• Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. (usda.gov)
  • The Luna Probe One-Step RT-qPCR Kit (No ROX) is optimized for real-time quantitation of target RNA sequences using hydrolysis probes. (neb.com)
  • The discriminative power of the probe set was further tested in silico on 15 additional complete enterobacterial genome sequences. (biomedcentral.com)
  • The probes themselves are domain specific for Universal, Eucarya, Bacteria, and Archaeal sequences in the 16S rDNA. (bio.net)
  • As expected, the E.coli showed a linear pattern of binding, the Yeast showed some low binding (presumably due to the mitochondrial DNA), however the spotted archaeal sequences produced some strange results. (bio.net)
  • As the technology evolves and test costs decline, whole genome sequencing (WGS), which can assess genetic sequences of nuclear and mitochondrial DNA and copy number variants (CNVs), or whole exome sequencing (WES), which can assess genetic sequences of the coding region of nuclear genes, but usually does not cover mitochondrial DNA and does not consistently identify CNVs, in combination with CMA, may become first-line testing for these conditions. (arupconsult.com)
  • Complete genomic sequences of microbial pathogens and hosts offer sophisticated new strategies for studying host-pathogen interactions. (medscape.com)
  • He added that the ability to support rapid infectious disease detection and drug susceptibility testing could be one of the "killer applications" for Hyb &Seq, a sequencing-by-hybridization platform in which DNA or RNA is read six bases at a time through the use of thousands of unique hexamer barcodes. (genomeweb.com)
  • In this study, we demonstrate that gDNA-based probe selection on the Affymetrix Human U133+2 GeneChip array can be used to study gene expression profiles in sheep tissues. (cambridge.org)
  • QuantiNova LNA Probe PCR Focus Panels enable quick and reliable gene expression analysis of over 150 pathways each for human, mouse or rat using hydrolysis probe-based qPCR. (qiagen.com)
  • A) Schematic representation of the FLS gene and the En-1 insertion allele. (uni-bielefeld.de)
  • The research in this paper describes best practices for using the digital drop Polymerase Chain Reaction (ddPCR) method to determine gene copy numbers in genomic DNA of six crops: citrus, potato, maize, rice, tomato and wheat. (usda.gov)
  • In addition to the cellular energy sensor AMP kinase, the peroxisome proliferator-activated receptor cofactors PGC1α ( 5 , 6 , 7 ) and possibly PGC1β ( 8 ) activate mitochondrial biogenesis and increase OXPHOS gene expression by increasing the transcription, translation, and activation of the transcription factors necessary for mitochondrial DNA (mtDNA) replication. (diabetesjournals.org)
  • Epigenetics refers to the study of heritable changes in gene function without alterations in DNA sequence ( Bird, 2007 ). (frontiersin.org)
  • DNA methylation is one of the major epigenetic mechanisms, and it plays an important role in determining gene function ( Hedrich and Tsokos, 2011 ). (frontiersin.org)
  • FISH mapping of the rRNA gene was carried out with a probe generated by PCR amplification using rRNA gene primers. (bioone.org)
  • Employing the DNA blot analysis only one COMT-encoding gene was found in the rat genome. (lu.se)
  • The loss of the expression of the maternal allele of the UBE3A gene is typically associated with the four following mechanisms: Deletion at the 15q11.2-q13 locus, UBE3A functional loss variation, presence of paternal parthenogenetic double chromosome or genomic imprinting defect ( 4 ). (spandidos-publications.com)
  • Since genes are composed of a given alphabet (A, T, C, G) with fixed pairing properties A-T and C-G, probes can be constructed that attract gene transcripts extracted from cell tissues and cultures. (lu.se)
  • Using such probes, one can obtain a fingerprint of the gene expression activity in a macroscopic sample. (lu.se)
  • In what follows we limit ourselves to the analysis of gene expression measurements obtained using microarrays with small spots of DNA fixed to glass slides. (lu.se)
  • Levels of gene expression are measured using a preparation of fluorescently labeled tissue RNA (copies of DNA), together with reference RNA labeled with a different fluorochrome, hybridized onto the slides. (lu.se)
  • A small amount of DNA can be amplified using the polymerase chain reaction (PCR) process, which can produce millions of copies of a gene or gene segments. (msdmanuals.com)
  • Overview of Genetics A gene, the basic unit of heredity, is a segment of DNA containing all the information necessary to synthesize a polypeptide (protein) or a functional RNA molecule. (msdmanuals.com)
  • Gene probes can be used to locate specific segments of normal or mutated DNA. (msdmanuals.com)
  • Gene probes can detect a number of disorders before and after birth. (msdmanuals.com)
  • Here we report development of a probe-based colorimetric-PCR assay involving heat shock protein (hsp) gene amplification (228bp) and its detection in an ELISA-like reaction. (cdc.gov)
  • DNA microarrays exploit primary sequence data to measure transcript levels and detect sequence polymorphisms, for every gene, simultaneously. (medscape.com)
  • By monitoring microbial gene expression, one can predict the functions of uncharacterized genes, probe the physiologic adaptations made under various environmental conditions, identify virulence-associated genes, and test the effects of drugs. (medscape.com)
  • Do hotspots (binary) or recombination rates (quantitative) correlate with features of DNA sequence or chromatin structure? (slideserve.com)
  • 4% of probes are specific to YJM789 sequence. (slideserve.com)
  • The new "spider‐specific" probes were used to sequence UCE loci in 51 specimens. (researchgate.net)
  • In-solution capture utilizes pools of oligonucleotides or probes bound to magnetic beads, whose sequence has been designed to hybridize to exon regions. (digitaljournal.com)
  • Sequence-based design of single-copy genomic DNA probes for fluorescence in situ hybridization. (wikigenes.org)
  • Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. (usda.gov)
  • Now, "it doesn't matter what kind of DNA or RNA [you are working with,] it's enough to sequence anything," he said. (genomeweb.com)
  • Although recent advances in next-generation sequencing have increased the accuracy of this line of research, there has been greater emphasis placed on epigenetic changes versus DNA sequence changes as the probable cause of discordant psychiatric disorders in MZs. (springer.com)
  • In fact, my knowledge of musical chord progressions directly influenced some of my key inquiries into DNA-based sequence patterns. (mskcc.org)
  • Different types of probes may investigate a broad range of sizes of DNA sequence. (msdmanuals.com)
  • The HBV sequence was then labeled for its utilization as a probe in the HBV DNA detection in serum of patients with HBsAg positive, with no evident physical symptoms of the disease. (bvsalud.org)
  • In a single tube, RNA is first converted to cDNA by a reverse transcriptase, and then a DNA-dependent DNA polymerase amplifies the cDNA, enabling quantitation via qPCR. (neb.com)
  • The fragments resulting from a HindIII digest of genomic DNA which are detected by the FLS cDNA probe are indicated with sizes given in kb. (uni-bielefeld.de)
  • EC 2.1.1.6) was determined from rat cDNA and genomic libraries were screened with DNA probes and specific antiserum. (lu.se)
  • Besides demonstrating that the probe selection method can be used to study the ovine transcriptome, the benefits of this approach are that it can greatly increase the number of annotated and novel genes that can be studied beyond those currently possible using ovine- or bovine-specific microarrays. (cambridge.org)
  • DNA microarrays based on the selected probes were used to type 92 clinical enterobacterial isolates. (biomedcentral.com)
  • The main advantage of aCGH over conventional CGH is the increased resolution achieved by microarrays with a large number of individual probes, routinely up to hundreds of thousands, covering the entire genome [ 4 ]. (biomedcentral.com)
  • DNA microarrays are powerful tools that can be used to identify DNA mutations. (msdmanuals.com)
  • DNA microarrays can be used in genome-wide association studies (GWAS) to compare patient and control populations to identify DNA variants that can contribute to disease risk. (msdmanuals.com)
  • Cite this: Using DNA Microarrays to Study Host-Microbe Interactions - Medscape - Sep 01, 2000. (medscape.com)
  • CCTG is conducting an innovative clinical trial that uses liquid biopsies - rather than invasive tissue biopsies - to screen for DNA markers in blood to help predict which of five new experimental therapies is likely to work best for individual patients with advanced prostate cancer. (queensu.ca)
  • It is the first precision medicine trial for prostate cancer in the world to use liquid biopsies for genomic testing. (queensu.ca)
  • The increased sensitivity ensures excellent amplification efficiencies down to 1 RNA molecule, making it easier for you to detect low-abundance targets such as lncRNAs from less starting material (see figure QuantiNova LNA Probe PCR Assays provide accurate, sensitive and linear quantification of targets over a wide dynamic range and figure QuantiNova LNA Probe PCR Assays enable both high-expression and low-expression detection of mRNA. The PCR performance of QuantiNova LNA PCR Assays was evaluated using a commercially available DNA template (gBlock). DNA templates were serially diluted from 1x10 9 to 10 copies and quantified with QuantiNova LNA PCR Assays using a Bio-Rad CFX96 or Bio-Rad CFX384 instrument. The QuantiNova LNA PCR Assays exhibited high linear range combined with outstanding sensitivity and near optimal efficiency. This high linearity along the entire input range is essential to prevent biases in calculations of relative expression. "> QuantiNova LNA Probe PCR Assays enable both high-expression and low-expression detection of mRNA ). (qiagen.com)
  • Probe-based qPCR/RT-qPCR monitors an increase in fluorescence upon 5´ → 3´ exonuclease cleavage of a quenched, target-specific probe to measure DNA amplification at each cycle of a PCR. (neb.com)
  • Multiplex ligation probe-dependent amplification analysis was performed to detect hypomethylation at the imprinting control region 1 on 11p15. (nih.gov)
  • was separated from 12C DNA and subjected to multiple displacement amplification (MDA) to generate sufficient DNA for the preparation of a fosmid metagenomic library. (lancs.ac.uk)
  • The multiplex ligation‑dependent probe amplification project of the Angel/chubby and copy number variation (CNV) sequencing were assessed concomitantly to identify the pathogenic genes responsible for the development of AS. (spandidos-publications.com)
  • We compared PCR amplification of 9 enterohemorrhagic Escherichia coli virulence factors among 40 isolates (21 O/H antigenicity classes) with DNA hybridization. (cdc.gov)
  • To improve the selectivity and avoid secondary structures a sandwich format of the CYP2C9*3 allele was designed using complementary fluorescein isothiocyanate-labeled signaling DNA probe and enzymatic amplification of the electrochemical signal. (bvsalud.org)
  • Des isolats suspects de Staphylococcus ont d'abord été identifiés par l'analyse biochimique classique, puis les souches confirmées par amplification en chaîne par polymérase (29 isolats de S. aureus et 17 isolats de S. saprophyticus) ont été analysées pour déterminer leur sensibilité aux différents antimicrobiens. (who.int)
  • The reactions were performed using a primer pair (TCZ1 and TCZ2) which prime the amplification of a highly repetive 195-bp T. cruzi genomic DNA. (bvsalud.org)
  • This review is about "molecular cytogenetics" including 1) the historical perspective of its development from cytogenetics, 2) technical aspects, 3) available probe sets, and 4) variants and applications of the basic fluorescence in situ hybridization (FISH) approach. (frontiersin.org)
  • The tagged DNA binds to its complementary DNA segment and can be detected by measuring the amount and type of fluorescence. (msdmanuals.com)
  • NEW YORK (GenomeWeb News) - Cancer Genetics today said that it and Nikon's Italian subsidiaries have entered into a distribution agreement covering Cancer Genetics' DNA probes intended for fluorescent in situ hybridization. (genomeweb.com)
  • For this purpose, we applied a global genome-wide probe selection strategy on 32 available complete enterobacterial genomes combined with a regression model for pathogen classification. (biomedcentral.com)
  • Besides premade probes, also genome wide, custom Pinpoint FISH assays engineered to meet your specific requirements are offered. (biocat.com)
  • LNA enhancement enables T m normalization across the panel and gives the primers and probes higher binding affinity, dramatically increasing assay sensitivity and specificity. (qiagen.com)
  • This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. (usda.gov)
  • Foi usado um total de 78 primers RAPD, sendo que 8 apresentaram 54% de fragmentos de DNA polimórficos. (scielo.br)
  • Rapid, sensitive and precise probe-based qPCR detection and quantitation of target RNA targets. (neb.com)
  • In the Luna Probe One-Step RT-qPCR Kit (No ROX), Hot Start Taq DNA Polymerase is combined with a novel WarmStart-activated reverse transcriptase, allowing dual control of enzyme activity via reversible, aptamer-based inhibition. (neb.com)
  • The Luna Probe One-Step RT-qPCR Kit (No ROX) is supplied at 2X concentration and contains Hot-Start Taq DNA Polymerase, dNTPs, and all required buffer components. (neb.com)
  • Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one and two copy events in transgenic plants with large genomes. (usda.gov)
  • DNA isolated from FFPE samples must be of high quality, QC needs to be performed by a qPCR-based method ( available at CTG) . (lu.se)
  • Previously, a probe-selection method based on hybridisation of genomic DNA (gDNA) was developed, which enables GeneChips to be used for species that they were not designed for. (cambridge.org)
  • Methods Probands from an AI cohort were screened by single molecule molecular inversion probes or targeted hybridisation capture (both a custom panel and whole exome sequencing) for COL17A1 variants. (bmj.com)
  • Of note, recent genomic studies demonstrate activating, somatic BRAF mutations in the majority of human specimens. (medscape.com)
  • We developed a DNA microarray for strain typing and detection of major antimicrobial resistance genes of clinically relevant enterobacteria. (biomedcentral.com)
  • The assay showed a minimum detection limit of 10 fg genomic DNA or 1 mycobacterial cell, albeit with variations depending on type and composition of the MWF matrix. (cdc.gov)
  • In conclusion, the developed colorimetric PCR allows detection and quantification of MWF mycobacteria without culturing and is the first probe-based assay for unambiguous differentiation between the two phylogenetically closely related species, M. immunogenum and M. chelonae. (cdc.gov)
  • Chronoamperometric measurements were performed at a range of 0.015-1.00 nM for both DNA targets achieving limit of detection of 42 p.m. (bvsalud.org)
  • Several methods have been devised recently for very sensitive detection of variola virus DNA and to distinguish this DNA from that of other orthopoxviruses, the most promising being analysis by polymerase chain reaction (PCR) of restriction fragment length polymorphisms, multiplex PCR and real-time PCR with fluorigenic probes. (who.int)
  • QuantiNova LNA Probe PCR Focus Panels are intended for molecular biology applications. (qiagen.com)
  • While exome capture methods using PCR, hybrid capture and molecular inversion probes exist, the most common and efficient strategies are in-solution capture methods. (digitaljournal.com)
  • A caracterização molecular foi baseada em marcadores RAPD, sequenciamento da região do espaçador interno transcrito do DNA ribossomal e "fingerprinting" telomérico. (scielo.br)
  • We discuss amplicon-based DNA barcoding and metabarcoding for the analysis of community diversity and molecular gut content analysis for assessing predator-prey relationships. (springer.com)
  • Organización molecular del complejo II y su rol en la anaerobiosis. (bvsalud.org)
  • In conclusion, our study demonstrated that hypomethylation of IFN-related genes is a common feature of GD/RA/SLE/SSc patients in CD4+ T cells, and the DNA methylation profile of IFN-related genes could be promising biomarkers for the diagnosis of GD, RA, SLE, and SSc. (frontiersin.org)
  • During my PhD, I analyzed DNA codes that regulate genes responsible for building the exquisite pattern of sensory organs that decorate the fly. (mskcc.org)
  • This assay detects DNA at varying concentrations, providing a qualitative result of either positive, negative, or inconclusive in the identification of Orthopoxvirus infections, other than smallpox (caused by variola virus). (cdc.gov)
  • performed on genomic DNA, using a 50 nuclease PCR assay. (cdc.gov)
  • In this study, twelve commercial coffee beverages found in local Portuguese markets were assessed to determine their total phenolic and flavonoid contents, as well as their antioxidant capacity, by conventional optical procedures, namely, ferric reducing antioxidant power and DPPH-radical scavenging assay, and non-conventional procedures such as a homemade DNA-based biosensor against two reactive radicals: HOâ ¢ and H2O2. (bvsalud.org)
  • The high binding affinity of LNA bases increases the flexibility of primer and probe placement on the transcript, so we are able to use intelligent positioning to design assays for otherwise difficult-to-analyze targets. (qiagen.com)
  • This set of tracks shows the genomic positions of probes and targets from a full suite of in-solution-capture target enrichment exome kits for Next Generation Sequencing (NGS) applications. (ucsc.edu)
  • The developed DNA-based biosensor was able to discriminate between the two synthetic target DNA targets, as well as the targeted denatured genomic DNA, extracted from volunteers genotyped as non-variant homozygous (A/A) and heterozygous (A/C) of the CYP2C9*3 polymorphism. (bvsalud.org)
  • KromaTiD sub-CEPs make use of pericentric non-repetitive genomic DNA to provide a uniform signal from chromosome to chromosome. (biocat.com)
  • The Pinpoint FISH TP53/CEP 17 Probe Kit is intended to detect the copy number of the LSI TP53 probe target located at chromosome 17q11.1 and of the CEP 17 probe target located at the centromere of chromosome 17. (biocat.com)
  • By use of aCGH, DNA derived from tumor tissue can be compared with reference DNA, e.g., normal whole blood DNA, and genomic imbalances can effectively be investigated. (biomedcentral.com)
  • However, in the Southern Brazilian areas disputed between Portugal and Spain, a genetic study suggests that the predominant genomic ancestry of the Brazilian Gaúchos (inhabitants of the Pampas) may be Spanish, not Portuguese. (wikipedia.org)
  • Genetic transformation provides scientists with many plants that are potentially useful for basic and applied research, but a significant amount of time and effort is needed to sort through them to find those with only one copy of the added DNA. (usda.gov)
  • Probing the far-ranging ethical and legal implications of genomic research, McGee tackles its most controversial and hotly debated aspects -- from patenting your DNA to genetic engineering at the supermarket -- and explodes unnecessary fears about this wondrous new knowledge. (harpercollins.com)
  • 2003 ). DNA barcodes can provide information on genetic variation within and between species, rapidly assign taxonomic status across divergent lineages (Hebert and Gregory 2005 ), and identify the prey composition of predators' gut contents (Agustí et al. (springer.com)
  • Our results demonstrate that the global probe selection approach based on longest common factor statistics as well as the design of a DNA microarray with a restricted set of discriminative probes enables robust discrimination of different enterobacterial variants and represents a proof of concept that can be adopted for diagnostics of a wide range of microbial pathogens. (biomedcentral.com)
  • A single microarray can test for millions of different DNA changes using only one sample. (msdmanuals.com)
  • The design and construction of a DNA microarray for any given microbial genome are straightforward. (medscape.com)
  • DNA microarray hybridization analysis stands out for its simplicity, comprehensiveness, data consistency, and high throughput. (medscape.com)
  • chromosomal DNA from a Paraguayan Trypanosoma cruzi isolate was extracted and sonicated. (bvsalud.org)
  • Here, we develop a specialized target‐capture probe set for spiders that contains over 2,000 ultraconserved elements (UCEs) and then demonstrate the utility of this probe set through sequencing and phylogenetic analysis. (researchgate.net)
  • This combination of DNA stable-isotope probing, MDA and metagenomics provided access to genomic information of a relatively large DNA fragment of these thus far uncultivated, predominant and active methanotrophs in peatland soil. (lancs.ac.uk)
  • S96: CCTCCTGACCGGGATTGAAGTGATAAACATGTCTAGCGTTA YJM789: CCTCCTGACCGGGATTGAACTGATAAACATGTCTAGCGTTA Probe sets: SNP interrogation 6: CTTCACTATTTGTACAGATCGCAAT Probe sets: groups of probes which each exactly map to a unique location, and which interrogate a common polymorphism. (slideserve.com)
  • In this work, a disposable electrochemical DNA-based biosensor capable of detecting CYP2C9*3 polymorphism was developed. (bvsalud.org)
  • High-throughput sequencing (HTS), particularly DNA metabarcoding, enables community-wide analyses of diversity and interactions at unprecedented scales and at a fraction of the cost that was previously possible. (springer.com)
  • En plants (lanes labelled P90 and 16) is derived from somatic reversion events. (uni-bielefeld.de)
  • Moreover, a broad range of pathogens have been covered by an efficient probe set size enabling the design of high-throughput diagnostics. (biomedcentral.com)
  • Results from a DNA gel-blot analysis of offspring (lanes labelled 8, 15, and 16) of plant 14 and of P90 (parent of plant 14). (uni-bielefeld.de)
  • The same membrane was then hybridized with the Bacterial-specific probe. (bio.net)
  • Orthopoxvirus DNA in clinical specimens by real-time PCR. (cdc.gov)
  • Our DNA services includes whole genome, whole exome or targeted library preparation and sequencing on Illumina platforms. (lu.se)
  • The assays in the QuantiNova LNA Probe PCR Focus Panels have been developed using stringent design criteria and lab-validated algorithms. (qiagen.com)
  • DNA input amounts differ between assays. (lu.se)
  • To download a certificate of analysis for pAE Bam 0.5 [pAEB Bam 0.50, probe E] ( 41020 ), enter the lot number exactly as it appears on your product label or packing slip. (atcc.org)
  • The certificate of analysis for that lot of pAE Bam 0.5 [pAEB Bam 0.50, probe E] ( 41020 ) is not currently available online. (atcc.org)
  • Its technology in combination with Cancer Genetics' DNA-FISH probes "will allow laboratories to perform simultaneous multicolor FISH testing with complex image analysis in academic and clinical settings," Cancer Genetics, which went public last month, said. (genomeweb.com)
  • The fasting blood samples were collected and VDR polymorphisms were detected using TaqMan fluorescent probes, and the three sites of BsmI-ApaI-TaqI were subjected to haplotype analysis. (hindawi.com)
  • were further confirmed by DNA stable-isotope probing analysis of a sample taken from the Moor House peatland (England). (lancs.ac.uk)
  • We then address the development of theoretical frameworks for community-level studies, and finally highlight critical gaps and future directions for DNA analysis of spider communities. (springer.com)
  • Analyses of the 'halos' showed that the probe did not bind in a linear manner. (bio.net)
  • In recent years, large-scale community analyses have benefitted tremendously from advances in DNA barcoding technology. (springer.com)
  • In the last two decades, DNA barcoding, the sequencing of short species-specific amplicons, has considerably simplified community analyses (Hebert et al. (springer.com)
  • DNA can be extracted from acceptable specimen types including, but not limited to, lesion fluid on a dry swab, lesion fluid swab in viral transport media, lesion fluid on a slide, crust, or lesion roof. (cdc.gov)
  • DNA extract solely from whole blood alone is not a suitable specimen for Orthopoxvirus diagnostic testing as the viremic phase may have already passed at the time of rash onset. (cdc.gov)
  • Insert-end-specific probes may be generated from T7 and SP6 promoters. (addgene.org)
  • Across arachnids, transcriptomic approaches may generate thousands of loci, and target‐capture methods, using the previously designed arachnid‐specific probe‐set, can target a maximum of about 1,000 loci. (researchgate.net)
  • We designed the "spider‐specific" probe set using three spider genomes (Loxosceles, Parasteatoda and Stegodyphus) and ensured that the newly designed probe‐set include UCEs from the previously designed Arachnida probe set. (researchgate.net)
  • The "spider‐specific" probes were also used to gather loci from a total of 84 representative taxa across Araneae. (researchgate.net)
  • On mapping these 84 taxa to the Arachnida probe set, we captured at most 710 UCE loci, while the spider specific probe set captured up to 1,547 UCE loci from the same taxon sample. (researchgate.net)
  • Researchers in Human Genetics and Genomics Advances report that how researchers describe genomic studies may alienate potential participants. (genomeweb.com)
  • Now is the time for every one of us to take control of our DNA, and one man is uniquely qualified to show us how: Glenn McGee, bioethicist at the University of Pennsylvania, pioneer in the study of "home genetics," and the acknowledged wunderkind of the exciting world found at the nexus of life science and computer technology. (harpercollins.com)
  • In recent years, studies on the differences between genomic and epigenomic characteristics of MZs have led to the development of new approaches for elucidating the etiology of psychiatric disorders (Liang et al. (springer.com)
  • Since the epigenetic status differs in each tissue type, in addition to the DNA from the peripheral blood, studies using DNA from nerve cells induced from postmortem brains or induced pluripotent stem cells are being carried out. (springer.com)
  • However, traditional Sanger sequencing-based DNA barcoding protocols can be prohibitively expensive and laborious when large community samples have to be processed. (springer.com)
  • first MRD studies of quadruplex DNA, using the 2H/17O (for A variety of NMR spectroscopy and relaxation techniques hydration) and 23Na (for ion binding) nuclides. (lu.se)
  • Our high quality reagents are available for every workflow, including popular DNA assembly methods such as NEBuilder ® HiFi DNA Assembly and NEBridge ® Golden Gate Assembly . (neb.com)
  • Nikon has developed, especially for the oncology/hematology field, a microspots system to investigate FISH on a microchannel, and CGI Italia's probes are very important to complete our full solution offer for our customers. (genomeweb.com)
  • Previous data the company has presented was generated using a smaller set of probes than the 4,096 necessary to provide complete coverage of any unknown genome thrown at the system. (genomeweb.com)
  • Genomic sequencing will provide the data needed to unravel the complexities of the host-pathogen interaction. (medscape.com)
  • Cosmid vector for genomic library construction. (addgene.org)
  • DNA should be of high quality and diluted in water or EB buffer, presence of EDTA in the storage buffer might affect the library preparation. (lu.se)
  • Phenotypic tests confirmed the array-based typing results and corroborate that the selected probes allowed correct typing and prediction of major antibiotic resistances of clinically relevant Enterobacteriaceae , including the subspecies level, e.g. the reliable distinction of different E. coli pathotypes. (biomedcentral.com)
  • If you are interested in custom probe pools for targeted sequencing, contact us for more information. (lu.se)