Chemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and Equipment
1-Pyrroline-5-Carboxylate DehydrogenasePyrroline Carboxylate ReductasesProline OxidaseOxidoreductases Acting on CH-NH Group DonorsProline2-Aminoadipic AcidL-Lysine 6-TransaminaseCyclic N-OxidesSpin TrappingSpin LabelsFree RadicalsBacterial ProteinsElectron Spin Resonance SpectroscopyL-Lactate DehydrogenaseNitrogen OxidesAlcohol DehydrogenaseHydroxyl Radical
1-Pyrroline-5-Carboxylate Dehydrogenase
An enzyme that catalyzes the oxidation of 1-pyrroline-5-carboxylate to L-GLUTAMATE in the presence of NAD. Defects in the enzyme are the cause of hyperprolinemia II.
Pyrroline Carboxylate Reductases
A group of enzymes that catalyze the reduction of 1-pyrroline carboxylate to proline in the presence of NAD(P)H. Includes both the 2-oxidoreductase (EC 1.5.1.1) and the 5-oxidoreductase (EC 1.5.1.2). The former also reduces 1-piperidine-2-carboxylate to pipecolate and the latter also reduces 1-pyrroline-3-hydroxy-5-carboxylate to hydroxyproline.
Proline Oxidase
The first enzyme of the proline degradative pathway. It catalyzes the oxidation of proline to pyrroline-5-carboxylic acid in the presence of oxygen and water. The action is not reversible. The specific activity of proline oxidase increases with age. EC 1.5.3.-.
Oxidoreductases Acting on CH-NH Group Donors
Enzymes catalyzing the dehydrogenation of secondary amines, introducing a C=N double bond as the primary reaction. In some cases this is later hydrolyzed.
Proline
A non-essential amino acid that is synthesized from GLUTAMIC ACID. It is an essential component of COLLAGEN and is important for proper functioning of joints and tendons.
2-Aminoadipic Acid
A metabolite in the principal biochemical pathway of lysine. It antagonizes neuroexcitatory activity modulated by the glutamate receptor, N-METHYL-D-ASPARTATE; (NMDA).
L-Lysine 6-Transaminase
A PYRIDOXAL PHOSPHATE containing enzyme that catalyzes the transfer of amino group of L-LYSINE onto 2-oxoglutarate to generate 2-aminoadipate 6-semialdehyde and L-GLUTAMATE.
Cyclic N-Oxides
Heterocyclic compounds in which an oxygen is attached to a cyclic nitrogen.
Spin Trapping
A technique for detecting short-lived reactive FREE RADICALS in biological systems by providing a nitrone or nitrose compound for an addition reaction to occur which produces an ELECTRON SPIN RESONANCE SPECTROSCOPY-detectable aminoxyl radical. In spin trapping, the compound trapping the radical is called the spin trap and the addition product of the radical is identified as the spin adduct. (Free Rad Res Comm 1990;9(3-6):163)
Spin Labels
Molecules which contain an atom or a group of atoms exhibiting an unpaired electron spin that can be detected by electron spin resonance spectroscopy and can be bonded to another molecule. (McGraw-Hill Dictionary of Chemical and Technical Terms, 4th ed)
Free Radicals
Highly reactive molecules with an unsatisfied electron valence pair. Free radicals are produced in both normal and pathological processes. They are proven or suspected agents of tissue damage in a wide variety of circumstances including radiation, damage from environment chemicals, and aging. Natural and pharmacological prevention of free radical damage is being actively investigated.
Bacterial Proteins
Proteins found in any species of bacterium.
Electron Spin Resonance Spectroscopy
A technique applicable to the wide variety of substances which exhibit paramagnetism because of the magnetic moments of unpaired electrons. The spectra are useful for detection and identification, for determination of electron structure, for study of interactions between molecules, and for measurement of nuclear spins and moments. (From McGraw-Hill Encyclopedia of Science and Technology, 7th edition) Electron nuclear double resonance (ENDOR) spectroscopy is a variant of the technique which can give enhanced resolution. Electron spin resonance analysis can now be used in vivo, including imaging applications such as MAGNETIC RESONANCE IMAGING.
L-Lactate Dehydrogenase
A tetrameric enzyme that, along with the coenzyme NAD+, catalyzes the interconversion of LACTATE and PYRUVATE. In vertebrates, genes for three different subunits (LDH-A, LDH-B and LDH-C) exist.
Nitrogen Oxides
Inorganic oxides that contain nitrogen.
Alcohol Dehydrogenase
A zinc-containing enzyme which oxidizes primary and secondary alcohols or hemiacetals in the presence of NAD. In alcoholic fermentation, it catalyzes the final step of reducing an aldehyde to an alcohol in the presence of NADH and hydrogen.
Hydroxyl Radical
The univalent radical OH. Hydroxyl radical is a potent oxidizing agent.

Molecular enzymology of mammalian Delta1-pyrroline-5-carboxylate synthase. Alternative splice donor utilization generates isoforms with different sensitivity to ornithine inhibition. (1/62)

Delta1-Pyrroline-5-carboxylate synthase (P5CS; EC not assigned), a mitochondrial inner membrane, ATP- and NADPH-dependent, bifunctional enzyme, catalyzes the reduction of glutamate to Delta1-pyrroline-5-carboxylate, a critical step in the de novo biosynthesis of proline and ornithine. We utilized published plant P5CS sequence to search the expressed sequence tag data base and cloned two full-length human P5CS cDNAs differing in length by 6 base pairs (bp) in the open reading frame. The short cDNA has a 2379-bp open reading frame encoding a protein of 793 residues; the long cDNA, generated by "exon sliding," a form of alternative splicing, contains an additional 6-bp insert following bp +711 of the short form resulting in inclusion of two additional amino acids in the region predicted to be the gamma-glutamyl kinase active site of P5CS. The long form predominates in all tissues examined except gut. We also isolated the corresponding long and short murine P5CS transcripts. To confirm the identity of the putative P5CS cDNAs, we expressed both human forms in gamma-glutamyl kinase- and gamma-glutamyl phosphate reductase-deficient strains of Saccharomyces cerevisiae and showed that they conferred the proline prototrophy. Additionally, we found expression of the murine putative P5CS cDNAs conferred proline prototrophy to P5CS-deficient Chinese hamster ovary cells (CHO-K1). We utilized stable CHO-K1 cell transformants to compare the biochemical characteristics of the long and short murine P5CS isoforms. We found that both confer P5CS activity and that the short isoform is inhibited by L-ornithine with a Ki of approximately 0.25 mM. Surprisingly, the long isoform is insensitive to ornithine inhibition. Thus, the two amino acid insert in the long isoform abolishes feedback inhibition of P5CS activity by L-ornithine.  (+info)

The sfr6 mutation in Arabidopsis suppresses low-temperature induction of genes dependent on the CRT/DRE sequence motif. (2/62)

The sfr mutations, which result in sensitivity to freezing after cold acclimation, define genes that are required for freezing tolerance. We tested plants homozygous for mutations sfr2 to sfr7 for cold-induced gene expression and found that sfr 6 plants were deficient in cold-inducible expression of the genes KIN1, COR15a, and LTI78, which all contain the C repeat/dehydration-responsive element (CRT/DRE) motif in their promoters. Similarly, sfr 6 plants failed to induce KIN1 normally in response to either osmotic stress or the application of abscisic acid. In contrast, cold-inducible expression of genes CBF1, CBF2, CBF3, and ATP5CS1, which lack the CRT/DRE motif, was not affected. The freezing-sensitive phenotype that defines sfr 6 also was found to be tightly linked to the gene expression phenotype. To determine whether the failure of cold induction of CRT/DRE-containing genes in sfr 6 was due to altered low-temperature calcium signaling, cold-induced cytosolic-free calcium ([Ca2+]cyt) elevations were investigated in the sfr 6 mutant, but these were found to be indistinguishable from those of the wild type. We discuss the possibilities that CRT/DRE binding proteins (such as CBF1) require activation to play a role in transcription and that the SFR6 protein is a vital component of their activation.  (+info)

Proline accumulation in developing grapevine fruit occurs independently of changes in the levels of delta1-pyrroline-5-carboxylate synthetase mRNA or protein. (3/62)

Mature fruit of grapevine (Vitis vinifera) contains unusually high levels of free proline (Pro; up to 24 micromol or 2.8 mg/g fresh weight). Pro accumulation does not occur uniformly throughout berry development but only during the last 4 to 6 weeks of ripening when both berry growth and net protein accumulation have ceased. In contrast, the steady-state levels of both the mRNA encoding V. vinifera Delta1-pyrroline-5-carboxylate synthetase (VVP5CS), a key regulatory enzyme in Pro biosynthesis, and its protein product remain relatively uniform throughout fruit development. In addition, the steady-state protein levels of Pro dehydrogenase, the first enzyme in Pro degradation, increased throughout early fruit development but thereafter remained relatively constant. The developmental accumulation of free Pro late in grape berry ripening is thus clearly distinct from the osmotic stress-induced accumulation of Pro in plants. It is not associated with either sustained increases in steady-state levels of P5CS mRNA or protein or a decrease in steady-state levels of Pro dehydrogenase protein, suggesting that other physiological factors are important for its regulation.  (+info)

Metabolite repression and inducer exclusion in the proline utilization gene cluster of Aspergillus nidulans. (4/62)

The clustered prnB, prnC, and prnD genes are repressed by the simultaneous presence of glucose and ammonium. A derepressed mutation inactivating a CreA-binding site acts in cis only on the permease gene (prnB) while derepression of prnD and prnC is largely the result of reversal of inducer exclusion.  (+info)

Removal of feedback inhibition of delta(1)-pyrroline-5-carboxylate synthetase results in increased proline accumulation and protection of plants from osmotic stress. (5/62)

The Delta(1)-pyrroline-5-carboxylate synthetase (P5CS; EC not assigned) is the rate-limiting enzyme in proline (Pro) biosynthesis in plants and is subject to feedback inhibition by Pro. It has been suggested that the feedback regulation of P5CS is lost in plants under stress conditions. We compared Pro levels in transgenic tobacco (Nicotiana tabacum) plants expressing a wild-type form of Vigna aconitifolia P5CS and a mutated form of the enzyme (P5CSF129A) whose feedback inhibition by Pro was removed by site-directed mutagenesis. Transgenic plants expressing P5CSF129A accumulated about 2-fold more Pro than the plants expressing V. aconitifolia wild-type P5CS. This difference was further increased in plants treated with 200 mM NaCl. These results demonstrated that the feedback regulation of P5CS plays a role in controlling the level of Pro in plants under both normal and stress conditions. The elevated Pro also reduced free radical levels in response to osmotic stress, as measured by malondialdehyde production, and significantly improved the ability of the transgenic seedlings to grow in medium containing up to 200 mM NaCl. These findings shed new light on the regulation of Pro biosynthesis in plants and the role of Pro in reducing oxidative stress induced by osmotic stress, in addition to its accepted role as an osmolyte.  (+info)

Genetic manipulation of the metabolism of polyamines in poplar cells. The regulation of putrescine catabolism. (6/62)

We investigated the catabolism of putrescine (Put) in a non-transgenic (NT) and a transgenic cell line of poplar (Populus nigra x maximowiczii) expressing a mouse (Mus musculus) ornithine (Orn) decarboxylase (odc) cDNA. The transgenic cells produce 3- to 4-fold higher amounts of Put than the NT cells. The rate of loss of Put from the cells and the initial half-life of cellular Put were determined by feeding the cells with [U-(14)C]Orn and [1,4-(14)C]Put as precursors and following the loss of [(14)C]Put in the cells at various times after transfer to label-free medium. The amount of Put converted into spermidine as well as the loss of Put per gram fresh weight were significantly higher in the transgenic cells than the NT cells. The initial half-life of exogenously supplied [(14)C]Put was not significantly different in the two cell lines. The activity of diamine oxidase, the major enzyme involved in Put catabolism, was comparable in the two cell lines even though the Put content of the transgenic cells was severalfold higher than the NT cells. It is concluded that in poplar cells: (a) exogenously supplied Orn enters the cells and is rapidly converted into Put, (b) the rate of Put catabolism is proportional to the rate of its biosynthesis, and (c) the increased Put degradation occurs without significant changes in the activity of diamine oxidase.  (+info)

A plant gene up-regulated at rust infection sites. (7/62)

Expression of the fis1 gene from flax (Linum usitatissimum) is induced by a compatible rust (Melampsora lini) infection. Infection of transgenic plants containing a beta-glucuronidase (GUS) reporter gene under the control of the fis1 promoter showed that induction is highly localized to those leaf mesophyll cells within and immediately surrounding rust infection sites. The level of induction reflects the extent of fungal growth. In a strong resistance reaction, such as the hypersensitive fleck mediated by the L6 resistance gene, there is very little fungal growth and a microscopic level of GUS expression. Partially resistant flax leaves show levels of GUS expression that were intermediate to the level observed in the fully susceptible infection. Sequence and deletion analysis using both transient Agrobacterium tumefaciens expression and stable transformation assays have shown that the rust-inducible fis1 promoter is contained within a 580-bp fragment. Homologs of fis1 were identified in expressed sequence tag databases of a range of plant species including dicots, monocots, and a gymnosperm. Homologous genes isolated from maize (Zea mays; mis1), barley (Hordeum vulgare; bis1), wheat (Triticum aestivum; wis1), and Arabidopsis encode proteins that are highly similar (76%-82%) to the FIS1 protein. The Arabidopsis homologue has been reported to encode a delta1-pyrroline-5-carboxylate dehydrogenase that is involved in the catabolism of proline to glutamate. RNA-blot analysis showed that mis1 in maize and the bis1 homolog in barley are both up-regulated by a compatible infection with the corresponding species-specific rust. The rust-induced genes homologous to fis1 are present in many plants. The promoters of these genes have potential roles for the engineering of synthetic rust resistance genes by targeting transgene expression to the sites of rust infection.  (+info)

Molecular mechanisms of proline-mediated tolerance to toxic heavy metals in transgenic microalgae. (8/62)

Pro has been shown to play an important role in ameliorating environmental stress in plants and microorganisms, including heavy metal stress. Here, we describe the effects of the expression of a mothbean delta(1)-pyrroline-5-carboxylate synthetase (P5CS) gene in the green microalga Chlamydomonas reinhardtii. We show that transgenic algae expressing the mothbean P5CS gene have 80% higher free-Pro levels than wild-type cells, grow more rapidly in toxic Cd concentrations (100 microM), and bind fourfold more Cd than wild-type cells. In addition, Cd-K edge extended x-ray absorption fine structure studies indicated that Cd does not bind to free Pro in transgenic algae with increased Pro levels but is coordinated tetrahedrally by sulfur of phytochelatin. In contrast to P5CS-expressing cells, Cd is coordinated tetrahedrally by two oxygen and two sulfur atoms in wild-type cells. Measurements of reduced/oxidized GSH ratios and analyses of levels of malondialdehyde, a product of the free radical damage of lipids, indicate that free Pro levels are correlated with the GSH redox state and malondialdehyde levels in heavy metal-treated algae. These results suggest that the free Pro likely acts as an antioxidant in Cd-stressed cells. The resulting increased GSH levels facilitate increased phytochelatin synthesis and sequestration of Cd, because GSH-heavy metal adducts are the substrates for phytochelatin synthase.  (+info)

Matki Indian Moth Bean Vigna Aconitifolia Seeds | Fair Dinkum SeedsMatki Indian Moth Bean Vigna Aconitifolia Seeds | Fair Dinkum Seeds
Matki Indian Moth Bean Vigna Aconitifolia Seeds Packet of 30+ freshly harvested home grown seeds! This is a very handy little nitrogen fixing legume that you dont see grown in Australia very often. Its native to India and Pakistan it is super drought tolerant. Over there they grown heaps both as a food crop and […]
https://fairdinkumseeds.com/products-page/beans-peas-and-other-legumes/matki-indian-moth-bean-vigna-aconitifolia-seeds/
Vigna aconitifolia - WikipediaVigna aconitifolia - Wikipedia
Vigna aconitifolia is a drought-resistant legume, commonly grown in arid and semi-arid regions of India. It is commonly called mat bean, moth bean, matki, Turkish gram or dew bean. The pods, sprouts and protein rich seeds of this crop are commonly consumed in India. Moth bean can be grown on many soil types, and can also act as a pasture legume. Moth bean is an herbaceous creeping annual which grows to approximately 40 cm high. Yellow flowers on its hairy and densely packed branches develop into yellow-brown pods, 2 to 3 inches in length The seeds of these pods contain approximately 22-24% protein. Due to its drought resistant qualities, its ability to combat soil erosion and its high protein content, moth bean has been identified as possibly a more significant food source in the future. It has been suggested that its suitability as a grain legume in semi-arid Africa should be further investigated. Belonging to the family Fabaceae (sub-family Papilionaceae), the moth bean is an herbaceous ...
https://en.wikipedia.org/wiki/Vigna_aconitifolia
Inactivation of Surface Microorganisms of Moth bean (Vigna aconitifolia) by Micronization and Changes in its Physico Chemical...Inactivation of Surface Microorganisms of Moth bean (Vigna aconitifolia) by Micronization and Changes in its Physico Chemical...
Inactivation of Surface Microorganisms of Moth bean (Vigna aconitifolia) by Micronization and Changes in its Physico Chemical and Rheological Properties
https://iiste.org/Journals/index.php/FSQM/article/view/34937/35938
Human Metabolome Database: Showing metabocard for L-Glutamic gamma-semialdehyde (HMDB0002104)Human Metabolome Database: Showing metabocard for L-Glutamic gamma-semialdehyde (HMDB0002104)
Glutamic gamma-semialdehyde is the metabolic precursor for proline biosynthesis. The conversion from L-Glutamate, an ATP- and NADPH-dependent reaction, is catalyzed by the enzyme Delta-1-pyrroline-5-carboxylate synthetase (P5CS) (OMIM 138250 ). L-Glutamic-gamma-semialdehyde can also be converted to or be formed from the amino acids L-ornithine (EC 2.6.1.13) and L-proline (EC 1.5.99.8 and EC 1.5.1.2). It is also one of the few metabolites that can be a precursor to other metabolites of both the urea cycle and the citric acid cycle (BioCyc ...
http://www.hmdb.ca/metabolites/HMDB02104
NOPR: Expression of Δ¹-pyrroline-5-carboxylate synthetase gene during drought in rice (Oryza sativa L.)NOPR: Expression of Δ¹-pyrroline-5-carboxylate synthetase gene during drought in rice (Oryza sativa L.)
The 45-days-old seedlings of drought resistant (N-22, CR143-2-2) and susceptible rice (Oryza sativa L.) genotypes (Panidhan, Pusa-169) were subjected to osmotic stress in PEG-6000 solution of -10 and -16 bar and the relative water content (RWC), proline content, and pyrroline-5-carboxylate synthetase (P5CS) activity and its P5CS expression were studied. A gradual decrease in RWC was observed in tolerant genotypes, whereas the decrease was drastic in susceptible ones. Proline content and P5CS activity increased both in susceptible and tolerant genotypes; the increase was higher in tolerant genotypes. Higher proline levels in tolerant genotypes were due to increased P5CS activity. The EcoRI, BamHI and XbaI restricted DNA of N-22 and Panidhan genotypes were hybridized with Arabidopsis P5CS sequence and a single band (approx 2.4 kb) was observed, however, P5CS expression was more in N-22, as compared to Panidhan ...
http://nopr.niscair.res.in/handle/123456789/3549
Characterization of the gene for Δ1-pyrroline-5-carboxylate synthetase and correlation between the expression of the gene and...Characterization of the gene for Δ1-pyrroline-5-carboxylate synthetase and correlation between the expression of the gene and...
Read Characterization of the gene for Δ1-pyrroline-5-carboxylate synthetase and correlation between the expression of the gene and salt tolerance in Oryza sativa L., Plant Molecular Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
https://www.deepdyve.com/lp/springer_journal/characterization-of-the-gene-for-1-pyrroline-5-carboxylate-synthetase-s1C3fIVspW
NAVER Academic | Yellow mosaic virus affects the ion leakage fromVigna aconitifoliaNAVER Academic | Yellow mosaic virus affects the ion leakage fromVigna aconitifolia
Yellow mosaic virus (YMV) causes a greater loss of electrolytes from infected leaf tissues ofVigna aconitifolia (mothbean). Four highly susceptible entries of mothbean were examined for the pattern of electrolyte loss after virus has invaded the tissues. It was observed that YMV triggered a heavy loss of ions at initial stages of disease development, but the loss receded at advanced stages of infection. Maximal damage to electrolytes occurred at the second stage, showing about 50% infection. The findings are interesting as the present observations on viral disease differ from other plant diseases.
http://academic.naver.com/article.naver?doc_id=34669923
PUT2 | LoqatePUT2 | Loqate
Delta-1-pyrroline-5-carboxylate dehydrogenase, nuclear-encoded mitochondrial protein involved in utilization of proline as sole nitrogen source; deficiency of the human homolog causes HPII, an autosomal recessive inborn error of ...
https://www.weizmann.ac.il/molgen/loqate/YHR037W
CiteSeerX - Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in ArabidopsisCiteSeerX - Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in Arabidopsis
CiteSeerX - Document Details (Isaac Councill, Lee Giles, Pradeep Teregowda): In higher eukaryotes, miRNAs and siRNAs guide translational inhibition, mRNA cleavage, or chromatin regulation. We found that the antisense overlapping gene pair of D 1-pyrroline-5-carboxylate dehydrogenase (P5CDH), a stress-related gene, and SRO5, a gene of unknown function, generates two types of siRNAs. When both transcripts are present, a 24-nt siRNA is formed by a biogenesis pathway dependent on DCL2, RDR6, SGS3, and NRPD1A. Initial cleavage of the P5CDH transcript guided by the 24-nt siRNA establishes a phase for the subsequent generation of 21-nt siRNAs by DCL1 and further cleavage of P5CDH transcripts. The expression of SRO5 is induced by salt, and this induction is required to initiate siRNA formation. Our data suggest that the P5CDH and SRO5 proteins are also functionally related, and that the P5CDH-SRO5 gene pair defines a mode of siRNA function and biogenesis that may be applied to other natural cis-antisense gene
http://citeseer.ist.psu.edu/viewdoc/summary?doi=10.1.1.329.621
Human Metabolome Database: Showing metabocard for 1-Pyrroline-5-carboxylic acid (HMDB0001301)Human Metabolome Database: Showing metabocard for 1-Pyrroline-5-carboxylic acid (HMDB0001301)
1-Pyrroline-5-carboxylic acid is an enamine or an imino acid that forms on spontaneous dehydration of L-glutamate γ-semialdehyde in aqueous solutions. The stereoisomer (S)-1-Pyrroline-5-carboxylate is an intermediate in glutamate metabolism, in arginine degradation and in proline biosynthesis and degradation and it can be converted to or be formed from the three amino acids L-glutamate, L-ornithine and L-proline. In particular, it is synthesized with the oxidation of proline by pyrroline-5-carboxylate reductase 1 (EC 1.5.1.2, PYCR1) or by proline dehydrogenase (EC 1.5.99.8, PRODH) and it is hydrolyzed to L-glutamate by delta-1-pyrroline-5-carboxylate dehydrogenase (EC 1.5.1.12, ALDH4A1). It is also one of the few metabolites that can be a precursor to other metabolites of both the urea cycle and the tricarboxylic acid (TCA) cycle ...
http://www.hmdb.ca/metabolites/HMDB0001301
Bambara groundnut | plant | BritannicaBambara groundnut | plant | Britannica
Other articles where Bambara groundnut is discussed: Fabales: Ecological and economic importance: …family is Vigna subterranea (Bambara groundnut), a leguminous plant that develops underground fruits in the arid lands of Africa. Important too are the seeds of Bauhinia esculenta; they are gathered for the high-protein tubers and seeds. Vigna aconitifolia (moth bean) and V. umbellata (rice bean) are much used in…
https://www.britannica.com/plant/Bambara-groundnut
Retinol Intensive Age
This nighttime treatment formulation combines 0.5% pure retinol paired with antioxidants and a host of beneficial ingredients to hydrate and soothe, while minimizing the appearance of fine lines and wrinkles. Retinol (Vitamin A) - is converted to retinoic acid in the skin. Vitamin A helps to promote a clear complexion and an even skin tone.Vigna Aconitifolia Seed Extract - is a botanical that promotes a clear complexion and an even skin tone.Sodium Hyaluronate - has the ability to hold 1,000 times its weight in water plays an important role in skin hydration.Glycerophosphoinositol Lysine - is a skin calming agent.Superoxide Dismutase (SOD) - is an enzyme that supports antioxidant defense.
http://www.kareenaesthetics.com/store/p23/Retinol_Intensive_Age.html
Moth bean | plant | BritannicaMoth bean | plant | Britannica
Other articles where Moth bean is discussed: Fabales: Ecological and economic importance: Vigna aconitifolia (moth bean) and V. umbellata (rice bean) are much used in the tropics for forage and soil improvement, and their seeds are palatable and rich in protein. Psophocarpus tetragonolobus (winged bean) is collected in Southeast Asia for the edible fruits and protein-rich tubers. Pachyrhizus (yam…
https://www.britannica.com/plant/moth-bean
1-OXYL-2,2,5,5-TETRAMETHYL-3-PYRROLINE-3-METHYL) METHANETHIOSULFONATE (CAS No. 81213-52-7) Suppliers @ ChemicalRegister.com
Suppliers List, E-mail/RFQ Form, Molecular Structure, Weight, Formula, IUPAC, Synonyms for (1-OXYL-2,2,5,5-TETRAMETHYL-3-PYRROLINE-3-METHYL) METHANETHIOSULFONATE (CAS No. 81213-52-7)
http://www.chemicalregister.com/1-OXYL-2_2_5_5-TETRAMETHYL-3-PYRROLINE-3-METHYL_METHANETHIOSULFONATE/Suppliers/pid416673.htm
local PubMed
Pyrroline-5-carboxylate reductase (P5CR) is a universal housekeeping enzyme that catalyzes the reduction of Delta(1)-pyrroline-5-carboxylate (P5C) to proline using NAD(P)H as the cofactor. The enzymatic cycle between P5C and proline is very important for the regulation of amino acid metabolism, intracellular redox potential, and apoptosis. Here, we present the 2.8 Angstroms resolution structure of the P5CR apo enzyme, its 3.1 Angstroms resolution ternary complex with NAD(P)H and substrate-analog. The refined structures demonstrate a decameric architecture with five homodimer subunits and ten catalytic sites arranged around a peripheral circular groove. Mutagenesis and kinetic studies reveal the pivotal roles of the dinucleotide-binding Rossmann motif and residue Glu221 in the human enzyme. Human P5CR is thermostable and the crystals were grown at 37 degrees C. The enzyme is implicated in oxidation of the anti-tumor drug thioproline ...
https://oca.weizmann.ac.il/pmbin/getpm?pmid=16730026
Hyperprolinemia and prolinuria in a new inbred strain of mice, pro/re. by R L. Blake and E S. RussellHyperprolinemia and prolinuria in a new inbred strain of mice, pro/re. by R L. Blake and E S. Russell
Biochemistry, Metabolism:, Hereditary Factors:, Origin:, Pathology:, Strains: AKR, AU, C57BL/6, DBA/2 (212), L (P), LP, P, SIMPSON, PL (PLA, PLB), RF (W), SJL, SM, ST/B (STB), SWR, 129, RIII/S. ...
https://mouseion.jax.org/ssbb1972/816/
PYCR2 Gene - GeneCards | P5CR2 Protein | P5CR2 AntibodyPYCR2 Gene - GeneCards | P5CR2 Protein | P5CR2 Antibody
Complete information for PYCR2 gene (Protein Coding), Pyrroline-5-Carboxylate Reductase 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
https://www.genecards.org/cgi-bin/carddisp.pl?gene=PYCR2&keywords=GH01J225921&prefilter=genomic_location
methyl 1,2,3,4-tetrahydroquinoline-7-carboxylate,hydrochloride 597562-79-3 Chemical Properties Physical Propertiesmethyl 1,2,3,4-tetrahydroquinoline-7-carboxylate,hydrochloride 597562-79-3 Chemical Properties Physical Properties
methyl 1,2,3,4-tetrahydroquinoline-7-carboxylate,hydrochloride chemical properties, What are the chemical properties of methyl 1,2,3,4-tetrahydroquinoline-7-carboxylate,hydrochloride 597562-79-3, What are the physical properties of methyl 1,2,3,4-tetrahydroquinoline-7-carboxylate,hydrochloride ect.
http://www.molbase.com/en/properties_597562-79-3-moldata-24072.html
Methyl 5-chloro-6-methylpyrazine-2-carboxylate|77168-85-5|Active Biopharma Corp
Methyl 5-chloro-6-methylpyrazine-2-carboxylate;77168-85-5;Methyl 5-chloro-6-methylpyrazine-2-carboxylate;ABP001119.Active Biopharma Corp
http://www.activebiopharma.com/Cas77168-85-5.html
methyl 4-amino-5-bromopyridine-3-carboxylate | CAS No. 1446182-20-2 | Sigma-Aldrichmethyl 4-amino-5-bromopyridine-3-carboxylate | CAS No. 1446182-20-2 | Sigma-Aldrich
methyl 4-amino-5-bromopyridine-3-carboxylate; CAS Number: 1446182-20-2; Linear Formula: C7H7BRN2O2; find AChemBlock-ADVH94547B44 MSDS, related peer-reviewed papers, technical documents, similar products & more at Sigma-Aldrich
https://www.sigmaaldrich.com/catalog/buildingblock/product/achemblock/advh94547b44?lang=en®ion=US
TRC | Details of CAS = , ChemicalName = (2R,5S)-L-Menthol-5-(4-amino-2-oxo-1(2H)-pyrimidinyl-13C)-1,3-oxathiolane-2-carboxylate...TRC | Details of CAS = , ChemicalName = (2R,5S)-L-Menthol-5-(4-amino-2-oxo-1(2H)-pyrimidinyl-13C)-1,3-oxathiolane-2-carboxylate...
Buy high quality (2R,5S)-L-Menthol-5-(4-amino-2-oxo-1(2H)-pyrimidinyl-13C)-1,3-oxathiolane-2-carboxylate from toronto research chemicals Inc.
https://www.trc-canada.com/product-detail/?M219023
엑스텐드(XTEND) BCAA 1.2kg 2개 세트
단백질보충제, BCAA, 스피드, 프로틴, 탄수화물, 벌크업, 외배엽 위한 살찌는 게이너, 아미노산, 글루타민, BCAA 보충제, 2017 BEST 인기판매
http://speednsplus.com/goods/view?no=5140
Compact Foundation - puroBIO Cosmetics - EspañolCompact Foundation - puroBIO Cosmetics - Español
Base de maquillaje compacta, pret à porter, ligerísima sobre la piel, uniforma el color del cutis sin recargarlo.. Su textura impalpable la hace perfecta para pieles de normales a grasas, el acabado es mate gracias a la mica y el silicio presentes en la fórmula.. La fórmula está enriquecida además por vigna aconitifolia, garcinia mangostana, aceite de macadamia, aceite de aguacate, manteca de karitè, aceite de karanja y aceite de albaricoque.. La cobertura es media/ligera, pero modulable. Por eso, es posible estratificar el producto para obtener una mayor cobertura.. ...
http://purobiocosmetics.it/es/?product=compact-foundation&noredirect=es_ES
The N-terminal domain of Arabidopsis proline dehydrogenase affects enzymatic activity and protein oligomerization. | CIQUIBIC
Fabro et al. Plant Physiol Biochem. 2020. Proline dehydrogenase (ProDH) is a flavoenzyme that catalyzes the oxidation of proline (Pro) into Δ1-pyrroline-5-carboxylate (P5C). In eukaryotes, ProDH coordinates with different Pro metabolism enzymes to control energy supply or stress responses signaling. Heterologous expression and crystallization of prokaryotic enzymes provided key data on their active center, folding capacity and oligomerization status. In contrast, eukaryotic ProDHs have not been crystallized so far, and their study as recombinant proteins remains limited. Plants contain two isoforms of ProDH with non-redundant functions. To contribute to the study of these enzymes, we describe the modeling, expression in E. coli, purification, and characterization of the Arabidopsis isoenzymes, AtProDH1 and AtProDH2. The 3D model suggested that both proteins adopt a distorted barrel structure (βα) with a cap formed by N-terminal α helices. The expression of two types of N-terminal deletion ...
https://ciquibic.fcq.unc.edu.ar/the-n-terminal-domain-of-arabidopsis-proline-dehydrogenase-affects-enzymatic-activity-and-protein-oligomerization/
Δ|sup|1|/sup|-pyrroline-5-carboxylate reductase from Arabidopsis thaliana : stimulation or inhibition by chloride ions and...Δ|sup|1|/sup|-pyrroline-5-carboxylate reductase from Arabidopsis thaliana : stimulation or inhibition by chloride ions and...
Δ,sup,1,/sup,-pyrroline-5-carboxylate (P5C) reductase (P5CR) catalyses the final step of proline synthesis in plants. In Arabidopsis thaliana, protein levels are correlated neither to the corresponding mRNA copy numbers, nor to intracellular proline concentrations. The occurrence of post-translational regulatory mechanisms has therefore been hypothesized, but never assessed.,br /,,br /,The purification of A. thaliana P5CR was achieved through either a six-step protocol from cultured cells, or heterologous expression of AtP5CR in Escherichia coli. The protein was characterized with respect to structural, kinetic, and biochemical properties.,br /,,br /,P5CR was able to use either NADPH or NADH as the electron donor, with contrasting affinities and maximum reaction rates. The presence of equimolar concentrations of NADP+ completely suppressed the NADH-dependent activity, whereas the NADPH-dependent reaction was mildly affected. Proline inhibited only the NADH-dependent reaction. At physiological ...
https://kops.uni-konstanz.de/handle/123456789/26652
Probable proline dehydrogenase 2Probable proline dehydrogenase 2
The protein encoded by this gene is similar to proline dehydrogenase (oxidase) 1, a mitochondrial enzyme which catalyzes the first step in proline catabolism. The function of this protein has not been determined. [provided by RefSeq, Jul 2008 ...
https://pharos.nih.gov/idg/targets/Q9UF12
Mutagenetix > Incidental...Mutagenetix > Incidental...
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the pyrroline-5-carboxylate reductase family. The encoded mitochondrial protein catalyzes the conversion of pyrroline-5-carboxylate to proline, which is the last step in proline biosynthesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012 ...
https://mutagenetix.utsouthwestern.edu/incidental/incidental_rec.cfm?mid=585617
Metabolic implications of stress-induced proline accumulation in plants | SpringerLinkMetabolic implications of stress-induced proline accumulation in plants | SpringerLink
In many plants, free proline accumulates in response to the imposition of a wide range of biotic and abiotic stresses. Controversy has surrounded the extent to which this shift in nitrogen metabolism
https://link.springer.com/article/10.1023%2FA%3A1005703923347
SAUSA300 1711 - AureoWikiSAUSA300 1711 - AureoWiki
Amino Acids and DerivativesProline and 4-hydroxyprolineProline, 4-hydroxyproline uptake and utilization Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase) ...
http://aureowiki.med.uni-greifswald.de/SAUSA300_1711
ethyl 1,3-benzothiazole-2-carboxylate 32137-76-1 H-NMR | C-NMR Spectral Analysis NMR Spectrumethyl 1,3-benzothiazole-2-carboxylate 32137-76-1 H-NMR | C-NMR Spectral Analysis NMR Spectrum
ethyl 1,3-benzothiazole-2-carboxylate 32137-76-1 NMR spectrum, ethyl 1,3-benzothiazole-2-carboxylate H-NMR spectral analysis, ethyl 1,3-benzothiazole-2-carboxylate C-NMR spectral analysis ect.
http://www.molbase.com/en/hnmr_32137-76-1-moldata-2176.html
ethyl 6-oxo-1,3,4,6-tetrahydro-2H-quinolizine-7-carboxylate | C12H15NO3 - ChemSynthesis
ethyl 6-oxo-1,3,4,6-tetrahydro-2H-quinolizine-7-carboxylate - chemical structural formula, chemical names, chemical properties, synthesis references
http://www.chemsynthesis.com/base/chemical-structure-5808.html
201283-53-6 | tert-Butyl L-N-(3-Benzyloxycarbonylamino-3-(S)-tert-butylcarboxy-1-oxopropyl-azetidine-2-carboxylate | [S-(R*,R*)...201283-53-6 | tert-Butyl L-N-(3-Benzyloxycarbonylamino-3-(S)-tert-butylcarboxy-1-oxopropyl-azetidine-2-carboxylate | [S-(R*,R*)...
Buy high quality tert-Butyl L-N-(3-Benzyloxycarbonylamino-3-(S)-tert-butylcarboxy-1-oxopropyl-azetidine-2-carboxylate 201283-53-6 from toronto research chemicals Inc.
https://www.trc-canada.com/product-detail/?CatNum=B690405
Reaction of Ethyl 5-Acetyl-3,4-dihydropyridine-1(2H)-carboxylate with 1,3-N,N-Bis-nucleophiles: A Facile Access to Novel...Reaction of Ethyl 5-Acetyl-3,4-dihydropyridine-1(2H)-carboxylate with 1,3-N,N-Bis-nucleophiles: A Facile Access to Novel...
Reaction of ethyl 5-acetyl-3,4-dihydropyridine-1(2H)-carboxylate with diverse 1,3-N,N-bis-nucleophiles results in the regioselective formation of the correspondingly substituted pyrimidines in good yields.. ...
https://enamine.net/our-research/publications/373-reaction-of-ethyl-5-acetyl-3-4-dihydropyridine-1-2h-carboxylate-with-1-3-n-n-bis-nucleophiles-a-facile-access-to-novel-pyrimidine-derivatives
How to put a de/activable picture in-game ?
I created a little creepy-face and i want to put it in-game and have the possibility to disable or enable this creepy-face ...
https://forum.frictionalgames.com/thread-27261.html
Charlotte Tilbury | Light Wonder Youth-Boosting Foundation SPF15 - 7 Medium, 40ml | NET-A-PORTER.COMCharlotte Tilbury | Light Wonder Youth-Boosting Foundation SPF15 - 7 Medium, 40ml | NET-A-PORTER.COM
Instructions for use: Blend a small amount onto your skin from the nose outwards For a more flawless finish, pat on top of areas where extra coverage is needed using a brush 40ml/1.4 fl.oz. Ingredients: Cyclopentasiloxane, Water (Aqua), Hydrogenated Didodecene, Titanium Dioxide (Nano), Ethylhexyl Methoxycinnamate, Mica, Glycerin, Sorbitan Isostearate, Peg/Ppg 18/18 Dimethicone, Sodium Chloride, Cyclohexasiloxane , Aluminum/Magnesium Hydroxide Stearate, Dimethicone/Vinyl Dimethicone Crosspolymer, Squalane, Cetearyl Ethylhexanoate, Dimethicone, Bis-C24-28 Hydroxyalkyl Olivoyl Glutamate , Disodium Cocoyl Glutamate, Methylparaben, Potassium Sorbate, Propylparaben, Isopropyl Titanium Triisostearate, Fragrance (Parfum), Glycine Soja (Soybean) Sterols, Sodium Cocoyl Glutamate, Laureth-4, Pentaerythrityl Tetra-Di-T-Butyl Hydroxyhydrocinnamate, Sodium Citrate, Vigna Aconitifolia Seed Extract, Bht, Chlorphenesin, [May Contain: Titanium Dioxide (CI77891), Mica, Iron Oxides (CI77491 ,CI 77492, CI77499),
https://www.net-a-porter.com/au/en/product/418015
Charlotte Tilbury | Light Wonder Youth-Boosting Foundation SPF15 - 6 Medium, 40ml | NET-A-PORTER.COMCharlotte Tilbury | Light Wonder Youth-Boosting Foundation SPF15 - 6 Medium, 40ml | NET-A-PORTER.COM
Instructions for use: Blend a small amount onto your skin from the nose outwards For a more flawless finish, pat on top of areas where extra coverage is needed using a brush 40ml/1.4 fl.oz. Ingredients: Cyclopentasiloxane, Water (Aqua), Hydrogenated Didodecene, Titanium Dioxide (Nano), Ethylhexyl Methoxycinnamate, Mica, Glycerin, Sorbitan Isostearate, Peg/Ppg 18/18 Dimethicone, Sodium Chloride, Cyclohexasiloxane , Aluminum/Magnesium Hydroxide Stearate, Dimethicone/Vinyl Dimethicone Crosspolymer, Squalane, Cetearyl Ethylhexanoate, Dimethicone, Bis-C24-28 Hydroxyalkyl Olivoyl Glutamate , Disodium Cocoyl Glutamate, Methylparaben, Potassium Sorbate, Propylparaben, Isopropyl Titanium Triisostearate, Fragrance (Parfum), Glycine Soja (Soybean) Sterols, Sodium Cocoyl Glutamate, Laureth-4, Pentaerythrityl Tetra-Di-T-Butyl Hydroxyhydrocinnamate, Sodium Citrate, Vigna Aconitifolia Seed Extract, Bht, Chlorphenesin, [May Contain: Titanium Dioxide (CI77891), Mica, Iron Oxides (CI77491 ,CI 77492, CI77499),
https://www.net-a-porter.com/au/en/product/418014
Collagen-Boosting Peptide Mask - Amala
100% Natural Origin. Gluten-free.. Living Beauty Bio-Active Complex: This ultra-concentrated blend of bio-active nutrients is Amalas signature cocktail of skin revitalizing Peony, anti-inflammatory Rose Gold, Vitamin C-rich Amla and antioxidant Spirulina.. Cocoa Pre+Probiotic Infusion: This protective, skin-balancing power shot of Cocoa Bean probiotics is enhanced with vegan prebiotics to help minimize inflammation, replenish collagen and maximize firmness.. Active Peptide Blend: This turbo boost of natural collagen-activating peptides helps improve skin density and elasticity for a smoother, younger-looking complexion.. Ingredients: Water (Aqua), Pentylene Glycol, Lactobacillus/Cocoa Fruit Ferment Filtrate, Leuconostoc/Radish Root Ferment Filtrate, Magnesium Ascorbyl Phosphate, Squalane, Phyllanthus Emblica Extract, Paeonia Lactiflora Extract, Spirulina Platensis Extract, Yeast Ferment Extract, Alpha-Glucan Oligosaccharide, Sodium Hyaluronate, Vigna Aconitifolia Seed Extract, Lactic Acid, ...
https://shopamala.com/product/collagen-boosting-peptide-mask/
Effect of Mutations in Genes PH085 and PH04 on Proline Utilization in Yeast Saccharomyces cerevisiae, Russian Journal of...Effect of Mutations in Genes PH085 and PH04 on Proline Utilization in Yeast Saccharomyces cerevisiae, Russian Journal of...
Read Effect of Mutations in Genes PH085 and PH04 on Proline Utilization in Yeast Saccharomyces cerevisiae, Russian Journal of Genetics on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
https://www.deepdyve.com/lp/springer_journal/effect-of-mutations-in-genes-ph085-and-ph04-on-proline-utilization-in-0oUegg0Dpu
RCSB PDB - 4NMA: Crystal structure of proline utilization A (PutA) from Geobacter sulfurreducens PCA in complex with L...RCSB PDB - 4NMA: Crystal structure of proline utilization A (PutA) from Geobacter sulfurreducens PCA in complex with L...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
https://www.rcsb.org/structure/4NMA
NWMN 1410 - AureoWikiNWMN 1410 - AureoWiki
Amino Acids and DerivativesProline and 4-hydroxyprolineA Hypothetical Protein Related to Proline Metabolism Pyrroline-5-carboxylate reductase (EC 1.5.1.2) ...
http://aureowiki.med.uni-greifswald.de/NWMN_1410
Methyl 5-bromo-1H-indazole-6-carboxylate 1000342-30-2, China Methyl 5-bromo-1H-indazole-6-carboxylate 1000342-30-2...
We,China Methyl 5-bromo-1H-indazole-6-carboxylate 1000342-30-2 Suppliers and China Methyl 5-bromo-1H-indazole-6-carboxylate 1000342-30-2 Manufacturers, provide Methyl 5-bromo-1H-indazole-6-carboxylate 1000342-30-2 product and the products related with China Methyl 5-bromo-1H-indazole-6-carboxylate 1000342-30-2 - SGB
http://www.chemnet.com/ChinaSuppliers/53384/Methyl-5-bromo-1H-indazole-6-carboxylate--2349706.html
KEGG ENZYME: 1.14.11.41
Fe2+-dependent enzyme. The enzyme is involved in the biosynthesis of the cyclic pentapeptide antibiotic viomycin. It differs from EC 1.14.11.34, 2-oxoglutarate/L-arginine monooxygenase/decarboxylase (succinate-forming), because it does not form guanidine and (S)-1-pyrroline-5-carboxylate from 3-hydroxy-L-arginine ...
http://www.genome.jp/dbget-bin/www_bget?ec:1.14.11.41
1tj2.2 | SWISS-MODEL Template Library
SWISS-MODEL Template Library (SMTL) entry for 1tj2.2. Crystal structure of E. coli PutA proline dehydrogenase domain (residues 86-669) complexed with acetate
https://swissmodel.expasy.org/templates/1tj2.2
BUTYL 9-HYDROXY-9H-FLUORENE-9-CARBOXYLATE MIXT. WITH ISOOCTYL (4-CHLORO-2-METHYLPHENOXY)ACETATE,Butyl 9-methoxy-9-phenyl-3...
Comprehensive supplier list for BUTYL 9-HYDROXY-9H-FLUORENE-9-CARBOXYLATE MIXT. WITH ISOOCTYL (4-CHLORO-2-METHYLPHENOXY)ACETATE,Butyl 9-methoxy-9-phenyl-3-azabicyclo[3.3.1]nonane-3-carboxylate
http://www.chemicalregister.com/Companies/AName/Page3106/aidB.htm
Ethyl-2-[(cyanoacetyl)amino]-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxylate | VWREthyl-2-[(cyanoacetyl)amino]-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxylate | VWR
Learn more about Ethyl-2-[(cyanoacetyl)amino]-5,6,7,8-tetrahydro-4H-cyclohepta[b]thiophene-3-carboxylate. We enable science by offering product choice, services, process excellence and our people make it happen.
https://us.vwr.com/store/category/ethyl-2-cyanoacetyl-amino-5-6-7-8-tetrahydro-4h-cyclohepta-b-thiophene-3-carboxylate/21157754
methyl 4,5-dimethyl-2,5-dihydro-1,3-thiazole-2-carboxylate | C7H11NO2S - ChemSynthesis
methyl 4,5-dimethyl-2,5-dihydro-1,3-thiazole-2-carboxylate - chemical structural formula, chemical names, chemical properties, synthesis references
http://www.chemsynthesis.com/base/chemical-structure-22885.html
ethyl-4-hydroxyquinoline-2-carboxylate | VWRethyl-4-hydroxyquinoline-2-carboxylate | VWR
Learn more about ethyl-4-hydroxyquinoline-2-carboxylate. We enable science by offering product choice, services, process excellence and our people make it happen.
https://us.vwr.com/store/product/11849099/ethyl-4-hydroxyquinoline-2-carboxylate
L Proline Benefits, Facts, L Proline Side Effects, L Proline Dosage.L Proline Benefits, Facts, L Proline Side Effects, L Proline Dosage.
Proline Benefits - Info on benefits of proline, facts, proline side effects, dosage, health benefits, keeps muscles and joints flexible, main component of collagen, adverse effects and more.
http://www.altiusdirectory.com/Lifestyle/sources-l-proline.html
Puta Argentina CINTIA ALONSO ❤️ xxxincestos.netPuta Argentina CINTIA ALONSO ❤️ xxxincestos.net
Es impresionante este vídeo porno incestuoso de Puta Argentina CINTIA ALONSO ❤️ Completamente GRATIS en el día de hoy. ¡Aprovecha!
https://xxxincestos.net/abuelos-y-abuelas/puta-argentina-cintia-alonso__trashed/
Proline Power Dogbones 50/15
Buy Proline Power Dogbones 50/15 securely online today at a great price. Proline Power Dogbones 50/15 available today at Tesla Wall Chargers.
https://www.teslawallchargers.com/proline-power-dogbones-5015/
Sieci WIFI - Karty, AP - Sklep ProLine.plSieci WIFI - Karty, AP - Sklep ProLine.pl
Sieci WIFI - Karty, AP w internetowym sklepie komputerowym ProLine. Bezpieczne zakupy, szybka wysy ka i niskie ceny. Zobacz teraz!
https://proline.pl/?kat=Sieci+WIFI+-+Karty%2C+AP
HydroxypethidineHydroxypethidine
Hydroxypethidine Hydroxypethidine Systematic (IUPAC) name Ethyl 4-(3-hydroxyphenyl)-1-methyl-piperidine-4-carboxylate Identifiers CAS number 468-56-4 ATC code
https://www.chemeurope.com/en/encyclopedia/Hydroxypethidine.html
전자 유량계 Proline Promag 10P | Endress+Hauser전자 유량계 Proline Promag 10P | Endress+Hauser
Promag P는 다양한 산업에서 가장 까다로운 요구 사항을 가진 분야에서 선호되는 센서입니다. 기초적인 어플리케이션 및 직접 통합을 위해 Promag 10 트랜스미터와 결합 된 Promag 10P는 부식성 액체 및 고온이 있는 화학 및 프로세스 응용 산업 전용입니다.
https://www.kr.endress.com/ko/Field-instruments-overview/Flow-measurement-product-overview/Product-Electromagnetic-flowmeter-Proline-Promag-10P
HyperprolinemiaHyperprolinemia
This enzyme helps to break down the pyrroline-5-carboxylate produced in the previous reaction, converting it to the amino acid ... A deficiency of either proline oxidase or pyrroline-5-carboxylate dehydrogenase results in a buildup of proline in the body. A ... This enzyme begins the process of degrading proline by starting the reaction that converts it to pyrroline-5-carboxylate.[ ... Pyridoxal phosphate de-activation by pyrroline-5-carboxylic acid. Increased risk of vitamin B6 deficiency and seizures in ...
https://en.wikipedia.org/wiki/Hyperprolinemia
List of diseases (D)List of diseases (D)
Dengue fever Dennis-Cohen syndrome Dennis-Fairhurst-Moore syndrome Dent disease Dental aberrations steroid dehydrogenase ... hypertension Dextrocardia with situs inversus Dextrocardia Dextrocardia-bronchiectasis-sinusitis D-glycerate dehydrogenase ... duplication Digitorenocerebral syndrome Digoxin toxicity Dihydropteridine reductase deficiency Dihydropyrimidine dehydrogenase ... nephrogenic type 1 Diabetes insipidus, nephrogenic type 2 Diabetes insipidus, nephrogenic type 3 Diabetes insipidus, ...
https://en.wikipedia.org/wiki/List_of_diseases_(D)
Proline dehydrogenaseProline dehydrogenase
In enzymology, proline dehydrogenase (PRODH) (EC 1.5.5.2, formerly EC 1.5.99.8) is an enzyme of the oxidoreductase family, ... It employs one cofactor, FAD, which requires riboflavin (vitamin B2). Proline dehydrogenase is in humans encoded by PRODH and ... Servet C, Ghelis T, Richard L, Zilberstein A, Savoure A (January 2012). "Proline dehydrogenase: a key enzyme in controlling ... Funck D, Eckard S, Müller G (April 2010). "Non-redundant functions of two proline dehydrogenase isoforms in Arabidopsis". BMC ...
https://en.wikipedia.org/wiki/Proline_dehydrogenase
1-Pyrroline-5-carboxylic acid1-Pyrroline-5-carboxylic acid
In many prokaryotes, proline dehydrogenase and P5C dehydrogenase form a bifunctional enzyme that prevents the release of P5C ... The enzyme pyrroline-5-carboxylate reductase converts P5C into proline In proline degradation, the enzyme proline dehydrogenase ... "Entrez Gene: ALDH18A1 aldehyde dehydrogenase 18 family, member A1". Liu, Li-Kai; Becker, Donald F.; Tanner, John J. (2017-10-15 ... Heacock, Anne M.; Williams, Irene H.; Frank, Leonard H.; Adams, Elijah (1975-04-01). "Δ1-Pyrroline-5-carboxylate and Δ1- ...
https://en.wikipedia.org/wiki/1-Pyrroline-5-carboxylic_acid
1-Pyrroline-5-carboxylate dehydrogenase1-Pyrroline-5-carboxylate dehydrogenase
III Delta1-Pyrroline-5-carboxylic acid dehydrogenase". J. Biol. Chem. 235: 3218-3223. Portal: Biology (EC 1.2.1, ... L-pyrroline-5-carboxylate-NAD+ oxidoreductase, and 1-pyrroline-5-carboxylate:NAD+ oxidoreductase. This enzyme participates in ... In enzymology, a 1-pyrroline-5-carboxylate dehydrogenase (EC 1.2.1.88) is an enzyme that catalyzes the chemical reaction (S)-1- ... pyrroline-5-carboxylate + NAD+ + 2 H2O ⇌ {\displaystyle \rightleftharpoons } L-glutamate + NADH + H+ The three substrates of ...
https://en.wikipedia.org/wiki/1-Pyrroline-5-carboxylate_dehydrogenase
Aldehyde dehydrogenase 4 family, member A1Aldehyde dehydrogenase 4 family, member A1
1998). "Mutations in the Delta1-pyrroline 5-carboxylate dehydrogenase gene cause type II hyperprolinemia". Hum. Mol. Genet. 7 ( ... This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent ... dehydrogenase that catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to ... "Entrez Gene: ALDH4A1 aldehyde dehydrogenase 4 family, member A1". Human ALDH4A1 genome location and ALDH4A1 gene details page ...
https://en.wikipedia.org/wiki/Aldehyde_dehydrogenase_4_family,_member_A1
Cutis laxaCutis laxa
Aldehyde Dehydrogenase 18 Family, Member A1; ALDH18A1 - 138250 Reddy GP, Mishra B, Upadhyaya DN (2019). "Acquired Localized ... Pyrroline-5-Carboxylate Reductase 1; PYCR1 - 179035 Online Mendelian Inheritance in Man (OMIM): ... 8 (1): 42-51. doi:10.1159/000443696. PMC 4899661. PMID 27293393. Bouloc A, Godeau G, Zeller J, Wechsler J, Revuz J, Cosnes A ( ... 64 (1): 55-58. doi:10.4103/ijd.IJD_14_18. PMC 6340237. PMID 30745636. Rongioletti F, Cutolo M, Bondavalli P, Rebora A (January ...
https://en.wikipedia.org/wiki/Cutis_laxa
ProlineProline
Muzammil S, Shrestha A, Dadshani S, Pillen K, Siddique S, Léon J, Naz AA (October 2018). "An Ancestral Allele of Pyrroline-5- ... carboxylate synthase1 Promotes Proline Accumulation and Drought Adaptation in Cultivated Barley". Plant Physiology. 178 (2): ... which is reduced to proline by pyrroline-5-carboxylate reductase (using NADH or NADPH), or turned into ornithine by ornithine ... 34 (5): 681-701.e10. doi:10.1016/j.cmet.2022.04.001. hdl:10230/53513. PMID 35508109. S2CID 248528026. Pavlov MY, Watts RE, Tan ...
https://en.wikipedia.org/wiki/Proline
PyrrolePyrrole
For example, Birch reduction of pyrrole esters and amides produced pyrrolines, with the regioselectivity depending on the ... Structural analogs of pyrrole include: Pyrroline, a partially saturated analog with one double bond Pyrrolidine, the saturated ... which is reduced to proline by pyrroline-5-carboxylate reductase (using NADH or NADPH), or turned into ornithine by ornithine ... Pyrroles can undergo reductions to pyrrolidines and to pyrrolines. ...
https://en.wikipedia.org/wiki/Pyrrole
Arginine and proline metabolismArginine and proline metabolism
... which is reduced to proline by pyrroline-5-carboxylate reductase (using NADH or NADPH), or turned into ornithine by ornithine ... Glutamate-5-semialdehyde is first formed by glutamate 5-kinase (ATP-dependent) and glutamate-5-semialdehyde dehydrogenase ( ... which requires NADH or NADPH). This can then either spontaneously cyclize to form 1-pyrroline-5-carboxylic acid, ... ISBN 1-57259-153-6.. (Proteinogenic amino acids, Basic amino acids). ...
https://en.wikipedia.org/wiki/Arginine_and_proline_metabolism
PYCR1PYCR1
Pyrroline-5-carboxylate reductase 1, mitochondrial is an enzyme that in humans is encoded by the PYCR1 gene. This gene encodes ... "Entrez Gene: PYCR1 pyrroline-5-carboxylate reductase 1". Reversade B, Escande-Beillard N, Dimopoulou A, Fischer B, Chng SC, Li ... Meng Z, Lou Z, Liu Z, Li M, Zhao X, Bartlam M, Rao Z (June 2006). "Crystal structure of human pyrroline-5-carboxylate reductase ... Yeh GC, Roth EF, Phang JM, Harris SC, Nagel RL, Rinaldi A (May 1984). "The effect of pyrroline-5-carboxylic acid on nucleotide ...
https://en.wikipedia.org/wiki/PYCR1
Aldehyde dehydrogenase 18 family, member A1Aldehyde dehydrogenase 18 family, member A1
Hu CA, Khalil S, Zhaorigetu S, Liu Z, Tyler M, Wan G, Valle D (November 2008). "Human Delta1-pyrroline-5-carboxylate synthase: ... The encoded protein catalyzes the reduction of glutamate to delta1-pyrroline-5-carboxylate, a critical step in the de novo ... This gene is a member of the aldehyde dehydrogenase family and encodes a bifunctional ATP- and NADPH-dependent mitochondrial ... "Entrez Gene: ALDH18A1 aldehyde dehydrogenase 18 family, member A1". Fischer-Zirnsak B, Escande-Beillard N, Ganesh J, Tan YX, Al ...
https://en.wikipedia.org/wiki/Aldehyde_dehydrogenase_18_family,_member_A1
List of MeSH codes (D08)List of MeSH codes (D08)
... pyrroline carboxylate reductases MeSH D08.811.682.662.750 - saccharopine dehydrogenases MeSH D08.811.682.662.825 - ... malate dehydrogenase MeSH D08.811.682.047.748 - malate dehydrogenase (nadp+) MeSH D08.811.682.047.892 - xanthine dehydrogenase ... acetoin dehydrogenase MeSH D08.811.682.047.070 - alcohol dehydrogenase MeSH D08.811.682.047.150 - carbohydrate dehydrogenases ... acyl-coa dehydrogenase MeSH D08.811.682.660.150.150 - acyl-coa dehydrogenase, long-chain MeSH D08.811.682.660.150.200 - acyl- ...
https://en.wikipedia.org/wiki/List_of_MeSH_codes_(D08)
Nicotinamide adenine dinucleotideNicotinamide adenine dinucleotide
"Crystal structures of Delta1-piperideine-2-carboxylate/Delta1-pyrroline-2-carboxylate reductase belonging to a new family of ... including glyceraldehyde 3-phosphate dehydrogenase and pyruvate dehydrogenase. In healthy mammalian tissues, estimates of the ... Lesk AM (1995). "NAD-binding domains of dehydrogenases". Curr. Opin. Struct. Biol. 5 (6): 775-83. doi:10.1016/0959-440X(95) ... ISBN 978-0-911910-27-8. Biellmann JF, Lapinte C, Haid E, Weimann G (1979). "Structure of lactate dehydrogenase inhibitor ...
https://en.wikipedia.org/wiki/Nicotinamide_adenine_dinucleotide
BiosynthesisBiosynthesis
Pyrroline-5-carboxylate is further reduced by the enzyme pyrroline-5-carboxylate reductase (P5CR) to yield a proline amino acid ... Aspartate-semialdehyde dehydrogenase catalyzes the reduction reaction by dephosphorylation of aspartyl-β-phosphate to yield ... kinase catalyzes the initial step in the diaminopimelic acid pathway by transferring a phosphoryl from ATP onto the carboxylate ... The next reaction is catalyzed by the enzyme pyrroline-5-carboxylate synthase (P5CS), which catalyzes the reduction of the ϒ- ...
https://en.wikipedia.org/wiki/Biosynthesis
Bruno ReversadeBruno Reversade
2015-09-03). "Recurrent De Novo Mutations Affecting Residue Arg138 of Pyrroline-5-Carboxylate Synthase Cause a Progeroid Form ... January 30, 2020). "Loss-of-function mutations in UDP-Glucose 6-Dehydrogenase cause recessive developmental epileptic ... ISBN 978-1-107-00382-8 - via Google Books. Rosier, Florence (8 July 2014). "Sur la piste d'un gène responsable de la gémellité ... 167 (1): 187-202.E17. doi:10.1016/j.cell.2016.09.001. PMID 27662089. Zhonga, Franklin L.; Robinson, Kim; Teo, Daniel Eng Thiam ...
https://en.wikipedia.org/wiki/Bruno_Reversade
List of EC numbers (EC 1)List of EC numbers (EC 1)
... benzaldehyde dehydrogenase (NAD+) EC 1.2.1.29: aryl-aldehyde dehydrogenase EC 1.2.1.30: carboxylate reductase (NADP+) EC 1.2. ... pyrroline-5-carboxylate reductase EC 1.5.1.3: dihydrofolate reductase EC 1.5.1.4: Now included with EC 1.5.1.3 dihydrofolate ... EC 1.1.1.1: alcohol dehydrogenase EC 1.1.1.2: alcohol dehydrogenase (NADP+) EC 1.1.1.3: homoserine dehydrogenase EC 1.1.1.4: (R ... formylmethanofuran dehydrogenase EC 1.2.99.6: carboxylate reductase EC 1.2.99.7: aldehyde dehydrogenase (FAD-independent) EC ...
https://en.wikipedia.org/wiki/List_of_EC_numbers_(EC_1)
List of EC numbers (EC 3)List of EC numbers (EC 3)
... pyruvate dehydrogenase (acetyl-transferring)]-phosphatase EC 3.1.3.44: [acetyl-CoA carboxylase]-phosphatase EC 3.1.3.45: 3- ... 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring)]-phosphatase EC 3.1.3.53: [myosin-light-chain] ... EC 3.2.1.91: cellulose 1,4-β-cellobiosidase (non-reducing end) EC 3.2.1.92: peptidoglycan β-N-acetylmuramidase EC 3.2.1.93: α,α ... EC 3.4.21.60 EC 3.4.21.60, scutelarin EC 3.4.99.29: Deleted entry: Myxobacter AL-1 proteinase I EC 3.4.99.30: Transferred entry ...
https://en.wikipedia.org/wiki/List_of_EC_numbers_(EC_3)
IMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlingsIMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlings
Water withholding condition induced the stimulation of proline synthesis via increased glutamate dehydrogenase (GDH), pyrroline ... Glutamate dehydrogenase might have played a dominant role in ammonium assimilation and glutamate biosynthesis, leading to an ... which via pyrroline-5-carboxylate synthetase activity led to enhanced proline accumulation in tolerant genotypes under stress ... and pyrroline-5-carboxylate reductase (P5CR) activities with inhibition of oxidation via reduced proline dehydrogenase activity ...
https://imsear.searo.who.int/handle/123456789/189985
IMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlingsIMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlings
Water withholding condition induced the stimulation of proline synthesis via increased glutamate dehydrogenase (GDH), pyrroline ... Glutamate dehydrogenase might have played a dominant role in ammonium assimilation and glutamate biosynthesis, leading to an ... which via pyrroline-5-carboxylate synthetase activity led to enhanced proline accumulation in tolerant genotypes under stress ... and pyrroline-5-carboxylate reductase (P5CR) activities with inhibition of oxidation via reduced proline dehydrogenase activity ...
https://imsear.searo.who.int/handle/123456789/189985?locale=es
Genomics (A-Z)|Home|PHGKBGenomics (A-Z)|Home|PHGKB
Dihydropyrimidine dehydrogenase deficiency. *Dihydroxyadeninuria. *Dilated cardiomyopathy. *Dilated cardiomyopathy with ...
https://phgkb.cdc.gov/PHGKB/specificPHGKB.action?topic=rare&query=list&letter=D
Code System ConceptCode System Concept
1-Pyrroline-5-carboxylate dehydrogenase Active Synonym false false 3720748015 1-pyrroline-5-carboxylate dehydrogenase Active ... 1-pyrroline-5-carboxylate dehydrogenase (substance). Code System Preferred Concept Name. 1-pyrroline-5-carboxylate ... dehydrogenase (substance). Concept Status. Published. Concept Status Date. 09/01/2022. Code System Name. SNOMED-CT ...
https://phinvads.cdc.gov/vads/ViewCodeSystemConcept.action?oid=2.16.840.1.113883.6.96&code=68803005
Hyperprolinemia: MedlinePlus GeneticsHyperprolinemia: MedlinePlus Genetics
Pyrroline carboxylate dehydrogenase deficiency. *Pyrroline-5-carboxylate dehydrogenase deficiency. Additional Information & ... Variants in either the PRODH or ALDH4A1 gene can cause a reduction in proline dehydrogenase or pyrroline-5-carboxylate ... This enzyme helps to break down the pyrroline-5-carboxylate produced in the previous reaction, converting it to the amino acid ... This enzyme begins the process of breaking down proline by starting the reaction that converts proline to pyrroline-5- ...
https://medlineplus.gov/genetics/condition/hyperprolinemia
IMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlingsIMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlings
Water withholding condition induced the stimulation of proline synthesis via increased glutamate dehydrogenase (GDH), pyrroline ... Glutamate dehydrogenase might have played a dominant role in ammonium assimilation and glutamate biosynthesis, leading to an ... which via pyrroline-5-carboxylate synthetase activity led to enhanced proline accumulation in tolerant genotypes under stress ... and pyrroline-5-carboxylate reductase (P5CR) activities with inhibition of oxidation via reduced proline dehydrogenase activity ...
https://imsear.searo.who.int/handle/123456789/189985?mode=full
MedlinePlus: Genetic Conditions: PMedlinePlus: Genetic Conditions: P
Pyrroline carboxylate dehydrogenase deficiency, see Hyperprolinemia. *Pyrroline-5-carboxylate dehydrogenase deficiency, see ... Pseudohermaphroditism, male, with gynecomastia, see 17-beta hydroxysteroid dehydrogenase 3 deficiency. *Pseudohypoaldosteronism ... Premature ovarian failure 1, see Fragile X-associated primary ovarian insufficiency. *Presbyacusia, see Age-related hearing ... PAI-1 deficiency, see Complete plasminogen activator inhibitor 1 deficiency. *PAI-1D, see Complete plasminogen activator ...
https://medlineplus.gov/genetics/condition-p/
ALDH4A1 gene: MedlinePlus GeneticsALDH4A1 gene: MedlinePlus Genetics
The ALDH4A1 gene provides instructions for producing the enzyme pyrroline-5-carboxylate dehydrogenase, which is found in ... Pyrroline-5-carboxylate dehydrogenase starts the second step in the process that breaks down the protein building block (amino ... Yoshida A, Rzhetsky A, Hsu LC, Chang C. Human aldehyde dehydrogenase gene family. Eur J Biochem. 1998 Feb 1;251(3):549-57. doi ... A lack of pyrroline-5-carboxylate dehydrogenase function leads to decreased breakdown of proline and elevated levels of proline ...
https://medlineplus.gov/genetics/gene/aldh4a1/
ALDH18A1 gene: MedlinePlus GeneticsALDH18A1 gene: MedlinePlus Genetics
A missense mutation in ALDH18A1, encoding Delta1-pyrroline-5-carboxylate synthase (P5CS), causes an autosomal recessive ... ALDEHYDE DEHYDROGENASE 18 FAMILY, MEMBER A1. Gene and Variant Databases. *NCBI Gene ... Recurrent De Novo Mutations Affecting Residue Arg138 of Pyrroline-5-Carboxylate Synthase Cause a Progeroid Form of Autosomal- ... The P5CS protein carries out the first step in this process by converting the amino acid glutamate to glutamate 5-semialdehyde ...
https://medlineplus.gov/genetics/gene/aldh18a1/
MedlinePlus: Genes: PMedlinePlus: Genes: P
PDHX: pyruvate dehydrogenase complex component X. *PDP1: pyruvate dehydrogenase phosphatase catalytic subunit 1 ... PYCR1: pyrroline-5-carboxylate reductase 1. *PYGL: glycogen phosphorylase L. *PYGM: glycogen phosphorylase, muscle associated ... PKD1: polycystin 1, transient receptor potential channel interacting. *PKD2: polycystin 2, transient receptor potential cation ... PIK3CD: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta. *PIK3R1: phosphoinositide-3-kinase regulatory ...
https://medlineplus.gov/genetics/gene-p/
Hyperprolinemia: MedlinePlus GeneticsHyperprolinemia: MedlinePlus Genetics
Pyrroline carboxylate dehydrogenase deficiency. *Pyrroline-5-carboxylate dehydrogenase deficiency. Additional Information & ... Variants in either the PRODH or ALDH4A1 gene can cause a reduction in proline dehydrogenase or pyrroline-5-carboxylate ... This enzyme helps to break down the pyrroline-5-carboxylate produced in the previous reaction, converting it to the amino acid ... This enzyme begins the process of breaking down proline by starting the reaction that converts proline to pyrroline-5- ...
https://medlineplus.gov/genetics/condition/hyperprolinemia/
IMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlingsIMSEAR at SEARO: Modulation of proline metabolism under drought and salt stress conditions in wheat seedlings
Water withholding condition induced the stimulation of proline synthesis via increased glutamate dehydrogenase (GDH), pyrroline ... Glutamate dehydrogenase might have played a dominant role in ammonium assimilation and glutamate biosynthesis, leading to an ... which via pyrroline-5-carboxylate synthetase activity led to enhanced proline accumulation in tolerant genotypes under stress ... and pyrroline-5-carboxylate reductase (P5CR) activities with inhibition of oxidation via reduced proline dehydrogenase activity ...
https://imsear.searo.who.int/handle/123456789/189985?locale=ar
1-Pyrroline-5-Carboxylate Dehydrogenase | Colorado PROFILES
An enzyme that catalyzes the oxidation of 1-pyrroline-5-carboxylate to L-GLUTAMATE in the presence of NAD. Defects in the ... "1-Pyrroline-5-Carboxylate Dehydrogenase" is a descriptor in the National Library of Medicines controlled vocabulary thesaurus ... This graph shows the total number of publications written about "1-Pyrroline-5-Carboxylate Dehydrogenase" by people in this ... Below are the most recent publications written about "1-Pyrroline-5-Carboxylate Dehydrogenase" by people in Profiles. ...
https://profiles.ucdenver.edu/display/207071
GO:0003842: 1-pyrroline-5-carboxylate dehydrogenase activity details
GO:0003842: 1-pyrroline-5-carboxylate dehydrogenase activity (Molecular function). Catalysis of the reaction: 1-pyrroline-5- ...
https://bacteria.sbs.ntu.edu.sg/go/view/2773
ALDH4A1 gene: MedlinePlus GeneticsALDH4A1 gene: MedlinePlus Genetics
The ALDH4A1 gene provides instructions for producing the enzyme pyrroline-5-carboxylate dehydrogenase, which is found in ... Pyrroline-5-carboxylate dehydrogenase starts the second step in the process that breaks down the protein building block (amino ... Yoshida A, Rzhetsky A, Hsu LC, Chang C. Human aldehyde dehydrogenase gene family. Eur J Biochem. 1998 Feb 1;251(3):549-57. doi ... A lack of pyrroline-5-carboxylate dehydrogenase function leads to decreased breakdown of proline and elevated levels of proline ...
https://medlineplus.gov/genetics/gene/aldh4a1/
Code System Concept
1-Pyrroline-5-carboxylate dehydrogenase Active Synonym false false 3720748015 1-pyrroline-5-carboxylate dehydrogenase Active ... 1-pyrroline-5-carboxylate dehydrogenase (substance). Code System Preferred Concept Name. 1-pyrroline-5-carboxylate ... dehydrogenase (substance). Concept Status. Published. Concept Status Date. 09/01/2022. Code System Name. SNOMED-CT ...
https://phinvads.cdc.gov/vads/ViewCodeSystemConcept.action?oid=2.16.840.1.113883.6.96&code=68803005
DeCSDeCS
Pyrroline Carboxylate Reductases [D08.811.682.662.695] Pyrroline Carboxylate Reductases * Saccharopine Dehydrogenases [D08.811. ... Dehydrogenase, GGS Dehydrogenase, Glutamic-Gamma-Semialdehyde Dehydrogenase, Glutamyl-Gamma-Semialdehyde Delta(1)-Pyrroline-5- ... Carboxylate Dehydrogenase GGS Dehydrogenase Glutamic Gamma Semialdehyde Dehydrogenase Glutamic-Gamma-Semialdehyde Dehydrogenase ... Dehydrogenase, GGS. Dehydrogenase, Glutamic-Gamma-Semialdehyde. Dehydrogenase, Glutamyl-Gamma-Semialdehyde. Delta(1)-Pyrroline- ...
https://decs.bvsalud.org/en/ths/resource/?id=50633
Finding step rocA for L-citrulline catabolism in Echinicola vietnamensis KMM 6221, DSM 17526
P5C dehydrogenase 2; L-glutamate gamma-semialdehyde dehydrogenase; EC 1.2.1.88 (characterized). 33%. 90%. 220.7. aldehyde ... L-glutamate gamma-semialdehyde dehydrogenase (EC 1.2.1.88) (characterized). 49%. 94%. 515.8. delta-1-pyrroline-5-carboxylate ... 2 candidates for rocA: 1-pyrroline-5-carboxylate dehydrogenase. Score. Gene. Description. Similar to. Id.. Cov.. Bits. Other ... dehydrogenase [NAD(P)+] (EC 1.2.1.5). 69%. 731.1. Confidence: high confidence medium confidence low confidence. transporter - ...
https://papers.genomics.lbl.gov/cgi-bin/gapView.cgi?orgs=orgsFit&set=carbon&orgId=FitnessBrowser__Cola&path=citrulline&step=rocA
Time-resolved multi-omics analysis reveals the role of nutrient stress-induced resource reallocation for TAG accumulation in...Time-resolved multi-omics analysis reveals the role of nutrient stress-induced resource reallocation for TAG accumulation in...
On one hand, nitrogen deprivation induced the down-regulation of isocitrate dehydrogenase level in TCA cycle and redirected ... Combining with the up-regulation of glutamate decarboxylase and succinic semialdehyde dehydrogenase in GABA shunt, and the ... MDH, malate dehydrogenase, GDH, glutamate dehydrogenase, SSADH, succinate-semialdehyde dehydrogenase, PLC, Phospholipase C, PLD ... Most of the enzymes involved in the TCA cycle, especially isocitrate dehydrogenase (IDH), were rapidly decreased in response to ...
https://biotechnologyforbiofuels.biomedcentral.com/articles/10.1186/s13068-020-01757-1
DeCS 2013 - December 17, 2013 versionDeCS 2013 - December 17, 2013 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-diHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs.bvs.br/I/DeCS2013_Alfab-0a9.htm
Bio2Vec
ID: GO:0043904 Type: http://bio2vec.net/ontology/gene_function Label: isochorismate pyruvate lyase activity Synonyms: isochorismate pyruvate lyase activity Alternative IDs: als API: GO SPARQL: GO ...
https://bio2vec.cbrc.kaust.edu.sa/bio2vec/details/1?iri=GO:0043904
Pre GI: CDS description
CDS with a similar description: 1-pyrroline-5-carboxylate dehydrogenaseproline dehydrogenase. CDS description. CDS accession. ... 1-pyrroline-5-carboxylate dehydrogenase/proline dehydrogenase. NC_016816:1912366:1952162. NC_016816:1912366. Pantoea ananatis ...
http://pregi.bi.up.ac.za/pre_gi_cds_desc.php?cds_desc=1-pyrroline-5-carboxylate%20dehydrogenase/proline%20dehydrogenase
Find your antibody within.
P5C dehydrogenase; EC 1.2.1.88; Aldehyde dehydrogenase family 4 member A1; L-glutamate gamma-semialdehyde dehydrogenase; ... Aldehyde dehydrogenase family 8 member A1; EC 1.2.1.-; aldh8a1; NP_001004540.1 487 zebrafish ... APC membrane recruitment protein 1; Amer1; Protein FAM123B; amer1; fam123b; NULL 930 zebrafish ... GDP-Man:Man(3)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase; EC 2.4.1.131; Asparagine-linked glycosylation protein 11 homolog ...
http://www.ab-mart.com/ProteinAntibodies/List?page=4&name=zebrafish
SustainPineDB
AutoFact: Aldehyde dehydrogenase n=1 Tax=Volvox carteri f. nagariensis RepID=D8UHH5_VOLCA 1.0e-11 ... AutoFact: Putative aldehyde dehydrogenase n=1 Tax=Oryza sativa Japonica Group RepID=Q6L5I4_ORYSJ 0.0 ... FL-Next: sp=Probable aldehyde dehydrogenase; Linum usitatissimum (Flax) (Linum humile). 0.0 ... AutoFact: Probable aldehyde dehydrogenase n=1 Tax=Linum usitatissimum RepID=ALDH_LINUS 0.0 ...
https://www.scbi.uma.es/sustainpinedb/annotations/28?ann_id=296706&tab=ung
SA0934 - AureoWikiSA0934 - AureoWiki
pyruvate dehydrogenase E1 component subunit alpha [2] (data from MRSA252). SA1938. (pdp). pyrimidine-nucleoside phosphorylase [ ... glyceraldehyde-3-phosphate dehydrogenase [2] (data from MRSA252). SA1959. (glmS). glucosamine--fructose-6-phosphate ... 1-pyrroline-5-carboxylate dehydrogenase [2] (data from MRSA252). SA0496. (rplA). 50S ribosomal protein L1 [2] (data from ... 1 61 121 181 241 ATGGAACAAAATTCATATGTAATCATCGACGAGACTGGTATTCACGCTAGACCAGCAACA. ATGTTAGTACAAACAGCTTCAAAATTCGATTCTGATATTC ...
https://aureowiki.med.uni-greifswald.de/SA0934
Network Portal - Gene GSU1723
proline dehydrogenase/delta-1-pyrroline-5-carboxylate dehydrogenase (NCBI). 178, 294. GSU3460. GSU3460. glycosyl transferase, ... POSITION A C G T 1 0.4 0.6 0.0 0.0 2 0.8 0.0 0.0 0.2 3 0.0 0.6 0.4 0.0 4 0.0 0.2 0.8 0.0 5 0.0 0.0 0.2 0.8 6 0.0 0.0 0.0 1.0 7 ... POSITION A C G T 1 0.0 1.0 0.0 0.0 2 0.0 0.875 0.125 0.0 3 0.75 0.0 0.0 0.25 4 0.25 0.5 0.125 0.125 5 0.0 0.0 0.0 1.0 6 0.0 0.0 ... POSITION A C G T 1 0.125 0.0 0.0 0.875 2 0.75 0.125 0.0 0.125 3 1.0 0.0 0.0 0.0 4 0.875 0.125 0.0 0.0 5 0.5 0.0 0.5 0.0 6 0.75 ...
http://networks.systemsbiology.net/gsu/gene/GSU1723
gpuA protein (Pseudomonas aeruginosa) - STRING interaction networkgpuA protein (Pseudomonas aeruginosa) - STRING interaction network
Rhh-type transcriptional regulator, proline utilization regulon repressor / proline dehydrogenase / delta 1-pyrroline-5- ... carboxylate dehydrogenase; Oxidizes proline to glutamate for use as a carbon and nitrogen source ... Rhh-type transcriptional regulator, proline utilization regulon repressor / proline dehydrogenase / delta 1-pyrroline-5- ... carboxylate dehydrogenase; Oxidizes proline to glutamate for use as a carbon and nitrogen source ...
https://string-db.org/network/287.DR97_3250
Integrating gene and protein expression data with genome-scale metabolic networks to infer functional pathways | BMC Systems...Integrating gene and protein expression data with genome-scale metabolic networks to infer functional pathways | BMC Systems...
As a technical note, consider that FAD/FADH2 is tightly bound to a protein, in our case to D-amino acid dehydrogenase (DAAD) in ... and pyrroline-5-carboxylate reductase (P5CR)). This pathway represents the canonical biosynthetic mechanisms of L-Pro [59]. ... homoserine dehydrogenase (NADPH); HSK, homoserine kinase; NACODA, N-acetylornithine deacetylase; PDH, pyruvate dehydrogenase; ... aldehyde dehydrogenase (acetaldehyde, NAD); ASAD, aspartate-semialdehyde dehydrogenase; ASPK, aspartate kinase; ASPTA, ...
https://bmcsystbiol.biomedcentral.com/articles/10.1186/1752-0509-7-134
Genes | Free Full-Text | Impacts of the Type I Toxin-Antitoxin System, SprG1/SprF1, on Staphylococcus aureus Gene ExpressionGenes | Free Full-Text | Impacts of the Type I Toxin-Antitoxin System, SprG1/SprF1, on Staphylococcus aureus Gene Expression
Pyruvate dehydrogenase E1 component subunit β (PdhB). P99063. 1.84 ↓. 2.23 ↓. 12. Dihydrolipoyl dehydrogenase (PdhD). P99084. ... Glyceraldehyde-3-phosphate dehydrogenase 1 (GapA1). P99136. 1.62 ↓. * the arrow denotes the direction of regulation; ↑ up- and ... Glyceraldehyde-3-phosphate dehydrogenase 1 (GapA1). P99136. 1.5 ↓. 16. 3-hexulose-6-phosphate synthase (HPS). Q7A774. 1.92 ↓. ... Pyruvate dehydrogenase E1 component subunit β (PdhB). P99063. 2.19 ↓. 1.82 ↓. 2. Succinate--CoA ligase (ADP-forming) subunit α ...
https://www.mdpi.com/2073-4425/12/5/770/htm
October 2016 October 2016
Deletion of the genes that encode mitochondrial enzymes, such as proline dehydrogenase (PUT1), Δ1-pyrroline-5-carboxylate ... dehydrogenase (PUT2), alanine transaminase (ALT1), and α-ketoglutarate dehydrogenase subunit (KGD1), abolished the enhanced ...
http://microbialcell.com/issues/october-2016/
SMPDBSMPDB
carboxylate. dehydrogenase,. mitochondrial. Proline. dehydrogenase. 1,. mitochondrial. Pyrroline-5-. carboxylate. reductase 2. ... Pyrroline hydroxycarboxylic. acid. NAD. NADH. ATP. AMP. PP. i. Glycine. Ornithine. Dissipation. Guanidoacetic acid. S- ... 1-Pyrroline-2-carboxylic acid. NH. 3. H. 2. O. 2. H. 2. O. O. 2. 1-Pyrroline-4-hydroxy-2-. carboxylate. NH. 3. H. 2. O. 2. NAD ... 1-Pyrroline-5-carboxylic acid. NAD. H. 2. O. NADH. L-Proline. NAD. NADH. Oxoglutaric acid. O. 2. 4-Hydroxyproline. Succinic ...
https://smpdb.ca/view/SMP0000507?highlight%5Bcompounds%5D%5B%5D=DB00148&highlight%5Bproteins%5D%5B%5D=DB00148
Effect of a glucose impulse on the CcpA regulon in Staphylococcus aureus | BMC Microbiology | Full TextEffect of a glucose impulse on the CcpA regulon in Staphylococcus aureus | BMC Microbiology | Full Text
Also succinate dehydrogenase (sdhB), succinyl-CoA synthetase (sucCD), and 2-oxoglutarate dehydrogenase (odhAB) were repressed ... glyceraldehyde-3-phosphate dehydrogenase; gapB, glyceraldehyde-3-phosphate dehydrogenase; glcK, glucokinase; mqo2, malate: ... 2-oxoglutarate dehydrogenase component E2; pckA, phosphoenolpyruvate carboxykinase; pdhABCD, pyruvate dehydrogenase; pfk, ... The genes coding for alanine dehydrogenase (ald), aldehyde dehydrogenase (aldA), arginase (arg), and delta-1-pyrroline-5- ...
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/1471-2180-9-95
Búsqueda | BVS NicaraguaBúsqueda | BVS Nicaragua
... such as glyceraldehyde-3-phosphate dehydrogenase (GAPDH), trypsin-1, and delta-1-pyrroline-5-carboxylate synthase (ALDH18A1). ... 5. Transcriptome analysis of the hepatopancreas in Penaeus vannamei under experimental infection with Enterocytozoon ... Satellite cells were isolated from the p. major muscle of 1-week-old faster-growing modern-commercial (NC) turkeys and slower- ... CO2 adsorption experiments show that (Br-)CH3-Pyridinium-MOF-1 has a higher affinity for CO2 than its electrically neutral ...
https://pesquisa.bvsalud.org/nicaragua/?lang=es&q=au:Xu,+Jiahui
DeCS 2014 - December 16, 2014 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-diHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2016.bvsalud.org/I/DeCS2014_Alfab-0a9.htm
DeCS 2011 - December 22, 2011 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-diHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2018.bvsalud.org/I/DeCS2011_Alfab-0a9.htm
DeCS 2014 - December 16, 2014 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-diHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2019.bvsalud.org/I/DeCS2014_Alfab-0a9.htm
DeCS 2016 - July 28, 2016 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-diHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2017.bvsalud.org/I/DeCS2016_Alfab-0a9.htm
DeCS 2009 - February 20, 2009 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-DiHETE use Leukotriene ... 3,5-Cyclic-Nucleotide Phosphodiesterase use 3,5-Cyclic-AMP Phosphodiesterases 3-alpha-Hydroxysteroid Dehydrogenase (B- ...
https://decs2009.bvsalud.org/I/DeCS2009_Alfab-0a9_ing.htm
DeCS 2010 - February 12, 2010 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-DiHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2010.bvsalud.org/I/DeCS2010_Alfab-0a9.htm
DeCS 2012 - February 22, 2012 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-diHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2020.bvsalud.org/I/DeCS2012_Alfab-0a9.htm
DeCS 2010 - February 12, 2010 version
2-Oxoisovalerate Dehydrogenase (Acylating) 2-Oxoisovalerate Dehydrogenase (Lipoamide) use 3-Methyl-2-Oxobutanoate Dehydrogenase ... 2-Amino-5-phosphonovaleric Acid use 2-Amino-5-phosphonovalerate 2-Amino-6-(1,2,3-trihydroxypropyl)-4(3H)-pteridinone use ... 5,10-Methylenetetrahydrofolate-Reductase (NADH) use Methylenetetrahydrofolate Dehydrogenase (NAD+) 5,12-DiHETE use Leukotriene ... 1,2-Benzoquinones use Benzoquinones 1,2-Cyclic-Inositol-Phosphate Phosphodiesterase use Glycerophosphoinositol ...
https://decs2012.bvsalud.org/I/DeCS2010_Alfab-0a9.htm
ReductaseSynthetaseMitochondrialGlutamatePutativeEnzymeProlineAldehyde dehydrogenasesGenesProteinChromosomeAcidSynthesisCharacterizationPROFILESAlpha-1,2-mannosyltransferaseMetabolicKinaseReactionsSymbolFAMILYDelta 1-pyrroline-5-carboxylateSynthetaseBetaine aldehyde dehySemialdehyde DehydrogenaseConvertsPutativeNADHALDH4A1Glutamate dehydrogenaseAmino acidReactionSuperfamilyGenePyridoxineSuccinate semialdehydePathwayVulgarisMutationsHydrolaseType
Reductase3
  • aldo-keto reductase family 1 member B15. (gsea-msigdb.org)
  • Water withholding condition induced the stimulation of proline synthesis via increased glutamate dehydrogenase (GDH), pyrroline-5-carboxylate synthetase (P5CS) and pyrroline-5-carboxylate reductase (P5CR) activities with inhibition of oxidation via reduced proline dehydrogenase activity to a large extent as compared to water deficit and salt stress conditions. (who.int)
  • In particular, the stress-induced increase in the transfer of reducing equivalents into proline by Δ¹-pyrroline-5-carboxylate (P5C) synthetase (P5CS) and P5C reductase (P5CR) may be a protective mechanism whereby many species ameliorate shifts in cellular redox potential which accompany all biotic and abiotic stresses which cause proline accumulation, including those that do not cause cellular dehydration. (ukzn.ac.za)
Synthetase1
  • Glutamate dehydrogenase might have played a dominant role in ammonium assimilation and glutamate biosynthesis, leading to an increased glutamate pool, which via pyrroline-5-carboxylate synthetase activity led to enhanced proline accumulation in tolerant genotypes under stress conditions. (who.int)
Mitochondrial1
  • Afterwards, the semen was cooled to 5 °C for 2 h, after that period, filled in 0.5 mL straws and then placed under liquid nitrogen vapor (N L), 8 cm from 2 the liquid sheet for 15 min, and then immersed on the N L. The samples were analyzed for sperm motility, plasma membrane and 2 acrosomal membrane integrity, mitochondrial activity and binding test. (bvsalud.org)
Glutamate8
  • An enzyme that catalyzes the oxidation of 1-pyrroline-5-carboxylate to L-GLUTAMATE in the presence of NAD. (ucdenver.edu)
  • This step converts pyrroline-5-carboxylate, which is produced in the first step, to the amino acid glutamate. (medlineplus.gov)
  • Combining with the up-regulation of glutamate decarboxylase and succinic semialdehyde dehydrogenase in GABA shunt, and the phosphoenolpyruvate carboxykinase in the central hub involving pyruvate/phosphoenolpyruvate/oxaloacetate, the products from nitrogen-containing compounds degradation were recycled to be intermediates of TCA cycle and be shunted toward de novo biosynthesis of fatty acids. (biomedcentral.com)
  • NADP-dependent glutamate dehydrogenase (NADP-GDH) was purified to homogeneity from Pseudomonas aeruginosa strain 8602 (PAC 1). (microbiologyresearch.org)
  • It was concluded that NADP-GDH is not essential for growth of the wild-type organism and that glutamate formation via NAD-dependent glutamate dehydrogenase does not occur to a significant extent. (microbiologyresearch.org)
  • Mutants of Klebsiella aerogenes lacking glutamate dehydrogenase. (microbiologyresearch.org)
  • Salmonella typhimurium mutants with altered glutamate dehydrogenase and glutamate synthase activities. (microbiologyresearch.org)
  • Characterization of glutamate dehydrogenase from the ammonia oxidizing chemoautotroph Nitromonas europaea. (microbiologyresearch.org)
Putative1
  • XV" YOL105C 1 15 18 YOL105C "Putative integral membrane protein containing novel cysteine motif. (davidson.edu)
Enzyme3
  • The ALDH4A1 gene provides instructions for producing the enzyme pyrroline-5-carboxylate dehydrogenase, which is found in tissues throughout the body. (medlineplus.gov)
  • ALDH4A1 gene variants reduce or eliminate the function of the pyrroline-5-carboxylate dehydrogenase enzyme. (medlineplus.gov)
  • Here, we show that a single point mutation (Q201) in the Acinetobacter baumannii xanthine oxidase (AbXOD) obtained mutant Q201E (k cat =799.44 s-1, no inhibition) with high enzyme activity and decrease of substrate inhibition in 5 mmol/L high substrate model, and which cause two loops structure change at active center, characterized by complete loss of substrate inhibition without reduction of enzymatic activity. (bvsalud.org)
Proline4
  • Pyrroline-5-carboxylate dehydrogenase starts the second step in the process that breaks down the protein building block (amino acid) proline. (medlineplus.gov)
  • A lack of pyrroline-5-carboxylate dehydrogenase function leads to decreased breakdown of proline and elevated levels of proline and intermediate breakdown product pyrroline-5-carboxylate, causing the signs and symptoms of hyperprolinemia type II. (medlineplus.gov)
  • Tolerant genotypes possessed increased proline content and 1,1 diphenyl-picryl hydrazyl (DPPH) radical scavenging activity along with the reduced magnitude of thiobarbituric acid reactive species in parallel with decreased H2O2 content. (who.int)
  • Transgenic plants, which were selected on the basis of kanamycin resistance, regenerated at a low frequency in the presence of 1 mM proline. (ukzn.ac.za)
Aldehyde dehydrogenases1
  • Vasiliou V, Pappa A. Polymorphisms of human aldehyde dehydrogenases. (medlineplus.gov)
Genes3
  • Eukaryotic aldehyde dehydrogenase (ALDH) genes: human polymorphisms, and recommended nomenclature based on divergent evolution and chromosomal mapping. (medlineplus.gov)
  • Sequence homologies of several regions within the 5' untranslated regions of these genes to promoter elements which have been shown to participate in redox control of gene expression, the actions of phytochrome and hormones, and tissue-specific regulation of gene expression are also identified. (ukzn.ac.za)
  • Transcriptomics-based expressions of genes encoding different types of SNF1 (sucrose non-fermenting 1)-related kinases involved in sugar and stress signaling or encoding key metabolic enzymes were in line with specific qRT-PCR analysis or with the important metabolic and regulatory changes revealed by metabolomic analysis. (frontiersin.org)
Protein6
  • One of the important and highly conserved regulators of carbon catabolite regulation in low-GC Gram-positive bacteria is the catabolite control protein A, CcpA, which has been intensively studied in Bacillus subtilis [ 1 , 2 ]. (biomedcentral.com)
  • limb development membrane protein 1 [So. (gsea-msigdb.org)
  • expressed in middle/late meiosis,IV" YDR525W 1 5 7 YDR525W "Ydr525wp,IV" YDR526C 1 5 8 YDR526C "Ydr526cp,IV" YER187W 1 5 9 YER187W "similar to killer toxin,V" YER188W 1 5 10 YER188W "Yer188wp,V" YER190W 1 5 11 YER190W "Yrf1-2p,V" YFL002C 1 5 12 YFL002C "ATP-dependent RNA helicase,VI" YFL002W-B 1 5 13 YFL002W-B "TyA gag protein. (davidson.edu)
  • contains a zinc finger,XV" YOL091W 1 15 16 YOL091W "involved in sporulation,XV" YOL103W-B 1 15 17 YOL103W-B "TyB Gag-Pol protein. (davidson.edu)
  • XIII" YMR047C 3 13 3 YMR047C "Nuclear pore complex protein that is member of GLFG repeat-containing family of nucleoporins and is,XIII" YMR049C 3 13 4 YMR049C "Ymr049cp,XIII" YMR051C 3 13 5 YMR051C "TyA Gag protein. (davidson.edu)
  • Penicillin-binding protein 5, D-alanyl-D-alanine carboxypeptidase [Interproscan]. (ntu.edu.sg)
Chromosome2
Acid3
  • For the typical bacterium that can make all 20 amino acids, there are 1-2 gaps in amino acid biosynthesis pathways. (lbl.gov)
  • 1. Cerutti, P. and Guroff, G. Enzymatic formation of phenylpyruvic acid in Pseudomonas sp. (qmul.ac.uk)
  • enzymes converting chorismic acid into prephenic acid and their relationships to prephenate dehydratase and prephenate dehydrogenase. (qmul.ac.uk)
Synthesis1
  • In addition, enteral or parenteral cystine, methionine, N-acetyl-cysteine, and L-2-oxothiazolidine-4-carboxylate are effective precursors of cysteine for tissue GSH synthesis. (researchgate.net)
Characterization1
  • Hu CA, Lin WW, Valle D. Cloning, characterization, and expression of cDNAs encoding human delta 1-pyrroline-5-carboxylate dehydrogenase. (medlineplus.gov)
PROFILES1
  • Below are the most recent publications written about "1-Pyrroline-5-Carboxylate Dehydrogenase" by people in Profiles. (ucdenver.edu)
Alpha-1,2-mannosyltransferase1
Metabolic1
  • It is now well established that the metabolic reprogramming undergone by transformed cells extends far beyond glycolysis and the Warburg effect, and changes in cell metabolism have fundamental implications for tumor biology and therapy [ 5 , 6 ]. (biomedcentral.com)
Kinase1
Reactions1
  • L-1-pyrroline-3-hydroxy-5-carboxylate = 13 reactions were found. (tu-bs.de)
Symbol3
FAMILY1
  • Aldehyde dehydrogenase family [Interproscan]. (ntu.edu.sg)
Delta 1-pyrroline-5-carboxylate1
  • The role of Delta(1)-Pyrroline-5-carboxylate dehydrogenase in proline degradation. (mpg.de)
Synthetase2
  • Instead, we discovered that the glutamate-consuming enzymes phosphoserine aminotransferase 1 (PSAT1) and aldehyde dehydrogenase 18A1 (ALDH18A1)/Δ1-pyrroline-5-carboxylate synthetase (P5CS) are required for collagen protein production by lung fibroblasts. (nih.gov)
  • Chandrakar V., Keshavkant S. (2018): Nitric oxide and dimethylthiourea up-regulates pyrroline-5-carboxylate synthetase expression to improve arsenic tolerance in Glycine max L. Environmental Progress and Sustainable Energy, 38: 402-409. (agriculturejournals.cz)
Betaine aldehyde dehy1
Semialdehyde Dehydrogenase2
  • aspartate-semialdehyde dehydrogenase [EC:1.2.1. (genome.jp)
  • alpha-ketoglutaric semialdehyde dehydrogenase [EC:1.2.1. (genome.jp)
Converts4
  • This step converts pyrroline-5-carboxylate, which is produced in the first step, to the amino acid glutamate. (medlineplus.gov)
  • Or as part of L-arginine degradation I, the aminotransferase rocD converts ornithine to glutamate 5-semialdehyde, which spontaneously converts to 1-pyrroline-5-carboxylate. (lbl.gov)
  • A dehydrogenase converts this to glutamate. (lbl.gov)
  • Dehydrogenase that converts trans-4-L-hydroxyproline to delta-1-pyrroline-3-hydroxy-5-carboxylate (Hyp) using ubiquinone-10 as the terminal electron acceptor. (nih.gov)
Putative4
  • putative zinc-binding dehydrogenase [Pec. (virginia.edu)
  • putative alcohol dehydrogenase [Salmonel. (virginia.edu)
  • Glycine max putative E3 ubiquitin-protein ligase UBR7-like (LOC100817441), transcript variant 1, mRNA. (go.jp)
  • Glycine max putative cyclin-D6-1-like (LOC100799951), mRNA. (go.jp)
NADH2
  • NADH, also known as DPNH or b-nadh, belongs to the class of organic compounds known as (5'->5')-dinucleotides. (ymdb.ca)
  • YP_007353830.1 [mitochondrion Moschus chrysogaster]NADH dehydrogenase subunit 1 (mitochondrion) [Moschus chrysogaster]. (vital-it.ch)
ALDH4A12
  • The ALDH4A1 gene is found on chromosome 1 . (medlineplus.gov)
  • Structural Studies of Yeast Delta-Pyrroline-5-carboxylate Dehydrogenase (ALDH4A1): Active Site Flexibility and Oligomeric State. (proteopedia.org)
Glutamate dehydrogenase1
  • We found that metabolism of glutamate to α-ketoglutarate by glutamate dehydrogenase or the glutamate-pyruvate or glutamate-oxaloacetate transaminases is not required for collagen protein production. (nih.gov)
Amino acid1
  • For the typical bacterium that can make all 20 amino acids, there are 1-2 gaps in amino acid biosynthesis pathways. (lbl.gov)
Reaction1
  • As an initial step in understanding the biochemistry of human P5CDh and molecular basis of HPII, we utilized published peptide sequence data and degenerate primer polymerase chain reaction to clone two full-length human P5CDh cDNAs, differing in length by 1 kilobase pair (kb). (nih.gov)
Superfamily2
  • Sophos NA, Vasiliou V. Aldehyde dehydrogenase gene superfamily: the 2002 update. (medlineplus.gov)
  • Although Put2p exhibits the expected aldehyde dehydrogenase superfamily fold, a large portion of the active site is disordered in the crystal structure. (proteopedia.org)
Gene2
  • The theory that operons are the remnants of tandem duplication has recently been criticized by Lawrence and Roth [ 5 ], who instead proposed that horizontal gene transfer may be the underlying mechanism for the occurrence of gene clusters. (biomedcentral.com)
  • 5] analyzed the gene expression of twelve transcription factors from two drought tolerant peanut genotypes under drought conditions and identified the expression patterns of drought-inducible transcripts. (scielo.cl)
Pyridoxine1
  • These vitB6 compounds (also called vitamers) are pyridoxine (PN), pyridoxamine (PM), pyridoxal (PL) and their 5′-phosphorylated forms pyridoxine 5′-phosphate (PNP), pyridoxamine 5′-phosphate (PMP) and pyridoxal 5′-phosphate (PLP). (intechopen.com)
Succinate semialdehyde1
  • Comment: GABA (4-aminobutanoate) is consumed by an aminotransferase (known as gabT or puuE), which forms succinate semialdehyde, and dehydrogenase gabD, which forms succinate. (lbl.gov)
Pathway2
  • It can be succinylated by aruFG and then catabolized by the later steps of the arginine succinyltransferase pathway, via aminotransferase, dehydrogenase, and desuccinylase reactions (see PMC179677 and PMID:7523119 ). (lbl.gov)
  • see pathway 5 of PMID:11759672 . (lbl.gov)
Vulgaris1
  • betaine aldehyd dehydrogenase [Beta vulgaris subsp. (cornell.edu)
Mutations1
  • In a screen for mutations that activate SKN-1-dependent oxidative stress responses in the muscle of C. elegans 5-7 , we identified 96 independent genetic mutants harboring loss-of-function alleles of alh - 6 , exclusively. (sciety.org)
Hydrolase2
  • ribonucleoside hydrolase 1 [Salmonella e. (virginia.edu)
  • Glycine max bifunctional epoxide hydrolase 2-like (LOC100804496), transcript variant 1, mRNA. (go.jp)
Type1
  • [1] The most common type is eumelanin, of which there are two types- brown eumelanin and black eumelanin. (knowpia.com)
Materials | Free Full-Text | Gene Expression, Bacteria Viability and Survivability Following Spray Drying of Mycobacterium...
Materials | Free Full-Text | Gene Expression, Bacteria Viability and Survivability Following Spray Drying of Mycobacterium... (mdpi.com)
ALDH4A1 gene: MedlinePlus Genetics
ALDH4A1 gene: MedlinePlus Genetics (medlineplus.gov)
Time-resolved multi-omics analysis reveals the role of nutrient stress-induced resource reallocation for TAG accumulation in...
Time-resolved multi-omics analysis reveals the role of nutrient stress-induced resource reallocation for TAG accumulation in... (biotechnologyforbiofuels.biomedcentral.com)
Bio2Vec
Bio2Vec (bio2vec.cbrc.kaust.edu.sa)
ISMARA results: TBX15_MGA
ISMARA results: TBX15_MGA (ismara.unibas.ch)
SustainPineDB
SustainPineDB (scbi.uma.es)
Network Portal - Gene GSU1723
Network Portal - Gene GSU1723 (networks.systemsbiology.net)
GpuA protein (Pseudomonas aeruginosa) - STRING interaction network
GpuA protein (Pseudomonas aeruginosa) - STRING interaction network (string-db.org)
Effects of Salt Stress on Chlorophyll Fluorescence and the Antioxidant System in Ginkgo biloba L. Seedlings in: HortScience...
Effects of Salt Stress on Chlorophyll Fluorescence and the Antioxidant System in Ginkgo biloba L. Seedlings in: HortScience... (journals.ashs.org)
October 2016
October 2016 (microbialcell.com)
Suggested guidelines for the diagnosis and management of urea cycle disorders | Orphanet Journal of Rare Diseases | Full Text
Suggested guidelines for the diagnosis and management of urea cycle disorders | Orphanet Journal of Rare Diseases | Full Text (ojrd.biomedcentral.com)
BKMS-react online
BKMS-react online (bkm-react.tu-bs.de)
Hyperprolinemia: MedlinePlus Genetics
Hyperprolinemia: MedlinePlus Genetics (medlineplus.gov)
RsfS protein (Pseudomonas aeruginosa) - STRING interaction network
RsfS protein (Pseudomonas aeruginosa) - STRING interaction network (string-db.org)
SACOL1745 - AureoWiki
SACOL1745 - AureoWiki (aureowiki.med.uni-greifswald.de)
PDF) Glutathione Metabolism and Its Implications for Health
PDF) Glutathione Metabolism and Its Implications for Health (researchgate.net)
Comparative analysis of alfalfa (Medicago sativa L.) leaf transcriptomes reveals genotype-specific salt tolerance mechanisms |...
Comparative analysis of alfalfa (Medicago sativa L.) leaf transcriptomes reveals genotype-specific salt tolerance mechanisms |... (bmcplantbiol.biomedcentral.com)
Mutations Affecting the Synthesis of NADP-dependent Glutamate Dehydrogenase in Pseudomonas aeruginosa | Microbiology Society
Mutations Affecting the Synthesis of NADP-dependent Glutamate Dehydrogenase in Pseudomonas aeruginosa | Microbiology Society (microbiologyresearch.org)
ECMDB: Arginine and proline metabolism
ECMDB: Arginine and proline metabolism (ecmdb.ca)
Tissue expression of ALDH18A1 - Summary - The Human Protein Atlas
Tissue expression of ALDH18A1 - Summary - The Human Protein Atlas (v17.proteinatlas.org)
Search Ageing-Associated Genes in Humans
Search Ageing-Associated Genes in Humans (genomics.senescence.info)
ISMARA results: CEBPB
ISMARA results: CEBPB (ismara.unibas.ch)
Newborn Screening Codes
Newborn Screening Codes (lhncbc.nlm.nih.gov)
Hyperprolinemia type 2 - Getting a Diagnosis - Genetic and Rare Diseases Information Center
Hyperprolinemia type 2 - Getting a Diagnosis - Genetic and Rare Diseases Information Center (rarediseases.info.nih.gov)
MeSH Browser
MeSH Browser (meshb.nlm.nih.gov)
Housekeeping Genes
Housekeeping Genes (esbl.nhlbi.nih.gov)