The species distribution from stool samples was as follows: 2,114 C. jejuni (78.9%), 486 C. coli (18.1%), 36 C. fetus (1.3%), 27 A. butzleri (1.0%), 8 C. lari (0.3%), 4 C. upsaliensis (0.1%), 2 C. hyointestinalis , and 1 Helicobacter canadensis . (cdc.gov)
As C. jejuni and C. coli are the main Campylobacter pathogens which cause human acute intestinal disease and they originate from animal sources, Campylobacteriosis has historically been considered to be zoonotic. (frontiersin.org)
Campylobacter jejuni causes foodborne gastroenteritis and may trigger acute autoimmune sequelae including Guillain Barré Syndrome. (bvsalud.org)
C. jejuni isolates were obtained from thirteen calves and the family member: C. coli from two calves, and C. hyointestinalis from two calves. (bvsalud.org)
Molecular methods applied to 2,855 strains of Campylobacter -like organisms received from a surveillance network of Campylobacter infections in France identified 29 Arcobacter butzleri infections. (cdc.gov)
1 ) originally described the species Arcobacter butzleri , previously named Campylobacter butzleri ( 1 ), after studying aerotolerant Campylobacter strains from human and veterinary sources. (cdc.gov)
The study period was from July 2002 to December 2003, and 2,855 Campylobacter -like strains were studied. (cdc.gov)
Cytotoxin production has been reported in Campylobacter strains from patients with bloody diarrhea. (medscape.com)
Campylobacter upsaliensis may cause diarrhea or bacteremia, whereas Campylobacter hyointestinalis, which has biochemical characteristics similar to those of C fetus, causes occasional bacteremia in immunocompromised individuals. (medscape.com)
Species10
Over the past decade, studies on human hosted Campylobacter species strongly suggest that Campylobacter concisus plays a role in the development of inflammatory bowel disease (IBD). (frontiersin.org)
In addition to C. concisus , humans are also colonized by a number of other Campylobacter species, most of which are in the oral cavity. (frontiersin.org)
Here we review the most recent advancements on C. concisus and other human hosted Campylobacter species including their clinical relevance, transmission, virulence factors, disease associated genes, interactions with the human immune system and pathogenic mechanisms. (frontiersin.org)
Several Campylobacter species utilize humans as their natural host and accumulated evidence supports their role in chronic inflammatory diseases of the human intestinal tract. (frontiersin.org)
Most of the studies on the human hosted Campylobacter species in the past decade were on Campylobacter concisus , this bacterium is therefore the focus of this review. (frontiersin.org)
To date, 40 Campylobacter species and subspecies have been isolated from a wide variety of animal or human sources (Figure 1 ). (frontiersin.org)
The systematic bacterial community composition was determined based on the next-generation sequencing method, and alpha diversity and beta diversity were conducted to access the species diversity within and between the bacterial communities, respectively. (e-fas.org)
In a study of American military personnel deployed in Thailand, more than half of those with diarrhea were found to be infected with Campylobacter species. (medscape.com)
Campylobacter species are sensitive to hydrochloric acid in the stomach. (medscape.com)
Foodborne gastroenteritis1
Campylobacters are the leading cause of bacterial foodborne gastroenteritis in the world. (assignster.com)
Complete genome sequence of the Arcobacter canalis type strain LMG 29148. (usda.gov)
Campylobacter , along with Arcobacter and Sulfurospirillum , are the three genera that belong to the family, Campylobacteraceae. (frontiersin.org)
from Belgium used an Arcobacter -selective medium for stool specimens and found that A. butzleri ranked fourth among Campylobacter spp. (cdc.gov)
and Campylobacter -like organisms ( 11 ), which stimulated interest to revisit the role of Arcobacter spp. (cdc.gov)
We used molecular methods to identify Campylobacter -related organisms collected from a network of clinical laboratories that do not use specific Arcobacter -selective medium. (cdc.gov)
Concisus2
Campylobacter concisus is a Gram-negative, highly fastidious, mesophilic bacterium that grows under both anaerobic and microaerobic conditions with the presence of hydrogen significantly aiding growth. (wikipedia.org)
Complete genome sequence of the hippuricase-positive Campylobacter avium type strain LMG 24591. (usda.gov)
The annotation of the full genome sequence revealed the absence of genes encoding for a non-flagellar type 3 protein secretion system (NF-T3SS). (assignster.com)
Bacterial1
Campylobacter infections are among the most common bacterial infections in humans. (medscape.com)
Infections5
The French surveillance network of human Campylobacter infections is composed of laboratories selected on a voluntary basis ( 12 ). (cdc.gov)
In industrialized regions, enteric Campylobacter infections produce an inflammatory, sometimes bloody, diarrhea or dysentery syndrome. (medscape.com)
Infections with Campylobacter -like organisms can produce an enterocolitis/proctocolitis syndrome in homosexual males, who are at increased risk for Helicobacter cinaedi and Helicobacter fennelliae infections. (medscape.com)
Conditions in which acid secretion is blocked, for example, by antacid treatment or disease, predispose patients to Campylobacter infections. (medscape.com)
Isolates2
They send their clinical Campylobacter isolates to the National Reference Center with a completed information sheet concerning the patient and epidemiologic data. (cdc.gov)
other isolates were identified by comparing 2 sequences of 400 bp located at both extremities of a 1,100-bp fragment of the beginning of the 16S rRNA gene amplified with primers F2-16S-CHPEC (ATCCTGGCTCAGAGTGAACG) and R2-16S-CHPEC (AAGGGCCATGATGACTTGAC) with those of DNA databases by using the BLAST program ( http://www.ncbi.nlm.nih.gov/blast/ ). (cdc.gov)
Humans1
Transmission of Campylobacter organisms to humans usually occurs via infected animals and their food products. (medscape.com)
Infection1
Symptoms of Campylobacter infection begin after an incubation period of up to a week. (medscape.com)
Organisms1
Campylobacter organisms also may be an important cause of traveler's diarrhea, especially in Thailand and surrounding areas of Southeast Asia. (medscape.com)
Family1
Fecal samples obtained from twenty-five calves, one dog, and one asymptomatic family member were cultured for Campylobacter. (bvsalud.org)
Include1
The known routes of Campylobacter transmission include fecal-oral, person-to-person sexual contact, unpasteurized raw milk and poultry ingestion, and waterborne (ie, through contaminated water supplies). (medscape.com)
Strains8
Species-specific identification of campylobacters is problematic, primarily due to the absence of suitable biochemical assays and the existence of atypical strains. (nih.gov)
Sequence analyses were performed by using almost 94% of the complete 16S rRNA genes of 135 phenotypically characterized Campylobacter strains, including all known taxa of this genus. (nih.gov)
The exception was a lack of discrimination among the taxa Campylobacter jejuni and C. coli and atypical C. lari strains, which shared identical or nearly identical 16S rDNA sequences. (nih.gov)
Molecular methods applied to 2,855 strains of Campylobacter -like organisms received from a surveillance network of Campylobacter infections in France identified 29 Arcobacter butzleri infections. (cdc.gov)
1 ) originally described the species Arcobacter butzleri , previously named Campylobacter butzleri ( 1 ), after studying aerotolerant Campylobacter strains from human and veterinary sources. (cdc.gov)
The study period was from July 2002 to December 2003, and 2,855 Campylobacter -like strains were studied. (cdc.gov)
The global emergence of antimicrobial-resistant (AMR) strains of Salmonella and Campylobacter is a serious public health concern. (bvsalud.org)
Cytotoxin production has been reported in Campylobacter strains from patients with bloody diarrhea. (medscape.com)
other isolates were identified by comparing 2 sequences of 400 bp located at both extremities of a 1,100-bp fragment of the beginning of the 16S rRNA gene amplified with primers F2-16S-CHPEC (ATCCTGGCTCAGAGTGAACG) and R2-16S-CHPEC (AAGGGCCATGATGACTTGAC) with those of DNA databases by using the BLAST program ( http://www.ncbi.nlm.nih.gov/blast/ ). (cdc.gov)
Organisms5
and Campylobacter -like organisms ( 11 ), which stimulated interest to revisit the role of Arcobacter spp. (cdc.gov)
We used molecular methods to identify Campylobacter -related organisms collected from a network of clinical laboratories that do not use specific Arcobacter -selective medium. (cdc.gov)
Infections with Campylobacter -like organisms can produce an enterocolitis/proctocolitis syndrome in homosexual males, who are at increased risk for Helicobacter cinaedi and Helicobacter fennelliae infections. (medscape.com)
Campylobacter organisms also may be an important cause of traveler's diarrhea, especially in Thailand and surrounding areas of Southeast Asia. (medscape.com)
Transmission of Campylobacter organisms to humans usually occurs via infected animals and their food products. (medscape.com)
Determine1
To assess the potential public health risk of this increasing wild boar population, we collected stool samples from 130 wild boars from the MAB (June 2015 - February 2016), to determine the Campylobacter and Salmonella occurrence and the antimicrobial susceptibility of the isolates. (bvsalud.org)
Highly1
Campylobacter concisus is a Gram-negative, highly fastidious, mesophilic bacterium that grows under both anaerobic and microaerobic conditions with the presence of hydrogen significantly aiding growth. (wikipedia.org)