Immunoblot assayDual-luciferase reporterSequencesRecombinantComplementation assaysFluorescenceQuantitativeCanonical pathwaysApoptosisSitu hybridizationPathwayBDNATissueProteinEnzymeAntibodyGenesCytotoxicityEndothelialGenomicDetectionAmplifiesBindPlasmidHybridizationSensitivityProbeInduceRegulateFlow cytometryInvolvesInfectionSamplesDiagnosisTranscriptionCellFluorescentRegulatorsPromoterPolymerasePrimersMolecularRegulatoryIsolateGene expressionSpecificProteinsQuantitativelyCancerSpecimensNegativeHuman
Immunoblot assay2
- RIBATM Recombinant immunoblot assay. (cdc.gov)
- The recombinant immunoblot assay is used to confirm HCV infection. (medscape.com)
Dual-luciferase reporter2
- EMSA and dual-luciferase reporter assays further confirmed that STM3 could directly bind the promoter region to activate FUL1 expression. (nature.com)
- The regulatory mechanism of lncSNHG5 was investigated by RNA sequencing, fluorescent in situ hybridization, cellular fractionation assay, mass spectrometry, RNA pull-down, RNA immunoprecipitation, gene-specific m6A assay, chromatin immunoprecipitation, dual luciferase reporter assay and actinomycin D treatment in CAFs and NFs. (thno.org)
Sequences8
- Qualitative RT-PCR for HCV RNA Test to detect HCV RNA by amplification of viral genetic sequences. (cdc.gov)
- Quantitative assays for HCV RNA Tests to detect HCV RNA concentration (viral load) by amplification of viral genetic sequences or by signal amplification. (cdc.gov)
- An RLU measurement equal to or greater than the Cutoff Value indicates the presence of HPV DNA sequences in the specimen. (cdc.gov)
- An RLU measurement less than the Cutoff Value indicates the absence of the specific HPV DNA sequences tested or HPV DNA levels below the detection limit of the assay. (cdc.gov)
- DNA and RNA are composed of linked sequences of nucleotides . (agemed.org)
- Using the respective signal sequences cloned upstream to GFP/CFP reporter proteins and transient expression studies with onion epidermal cells, evidence is provided that rice ClpB-m and Clp-c proteins are indeed localized to their respective cell locations mitochondria and chloroplasts, respectively. (biomedcentral.com)
- Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. (bvsalud.org)
- The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (bvsalud.org)
Recombinant1
- RT-PCR assays revealed that the transcriptional levels of the rim genes were consistent with the changes in rimocidin production in the recombinant strains. (biomedcentral.com)
Complementation assays3
- Complementation assays of Δhsp104 mutant yeast cells showed that OsClpB-cyt , OsClpB-m , OsClpC1 and OsClpD1 have significantly positive effects. (biomedcentral.com)
- From the complementation assays, OsClpD1 appears to be more effective than OsClpB-cyt protein in rescuing the thermosensitive defect of the yeast ScΔhsp104 mutant cells. (biomedcentral.com)
- The rimR 2 deletion and complementation assays were conducted to explore its role. (biomedcentral.com)
Fluorescence5
- Fluorescence and isotope tagging are the principal means for measuring antibody binding to cells in flow cytometry. (nature.com)
- We're not using any sophisticated fluorescence chemistry on the probe … we're just measuring a fluorescent intercalating dye [SYBR Green]. (genomeweb.com)
- We determined in six neuroblastoma cell lines the cytotoxicity of TPZ using DIMSCAN, a digital imaging fluorescence assay, apoptosis and mitochondrial membrane potential (ΔΨ m ) by flow cytometry, and protein expression by immunoblotting. (aacrjournals.org)
- Tubule formation and three-dimensional sprouting assays and tissue fluorescence staining were conducted to investigate angiogenesis. (thno.org)
- In vitro permeability assays, trans-endothelial invasion assays, in vivo permeability assays and tissue fluorescence staining were conducted to examine vascular permeability. (thno.org)
Quantitative4
- Of the truly quantitative techniques, HIV-1 RNA assays of tissue homogenates held the greatest promise for objective cross-study comparisons. (mahidol.ac.th)
- Bacterial ability to form biofilms was verified using a crystal violet colorimetric assay and testing cell viability by real-time quantitative PCR and Plate Count assay. (frontiersin.org)
- HBV DNA (quantitative viral load) indicates viral burden and viral replication. (medscape.com)
- Differential expression was validated by quantitative RT-PCR of five genes ( GAB1, MAPK9, PIK3C2B, PIK3C3 and PRKCH ) that are involved in several relevant signaling pathways. (biomedcentral.com)
Canonical pathways1
- Moreover, these transcripts almost exclusively belong to canonical pathways related to signaling rather than metabolic pathways. (biomedcentral.com)
Apoptosis6
- Signals to trigger apoptosis may come from within the cell or from outside, by stimulating suicide receptors in the cell's external membrane. (agemed.org)
- Internal signals producing apoptosis depend on interactions of several proteins and may serve to protect the organism from cancer by killing cells that have pre-cancerous changes. (agemed.org)
- The DNA damage response (DDR) is a mechanism that protects cells against radiation-induced oxidative DNA damage by causing cell cycle arrest and apoptosis. (researchsquare.com)
- Ionizing radiation is well known to induce oxidative DNA damage, such as DNA double-strand breaks (DSBs), and consequently trigger the DNA damage response (DDR), including cell cycle arrest and apoptosis. (researchsquare.com)
- PP2A is involved in diverse regulatory functions, including cell cycle progression, apoptosis, and DNA repair. (cancerbiomed.org)
- Classic anti-cancer strategies aimed at actively killing cancer cells include alkylating agents that generate crosslinks in DNA and trigger repair mechanisms to induce apoptosis, antimetabolites that severely disrupt nucleic acid synthesis, and alkaloids that interfere with microtubule polymerization/depolymerization and halt mitosis 2 . (cancerbiomed.org)
Situ hybridization3
- In situ hybridization (ISH) is a type of hybridization that uses a labeled complementary DNA, RNA or modified nucleic acids strand (i.e., probe) to localize a specific DNA or RNA sequence in a portion or section of tissue (in situ) or if the tissue is small enough (e.g., plant seeds, Drosophila embryos), in the entire tissue (whole mount ISH), in cells, and in circulating tumor cells (CTCs). (wikipedia.org)
- RNA ISH (RNA in situ hybridization) is used to measure and localize RNAs (mRNAs, lncRNAs, and miRNAs) within tissue sections, cells, whole mounts, and circulating tumor cells (CTCs). (wikipedia.org)
- An alternative technology, branched DNA assay, can be used for RNA (mRNA, lncRNA, and miRNA ) in situ hybridization assays with single molecule sensitivity without the use of radioactivity. (wikipedia.org)
Pathway4
- The classical NF-κB MGCD0103 datasheet signaling pathway involves the activation of the IKK complex, which phosphorylates IκBα and targets them for ubiquitin-dependent degradation [8]. (plasignaling.com)
- IKK is the major upstream kinase of IκBα in the NF-κB signaling pathway. (plasignaling.com)
- 8-Oxo-dG in DNA is repaired primarily via the DNA base excision repair pathway. (biomedcentral.com)
- Continued investigations have since revealed mutations in canonical signaling pathways that frequently drive tumorigenesis, such as the Hippo pathway or Wnt/β-catenin signaling 3 . (cancerbiomed.org)
BDNA1
- ViewRNA assays) can be used to visualize up to four targets in one assay, and it uses patented probe design and bDNA signal amplification to generate sensitive and specific signals. (wikipedia.org)
Tissue2
- With a resolution down to a few micrometers, these images can be used to measure the interbranch segment diameters, branching angles, volume of tissue perfused, and study the vascular anatomic relationships DOCK10 to organ microstructures such as glomeruli in kidney, hepatic lobules in liver, and so on. (gsk-3signals.com)
- Such data can be used to model intravascular flow, endothelial shear stress, and altered branching geometry such as that which may occur in localized angiogenesis and around tissue infarction and tumors. (gsk-3signals.com)
Protein9
- To enhance the osteogenic potential of stem cell sheet, we fabricated bone morphogenetic protein 2 ( BMP-2 ) gene-engineered cell sheet using a complex of polyethylenimine-alginate (PEI-al) nanocomposites plus human BMP-2 complementary(c)DNA plasmid, and studied its osteogenesis in vitro and in vivo. (dovepress.com)
- Both technologies have been primarily focused on measurement of protein epitopes, but have been used to measure nucleic acids such as targeted mRNA 11 , 12 . (nature.com)
- The DNA guardian protein p53 plays the most important role in DDR: it promotes DNA repair and the elimination of cells that are unable to repair the damage caused by oxidative stresses, including radiation. (researchsquare.com)
- Ligand-binding assays that measure protein-protein, protein-small molecule, or protein-nucleic acid interactions using a very large set of capturing molecules, i.e., those attached separately on a solid support, to measure the presence or interaction of target molecules in the sample. (bvsalud.org)
- Quantify DNA, RNA, and protein in seconds using only 1-2 µL of sample-no need for dilution. (thermofisher.cn)
- These data indicate that tuberin deficiency in angiomyolipoma enhances mTOR activation by phosphorylation of S6K and downregulation of protein and mRNA expression of OGG1 resulted in accumulation of oxidized DNA in patients with TSC. (biomedcentral.com)
- Protein phosphatases play essential roles as negative regulators of kinases and signaling cascades involved in cytoskeletal organization. (cancerbiomed.org)
- PP2A, a serine/threonine phosphatase composed of 3 distinct subunits-65-kDa PP2A-A (scaffold subunit), 55-kDa PP2A-B (regulatory subunit), and 37-kDa PP2A-C (catalytic subunit)-constitutes 0.2%-1.0% of the total protein content in mammalian cells and has been implicated in the regulation of diverse cellular processes, including signal transduction, cell cycle progression, DNA replication, gene transcription, and protein translation 5 - 8 . (cancerbiomed.org)
- free janes battles with the luftwaffe data apply a device of chromatographic recovery descriptions changed in the protein, type men and partition objective and are growth of the DNA class. (scoutconnection.com)
Enzyme3
- According to the prediction of bioinformatics software of Miranda, we showed that 5′-UTR regions of hsa-miR-124-3p, a mature sequence of human miR-124 precursor, could bind to 3′-UTR region of branched chain amino acid transaminase 1(BCAT1) gene, the enzyme that catalyzes branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth [ 15 , 16 ]. (biomedcentral.com)
- The gene coding for the DNA repair enzyme that recognizes and excises 8-oxo-dG is 8-oxoG-DNA glycosylase (OGG1) [ 14 ]. (biomedcentral.com)
- The specific enzyme (AK) is feedback inhibited by its end product either by lysine or threonine and activated by metabolite from a competing branch (Asp). (apoptosisblog.com)
Antibody1
- Detection and typing of HPV DNA in vaginal swabs (in conjunction with testing of NHANES sera for HPV antibody) will allow evaluation of trends in prevalence of type-specific HPV infection by age, sexual behavior, and race/ethnicity. (cdc.gov)
Genes5
- While a few important genes for tomato inflorescence-branching development have been identified, the regulatory mechanism underlying inflorescence branching is still unclear. (nature.com)
- A series of regulatory genes that have received much attention makes major contributions to inflorescence architecture in tomato by changing the inflorescence-branching pattern. (nature.com)
- The genomic DNA of tick species was extracted, and cytochrome oxidase subunit 1 (cox1) and 16S ribosomal RNA (rRNA) genes were amplified and sequenced. (bvsalud.org)
- In comparison with fiber-rich treatments that increased diversity and promoted Firmicutes and Bacteroidetes populations, resistant starch reduced microbial diversity and fecal pH, led to a bloom in Actinobacteria, and modified Kyoto Encyclopedia of Genes and Genomes orthology (KO) terms pertaining to starch and sucrose metabolism, fatty acid biosynthesis and metabolism, epithelial cell signaling, among others. (biomedcentral.com)
- relevant atoms are oppositely changed from produced measures, with yields that are using on the free janes battles with the luftwaffe the bomber campaign against germany 1942 genes did. (scoutconnection.com)
Cytotoxicity1
- The concentration of the chemicals tested as anti-biofilm agents was chosen based on cytotoxicity assays: the highest non-cytotoxic chemical concentration was used for biofilm inhibition assays, with dendrimer concentration 10-fold higher than polyamino-phenolic ligands. (frontiersin.org)
Endothelial1
- Enhanced ZNF281 transcriptionally regulated CCL2 and CCL5 expression to activate P38 MAPK signaling in endothelial cells. (thno.org)
Genomic2
- Selective Whole-Genome Amplification as a Tool to Enrich Specimens with Low Treponema pallidum Genomic DNA Copies for Whole-Genome Sequencing. (cdc.gov)
- AE001437) was amplified by polymerase chain reaction (PCR) from C. acetobutylicum (strain ATCC 824) genomic DNA using forward (AAAATCGTAGTAACAAAGTTTGG) and reverse (CATTAAATGCATTGTATATGGATTTAACAGC) primers. (apoptosisblog.com)
Detection5
- It uses chemiluminescence for the qualitative detection of human papillomavirus (HPV) DNA in cervical specimens. (cdc.gov)
- After amplification the samples are typed by hybridization to the typing strips followed by colorimetric detection. (cdc.gov)
- However, product information on Roche's website claims its BRAF test detects mutations at less than a 5 percent mutation level, while DiaCarta claims its XNA method enables detection of less than 0.1 percent mutated DNA. (genomeweb.com)
- Powell added that the company is already able to perform V600E BRAF mutation detection on such a strip, although this version of the assay is not yet commercially available. (genomeweb.com)
- OBJECTIVE: To evaluate the field performance of a multiplex PCR (M-PCR) assay for detection of herpes simplex virus (HSV)-1 and HSV-2, Treponema pallidum (T. pallidum) and Haemophilus ducreyi (H. ducreyi) in genital ulcer disease (GUD) specimens. (cdc.gov)
Amplifies1
- It amplifies the signal (its target) and the noise (anything in the background). (planetwaves.net)
Bind1
- Subsequent signal amplification is predicated on specific hybridization of adjacent probes (individual oligonucleotides [oligos] that bind side by side on RNA targets). (wikipedia.org)
Plasmid1
- The low Diseases of the Abdomen plasmid of the using DNA is genetic to the transcription of the drug collagens of the two observations. (scoutconnection.com)
Hybridization2
- Signal amplification is achieved via a series of sequential hybridization steps. (wikipedia.org)
- This test, using Hybrid Capture 2 technology, is a nucleic acid hybridization microplate assay with signal amplification. (cdc.gov)
Sensitivity1
- The Panel does not recommend use of the currently approved HIV p24 antigen assay for infant diagnosis in the United States because the sensitivity and specificity of the assay in the first months of life is less than that of other HIV virologic tests. (medscape.com)
Probe2
- As noted above, the probe is either a labeled complementary DNA or, now most commonly, a complementary RNA (riboprobe). (wikipedia.org)
- Specimens containing the target DNA hybridize with the HR HPV RNA probe cocktail. (cdc.gov)
Induce1
- clinical AlertsBrief sequence to this area that is Open Access not from an cavity totalDownloads:223 it are preferencesContactWant to induce in DNA? (scoutconnection.com)
Regulate1
- 1) Characterize novel families of oncoproteins (Pbx and Meis) that dimerize with and regulate the DNA binding properties of Hox proteins. (stanford.edu)
Flow cytometry1
- The goals for advances in flow cytometry are clear: measure as many relevant target molecules per cell as quickly as possible. (nature.com)
Involves2
- On the other hand, we clarified the upstream mechanism regulating miR-124-3p expression in ESCC, which involves in the hypermethylation-silencing regulation mediated by DNA methyltransferase 1(DNMT1), which is of high expression in ESCC tissues and cell lines in the present study. (biomedcentral.com)
- DNA methylation involves in the addition of a methyl (CH3) group to DNA with DNA methyltransferases (DNMTs), thereby often modifying gene function through regulation of gene expression [ 7 ]. (biomedcentral.com)
Infection4
- All patients with HCV infection are recommended to have an evaluation for advanced fibrosis with the use of liver biopsy, imaging, and/or noninvasive markers to aid in decision making regarding treatment strategies and to determine whether additional measures for the management of cirrhosis should be initiated (eg, screening for hepatocellular carcinoma). (medscape.com)
- These assays are 97% specific but cannot distinguish acute from chronic infection. (medscape.com)
- No national surveillance system exists to measure the full burden of HPV infection, and no reliable national population estimate of HPV exists. (cdc.gov)
- Any positive HIV DNA PCR finding should be confirmed with follow-up HIV DNA PCR before infection is diagnosed. (medscape.com)
Samples3
- Called QClamp, the technology uses xenonucleic acid (XNA) to "clamp," or silence, amplification of non-mutant DNA in heterogeneous samples, thus exclusively amplifying mutant DNA. (genomeweb.com)
- The significance of our research is the development of an SWGA DNA enrichment method that expands the range of clinical specimens that can be directly sequenced to include samples with low numbers of T. pallidum. (cdc.gov)
- In this anti-cancer online применение научной фотографии, since the stress and chromatin samples are yet expected via proportional web of the T-DNA, the extension and use effects will be at new amounts. (stefan-mader.de)
Diagnosis2
- Evaluation of a laboratory-developed multiplex real-time PCR assay for diagnosis of syphilis, herpes and chancroid genital ulcers in four public health laboratories in the USA. (cdc.gov)
- Our work demonstrates that lncSNHG5 and its downstream signaling ZNF281-CCL2/CCL5 in CAFs play a crucial role in premetastatic niche formation in breast cancer and may serve as potential targets for the diagnosis and treatment of BC metastasis. (thno.org)
Transcription1
- In further yields, free janes battles with the of the R-squared anti-virus are reversible that need the transcription but are rather fail the same stability DNA. (scoutconnection.com)
Cell2
- Assays on the cell culture showed that the genetically engineered cells released the BMP-2 for at least 14 days. (dovepress.com)
- Loss of heterozygosity at the 8-oxoG-DNA glycosylase (OGG1) allele is found in human kidney clear cell carcinoma identifying loss of OGG1 function as a possible contributor to tumorigenesis in the kidney. (biomedcentral.com)
Fluorescent1
- Fluorescent DNA ISH (FISH) can, for example, be used in medical diagnostics to assess chromosomal integrity. (wikipedia.org)
Regulators1
- These regulators are characterized by the presence of OmpR -like DNA-binding domains [ 22 ]. (biomedcentral.com)
Promoter1
- One online применение научной of this introduction of the functional ridge has separated in vector The left recombination recorded by this algorithm is an coronary sublimation procollagen that is invention between the IRS and the cases and covariate of the CD DNA with the design distance, preferably following a individual transfer promoter in the relevant kanamycin. (stefan-mader.de)
Polymerase1
- This assay uses Roche Linear Array HPV Genotyping test that is based on HPV L1 consensus polymerase chain reaction (PCR) with biotinylated PGMY09/11 primer sets. (cdc.gov)
Primers1
- It also includes biotinylated β-globin primers as an internal control for sample amplification. (cdc.gov)
Molecular3
- A Genomeplex material from 11 of these patients was also subjected to Whole Genome Amplication Kit (Sigma, St. Louis, MO, molecular DNA analysis to demonstrate the presence of B. USA) was used to preamplify the extracted DNA sample. (cdc.gov)
- We applied two highly sensitive RNA assays based on either signal amplification (branched-DNA assay, Quantiplex HIV RNA, Chiron Corporation) or template amplification (RT-PCR assay, Amplicor HIV-1 Monitor, Roche Molecular Systems). (mahidol.ac.th)
- Molecular Diagnostic and Prognostication Assays for the Subtyping of Urinary Bladder Cancer Are on the Way to Illuminating Our Vision. (who.int)
Regulatory1
- In a predictive online применение научной фотографии 1975, the SEs DNA is a regulatory transform entry lifestyle. (stefan-mader.de)
Isolate1
- A small number of conserved canonical single nucle- ated against a panel of 13 canSNPs, the results demonstrat- otide polymorphisms (canSNP) that defi ne major phyloge- netic branches for Bacillus anthracis were used to place ed that each B. anthracis isolate had 1 of only 12 different a Sverdlovsk patient's B. anthracis genotype into 1 of 12 canSNP profi les. (cdc.gov)
Gene expression1
- clinicians require high-resolution data on gene expression, but in standard real-time PCR and sequencing methods, unless a mutated gene makes up at least 10 percent of a sample, its signal is often swamped by super-abundant wild-type DNA. (genomeweb.com)
Specific2
- The resultant RNA: DNA hybrids are captured onto the surface of a microplate well coated with antibodies specific for RNA: DNA hybrids. (cdc.gov)
- Immobilized hybrids are then reacted with alkaline phosphatase conjugated antibodies specific for the RNA: DNA hybrids, and detected with a chemiluminescent substrate. (cdc.gov)
Proteins1
- RANK lacks intrinsic enzymatic activity in its intracellular domain, and it transduces signaling by recruiting adaptor molecules such as the TRAF family of proteins [8]. (plasignaling.com)
Quantitatively1
- Results of HBV serologic markers can be reported qualitatively or quantitatively as international units (IU) or signal per cutoff (s/c) value. (medscape.com)
Cancer1
- DNA methylation is one of the best known epigenetic mechanisms in cancer epigenetics. (biomedcentral.com)
Specimens2
- Downstream next-generation sequencing (NGS) of the syphilis spirochete Treponema pallidum subspecies pallidum (T. pallidum) is hindered by low bacterial loads and the overwhelming presence of background metagenomic DNA in clinical specimens. (cdc.gov)
- METHODS: GUD M-PCR was performed on 186 remnant specimens, previously collected for HSV testing, by four public health laboratories (PHLs) and the Laboratory Reference and Research Branch (LRRB) at the Centers for Disease Control and Prevention. (cdc.gov)
Negative2
- DNA HIV PCR results are consistently negative in an infant older than 4 months in the absence of breastfeeding. (medscape.com)
- Two DNA HIV PCR results obtained at least a month apart are negative in an infant older than 6 months. (medscape.com)
Human1
- DiaCarta has other commercial assays, a line of human papillomavirus tests that use branched DNA technology licensed from Siemens. (genomeweb.com)