OocytesProteinsCDNAProteinEncodesMolecularEmbryosAnimal cap explantsMammalianGenomic sequencesNucleotideResiduesMutationAssaysSpeciesHomologuesTropicalisTranscriptionMesodermGenesOrganismsTransportersRatsSitu HybridizationRegionsCloningIdentityHumanFunctionalBindRecombinantAlignmentEarlyExonsNeuronalMotifDiscovered on the basisDomainsResults
Oocytes9
- A C. elegans messenger RNA expressed in Xenopus oocytes encodes an avermectin-sensitive glutamate-gated chloride channel. (nih.gov)
- To elucidate the structure and properties of this channel, we used Xenopus oocytes for expression cloning of two functional complementary DNAs encoding an avermectin-sensitive glutamate-gated chloride channel. (nih.gov)
- To investigate the mechanism of the egl-2(gf) phenotype and rescue by imipramine, we analyzed EGL-2 currents in Xenopus oocytes. (jneurosci.org)
- When cRNA transcribed from mtUT cDNA was injected into Xenopus laevis oocytes, phloretin-inhibitable urea uptake was enhanced 3.4-fold relative to water-injected controls. (mcmaster.ca)
- an investigation of their specific localization in human brain and their influence on CaV2.1 voltage-dependent calcium channels expressed in Xenopus oocytes. (biomedcentral.com)
- In addition, we investigated whether human γ 2 or γ 4 could modulate the electrophysiological properties of a neuronal VDCC complex transiently expressed in Xenopus oocytes. (biomedcentral.com)
- When co-expressed in Xenopus oocytes with a Ca V 2.1/β 4 VDCC complex, either in the absence or presence of an α2δ 2 subunit, neither γ 2 nor γ 4 significantly modulated the VDCC peak current amplitude, voltage-dependence of activation or voltage-dependence of steady-state inactivation. (biomedcentral.com)
- Xenopus laevis oocytes expressing hOAT1 supported probenecid-sensitive uptake of [ 3 H] p -aminohippurate ( K m = 4 μM), which was trans -stimulated in oocytes preloaded with glutarate. (aspetjournals.org)
- When expressed in Xenopus laevis oocytes, hOAT3 mediated the transport of estrone sulfate ( K m = 3.1 μM), p -aminohippurate ( K m = 87.2 μM), methotrexate ( K m = 10.9 μM), and cimetidine ( K m = 57.4 μM) in a sodium-independent manner. (aspetjournals.org)
Proteins16
- Molecular characterization of Xenopus laevis DP proteins. (ox.ac.uk)
- Here, we have defined DRTF1/E2F in Xenopus laevis that, like its mammalian counterpart, specifically binds to the E2F site, is regulated during development, and interacts with pRb and related proteins. (ox.ac.uk)
- Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus. (lookformedical.com)
- Based on primary sequence comparisons, β subunits are predicted to be modular structures composed of five domains (A-E) that are related to the large family of membrane-associated guanylate kinase proteins. (jneurosci.org)
- Methylated DNA affinity capture by methyl-CpG binding proteins produces fractions highly enriched for methylated DNA, suitable for coupling to next generation sequencing technologies. (biomedcentral.com)
- The tumor suppressor gene overgrown hematopoietic organs-31 (oho31) of Drosophila encodes a protein with extensive homology to the Importin protein of Xenopus (50% identity), the related yeast SRP1 protein, and the mammalian hSRP1 and RCH1 proteins. (rupress.org)
- The gene encodes a phosphoprotein of 522 amino acids made of three domains: a central hydrophobic domain of eight repeats of 42-44 amino acids each, displaying similarity to the arm motif found in junctional and nucleopore complex proteins, and flanked by two hydrophilic NH2- and COOH-terminal domains. (rupress.org)
- Stargazin (γ 2 ) and the closely related γ 3 , and γ 4 transmembrane proteins are part of a family of proteins that may act as both neuronal voltage-dependent calcium channel (VDCC) γ subunits and transmembrane α-amino-3-hydroxy-5-methyl-4-isoxazoleproponinc (AMPA) receptor regulatory proteins (TARPs). (biomedcentral.com)
- So far, more than 800 MIP proteins have been identified on the basis of sequence homology, but only less than 10% of them have been functionally characterized. (biologic.net)
- In most studies, the channel properties of MIP proteins have been determined by using Xenopus oocyte swelling assays or stopped-flow spectrophotometry on proteoliposomes. (biologic.net)
- These results show that stopped-flow spectrophotometry performed on E. coli cell suspensions is a useful experimental system to analyse the selectivity of wild-type or mutant MIP proteins and that a bifunctional aquaglyceroporin switches to an AQP by a single amino acid mutation in the pore constriction. (biologic.net)
- BARD1, unlike BRCA1, also contains a centrally located sequence of three ankyrin repeats 11 that are found in many proteins involved in transcriptional regulation. (bmj.com)
- 100% sequence homology with Mouse, Rat, Canine, Equine and all other mammalian proteins examined. (novusbio.com)
- These genes, encoding for RNA binding proteins, contain a highly conserved RNA recognition motif and at least one DAZ repeat encoding for a 24 amino acids sequence able to bind other mRNA binding proteins. (ijbs.com)
- These proteins have a highly conserved RNA recognition motif (RRM) for binding target mRNAs and at least one characteristic sequence of 24 amino acids, which are termed as DAZ repeats [ 1 ]. (ijbs.com)
- The 72-amino acid TEA DNA binding domains in mTEAD-2, 3, and 4 are approximately 99% homologous to the same domain in mTEAD-1, and all four proteins bind specifically to the same DNA sequences in vitro with a Kd value of 16-38 nM DNA. (embl-heidelberg.de)
CDNA4
- A 1700 base pair cDNA for a putative Magadi tilapia urea transporter (mtUT) was cloned, sequenced and found to display high homology with urea transporters from mammals, amphibians and other fishes. (mcmaster.ca)
- A cDNA sharing the highest degree of homology with mammalian erythropoietin (EPO) receptors, tentatively named xlEPOR, was cloned from a cDNA library of Xenopus laevis immature erythrocytes. (elsevierpure.com)
- BDNF cDNA encodes a 247 amino acid residue precursor protein with a signal peptide and a proprotein that are cleaved to yield the 119 amino acid residue mature BDNF. (novusbio.com)
- The hOAT3 cDNA consisted of 2179 base pairs that encoded a 543-amino-acid residue protein with 12 putative transmembrane domains. (aspetjournals.org)
Protein13
- After sequencing and characterization of the gene, the construct was described as a 1284 nucleotide sequence resulting in a protein consisting of 428 amino acids after transcription. (wikipedia.org)
- The human CSNK1D contains 1245 nucleotides and is transcribed into a protein consisting of 415 amino acids. (wikipedia.org)
- The longest variant consists of 428 amino acids in rat (TV3) and mice (CRAb), while the human (TV3) variant is missing the second to last amino acid (threonine), resulting in a protein of a length of 427 amino acids. (wikipedia.org)
- NUDF protein, the product of the nudF gene, displays 42% sequence identity with the human protein LIS1 required for neuronal migration. (xenbase.org)
- NUDF protein interacts with the Aspergillus NUDE coiled-coil in a yeast two-hybrid system, while human LIS1 interacts with the human homologue of the NUDE/RO11 coiled-coil and also the Xenopus MP43 coiled-coil. (xenbase.org)
- Strains were transformed with nudE variants in pAid vector and grown at 43°C. Numbers refer to amino acid residues of NUDE protein expressed by the constructs (see Fig. 3 for detailed amino acid sequences). (xenbase.org)
- A) Homology between A. nidulans NUDE protein and N. crassa RO11 protein. (xenbase.org)
- This means that the predicted protein product of the PRI protein contains the Hox-C6 homeodomain but is truncated by 82 amino acids compared with the PRII product. (ox.ac.uk)
- In order to learn more about their origins and relationships to each other, as well as to clarify the nomenclature used to describe them, the tenascin genes of the urochordate Ciona intestinalis , the pufferfish Tetraodon nigroviridis and Takifugu rubripes and the frog Xenopus tropicalis were identified and their gene organization and predicted protein products compared with the previously characterized tenascins of amniotes. (biomedcentral.com)
- The 404 kb long gene codes for a 75-kDa protein containing 676 amino acids and is expressed mainly in the heart, kidneys, pancreas, and small intestine. (studybay.net)
- Histone protein and message are stored in the oocyte as part of the mechanism to provide enough histones to keep-up with the high rate of DNA synthesis in early Xenopus development. (warwick.ac.uk)
- The T-box is defined as the minimal region within the T-box protein that is both necessary and sufficient for sequence-specific DNA binding, all members of the family so far examined bind to the DNA consensus sequence TCACACCT. (embl-heidelberg.de)
- We were able to identify several classes of antimicrobial peptides, such as buforins, peroniins and brevinins, as well as PLA 2 , lectins and galectins, combining protein sequencing and RNA-seq analysis for the first time. (biomedcentral.com)
Encodes1
- rlst-1 encodes 652 amino acids, predicting at least 11 transmembrane regions. (nih.gov)
Molecular3
- At the molecular level, knockdown of PQBP1 in Xenopus animal cap explants inhibits target gene induction by FGF but not by BMP, Nodal or Wnt ligands, and knockdown of either PQBP1 or WBP11 in embryos inhibits expression of fgf4 and FGF4 -responsive cdx4 genes. (xenbase.org)
- Site directed mutagenesis sitedirected mutagenesis is a molecular biology method that is used to make specific and intentional changes to the dna sequence of a gene and any gene products. (web.app)
- We have now applied the tools of molecular homology modeling to predicting a structure of CLN2 that could be used as a basis for a search for the biological substrates of this family of enzymes and for the design of specific inhibitors. (biomedcentral.com)
Embryos3
- Here, we reveal essential roles for PQBP1 and a binding partner, WBP11 , in early development of Xenopus embryos. (xenbase.org)
- Together, these results suggest that xCyp26c plays a specific role in anterior-posterior (A-P) neural patterning of Xenopus embryos. (molcells.org)
- For a reverse experiment, DNA methylation in early Xenopus embryos was assessed by MBD affinity capture. (biomedcentral.com)
Animal cap explants1
- To identify genes involved in the anterior neural specification, we analyzed gene expression profiles using a Xenopus Affymetrix Gene Chip after BMP-4 inhibition in animal cap explants. (molcells.org)
Mammalian1
- The comparative identities of the deduced entire amino acid sequence to mammalian EPO receptors were quite low, although functional domains indispensable for erythropoietic activities were found in the molecule. (elsevierpure.com)
Genomic sequences2
- Similar enzymes have been found in the genomic sequences of several species, but neither systematic analyses of their distribution nor modeling of their structures have been previously attempted. (biomedcentral.com)
- We have analyzed the presence of orthologs of human CLN2 in the genomic sequences of a number of eukaryotic species. (biomedcentral.com)
Nucleotide3
- The only exception is rat TV3, which is also transcribing its nucleotide sequence into an isoleucine. (wikipedia.org)
- We have cloned the oho31 gene of Drosophila melanogaster and determined its nucleotide sequence. (rupress.org)
- Pdf differences in gene sequences, many of which are single nucleotide. (web.app)
Residues1
- All neurotrophins have six conserved cysteine residues that are involved in the formation of three disulfide bonds and all share approximately 55% sequence identity at the amino acid level. (novusbio.com)
Assays1
- Oxidative stress and glucose metabolism were analyzed using biochemical assays, Western blotting, dihydroethidium (DHE) fluorescence, and periodic acid-Schiff (PAS) staining methods. (bvsalud.org)
Species2
- Cyp26 genes have been previously characterized in various species, but their function in Xenopus leavis have not yet been fully identified. (molcells.org)
- Comparison of the deduced amino acid sequences of the giant panda with those of these other species revealed that the RPS14 of giant panda is highly homologous with those of B. taurus, R. norvegicus and D. rerio (85.99, 99.34 and 99.34%, respectively), and is 100% identical with the others. (geneticsmr.com)
Homologues2
- The Hox-C6 gene, in common with its Xenopus and human homologues, is organised as 3 exons with 2 distinct promoters (PRI and PRII) producing 2 different transcripts. (ox.ac.uk)
- I have isolated and completely sequenced two X. laevis homologues of Oct-1. (warwick.ac.uk)
Tropicalis1
- Closely related, although clearly distinct, enzymes are present in fish (fugu and zebra), as well as in frogs (Xenopus tropicalis). (biomedcentral.com)
Transcription4
- While the human transcription variants are using isoleucine, the mouse and rat sequences incorporate a valine instead. (wikipedia.org)
- Both transcription variants share the first 399 amino acids, but differ at the following 16 amino acids for TV1 and ten amino acids for TV2, respectively. (wikipedia.org)
- Besides various sequences of the three different transcription variants, the variants also show differences in Michaelis-Menten kinetic parameters (Km and Vmax) in regard to their potential to phosphorylate canonical (α-casein) as well as non-canonical (GST-β-catenin1-181) substrates (Xu et al. (wikipedia.org)
- The predicted amino acid sequence derived from the cloned SWI5 gene shows homology with the repeated DNA-binding domains ('zinc fingers') of Xenopus transcription factor TFIIIA. (ox.ac.uk)
Mesoderm1
- pqbp1 and wbp11 genes are similarly expressed in mesoderm and neural tissues during Xenopus development. (xenbase.org)
Genes1
- Five Dmrt family genes with full-length transcript sequences were identified in Amur sturgeon. (researchsquare.com)
Organisms3
- The alignment of all CK1δ sequences of all organisms shows a high homology in the first 399 amino acids, except for position 381. (wikipedia.org)
- The first variant consists of 415 amino acids across all three organisms and is called TV1 in human and rat, while the murine counterpart is named CRAa. (wikipedia.org)
- For over a century amphibians from the genus Xenopus have been the organisms of choice to study developmental processes. (biomedcentral.com)
Transporters2
Rats1
- The shortest group of sequences consists of 409 amino acids: TV2 in humans and rats, CRAc in mice. (wikipedia.org)
Situ Hybridization1
- In the peripheral blood of phenylhydrazine-treated adult Xenopus, immature erythrocytes expressing xlEPOR were identified by in situ hybridization and immunostaining with polyclonal antibodies to xlEPOR. (elsevierpure.com)
Regions1
- The regions between arrowheads were used in sequence exchange experiments to test if human or X. laevis coiled-coil regions can substitute for the NUDE coiled-coil. (xenbase.org)
Cloning1
- In this paper we describe the cloning and sequencing of the SWI5 gene. (ox.ac.uk)
Identity3
- The deduced amino acid sequence of hOAT3 showed 36 to 51% identity to those of other members of the OAT family. (aspetjournals.org)
- X. laevis and human Oct-1 display strong evolutionary conservation (85% Identity over a stretch of 750 amino acids), which presumably means that X. laevis has a similar, if not identical function to human Oct-1. (warwick.ac.uk)
- Enzymes with sequences sharing over 80% identity have been found in the genomes of macaque, mouse, rat, dog, and cow. (biomedcentral.com)
Human3
- The series of FN type III domains are interrupted in both mouse and human tenascin-X by a proline-rich stretch of about 100 amino acids. (biomedcentral.com)
- Homology between human and X. laevis does, however, break down shortly before the N terminal end, at a point where alternate splicing is known to occur in hunan Oct-1 (W. Herr, pers. (warwick.ac.uk)
- A three-dimensional model of human CLN2 was built based mainly on the homology with Pseudomonas sp. (biomedcentral.com)
Functional2
- Xenopus oocyte expression system was used for functional analysis. (nih.gov)
- The resulting sequences were submitted to functional annotation against non-redundant NCBI database and Database of Anuran Defense Peptide. (biomedcentral.com)
Bind1
- Oct-R binds more strongly to this degenerate motif than the consensus motif, but only in the context of the H2B promoter, and does not bind either motif in another sequence context. (warwick.ac.uk)
Recombinant1
- Because recombinant antibody production involves sequencing the antibody light and heavy chains, it is a highly controlled and reliable process. (cellsignal.com)
Alignment1
- Multiple sequence alignment reveals that differences in the size of tenascin-W from various vertebrate classes can be explained by duplications of specific fibronectin type III domains. (biomedcentral.com)
Early2
- We found that the xCyp26c gene, encoding a retinoic acid (RA) degradation enzyme, was upregulated following inhibition of BMP signaling in early neuroectodermal cells. (molcells.org)
- The role of Cyp26 during RA utilization and the anteriorization of the neuroectoderm during the early embryonic stages of Xenopus is also unclear. (molcells.org)
Exons1
- While they share the first eight exons, TV1 is using exon 10and TV2 exon 9 to finish their respective sequence. (wikipedia.org)
Neuronal1
- A c-jun amino-terminal kinase that is found predominantly within NEURONS of the BRAIN, suggesting a role in stress-induced neuronal APOPTOSIS. (lookformedical.com)
Motif1
- The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). (wikipedia.org)
Discovered on the basis1
- Four remaining family members (MBD1, MBD2, MBD3 and MBD4) have been discovered on the basis of homology searches with the MeCP2 MBD amino acid sequence [ 8 ]. (biomedcentral.com)
Domains1
- A phylogenetic tree based on the predicted amino acid sequences of the fibrinogen-related domains demonstrates that tenascin-C and tenascin-R are the most closely related vertebrate tenascins, with the most conserved repeat and domain organization. (biomedcentral.com)
Results1
- The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. (wikipedia.org)