1-Methyl-3-isobutylxanthine
Theophylline
A methyl xanthine derivative from tea with diuretic, smooth muscle relaxant, bronchial dilation, cardiac and central nervous system stimulant activities. Theophylline inhibits the 3',5'-CYCLIC NUCLEOTIDE PHOSPHODIESTERASE that degrades CYCLIC AMP thus potentiates the actions of agents that act through ADENYLYL CYCLASES and cyclic AMP.
Cyclic AMP
Encyclopedias as Topic
Telomerase
Induced Pluripotent Stem Cells
Stem Cells
Teratoma
A true neoplasm composed of a number of different types of tissue, none of which is native to the area in which it occurs. It is composed of tissues that are derived from three germinal layers, the endoderm, mesoderm, and ectoderm. They are classified histologically as mature (benign) or immature (malignant). (From DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1642)
Cell Differentiation
Dissertations, Academic as Topic
Materia Medica
Materials or substances used in the composition of traditional medical remedies. The use of this term in MeSH was formerly restricted to historical articles or those concerned with traditional medicine, but it can also refer to homeopathic remedies. Nosodes are specific types of homeopathic remedies prepared from causal agents or disease products.
Batch Cell Culture Techniques
Homeodomain Proteins
Oligonucleotide Array Sequence Analysis
Luteinizing hormone inhibits conversion of pregnenolone to progesterone in luteal cells from rats on day 19 of pregnancy. (1/1387)
We have previously reported that intrabursal ovarian administration of LH at the end of pregnancy in rats induces a decrease in luteal progesterone (P4) synthesis and an increase in P4 metabolism. However, whether this local luteolytic effect of LH is exerted directly on luteal cells or on other structures, such as follicular or stromal cells, to modify luteal function is unknown. The aim of the present study was to determine the effect of LH on isolated luteal cells obtained on Day 19 of pregnancy. Incubation of luteal cells with 1, 10, 100, or 1000 ng/ml of ovine LH (oLH) for 6 h did not modify basal P4 production. The addition to the culture medium of 22(R)-hydroxycholesterol (22R-HC, 10 microgram/ml), a membrane-permeable P4 precursor, or pregnenolone (10(-2) microM) induced a significant increase in P4 accumulation in the medium in relation to the control value. When luteal cells were preincubated for 2 h with oLH, a significant (p < 0.01) reduction in the 22R-HC- or pregnenolone-stimulated P4 accumulation was observed. Incubation of luteal cells with dibutyryl cAMP (1 mM, a cAMP analogue) plus isobutylmethylxanthine (1 mM, a phosphodiesterase inhibitor) also inhibited pregnenolone-stimulated P4 accumulation. Incubation with an inositol triphosphate synthesis inhibitor, neomycin (1 mM), or an inhibitor of intracellular Ca2+ mobilization, (8,9-N, N-diethylamino)octyl-3,4,5-trimethoxybenzoate (1 mM), did not prevent the decrease in pregnenolone-stimulated P4 secretion induced by oLH. It was concluded that the luteolytic action of LH in late pregnancy is due, at least in part, to a direct action on the luteal cells and that an increase in intracellular cAMP level might mediate this effect. (+info)Phosphorylation of the small heat shock-related protein, HSP20, in vascular smooth muscles is associated with changes in the macromolecular associations of HSP20. (2/1387)
Cyclic nucleotide-dependent vasorelaxation is associated with increases in the phosphorylation of a small heat shock-related protein, HSP20. We hypothesized that phosphorylation of HSP20 in vascular smooth muscles is associated with alterations in the macromolecular associations of HSP20. Treatment of bovine carotid artery smooth muscles with the phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine, and the adenylate cyclase activator, forskolin, led to increases in the phosphorylation of HSP20 and dissociation of macromolecular aggregates of HSP20. However, 3-isobutyl-1-methylxanthine and forskolin treatment of a muscle that is uniquely refractory to cyclic nucleotide-dependent vasorelaxation, human umbilical artery smooth muscle, did not result in increases in the phosphorylation of HSP20 or to dissociation of macromolecular aggregates. HSP20 can be phosphorylated in vitro by the catalytic subunit of cAMP-dependent protein kinase (PKA) in both carotid and umbilical arteries and this phosphorylation of HSP20 is associated with dissociation of macromolecular aggregates of HSP20. Activation of cyclic nucleotide-dependent signaling pathways does not lead to changes in the macromolecular associations of another small heat shock protein, HSP27. Interestingly, the myosin light chains (MLC20) are in similar fractions as the HSP20, and phosphorylation of HSP20 is associated with changes in the macromolecular associations of MLC20. These data suggest that increases in the phosphorylation of HSP20 are associated with changes in the macromolecular associations of HSP20. HSP20 may regulate vasorelaxation through a direct interaction with specific contractile regulatory proteins. (+info)Identification of a region of the C-terminal domain involved in short-term desensitization of the prostaglandin EP4 receptor. (3/1387)
1. The prostaglandin EP4 receptor, which couples to stimulation of adenylyl cyclase, undergoes rapid agonist-induced desensitization when expressed in CHO-K1 cells. 2. Truncation of the 488-amino acid receptor at residue 350 removes the carboxy-terminal domain and abolishes desensitization. 3. To further delineate residues involved in desensitization, the receptor was truncated at position 408, 383 or 369. Receptors truncated at position 408 or 383 underwent PGE2-induced desensitization, whereas the receptor truncated at position 369 displayed sustained activity, indicating that the essential residues for desensitization lie between 370 and 383. 4. The six serines in the 14-amino acid segment between residues 370 and 383 were mutated to alanine, retaining the entire C-terminal domain. Desensitization was absent in cells expressing this mutant. 5. The results indicate involvement of serines located between 370 and 382 in rapid desensitization of the EP4 receptor. (+info)Melatonin inhibits release of luteinizing hormone (LH) via decrease of [Ca2+]i and cyclic AMP. (4/1387)
The role of [Ca2+]i and cAMP in transduction of the melatonin inhibitory effect on GnRH-induced LH release from neonatal rat gonadotrophs has been studied, because melatonin inhibits the increase of both intracellular messengers. Treatments increasing Ca2+ influx (S(-) Bay K8644 or KCI) or cAMP concentration (8-bromo-cAMP or 3-isobutyl-1-methylxanthine) potentiated the GnRH-induced LH release and partially diminished the inhibitory effect of melatonin. Combination of the treatments increasing cAMP and calcium concentrations blocked completely the melatonin inhibition of LH release. The combined treatment with 8-bromo-cAMP and S(-) Bay K8644 also blocked the melatonin inhibition of GnRH-induced [Ca2+]i increase in 89 % of the gonadotrophs, while any of the treatments alone blocked the melatonin effect in about 25 % of these cells. These observations suggest that a cAMP-dependent pathway is involved in regulation of Ca2+ influx by melatonin and melatonin inhibition of LH release may be mediated by the decrease of both messengers. (+info)Modulation of human airway smooth muscle proliferation by type 3 phosphodiesterase inhibition. (5/1387)
Elevation in cell cAMP content can inhibit mitogenic signaling in cultured human airway smooth muscle (HASM) cells. We studied the effects of the type 3-selective phosphodiesterase inhibitor siguazodan, the type 4-selective phosphodiesterase inhibitor rolipram, and the nonselective inhibitor 3-isobutyl-1-methylxanthine (IBMX) on proliferation of cultured HASM cells. At concentrations selective for the type 3 phosphodiesterase isoform, siguazodan inhibited both [3H]thymidine incorporation (IC50 2 microM) and the increase in cell number (10 microM; 64% reduction) induced by platelet-derived growth factor-BB (20 ng/ml). These effects were mimicked by IBMX. At concentrations selective for type 4 phosphodiesterase inhibition, rolipram was without effect. A 20-min exposure to siguazodan and rolipram did not increase whole cell cAMP levels. However, in HASM cells transfected with a cAMP-responsive luciferase reporter (p6CRE/Luc), increases in cAMP-driven luciferase expression were seen with siguazodan (3.9-fold) and IBMX (16.5-fold). These data suggest that inhibition of the type 3 phosphodiesterase isoform present in airway smooth muscle results in inhibition of mitogenic signaling, possibly through an increase in cAMP-driven gene expression. (+info)Isoforms of the Na-K-2Cl cotransporter in murine TAL II. Functional characterization and activation by cAMP. (6/1387)
The functional properties of alternatively spliced isoforms of the mouse apical Na+-K+-2Cl- cotransporter (mBSC1) were examined, using expression in Xenopus oocytes and measurement of 22Na+ or 86Rb+ uptake. A total of six isoforms, generated by the combinatorial association of three 5' exon cassettes (A, B, and F) with two alternative 3' ends, are expressed in mouse thick ascending limb (TAL) [see companion article, D. B. Mount, A. Baekgaard, A. E. Hall, C. Plata, J. Xu, D. R. Beier, G. Gamba, and S. C. Hebert. Am. J. Physiol. 276 (Renal Physiol. 45): F347-F358, 1999]. The two 3' ends predict COOH-terminal cytoplasmic domains of 129 amino acids (the C4 COOH terminus) and 457 amino acids (the C9 terminus). The three C9 isoforms (mBSC1-A9/F9/B9) all express Na+-K+-2Cl- cotransport activity, whereas C4 isoforms are nonfunctional in Xenopus oocytes. Activation or inhibition of protein kinase A (PKA) does not affect the activity of the C9 isoforms. The coinjection of mBSC1-A4 with mBSC1-F9 reduces tracer uptake, compared with mBSC1-F9 alone, an effect of C4 isoforms that is partially reversed by the addition of cAMP-IBMX to the uptake medium. The inhibitory effect of C4 isoforms is a dose-dependent function of the alternatively spliced COOH terminus. Isoforms with a C4 COOH terminus thus exert a dominant negative effect on Na+-K+-2Cl- cotransport, a property that is reversed by the activation of PKA. This interaction between coexpressed COOH-terminal isoforms of mBSC1 may account for the regulation of Na+-K+-2Cl- cotransport in the mouse TAL by hormones that generate cAMP. (+info)Insulin-secreting activity of the traditional antidiabetic plant Viscum album (mistletoe). (7/1387)
Viscum album (mistletoe) has been documented as a traditional treatment of diabetes. In acute 20-min tests, 1-10 mg/ml aqueous extract of mistletoe evoked a stepwise 1.1- to 12.2-fold stimulation of insulin secretion from clonal pancreatic B-cells. This effect was abolished by 0.5 mM diazoxide and prior exposure to extract did not alter subsequent stimulation of insulin secretion induced by 10 mM L-alanine, thereby negating a detrimental effect on cell viability. The insulin-releasing effect of mistletoe extract was unaltered by 16.7 mM glucose, l-alanine (10 mM), 3-isobutyl-1-methylxanthine (IBMX) (1 mM), or a depolarising concentration of KCl (25 mM). The ability of extract to enhance insulin secretion did not depend upon the use of heat during extract preparation and was not mediated by lectins. These results demonstrate the presence of insulin-releasing natural product(s) in Viscum album which may contribute to the reported antidiabetic property of the plant. (+info)Aldosterone, not estradiol, is the physiological agonist for rapid increases in cAMP in vascular smooth muscle cells. (8/1387)
BACKGROUND: Steroid-induced gene regulation in the endocrine tissues and vascular wall is achieved through the interaction of specific receptor proteins and promoters of target genes. In addition to these delayed steroid actions, rapid effects of steroids have been reported in various tissues that were clearly incompatible with the classic theory of genomic steroid action. METHODS AND RESULTS: Because high doses of 17beta-estradiol have been shown to modulate intracellular cAMP levels in vascular smooth muscle cells, steroid-induced stimulation of adenylate cyclase stimulation and phosphorylation of cAMP response element binding protein was investigated in porcine coronary artery vascular smooth muscle cells. Aldosterone induces a approximately 1.5- to 2.5-fold increase in intracellular cAMP levels (EC50 approximately 0.01 to 0.1 nmol/L) within 1 minute, whereas 17beta-estradiol and hydrocortisone act only at supraphysiological concentrations (10 micromol/L). Aldosterone-induced changes in intracellular cAMP are calcium dependent; they are not blocked by inhibitors of mineralocorticoid receptors, transcription, or protein synthesis. In addition, aldosterone induces a time-dependent phosphorylation of cAMP response element binding protein with potential transcriptional importance. CONCLUSIONS: A nongenomic modulation of vascular smooth muscle cells by aldosterone is consistent with the data that aldosterone, not estrogen, is the physiological stimulus for cAMP. (+info)
Further characterization of the putative 5-HT4 receptor mediating depolarization of the rat isolated vagus nerve - Semantic...
GH3 cells expressing constitutively active Gsα (Q227L) show enhanced hormone secretion and proliferation<...
Gsk126 In Vivo | Cuentanos tu Historia
Long-term effects of neonatal exposure to isobutylmethylxanthine | SpringerLink
TNO Repository search for: subject:Intraperitoneal drug administration
JoVE Author Search: Barrionuevo G
N-{3-[5-Amino-4-cyano-1-(4-fluorophenyl)-1H-pyrazol-3-yl]propyl}-3-isobutyl-4-oxo-3,4-dihydro-1-phthalazinecarboxamide |...
JoVE Author Search: Brewis IA
Cell response to nanocellulose films
Cyclic AMP Raises Intracellular Ca2+ in Human Megakaryocytes Independent of Protein Kinase A | Arteriosclerosis, Thrombosis,...
Pharmacology definition - Phosphodiesterase Inhibitor - Medical Zone
Preparation and identification of new Azo (methyl-xanthine) ligands and their transition metal complexes / كلية 5
8-bromo-7-2s-3-4-ethylphenoxy-2-hydroxy-propyl-3-methyl-xanthine - albumin
11C]-labeling of some caffeine derivatives for mapping adenosine A2a receptors by PET technique | SpringerLink
3-butyl-6-isobutyl-5-methyl-1H-pyrazin-2-one | C13H22N2O - ChemSynthesis
2-ISOBUTYL-4,6-DIMETHYL-S-TRIAZINE | C9H15N3 - PubChem
Isobutyl-(4-methyl-benzyl)-piperidin-4-yl-amine | C17H28N2 - PubChem
1-ISOBUTYL-1H-IMIDAZOL-5-YL)METHANOL 95% (CAS No. 226930-88-7) Suppliers @ ChemicalRegister.com
Forskolin 250 mg (Forskolin 1234) 60 Vcaps , made by creative-bioscience
Pure Natural Forskolin Dr Oz - 2016s Best Forskolin Extract
Modulation of islet G-proteins, α-glucosidehydrolase inhibition and insulin release stimulated by various secretagogues |...
Modulation of islet G-proteins, α-glucosidehydrolase inhibition and insulin release stimulated by various secretagogues |...
Prostaglandin e1 and f2α stimulate differentiation and proliferation, respectively, of clonal osteoblastic mc3t3-e1 cells by...
Isobutyl Benzene
Forskolin | Adenylate cyclase activator | Coleonol | CAS [66575-29-9] | Axon 2264 | Axon Ligand™ with |98% purity available...
Patent US6037346 - Local administration of phosphodiesterase inhibitors for the treatment of ... - Google Patents
Isobutyl Acetate Manufacturers, Stockists, Suppliers, Dealers in Dubai - Dubai Yellow Pages Online
Fertilization tubules in wild-type (A) and ida5 (B) mt+ | Open-i
Buy Isobutyl Acetate from Brenntag Peru Suppliers | 110-19-0
Forskolin - Benefits, Dosage, Side Effects, Reviews, Dr. Oz and more
Plus it
4-Methyl-2-pentanone Compound Information and Applications for GC (Gas Chromatography) and LC (Liquid Chromatography) Analysis
...
Plus it
CAS 110-19-0 : ISOBUTYL ACETATE
Cholesterol isobutyl carbonate - Alfa Chemistry
ChemIDplus - 14056-10-1 - OOGCHGUNVLXNNP-UHFFFAOYSA-N - Isobutyl 3-cyanoacrylate - Similar structures search, synonyms,...
Where Can I Purchase Forskolin Extract in Nepal [Forskolin 250 20% Review] [Forskolin 250 20% Review] [Forskolin 250 20% Review...
Buy cheap Penegra online without prescription | Visa & MasterCard accepted
Methyl isobutyl ketone Compound Information and Applications for GC (Gas Chromatography) and LC (Liquid Chromatography)...
Effect of 1-(2-chloroethyl)-3-isobutyl-3-(beta-maltosyl)-1- -nitrosour by Y Akaike, Y Arai et al.
Intracellular cAMP levels are higher in LDLR-/−p110γ | Open-i
Patent Detail: Modulation of Bioactive Epoxy-Fatty Acid Levels by Phosphodiesterase Inhibitors (Superfund Research Program)
Dipyridamole purchase | Hynes Landscaping
Forskolin GNC Review
Camp may have gone but you cant evict an idea, say protesters | The Times
All Natural Forskolin - Support A Healthy Metabolism
Go to Just Potent Forskolin Extract Review.
Resensitization of hepatocyte glucagon-stimulated adenylate cyclase can be inhibited when cyclic AMP phosphodiesterase...
The in vitro activation of cyclic AMP production by either forskolin or isoproterenol in the syrian hamster pineal during the...
methyl isobutyl acetate
Methyl isobutyl ketone - Masterchem.ee
Methyl isobutyl ketone - Masterchem.ee
Plus it
Suggest that cAMP may not be a key player in mediating | CTSK Inhibito ctskinhibito.com
Suggest that cAMP may not be a key player in mediating | Caspase1-Inhibitors caspase1inhibitor.com
Long-term effect of forskolin on the activation of adenylyl cyclase in astrocytes - Fingerprint
- Scholars @ UT Health San...
Forskolin Archives - F*CK FAT - Weight Loss for the Real World
How Forskolin Works for Weight Loss - Forskolin Review
Forskolin Fuel: Dont Buy Forskolinl! Check The Shocking Reviews!
Forskolin Fit Pro Reviews: Does It Really Work? | Trusted Health Answers
Try Forskolin Extract For FREE & See The Results
Muse cell
Y Fujita 1 2, T Nohara 1, S Takashima 1, K Natsuga 1, M Adachi 3, K Yoshida 3, S Shinkuma 4, T Takeichi 5, H Nakamura 1, O Wada ... 2021 Jan;141(1):198-202 Mineda, K.; Feng, J.; Ishimine, H.; Takada, H.; Doi, K.; Kuno, S.; Kinoshita, K.; Kanayama, K.; Kato, H ... 3][1][4][5][6] ] In the bone marrow, they represent one out of 3000 mono-nucleated cells. Other than mesenchymal tissues, Muse ... 34 (1): 160-73. doi:10.1002/stem.2206. PMID 26388204. Kinoshita, K.; Kuno, S.; Ishimine, H.; Aoi, N.; Mineda, K.; Kato, H.; Doi ...
List of MeSH codes (D03)
... methyl ester MeSH D03.383.725.210 - dimethindene MeSH D03.383.725.220 - 2,2'-dipyridyl MeSH D03.383.725.227 - disopyramide MeSH ... methyl ester MeSH D03.383.725.547.950 - xanthinol niacinate MeSH D03.383.725.565 - nicotinyl alcohol MeSH D03.383.725.592 - ... 4-dichloro-n-methyl-n-(2-(1-pyrrolidinyl)-cyclohexyl)-benzeneacetamide, (trans)-isomer MeSH D03.383.773.342 - glycopyrrolate ... 4-methyl-1-homopiperazinylthiocarbonyl)disulfide MeSH D03.383.129.308.100 - 4-(3-butoxy-4-methoxybenzyl)-2-imidazolidinone MeSH ...
Korean Red Ginseng (Panax ginseng) Potentiates the Inhibitory Actions of Testosterone on Obesity and Adipogenesis in High Fat...
1. Regulation of body weight and adipose tissue mass by ginseng extract (GE) and testosterone (T) in high-fat diet (HFD)-fed ... 3). Co-administration of GE and testosterone decreased C/EBPα and aP2 mRNA levels compared with HFD-fed mice treated with ... 3. Effects of ginseng extract (GE) and testosterone (T) on adipogenesis-associated gene expression in high-fat diet (HFD)-fed ... Reverse : 5'- AAATATTGCCAAGTCGCTGTCATC -3'. Statistical analysis. All values are expressed as mean ± standard deviation (SD). ...
Privatpraxis Dr. Strunz
2-3, 1976). *Strunz, ZU.T., Grossman, M.I.: Gastric emptying of liquids in intact dogs. Clin. Res. 25: 112 A, 1977 (Annual ... 3-5, 1974). *Strunz, U., Domschke, W., Schubert, E., Mitznegg, P., Wünsch, E., Jaeger, E., Demling, L.: Different motor ... 3-5, 1974). *Schubert, E., Strunz, U., Mitznegg, P., Domschke, S., Domschke W., Demling, L.: Muskulotrophe Wirkung von ... Biol. 1: 461, 1975 (2nd Annual Meeting of the Deutsche Arbeitsgemeinschaft für Ultraschalldiagnostik (DAUD), Hannover, West ...
Stable and strong promoter? - Information - 2022
3). The relative fluorescence intensities of the remaining promoters P17, P18, P20, P23 and P29 were lower than that of lac ... 3), The orders of promoter strength reflected by the real-time qPCR and GFP reporter were identical to the result obtained by ... 1). qPCR was employed for the analysis of transcriptional levels of gfp under different promoters at different growth phases, i ... DNA solution was composed of pT2AL-CMV/βactin-Tomato-T2A-GFP (1-3 μg/μL) and CMV/βactin-T2TP at a molar ratio of 1:5-1:10, ...
pharmawuerz | Adenylate | BibSonomy
4-dioxo-6-methyl-8-(substituted) 1,2,3,4-tetrahydro 1,2,4-triazolo 3,4-f-purines as potential adenosine receptor antagonists. ... 1-Methyl-3-isobutylxanthine/pharmacologyAMP-DependentAMP/metabolismAcidAdenylateAdrenergicAminoBlotting,CellCyclase/metabolism ... Am J Physiol 263 (2 Pt 1): C502-8 (August 1992. )Spielman, W S Klotz, K N Arend, L J Olson, B A LeVier, D G Schwabe, U R01 DK- ... Arrestins*Cyclic5'-O-(3-Thiotriphosphate)/pharmacologyAMP-DependentAcidAdenylateAminoAnimalsAntibodiesAntigens/genetics/* ...
Targeting of mammalian glucose transporters | Journal of Cell Science | The Company of Biologists
Regulation of the expression of pp160, a putative insulin receptor signal protein, by insulin, dexamethasone, and 1-methyl-3- ... Regulation of the expression of pp160, a putative insulin receptor signal protein, by insulin, dexamethasone, and 1-methyl-3- ... Phosphatidylinositol 3-kinase is activated by association with IRS-1 during insulin stimulation. ... Phosphatidylinositol 3-kinase is activated by association with IRS-1 during insulin stimulation. ...
Human adipose-derived stem cells pre-treated with platelet-rich plasma and hepatocyte growth factor alleviate liver fibrosis in...
... isobutylxanthine (IBMX) (Sigma Aldrich) for adipogenic differentiation. Cells were stained with Oil Red O (Sigma Aldrich) to ... 2010; 3 : 161-174 . View Article PubMed PMC Google Scholar * F Ishikawa, CJ Drake, S Yang, P Fleming, H Minamiguchi, RP ... 2014; 1 : 43-49 . View Article Google Scholar * PK Ngoc, PV Phuc, TH Nhung, DT Thuy, NTM Nguyet. Improving the efficacy of type ... 1989; 342 : 440-3 . View Article PubMed Google Scholar * H Funakoshi, T Nakamura. Hepatocyte growth factor: from diagnosis to ...
PDE4-regulated cAMP degradation controls the assembly of integrin-dependent actin adhesion structures and REF52 cell migration<...
Y1 - 2004/5/1. N2 - Plating of REF52 cells onto extracellular matrix components leads to the formation of integrin-dependent ... keywords = "1-Methyl-3-isobutylxanthine, 3',5'-Cyclic-AMP Phosphodiesterases, Actins, Animals, Cell Adhesion, Cell Line, Cell ...
Activation of chloride secretion by isoflavone genistein in endometrial epithelial cells
1,2 bis(o aminophenoxy)ethane n,n,n',n' tetraacetic acid. 4,4' diisothiocyanatostilbene 2,2' disulfonic acid. 5 nitro 2 (3 ... ethylene glycol 1,2 bis(2 aminophenyl) ether n,n,n',n' tetraacetic acid. forskolin. fulvestrant. glibenclamide. ... 1-Methyl-3-isobutylxanthine. Amiloride. Animals. Bumetanide. Cell Membrane Permeability. Cells, Cultured. Chlorides. Colforsin ... n benzyl 2 cyano 3 (3,4 dihydroxyphenyl)acrylamide. protein tyrosine kinase. tyrphostin. uridine triphosphate. vanadic acid. ...
Oroxylum indicum (L.) Kurz extract inhibits adipogenesis and lipase activity in vitro | BMC Complementary Medicine and...
... methyl isobutyl xanthine (IBMX), lipase from porcine pancreas type 2, dimethyl sulphoxide (DMSO), 4-Nitrophenyl dodecanoate ( ... Each area is produced as a result of asymmetrical stretching from the methyl and methylene groups of lipids, and also the ... ORCID: orcid.org/0000-0003-3884-30221 Show authors. BMC Complementary and Alternative Medicine volume 18, Article number: 177 ( ... Briefly, 1 mL of the OIE was mixed with 2 mL of 2% w/v of NaOH. A 2 mL aliquot of 10% w/v lead acetate solution was added to 1 ...
Natalie Ahn's research topics | Colorado PROFILES
In this concept 'cloud', the sizes of the concepts are based not only on the number of corresponding publications, but also how relevant the concepts are to the overall topics of the publications, how long ago the publications were written, whether the person was the first or senior author, and how many other people have written about the same topic. The largest concepts are those that are most unique to this person ...
MEDICA
Academic Dissertations;Academic Dissertations--South Carolina;1-Methyl-3-isobutylxanthine--pharmacology;Receptor, Adenosine A2B ... pharmacology and toxicology of 3-isobutyl 1-methylxanthine (IBMX) in the 661w retina-derived cell line ...
Halothane reduces force and intracellular Ca2+ in airway smooth muscle independently of cyclic nucleotides.
1-Methyl-3-isobutylxanthine, Animals, Calcium, Cyclic AMP, Dogs, Female, Halothane, Indomethacin, Intracellular Membranes, ... Isometric force and the intracellular concentrations of adenosine cyclic 3',5'-monophosphate ([cAMP]i) guanosine cyclic 3',5'- ... These findings suggest that in canine tracheal smooth muscle contracted with ACh 1) halothane increases [cAMP]i by a ...