Rna polymerase promoter rna polymerase i. Medical search. Frequent questions

A mutation within the β subunit of Escherichia coli RNA polymerase impairs transcription from bacteriophage T4 middle promoters. (nih.gov)
17. Substitutions in the Escherichia coli RNA polymerase inhibitor T7 Gp2 that allow inhibition of transcription when the primary interaction interface between Gp2 and RNA polymerase becomes compromised. (nih.gov)

We have also used homology modelling of the priming and incoming nucleoside triphosphates from the T7 DNA-polymerase ternary complex structure to explain the specificity of T7RNAP for ribonucleotides, its ability to initiate from a single nucleotide, and the abortive cycling at the initiation of transcription. (nih.gov)
4. Substitution of a single bacteriophage T3 residue in bacteriophage T7 RNA polymerase at position 748 results in a switch in promoter specificity. (nih.gov)
5. Promoter specificity determinants of T7 RNA polymerase. (nih.gov)
8. Identification of a region of the bacteriophage T3 and T7 RNA polymerases that determines promoter specificity. (nih.gov)
Protein-nucleic acid contacts help explain DNA and RNA strand separation, the specificity of RNA synthesis, and RNA and DNA translocation during transcription elongation. (nih.gov)
Thermo Scientific™ T7 RNA Polymerase is a DNA-dependent RNA polymerase with strict specificity for its double-stranded promoter. (fishersci.com)
In a continuous evolutionary arc of less than three days, we discover T7 RNA polymerase enzymes with a degree of specificity for the T3 promoter exceeding that of the wild type enzyme for its native substrate. (harvard.edu)

Although the single-polypeptide-chain RNA polymerase from bacteriophage T7 (T7RNAP), like other RNA polymerases, uses the same mechanism of polymerization as the DNA polymerases, it can also recognize a specific promoter sequence, initiate new RNA chains from a single nucleotide, abortively cycle the synthesis of short transcripts, be regulated by a transcription inhibitor, and terminate transcription. (nih.gov)
The T7 promoter sequence is recognized by interactions in the major groove between an antiparallel beta-loop and bases. (nih.gov)
Depending on the spacer sequence, the proposed interaction of the beta' zipper with the spacer can also facilitate open promoter complex formation and even substitute for interactions of the sigma subunit with the -35 element. (ncl.ac.uk)
Finally, our data suggest that sequence-dependent interactions of the beta' zipper with DNA can contribute to promoter-proximal sigma-dependent RNAP pausing, a recently recognized important step of transcription control. (ncl.ac.uk)
In molecular biology, the TATA box (also called the Goldberg-Hogness box) is a sequence of DNA found in the core promoter region of genes in archaea and eukaryotes. (wikipedia.org)
They first discovered the TATA sequence while analyzing 5' DNA promoter sequences in Drosophila, mammalian, and viral genes. (wikipedia.org)
In archaea species, the promoter contains an 8 bp AT-rich sequence located ~24 bp upstream of the transcription start site. (wikipedia.org)
RNA polymerase promoter sequence (TAATACGACTCACTATAGGG) to facilitate in vitro transcription. (cdc.gov)
Both the TFIIB protein and the DNA sequence help RNA polymerase figure out where to start reading the DNA. (thetech.org)
For those circumstances in which the holoenzyme is built onto the euchromatin, it is necessary to consider the holoenzyme components and the likely sequence of binding, RNA polymerase II entrance upon the scene and subsequent action. (wikiversity.org)
6. Effects of substitutions in a conserved DX(2)GR sequence motif, found in many DNA-dependent nucleotide polymerases, on transcription by T7 RNA polymerase. (nih.gov)
The crRNA, or CRISPR RNA sequence contains approximately 20 nucleotides of homology complementary to the strand of DNA opposite and upstream of a PAM (Protospacer Adjacent Motif) (NGG) sequence. (neb.com)
A. The target-specific oligo contains the T7 promoter sequence, ~20 nucleotides of target-specific sequence and a 14 nucleotide overlap sequence complementary to the S. pyogenes Cas9 Scaffold Oligo supplied in the reaction mix. (neb.com)
Predicted to enable RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. (mcw.edu)
Although such studies provided insights into the location of mtDNA promoters in the mentioned organisms, the techniques used were typically low throughput, were only semi quantitative, challenging to apply and require prior sequence knowledge. (biorxiv.org)
2. The DNA construct of claim 1 wherein the promoter sequence is foreign to the filamentous fungus host. (gc.ca)
3. The DNA construct of claim 2 wherein the promoter sequence is derived from a fungal gene. (gc.ca)
The DNA label contains a firefly luciferase coding sequence downstream from a T7 RNA polymerase promoter. (uncg.edu)

Bacterial promoters are recognized by RNA polymerase (RNAP) sigma subunit, which specifically interacts with the -10 and -35 promoter elements. (ncl.ac.uk)
Here, we provide evidence that the beta' zipper, an evolutionarily conserved loop of the largest subunit of RNAP core, interacts with promoter spacer, a DNA segment that separates the -10 and -35 promoter elements, and facilitates the formation of stable closed promoter complex. (ncl.ac.uk)
These results suggest that there exists a novel class of promoters that rely on interaction of the beta' zipper with promoter spacer, along with or instead of interactions of sigma subunit with the -35 element, for their activity. (ncl.ac.uk)
This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. (nih.gov)
Structural, biochemical, and dynamic characterizations of the hRPB8 subunit of human RNA polymerases. (nih.gov)
This led to the derivation of a 10-subunit form of RNA polymerase II especially conducive to crystallization, and to the use of two-dimensional crystals as seeds for the growth of large single crystals for X-ray analysis. (nih.gov)
In order for rifampicin to exert its antibacterial effects, it must bind the beta-subunit of M. tuberculosis 's RNA polymerase. (coursehero.com)
However, mutations in the gene that code for the beta-subunit of RNA polymerase have resulted in a decreased affinity of the drug. (coursehero.com)

RNA polymerase stalling at developmental control genes in the Drosophila melanogaster embryo. (nature.com)
The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. (nih.gov)
The TATA box was found in protein coding genes transcribed by RNA polymerase II. (wikipedia.org)
The TATA box is also found in 40% of the core promoters of genes that code for the actin cytoskeleton and contractile apparatus in cells. (wikipedia.org)
These sequences, called promoters , happen just before the start of our genes. (thetech.org)
Promoters make sure that RNA polymerase only gets called to genes, and not to other parts of our DNA. (thetech.org)
Genes are the only parts of DNA that get copied into RNA. (thetech.org)
RNA polymerase II is recruited to the promoters of protein-coding genes in living cells. (wikiversity.org)
This protein binds to the serum response element (SRE) in the promoter region of target genes. (avivasysbio.com)
This bi-genomic division is accompanied by profoundly different transcription regulatory system: whereas nDNA-encoded genes are transcribed individually by RNA polymerase 2 and the general nuclear transcription machinery, mtDNA transcription is long known to be regulated mainly by a dedicated RNA polymerase (POLRMT) and mtDNA-specific transcription factors (TFAM and TFB2) ( Shutt and Shadel 2010 ). (biorxiv.org)
Regulatory genes are genes whose products are either RNA or proteins. (proprofs.com)
This means that the statement "Regulatory genes are genes whose products are either RNA or proteins" is true. (proprofs.com)
After transcription, the Cas genes are translated into various Cas proteins, and the spacers in the CRISPR array are processed into guide RNAs. (northwestern.edu)
In the area of transcriptional control, we are examining the chromatin remodeling (CR) complexes, histone acetyl transferases (HATs), and general regulatory factors (GRFs) involved in remodeling and evicting nucleosomes that occlude promoter sequences and impede preinitiation complex (PIC) assembly by RNA Polymerase II (Pol II) at the hundreds of genes co-regulated by Gcn4, and genome-wide. (nih.gov)

Protein-protein interactions between transcription activator proteins and RNA polymerase or basal transcription factors have been suggested to be important for transcription activation 1-8 . (utmb.edu)
In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. (nih.gov)
Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. (nih.gov)
It transduces regulatory information from activator and repressor proteins to RNA polymerase II. (nih.gov)
Aspergillus may be provided with foreign or natural coding regions associated with foreign or natural promoter sequences and optionally signal peptide sequences which can be used to control the expression and/or secretion of the proteins encoded by these coding regions. (gc.ca)
They produce products that can be either RNA or proteins. (proprofs.com)
There are several types of dynamic agent in this model: RNA polymerases, viruses, guide RNAs, cas9 proteins, and cas1-cas2 complexes. (northwestern.edu)
Small molecules like guide RNAs can diffuse very quickly, moderately sized molecules like proteins diffuse slightly more slowly, and very large molecules like viral DNA move very slowly. (northwestern.edu)
MYC dissociation from active promoters alters its interactions with proteins involved in transcription termination and RNA processing, influencing DNA repair and thus, potentially, tumour cell growth. (nature.com)

Based on in vitro studies, it has been demonstrated that the DSIF complex, composed of SPT4 and SPT5, regulates the elongation stage of transcription catalyzed by RNA polymerase II (RNA Pol II). (nih.gov)
RNA polymerase II (Pol II) pauses downstream of the transcription initiation site before beginning productive elongation. (nature.com)
Jonkers, I. & Lis, J.T. Getting up to speed with transcription elongation by RNA polymerase II. (nature.com)
Kinetic competition between elongation rate and binding of NELF controls promoter-proximal pausing. (nature.com)

In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. (nih.gov)
This structure now reveals that human TFIIBc binds to the promoter asymmetrically through base-specific contacts in the major groove upstream and in the minor groove downstream of the TATA-box. (rcsb.org)
The C-terminus binds to the GAL4 DNA-binding domain and is transfected into cells, which activates the transcription of GAL4-dependent promoters. (news-medical.net)
RUNX2, presumably in complex with CBFB, binds the promoter of the BAX gene (Eliseev et al. (reactome.org)
This regulatory protein binds to the gene's promoter region and prevents the RNA polymerase enzyme from binding and initiating transcription. (proprofs.com)
This activator protein binds to a specific site on the DNA, known as an activator binding site, and enhances the binding of RNA polymerase to the promoter region, leading to increased gene expression. (amcomm.org)

Pausing of RNA polymerase II disrupts DNA-specified nucleosome organization to enable precise gene regulation. (nature.com)
Gene transcription by RNA polymerase II depends on the regulation of the core promoter by long-range regulatory elements such as enhancers and silencers. (wikipedia.org)
Transcription regulation at the core: similarities among bacterial, archaeal, and eukaryotic RNA polymerases. (nih.gov)
We also seek to identify the functional consequences and regulation by chromatin regulators of the cryptic internal promoters we found recently to be activated by Gcn4 binding within gene coding sequences (CDSs). (nih.gov)

T7RNAP initiates RNA synthesis at promoter sequences that are conserved from positions -17 to +6 relative to the start site of transcription. (nih.gov)
Promoter sequences vary between bacteria and eukaryotes. (wikipedia.org)
3. Selection and characterization of a mutant T7 RNA polymerase that recognizes an expanded range of T7 promoter-like sequences. (nih.gov)
These sequences have been adapted for use in the lab by combining the tracrRNA and crRNA into one long single guide RNA (sgRNA) (1) species capable of complexing with Cas9 to recognize and cleave the target DNA. (neb.com)
Signal peptide sequences and promoter sequences valuable for this purpose are disclosed as are expression vectors containing coding regions native or foreign to the fungal host. (gc.ca)

The TATA box was first identified in 1978 as a component of eukaryotic promoters. (wikipedia.org)
The TATA box was the first eukaryotic core promoter motif to be identified in 1978 by American biochemist David Hogness while he and his graduate student, Michael Goldberg were on sabbatical at the University of Basel in Switzerland. (wikipedia.org)
Even though the TATA box is present in many eukaryotic promoters, it is not contained in the majority of promoters. (wikipedia.org)
In bacteria, promoter regions may contain a Pribnow box, which serves an analogous purpose to the eukaryotic TATA box. (wikipedia.org)
The diagram describes the eukaryotic preinitiation complex which includes the general transcription factors and RNA Polymerase II. (wikiversity.org)

Figure 3: Promoters with stable Pol II pausing lack PICs but show downstream occupancy of TBP. (nature.com)
When there is an absence of the TATA box and TBP is not present, the downstream promoter element (DPE) in cooperation with the initiator element (Inr) bind to the transcription factor II D (TFIID), initiating transcription in TATA-less promoters. (wikipedia.org)
The template DNA must contain: an in-frame start codon, an in-frame stop codon, a T7 promoter, an upstream ribosome binding site, a downstream spacer region, and a downstream T7 terminator. (neb.com)
A PCR fragment can be synthesized using primers to add upstream and downstream elements such as the T7 promoter and terminator. (neb.com)

[6] Or, transcription factories are present and the euchromatin is brought within the nearest transcription factory and A1BG messenger RNA (mRNA) is transcribed. (wikiversity.org)
Studies have shown that the C-terminus of BRCA1 which incorporates amino acids 1528 to 1863 forms a complex with RNA polymerase II, an enzyme that makes mRNA precursors as well as many noncoding RNAs. (news-medical.net)
The two ribosomal subunits then lock around the mRNA and the process of translation into a protein begins, with the necessary amino acid subunits being delivered by transfer RNA molecules. (evolutionnews.org)

Transcription initiation requires the assembly of a preinitiation complex (PIC), which is nucleated through binding of the TATA-box binding protein (TBP) to the promoter. (rcsb.org)
Polymerase II and OGT co-immunoprecipitated, and OGT is a component of the preinitiation complex. (nih.gov)
These data suggest that the cycling of O-GlcNAc on and off of polymerase II occurs during assembly of the preinitiation complex. (nih.gov)

Architecture of the bacteriophage T4 activator MotA/promoter DNA interaction during sigma appropriation. (nih.gov)
Bacteriophage T4 MotA activator and the β-flap tip of RNA polymerase target the same set of σ70 carboxyl-terminal residues. (nih.gov)
2. Characterization of bacteriophage T7 RNA polymerase by linker insertion mutagenesis. (nih.gov)
9. Hierarchy of base-pair preference in the binding domain of the bacteriophage T7 promoter. (nih.gov)
15. [Functional studies of mutant forms of bacteriophage T7 RNA polymerases containing point substitutions in the motif at the active site of the enzyme]. (nih.gov)
18. [Site-specific mutagenesis of RNA-polymerase from bacteriophage T7: effect of Met-635 and Ser-633 substitutions on enzyme properties]. (nih.gov)
19. Discrimination between bacteriophage T3 and T7 promoters by the T3 and T7 RNA polymerases depends primarily upon a three base-pair region located 10 to 12 base-pairs upstream from the start site. (nih.gov)
20. T7-promoter-based Escherichia coli expression system induced with bacteriophage M13HEP. (nih.gov)

As T7RNAP is homologous to the Pol I family of DNA polymerases, the differences between the structure of T7RNAP complexed to substrates and that of the corresponding DNA polymerase complex provides a structural basis for understanding many of these functional differences. (nih.gov)
When promoters use the SAGA/TATA box complex to recruit RNA polymerase II, they are more highly regulated and display higher expression levels than promoters using the TFIID/TBP mode of recruitment. (wikipedia.org)
After the RNA polymerase and the transcriptional initiation complex bind to the promoter, how can it recognize the transcription start site? (thetech.org)
RNA polymerase II holoenzyme complex may also have to search for one or more transcription start sites. (wikiversity.org)
RNA polymerase II was also crystallized in the form of an actively transcribing complex, containing template DNA and product RNA. (nih.gov)
We present here the 2.65 A resolution crystal structure of a human TFIIBc-TBPc complex bound to an idealized and extended adenovirus major late promoter. (rcsb.org)
The C-terminal end of BRCA1 interacts directly or indirectly with p53, RNA Polymerase II, RNA helicaseA, p300 and CBP (CREB binding protein), BRCA2, histone-deacetylase complex, RB and CtIP. (news-medical.net)
What general transcription factor for RNA polymerase II acts immediately after TFIID in the formation of the pre-initiation complex? (flashcardmachine.com)
TTF1:rRNA promoter:ERCC6:EHMT2 complex dimethylates histone H3 at lysine-9. (reactome.org)
In budding yeast, his major finding was that the most upstream cyclin-dependent kinase complex, Cln3-Cdk1, directly phosphorylates Ser5 residues on RNA polymerase II C-terminal repeats at a specific set of promoters to activate gene expression and drive the G1/S transition. (nih.gov)

The SCP is the strongest core promoter observed in vitro and in cultured cells and yields high levels of transcription in conjunction with transcriptional enhancers. (wikiversity.org)
10. A combined in vitro/in vivo selection for polymerases with novel promoter specificities. (nih.gov)
1996. In vitro selection of catalytic RNA. (sandia.gov)

Interactions between catabolite gene activator protein (CAP) 9,10 and RNA polymerase have been proposed based on face-of-helix-dependent transcription activation by CAP 11-13 and based on face-of-helix-dependent cooperative binding of CAP and RNA polymerase to promoter DNA 14,15 . (utmb.edu)
Human SIRT7 is a histone deacetylase that is recruited to target promoters by interactions with transcription factors, promoting transcriptional repression [ 3356 ]. (senescence.info)
Furthermore, conformational changes in Mediator were observed that increased interactions with RNA polymerase II. (nih.gov)

Here we use the thermodynamically rigorous technique of fluorescence polarization 20-23 to show that CAP interacts with RNA polymerase in solution in the absence of promoter DNA (K D.app = 2.8 x 10 -7 M), whereas [Alal58]CAP, a mutant of CAP specifically defective in transcription activation, does not. (utmb.edu)
This region also interacts with p53 and stimulates p53-dependent transcription of the p21 promoter. (news-medical.net)
Furthermore, the C-terminus of BRCA1 interacts with the RNA polymerase II holoenzyme to act as transcriptional activator. (news-medical.net)

Characterization of RNA polymerase type II from human term placenta. (nih.gov)

The general transcription factors are responsible for promoter recognition and for melting the DNA template for the initiation of transcription. (nih.gov)
The animation also shows transcription factors that are bound to an enhancer, which are brought into close proximity to the promoter by looping round of the DNA, where they can interact with the RNA polymerase and trigger the initiation of transcription. (evolutionnews.org)

Figure 1: ChIP-nexus detects the precise locations of basal transcription factors and Pol II along the core promoter in vivo . (nature.com)
Holstege, F.C., van der Vliet, P.C. & Timmers, H.T. Opening of an RNA polymerase II promoter occurs in two distinct steps and requires the basal transcription factors IIE and IIH. (nature.com)

7. Mutations in T7 RNA polymerase that support the proposal for a common polymerase active site structure. (nih.gov)
The data support a model where mutations occur when the initiating form of RNA polymerase is retained. (nih.gov)

TATA-binding protein (TBP) can be recruited in two ways, by SAGA, a cofactor for RNA polymerase II, or by TFIID. (wikipedia.org)

16. Studies of contacts between T7 RNA polymerase and its promoter reveal features in common with multisubunit RNA polymerases. (nih.gov)

The two oligos anneal at the overlapping region and are filled in by the DNA polymerase, creating a double-stranded DNA (dsDNA) template for transcription. (neb.com)
C. The DNA polymerase extends both oligos from their 3´ ends creating a double-stranded DNA template. (neb.com)
D. The RNA polymerase recognizes the double-stranded DNA of the T7 promoter and initiates transcription. (neb.com)

Mediator makes the key connection between enhancers and promoters. (nih.gov)
Contrary to current models that indicate Mediator acts as a topological bridge linking enhancers and promoters, depletion of Mediator does not alter genome architecture. (nih.gov)
These results led to the proposal that the structural flexibility of Mediator enables it to integrate and relay regulatory signals between transcription factors and RNA polymerase II and that Mediator forms a functional, instead of an architectural, bridge linking enhancers and promoters. (nih.gov)
A Pliable Mediator Acts as a Functional Rather Than an Architectural Bridge between Promoters and Enhancers. (nih.gov)
They noted that such damage occurs preferentially at promoters and enhancers and is associated with demethylation and transcription activation. (blogspot.com)
This title is a bit of a surprise since the paper only talks about breaks in enhancers and promoters and the word "junk" doesn't appear anywhere in the published report in Nature . (blogspot.com)

The type of core promoter affects the level of transcription and expression of a gene. (wikipedia.org)
Earlier "studies led to the design of a super core promoter (SCP) that contains a TATA, Inr, MTE, and DPE in a single promoter (Juven-Gershon et al. (wikiversity.org)
These findings indicate that gene expression levels can be modulated via the core promoter. (wikiversity.org)
The core promoter includes the transcription start site(s) (TSS). (wikiversity.org)

Synthesis of the dsDNA template and transcription of RNA occur in a single reaction, resulting in the generation of a functional sgRNA. (neb.com)
Although the O-GlcNAc modification of RNA polymerase II CTD was documented in 1993, its functional significance remained obscure. (nih.gov)

The RNA transcripts were diluted with a 10-fold serial dilution and used as standards to calculate viral genome copy number. (cdc.gov)
Viral genome copy number was calculated in each sample using the standard curves of the template RNA. (cdc.gov)

Small extrachromosomal circular DNAs, microDNA, produce short regulatory RNAs that suppress gene expression independent of canonical promoters. (nih.gov)
This highly unexpected finding links Cdk activity for the first time directly to transcriptional activation and contrasts with the prevailing model that RNA polymerase II phosphorylation is merely a basal step in transcriptional activation and demonstrates how direct RNA polymerase II phosphorylation at specific promoters can dynamically modulate gene expression. (nih.gov)
In our future research we want to understand more thoroughly how cell cycle cyclin-Cdk-Cks complexes are recruited to specific promoters, how they regulate gene expression by phosphorylating RNA polymerase II and study other promoter-specific kinases capable of phosphorylating RNA-polymerase II. (nih.gov)

This system includes all of the components needed for protein synthesis: a highly active cell extract, an optimized T7 RNA polymerase, an RNase inhibitor and a protein synthesis reaction buffer containing energy source, nucleotides, and amino acids. (neb.com)
Combine the following in a 1.5 ml microcentrifuge tube: 12 µl of NEBExpress S30 Synthesis Extract, 25 µl of 2X Protein Synthesis Buffer, 1µl of T7 RNA Polymerase, 1 µl of RNase Inhibitor, 250 ng of DNA template, and nuclease free water to total reaction volume of 50 µl. (neb.com)

47a) Antisense RNA, Transcriptional Interference and Genetic Switch: Train Wreck or Noise Filter? (aiche.org)
Control products, reagents, and RNA samples for use in the study of RNA and the process of RNA interference (RNAi or post-transcriptional gene silencing). (fishersci.com)

1. T7 RNA polymerase mutants with altered promoter specificities. (nih.gov)

In nature, S. pyogenes Cas9 is programmed with two separate RNAs, the crRNA and tracrRNA. (neb.com)
Target-specific oligos (or EnGen sgRNA Control Oligo, S. pyogenes) are mixed with the EnGen 2X sgRNA Reaction Mix (NTPs, dNTPs, S. pyogenes Cas9 Scaffold Oligo), 0.1 M DTT and the EnGen sgRNA Enzyme Mix (DNA and RNA polymerases) at room temperature. (neb.com)
When they are processed into guide RNAs, they are critical for the function of one of the protein components, Cas9. (northwestern.edu)

From a teleological standpoint, this arrangement [of focused promoters] is consistent with the notion that it would be easier to regulate the transcription of a gene with a single transcription start site than one with multiple start sites. (wikiversity.org)
OmpR,+] phrase and all other phrases that regulate this promoter(s). (unam.mx)
MicroRNAs (miRNAs) are a group of small, non-coding RNAs that regulate protein-coding gene function at the post-transcriptional level by binding to complementary sites on target mRNAs in the 3′UTR ( Ambros, 2004 ). (peerj.com)

To this end we used deep sequencing (GRO-seq and PRO-seq) and analyzed nascent mtDNA-encoded RNA transcripts in diverse human cell lines and metazoan organisms. (biorxiv.org)

PCR 2× reaction mix buffer, 10 pmol of each primer, 2.5 mmol/L MgSO4, 20 U RNase inhibitor, 1 L SuperScript III/ Platinum Taq Enzyme Mix, and 5 L RNA. (cdc.gov)
Each 25-L reaction mixture contained 12.5 L of 2× RT-PCR buffer, 1 L RT-PCR buffer enzyme mix, 400 nmol/L each primer, 120 nmol/L probe, and 3 L of RNA extract. (cdc.gov)

Polarity of transcription on Pol II and archaeal promoters: where is the "one- way sign" and how is it read? (rcsb.org)

A methylation assay revealed that the promoter of OgCHS was not methylated in Gower Ramsey, while a positive methylation effect was present in the upstream promoter region of OgCHS in Honey Dollp. (springer.com)
Overall, our results suggest that the failure of anthocyanin accumulation in Honey Dollp floral tissues may be attributed to inactivation of the OgCHS gene resulting from the epigenetic methylation of 5′-upstream promoter region. (springer.com)
Second, an L1 transposon element, which is absent in the human promoter, is found 480 bp upstream of the transcription start site in mouse. (aspetjournals.org)

Thanks to TFIIB, the RNA polymerase is almost where it needs to be to start reading the gene. (thetech.org)
Transcription factor IIB (TFIIB) is essential for transcription initiation from RNA polymerase II promoters. (rcsb.org)

In Arabidopsis thaliana , downregulation of the floral repressor FLC in response to cold occurs through a mechanism in which the FLC activator FRIGIDA is sequestered into biomolecular condensates away from the FLC promoter. (nature.com)

Different requirements for σ Region 4 in BvgA activation of the Bordetella pertussis promoters P(fim3) and P(fhaB). (nih.gov)
AraC protein bound to arabinose and two two separate sites in the araBAD promoter region. (flashcardmachine.com)
The CRISPR locus is the small band of light blue at the center of the cell, with a slightly lighter promoter region at one end. (northwestern.edu)
This allows RNA polymerase to bind to the promoter region and initiate transcription. (amcomm.org)
A mutation in the promoter region results in decreased affinity, or binding ability, for isoniazid. (coursehero.com)
All members in this genus tested so far are shown to produce a unique subgenomic flavivirus RNA (sfRNA) derived from the 3' untranslated region (UTR). (mdpi.com)

Structural studies of the RNA polymerase II transcription machinery began with electron microscope analysis of two-dimensional protein crystals formed on lipid layers. (nih.gov)

But, there's still a bunch of DNA bases between the promoter and the spot where RNA polymerase actually begins reading: the gene's transcription start site . (thetech.org)

A complete RNA polymerase II transcription system has been derived by the fractionation of yeast and mammalian cell extracts. (nih.gov)

Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. (springer.com)

The crystal structure at 2.4 A resolution of T7RNAP complexed with a 17-base-pair promoter shows that the four base pairs closest to the catalytic active site have melted to form a transcription bubble. (nih.gov)
Nine base pairs of DNA-RNA hybrid could be seen extending from the active center at nearly right angles to the entering DNA. (nih.gov)
About every 10,000 base pairs, DNA polymerase makes a mistake. (coursehero.com)

13. A mutation in T7 RNA polymerase that facilitates promoter clearance. (nih.gov)

Anatomy12

Organisms16

Diseases2

Chemicals and Drugs124

Analytical, Diagnostic and Therapeutic Techniques and Equipment27

Phenomena and Processes81

Information Science3

Health Care2

Escherichia coli RNA2

Specificity7

Sequence18

Subunit8

Genes14

Proteins9

Elongation4

Binds6

Regulation4

Sequences5

Eukaryotic5

Downstream4

MRNA3

Preinitiation complex3

Bacteriophage8

Complex10

Vitro3

Interactions3

Interacts3

Characterization1

Initiation of transcript2

Basal transcription factors2

Mutations2

TFIID1

Multisubunit1

Double-stranded3

Enhancers6

Core promoter4

Functional2

Genome2

Gene expression3

Synthesis2

Interference2

Mutants1

Cas93

Regulate3

Transcripts1

Enzyme Mix2

Archaeal1

Upstream3

TFIIB2

Activator1

Region6

Structural1

Gene's1

Mammalian1

19931

Base pairs3

Facilitates1