NucleicBDNA assayImmunoblot assayQuantificationProteinQuantifyEnzymeQuantitativeSequencesOligonucleotidesMultiplexMoleculesAmino acidGenesGenomicMitochondrialMembraneSingle-strandedDetectPathwaySpecimensProteinsMetabolicYeastStructuresBiologicalCellSynthesisDiagnosisEstablishTraceReactionRecruitmentSpecificSequenceSurfaceHostDiversityCancerMethodTreatment
Nucleic7
- In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification assay) that is used to detect nucleic acid molecules. (wikipedia.org)
- The label oligonucleotide and the branched DNA then detects the immobilized target nucleic acid. (wikipedia.org)
- The branched DNA binds to the sample nucleic acid by specific hybridization in areas which are not occupied by capture hybrids. (wikipedia.org)
- The design of the branched DNA and the way it is hybridized to the nucleic acid to be investigated differs between different generations of the bDNA assay. (wikipedia.org)
- A number of nucleic acid-based detection methods can be used to detect low levels of HIV-1 RNA or DNA, including PCR (standard, quantitative competitive, real time, in situ), branched DNA signal amplification (bDNA), strand displacement amplification (SDA), transcription-mediated amplification (TMA), and nucleic acid sequence-based amplification (NASBA). (ucsf.edu)
- Genomtec S.A. is mainly involved in conducting research and development activities, as well as commercialization of its innovative molecular diagnostic products in the area of optical systems and isothermal nucleic acid amplification methods. (genomtec.com)
- In addition, the company chose to work with the new technology of Loop-Mediated Isothermal Nucleic Acid Amplification - LAMP. . (genomtec.com)
BDNA assay6
- The branched-DNA (bDNA) assay provides a reliable method for the quantification of HIV-1 RNA in human plasma and is considered one of the most reproducible assays ready for use in clinical trials. (ox.ac.uk)
- A series of oligonucleotide probe design and solution changes have been developed to enhance the sensitivity of the bDNA assay while maintaining its performance characteristics. (ox.ac.uk)
- Among the changes incorporated into the enhanced-sensitivity bDNA (ES bDNA) assay to reduce the background level and enhance the signal are the use of shorter overhang sequences of target probes for capture, the cruciform design of target probes for amplification, and the addition of preamplifier molecules. (ox.ac.uk)
- The ES bDNA assay is at least 20-fold more sensitive than the first-generation bDNA assay, yet it maintains a high level of accuracy, linearity, and reproducibility. (ox.ac.uk)
- Further, quantification values obtained with the ES bDNA assay and the first-generation bDNA assay are highly correlated, thus allowing for meaningful comparisons of HIV-1 RNA levels in specimens tested with either assay. (ox.ac.uk)
- The ES bDNA assay may be useful in determining the prognostic value of HIV-1 RNA levels of below 10,000 copies per ml and in assessing the clinical benefit of antiretroviral therapy-induced decreases in plasma HIV-1 RNA sustained at levels of below 10,000 copies per ml. (ox.ac.uk)
Immunoblot assay2
- The recombinant immunoblot assay is used to confirm HCV infection. (medscape.com)
- Recombinant immunoblot assay. (cdc.gov)
Quantification1
- An enhanced-sensitivity branched-DNA assay for quantification of human immunodeficiency virus type 1 RNA in plasma. (ox.ac.uk)
Protein13
- To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 ( BMP-2 ) gene-engineered cell sheet using a complex of polyethylenimine-alginate (PEI-al) nanocomposites plus human BMP-2 complementary(c)DNA plasmid, and studied its osteogenesis in vitro and in vivo. (dovepress.com)
- Consequently, most, if not all, of the hydrogenosomal proteins are encoded by the nuclear DNA, synthesized in the cytosol, and then imported into hydrogenosome via a protein import machinery. (plasignaling.com)
- Quantify DNA, RNA, and protein in seconds using only 1-2 µL of sample-no need for dilution. (thermofisher.cn)
- The beta subunit contains a C-terminal domain which is involved in cell signaling, through phosphorylations and protein-protein interactions. (cusabio.com)
- We determined in six neuroblastoma cell lines the cytotoxicity of TPZ using DIMSCAN, a digital imaging fluorescence assay, apoptosis and mitochondrial membrane potential (ΔΨ m ) by flow cytometry, and protein expression by immunoblotting. (aacrjournals.org)
- However, the fact that OsClpC3 protein appears mitochondrial/chloroplastic with equal probability and OsClpC4 a plasma membrane protein reflects functional diversity of this class. (biomedcentral.com)
- From the complementation assays, OsClpD1 appears to be more effective than OsClpB-cyt protein in rescuing the thermosensitive defect of the yeast ScΔhsp104 mutant cells. (biomedcentral.com)
- Those 22 amino acids (MANLGCWMLVLFVATWSDLGLC) get cleaved off by signal peptidase and the protein continues to be translated directly into the ER. (cureffi.org)
- Once the signal peptide and GPI signal have both been cleaved, the initial 253 amino acid protein is just 208 amino acids. (cureffi.org)
- Preferential activation of microsomal diacylglycerol/protein kinase C signaling during glucose treatment (De Novo phospholipid synthesis) of rat adipocytes. (jci.org)
- Products of the former group function directly in protecting cells against damage derived from stresses and sustaining cell viability, and the latter is composed of regulatory proteins, such as transcription factors (TFs), protein kinases and protein phosphatases, that are responsible for transducing stress signaling and regulating expression of stress-responsive genes [ 5 ]. (biomedcentral.com)
- Finally, the signal sequence is cleaved and the pre-protein is either folded or trafficked onwards. (elifesciences.org)
- BCL2 antibodies targeted at different epitopes detect varying levels of protein expression and correlate with frequent gene amplification in diffuse large B-cell lymphoma. (uams.edu)
Quantify3
- Diagrammatically, the process can be resembled as Base → Capture Probe → Extender → Target → label extender → pre-amplifier → amplifier The assay can be used to detect and quantify many types of RNA or DNA target. (wikipedia.org)
- The Invitrogen Qubit Fluorometer is designed to quickly and specifically quantify DNA or RNA. (thermofisher.cn)
- the ability of the artus epstein-barr virus (ebv) pcr kit and the abbott realtime ebv pcr assay to detect and quantify plasma ebv dnaemia was compared. (liverpool.ac.uk)
Enzyme6
- After binding of the target to the solid support it can be detected by branched DNA which is coupled to an enzyme (e.g. alkaline phosphatase). (wikipedia.org)
- The branching of the DNA allows for very dense decorating of the DNA with the enzyme, which is important for the high sensitivity of the assay[citation needed]. (wikipedia.org)
- The BCKD enzyme is a multimeric enzyme complex with four components, branched-chain keto acid decarboxylase alpha and beta subunits (E1 α and E1 β ), dihydrolipoyl transacylase (E2) subunit, and dihydrolipoamide dehydrogenase (E3) subunit. (nature.com)
- However, in clinical practice, the most common method for diagnosing established HIV infection is by performing a screening test (eg, enzyme-linked immunosorbent assay [ELISA]) and by confirming a positive result with a supplementary test. (medscape.com)
- The specific enzyme (AK) is feedback inhibited by its end product either by lysine or threonine and activated by metabolite from a competing branch (Asp). (apoptosisblog.com)
- Glucose rapidly increased DAG content and PKC enzyme activity in microsomes, but not in plasma membranes or other membranes, during a 30-min treatment of rat adipocytes. (jci.org)
Quantitative2
- The assay can be run as a high throughput assay, unlike quantitative Northern-blotting or the RNAse-protection assay, which are labor-intensive and thus difficult to perform on a large number of samples. (wikipedia.org)
- HBV DNA (quantitative viral load) indicates viral burden and viral replication. (medscape.com)
Sequences2
- Using the respective signal sequences cloned upstream to GFP/CFP reporter proteins and transient expression studies with onion epidermal cells, evidence is provided that rice ClpB-m and Clp-c proteins are indeed localized to their respective cell locations mitochondria and chloroplasts, respectively. (biomedcentral.com)
- The encoded SMILES sequences are encoded as vectors, with the CSF signal amplitude across each phase bin during task runs. (robinduttson.com)
Oligonucleotides1
- Several different short single-stranded DNA molecules (oligonucleotides) are used in a branched DNA-assay. (wikipedia.org)
Multiplex2
- Evaluation of a laboratory-developed multiplex real-time PCR assay for diagnosis of syphilis, herpes and chancroid genital ulcers in four public health laboratories in the USA. (cdc.gov)
- OBJECTIVE: To evaluate the field performance of a multiplex PCR (M-PCR) assay for detection of herpes simplex virus (HSV)-1 and HSV-2, Treponema pallidum (T. pallidum) and Haemophilus ducreyi (H. ducreyi) in genital ulcer disease (GUD) specimens. (cdc.gov)
Molecules5
- The dish is peppered with small, single stranded DNA molecules (or chains) that stick out into the solution. (wikipedia.org)
- These are known as capture probe DNA molecules. (wikipedia.org)
- First, it creates more available surface area for target DNA molecules to bind, and second, it allows the assay to be easily adapted to detect a variety of target DNA molecules. (wikipedia.org)
- Glycans can differ on several dimensions: the length, branching structure, and the particular sugar molecules at each position. (cureffi.org)
- Second, even if two molecules of PrP are both, say, diglycosylated, they might still differ in the types of glycan chains attached (again: length, branching structure, types of sugar molecules included). (cureffi.org)
Amino acid2
- Here, based on significant liver contribution to the catabolism of the branched chain amino acid leucine, we develop a liver-directed adeno-associated virus (AAV8) gene therapy for MSUD. (nature.com)
- The C-terminus of PrP is a 23 amino acid sequence (SMVLFSSPPVILLISFLIFLIVG) which signals for the addition of a GPI anchor. (cureffi.org)
Genes3
- In comparison with fiber-rich treatments that increased diversity and promoted Firmicutes and Bacteroidetes populations, resistant starch reduced microbial diversity and fecal pH, led to a bloom in Actinobacteria, and modified Kyoto Encyclopedia of Genes and Genomes orthology (KO) terms pertaining to starch and sucrose metabolism, fatty acid biosynthesis and metabolism, epithelial cell signaling, among others. (biomedcentral.com)
- These genes, most of which are constitutively expressed before and during symbiosis, constitute the common symbiosis signaling pathway (CSSP), which is also required for root nodule symbiosis (RNS). (frontiersin.org)
- Two unique NER subpathways have been recognized: global genomic NER (GG-NER) and transcription-coupled NER (TC-NER), which excise UV DNA photoproducts throughout the entire genome and exclusively from your ENOblock (AP-III-a4) transcribed strands of active genes, respectively. (colinsbraincancer.com)
Genomic3
- Selective Whole-Genome Amplification as a Tool to Enrich Specimens with Low Treponema pallidum Genomic DNA Copies for Whole-Genome Sequencing. (cdc.gov)
- AE001437) was amplified by polymerase chain reaction (PCR) from C. acetobutylicum (strain ATCC 824) genomic DNA using forward (AAAATCGTAGTAACAAAGTTTGG) and reverse (CATTAAATGCATTGTATATGGATTTAACAGC) primers. (apoptosisblog.com)
- lymphoblastoid cell lines (lcls) transformed by epstein-barr virus (ebv) serve as an unlimited resource of human genomic dna. (liverpool.ac.uk)
Mitochondrial1
- High exposure to VPA can lead to carnitine depletion causing a misbalance between the intra-mitochondrial beta-oxidation and the microsomal co-oxidation, a pathway that produces toxic metabolites such as 4-en-VPA which inhibits ammonia elimination. (unav.edu)
Membrane6
- It contains the targeting signals and directs the import of most matrix proteins, many inner membrane proteins and some intermembrane space proteins into mitochondria-like organelles (Chacinska et al. (plasignaling.com)
- PM, plasma membrane. (rupress.org)
- Once there it remains GPI-anchored to the exoplasmic (outside) surface of the plasma membrane. (cureffi.org)
- This membrane, together with the fungal plasma membrane, and the space in between, constitute the symbiotic interface, over which nutrients are exchanged. (frontiersin.org)
- AM symbiosis culminates with the formation of the arbuscules, highly branched fungal structures that are separated from the surrounding host cytoplasm by the periarbuscular membrane (PAM). (frontiersin.org)
- Glucose-induced activation of DAG/PKC signaling in microsomes was not associated with a change in the translocation of Glut-4 transporters from microsomes to the plasma membrane, a biological response that is known to be stimulated by agonists, e.g., phorbol esters, which increase DAG/PKC signaling in plasma membranes, as well as in microsomes. (jci.org)
Single-stranded1
- Current models suggest that blockage of fork development by DNA adducts uncouples the experience of replicative helicase complexes from that of DNA polymerases, which creates parts of single-stranded DNA (ssDNA) (8, 9). (colinsbraincancer.com)
Detect2
- Despite the fact that the starting material is not preamplified, bDNA assays can detect less than 100 copies of HIV-RNA per mL of blood. (wikipedia.org)
- 20 copies/ml), with the use of more sensitive tests, it is possible to detect residual HIV-1 RNA in the plasma of almost all patients on ART. (ucsf.edu)
Pathway1
- Secretory pathway proteins with a DXE signal, called a 'di-acidic' signal since D is aspartic acid and E is glutamic acid, get exocytosed . (cureffi.org)
Specimens3
- Downstream next-generation sequencing (NGS) of the syphilis spirochete Treponema pallidum subspecies pallidum (T. pallidum) is hindered by low bacterial loads and the overwhelming presence of background metagenomic DNA in clinical specimens. (cdc.gov)
- The significance of our research is the development of an SWGA DNA enrichment method that expands the range of clinical specimens that can be directly sequenced to include samples with low numbers of T. pallidum. (cdc.gov)
- METHODS: GUD M-PCR was performed on 186 remnant specimens, previously collected for HSV testing, by four public health laboratories (PHLs) and the Laboratory Reference and Research Branch (LRRB) at the Centers for Disease Control and Prevention. (cdc.gov)
Proteins2
- The QSP model included a VPA population pharma-cokinetics model that allowed the prediction of total and unbound concentrations after single and multiple oral doses considering its saturable binding to plasma proteins. (unav.edu)
- ATR/Mec1 phosphorylates a variety of proteins substrates after that, a lot of which promote DNA replication conclusion and therefore cell success (11, 12). (colinsbraincancer.com)
Metabolic2
- Metabolic profiling of plasma, urine and fecal samples was performed. (nature.com)
- Maple syrup urine disease (MSUD) is a rare recessively inherited metabolic disorder causing accumulation of branched chain amino acids leading to neonatal death, if untreated. (nature.com)
Yeast1
- Complementation assays of Δhsp104 mutant yeast cells showed that OsClpB-cyt , OsClpB-m , OsClpC1 and OsClpD1 have significantly positive effects. (biomedcentral.com)
Structures1
- The COVID-19 pandemic has shown that rapidly determining the pathogenesis, or causes of the disease, at the level of basic cellular structures (RNA and DNA) is the new expected standard. (genomtec.com)
Biological1
- The traditional use of organic solvents in various branches of industry is being rethought as these compounds very often display high volatility, toxicity and lipophilicity (related to the ability to interact with biological membranes). (easychair.org)
Cell7
- Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. (dovepress.com)
- The chemi- appear to interact with the structural elements of the cell, cal analysis was assessed at DATA CHEM Laboratories using plasma- with apparent binding to the cytoskeleton [Porter et al. (cdc.gov)
- Clinical manifestation coincides with the employment of humoral immune mechanisms, enrolling plasma cell recruitment, deposition of myelin-bound IgG and antibody-dependent macrophageal myelin-stripping. (biomedcentral.com)
- comparison of the artus epstein-barr virus (ebv) pcr kit and the abbott realtime ebv assay for measuring plasma ebv dna loads in allogeneic stem cell transplant recipients. (liverpool.ac.uk)
- It is noteworthy that several essential NER factors (RPA1C3, proliferating cell nuclear antigen, and DNA ligase) also play independent functions in other crucial cellular processes, such as DNA replication and homologous recombination. (colinsbraincancer.com)
- Helix-distorting CPDs and 6-4PPs strongly block the progression of DNA polymerases, which causes prolonged replication fork stalling and formation of DNA strand breaks, eventually leading to cell death (7). (colinsbraincancer.com)
- Jiwani S, Bornhost J, Alapat D. Biphenotypic plasma cell myeloma: two cases of plasma cell neoplasm with a coexpression of kappa and lambda light chains. (uams.edu)
Synthesis1
- Eukaryotic cells have thus developed the extremely conserved DNA harm response (DDR), a significant branch which (the S stage checkpoint) works to decelerate DNA synthesis, thus providing more possibility to mitigate the genotoxic implications of replicative tension. (colinsbraincancer.com)
Diagnosis1
- plasma epstein-barr virus dna for pediatric burkitt lymphoma diagnosis, prognosis and response assessment in malawi. (liverpool.ac.uk)
Establish1
- We establish and characterize the Bckdha ( branched chain keto acid dehydrogenase a ) −/− mouse that exhibits a lethal neonatal phenotype mimicking human MSUD. (nature.com)
Trace1
- A recent publication in Nature Scientific Reports uses levels of cfDNA as a predictor of chemotherapy efficacy in treatment of advanced cancers, and uses the branched DNA approach to amplify signal of the trace occurring cfDNA. (wikipedia.org)
Reaction1
- The poly(A) tail is encoded in the DNA template, which eliminates reaction steps and reduces overall production time and material loss [19] . (researchgate.net)
Recruitment1
- Mild Acidosis-Directed Signal Amplification in Tumor Microenvironment via Spatioselective Recruitment of DNA Amplifiers. (ucas.ac.cn)
Specific1
- These assays are 97% specific but cannot distinguish acute from chronic infection. (medscape.com)
Sequence2
- Despite the deficiency of each primer sets to separate a few species, cluster analysis of combined data sets indicated the ability of rep-PCR technique to separate 26 LGK-974 ic50 out of 27 examined species in highly supported clusters corresponded to the species recognized based on DNA sequence data. (plasignaling.com)
- which contain an N-terminal cleavable signal sequence. (elifesciences.org)
Surface1
- one that hybridizes to the capture DNA molecule and one that sticks out above the surface. (wikipedia.org)
Host1
- HBV can be present in hepatocytes in two forms: as replicating virus, leading to production of infectious particles, or as a nonreplicative form after integrating into the host DNA. (medscape.com)
Diversity1
- We validated a subset of 1538 SNPs through the GoldenGate assay, proving their ability to structure a diversity panel of breeding germplasm. (biomedcentral.com)
Cancer1
- Molecular Diagnostic and Prognostication Assays for the Subtyping of Urinary Bladder Cancer Are on the Way to Illuminating Our Vision. (who.int)
Method1
- 4,5] The validated method needs to be documented in a test assay procedure, 603 7937. (forexinfolink.com)
Treatment1
- pebv dna was measured at baseline, mid-treatment, and treatment completion. (liverpool.ac.uk)