A potent cyclic nucleotide phosphodiesterase inhibitor; due to this action, the compound increases cyclic AMP and cyclic GMP in tissue and thereby activates CYCLIC NUCLEOTIDE-REGULATED PROTEIN KINASES
Purine bases found in body tissues and fluids and in some plants.
A methyl xanthine derivative from tea with diuretic, smooth muscle relaxant, bronchial dilation, cardiac and central nervous system stimulant activities. Theophylline inhibits the 3',5'-CYCLIC NUCLEOTIDE PHOSPHODIESTERASE that degrades CYCLIC AMP thus potentiates the actions of agents that act through ADENYLYL CYCLASES and cyclic AMP.
An adenine nucleotide containing one phosphate group which is esterified to both the 3'- and 5'-positions of the sugar moiety. It is a second messenger and a key intracellular regulator, functioning as a mediator of activity for a number of hormones, including epinephrine, glucagon, and ACTH.
The rate dynamics in chemical or physical systems.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
An essential ribonucleoprotein reverse transcriptase that adds telomeric DNA to the ends of eukaryotic CHROMOSOMES.
Cells from adult organisms that have been reprogrammed into a pluripotential state similar to that of EMBRYONIC STEM CELLS.
Cells that can give rise to cells of the three different GERM LAYERS.
Relatively undifferentiated cells that retain the ability to divide and proliferate throughout postnatal life to provide progenitor cells that can differentiate into specialized cells.
A true neoplasm composed of a number of different types of tissue, none of which is native to the area in which it occurs. It is composed of tissues that are derived from three germinal layers, the endoderm, mesoderm, and ectoderm. They are classified histologically as mature (benign) or immature (malignant). (From DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1642)
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
Dissertations embodying results of original research and especially substantiating a specific view, e.g., substantial papers written by candidates for an academic degree under the individual direction of a professor or papers written by undergraduates desirous of achieving honors or distinction.
Methods for maintaining or growing CELLS in vitro.
Materials or substances used in the composition of traditional medical remedies. The use of this term in MeSH was formerly restricted to historical articles or those concerned with traditional medicine, but it can also refer to homeopathic remedies. Nosodes are specific types of homeopathic remedies prepared from causal agents or disease products.
Methods for cultivation of cells, usually on a large-scale, in a closed system for the purpose of producing cells or cellular products to harvest.
Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.

Luteinizing hormone inhibits conversion of pregnenolone to progesterone in luteal cells from rats on day 19 of pregnancy. (1/1387)

We have previously reported that intrabursal ovarian administration of LH at the end of pregnancy in rats induces a decrease in luteal progesterone (P4) synthesis and an increase in P4 metabolism. However, whether this local luteolytic effect of LH is exerted directly on luteal cells or on other structures, such as follicular or stromal cells, to modify luteal function is unknown. The aim of the present study was to determine the effect of LH on isolated luteal cells obtained on Day 19 of pregnancy. Incubation of luteal cells with 1, 10, 100, or 1000 ng/ml of ovine LH (oLH) for 6 h did not modify basal P4 production. The addition to the culture medium of 22(R)-hydroxycholesterol (22R-HC, 10 microgram/ml), a membrane-permeable P4 precursor, or pregnenolone (10(-2) microM) induced a significant increase in P4 accumulation in the medium in relation to the control value. When luteal cells were preincubated for 2 h with oLH, a significant (p < 0.01) reduction in the 22R-HC- or pregnenolone-stimulated P4 accumulation was observed. Incubation of luteal cells with dibutyryl cAMP (1 mM, a cAMP analogue) plus isobutylmethylxanthine (1 mM, a phosphodiesterase inhibitor) also inhibited pregnenolone-stimulated P4 accumulation. Incubation with an inositol triphosphate synthesis inhibitor, neomycin (1 mM), or an inhibitor of intracellular Ca2+ mobilization, (8,9-N, N-diethylamino)octyl-3,4,5-trimethoxybenzoate (1 mM), did not prevent the decrease in pregnenolone-stimulated P4 secretion induced by oLH. It was concluded that the luteolytic action of LH in late pregnancy is due, at least in part, to a direct action on the luteal cells and that an increase in intracellular cAMP level might mediate this effect.  (+info)

Phosphorylation of the small heat shock-related protein, HSP20, in vascular smooth muscles is associated with changes in the macromolecular associations of HSP20. (2/1387)

Cyclic nucleotide-dependent vasorelaxation is associated with increases in the phosphorylation of a small heat shock-related protein, HSP20. We hypothesized that phosphorylation of HSP20 in vascular smooth muscles is associated with alterations in the macromolecular associations of HSP20. Treatment of bovine carotid artery smooth muscles with the phosphodiesterase inhibitor, 3-isobutyl-1-methylxanthine, and the adenylate cyclase activator, forskolin, led to increases in the phosphorylation of HSP20 and dissociation of macromolecular aggregates of HSP20. However, 3-isobutyl-1-methylxanthine and forskolin treatment of a muscle that is uniquely refractory to cyclic nucleotide-dependent vasorelaxation, human umbilical artery smooth muscle, did not result in increases in the phosphorylation of HSP20 or to dissociation of macromolecular aggregates. HSP20 can be phosphorylated in vitro by the catalytic subunit of cAMP-dependent protein kinase (PKA) in both carotid and umbilical arteries and this phosphorylation of HSP20 is associated with dissociation of macromolecular aggregates of HSP20. Activation of cyclic nucleotide-dependent signaling pathways does not lead to changes in the macromolecular associations of another small heat shock protein, HSP27. Interestingly, the myosin light chains (MLC20) are in similar fractions as the HSP20, and phosphorylation of HSP20 is associated with changes in the macromolecular associations of MLC20. These data suggest that increases in the phosphorylation of HSP20 are associated with changes in the macromolecular associations of HSP20. HSP20 may regulate vasorelaxation through a direct interaction with specific contractile regulatory proteins.  (+info)

Identification of a region of the C-terminal domain involved in short-term desensitization of the prostaglandin EP4 receptor. (3/1387)

1. The prostaglandin EP4 receptor, which couples to stimulation of adenylyl cyclase, undergoes rapid agonist-induced desensitization when expressed in CHO-K1 cells. 2. Truncation of the 488-amino acid receptor at residue 350 removes the carboxy-terminal domain and abolishes desensitization. 3. To further delineate residues involved in desensitization, the receptor was truncated at position 408, 383 or 369. Receptors truncated at position 408 or 383 underwent PGE2-induced desensitization, whereas the receptor truncated at position 369 displayed sustained activity, indicating that the essential residues for desensitization lie between 370 and 383. 4. The six serines in the 14-amino acid segment between residues 370 and 383 were mutated to alanine, retaining the entire C-terminal domain. Desensitization was absent in cells expressing this mutant. 5. The results indicate involvement of serines located between 370 and 382 in rapid desensitization of the EP4 receptor.  (+info)

Melatonin inhibits release of luteinizing hormone (LH) via decrease of [Ca2+]i and cyclic AMP. (4/1387)

The role of [Ca2+]i and cAMP in transduction of the melatonin inhibitory effect on GnRH-induced LH release from neonatal rat gonadotrophs has been studied, because melatonin inhibits the increase of both intracellular messengers. Treatments increasing Ca2+ influx (S(-) Bay K8644 or KCI) or cAMP concentration (8-bromo-cAMP or 3-isobutyl-1-methylxanthine) potentiated the GnRH-induced LH release and partially diminished the inhibitory effect of melatonin. Combination of the treatments increasing cAMP and calcium concentrations blocked completely the melatonin inhibition of LH release. The combined treatment with 8-bromo-cAMP and S(-) Bay K8644 also blocked the melatonin inhibition of GnRH-induced [Ca2+]i increase in 89 % of the gonadotrophs, while any of the treatments alone blocked the melatonin effect in about 25 % of these cells. These observations suggest that a cAMP-dependent pathway is involved in regulation of Ca2+ influx by melatonin and melatonin inhibition of LH release may be mediated by the decrease of both messengers.  (+info)

Modulation of human airway smooth muscle proliferation by type 3 phosphodiesterase inhibition. (5/1387)

Elevation in cell cAMP content can inhibit mitogenic signaling in cultured human airway smooth muscle (HASM) cells. We studied the effects of the type 3-selective phosphodiesterase inhibitor siguazodan, the type 4-selective phosphodiesterase inhibitor rolipram, and the nonselective inhibitor 3-isobutyl-1-methylxanthine (IBMX) on proliferation of cultured HASM cells. At concentrations selective for the type 3 phosphodiesterase isoform, siguazodan inhibited both [3H]thymidine incorporation (IC50 2 microM) and the increase in cell number (10 microM; 64% reduction) induced by platelet-derived growth factor-BB (20 ng/ml). These effects were mimicked by IBMX. At concentrations selective for type 4 phosphodiesterase inhibition, rolipram was without effect. A 20-min exposure to siguazodan and rolipram did not increase whole cell cAMP levels. However, in HASM cells transfected with a cAMP-responsive luciferase reporter (p6CRE/Luc), increases in cAMP-driven luciferase expression were seen with siguazodan (3.9-fold) and IBMX (16.5-fold). These data suggest that inhibition of the type 3 phosphodiesterase isoform present in airway smooth muscle results in inhibition of mitogenic signaling, possibly through an increase in cAMP-driven gene expression.  (+info)

Isoforms of the Na-K-2Cl cotransporter in murine TAL II. Functional characterization and activation by cAMP. (6/1387)

The functional properties of alternatively spliced isoforms of the mouse apical Na+-K+-2Cl- cotransporter (mBSC1) were examined, using expression in Xenopus oocytes and measurement of 22Na+ or 86Rb+ uptake. A total of six isoforms, generated by the combinatorial association of three 5' exon cassettes (A, B, and F) with two alternative 3' ends, are expressed in mouse thick ascending limb (TAL) [see companion article, D. B. Mount, A. Baekgaard, A. E. Hall, C. Plata, J. Xu, D. R. Beier, G. Gamba, and S. C. Hebert. Am. J. Physiol. 276 (Renal Physiol. 45): F347-F358, 1999]. The two 3' ends predict COOH-terminal cytoplasmic domains of 129 amino acids (the C4 COOH terminus) and 457 amino acids (the C9 terminus). The three C9 isoforms (mBSC1-A9/F9/B9) all express Na+-K+-2Cl- cotransport activity, whereas C4 isoforms are nonfunctional in Xenopus oocytes. Activation or inhibition of protein kinase A (PKA) does not affect the activity of the C9 isoforms. The coinjection of mBSC1-A4 with mBSC1-F9 reduces tracer uptake, compared with mBSC1-F9 alone, an effect of C4 isoforms that is partially reversed by the addition of cAMP-IBMX to the uptake medium. The inhibitory effect of C4 isoforms is a dose-dependent function of the alternatively spliced COOH terminus. Isoforms with a C4 COOH terminus thus exert a dominant negative effect on Na+-K+-2Cl- cotransport, a property that is reversed by the activation of PKA. This interaction between coexpressed COOH-terminal isoforms of mBSC1 may account for the regulation of Na+-K+-2Cl- cotransport in the mouse TAL by hormones that generate cAMP.  (+info)

Insulin-secreting activity of the traditional antidiabetic plant Viscum album (mistletoe). (7/1387)

Viscum album (mistletoe) has been documented as a traditional treatment of diabetes. In acute 20-min tests, 1-10 mg/ml aqueous extract of mistletoe evoked a stepwise 1.1- to 12.2-fold stimulation of insulin secretion from clonal pancreatic B-cells. This effect was abolished by 0.5 mM diazoxide and prior exposure to extract did not alter subsequent stimulation of insulin secretion induced by 10 mM L-alanine, thereby negating a detrimental effect on cell viability. The insulin-releasing effect of mistletoe extract was unaltered by 16.7 mM glucose, l-alanine (10 mM), 3-isobutyl-1-methylxanthine (IBMX) (1 mM), or a depolarising concentration of KCl (25 mM). The ability of extract to enhance insulin secretion did not depend upon the use of heat during extract preparation and was not mediated by lectins. These results demonstrate the presence of insulin-releasing natural product(s) in Viscum album which may contribute to the reported antidiabetic property of the plant.  (+info)

Aldosterone, not estradiol, is the physiological agonist for rapid increases in cAMP in vascular smooth muscle cells. (8/1387)

BACKGROUND: Steroid-induced gene regulation in the endocrine tissues and vascular wall is achieved through the interaction of specific receptor proteins and promoters of target genes. In addition to these delayed steroid actions, rapid effects of steroids have been reported in various tissues that were clearly incompatible with the classic theory of genomic steroid action. METHODS AND RESULTS: Because high doses of 17beta-estradiol have been shown to modulate intracellular cAMP levels in vascular smooth muscle cells, steroid-induced stimulation of adenylate cyclase stimulation and phosphorylation of cAMP response element binding protein was investigated in porcine coronary artery vascular smooth muscle cells. Aldosterone induces a approximately 1.5- to 2.5-fold increase in intracellular cAMP levels (EC50 approximately 0.01 to 0.1 nmol/L) within 1 minute, whereas 17beta-estradiol and hydrocortisone act only at supraphysiological concentrations (10 micromol/L). Aldosterone-induced changes in intracellular cAMP are calcium dependent; they are not blocked by inhibitors of mineralocorticoid receptors, transcription, or protein synthesis. In addition, aldosterone induces a time-dependent phosphorylation of cAMP response element binding protein with potential transcriptional importance. CONCLUSIONS: A nongenomic modulation of vascular smooth muscle cells by aldosterone is consistent with the data that aldosterone, not estrogen, is the physiological stimulus for cAMP.  (+info)

A putative 5-HT4 receptor-mediated depolarization of the rat isolated vagus nerve has been studied using a grease-gap extracellular recording technique. Ondansetron (1 μM) was used to block the predominant 5-HT3 receptor mediated depolarization in this preparation and the effects of the 5-HT4 receptor antagonists DAU 6285 (endo-8-methyl-8-azabicyclo [3.2.1] oct-3-y1-2,3-dihydro-6-methoxy-2-oxo-1H-benzimidazole-1-carboxylate HCl); 0.3, 1.0 or 3.0 μM and SDZ 205-557 (2-methoxy-4-amino-5-chloro-benzoic acid 2-(diethylamino)-ethyl ester HCl); 0.1, 0.3 or 1.0 μM were studied on the residual, ondansetron-resistant, component of the response. The effects of the phosphodiesterase inhibitor isobutylmethylxanthine (IBMX) and of forskolin on the ondansetron-resistant response were also studied. Both DAU 6285 and SDZ 205-557 acted as competitive antagonists of the ondansetron-resistant response to 5-HT with pA2 values of 6.8 (6.7-7.1, n = 12) and 7.1 (6.9-7.5, n = 12) respectively. The vagus nerve was
TY - JOUR. T1 - GH3 cells expressing constitutively active Gsα (Q227L) show enhanced hormone secretion and proliferation. AU - Ham, J.. AU - Ivan, M.. AU - Wynford-Thomas, D.. AU - Scanlon, M. F.. PY - 1997/3/14. Y1 - 1997/3/14. N2 - cAMP levels in CH3gsp cells (Q227L mutation of Gsα), in comparison with uninfected GH3 and GH3vt (with vector alone) cells, were two to three fold (P , 0.01) higher (basal), and 10-20 fold (P , 0.001) higher (in the presence of isobutyl methylxanthine, (IBMX)). Proliferation of GHSgsp cells after 7 days in culture, as determined by cell number and [3H]thymidine Incorporation, were up to 25% (respectively P , 0.001 and P , 0.02) higher. After chronic (4 days) but not acute (15 min) exposure to forskolin (10 μM) or dibutyryl cAMP (50 μM) all cell types showed a greater than 200% (P , 0.001) increase in [3H]thymidine incorporation. Secretion of prolactin and growth hormone by GH3gsp cells were two to four fold (P , 0.001) higher than GH3 and GH3vt cells after 4 h ...
ent 3T3-L1 cells form insulin responsive adipocytes spontaneously in 2? weeks [2,3]. Incubating these cells in an adipogenic cocktail containing Dulbeccos modified Eagles medium (DMEM) with fetal bovine serum (FBS), dexamethasone and methylisobutylxanthine accelerates this process [4]. The conditions for 3T3-L1 adipocyte induction have been used in other cell types to assess their adipogenic pot
An acute model of morphine withdrawal was used to determine if neonatal exposure to 3-isobutyl-1-methylxanthine (IBMX) would cause alterations in the expression of withdrawal in the adult rat. IBMX...
Pharmacological modulation of the in vivo induction of plasminogen activator inhibitor type-1 (PAI-1) synthesis was studied in rats using the induction of PAI-1 by endotoxin as a model system. Both the cyclooxygenase inhibitors acetylsalicylic acid and indomethacin enhanced PAI-1 induction. The combined cyclooxygenase-lipoxygenase inhibitor, BW755C, dose-dependently inhibited induction. Since five other lipoxygenase inhibitors, a phospholipase inhibitor, an inhibitor of leukotriene formation and dexamethasone had no effect on the endotoxin-induced increase in PAI-1 synthesis, the effect of BW755C could not be ascribed to its known pharmacological properties. In addition, induction of PAI was enhanced by isobutyl-methylxanthine, a phosphodiesterase inhibitor, but not, however, by other phosphodiesterase inhibitors, or by forskolin or N(G)-nitro-L-arginine, suggesting an effect of isobutyl-methylxanthine other than through cyclic nucleotides. Heparin and hirudin had no effect either. Overall, the ...
Calcium, Pyramidal Cells, Interneurons, Ampa, Epsp, Hippocampal Mossy Fiber, Interneuron, Nmda, Synapses, Strontium, 1-methyl-3-isobutylxanthine, Ampa Receptors, Catalytic Subunit, Depression, Forskolin, Ibmx, Kinase, Long-term Potentiation, Protein Kinase, Protein Kinase A
Structure, properties, spectra, suppliers and links for: N-{3-[5-Amino-4-cyano-1-(4-fluorophenyl)-1H-pyrazol-3-yl]propyl}-3-isobutyl-4-oxo-3,4-dihydro-1-.
Tyrosine, 3-isobutyl-1-methylxanthine, Antibodies, Cells, Dbcamp, Ibmx, Immunoblotting, Kinase, Phosphoproteins, Phosphorylation, Proteins, Serine, Sperm, Threonine, Time
2015 (English)In: Uppsala Biomaterials Conference: A joint conference between local groups at Uppsala University working with biomaterials and their applications:, 2015Conference paper, Oral presentation with published abstract (Refereed) ...
The present report shows that iloprost induces a Ca2+ response in human hematopoietic stem cells and immature megakaryocytes. Analysis of the signaling pathway by which iloprost raises [Ca2+]i reveals a central role of cAMP. First, iloprost-induced [Ca2+]i increases are accompanied by cAMP production. Second, the effect of iloprost is mimicked by carbaprostacylin, a more specific agonist of the IP receptor, which is coupled to the adenylyl cyclase-activating G protein, Gs. Third, direct activation of adenylyl cyclase by forskolin raises cAMP and [Ca2+]i. Fourth, the phosphodiesterase inhibitor IBMX, which prevents cAMP breakdown, induces a Ca2+ response and potentiates the iloprost-induced rise in [Ca2+]i. Together, these data illustrate that in immature megakaryocytes, rises in cAMP and [Ca2+]i go hand in hand.. The observations that dibutyryl cAMP, IBMX, and forskolin raise [Ca2+]i indicate that cAMP is an upstream regulator of Ca2+. Elevated cAMP levels have been shown to induce Ca2+ ...
Phosphodiesterase Inhibitor Phosphodiesterase inhibitor is useful in treating patient due to exacerbation of the congestive cardiac failure or acute cardiac failure. However, the phosphodiesterase inhibitor may carries its own side effects such as cardia
مرحبا بكم في شبكة جامعة بابل الالكترونية لتحميل المحاضرات والبحوث الاكاديمية في موقع الكلية او الاطلاع على لوحة اعلانات الطلاب ونتائج الامتحانات اتبع الروابط في الصفحة الرئيسية لموقع الكلية ضمن شبكة جامعة بابل
When using this server please cite the following paper:. Zsila F, Bikadi Z, Malik D, Hari P, Pechan I, Berces A, Hazai E.. Evaluation of drug-human serum albumin binding interactions with support vector machine aided online automated docking.. Bioinformatics. 2011 May 18. ...
[11C]-labeled form of ten A2a adenosine receptor specific 8-styryl-7-methyl-xanthine derivatives ([11C]-caffeines) were synthesised by N-methylation of the corresponding 8-styryl-xanthine derivatives...
3-butyl-6-isobutyl-5-methyl-1H-pyrazin-2-one - chemical structural formula, chemical names, chemical properties, synthesis references
2-ISOBUTYL-4,6-DIMETHYL-S-TRIAZINE | C9H15N3 | CID 35161 - structure, chemical names, physical and chemical properties, classification, patents, literature, biological activities, safety/hazards/toxicity information, supplier lists, and more.
Isobutyl-(4-methyl-benzyl)-piperidin-4-yl-amine | C17H28N2 | CID 44411213 - structure, chemical names, physical and chemical properties, classification, patents, literature, biological activities, safety/hazards/toxicity information, supplier lists, and more.
Suppliers List, E-mail/RFQ Form, Molecular Structure, Weight, Formula, IUPAC, Synonyms for (1-ISOBUTYL-1H-IMIDAZOL-5-YL)METHANOL 95% (CAS No. 226930-88-7)
Product Page for Forskolin 250 mg (Forskolin 1234) 60 Vcaps made by creative-bioscience offering price, ingredients and full item description from betterlife
Looking for pure natural forskolin extract that actually works? Look no more, we have best pure forskolin extract with full detailed reviews.
Guanine nucleotide-binding proteins (G-proteins) are known to act as important modulators of insulin release from the islets of Langerhans. We have recently found that the deoxynojirimycin-derivative emiglitate, a recognized inhibitor of intestinal α-glucosidehydrolase activity, is a powerful inhibitor of glucose-induced insulin release. With the use of isolated mouse islets the present investigation was performed in a primary attempt to elucidate whether this inhibitory mechanism in some way was linked to the β-cell G-protein system. Treatment of freshly isolated islets with pertussis toxin (PTX), which is known to inactivate the Gi-proteins, abolished the inhibitory effect of the α2-adrenoceptor agonist clonidine on insulin release stimulated by the phosphodiesterase inhibitor IBMX in the presence of the protein kinase C activator TPA and even changed it into an increase. Emiglitate did not display any inhibitory action on insulin release induced by these secretagogues. Similarly, ...
Guanine nucleotide-binding proteins (G-proteins) are known to act as important modulators of insulin release from the islets of Langerhans. We have recently found that the deoxynojirimycin-derivative emiglitate, a recognized inhibitor of intestinal α-glucosidehydrolase activity, is a powerful inhibitor of glucose-induced insulin release. With the use of isolated mouse islets the present investigation was performed in a primary attempt to elucidate whether this inhibitory mechanism in some way was linked to the β-cell G-protein system. Treatment of freshly isolated islets with pertussis toxin (PTX), which is known to inactivate the Gi-proteins, abolished the inhibitory effect of the α2-adrenoceptor agonist clonidine on insulin release stimulated by the phosphodiesterase inhibitor IBMX in the presence of the protein kinase C activator TPA and even changed it into an increase. Emiglitate did not display any inhibitory action on insulin release induced by these secretagogues. Similarly, ...
TY - JOUR. T1 - Prostaglandin e1 and f2α stimulate differentiation and proliferation, respectively, of clonal osteoblastic mc3t3-e1 cells by different second messengers in vitro. AU - Hakeda, Yoshiyuki. AU - Hotta, Takahiko. AU - Kurihar, Anoriyoshi. AU - Ikeda, Eiko. AU - Maeda, Norihiko. AU - Yagyu, Yoshihiro. AU - Kumegawa, Masayoshi. PY - 1987/12/1. Y1 - 1987/12/1. N2 - The effect of several prostaglandins (PGs) on osteoblastic cells was investigated using clone MC3T3-E1 under serum-free conditions. PGA1, A2, B1, and B2 had little effect on intracellular cAMP, alkaline phosphatase (ALP) activity, and DNA synthesis in the cells. At 4-2000 ng/ml, PGE1 among PG analogs tested had a dose-dependent stimulatory effect on ALP activity in the cells, and this effect was amplified by isobutyl methylxanthine. Also, PGE1 strongly augmented the amount of intracellular cAMP over the same concentration range. However, PGEj had little effect on ornithine decarboxylase activity and DNA synthesis, and at ...
isobutyl benzene manufacturers and isobutyl benzene suppliers Directory - Find isobutyl benzene Manufacturers, Exporters and isobutyl benzene suppliers on ECVERY.com
Forskolin | Adenylate cyclase activator | Coleonol | CAS [66575-29-9] | Axon 2264 | Axon Ligand™ with >98% purity available from supplier Axon Medchem, prime source of life science reagents for your research
A method is provided for treating erectile dysfunction in a mammalian male individual. The method involves the local administration of a phosphodiesterase inhibitor or a pharmaceutically acceptable salt, ester, amide or derivative thereof within the context of an effective dosing regimen. A preferred mode of administration is transurethral. Pharmaceutical formulations and kits are provided as well.
Dubai Isobutyl Acetate, Buy High Quality Isobutyl Acetate Products from Dubai Isobutyl Acetate Suppliers and Manufacturers at Dubai Yellow Pages Online
Fertilization tubules in wild-type (A) and ida5 (B) mt+ gametes produced in response to a 1-h exposure to 10 mM dibutyryl-cAMP and 1 mM IBMX. Bar, 0.3 μm.
Buy customized variation and grade of Isobutyl Acetate (C6H12O2) from Brenntag; safe delivery, in stock in Brenntag Peru, find MSDS, quote, sample now!
Discover Forskolin and its many benefits here. Dr. Oz commented on Forskolin for weight loss. Learn the proper Forskolin dosage and side effects.
Recent evidence suggests that ethanol initially causes an increase in receptor-dependent cAMP levels, followed by heterologous desensitization of receptors coupled to GS after chronic exposure. Here we investigated the role of adenosine in mediating these responses. We found that ethanol caused accumulation of extracellular adenosine in NG108-15 and S49 lymphoma cells. This adenosine activated adenosine receptors to increase intracellular cAMP levels. The addition of adenosine deaminase, to degrade accumulated extracellular adenosine, or isobutyl-methylxanthine, an adenosine receptor antagonist, completely blocked ethanol-induced increases in cAMP levels in NG108-15 cells. Chronic exposure of NG108-15 and S49 wild type cells to ethanol resulted in heterologous desensitization of adenosine receptor- and prostaglandin E1 receptor-dependent cAMP signal transduction. Coincubation of NG108-15 and S49 wild type cells with adenosine deaminase and ethanol for 48 hr prevented heterologous ...
Methyl Isobutyl Ketone; 2-Pentanone, 4-methyl-; Hexone; Isobutyl methyl ketone; Isopropylacetone; MIBK; MIK; 2-Methyl-4-Pentanone; 2-Methylpropyl methyl ketone; 4-Methyl-2-oxopentane; 4-Methyl-2-pentanone; iso-C4H9COCH3; 4-Methylpentan-2-one; Methylpentan-2-one; Hexon; Isobutyl-methylketon; Ketone, isobutyl methyl; Methyl-isobutyl-cetone; Methylisobutylketon; Metilisobutilchetone; Metyloizobutyloketon; 4-Methyl-pentan-2-on; 4-Methyl-2-pentanon; 4-Metilpentan-2-one; Rcra waste number ...
The purpose of our study was to determine whether Gi-mediated control over adenylyl cyclase in preglomerular arteriolar smooth muscle cells (PGASMC) is enhanced in the spontaneously hypertensive rat (SHR). PGASMC were cultured from preglomerular microvessels isolated from adult SHR (14-15 wk of age) and age-matched WKY rats. Confluent monolayers of cells in third passage were used for the experiments. cAMP released into the media (30 min) as well as cellular levels of cAMP were measured in the presence of a phosphodiesterase inhibitor, 1-isobutyl-3-methyl-xanthine (IBMX; 100 μM) and expressed as pmol/mg protein. Total (released + cellular) cAMP was significantly lower in SHR (14.19 ± 2.30 pmol/mg protein) as compared with WKY (28.3 ± 3.04 pmol/mg protein). Correspondingly, the released (4.6 ± 0.4 pmol/mg protein) as well as cellular (9.78 ± 2.18 pmol/mg protein) cAMP levels were also significantly lower in SHR when compared with WKY (8.85 ± 1.26 and 18.86 ± 2.0 pmol/mg protein, ...
110-19-0 Isobutyl acetate testing. Laboratory testing for CAS number 110-19-0. Acetic acid, 2-methylpropyl ester;Acetic acid, isobutyl ester;«beta»-Methylpropyl ethanoate;2-Methylpropyl acetate;2-Methyl-1-propyl acetate;Isobutyl acetate fcc;Acetate disobutyle;Isobutyl ethanoate;2-Methylpropyl ethanoate;Isobutylester kyseliny octove;UN 1213;2-Methyl-1-propanol, acetate;i-Butyl acetate.
Alfa Chemistry is the worlds leading provider for special chemicals. We offer qualified products for 77546-35-1(CHOLESTEROL ISOBUTYL CARBONATE),please inquire us for 77546-35-1(CHOLESTEROL ISOBUTYL CARBONATE).
14056-10-1 - OOGCHGUNVLXNNP-UHFFFAOYSA-N - Isobutyl 3-cyanoacrylate - Similar structures search, synonyms, formulas, resource links, and other chemical information.
Where Can I Purchase Forskolin Extract in Nepal. Purchase Forskolin Extract online in official website from Nepal with cheap price, Buy Forskolin online in Nepal
Penegra is an oral drug that is used for treating erectile disfunction, it is in a class of drugs called phosphodiesterase inhibitors (PDE-5 inhibitors).
Methyl Isobutyl Ketone; 2-Pentanone, 4-methyl-; Hexone; Isobutyl methyl ketone; Isopropylacetone; MIBK; MIK; 2-Methyl-4-Pentanone; 2-Methylpropyl methyl ketone; 4-Methyl-2-oxopentane; 4-Methyl-2-pentanone; iso-C4H9COCH3; 4-Methylpentan-2-one; Methylpentan-2-one; Hexon; Isobutyl-methylketon; Ketone, isobutyl methyl; Methyl-isobutyl-cetone; Methylisobutylketon; Metilisobutilchetone; Metyloizobutyloketon; 4-Methyl-pentan-2-on; 4-Methyl-2-pentanon; 4-Metilpentan-2-one; Rcra waste number ...
Akaike, Y; Arai, Y; Taguchi, H; and Satoh, H, Effect of 1-(2-chloroethyl)-3-isobutyl-3-(beta-maltosyl)-1- -nitrosourea on experimental tumors. (1982). Subject Strain Bibliography 1982. 3216 ...
Intracellular cAMP levels are higher in LDLR-/−p110γ−/− than in LDLR−/−p110γ+/−macrophages.LDLR−/−p110γ+/− and LDLR−/−p110γ−/− BMM
NIEHS intramural scientists have defined descriptive terms of particular relevance to their own research, and have ranked those terms accordingly. This search feature obtains best-matches with the terms you choose, and shows an overall score based on the scientific rankings.. View our page to search various areas of interest and methodology.. ...
dipyridamole persantine is Purchase a phosphodiesterase inhibitor that blocks uptake and metabolism of adenosine by erythrocytes and vascular endothelial cells.. Sorosises will be aggregated. Trillionfold encysted isoenzyme may extremly idly find out about beneathe unexpectedly unleaded cheeseburger. Danegelds are brusquely heaving of the bit by bit cutaneous jacquelin. Ramification had Cheap chinkled by the when push comes to shove fallback norther.. ...
Forskolin GNC Review: Everyone has pretty much heard about Pure Forskolin, but reading a Forskolin weight loss review will give you just a little more insight into how this diet product works. There are certainly enough Forskolin side effects with some products to take a closer look here. This Forskolin review was written to inform… Read More ». ...
After four months and 12 days it took just four hours to extinguish the protest campsite outside St Pauls Cathedral. Overnight, the heart of the City of London was transformed from a ramshackle but
Burn away fat and keep it off with the All Natural Forskolin weight loss supplement. With 100% pure forskolin extract, its benefits are unmatched.
Discover if Just Potent Pharmaceutical Grade Forskolin Extract is an effective supplement. Read the full review | Learn more with Review Critic
Treatment of intact hepatocytes with glucagon led to the rapid desensitization of adenylate cyclase, which reached a maximum around 5 min after application of glucagon, after which resensitization ensued. Complete resensitization occurred some 20 min after the addition of glucagon. In hepatocytes which had been preincubated with the cyclic AMP phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX), glucagon elicited a stable desensitized state where resensitization failed to occur even 20 min after exposure of hepatocytes to glucagon. Treatment with IBMX alone did not elicit desensitization. The action of IBMX in stabilizing the glucagon-mediated desensitized state was mimicked by the non-methylxanthine cyclic AMP phosphodiesterase inhibitor Ro-20-1724 [4-(3-butoxy-4-methoxylbenzyl)-2-imidazolidinone]. IBMX inhibited the resensitization process in a dose-dependent fashion with an EC50 (concn. giving 50% of maximal effect) of 26 +/- 5 microM, which was similar to the EC50 value of 22 +/- ...
TY - JOUR. T1 - The in vitro activation of cyclic AMP production by either forskolin or isoproterenol in the syrian hamster pineal during the day is not accompanied by an increase in melatonin production. AU - Santana, Celsa. AU - Guerrero, Juan M.. AU - Reiter, Russel J. AU - Troiani, Maureen E.. PY - 1988/12/30. Y1 - 1988/12/30. N2 - The role of cyclic AMP in the regulation of melatonin production was investigated in cultured Syrian hamster pineal glands. Forskolin markedly increased cyclic AMP production in pineal glands collected either late in the light period or in the dark period. The effect of forskolin was synergistically enhanced by 3-isobutylmethylxanthine, a phosphodiesterase inhibitor; however, increase in cyclic AMP after isoproterenol was only apparent in the presence of 3-isobutylmethylxanthine. Since β-adrenergic agonists are able to stimulate melatonin production late in the dark period only, these data suggest that, in the hamster pineal gland, there may be intracellular ...
ISOBUTYL ACETATE reacts exothermically with acids to give alcohols and other acids. Tags: Methyl Acetate Methyl isobutyl ketone Filter Results. We are offering Isobutyl Acetate to our clients. This water soluble, high volatile chemical with mild odor is appreciated by the clients based in various parts of the country. METHYL ISOBUTYL KETONE: ICSC: 0511: MIBK 4-Methyl-2-pentanone Isopropylacetone Hexone: July 1997: CAS #: 108-10-1: UN #: 1245 EC Number: 203-550-1 ACUTE HAZARDS PREVENTION FIRE FIGHTING; FIRE & EXPLOSION: Highly flammable. Incompatible products. CAS 42558-54-3, EC Number 418-900-0, chemical formula CH₃CH(CH₃)COCH₂COOCH₃. Identification Product Name Isobutyl isobutyrate Cat No. Isopropyl acetate: CH 3 COOCH(CH 3) 2: 108-21-4 : 89: Butyl acetate. ... acetic acid 2-methyl propyl ester . The chemical compound isobutyl acetate, also known as 2-methylpropyl ethanoate ( IUPAC name) or β-methylpropyl acetate, is a common solvent. Methyl isobutyrylacetate is used for the synthesis ...
Other names: 4-Methyl-2-pentanone, Isopropylacetone, Hexone, Isobutyl methyl ketone, 2-Methylpropyl methyl ketone, 4-Methyl-2-oxopentane, MIK, Isobutylmethyl ketone, MIBK, Isohexanone
Other names: 4-Methyl-2-pentanone, Isopropylacetone, Hexone, Isobutyl methyl ketone, 2-Methylpropyl methyl ketone, 4-Methyl-2-oxopentane, MIK, Isobutylmethyl ketone, MIBK, Isohexanone
Cells. Mouse melanoma (SW1) and human melanoma (LU1205) cells were maintained in DMEM supplemented with 10% fetal bovine serum, l-glutamine, and antibiotics. The human melanoma cell lines MEWO and WM115 were maintained in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics. Primary mouse melanocytes were cultured in F-12 medium supplemented with 10% fetal bovine serum, antibiotics, isobutylmethylxanthine, bovine pituitary extract, and 12-O-tetradecanoylphorbol-13-acetate.. Constructs and inhibitors. An ATF2 peptide (amino acids 51-100) was cloned into HA-tagged pcDNA3 vector as described previously (30). 5xJun2tk-Luc (marker for ATF2 transcriptional activities), 5xTRE-tk-Luc (marker for AP1/c-Jun transcriptional activities), and 2xNF-κB-Luc were described previously (31). Pharmacologic inhibitor of JNK (SP600125) was purchased (EMD Biosciences) and added (5 μmol/L) to cultured cells as indicated in Results.. Transcriptional analysis. Transient transfection of different reporter ...
Suggest that cAMP may not be a key player in mediating RV-induced ROS generation in lung cancer cells. The NADPH oxidases (Noxs) are a family of transmembrane
Suggest that cAMP may not be a key player in mediating RV-induced ROS generation in lung cancer cells. The NADPH oxidases (Noxs) are a family of transmembrane
Dive into the research topics of Long-term effect of forskolin on the activation of adenylyl cyclase in astrocytes. Together they form a unique fingerprint. ...
1. Intro 2. Forskolin & Dr. Oz 3. Forskolin Reviews 4. Forskolin Side Effects 5. References A number of forskolin reviews can help you decide which brand might work best for your needs. What exactly does it do and how does.... ...
Learning how Forskolin works for weight loss is important, and so is finding the best way to get a Forskolin trial offer online. Forskolin reviews.
Forskolin Reviews: See Forskolin Fuel reviews from real customers! Does it work? Forskolin for weight loss, Ingredients and side effects. Best place to buy it?
BREAKING NEWS: Click Here To Read This Exclusive Forskolin Fit Pro Review! Does Forskolin Fit Pro Work? Get The Facts. Learn More About This Product Today!
By now youve probably heard the amount of media attention that pure Forskolin extract has received for its amazing fat burning results.
Y Fujita 1 2, T Nohara 1, S Takashima 1, K Natsuga 1, M Adachi 3, K Yoshida 3, S Shinkuma 4, T Takeichi 5, H Nakamura 1, O Wada ... 2021 Jan;141(1):198-202 Mineda, K.; Feng, J.; Ishimine, H.; Takada, H.; Doi, K.; Kuno, S.; Kinoshita, K.; Kanayama, K.; Kato, H ... 3][1][4][5][6] ] In the bone marrow, they represent one out of 3000 mono-nucleated cells. Other than mesenchymal tissues, Muse ... 34 (1): 160-73. doi:10.1002/stem.2206. PMID 26388204. Kinoshita, K.; Kuno, S.; Ishimine, H.; Aoi, N.; Mineda, K.; Kato, H.; Doi ...
... methyl ester MeSH D03.383.725.210 - dimethindene MeSH D03.383.725.220 - 2,2'-dipyridyl MeSH D03.383.725.227 - disopyramide MeSH ... methyl ester MeSH D03.383.725.547.950 - xanthinol niacinate MeSH D03.383.725.565 - nicotinyl alcohol MeSH D03.383.725.592 - ... 4-dichloro-n-methyl-n-(2-(1-pyrrolidinyl)-cyclohexyl)-benzeneacetamide, (trans)-isomer MeSH D03.383.773.342 - glycopyrrolate ... 4-methyl-1-homopiperazinylthiocarbonyl)disulfide MeSH D03.383.129.308.100 - 4-(3-butoxy-4-methoxybenzyl)-2-imidazolidinone MeSH ...
1. Regulation of body weight and adipose tissue mass by ginseng extract (GE) and testosterone (T) in high-fat diet (HFD)-fed ... 3). Co-administration of GE and testosterone decreased C/EBPα and aP2 mRNA levels compared with HFD-fed mice treated with ... 3. Effects of ginseng extract (GE) and testosterone (T) on adipogenesis-associated gene expression in high-fat diet (HFD)-fed ... Reverse : 5'- AAATATTGCCAAGTCGCTGTCATC -3'. Statistical analysis. All values are expressed as mean ± standard deviation (SD). ...
2-3, 1976). *Strunz, ZU.T., Grossman, M.I.: Gastric emptying of liquids in intact dogs. Clin. Res. 25: 112 A, 1977 (Annual ... 3-5, 1974). *Strunz, U., Domschke, W., Schubert, E., Mitznegg, P., Wünsch, E., Jaeger, E., Demling, L.: Different motor ... 3-5, 1974). *Schubert, E., Strunz, U., Mitznegg, P., Domschke, S., Domschke W., Demling, L.: Muskulotrophe Wirkung von ... Biol. 1: 461, 1975 (2nd Annual Meeting of the Deutsche Arbeitsgemeinschaft für Ultraschalldiagnostik (DAUD), Hannover, West ...
3). The relative fluorescence intensities of the remaining promoters P17, P18, P20, P23 and P29 were lower than that of lac ... 3), The orders of promoter strength reflected by the real-time qPCR and GFP reporter were identical to the result obtained by ... 1). qPCR was employed for the analysis of transcriptional levels of gfp under different promoters at different growth phases, i ... DNA solution was composed of pT2AL-CMV/βactin-Tomato-T2A-GFP (1-3 μg/μL) and CMV/βactin-T2TP at a molar ratio of 1:5-1:10, ...
4-dioxo-6-methyl-8-(substituted) 1,2,3,4-tetrahydro 1,2,4-triazolo 3,4-f-purines as potential adenosine receptor antagonists. ... 1-Methyl-3-isobutylxanthine/pharmacologyAMP-DependentAMP/metabolismAcidAdenylateAdrenergicAminoBlotting,CellCyclase/metabolism ... Am J Physiol 263 (2 Pt 1): C502-8 (August 1992. )Spielman, W S Klotz, K N Arend, L J Olson, B A LeVier, D G Schwabe, U R01 DK- ... Arrestins*Cyclic5'-O-(3-Thiotriphosphate)/pharmacologyAMP-DependentAcidAdenylateAminoAnimalsAntibodiesAntigens/genetics/* ...
Regulation of the expression of pp160, a putative insulin receptor signal protein, by insulin, dexamethasone, and 1-methyl-3- ... Regulation of the expression of pp160, a putative insulin receptor signal protein, by insulin, dexamethasone, and 1-methyl-3- ... Phosphatidylinositol 3-kinase is activated by association with IRS-1 during insulin stimulation. ... Phosphatidylinositol 3-kinase is activated by association with IRS-1 during insulin stimulation. ...
... isobutylxanthine (IBMX) (Sigma Aldrich) for adipogenic differentiation. Cells were stained with Oil Red O (Sigma Aldrich) to ... 2010; 3 : 161-174 . View Article PubMed PMC Google Scholar * F Ishikawa, CJ Drake, S Yang, P Fleming, H Minamiguchi, RP ... 2014; 1 : 43-49 . View Article Google Scholar * PK Ngoc, PV Phuc, TH Nhung, DT Thuy, NTM Nguyet. Improving the efficacy of type ... 1989; 342 : 440-3 . View Article PubMed Google Scholar * H Funakoshi, T Nakamura. Hepatocyte growth factor: from diagnosis to ...
Y1 - 2004/5/1. N2 - Plating of REF52 cells onto extracellular matrix components leads to the formation of integrin-dependent ... keywords = "1-Methyl-3-isobutylxanthine, 3',5'-Cyclic-AMP Phosphodiesterases, Actins, Animals, Cell Adhesion, Cell Line, Cell ...
1,2 bis(o aminophenoxy)ethane n,n,n',n' tetraacetic acid. 4,4' diisothiocyanatostilbene 2,2' disulfonic acid. 5 nitro 2 (3 ... ethylene glycol 1,2 bis(2 aminophenyl) ether n,n,n',n' tetraacetic acid. forskolin. fulvestrant. glibenclamide. ... 1-Methyl-3-isobutylxanthine. Amiloride. Animals. Bumetanide. Cell Membrane Permeability. Cells, Cultured. Chlorides. Colforsin ... n benzyl 2 cyano 3 (3,4 dihydroxyphenyl)acrylamide. protein tyrosine kinase. tyrphostin. uridine triphosphate. vanadic acid. ...
... methyl isobutyl xanthine (IBMX), lipase from porcine pancreas type 2, dimethyl sulphoxide (DMSO), 4-Nitrophenyl dodecanoate ( ... Each area is produced as a result of asymmetrical stretching from the methyl and methylene groups of lipids, and also the ... ORCID: orcid.org/0000-0003-3884-30221 Show authors. BMC Complementary and Alternative Medicine volume 18, Article number: 177 ( ... Briefly, 1 mL of the OIE was mixed with 2 mL of 2% w/v of NaOH. A 2 mL aliquot of 10% w/v lead acetate solution was added to 1 ...
In this concept 'cloud', the sizes of the concepts are based not only on the number of corresponding publications, but also how relevant the concepts are to the overall topics of the publications, how long ago the publications were written, whether the person was the first or senior author, and how many other people have written about the same topic. The largest concepts are those that are most unique to this person ...
Academic Dissertations;Academic Dissertations--South Carolina;1-Methyl-3-isobutylxanthine--pharmacology;Receptor, Adenosine A2B ... pharmacology and toxicology of 3-isobutyl 1-methylxanthine (IBMX) in the 661w retina-derived cell line ...
1-Methyl-3-isobutylxanthine, Animals, Calcium, Cyclic AMP, Dogs, Female, Halothane, Indomethacin, Intracellular Membranes, ... Isometric force and the intracellular concentrations of adenosine cyclic 3',5'-monophosphate ([cAMP]i) guanosine cyclic 3',5'- ... These findings suggest that in canine tracheal smooth muscle contracted with ACh 1) halothane increases [cAMP]i by a ...

No FAQ available that match "1 methyl 3 isobutylxanthine"