaccines to stimulate the host's immune response. This includes any preparation intended for active immunological prophylaxis.Veterinary Drugs: Drugs used by veterinarians in the treatment of animal diseases. The veterinarian's pharmacological armamentarium is the counterpart of drugs treating human diseases, with dosage and administration adjusted to the size, weight, disease, and idiosyncrasies of the species. In the United States most drugs are subject to federal regulations with special reference to the safety of drugs and residues in edible animal products.Falconiformes: An order of diurnal BIRDS of prey, including EAGLES; HAWKS; buzzards; vultures; and falcons.Vaccines: Suspensions of killed or attenuated microorganisms (bacteria, viruses, fungi, protozoa), antigenic proteins, synthetic constructs, or other bio-molecular derivatives, administered for the prevention, amelioration, or treatment of infectious and other diseases.Viral Vaccines: Suspensions of attenuated or killed viruses administered for the prevention or treatment of infectious viral disease.Pancreatic Elastase: A protease of broad specificity, obtained from dried pancreas. Molecular weight is approximately 25,000. The enzyme breaks down elastin, the specific protein of elastic fibers, and digests other proteins such as fibrin, hemoglobin, and albumin. EC 3.4.21.36.Leukocyte Elastase: An enzyme that catalyzes the hydrolysis of proteins, including elastin. It cleaves preferentially bonds at the carboxyl side of Ala and Val, with greater specificity for Ala. EC 3.4.21.37.Exocrine Pancreatic Insufficiency: A malabsorption condition resulting from greater than 10% reduction in the secretion of pancreatic digestive enzymes (LIPASE; PROTEASES; and AMYLASE) by the EXOCRINE PANCREAS into the DUODENUM. This condition is often associated with CYSTIC FIBROSIS and with chronic PANCREATITIS.ElastinFeces: Excrement from the INTESTINES, containing unabsorbed solids, waste products, secretions, and BACTERIA of the DIGESTIVE SYSTEM.Pancreatitis, Chronic: INFLAMMATION of the PANCREAS that is characterized by recurring or persistent ABDOMINAL PAIN with or without STEATORRHEA or DIABETES MELLITUS. It is characterized by the irregular destruction of the pancreatic parenchyma which may be focal, segmental, or diffuse.
... flanking region of the human Dexras1 gene". Biochimica et Biophysica Acta. 1627 (2-3): 85-9. doi:10.1016/s0167-4781(03)00079-4 ... flanking region of this gene allows glucocorticoids to induce expression of RASD1.[12] ... perinuclear region of cytoplasm. • plasma membrane. • cell nucleus. • sarcoplasmic reticulum. • membrane. Biological process. • ... As a GTPase, RASD1 also shares motifs, such as in the regions G-1 to G-3, with other GTPases. The full-length RASD1 cDNA ...
Primers bound to the regions flanking the target DNA provide 3'-hydroxyl groups for DNA polymerase catalyzed extension. The ... This means that each newly synthesized strand of DNA will have a region complimentary to a primer. There is an exponential ... terminal region (5'-NTR) as well as a 3'-poly-A tail. The positive sense genome contains a single extended open reading frame ... terminal region of potato virus YN RNA. J. Gen. Virol., 70: 229-233. Dallaire, B.J., Charest, P.J., Devantier., Y. and ...
... flanking region of the human aortic smooth muscle actin gene". Nucleic Acids Res. 18 (5): 1318. doi:10.1093/nar/18.5.1318. PMC ... Analysis of a cDNA and 5' upstream region". J. Biol. Chem. 265 (3): 1683-7. PMID 2295650. Kamada S, Nakano Y, Kakunaga T (1990 ... 1991). "Transcriptional regulatory elements in the 5' upstream and first intron regions of the human smooth muscle (aortic type ... 99 (3): 627-36. PMID 1939373. Ueyama H, Ohsugi R (1990). "TaqI polymorphism in the 3′ ...
Acín A, Rodriguez M, Rique H, Canet E, Boutin JA, Galizzi JP (1999). "Cloning and characterization of the 5' flanking region of ... 86 (3): 372-5. doi:10.1038/sj.bjc.6600074. PMC 2375209 . PMID 11875702. Hu X, Murphy F, Karwautz A, Li T, Freeman B, Franklin D ... Mitochondrial uncoupling protein 3 is a protein that in humans is encoded by the UCP3 gene. UCP3 is a mitochondrial uncoupling ... 47 (3): 425-6. doi:10.1006/geno.1997.5135. PMID 9480760. Vidal-Puig A, Solanes G, Grujic D, Flier JS, Lowell BB (July 1997). " ...
... flanking region with the interaction of the miR-200c family of micro-RNA. MiR-200c is in turn modulated by the protein HuR ( ... flanking region". Gene. 409 (1-2): 100-8. doi:10.1016/j.gene.2007.11.015. PMID 18178340. Raspaglio G, De Maria I, Filippetti F ... flanking region at +168 nucleotides. This site binds basic helix-loop-helix (bHLH) hypoxia induced transcription factors Hif-1α ... and class III β-tubulin are limited to only 13aa within region 1-429aa, while all amino acids in region 430-450aa are divergent ...
... flanking region of the human ABO-secretor gene (FUT2) and association between FUT2 and FUT2/01 loci". Hum. Biol. 76 (5): 789-95 ... 1995). "Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H ... 34 (3): 314-8. PMID 15487706. Pang H, Soejima M, Koda Y, Kimura H (2005). "A novel tetrameric short tandem repeat located in ... 246 (3): 750-5. doi:10.1111/j.1432-1033.1997.t01-1-00750.x. PMID 9219535. Koda Y; Soejima M; Johnson PH; et al. (1997). " ...
The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. CYP1A2 also ... nontranslated region, and localization of gene to chromosome 15". Journal of Experimental Pathology. 3 (1): 1-17. PMID 3681487 ... doi:10.1210/mend-3-9-1399. PMID 2575218. Butler MA, Iwasaki M, Guengerich FP, Kadlubar FF (Oct 1989). "Human cytochrome P-450PA ... 51 (3): 313-9. doi:10.1016/0006-2952(95)02178-7. PMID 8573198. Hakkola J, Raunio H, Purkunen R, Pelkonen O, Saarikoski S, ...
Shimizu T, Kobayashi T, Ba-Thein W, Ohtani K, Hayashi H (1995). "Sequence analysis of flanking regions of the pfoA gene of ... flanking region". Microbiol Immunol. 39 (9): 677-86. doi:10.1111/j.1348-0421.1995.tb03256.x. PMID 8577281. This article ... 3 (9): 853-859. doi:10.1016/S0969-2126(01)00220-9. PMID 8535779. Bairoch, A. "Classification of glycosyl hydrolase families and ... Clostridium perfringens: beta-galactosidase gene (pbg) is located in the 3'- ...
Its binding site is a GC-rich sequence that is present in the cis-regulatory regions of several viral and cellular genes. AP2- ... flanking IRF6 were screened by direct sequencing for potential causative variants in 184 NSCL/P cases. The rare allele of the ... A search of NSCL/P cases for potential regulatory elements for IRF6 gene was made aligning genomic sequences to a 500 Kb region ... Sequencing of candidate genes in that region in 4 additional unrelated BOFS patients revealed 4 different de novo missense ...
... flanking regions of the NADH-dependent hydroxypyruvate reductase gene from Cucumis sativus L". Plant Molecular Biology. 28 (5 ... 103 (3): 933-941. doi:10.1104/pp.103.3.933. PMC 159066 . PMID 8022942. CS1 maint: Uses authors parameter (link) Sloan, J. S., B ... CS1 maint: Uses authors parameter (link) Daniel, S.G. and W.M. Becker (1995). "Transgenic analysis of the 5' and 3'- ... 3 (6): 867-874. doi:10.1111/j.1365-313X.1993.00867.x. CS1 maint: Uses authors parameter (link) http://www.cies.org/grantee/ ...
2000). "Characterization of the 5'-flanking and 5'-untranslated regions of the cyclic adenosine 3',5'-monophosphate-responsive ... untranslated region of human type 2 iodothyronine deiodinase mRNA contains a functional selenocysteine insertion sequence ... The 3' UTR of Sec-containing genes have a common stem-loop structure, the Sec insertion sequence (SECIS), which is necessary ... 144 (3): 937-946. doi:10.1210/en.2002-220960. PMID 12586771. Ambroziak M, Pachucki J, Chojnowski K, et al. (2003). "Pax-8 ...
... flanking region of the beta-globin gene. The CoTC core is highly conserved in the 3' UTR of other primate beta-globin genes. ... The CoTC process in the human beta-globin gene was proposed to involve an RNA self-cleaving activity located in the 3' ...
... flanking region MeSH G14.340.024.220.282 --- 5' flanking region MeSH G14.340.024.220.400 --- introns MeSH G14.340.024.220.760 ... flanking region MeSH G14.340.024.340.137.295 --- 5' flanking region MeSH G14.340.024.340.137.430 --- immunoglobulin switch ... locus control region MeSH G14.080.689.650 --- operator regions (genetics) MeSH G14.080.689.675 --- promoter regions (genetics) ... locus control region MeSH G14.340.024.630 --- nucleolus organizer region MeSH G14.340.024.686 --- operon MeSH G14.340.024.686. ...
... flanking region - 5' end - 5' flanking region - 5'-ribose- 3' - acrylamide gels - adenine - adenosine deaminase deficiency - ... Contents : Top 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z 3' end - 3' ...
The 5′-flanking region of a gene often denotes a region of DNA which is not transcribed into RNA. The 5′-flanking region ... flanking region is a region of DNA that is not copied into the mature mRNA, but which is present adjacent to 3′-end of the gene ... The 5′-untranslated region (5′-UTR) is a region of a gene which is transcribed into mRNA, and is located at the 5′-end of the ... flanking region often contains sequences that affect the formation of the 3′-end of the message. It may also contain enhancers ...
Only the region between the start and stop codons encodes the final protein product. The flanking untranslated regions (UTRs) ... Indeed, the intron regions of a gene can be considerably longer than the exon regions. Once spliced together, the exons form a ... These sequence regions can either be next to the transcribed region (the promoter) or separated by many kilobases (enhancers ... Exon regions are retained in the final mature mRNA molecule, while intron regions are spliced out (excised) during post- ...
Additionally, flanking regions outside this immunostimulatory hexamer must be guanine-rich to ensure binding and uptake into ... Accessory regions pertaining to the plasmid backbone may engage in a wide range of structural instability phenomena. Well-known ... The optimal immunostimulatory sequence is an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines. ... Extrapolation of this data to other species requires caution - individual species may require different flanking sequences, as ...
There is a non coding regions: the 5′ region of 40 nt and the 3region of 137 nt. This open reading frame encodes several ... The M segment RNA is 4,818 nucleotides in length and contains one open reading frame flanked by 5′ and 3′ non coding regions of ... It contains a unique potential N-gly site in the Gn and Gc glycoprotein regions at amino acids 612 and 1514 respectively. The S ... noncoding regions are 49 nt and 193 nt in length respectively. Sang R, Onyango C, Gachoya J, Mabinda E, Konongoi S, Ofula V, ...
Vamvakopoulos NC, Chrousos GP (1994). "Structural organization of the 5' flanking region of the human corticotropin releasing ... 1990). "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Lett. 267 (1): 1- ... "Annals of internal medicine 102 (3): 344-358. PMID 2982307.. *↑ Grammatopoulos, D K; Dai Y, Randeva H S, Levine M A, Karteris E ... Med. 1 (5): 460-3. PMID 7585095. doi:10.1038/nm0595-460.. *. Slominski A, Ermak G, Hwang J; et al. (1995). "Proopiomelanocortin ...
... flanking region". Journal of Biochemistry. 101 (3): 591-9. doi:10.1093/jb/101.3.591. PMID 3648024. Kawashima I, Tani T, Mita- ... 44 (1): 210-3. PMID 9952246. Borowitz D, Baker SS, Duffy L, Baker RD, Fitzpatrick L, Gyamfi J, Jarembek K (September 2004). " ... 44 (1): 210-3. PMID 9952246. Gullo L, Ventrucci M, Tomassetti P, Migliori M, Pezzilli R (January 1999). "Fecal elastase 1 ... 145 (3): 322-6. doi:10.1016/j.jpeds.2004.04.049. PMID 15343184. Edelstein C, Italia JA, Scanu AM (April 1997). " ...
The 5' flanking region is a region of DNA that is adjacent to the 5' end of the gene. The 5' flanking region contains the ... 5' flanking regions differ between prokaryotes and eukaryotes. In eukaryotes, the 5' flanking region has a complex set of ... Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. Polymorphisms in this region can ... flanking region of the insulin gene have been associated with type 2 diabetes. Polymorphisms in the 5' flanking region of the ...
Mizui Y, Yamazaki K, Kuboi Y, Sagane K, Tanaka I (Sep 2000). "Characterization of 5'-flanking region of human aggrecanase-1 ( ... Adjacent to the C-terminal TSR is a disintegrin-like domain, a cysteine-rich region that stacks against the active-site of the ... Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a ... 5 (3): 169-76. doi:10.1093/dnares/5.3.169. PMID 9734811. Tortorella MD, Burn TC, Pratta MA, Abbaszade I, Hollis JM, Liu R, ...
Apr 2013). "Genomic Regions Flanking E-Box Binding Sites Influence DNA Binding Specificity of bHLH Transcription Factors ... The CT-Rich Regions(CTRR) located about 23 nucleotides upstream of the E-box is important in E-box binding, transactivation ( ... Besides, each bHLH monomer has a basic region, which helps mediate recognition between the bHLH monomer and the E-box (the ... Furthermore, the sequence constraints on the region around the circadian E-box are not fully understood: it is believed to be ...
Vamvakopoulos NC, Chrousos GP (1994). "Structural organization of the 5' flanking region of the human corticotropin releasing ... "Structural analysis of the regulatory region of the human corticotropin releasing hormone gene". FEBS Lett. 267 (1): 1-5. doi: ... 47 (3): 113-6. doi:10.1159/000132525. PMID 3259914. Sasaki A, Tempst P, Liotta AS, Margioris AN, Hood LE, Kent SB, Sato S, ... 1 (5): 460-3. doi:10.1038/nm0595-460. PMID 7585095. Slominski A, Ermak G, Hwang J, Chakraborty A, Mazurkiewicz JE, Mihm M (1995 ...
... core protein is mediated by a novel structural motif in the transmembrane domain and ectodomain flanking region". The Journal ... cleaves off heparan sulfate to expose a binding site in the N-terminal region of syndecan-1's core protein. Three SDC1 elements ... "The mapping and visual ordering of the human syndecan-1 and N-myc genes near the telomeric region of chromosome 2p". Human ... 3) An N-terminal chondroitin sulfate chain that also likely binds to the cationic face. Point mutagenesis of lacritin has ...
The hair is longest on the flanks and rump. In the fall, the summer coat is gradually replaced by a thicker, coarse-haired ... Douzery, E.; Randi, E. (November 1997). "The mitochondrial control region of Cervidae: evolutionary patterns and phylogenetic ... studies of mitochondrial control region and cytochrome b DNA sequences placed it near Capreolus within an Old World section of ... 2.4-3 in 20-31 lbs The water deer has narrow pectoral and pelvic girdles, long legs, and a long neck. The powerful hind legs ...
Localization of Genetic Elements and Characterization of Unknown Flanking DNA, Lateral Diffusion and Exocytosis of Membrane ... Video articles in JoVE about 3 flanking region include Generation of Marked and Markerless Mutants in Model Cyanobacterial ... Flanking Region: The region of DNA which borders the 3 end of a transcription unit and where a variety of regulatory sequences ... Linear Amplification Mediated PCR - Localization of Genetic Elements and Characterization of Unknown Flanking DNA. Richard ...
... flanking genomic region in three different MON810 maize varieties. Genetic characterization of the cry1Ab coding region allowed ... flanking genomic region in MON810 maize using next-generation sequencing. ... In conclusion, the variation in the coding region is either due to the increased age of the seeds from the tested maize ... Specifically, position 71 of the analyzed region varied in 15 of 600 samples tested and thus appears to be a mutational hotspot ...
... flanking SHOX region in order to determine the relevance of the regulatory sequences in this region.Design. We collected DNA ... flanking region. Recently, a 47.5 kb recurrent PAR1 deletion downstream of SHOX was reported, but its frequency and clinical ... PAR1 region. Clinical data were available from 23 index patients and 21 relatives.Results. In 9 families (20 individuals) a ... PAR1 region is remarkably variable. Height, sitting height/height ratio and the presence of Madelung deformity were not ...
... a larger PCR product that includes the flanking regions, we have to choose a larger region to be used for primer design. To see ... covering ONLY the mRNA coding region and a bit of the downstream flanking region. (See LepR3mRNA.gen). Therefore, if we want ... This approach is especially useful if the target is a complete copy of the gene, including the flanking regions which may ... For simplicity, lets say that the region to be searched by PrimerBLAST should include 1000 bp flanking the desired product. ...
... flanking region 1. (B) Depletion of CDK12 has little effect on levels of RNAPII at the c-FOS gene. ChIPs were performed using ... flanking regions 1 and 2, respectively. (B) CDK12 depletion does not affect c-FOS RNA splicing. CDK12-depleted or control cells ... A) Knockdown of eIF4A3 reduces CDK12 enrichment at the c-FOS exon 2/intron 2 region and the polyadenylation site. ChIPs were ... Horizontal lines below transcripts represent regions amplified by RT-qPCR. Primers span exon-exon junctions, as follows: exons ...
... flanking region TCTGATTGAGATATTGATTGCCCCCGTAGCTGCAAAAATTTAGCCCTCTG SNP nucleotide AC SNPdb format ... 3 Position 60.59 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region TCAGCGCATCTCTGTGATTTCACCTATCAGAATCGTACCCACTAGGGGTT SNP nucleotide AG SNPdb format ...
... flanking region GTGCCAAGAGAATTCATATGGCCAGTCAATAAAGCTCGCTATTTAGAGCC SNP nucleotide TC SNPdb format ...
... flanking region ATTCTCATGCCTGAGAACACTGATGTTAATAAAGCATCACTGGGATCAAA SNP nucleotide AT SNPdb format ...
... flanking region ATTGATGACATCAAAATTGCCAGATGAAGCCACAGTCCCCCTTGCATTTG SNP nucleotide AC SNPdb format ...
... flanking region TTTTTTTTGTTAGAGATGTCGCCCACTAGTTCACTACCATGAAAAGGGGA SNP nucleotide TG SNPdb format ...
... flanking region AATTTACACAGCAAAGTGTCAATAGTTTTTTTGTTCTTTTTTACACATTT SNP nucleotide AG SNPdb format ... 3 Position 59.31 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region CTTCTTCTCGCTCANTNTCGGTTTAACAAGTCTGCTTAGTCTTNCTGACACAATCATTGAGTAATGCAGNGGAAAGGGTTTGAAAATAATGAACCTTAAT SNP ...
... flanking region CCCAAGTACTTAACACGGTCAGGACCATACCATGGGCTACCAGAGGAAGC SNP nucleotide TG SNPdb format ... 3 Position 0.54 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region TTGATAGTTGGCGCAAGGCTTAATTGGCTTTTGCATTTCGGAGAGCCACC SNP nucleotide CG SNPdb format ...
... flanking region TTTTCGCTTTAGCCCCTTACGGACCATACTGGCGTAANATACGTAAAATGGTAACTCTTGAACTCTTAACCAACAGTCGCCTTGAGAAGCTAAAACATGT SNP ...
... flanking region CAACTTCTTATTCTAAAAACTTTCCACATGACATGTTCAAGAGCACGACACTTTGNTACATTTTTGGCTGANTNGTTAAGATACTTAAACAGCTGATCAT SNP ...
... flanking region CCCCTGTATTTATGGGCTTCATTTTCACAGCGACGTTTCTTATTGATTCG SNP nucleotide AT SNPdb format ... 3 Position 57.05 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region TTATGTCGGTGACAGAGTATGAACACTTGCTCCATTCTGACAAATAGCCA SNP nucleotide TC SNPdb format ... 3 Position 61.00 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region AGATTATATTTTCTCATCTATGCTGATTGTTTGTTTGATCGCAGATGCATGATAAAGCTGTGAAATTGTATGCCGAATTGGCAGAGGTAGCCATTAACAG SNP ... 3 Position 61.59 MB Confidence uncalculated Protocol SNP Tomato - Kazusa and SolCAP markers mapped to genome. ...
... flanking region CTTTGTCAATCAAGAGACAAGGATGGCGAAGATGGTAATAAAAGCAACCATTTCTTTTTTCGAGTGCTTTCTTCCAGTTTAGATTATAAAAGTTCCTCTT SNP ...
... flanking region CTCCCAATGACTAGCTTCTACAGGCATGCTGAAAANGGACATTTTTTGGTNACCTCANTGCTGCATTNCATATTTGAAGGTTTTGTTCTGCTGTTGAGAG SNP ...
... flanking region CCTAAAGAATGTCCCTCGTCTGGTTGAAGCATTTCTGCTAGGTGACATTGAGCAGACAGAGAGTCTTGATTTTGCAAAGATTTTCGANTCTTGTTCTGCT SNP ...
... flanking region CCAGGGGAAGTTTCTTTAGGTCAGAATCTCTCAAATTTGTTAAGACTTGGTTTACTGTATAAGTTTGGTGGGATTTATTTAGATACTGATGTTATAGTGT SNP ...
... flanking region AATCGAAACAAGGGGAGTTATTGTTAGGTGGGTATGTAGGATCATGGCTTCTATATGCATCACAGCCTTATCCCAAATTAAAC SNP nucleotide AT SNPdb ...
  • We used next-generation sequencing to investigate the genetics and epigenetics of the cry1Ab coding region and its 3flanking genomic region in three different MON810 maize varieties. (springer.com)
  • 1995). "Molecular cloning of a human genomic region containing the H blood group alpha(1,2)fucosyltransferase gene and two H locus-related DNA restriction fragments. (wikipedia.org)
  • For example, a genomic region that is present in one species, but is not present in several other related species suggests that the region may have been horizontally transferred. (wikipedia.org)
  • Flanking SNPs are Single nucleotide polymorphisms (SNP) that appear in the flanking region. (wikipedia.org)
  • In a single strand of DNA or RNA, the chemical convention of naming carbon atoms in the nucleotide sugar-ring means that there will be a 5′-end, which frequently contains a phosphate group attached to the 5′ carbon of the ribose ring, and a 3′-end (usually pronounced "five prime end" and "three prime end"), which typically is unmodified from the ribose -OH substituent. (wikipedia.org)
  • Epigenetic analysis revealed a low degree of methylation, making it difficult to associate the coding region variants with methylation status. (springer.com)
  • 3) MHC gene variants are highly polymorphic (diversely varying from organism to organism within a species). (wikipedia.org)
  • Allele frequency of exon 3 and exon 6 splice at an alliance mutation were analyzed to be similar in African American and mende tribe and was absent in Caucasians. (wikipedia.org)
  • The CYP3A5*3 allele is linked with a poor metabolization of medication. (wikipedia.org)
  • Estrogen receptor alpha (ERα), also known as NR3A1 (nuclear receptor subfamily 3, group A, member 1), is one of two main types of estrogen receptor, a nuclear receptor that is activated by the sex hormone estrogen. (wikipedia.org)
  • Later, the separation of fairy armadillos subfamily from their tolypeutine sister-group was estimated to have occurred 32 ± 3 Mya. (wikipedia.org)
  • Differences between Class I (the most commonly represented and constitutively expressed isotype) and class III β-tubulin are limited to only 13aa within region 1-429aa, while all amino acids in region 430-450aa are divergent. (wikipedia.org)
  • Giuseppe Lolaico (born 3 March 1982) is an Italian footballer who plays for Potenza F.C.. Primarily a full-back, he could play on both flank and occasionally plays as a winger. (wikipedia.org)
  • Significantly altered from its original channel, it flows through a primarily rural farming region of reclaimed cropland, south of Lake Michigan. (wikipedia.org)